Research Report 2003 - Max-Planck-Institut für molekulare Genetik

Max-Planck-Institut 

für molekulare Genetik 

Research Report 2003 

Max Planck Institute 

for Molecular Genetics, Berlin


Published by the Max Planck Institute for Molecular Genetics (MPIMG), 

Berlin, Germany, October 2003 

Editorial Board Bernhard Herrmann, Hans Lehrach, 

H.-Hilger Ropers, Martin Vingron 

Coordination 

& lay-out: Patricia Béziat 

Photos: Katrin Ullrich, MPIMG 

Printing & 

technical support: Thomas Didier, Meta Data 

Contact: Max Planck Institute for Molecular Genetics 

Ihnestr. 63 - 73 

D-14195 Berlin 

Phone: ++49 / 30 / 8413 - 0 

Fax: ++49 / 30 / 8413 - 1394 

Email: info@molgen.mpg.de 

For further information about the MPIMG please see our website: 

http://www.molgen.mpg.de

Table of Contents 

The Max Planck Institute for Molecular Genetics 

• Organigram . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 

• Mission . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .5 

• Development of the institute. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .5 

• Research concept . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 

Department of Vertebrate Genomics 

• Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 

• Protein Structure Factory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12 

• Mass Spectrometry Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 

• Bioinformatics Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 

• Mouse, Medaka & MHC Group. . . . . . . . . . . . . . . . . . . . . . . . . . . 25 

• Genetic Variation, Haplotypes & Genetics of Complex Disease Group . . 30 

• Oligofingerprinting / Cell Arrays Group . . . . . . . . . . . . . . . . . . . . 32 

• Kinetic Modeling Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36 

• In vitro Ligand Screening Group. . . . . . . . . . . . . . . . . . . . . . . . . . 39 

• Neurodegenerative Disorders Group . . . . . . . . . . . . . . . . . . . . . . . 43 

• Automation Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45 

• Evolution & Development Group . . . . . . . . . . . . . . . . . . . . . . . . . 52 

• Gene Traps & Microarrays - Molecular Analysis of Heart Failure Group . 56 

• Protein Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61 

• Cardiovascular Genetics Group . . . . . . . . . . . . . . . . . . . . . . . . . . . 65 

• Genomic Sequencing & Gene Function in Complex Diseases Group . . . 68 

• Chromosome 21 Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71 

Department of Human Molecular Genetics 

• Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75 

• Neurochemistry Group & Mouse Lab . . . . . . . . . . . . . . . . . . . . . . 81 

• Clinical Genetics. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84 

• Chromosome Rearrangement & Disease . . . . . . . . . . . . . . . . . . . . 87 

• DNA Microarrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91 

• Neurobiology Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .94 

• Cytology Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98 

• Biochemistry of Inherited Brain Disorders . . . . . . . . . . . . . . . . . 101 

• Familial Mental Retardation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 104 

Department of Computational Molecular Biology 

• Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109 

• Gene Structure & Array Design Group . . . . . . . . . . . . . . . . . . . . 112 

• Protein Families & Evolution Group . . . . . . . . . . . . . . . . . . . . . . 115 

• Algorithms Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118 

• Protein Function Analysis Group . . . . . . . . . . . . . . . . . . . . . . . . . 122 

• Computational Diagnostics Group . . . . . . . . . . . . . . . . . . . . . . . . 124 

• Transcriptional Regulation Group . . . . . . . . . . . . . . . . . . . . . . . . 128 

MPI for Molecular Genetics 


1

2 

General Information 

Department of Developmental Genetics 

• Scientific development and future orientation . . . . . . . . . . . . . . . 131 

Emeritus Group General Molecular Genetics 

• Biographical notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 

Research Group Development & Disease 

• Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141 

Junior Research Groups / Otto-Warburg Laboratory 

• Endocrine Regulation of C. elegans Development & Aging . . . . 147 

• Gene Silencing in Saccharomyces cerevisiae . . . . . . . . . . . . . . . . 152 

• Molecular Control of Skeletal Development . . . . . . . . . . . . . . . . 157 

Ribosome Group 

• Ribosomal RNA Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163 

• Ribosome Crystallography . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 166 

• Ribosomal Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170 

Miscellaneous Research Groups 

• Phage & Conjugation Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175 

• Microscopy Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 180 

• High-throughput Technologies Group . . . . . . . . . . . . . . . . . . . . . 182 

• Analysis of Protein Evolution Group . . . . . . . . . . . . . . . . . . . . . 186 

Administration & Research Support 

• Administration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 189 

• Technical Management & Workshops . . . . . . . . . . . . . . . . . . . . . 191 

• Analytics & Computing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 192 

• Animal Facility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194 

• Library . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .195 

• Graphics / Photo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196



3

4 

General Information

The Max Planck Institute for 

Molecular Genetics 

Mission 

Research at the MPIMG concentrates on genome analysis of man and other organisms to 

contribute to a global understanding of many of the biological processes in the organism, 

and to provide a basis to elucidate the mechanism behind many human diseases. It is the 

overall goal of the combined efforts of all MPIMG’s groups to gain new insights into the 

development of diseases on a molecular level, thus contributing to the development of 

cause-related new medical treatments. 

Development of the institute 

The Max Planck Institute for Molecular Genetics (MPIMG) was founded in 1964 with 

the appointment of Heinz-Günther Wittmann and Heinz Schuster as heads of department, 

followed by the appointment of Thomas Trautner in 1965. At this time, the research of the 

institute was focussing on DNA replication and gene regulation in bacteria, bacterial phage 

and fungi (departments Schuster and Trautner) and on the structure, function and evolution 

of ribosomes which were central to the work of H.-G. Wittmann. 

In 1970, the three departments, as well as 

four independent junior research groups (the 

future Otto Warburg Laboratories) moved 

into the new premises of the institute situated 

in the Ihnestraße, Berlin-Dahlem. After 

the sudden death of H.G. Wittmann in 

1990 and the retirement of H. Schuster in 

1995, the appointments of Hans Lehrach 

(1994, Dept. of Vertebrate Genomics), and 

Hans-Hilger Ropers (Dept. of Human Molecular 

Genetics, full-time since 1997) induced 

a major shift in the scientific orientation 

of the institute. Following the retirement 

of T. Trautner in 2000, Martin Vingron 

was appointed as head of the new Department of Computational Molecular Biology. At 

the same time, Stefan Mundlos was jointly appointed by the Humboldt University of 

Berlin and the Max Planck Society as head of the Institute of Medical Genetics at the 

Charité and of an independent research group at the MPIMG. Together with the Free 

University of Berlin, Bernhard Herrmann has been appointed professor at the university 

and director at the institute in 2003, forming the fourth department. 

Currently three junior research groups work at the institute. A newly created junior 

research group will start in 2004 when the others are due to leave. 

Research concept 

Genome research, the systematic study of genes and genomes, has changed the way in 

which research in molecular genetics is pursued. The focus and composition of the MPI 

for Molecular Genetics reflects this development. Large scale genome research (Dept. 

Lehrach) generates the tools and information to understand the function of most or all 

genes of man and other organisms. Human molecular genetics (Dept. Ropers) searches 

for disease genes and their biological function. Computational molecular biology (Dept. 



5

6 

General Information 

Vingron) exploits the generated data to better understanding of biological and disease 

processes. The newly established Dept. of Developmental Genetics (Dept. Herrmann) 

uses the systematic functional analysis for understanding developmental mechanisms. 

The institute pursues a number of large scale projects. Probably the most prominent 

national project is the German National Genome Network (NGFN), where all departments 

of the institute participate and collaborate with each other. Other prominent 

projects include a number of EU projects, participation in several projects of the German 

Ministry of Science as well DFG “Sonderforschungsbereiche”. 

With this involvement in national and international research projects as well as by 

virtue of the research output of the institute, the MPIMG is perceived internationally 

as a stronghold of genome and genetics research in Germany. The publications coming 

from the institute document the international competitiveness of the institute. Maintaining 

this status in the future will require continuing technological innovation, close 

co-operation with the universities and, in particular, their medical schools, and ongoing 

integration between genome research and genetics, as well as between experimental 

and computational biological research. These are the means by which research 

excellence shall be maintained and further strengthened in the future. 

Bernhard Herrmann, Director 

Hans Lehrach, Director 

H.-Hilger Ropers, Director 

Martin Vingron, Director


Introduction 

Since the foundation of the department “Vertebrate Genomics” in 1994, we have focused 

our work on structural and functional genomics of man and a number of model 

organisms, a systematic analysis of structure and function of most or all genes of an 

organism by high throughput, automated procedures. 

Since we expect that many biological processes will only become understandable by 

such systematic, genome-wide analyses, we consider such genome-wide analyses our 

best chance to understand many processes in biology, particularly many of the common, 

complex diseases (heart diseases, cancer, neurological diseases) which affect a 

large fraction of the population. Since much of the funding for biological and medical 

science (including much of that for the MPG) has always been justified by the argument, 

that a more detailed understanding of biological processes will ultimately help 

the population (which, after all, funds science through their taxes) we see a major 

commitment to this type of research also as essential for the Max Planck Society. 

Scientific overview 

Head: 

Prof. Dr. Hans Lehrach 

Phone: +49 (0)30-8413 1220 

Fax: +49 (0)30-8413 1380 

Email: lehrach@molgen.mpg.de 

Scientific Management: 

Dr. Claudia Falter 

Phone: +49 (0)30-8413 1411 

Fax: +49 (0)30-8413 1380 

Email: falter@molgen.mpg.de 

Secretary: 

Johanna Belart 

Phone: +49 (0)30-8413 1221 

Fax: +49 (0)30-8413 1380 

Email: belart@molgen.mpg.de 

We consider life essentially as computational process: the organism computes its phenotype 

from the DNA sequence of its genome, modulated by the environment. This ‘computation’ 

is carried out by a complex network of molecular (and cellular) processes, involving 

most or all genes and gene products of the organism. It is therefore highly likely, that 

progress in many essential areas, for example to understand and ultimately to be able to 

treat many of the common diseases, will depend on understanding these networks. We 

therefore had to develop techniques, able to generate the same types of information, which 

had previously been generated by hand on selected ‘interesting’ genes on essentially all 

genes of many different organisms and to use these techniques to analyze the structure 

and evolution and function of the genes of man and model organisms. This effort has been 

complemented by the analysis of a number of medical problems (Huntington chorea, 

Apeced, Downs syndrome, heart disease, obesity, stroke, cancer, infection, arthritis, inflammatory 

bowel disease, autoimmunity etc.) 



7


8 

Analysis of genomic sequences 

Mapping and sequencing projects 

A major effort during the last 6 years has been directed at mapping of chromosomes 

(Yaspo, Sudbrak) and entire genomes (Himmelbauer, Schalkwyk*, Knoblauch*), and 

the determination of genomic sequences, culminating in the completion of the sequence 

of chromosome 21 (Yaspo, Reinhardt), the working draft of the human genome and 

finally the recent publication of the essentially completed genome sequence. Since 

then, we have increasingly focused on the use of genomic sequencing to understand 

the evolution of regions of the human genome (Yaspo, Sudbrak, Reinhardt). In one of 

these projects, the sequencing of chimp chromosome 22, the equivalent of human 

chromosome 21, has been completed in collaboration with groups in Germany, Japan, 

China, Taiwan and South Korea. The results, currently being prepared for publication, 

provide fascinating insights into the biological differences between man and our closest 

relative. The sequence of the rat MHC has been completed, and submitted for 

publication (Himmelbauer, Reinhardt). To try to understand more distant evolutionary 

processes, we have continued to work on the genomic sequence of Oikopleura, a chordate 

with an exceptionally small genome (app. 70 Mb). In a first whole genome shotgun 

phase, a coverage of approximately 1.1 x has been achieved. To minimize the 

effect of the high polymorphism rate, we have now shifted to BAC based sequencing, 

with the progress limited by lack of funding (Reinhardt, Yaspo). 

Genetic analysis 

Genotype-phenotype correlations in man will increasingly require the application of 

more effective genotyping tools. For this, new protocols for SNP genotyping (Gut*, 

Sauer) and microsequencing (Nordhoff*) based on mass spectroscopy have been developed. 

An alternative optical approach for SNP typing is currently under development 

(Soldatov). New approaches to compare the sequences of candidate genes in 

patients and controls, and to analyze their haplotypes have been developed and are 

being applied in a number of different disease areas (Hoehe, Reinhardt). 

Analysis of transcripts 

Further insights into evolutionary processes in key organisms with larger genomes 

have been derived from the analysis of transcripts, based on a combination of the 

oligonucleotide fingerprinting approach to assign cDNA clones to clusters corresponding 

to different genes, combined with a limited amount of cDNA sequencing. This 

approach has been applied to a number of different organisms, e.g. zebrafish (Clark*), 

different plants (Radeloff*), man and mouse (Radeloff*, Janitz), cow (Janitz) etc. 

Among other projects, this has given insights into the set of genes available to amphioxus, 

a cephalochordate, and sea urchin, an echinoderm, representing key stages in 

deuterostome evolution. This work has contributed to understanding the evolution of 

the vertebrate genome, and especially the ‘Ohno hypothesis’, according to which two 

whole genome duplications of a chordate genome have led to the vertebrate genome 

(Panopoulou, Poustka). 

Functional Genomics 

Analysis of gene expression 

Efficient, sensitive techniques to detect and quantify patterns of transcription have 

been a major focus in functional genomics. Starting from our first arrayer developed 

by us in 1987, we have carried out long term technology development in this area, 

from the first filter based complex cDNA hybridization screens to high throughput 

chip hybridization systems (Eickhoff*, Hultschig), and applied these techniques to a 

number of biological (and medical) problems (Yaspo, Nietfeld, Ruiz, Sperling, Soldatov 

etc.). A number of global (ENSEMBL chip by Yaspo, RZPD) and disease specific 

(Ruiz, Sperling, Hultschig) chips have been constructed. 

* former member of the department

To generate high resolution expression information we have carried out a systematic analysis of 

gene expression of mouse orthologues by whole-mount in-situ hybridization on mouse embryos 

(Bernhard Herrmann) and brain tissue slices (Ariel Ruiz i Altaba, New York, Yaspo). 

Proteomics 

Due to the fact, that many genes act through their protein product, we need effective 

techniques to measure protein abundances, and to determine their modification status. A 

significant effort has therefore been directed towards the development of mass spectrometry 

techniques to generate this information on high throughput (Gobom). A combination 

of 2-D gel electrophoresis with mass spectrometric identification of protein spots 

has, for example, been used in a systematic analysis of mouse proteins (in collaboration 

with Joachim Klose, Humboldt University). 

To generate information on protein function and protein interactions, a number of different 

approaches have been followed. One key technique in this has been the development 

of a robust, high throughput 2-hybrid system, which has been used to generate information 

on interacting proteins on thousands of human genes (Wanker*). In addition, a number 

of specific screens have been carried out on proteins involved in Chorea Huntington 

(Wanker*) and other neurodegenerative diseases (Krobitsch), proteins encoded on chromosome 

21 (Yaspo), the products of genes overexpressed in heart disease (Sperling) and 

many others. As a complement, mass spectrometry techniques have been developed to 

isolate and characterize the components of larger complexes (Gobom), and are now being 

used to complement the 2- hybrid data (Gobom). 

For interaction studies of large numbers of proteins in parallel with e.g. antibodies, other 

proteins, DNA or RNA fragments, small molecules, a number of protein array systems 

have been developed, ranging from PVDF membrane arrays to chips carrying purified 

proteins. Such arrays have been used in a number of different applications (Cahill*, Konthur, 

Seitz). They will provide an additional route to establish and verify information on protein-protein 

interactions, and will play a key role in the development of regulatory genomics 

and chemical genomics approaches. 

To be able to generate antibodies to many gene products in parallel, we have established 

an automated phagemid selection protocol, and have made major progress in streamlining 

the clone characterization, opening the way to high throughput antibody generation, to be 

used, among other applications, in the construction of antibody chips. In addition, as part 

of the characterization of gene products encoded on chromosome 21, antisera are being 

generated against chromosome 21 encoded proteins in the chick system. 

Structural genomics 

Since the structure of proteins can also give insights into protein function and evolution, 

and can aid in the development of drugs directed against these proteins, a number of 

structural genomics projects have been started throughout the world. The department has 

been instrumental in starting the ‘Proteinstrukturfabrik’ (PSF), the first of these projects 

world wide, involving a number of groups and facilities throughout Berlin. In this project, 

we are particularly contributing in providing expression constructs of human proteins 

(Büssow), and in the construction of a high throughput crystallization robot, able to handle 

up to 4 Million crystallization trials in parallel (Eickhoff*, Nyarsik). 

As a next step in high throughput structural genomics, we have currently started a follow 

up project, the ‘Ultrastrukturnetzwerk’ (USN), to be able to analyze larger complexes. For 

this network, which again will involve a number of groups throughout Berlin, mass spectroscopic 

analysis of protein complexes (Gobom) will be combined with an analysis of 

the structure of the complex by Cryo-EM (Lange). 

Gene function at the cellular level 

To be able to analyze gene (and promoter) function at the cellular level, we have recently developed 

cell array systems, allowing the analysis of many constructs in parallel. These systems can 

be used to test the function of proteins (and protein variants), carry out RNAi experiments, test 

promoter function, and identify protein-protein interactions within the mammalian cell (Janitz). 



9


10 

Gene function in model organisms 

The ultimate test for the function of a gene is the analysis of mutant organisms. To provide 

an efficient route for such functional tests, we have been involved in starting the german 

gene trap consortium (Wiles*, Ruiz). More recently, a chemical mutagenesis protocol, 

coupled to an efficient mutation detection, has been developed (Himmelbauer). Additional 

strategies are being developed (RNAi). 

Gene function in Complex Diseases 

Ultimately most of the work carried out within the department has medical implications, 

either through the development of new techniques, or directly through work on 

the analysis of processes of medical interest. Within the last 6 years, work on Chorea 

Huntington has progressed rapidly, most recently culminating in the identification of 

small molecules blocking the aggregation process we believe to be at the heart of the 

disease mechanism, and the establishment of a dense protein-protein interaction network 

established through high throughput 2 hybrid analysis (Wanker*). (Due to Erich 

Wanker’s move to a C4-Position at the MDC, much of this work has now shifted to 

Berlin-Buch.) Work on other neurodegenerative diseases does however continue 

(Krobitsch). Similarly chromosome 21 and Down syndrome (Yaspo) as well as the X 

chromosome (Sudbrak) have been a long term focus of the work in the department. In 

addition to these core projects, a number of other disease areas have been investigated, 

mostly in collaborative projects. Examples are heart disease (Sperling, Ruiz), arthritis 

(Janitz, Ruiz), inflammatory bowel disease, infection and stroke (Nietfeld), obesity 

(Soldatov, Hoehe), and many others. 

Bioinformatics / Systems biology 

Bioinformatic tools continue to play a central role in our work, an area, which has been strengthened 

considerably by the new department of Martin Vingron. Work carried out within the department 

continues to address the problems of sequence analysis, sequence interpretation and 

sequence annotation (Hennig, Yaspo) and gene expression analysis (Herwig). 

Efforts to integrate data generated throughout the department have involved the construction 

of a unified laboratory database (Hennig). In addition, in collaboration with the RZPD 

and the department of Martin Vingron, we have established a new database/data base 

interface (www.genome-matrix.org), unifying data across many data types and many species 

(Zehetner, Hennig, Yaspo). A similar effort to integrate such molecular data with 

medical information (d-matrix) is under way (Sperling). 

Ultimately many complex biological and medical processes will only be ‘understood’ 

through the establishment of quantitative models, duplicating the knowledge we have 

about a biological system by computational objects. For this, a modeling environment 

has been developed (PyBios), and will be expanded as part of one of our EU collaborations 

(Herwig, Klipp). 

Future developments 

A continuing focus in the department is the development of new techniques in functional 

genomics, especially nanotechnology (Nyarsik), mass spectroscopy (Gobom, Sauer) and 

protein and antibody chips (Seitz, Konthur, Yaspo). As a new direction uniting most of the 

departments within the institute, we plan to focus increasingly on the analysis of regulatory 

networks and regulation mechanisms (regulatory genomics). This will combine the 

expertise in computational analysis of promoters (Vingron), expertise in the experimental 

analysis of transcription factors and other regulatory genes (Herrmann), and our expertise 

in automation. In addition, as more and more data become available from other centers 

world wide, our efforts in data integration and systems biology will increase further, in 

close interaction with Martin Vingron’s department. Conversely, work in a number of 

areas (e.g. most areas of plant genomics) has been reduced or stopped.

Competitive position 

Since a long time, the department plays a key role in technology development and automation, 

covering essentially all areas of functional genomics. In some areas (mapping of 

the mouse and rat genome, genomic sequencing, expression analysis, protein-protein interactions, 

gene traps) high throughput data production pipelines have been developed, 

and have contributed significantly to the world wide genome project. In other areas, the 

development has been less rapid, either due to technical difficulties (high throughput 

proteomics), or, in many cases, due to lack of funding. The department has played a key 

role in setting up the resource center of the German Genome Project (RZPD), and a 

number of national and international research networks (gene trap consortium, Protein 

Structure Factory, Berlin Center of Genome Based Bioinformatics (BCB), Ultrastrukturnetzwerk 

(USN), etc). In addition, we were able to transfer our knowledge and results by 

founding and co-founding a number of start up companies (GPC, Scienion, PSF AG, 

Prot@gen), by patenting (34 patents since 1998) and in around 200 publications in the 

last 6 years. We are probably the only center within Germany covering the entire range of 

functional genomics, and have played a central role in the founding of both DHGP 

(Deutsches Humangenomprojekt) and NGFN (National Genome Research Network). 

Due to limited resources the structure of the department has had to remain a compromise, 

since from the beginning we have had to complement the limited long term funding by the 

MPG (currently approximately 15 % of our overall budget) by large scale grant funding 

from many different outside sources to be able to remain competitive with many of the 

large, well funded centers set up for genome research in other countries. Interactions with 

the department of Hilger Ropers have played an important role in a number of projects. 

Good interactions also exist with the junior groups, the research group of Stefan Mundlos 

as well as other research groups in the institute (e.g. the ribosome groups contributing to 

the Ultrastrukturnetzwerk). Of particular importance for our work have however also 

been the more recent appointments of Martin Vingron and, most recently, Bernhard 

Herrmann, dramatically strengthen the overall capabilities of the institute as one of the 

very centers focusing on genome research in Germany, as well as the continuing interaction 

with the service group, providing most of the essential infrastructure for e.g. sequencing 

projects in the institute. 



11


12 

Protein Structure Factory 

Head: 

Dr. Konrad Büssow 

Phone: +49 (0)30-32639 2802 

Fax: +49 (0)30-32639 2833 

Email: buessow@molgen.mpg.de 

PSF / Protein Expression: 

Christoph Scheich (engineer) 

Dr. Volker Sievert (scientist) 

Janett Tischer (technician) 

Claudia Quedenau (PhD student) 

PSF / Protein Crystallisation: 

Joachim Lebik (engineer) 

NGFN core area platform 4 / protein 

expression 

Dr. Hendrik Weiner (scientist) 

Thomas Faupel (PhD student) 

Brigitte Hieke (technician) 


The Protein Structure Factory is a structural genomics project for the systematic structural analysis 

of human proteins. The goal of the Protein Structure Factory is to systematically select suitable 

human proteins by sequence analysis, express the proteins in recombinant form and proceed 

with structural analysis with those proteins that can be produced easily. 

The PSF is part of the International Structure Genomics Organization (ISGO) and has organised 

the International Congress of Structural Genomics 2002. Funded in 1999, the Protein Structure 

Factory is one of the earliest endeavours towards fast and cost-effective high-throughput protein 

production and structure determination. 

The Department of Vertebrate Genomics has initiated the Protein Structure Factory as a BMBFfounded 

“Leitprojekt” as partner of a multidisciplinary consortium of structural biology and 

other research groups and companies (http://www.proteinstrukturfabrik.de). Our scientific partners 

in the Protein Structure Factory and the expertise provided are: 

• Prof. Dr. Udo Heinemann, MDC Berlin – X-ray diffraction at BESSY synchroton 

• Prof. Dr. Wolfgang Saenger, FU Berlin – protein crystallisation 

• Prof. Dr. Hartmut Oschkinat, FMP Berlin – NMR of protein domains 

• PD Dr. Christine Lang, TU-Berlin – protein expression in yeast 

• Prof. Dr. K.-P. Hofmann, Charité Berlin – biophysical characterisation of proteins 

• Alpha Bioverfahrenstechnik GmbH, Kleinmachnow – protein expression and purification 

• Deutsches Resourcenzentrum GmbH, Berlin – cDNA clone resources 

• Prof. Dr. Peer Bork, EMBL Heidelberg – bioinformatics, selection of target proteins 

Current status of research 

Many structural genomics projects have been initiated since the start of the Protein Structure 

Factory in 1999. It is clear today that the major bottleneck in the systematic structural analysis of 

proteins is their production and crystallisation. Especially the recombinant production of eukaryotic 

proteins is difficult and has a high failure rate. One way to overcome this limitation is to 

generate and analyse a large number of targets and to proceed with the ones that can be produced 

readily. Alternative expression systems are another option - yeast is used in addition to E. coli at

the Protein Structure Factory. Finally, in vitro folding of proteins can transfer insolubly expressed 

proteins into the folded form (see below). 

High-throughput protein expression 

Our part in the project is the generation of E. coli expression clones for human proteins and the 

characterization of the clones. We are responsible to supply the Protein Structure Factory with a 

sufficient number of clones that express human proteins in good yield and soluble form. We 

have established expression systems that allow efficient protein purification by affinity chromatography 

via affinity tags and removal of affinity tags after protein purification (Heinemann et 

al., 2003). All steps required for subcloning of cDNAs into our optimised expression vectors 

and subsequent characterisation of expression clones by protein expression and affinity purification 

were established and automated in 96-well format on a pipetting robot (Scheich et al, 

2003, Holz et al., 2003). 

In co-operation with the group of Peer Bork, we selected 860 human proteins that have a high 

probability to be successfully expressed in E. coli, e.g. excluding membrane proteins. Another 

selection criterion was the availability of full-length cDNA clones, since these clones enabled us 

to use high-throughput cloning procedures. 

So far, our group supplied constructs for soluble expression of 243 human proteins. Using these 

clones, 52 distinct proteins were expressed and purified in sufficient amount and quality for 

crystallization trials in the year 2002. In 2003, this number was already reached after eight 

months. Using these crystals, two structures were solved by our partners in the Protein Structure 

Factory and six more proteins with well-diffracting crystals were obtained in this time period 

(Manjasetty et al., in press). The current status of generated clones, proteins and structures is 

available at: http://www.proteinstrukturfabrik.de/public/PSF_Status_1.shtml. 

A database and additional software were developed for management of data in the group and to 

provide co-workers in the Protein Structure Factory with information on sequences and clones 

of target proteins. Part of this software development was published (Büssow et al., 2002). 

A large proportion of human proteins do not fold and form insoluble aggregates when expressed 

in E. coli cells. In vitro folding can transfer such aggregates into correctly folded proteins. 

We have developed a automated method for protein crystallisation, that allows to perform 

fast screenings for suitable folding buffer conditions using a biophysical readout (Scheich et al., 

in preparation). 

Automated protein crystallisation 

The department of Vertebrate Genomics has automated protein crystallisation in the Protein 

Structure Factory in a co-operative effort with the group of Prof. Saenger, Free University of 

Berlin (Mueller et al., 2001). Automation is a requirement for the crystallisation of larger number 

of target proteins, since manual crystallisation is very time-consuming. We have established 

automated set-up and analysis of crystallisation screens. A micro-dispensing technology for 

crystallisation in sub-microlitre volumes in microtitre plates has been established. Crystallisation 

is currently monitored by a system that takes pictures of crystallisation drops in a 96-well plate 

automatically. An additional system is under development that will combine a microtitre-plate 

storage device with a detection system and that will be able to automatically record images of 

crystallisation experiments at certain time intervals. 

Protein-protein interaction studies 

As part of the “Nationales Genomforschungsnetz” NGFN, a project has been established 

at the Protein Structure Factory for expression of human proteins involved in neurodegenerative 

diseases for the in vitro characterization of protein-protein interaction. 

We are developing a technology for identification of protein interaction partners using highdensity 

protein arrays on filter membranes (Weiner et al., in press). This project is a collaboration 

with Prof. Erich Wanker of the MDC Berlin-Buch, in which we share a common set of 100 

proteins involved in neurodegenerative disease to identify novel protein-protein interactions. 

We have identified sets of interaction partners for different target proteins. Interactions are currently 

being verified by in vitro pull-down assays and other methods. (NGFN Platform 4, http:/ 

/www.ngfn.de/protein) 



13


14 

General information 

Publications 1998-2003 

Manjasetty BA, Delbrück H, Pham D-T, 

Mueller U, Fieber-Erdmann M, Scheich C, 

Sievert V, Büssow K, Niesen F, Weihofen W, 

Loll B, Saenger W & Heinemann U (2003). 

Crystal structure of Homo sapiens protein 

hp14.5. Proteins: Structure, Function, and 

Genetics (in press) 

Weiner H, Faupel T & Büssow K (2003). Protein 

arrays from cDNA expression libraries. 

In: Protein Arrays, vol. Humana Press Inc. (in 

press) 

Holz C, Prinz B, Bolotina N, Sievert V, Büssow 

K, Simon B, Stahl U & Lang C (2003). Establishing 

the yeast Saccharomyces cerevisiae as 

a system for expression of human proteins on 

a proteome-scale. J Funct & Struct Genomics 

(in press) 

Heinemann U, Büssow K, Mueller U & 

Umbach P (2003). Facilities and methods for 

the high-throughput crystal structure analysis 

of human proteins. Acc Chem Res 36:157-163 

Scheich C, Sievert V & Büssow K (2003). An 

automated method for high-throughput protein 

purification applied to a comparison of 

His-tag and GST-tag affinity chromatography. 

BMC Biotechnology 3:12 

Eickhoff H, Konthur Z, Lueking A, Lehrach 

H, Walter G, Nordhoff E, Nyarsik L & Büssow 

K (2002). Protein array technology: the tool 

to bridge genomics and proteomics. Adv 

Biochem Engineer/Biotech 77:103-12 

Walter G, Büssow K, Lueking A & Glokler J 

(2002). High-throughput protein arrays: prospects 

for molecular diagnostics. Trends in Mol 

Med 8:250-3 

Büssow K, Hoffmann S & Sievert V (2002). 

ORFer - retrieval of protein sequences and 

open reading frames from GenBank and storage 

into relational databases or text files. BMC 

Bioinformatics 3:40 

Klose J, Nock C, Herrmann M, Stuhler K, 

Marcus K, Bluggel M, Krause E, Schalkwyk 

LC, Rastan S, Brown SD, Büssow K, 

Himmelbauer H & Lehrach H (2002). Genetic 

analysis of the mouse brain proteome. Nature 

Genetics 30:385-93 

Büssow K, Konthur Z, Lueking A, Lehrach 

H & Walter G (2001). Protein array technology. 

Potential use in medical diagnostics. Am 

J Pharmacogenomics 1:37-43 

Büssow K, Nordhoff E, Lübbert C, Lehrach 

H & Walter G (2000). A human cDNA library 

for high-throughput protein expression screening. 

Genomics 65:1-8 

Walter G, Büssow K, Cahill D, Lueking A & 

Lehrach H (2000). Protein arrays for gene 

expression and molecular interaction screening. 

Curr Opinion Microbiol 3:298-302 

Holt LJ, Büssow K, Walter G & Tomlinson 

IM (2000). By-passing selection: direct screening 

for antibody-antigen interactions using 

protein arrays. NAR 28:E72 

Egelhofer V, Büssow K, Luebbert C, Lehrach 

H & Nordhoff E (2000). Improvements in 

Protein Identification by MALDI-TOF-MS 

Peptide Mapping. Anal Chem 72:2741-2750 

Lueking A, Horn M, Eickhoff H, Büssow K, 

Lehrach H & Walter G (1999). Protein 

microarrays for gene expression and antibody 

screening. Anal Biochem 270:103-111 

Büssow K, Cahill D, Nietfeld W, Bancroft D, 

Scherzinger E, Lehrach H & Walter G (1998). 

A method for global protein expression and 

antibody screening on high-density filters of 

an arrayed cDNA library. NAR 26:5007-5008 

External funding 

BMBF Leitprojekt Proteinstrukturfabrik 

Nationales Genomforschungsnetz NGFN, 

Kernbreich, Plattform 4

Mass Spectrometry Group 

Head: 

Dr. Johan Gobom 

Phone: +49 (0)30-8413 1542 

Fax: +49 (0)30-8413 1380 

Email: gobom@molgen.mpg.de 

Scientists: 

Niklas Gustavsson, PhD. 

Klaus-Dieter Klöppel, PhD 

Thomas Kreitler 

Ekaterina Mirgorodskaya, PhD 

Dieter Weichart, PhD 

Graduate students: 

Eryk Witold Wolski 

Students: 

Stefan Giesen 

Technicians: 

Corina Bräuer 

Beata Lukaczewska 

Dorothea Theiss 


The current work of the group focuses on the development and use of mass spectrometry 

and associated techniques for the study of native and recombinant proteins. Emphasis is 

placed on the development of new technology, including hardware, experimental protocols 

and data interpretation routines with application to mass spectrometry-based proteome 

analyses. Techniques established in the group are being applied in proteomic projects for 

the generation of biologically and clinically valuable information. The group is partially 

funded by the NGFN (National Genome Research Network). Since the current group 

leader, Johan Gobom, started his work in the mass spectrometry group in year 2000, the 

research within the group and with external collaborations has resulted in 14 scientific 

publications in peer-reviewed periodicals and books. 

Projects - Current state of the research 

(a) Development of technology for high-throughput protein identification 

The efforts of the group address key analytical problems, specifically in the interface 

of 2-dimensional gel electrophoresis (2-DE) and mass spectrometry, and generally for 

mass spectrometric analysis of proteins and peptides derived from biological samples. 

A task recently accomplished is the establishment of technology for high-throughput 

identification of proteins separated by 2-dimensional gel electrophoresis (2-DE) by 

matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. 

This included the development of a gel excision workstation and a workflow 

for efficient, parallel processing of protein gel samples (Nordhoff et al. 2001). It is 

currently implemented on a commercial robotic platform in collaboration with the 

company Tecan (Switzerland). The resulting production of large mass spectrometric 

datasets spurred the development of improved and automated data analysis routines. A 

new strategy for protein identification by peptide mass fingerprinting was also developed 

that permits confident identification of proteins with mass spectra that lack internal 

calibrant signals (Egelhofer et al. 2000). This identification strategy was improved 

and implemented in a protein identification search engine, MSA (Egelhofer et al. 2002). 

A new concept for linking proteomic and genomic information by clustering mass 

spectrometric fingerprints generated from native proteins and recombinant expression 

products was also introduced (Schmidt et al. 2002). This technology and work-flow 



15


16 

allows automatic analysis of >1000 protein samples/per day and forms the basis for 

our ongoing proteome projects in human brain and Arabidopsis thaliana (see below) 

and collaborations. In collaboration with the group of Dr. Ralf Rabus (Max Planck 

Institute for Marine Microbiology, Bremen) the first proteomic study of the recently 

sequenced organism Pirellula was performed, in which over 1000 new proteins from 

this organism was identified (manuscript in preparation). 

(b) MALDI mass spectrometry – new and improved sample preparation methods 

The physical process of MALDI-TOF mass spectrometry is inherently fast (

different tissues of A. thaliana, which can serve as a basis for proteomic and biological 

investigations in this plant. This task was recently accomplished and a manuscript describing 

the results has been submitted (Giavalisco et al. 2003b). 

(f) Human brain proteome analysis 

The NGFN platform technology project “Development of Platform Technologies for Functional 

Proteome Analysis – Application to Human Brain” is performed in collaboration 

with several academic and industrial partners. A new calibration routine for MALDI-TOF 

spectra was developed that improves the mass accuracy (Gobom et al. 2002). In collaboration 

with the company Protagen AG (Dortmund), and Prof. Klose (Charité), over 1000 

brain-specific proteins have been identified (Chamrad et al. 2003), which will serve as the 

basis for protein-protein interaction studies and the development of a protein chip. 

(g) Clinical proteomics 

A recently initiated project within the NGFN is the Proteomverbund, which aims integrate 

state-of-the-art proteomic technology in clinical research. Within this consortium 

we have, in collaboration with the research group of Dr. Seegert at the University of Kiel, 

initiated a study aiming to discern aberrant protein expression/modification in chronic 

inflammatory bowel disorder. 

Planned developments / future orientation 

NGFN-2 - Our group is well-established within the NGFN and we plan to maintain these 

efforts by applying for funding in the 2nd round of NGFN. Here, we aim to extend the use 

of our established technology in clinical proteomic studies in collaboration with medical 

networks. 

EU-FP6 - Within the project Molecular phenotyping we aim to extend our technology to 

the proteomic analysis of post-translational modifications and quantitative analysis, to 

perform differential analysis of patient/control samples for the discovery of disease markers. 

A Fourier-transform ion cyclotron resonance (FT-ICR) mass spectrometry laboratory 

has been established. This technique offers, by its unique available fragmentation modes, 

the possibility for detailed protein structural characterization. The implementation of this 

advanced mass spectrometric technique in proteomic research is in progress. 

Ultra Structure Network (USN) 

As an extension of work carried out within the protein structure factory, we plan to address 

the question of the composition and structure of larger protein complexes by a 

combination of mass spectrometry to identify the components of complexes, and Cryo 

EM to analyze their structure (Bodo Lange). 



17


18 



Chamrad D, Koerting G, Gobom J, Thiele H, 

Klose J, Meyer HE, Blueggel M (2003). Interpretation 

of Mass Spectrometry Data for 

High Throughput Proteomics. Bioanal Chem 

(in press) 

Giavalisco P, Nordhoff E, Lehrach H, Gobom 

J & Klose J (2003). Extraction of proteins from 

plant tissues for 2-DE analysis, Electrophoresis 

24: 207-216 

Gustavsson N, Mirgorodskaya E, Lehrach H 

& Gobom J (2003). Reduction of sample complexity 

by metal-affinity isolation of histidinecontaining 

peptides for identification of proteins 

in complex mixture. Proc 51st ASMS 

Conference on Mass Spectrometry and Allied 

Topics, Montreal June 8 –12, 2003 

Kreitler T, Wolski EW, Mirgorodskaya E, 

Lehrach H & Gobom J (2003). Frequency 

analysis of MALDI-TOF spectra: noise filtering 

and signal detection. Proc 51st ASMS 

Conference on Mass Spectrometry and Allied 

Topics, Montreal June 8 –12, 2003 

Mirgorodskaya E, Braeuer C, Kloeppel K D, 

Lehrach H & Gobom J (2003). Interfacing 

nanoLC and MALDI-TOF MS for the analysis 

of complex peptide mixtures.Proc 51st ASMS Conference on Mass Spectrometry and 

Allied Topics, Montreal June 8 –12, 2003 

Nordhoff E, Schürenberg M, Thiele G, Lübbert 

C, Kloeppel KD, Theiss D, Lehrach H & 

Gobom J (2003). Sample Preparation Protocols 

for MALDI-MS of Peptides and Oligonucleotides, 

using Prestructured Sample Supports. 

Int J Mass Spectrom 226:163-180 

Egelhofer V, Gobom J, Seitz H, Giavalisco P, 

Lehrach H & Nordhoff E (2002). Protein identification 

by MALDI-TOF-MS peptide mapping: 

A new strategy, Anal Chem 74(8): 1760- 

1771 

Gobom J, Mueller M, Egelhofer V, Theiss D, 

Lehrach H & Nordhoff E (2002). A Calibration 

Method that Simplifies and Improves Accurate 

Determination of Peptide Molecular 

Masses by MALDI-TOF MS. Anal Chem 74: 

3915-3923 

Gobom J & Nordhoff E (2002). Quantitative 

Analysis of Neuropeptides by MALDI-TOF- 

MS, In: Mass Spectrometry and Hyphenated 

Techniques in Neuropeptide Research, J. 

Silberring & R. Ekman, eds., John Wiley & 

Sons, Inc. (ISBN 0-471-35493-7), Chp 16: 

415-429 

Schmidt F, Lueking A, Nordhoff E, Gobom 

J, Klose J, Seitz H, Egelhofer V, Eickhoff H, 

Lehrach H & Cahill DJ (2002). Generation of 

minimal protein identifiers of proteins from 

two-dimensional gels and recombinant proteins. 

Electrophoresis 23: 621-625 

Bergquist J, Gobom J, Blomberg A, 

Roepstorff P & Ekman (2001). Identification 

of nuclei associated proteins by 2D-gel electrophoresis 

and mass spectrometry. J Neurosci 

Met 109:3-11 

Ekman R, Gobom J, Persson R, Mecocci P & 

Nilsson CL (2001). Arginine vasopressin in the 

cytoplasm and nuclear fraction of lymphocytes 

from healthy donors and patients with depression 

or schizophrenia. Peptides 22: 67-72 

Gobom J, Schuerenberg M, Mueller M, 

Theiss D, Lehrach H & Nordhoff E (2001). 

alpha-cyano-4-hydroxycinnamic acid affinity 

sample preparation. A protocol for MALDI- 

MS peptide analysis in proteomics. Anal Chem 

73: 434-438 

Johnson T, Bergquist J, Ekman R, Nordhoff 

E, Schurenberg M, Kloppel KD, Mueller M, 

Lehrach H & Gobom J (2001). A CE-MALDI 

interface based on the use of prestructured 

sample supports. Anal Chem 73:1670-1675 

Nordhoff E, Egelhofer V, Giavalisco P, 

Eickhoff H, Horn M, Przewieslik T, Theiss D, 

Schneider U, Lehrach H & Gobom J (2001). 

Large-gel two-dimensional electrophoresismatrix 

assisted laser desorption/ionizationtime 

of flight-mass spectrometry: An analytical 

challenge for studying complex protein 

mixtures. Electrophoresis 22: 2844-2855 

Egelhofer V, Büssow K, Luebbert C, Lehrach 

H & Nordhoff E (2000). Improvements in protein 

identification by MALDI-TOF-MS peptide 

mapping, Anal Chem 72: 2741-2750 

Schuerenberg S, Luebbert C, Eickhoff H, 

Kalkum M, Lehrach H & Nordhoff E (2000). 

Prestructured MALDI-MS Sample Supports. 

Anal Chem A 72: 3436-3442

Bioinformatics Group 

Heads: 

Ralf Herwig, PhD 

Phone: +49 (0)30-8413 1265 

Fax: +49 (0)30-8413 1384 

Email: herwig@molgen.mpg.de 

Scientists / Developers: 

Matthias Steinfath, PhD 

Detlef Groth, PhD 

Günther Zehetner, PhD 

Wasco Wruck 

Mario Drungowski 

Elisabeth Maschke-Dutz 

Raffaello Galli 

Günther Teltow 

Steffen Hennig, PhD 

Phone: +49 (0)30-8413 1612 

Fax: +49 (0)30-8413 1380 

Email: hennig@molgen.mpg.de 


Christoph Wierling 

Hendrik Hache 

Diploma students: 

Sven Kiesewetter 

Marcus Albrecht 

Andriani Daskalaki 

The bioinformatics group was established in 2001. 


Expression Analysis (Herwig) 

Our efforts can be subdivided in three major tasks: Data analysis, Visualisation and 

Simulation & Modelling. 

a) Oligofingerprinting (ofp) 

This is a hybridisation-based technology that enables us to screen complete cDNA libraries 

by the hybridisation of short DNA sequences to unknown cDNA clones and the subsequent 

identification of these oligo-fingerprints. Data sets from academic groups within 

and outside the department (AG Janitz; AG Cahill; AG Himmelbauer; Weizmann Institute) 

and from industrial collaborations (KWS Saatzucht AG) have been processed. Data 

analysis includes the full data analysis pipeline such as data management, image analysis, 

high-dimensional clustering and sequence analysis. A technical collaboration with the 

RZPD GmbH has been set up for the utilisation of our ofp data analysis pipeline. 



19


20 

b) DNA expression profiling 

Our group has carried out data analysis service for more than 20 projects from 10 

different groups within and outside the department. Different technologies (Affymetrix, 

glass-chips, nylon-arrays) have been incorporated in the data analysis modules. Research 

covers the full pipeline from image analysis, normalisation, cluster analysis, 

reverse engineering and modelling and simulation. 

c) “Meta-clustering” 

We set up a framework to compare and validate various clustering methods for gene expression 

profiles. Since the concept of co-regulation is fundamental to large gene expression screenings 

and since each individual method has a certain bias we focus on validation methods for gene 

expression clusters by robust normalisation of the data, by the comparison of different methods, 

by the definition and implementation of numerical cluster validation methods and the comparison 

of gene expression data to alternative data sources. A graphical user interface to a comprehensive 

data-mining tool, BioMiner, has been set up in close collaboration with the bioinformatics 

start-up MicroDiscovery GmbH Berlin. 

d) Data integration 

We define methods and strategies to correlate and integrate data from various sources into 

a unifying gene-based concept. As an example we correlated data from EST-mining, RT- 

PCR and whole-mount in-situ hybridisations from mouse orthologues to human chromosome 

21 genes. Further attempts are ongoing with the AG Yaspo to validate EST-mining 

data and gene expression data. In order to take into account transcriptional regulation we 

work on a joined project with the Department of Computational Biology (Prof. Vingron) 

in order to evaluate gene expression data and transcriptional profiling data coming from 

comparative cross-species sequence analysis. 

e) Statistical service 

The bioinformatics group has contributed to the statistical evaluation of other data sets such as 

the comparative analysis of the 2R hypothesis, the analysis of peptide peak-lists derived from 

2D-gels (AG Gobom) and the large-scale sequence analysis of bacteria genomes (AG Russo). 

f) Simulation and Modelling 

Modelling and simulation systems are a valuable tool for the understanding of complex systems. 

We developed an object-oriented environment, PyBioS, that is able to process such systems. 

In the context of array hybridization experiments we used this system for the simulation of 

artificial gene expression data in order to identify and validate important experimental parameters. 

In collaboration with the Kinetic modeling group (AG Klipp) we established a modeling 

platform for in-silico experiments in the context of target validation. 

g) Visualisation 

We develop tools for data quality control and visualisation. The program Xdigitise was 

designed for the visualisation and manipulation of TIF-images in order to check image 

analysis results. The automated image analysis program, FA, for hybridisation images has 

been developed and successfully applied to various projects. Furthermore, we are developing 

the Java tool A-Cgen for the purpose of array data quality control. This tool is 

implemented in the chip-processing pipeline that we set up with the automation group 

(AG Hultschig). We currently implement modules for data quality control, normalisation 

and the detection of differentially expressed genes. Furthermore, the tool allows webconnections 

to data resources such as GenomeMatrix, Entrez server and Ensembl. 

Sequence Analysis (Hennig) 

The main research areas and activities of our group are evolutionary sequence analysis, 

generalized sequence annotation based on GeneOntology, clustering of redundant 

cDNA sequences (ESTs), species-species comparison in terms of orthology, and 

the development of automatic high-throughput procedures for genome annotation.

a) Evolutionary studies 

In a recent publication we have tested the 2R hypothesis, which postulates 2 rounds of genome 

duplications at the origin of vertebrates, and found high significance that there was at least one 

genome duplication around 600 myr ago. The study was based on a set of genes (proteins) 

orthologous between 4 invertebrate (yeast, C.elegans, drosophila, amphioxus) and 2 vertebrate 

species (human, mouse), which we constructed from public and inhouse (amphioxus) sources. 

Based on ~3000 groups of orthologous genes we found an almost 3-fold increase in gene 

numbers from invertebrates to vertebrates. The majority of those extra duplicates could be dated 

to a time interval around 600 myr ago, i.e. shortly after the emergence of amphioxus. Moreover, 

we identified a significant number of segments in the human genome sequence, which can be 

clearly shown to be derivatives of large-scale ancient duplication events. 

b) Generalised sequence annotation by GeneOntology (GO) 

The absolute need for a unified vocabulary for description of genes and their products led to the 

foundation of the GeneOntology consortium, which currently provides a hierarchy of more than 

11.000 terms. In order to facilitate the task of annotating anonymous sequence data, e.g. from an 

in house EST project, we have developed an automated system (http://goblet.molgen.mpg.de) 

able to perform GO annotations on any kind of coding sequences (cDNA, protein). We also 

demonstrated that import of GO-terms from existing species annotations is meaningful even in 

cases of significant evolutionary distance and in the majority of cases gives correct results. 

c) High-throughput sequence clustering and genome analysis 

Our group was involved in many sequencing projects carried out mainly at the MPIMG. For 

various model organisms (zebrafish, sea urchin, amphioxus, medaka ) gene catalogs were developed 

by large scale EST analysis. An important step in the analysis was the clustering of EST 

sequences into unique contigs. We have developed an automated system that performs clustering 

of several 100.000 ESTs typically within a day generating one unique sequence (contig) per 

cluster. For the genomic sequencing projects carried out in house (human chromosomes 17, 21, 

X) we designed an automated pipeline of analysis steps called GenscanX. Parts of our analysis 

entered the final annotation of the human chromosomes 17, 21 and X. We also participated in 

several smaller projects focusing on the analysis of single disease genes. 

Recently, we started to develop a system for identification of non-mRNA genes in mammalian 

genomes. 

Future perspectives 

a) NGFN-2 (National Genome Research Network) - Our group is well established 

within the NGFN and we plan to maintain these efforts by applying for funding in the 

2nd round of NGFN. Main focus here will be data integration aspects, tools for functional 

genomics analysis and detection and analysis of non-mRNA genes. Furthermore, 

our group is integrated in the disease-oriented networks “Infection and Inflammation” 

and “Cardiovascular Diseases” carrying out statistical analysis of clinical 

data and detection of disease relevant genes. 

b) EU-Framework 6 - A further direction will be Systems Biology, as a methodological 

concept to integrate bioinformatics with modelling and simulation. Here, we successfully 

applied for a grant within the EU-Framework 6 program. The project will start 2004 in 

collaboration with the EBI-Ensembl group, the School of Computer Science Tel-Aviv 

University, LION Bioscience Ltd. Cambridge and MicroDiscovery GmbH Berlin. We 

will construct a software platform for the modelling of disease processes. 

c) BioRegio - Our group applied (together with MicroDiscovery GmbH, Scienion 

GmbH and the German Institute for Human Nutrition) for a BMBF BioRegio grant on 

the large-scale screening of a mouse model for diabetes and obesity in various relevant 

tissues and through time points of disease progression. This passed the first evaluation 

round and is currently under revision. 



21


22 



Poustka AP, Groth D, Hennig S, Thamm S, 

Cameron A, Herwig R, Panopoulou, G & 

Lehrach H (2003). Generation, annotation, 

evolutionary analysis and database integration 

of 20,000 unique sea urchin EST clusters. 

Genome Res (in press) 

Grzeskowiak R, Witt H, Drungowski M, 

Thermann R, Hennig S, Perrot A, Osterziel 

KJ, Klingbiel D, Scheid S, Spang R, Lehrach 

H & Ruiz P (2003). Expression profiling of 

human idiopathic dilated cardiomyopathy. 

Cardiovascular Res (in press) 

Dieterich C, Herwig R & Vingron M (2003). 

Exploring potential target genes of signaling 

pathways by predicting conserved transcription 

factor binding sites. Bioinformatics (in 

press) 

Dickmeis T, Plessy C, Rastegar S, Aanstad P, 

Herwig R, Chalmel F, Fischer N & Straehle 

U (2003). Expression profiling and comparative 

genomics identify a conserved regulatory 

region controlling midline expression in the 

zebrafish embryo. Genome Res (in press) 

Panopoulou G, Hennig S, Groth D, Krause A, 

Poustka A, Herwig R, Vingron M & Lehrach 

H (2003). New Evidence for Genome-Wide 

Duplications at the Origin of Vertebrates Using 

an Amphioxus Gene Set and Completed 

Animal Genomes. Genome Res 13:1056-1066 

Hennig S, Groth D & Lehrach H (2003). Automated 

Gene Ontology annotation for anonymous 

sequence data. Nucleic Acids Research 

31: 3712-3715 

Herwig R, Schuchhardt J, Eickhoff H, Herzel 

H & Lehrach H (2003). Datenanalyse von 

Biochips: Von der Sequenz zum System. In 

Grundlagen der Molekularen Medizin (D. 

Ganten and K. Ruckpaul, eds.), Neuauflage, 

Springer Verlag, Berlin, pp. 360-387 

Kaynak B, Heydebreck Av, Mebus S, Seelow 

D, Hennig S, Vogel J, Sperling HP, Pregla R, 

Alexi-Meskishvili V, Hetzer R, Lange PE, 

Vingron M, Lehrach H & Sperling S (2003). 

Genome-wide array analysis of normal and 

malformed human hearts. Circulation 107: 

2467-2474. 

Sudbrak R, Reinhardt R, Hennig S, Lehrach 

H, Günther E & Walter L (2003). Comparative 

and evolutionary analysis of the rhesus 

macaque extended MHC class II region. Immunogenetics 

54: 699-704 

Olbrich H, Haffner K, Kispert A, Volkel A, 

Volz A, Sasmaz G, Reinhardt R, Hennig S, 

Lehrach H, Konietzko N, Zariwala M, Noone 

PG, Knowles M, Mitchison HM, Meeks M, 

Chung EM, Hildebrandt F, Sudbrak R & 

Omran H (2002). Mutations in DNAH5 cause 

primary ciliary dyskinesia and randomization 

of left-right asymmetry. Nature Genetics 

30:143-144. 

Hennig S, Panopoulou G, Lehrach H & 

Poustka AJ (2002). Comparative EST analysis. 

In Analysing gene expression - a handbook 

of methods: possibilities and pitfalls (S. 

Lorkowski & P. Cullen, eds.); Wiley-VCH, 

Weinheim, pp. 770-778 

Bauer O, Janitz M, Guerasimova A, Herwig 

R, Lehrach H & Radelof U (2002). Oligonucleotide 

fingerprinting including differential 

cDNA library screening. In Analysing gene 

expression - a handbook of methods: possibilities 

and pitfalls (S. Lorkowski & P. Cullen, 

eds.); Wiley-VCH, Weinheim, pp. 463-471 

Herwig R & Lehrach H (2002). Clustering 

gene expression profiles. In Analysing gene 

expression - a handbook of methods: possibilities 

and pitfalls ( S. Lorkowski & P. Cullen, 

eds.); Wiley-VCH, Weinheim, pp. 790-798 

Gitton Y, Dahmane N, Baik S & Altaba R 

(Group 1), Neidhardt L, Scholze M & 

Herrmann B (Group 2), Kahlem P, Ben-Kahla 

A, Schrinner S, Yildirimman R, Herwig R, 

Lehrach H & Yaspo M-L (Group 3) (Groups 

contributed equally) (2002). A gene expression 

map of human chromosome 21 orthologues 

in the mouse. Nature 420: 586-590 

Wierling CK, Steinfath M, Elge T, Schulze- 

Kremer S, Aanstad P, Clark M, Lehrach H & 

Herwig R (2002). Simulation of DNA array 

hybridization experiments and evaluation of 

critical parameters during subsequent image 

and data analysis. BMC Bioinformatics 3: 29 

Herwig R, Schulz B, Weisshaar B, Hennig 

S, Steinfath M, Drungowski M, Stahl D, Wruck 

W, Menze A, O’Brien J, Lehrach H & Radelof 

U (2002). Construction of a “unigene” cDNA 

clone set by oligonucleotide fingerprinting allows 

access to 25,000 potential sugar beet 

genes. The Plant Journal 32: 845-857 

Tang T-H, Bachellerie J-P, Rozhdestvensky T, 

Bortolin M-L, Huber H, Drungowski M, Elge 

T, Brosius J & Hüttenhofer A (2002). Identification 

of 86 candidates for small non-messenger 

RNAs from the archaeon Archaeoglobus 

fulgidus. PNAS USA 99: 7536-7541

Fuchs T, Malecova B, Linhart C, Sharan R, 

Khen M, Herwig R, Shmulevich D, Elkon R, 

Steinfath M, O’Brien J, Radelof U, Lehrach 

H, Lancet D & Shamir R (2002). DEFOG: a 

practical scheme for deciphering families of 

genes. Genomics 80: 295-302 

Wruck W, Griffiths H, Steinfath M, Lehrach 

H, Radelof U & O’Brien J (2002). Xdigitise: 

visualization of hybridization experiments. 

Bioinformatics 18: 757-760 

Herwig R, Aanstad P, Clark M & Lehrach H 

(2001). Statistical evaluation of differential 

expression on cDNA nylon arrays with replicated 

experiments. Nucl Acids Res 29: e117 

Dickmeis T, Aanstad P, Clark M, Fischer N, 

Herwig R, Mourrain P, Blader P, Rosa F, 

Lehrach H & Straehle U (2001). Identification 

of nodal signalling targets by array analysis 

of induced complex probes. Developmental 

Dynamics 222: 571-580 

Clark M, Hennig S, Herwig R, Clifton S, 

Marra M, Lehrach H, Johnson S & the WU- 

GSC EST Group (2001). An Oligonucleotide 

Fingerprint Normalized and Expressed Sequence 

Tag Zebrafish cDNA Library. Genome 

Research 11: 1594-1602 

Seranski P, Hoff C, Radelof U, Hennig S, 

Reinhardt R, Schwartz CE, Heiss NS & 

Poustka A (2001). RAI1 is a novel polyglutamine 

encoding gene that is deleted in Smith- 

Magenis syndrome patients. Gene 270: 69-76 

Handschug K, Sperling S, Yoon SJ, Hennig 

S, Clark AJ & Huebner A (2001). Triple A syndrome 

is caused by mutations in AAAS, a new 

WD-repeat protein gene. Hum Mol Genet 10: 

283-90 

Guerasimova A, Nyarsik L, Girnus M, 

Steinfath M, Wruck W, Griffiths H, Wierling 

C, Herwig R, O’Brien J, Eickhoff H, Lehrach 

H & Radelof U (2001). New tools for oligonucleotide 

fingerprinting. BioTechniques 31: 

490-495 

Steinfath M, Wruck W, Seidel H, Lehrach H, 

Radelof U & O’Brien J (2001). Automated 

image analysis for array hybridisation experiments. 


Hattori M, Fujiyama A, Taylor T D, Watanabe 

H, Yada T,…, Hennig S, ... et al. (2000). The 

DNA sequence of human chromosome 21. 

Nature 405:311-9 

Herwig R, Schmitt AO, Steinfath M, O’Brien 

J, Seidel H, Meier-Ewert S, Lehrach H & 

Radelof U (2000). Information theoretical 

probe selection for hybridisation experiments. 


Herwig R (2000). Ein Normalisierungs- und 

Clusteranalyseprogramm zur Bearbeitung 

großer genomischer Datenmengen. In 

Forschung und wissenschaftliches Rechnen. 

Beiträge zum Heinz-Billing Preis 1999 (T. 

Plesser & H. Hayd, eds.), Gesellschaft für wissenschaftliche 

Datenverarbeitung Göttingen 

(GWDG), pp 93-107 

Hennig S, Herwig R, Clark M, Aanstad P, 

Musa A, O’Brien J, Bull C, Radelof U, 

Panopoulou G, Poustka A & Lehrach H (2000). 

A data-analysis pipeline for large-scale gene 

expression analysis. In Proceedings of the 4th 

Annual International Conference on Research 

in Computational Molecular Biology 

RECOMB 2000 (R. Shamir et al. eds.), ACM 

Press, New York, pp 165-173 

Seranski P, Heiss NS, Dhorne-Pollet S, Radelof 

U, Korn B, Hennig S, Backes E, Schmidt S, 

Wiemann S, Schwarz CE, Lehrach H & 

Poustka A (1999). Transcription mapping in 

a medulloblastoma breakpoint interval and 

Smith-Magenis syndrome candidate region: 

identification of 53 transcriptional units and 

new candidate genes. Genomics 56: 1-11 

Boeddrich A, Burgtorf C, Roest Crollius H, 

Hennig S, Bernot A, Clark M, Reinhardt R, 

Lehrach H & Francis F (1999). Analysis of the 

spermine synthase gene region in Fugu 

rubripes, Tetraodon fluviatilis, and Danio 

rerio. Genomics 57: 164-8 

Boeddrich A, Burgtorf C, Francis F, Hennig 

S, Panopoulou G, Steffens C, Borzym K & 

Lehrach H (1999). Sequence analysis of an 

amphioxus cosmid containing a gene homologous 

to members of the aldo-keto reductase 

gene superfamily. Gene 230: 207-14 

Herwig R, Poustka A, Müller C, Bull C, 

Lehrach H & O’Brien J (1999). Large-scale 

clustering of cDNA fingerprinting data. Genome 

Research 9: 1093-1105 

Poustka A, Herwig R, Krause A, Hennig S, 

Meier-Ewert S & Lehrach H (1999). Towards 

the gene catalogue of sea urchin development: 

the construction and analysis of an unfertilized 

egg cDNA library highly normalized by 

oligonucleotide fingerprinting. Genomics 59: 

122-133 

Schmitt AO, Herwig R, Meier-Ewert S & 

Lehrach H (1999). High-density cDNA grids 

for hybridization fingerprinting experiments. 

In PCR Applications. Protocols for functional 

genomics (M.A. Innis, D.H. Gelfand & J.J. 

Sninsky, eds.), Academic Press, San Diego, pp 

457-472 



23


24 

Radelof U, Hennig S, Seranski P, Steinfath 

M, Ramser J, Reinhard R, Poustka A, Francis 

F & Lehrach H (1998). Preselection of shotgun 

clones by oligonucleotide fingerprinting: 

an efficient and high throughput strategy to 

reduce redundancy in large-scale sequencing 

projects. Nucl Acids Res 26: 5358-5364 

Meier-Ewert S, Lange J, Gerst H, Herwig R, 

Schmitt AO, Freund J, Elge T, Mott R, 

Herrmann B & Lehrach H (1998). Comparative 

gene expression profiling by oligonucleotide 

fingerprinting. Nucl Acids Res 

26(9):2216-2223 

Panopoulou G, Clark M, Gerst H, Herwig R, 

Holland LZ, Holland ND & Lehrach H (1998). 

Large-scale identification of amphioxus genes 

from different developmental stages using oligonucleotide 

fingerprinting. Develop Biol 

198(1):200-201 

Theses 

Ralf Herwig: Large-scale information-theoretic 

clustering with application to genetic fingerprinting 

data, PhD Thesis, Free University 

of Berlin, 02/2001, sponsored by Max-Planck- 

Society 

Sven Kiesewetter: GEx – an interactive program 

for the visualisation and validation of 

gene expression profiles (in German), Bachelor 

Thesis in Bioinformatics, Free University 

of Berlin (submitted) 


BMBF Grant 01GR0105, National Genome 

Research Network, Core Area Platform 7, 

Bioinformatics and Databases (03/2001-10/ 

2004) 

EU Framework 6, EMI-CD - European Modelling 

Initiative combating complex diseases 

(01/2004-12/2006) 

International academic co-operations 

Prof. Dr. Doron Lancet, Weizmann Institute 

of Science, Rehovot, Israel 

Prof. Dr. Ron Shamir, Department of Computer 

Science, Tel-Aviv University, Israel. 

Dr. Pia Aanstad, University of California San 

Francisco. Dep. of Biochemistry and Biophysics, 

USA 

Dr. Ewan Birney, EBI, ENSEMBL group, 

Cambridge, UK 

Dr. John O’Brien, Department of Clinical Pharmacology, 

Royal College of Surgeon in Ireland 

Dublin, Ireland 

Dr. Dolores Cahill, Centre for Proteome Research, 

Dublin, Ireland 

Prof. Dr. John Williams, Roslin Institute, 

Edinburgh, UK 

Dr. Philippe Rouet, Faculty of Medicine, 

INSERM U586, Toulouse, France 

National academic co-operations 

Prof. Dr. Martin Vingron, Max-Planck-Institute 

for Molecular Genetics, Dep. of Computational 

Biology 

Prof. Dr. Christine Müller, University of 

Oldenburg, Dep. of Mathematics 

Prof. Dr. R. Heinrich, Humboldt University 

Berlin 

Prof. Dr. H.-P. Herzel, Humboldt University 

Berlin 

Prof. Dr. E. Wanker, Max-Delbrück-Center 

Buch 

Prof. Dr. H. Joost, German Institute for Human 

Nutrition, Dep. Pharmacology 

Dr. Stefan Bläß, Charité Berlin, Dep. of Rheumatology 

and Clinical Immunology 

Prof. Dr. Bernd Weisshaar, MPI for Plant 

Breeding Research, Cologne 

Prof. Dr. J. Brosius, University of Münster, Inst. 

of Experimental Pathology 

Dr. Lutz Walter, University of Göttingen, Dept. 

of Immunogenetics 

Dr. Boris Ivandic, University of Heidelberg, 

Dept. of Cardiology 

Industrial co-operations 

Dr. Arif Malik, MicroDiscovery GmbH Berlin 

Dr. Thure Etzold, LION Bioscience Ltd., Cambridge, 

UK 

Dr. Uwe Radelof, RZPD Berlin 

Dr. Holger Eickhoff, Scienion GmbH Berlin 

Dr. Britta Schulz, KWS Saatzucht AG Einbeck

Mouse, Medaka & MHC Group 

Head: 

Dr. Heinz Himmelbauer 

Phone: +49 (0)30-8413 1354 

Fax: +49 (0)30-8413 1128 

Email: himmelbauer@molgen.mpg.de 

Scientist: 

Katarina Bilikova (since 08/2003) 


Peter Hurt (since 01/2001) 

Anja Berger (since 04/2001) 

Boris Greber (since 06/2001) 

Maryam Zadeh-Khorasani (since 09/2001) 

Undergraduate students: 

Christoph Campregher (until 06/2003) 

Gabriele Hebenstreit, (since 07/2002) 

Technicians: 

Stefanie Palczewski 

Andreas Hirsch 


With the sequence of the human genome completed and the majority of human genes known, 

the focus shifts to model organisms, for comparative genome analysis and for the analysis of 

gene function. Our model system of choice since 1995 has been the mouse. Complementing 

work in rat and medaka (rice fish) was initiated in 2001. 

Mouse mapping and proteomics 

For the mouse, we initially focussed onto marker development for the genetic and physical 

mapping of the mouse genome (1-4, 9-11) and established a YAC/BAC map with 12,000 novel 

markers (18). In addition, similar technologies were applied to the rat (6, 16). A number of 

mouse genes were characterized in several collaborations at the national and international level 

(5,8,12,13,14). Subsequently, we proceeded with functional studies, applying subtractive cDNA 

hybridisation and complex probes for the analysis of gene expression differences during mouse 

placental development (15, 17). This allowed us to identify over 600 genes that are differentially 

regulated in the two stages we examined (together with R. Fundele, now at Lund University, 

Sweden). In co-operation with the Klose group (Charité, Berlin), we separated brain proteins on 

high-resolution 2D-protein gels. 1,324 polymorphic proteins were detected, of which 665 could 

be mapped genetically (7,19). Interestingly, protein polymorphisms were to some extent due to 

modifying activities that segregated on the cross. We also found that quantitative variations in 

protein amounts were mostly inherited in an allele-specific manner. 

Chemical mutagenesis of mouse ES cells 

Under funding by the NGFN we are currently carrying out a project to create and screen libraries 

of chemically mutagenised mouse ES cells to create a resource of mutagenised ES cells that 

can be screened for mutations within any gene, with particular focus on genes with biomedical 

relevance, such that appropriate mouse models can be generated. As part of this project, we have 

tested TMP (trimethylpsoralen) and 4-NQO (4-nitroquinoline-N-oxide), which had previously 

not been used for ES cell mutagenesis as well as ENU (ethylnitrosourea), a well-characterized 

mutagen as control, for their power to induce mutations in ES cells (21). For each mutagen, the 



25


26 

spectrum of induced mutations (point mutations, deletions, nonsense, missense, splice mutation) 

was carried out. While work in C. elegans had previously suggested that TMP can efficiently 

induce deletions, we detected predominantly a low rate of point mutations in ES cells 

with this mutagen. Both 4-NQO and ENU, which have different mutational spectra, were found 

suitable for library generation. Using ENU, we have created a library of 40,000 mutagenized ES 

cell clones that was replicated for storage in liquid nitrogen and for the generation of screening 

templates. This is the so far largest library of mutagenised ES cells world-wide. Several mutation 

detection technologies were evaluated for their power to detect point mutations and deletions 

in pools of mutagenized cells, i.e. heteroduplex analysis (WAVE), capillary electrophoresis, 

Cel I mismatch cleavage, protein truncation test, and nested PCR for splice mutation detection. 

At the moment, a number of induced mutations have been identified in test genes. A scaleup 

of the protocol is planned in near future. 

Sequencing and annotation of the rat major histocompatibility complex 

As an extension to the mouse mapping project, we have set out to sequence the major histocompatibility 

complex (MHC) of the rat (20,24). The MHC was initially discovered in mouse in the 

context of tumour transplantation studies and subsequently shown to play a major role in infectious 

diseases and autoimmune disorders, e.g. multiple sclerosis, rheumatoid arthritis and type I 

diabetes mellitus. Our sequence is based on a previously generated BAC/PAC contig and spans 

almost 4 Mb encompassing the rat class I , class II and class III gene regions, identifying at least 

220 genes within the interval. While we found gene content and order well conserved in the 

class II and class III gene intervals in comparison to human and mouse, profound rat-specific 

features were encountered within the class I gene regions. Class I region-associated differences 

were found both at the structural level, the number and organisation of class I genes and gene 

families, and, in a more global context, in the way how evolution worked to shape the presentday 

rat MHC. Our sequence is the first finished sequence for a segment of the rat genome and 

constitutes one of the largest contiguous sequences so far for rodent genomes in general. After 

the human MHC the rat MHC is the second mammalian MHC region sequenced to completion. 

The rat MHC haplotype n (RT1 n ) sequence generated by us can now be used to study the 

molecular genetic basis of MHC-controlled disease traits and serve as a reference sequence. 

Sequencing of further rat MHC haplotypes will delineate the features that distinguish the different 

haplotypes, causing animals to be either disease-prone or resistant. 

Characterization of the medaka genome and transcriptome 

Two years ago we initiated a project to analyse the medaka genome (22), building upon a similar 

project that we previously conducted for mouse (18). The medaka (Oryzias latipes) is an “old’’ 

model system for genetic research with tradition going back to the early 20th century. Until 

recently its use was restricted to Japan. Phylogenetic studies place the medaka in close relationship 

to the pufferfish (Fugu and Tetraodon) with an estimated divergence time of 60-80 Myr, 

less than the evolutionary distance between man and mouse. Medaka and the zebrafish are 

relatively distant cousins that have evolved separately for at least 110 Myr. The key technologies 

that made zebrafish such a successful model species are fully applicable to the medaka. However, 

genomics in medaka offers several advantages, e.g. the availability of divergent, perfectly 

inbred strains and a small 800 Mb genome, half the size of the zebrafish genome. We follow two 

approaches, first, the generation of a UniGene cDNA set for medaka and second, the generation 

of a medaka physical map in BACs. Towards assembling a comprehensive gene set of the 

medaka, we have processed 137,000 cDNA clones from several developmental stages and 

adult tissues of the medaka and normalised the libraries using the oligonucleotide fingerprinting 

(OFP) technology. A pilot set of 6600 sequences from re-arrayed cDNA clones indicated low 

redundancy (14%) and high percentage of novel medaka genes, currently not covered by ESTs 

(44%). For the generation of a medaka physical map, we have imported BAC resources prepared 

from several strains. We generate data hybridisation-based, using BAC endprobes and 

ESTs that are genetically mapped or which provide cross-links to the Fugu genome sequence. 

At present, 2000 markers have been mapped and future markers will be generated from BACs 

that so far are not included in contigs. We have already passed on clones for four different 

positional cloning projects carried out in the Wittbrodt group (Heidelberg) and the Furutani- 

Seiki lab (Osaka). In addition, BAC-based sequencing is currently under way in the group of 

Shimizu (Tokyo).


Publications 1998-2003* 

1. Himmelbauer H*, Wedemeyer N, Haaf T, 

Wanker EE, Schalkwyk LC & Lehrach H 

(1998). IRS-PCR based genetic mapping of 

the huntingtin interacting protein gene (HIP1) 

on mouse chromosome 5. Mamm Genome 

9:26-31 

2. Himmelbauer H*, Dunkel I, Otto GW, 

Burgtorf C, Schalkwyk LC & Lehrach H 

(1998). Complex probes for high-throughput 

parallel genetic mapping of genomic mouse 

BAC clones. Mamm Genome 9: 611-619 

3. Schalkwyk LC, Weiher M, Kirby M, Cusack 

B, Himmelbauer H & Lehrach H (1998). 

Refined radiation hybrid map of mouse chromosome 

17. Mamm Genome 9: 807-811 

4. Zechner U, Scheel S, Hemberger M, Hopp 

M, Haaf T, Fundele R, Wanker EE, Lehrach 

H, Wedemeyer N & Himmelbauer H* 

(1998). Characterization of the mouse Src homology 

3 domain gene Sh3d2c on Chr. 7 demonstrates 

coexpression with huntingtin in the 

brain and identifies the processed pseudogene 

Sh3d2c-ps1 on Chr. 2. Genomics 54: 505-510 

5. Hemberger M, Himmelbauer H, Neumann 

HPH, Plate KH, Schwarzkopf G & Fundele 

R (1999). Expression of the von Hippel- 

Lindau-binding protein-1 (Vbp1) in fetal and 

adult mouse tissues. Hum Mol Genet 8:229- 

236 

6. Grützner F, Himmelbauer H, Paulsen M, 

Ropers H-H & Haaf T (1999). Comparative 

mapping of mouse and rat chromosomes by 

fluorescence in situ hybridization. Genomics 

55:306-313 

7. Nock C, Gauss C, Schalkwyk LC, Klose J, 

Lehrach H & Himmelbauer H* (1999). Technology 

development at the interface of 

proteome research and genomics: Mapping 

non-polymorphic proteins on the physical map 

of mouse chromosomes. Electrophoresis 20: 

1027-1032 

8. Krause R, Hemberger H, Himmelbauer H, 

Kalscheuer V & Fundele RH (1999). Identification 

and characterisation of G90, a novel 

mouse RNA that lacks an open reading frame. 

Gene 232:35-42 

9. Hardt T, Himmelbauer H, Ropers H-H & 

Haaf T (1999). Towards identification of individual 

homologous chromosomes: Comperative 

genomic hybridization and spectral karyotyping 

discriminate between paternal and 

maternal euchromatin in Mus musculus x M. 

spretus interspecies hybrids. Cytogenetics Cell 


* indicates corresponding author/s 

10. Schalkwyk LC, Jung M, Daser A, Weiher 

M, Walter J, Himmelbauer H & Lehrach H 

(1999). Panel of microsatellite markers for 

whole-genome scans and radiation hybrid 

mapping and a mouse family tree. Genome 

Res 9: 878-887 

11. Himmelbauer H*, Schalkwyk LC & 

Lehrach H (2000). Interspersed repetitive sequence 

(IRS)-PCR for typing of whole genome 

radiation hybrid panels. Nucleic Acids Res 

28: e7 

12. Klein BS, Himmelbauer H, Zechner U, 

Riemann M, Liptay S, Hameister H & Schmid 

RM (2000). Assignment of the murine RBP- 

JK gene to chromosome 5 and one processed 

pseudogene to chromosome 6. Cytogenetics 

Cell Genetics 88: 218-220 

13. Mages H. W., Hutloff A., Heuck C., 

Büchner K., Himmelbauer H., Oliveri F. and 

Kroczek R. A. (2000). Molecular cloning of 

murine ICOS and identification of its ligand. 

Europ. J. Immunology 30, 1040-1047. 

14. Hopitzan A, Himmelbauer H, Spevak W 

& Castanon MJ (2000).The mouse Psma1 

gene coding for the alpha-type C2 proteasome 

subunit: structural and functional analysis, 

mapping and co-localization with Pde3b on 

mouse chromosome 7. Genomics 66:313-323 

15. Hemberger M, Himmelbauer H, 

Ruschmann J, Zeitz C & Fundele R (2000). 

cDNA subtraction cloning reveals novel genes 

whose temporal and spatial expression indicates 

association with trophoblast invasion. 

Develop Biol 222: 158-169 

16. Gösele C, Liu H, Rossmann M, Hieke B, 

Groß U, Kramer M, Himmelbauer H, 

Bihoreau M-T, Kwitek-Black AE, Twigger S, 

Tonellato P J, Jacob HJ, Schalkwyk LC, 

Lindpaintner K, Ganten D, Lehrach H & 

Knoblauch M (2000). High throughput scanning 

of the rat genome using interspersed repetitive 

sequence (IRS) -PCR markers. 

Genomics 69: 287-294 

17. Hemberger M*, Cross JC, Ropers H-H, 

Lehrach H, Fundele R & Himmelbauer H* 

(2001). UniGene cDNA-based monitoring of 

transcriptome changes during mouse placental 

development. PNAS USA 98:13126-13131 

18. Schalkwyk LC*, Cusack B, Dunkel I, 

Hopp M, Kramer M, Palczewski S, Piefke J, 

Scheel S, Weiher M, Wenske G, Lehrach H & 

Himmelbauer H* (2001). Advanced integrated 

mouse YAC map including BAC framework. 

Genome Res 11: 2142-2150 



27


28 

19. Klose J*, Nock C, Herrmann M, Stühles 

K, Marcus K, Blüggel M, Krause E, 

Schalkwyk LC, Rastan S, Brown SDM, 

Büssow K, Himmelbauer H* & Lehrach H 

(2002). Genetic analysis of the mouse brain 

proteome. Nature Genetics 30: 385-393 

20. Walter L, Hurt P, Himmelbauer H, Sudbrak 

R & Günther E (2002). Cloning of the major 

histocompatibility complex class II and class 

III regions of the rat. Immunogenetics 54:268- 

275 

21. Greber B, Lehrach H & Himmelbauer 

H* (2003). Characterization of trimethylpsoralen 

as mutagen for mouse embryonic 

stem cells. Mutation Res 525: 67-76 

22. Shima A, Himmelbauer H, Mitani H, 

Furutani-Seiki M, Wittbrodt J & Schartl M 

(2003). Fish genomes flying. EMBO Reports 

4:121-125. 

23. Abiola O, Angel JM, Avner P, Bachmanov 

AA, Bennett B, Blankenhorn EP, Blizard DA, 

Bolivar V, Brockmann GA, Casley WL, Cook 

M, Buck KJ, Bureau J-F, Chesler EJ, Cheverud 

JM, Churchill GA, Crabbe JC, Crusio WE, 

Darvasi A, Demant P, Doerge RW, Elliott RW, 

Farber CR, Flint J, Gershenfeld H, Gibson JP, 

Gu W, de Haan G, Himmelbauer H, Hitzemann 

R, Hunter K, Hsu H-C, Iraqi F, Jansen RC, 

Johnson TE, Kempermann G, Lammert F, Lu 

L, Manly KF, Matthews DB, Medrano JF, 

Mehrabian M, Mittleman G, Mock BA, Mogil 

JS, Montagutelli X, Morahan G, Mountz JD, 

Nagase H, Nowakowski RS, O’Hara BF, 

Osadchuk AV, Paigen B, Palmer AA, Peirce JL, 

Pomp D, Rosen GD, Rosemann M, Schalkwyk 

LC, Seltzer Z, Settle S, Shimomura K, Shou S, 

Sikela JM, Siracusa LD, Spearow JL, Teuscher 

C, Threadgill DW, Toth LA, Toye AA, Vadasz 

C, Wakeland E, Williams RW, Van Zant G, 

Zhang H-G, Zou F & Flaherty L (2003). A 

community’s view on the nature and identification 

of quantitative trait loci. Nature Reviews 


Teaching 

Computing for molecular biologists, 1 SWS, 

Salzburg University, Austria, WS 1998/99, SS 

1999, WS 1999/00, SS 2000, WS 2000/01, 

SS 2001, WS 2001/02, SS 2002, WS 2002/ 

03, SS 2003 

State doctorate (Habilitation) 

Heinz Himmelbauer: Die Maus als Forschungsobjekt 

und Modellsystem für biologische 

Fragestellungen in der Genomforschung. 

Habilitationsschrift, Faculty of 

Natural Sciences, University of Salzburg, Austria, 

1999 

Theses 

Christina Nock (2001): Vom Genom zum 

Proteom. Genetische und physikalische 

Kartierung von Gehirnproteinen der Maus. 

PhD Thesis, Freie Universität Berlin. H. 

Himmelbauer co-supervisor with J. Klose. 

Christoph Campregher (2003): Chemische 

Mutagenese embryonaler Mausstammzellen 

und Entwicklung eines Nachweisverfahrens 

für Nonsensemutationen. Diploma Thesis, Faculty 

of Natural Sciences, University of Salzburg, 

Austria 

Visiting scientists 

Jiri Forejt, Czech Academy of Sciences, 

Prague, Apr.-May 1999 

Petr Jansa, Czech Academy of Sciences, 

Prague, Sept. 2001-Jan 2002 

Yaniv Bledi, Hebrew University, Jerusalem, 

Sept. 2003 


Core area of the German National Genome 

Research Network, Platform 5/4: Chemical 

mutagenesis of mouse ES-cells and molecular 

characterization of induced mutations, 

2001-2004 

Human Frontier Science Program (HFSP): 

Systematic molecular and genetic analysis of 

lens-retina interactions in vertebrates, 2001- 

2004 

BioProfile: Humanised mouse models for 

xenobiotics metabolizing enzymes, 2003-2006 

FP6-2003-LIFESCIHEALTH-I: Functional 

Genomics in engineered ES cells (FunGenEs), 

2004-2007 

Selected national co-operations 

Joachim Klose, Humboldt University, Berlin 

Wolfgang Wurst, GSF, Munich 

Peter Nürnberg & H-C Hennies, MDC Berlin 

Norbert Hübner & Detlev Ganten, MDC, Berlin 

Lutz Walter & Eberhard Günther, University 

of Göttingen 

Dieter Weichenhan & Heinz Winking, Medical 

University of Lübeck

Jochen Wittbrodt, EMBL, Heidelberg 

Manfred Schartl, Biozentrum Würzburg 

Walter Meinl & Hans-Rudolf Glatt, DIfE, 

Potsdam 

Selected international co-operations 

Myriam Hemberger & James Cross, University 

of Calgary, Canada 

Marc Zabeau, University of Gent, Belgium 

Reinald Fundele, University of Lund, Sweden 

Leo Schalkwyk, University College London, 

UK 

Jiri Forejt, Czech Academy of Sciences, 

Prague, Czech Republic 

Takashi Shiina & Hidetoshi Inoko, Tokai University, 

Kanagawa, Japan 

Makoto Furutani-Seiki & Hisato Kondoh, Japan 

Science and Technology Corporation, 

Kyoto, & Osaka University, Japan 

Takashi Sasaki, Shuichi Asakawa & 

Nobuyoshi Shimizu, Keio Medical School, 

Tokyo, Japan 

Hiroshi Mitani & Akihiro Shima, Tokyo University, 

Japan 



29


30 

Genetic Variation, Haplotypes & Genetics 

of Complex Disease Group 

Head: 

Margret Hoehe, MD, PhD 

The group was established in 2002. 

Scientist: 

Bernd Timmermann, Dipl.Biol. 

Introduction 

Haplotype-based approaches to all phases of disease gene discovery have gained a 

central role in genetic analysis. In particular, the systematic analysis of candidate genebased 

haplotypes is a key step common to all strategies of disease gene identification. 

Candidate gene sequences have to be compared in large numbers of patients and controls 

in order to identify those specific sequence variants associated with the disease. 

In that, haplotype-based approaches to candidate gene analysis are mandatory, because 

only the correct determination of the specific combinations of given gene sequence 

variants as they occur separately on each of the two chromosomes of an individual 

will allow establishment of correlations between genetic variation, gene function, 

dysfunction, and disease phenotype. 


We have developed approaches and technologies in order to 

1) compare candidate gene sequences systematically at large scale (“Multiplex 

Sequence Comparison”, high throughput capillary sequencing) 

2) determine the molecular haplotypes 

3) predict haplotypes in silico, specifically the most likely haplotype pairs for each 

genotype in a given sample 

4) perform classification of haplotypes to reduce haplotype complexity and extract 

genetic risk haplotypes against a background of high genome sequence diversity. 

In the process of research, development and production, we have systematically analysed 

more than thirty candidate genes of relevance for several common, complex diseases 

in an average of about 300 individuals, one of the largest bodies of comparative sequence 

data (more than 25 finished Megabases of sequence), and the greatest depth of 

sequence analysis reached to date. This body of data allows addressing important questions 

regarding linkage disequilibrium and haplotype structures given in genomic regions 

and candidate gene segments, respectively, at the ultimate level of resolution. 

This has important implications for all approaches to haplotype-based disease gene 

discovery. The analysis of haplotype/genotype-phenotype relationships is presently 

being addressed in national and international collaborations (J. Ott, Rockefeller University, 

K.K. Kidd, H. Zhao, Yale University, K. M. Weiss, Penn State University, R. Shamir, Tel Aviv 

University/Weizmann-Institute, J. Reich, K. Rohde, Max-Delbrück-Center, A. Ullrich, Max 

Planck Institute for Biochemistry, R. Reinhardt, Max Planck Institute for Molecular Genetics). 

Present work / future developments / co-operations 

In this context, approaches to a) cope with the multiplicity of haplotypes through various 

approaches to haplotype classification, b) analyse all genes simultaneously for 

association with phenotype, c) analyse haplotype-haplotype and gene-gene-environment 

interactions are being developed and applied. Moreover, comparative sequence 

analyses of novel candidate genes are carried out in order to identify genetoc risk 

patterns for complex disease. First significant results on potential genetic risk profiles 

for diseases have been obtained.



Branson R, Potoczna N, Kral JG. Lentes KU, 

Hoehe MR, Horber FF (2003). Binge eating 

as a major phenotype of melanocortin 4 receptor 

gene mutations. N Engl J Med 

348(12):1096-103 

Burgtorf C, Kepper P, Hoehe M, Schmitt C, 

Reinhardt R, Lehrach H, Sauer S (2003). 

Clone-based Systematic Haplotyping (CSH) 

– a procedure for physical haplotyping of 

whole genomes. Genome Res (in press) 

Franke P, Wendel B, Knapp M, Schwab SG, 

Neef D, Maier W, Wildenauer DB, Hoehe MR 

(2003). Introducing a new recruitment approach 

to sample collection for genetic association 

studies in opioid dependence. Eur Psychiatry 

18(1):18-22 

Hoehe MR (2003). Haplotypes and the systematic 

analysis of genetic variation in genes 

and genomes. Pharmacogenomics 4(5):547- 

70 

Hoehe MR (2003). Individuelle Genomanalyse 

als Basis neuer Therapiekonzepte. In: Das 

genetische Wissen und die Zukunft des Menschen. 

De Gruyter, Berlin, New York, 301-317 

Hoehe MR, Timmermann B, Lehrach H 

(2003). Human inter-individual DNA sequence 

variation in candidate genes, drug targets, the 

importance of haplotypes and pharmacogenomics. 

Curr Pharm Biotechnol (in press) 

Wenzel K, Felix SB, Flachmeier C, Heere P, 

Schulze W, Grunewald I, Pankow H, Hewelt 

A, Scherneck S, Bauer D, Hoehe MR (2003). 

Identification and characterization of KAT, a 

novel gene preferentially expressed in several 

human cancer cell lines. Biol Chem 384(5): 

763-75 

Busjahn A, Freier K, Faulhaber HD, Li GH, 

Rosenthal M, Jordan J, Hoehe MR, Timmermann 

B, Luft FC (2002). Beta-2 adrenergic 

receptor gene variations and coping styles in 

twins. Biol Psychol 61(1-2):97-109 

Herrmann SM, Nicaud V, Tiret L, Evans A, 

Kee F, Ruidavets JB, Arveiler D, Luc G, 

Morrison C, Hoehe MR, Paul M, Cambien F 

(2002). Polymorphisms of the beta2 - 

adrenoceptor (ADRB2) gene and essential 

hypertension: the ECTIM and PEGASE studies. 

J Hypertens 20(2):229-35 

Hoehe MR, Timmermann B, Lehrach H 

(2002). Haplotypen und die systematische 

Analyse genetischer Variation: Krankheitsgene, 

“Drug Targets” und Pharmakogenomik. 

Biospektrum Special Issue 8:478-485 

Patkar AA, Berrettini WH, Hoehe MR, 

Thornton CC, Gottheil E, Hill K, Weinstein 

SP (2002). Serotonin transporter polymorphisms 

and measures of impulsivity, aggression, 

and sensation seeking among African- 

American cocaine-dependent individuals. Psychiatry 

Res 110:103-115 

Patkar AA, Berrettini WH, Hoehe MR, Hill 

K, Gottheil E, Thornton CC, Weinstein SP 

(2002). No associations between polymorphisms 

in the serotonin transporter gene and 

susceptibility to cocaine-dependence among 

African-American individuals. Psychiatr Genet 

12:161-164 

Schmidt LG, Samochowiec J, Finckh U, 

Fiszer-Piosik E, Horodnicki J, Wendel B, Rommelspacher 

H, Hoehe MR (2002). Association 

of a CB1 cannabinoid receptor gene 

(CNR1) polymorphism with severe alcohol dependence. 

Drug Alcohol Depend 65(3):221-4 


MRH and BT have been supported by a 

grant (01GR0155) from the BMBF (Federal 

Ministry for Education and Research) 

to MRH as part of the German National 

Genome Research Network (NGFN) 

Core. In addition, MRH has been allocated 

one position for a graduate student for 

three years from the BMBF BioProfile 

Programme. MRH has received some support 

from pharmaceutical industry for phenotypic 

characterization of patients. 



31


32 

Oligofingerprinting / Cell Arrays Group 

Scientists: 

Dr. Anna Guerasimova 

Dr. Dominique Vanhecke 


Andrea Fiebitz 

Yuhui Hu 


The main research focus of the group comprises high-throughput functional genomics and 

genome-wide expression analysis using transfected-cell array (TCA) and oligonucleotide fingerprinting 

(ONF) technologies, respectively. In the field of functional genomics we optimised 

and further developed a cell array platform based on the reverse transfection process (Figure 1). 

Briefly, full-length open reading frames of genes inserted in expression vectors are printed at a 

high density on a glass slide along with a lipid transfection reagent using a robotic arrayer. 

Densities of up to 8000 spots per standard slide could be achieved. When the microarray of 

DNA constructs are covered with a layer of adherent cells only the cells growing on top of the 

DNA spots become transfected, resulting in the expression of specific proteins in spatially 

distinctive groups of cells. The phenotypic effects 

of this ‘reverse transfection’ of hundreds 

or thousands of genes can be detected using 

specific cell-based bioassays, e.g. immunofluorescence 

(Figure 2) or induction of apoptosis. 

At the moment we are focused on the development 

of three applications using TCA: 

Figure 1: Schematic presentation of the 

principles of the transfected-cell array technique. 

Head: 

Dr. Michal Janitz 

Fabeckstr. 60-62 

14195 Berlin 

Phone: +49 (0)30-8413 1486 

Fax: +49 (0)30-8413 1462 

Email: janitz@molgen.mpg.de 

Technicians: 

Nadine Scholz-Neumann 

Irina Girnus 

Sabine Thamm 

Cellular localisation of the proteins 

Taking advantage of transfection of hundreds 

different cDNAs in parallel using the transfection 

array we are able to determine 

localisation of the expressed proteins in a highthroughput 

manner using a microscope. By 

evaluation of the transfected cells forming a 

single spot we can determine whether the protein 

expressed from the transfected cDNA 

localises in the nucleus, cytoplasm or is transported 

to the cellular membrane.

THETA – Two Hybrid Transfected-cell Array 

By combination of the transfected-cell technology with the mammalian two hybrid system 

we have developed a powerful tool for screening of the whole cDNA libraries in a 

search for proteins interacting with the selected gene product used as a bait. In contrast to 

other high throughput two hybrid platforms THETA is performed using mammalian cells. 

Thus, interactions based on post-translational modifications can also be detected. 

RITA – RNA Interference Transfection Array. 

A high-throughput tool for loss-of-function studies in mammalian cells 

In this project we developed a high-throughput approach, an RNA Interference Transfection 

Array (RITA), for loss-of-function studies in mammalian cells. RITA combines reverse 

transfection array technique with recently developed RNA interfence technology 

based on a usage of short interfering RNA for transient or stable gene silencing. We 

envisage establishment of RITA technique for a number of cell lines and primary cells 

representing different physiological compartments of the organism, in which genes comprising 

for example entire signal transduction pathways can be silenced in a single experiment. 

Thus, RITA will represent a powerful alternative tool to in vivo knockout studies 

allowing for substantial reduction of experimental animal usage. 

Oligonucleotide fingerprinting is a highly parallel and very efficient method to analyse cDNA 

libraries and to select shotgun clones prior to genomic sequencing with reduced redundancy. 

The oligofingerprinting approach provides a powerful tool, a non-redundant cDNA clone set 

(unigene set), for gene expression studies. One of the advantages of this method is an immediate 

availableness of individual clones, which have been arrayed for high-throughput screening. 

Thus, any clone of interest can immediately be further analysed by classical molecular biology 

methods such as Northern hybridization, TaqMan assay and others. Furthermore, 

oligofingerprinting allows to select for non-redundant cDNA clones, which are tissue- and cellspecific. 

Therefore, cell-type specific unigene sets can be used for studies where very subtle 

differences in gene expression need to be detected, e.g. in particular subtypes of T helper cells. 

We have performed several oligofingerprinting projects related to establishment of unigene sets 

specific for murine T helper cells subpopulations, normal cattle brain for gene expression profiling 

studies during onset and development of BSE as well as establishment of the unigene sets 

from different organs of sugar-beet. 

Recently we also took an effort to increase the 

robustness and cost-effectiveness of the ONF 

approach. The applied strategy comprises development 

of parallel micro (nano)-dispensing 

device and high sensitivity CCD-based 

detection system (in co-operation with the 

Automation group MPI, Lajos Nyarsik). Moreover, 

we established a new hybridization protocol 

using fluorescent, instead of radioactive, 

oligonucleotide probes as well as applying new 

protocol for target clone preparation. 

Future research will be focused on development 

of the TCA technology for the variety of 

cell types representing different compartments 

of the body in order to investigate cell-type spe- 

Figure 2. An example of the signal detection for 

transfected cell array. Expression plasmid 

containing Green Fluorescence Protein (GFP) has 

been spotted in 8x8 spot blocks and subsequently 

reverse transfected in an array format into the 

HEK cell line. Green fluorescence signal indicates 

cells expressing GFP. Cells covering the area 

outside of the spots remain negative for GFP. 

cific effects influencing gene expression. Moreover, we have recently initiated a project toward 

optimisation of the cell array for non-adhesive cells e.g. T lymphocytes with the aim to extend 

applicability of the TCA to blood cells. Regarding oligofingerprinting, our long-term goal is to 

develop this technology toward its application for re-sequencing of any genome for the cost and 

time requirements highly competitive to the current DNA sequencing methods. 



33


34 



Malecova B, Ramser J, O’Brien JK, Janitz 

M, Judova J, Lehrach H & Simuth J (2003). 

Honeybee (Apis mellifera L.) mrjp gene family: 

computational analysis of putative promoters 

and genomic structure of mrjp1, the gene 

coding for the most abundant protein of larval 

food. Gene 303:165-75 

Vanhecke D, Fiebitz A, Wagner F, Girnus I, 

Scholz-Neumann N, Lehrach H & Janitz M 

(2003). A high throughput mammalian two 

hybrid system for the detection of T helper specific 

signal transduction molecules. Clin 

Immunol Suppl 1: S144 

Bauer O, Janitz M, Guerasimova A, Herwig 

R, Lehrach H & Radelof U (2002). OFP - Oligonucleotide 

fingerprinting. In Analysing Gene 

Expression. A Handbook of Methods: Possibilities 

and Pitfalls. Lorkowski S & Cullen P 

eds., Wiley-VCH, Weinheim, pp. 463-471 

Guerasimova A, Nyarsik L, Girnus I, 

Steinfath M, Wruck W, Griffiths H, Herwig 

R, Wierling C, O’Brien J, Eickhoff H, Lehrach 

H & Radelof U (2001). New tools for oligonucleotide 

fingerprinting. Biotechniques 

31(3):490-5 

Janitz M, Reiners-Schramm L, Muhlethaler- 

Mottet A, Rosowski M & Lauster R (2001). 

Analysis of the sequence polymorphism within 

class II transactivator gene promoters. Exp 

Clin Immunogenet 18:199-205 

Guerasimova A, Ivanov I & Lehrach H 

(1999). A method of one-step enzyme labelling 

of short oligonucleotide probes for filter 

hybridisation. Nucleic Acids Res 27(2):703-5 

Janitz M, Reiners-Schramm L & Lauster R 

(1998). Expression of the H2-Ea gene is modulated 

by a polymorphic transcriptional enhancer. 

Immunogenetics 48(4):266-72 

Cowell LG, Kepler TB, Janitz M, Lauster R 

& Mitchison NA (1998). The distribution of 

variation in regulatory gene segments, as 

present in MHC class II promoters. Genome 

Res 8(2):124-34 

Janitz M, Heiser V, Bottcher U, Landt O & 

Lauster R (1998). Three alternatively spliced 

variants of the gene coding for the human bone 

morphogenetic protein-1. J Mol Med 76(2): 

141-6 

Theses 

A. Guerasimova: Novel experimental approaches 

to DNA characterisation by Oligonucleotide 

Fingerprinting: Application of Peptide 

Nucleic Acids. PhD Thesis, Free University 

of Berlin, 2000 

J. Illiger: Analyse der Genexpression von 

humanen T-Lymphocyten und Natural Killer- 

Zellen mittels Oligonucleotid Fingerprinting. 

PhD Thesis, Free University of Berlin, 2002 

O. Bauer: Multiplexed hybridizations of positively 

charge-tagged PNA detected by MALDI- 

TOF mass spectrometry. PhD Thesis, Free 

University of Berlin, 2003 

O. Bauer: Funktionelle Analyse differentiell 

exprimierter Gene in der Embryonalentwicklung 

von Danio Rerio. Diploma Thesis, Free 

University of Berlin, 2000 


BMBF / NGFN: Berlinflame – functional 

genomics of inflammatory chronic diseases. 

Subproject 4 in the frame of Infection and 

Inflammation Network of NGFN (BMBF). 1 

postdoc position funded, 2001 - 2004 

DHGP: Oligonucleotide fingerprinting by multiplex 

PNA hybridization and MALDI mass 

spectrometry detection. 1999 – 2004 

DHGP: Gene expression profiling in murine 

T cells for identification and functional analysis 

of T cell gene regulatory networks that are 

implicated in autoimmune diseases. 1999 - 

2004 

KWS: Establishment of the unigen sets for 

cDNA libraries derived from different organs 

of sugar beet. 1999 - 2002 

EU FP5: Establishing the resources for the examination 

of gene expression in cattle. 1999- 

2003 

EU FP5: Structural and functional genomics 

tools for cattle research. 2003-2005 

EU FP6: Advanced molecular tools for arraybased 

analyses of genomes, transcriptomes, 

proteomes, and cells. 2004 - 2006 

BMBF: Transfected-cell array-a high throughput 

tool for gene functional studies in mammalian 

cells as alternative to knockout and 

transgenic mouse studies. 2004 – 2007

Academical co-operations 

Andreas Radbruch, Deutsches Rheumaforschungszentrum 

Berlin 

Gerd-Rüdiger Burmester, Rheumatology 

Clinic, Charité, Humboldt University Berlin 

John Williams, Roslin Institute, UK 

Reinhold Kreutz, Institut für Klinische Pharmakologie 

und Toxikologie, Free University of 

Berlin 

Jörn Koch, Aarhus University, Denmark 

Anthony Brookes, Karolinska Institute, Sweden 

Dolores Cahill, Royal College of Surgeons, 

Ireland 

Steve Hawkins, Veterinary Laboratories 

Agency, UK 


Development of the RNA Interference Transfected-Cell 

Array, with Qiagen 

Oligofingerprinting of the sugar beet cDNA 

libraries, with KWS 



35


36 

Kinetic Modeling Group 

Head: 

Dr. Edda Klipp 

Phone: +49 (0)30-8413 1717 

Fax: +49 (0)30-8413 1380 

Email: klipp@molgen.mpg.de 

Scientist: 

Dr. Axel Kowald 

Students: 

Sebastian Schmeier 

Bente Kofahl 

Susanne Gerber 

The Kinetic Modeling Group was founded in late 2001, belongs to the Berlin Center 

of Genome-based Bioinformatics (BCB) and is supported by the BMBF. 


Mathematical modeling of complex biological phenomena and diseases is an important 

approach to combine the accumulating amount of data in biological investigations and the 

increasing qualitative understanding of cellular operation in a productive way. The realization 

of genomic information in a biological instance is ensured by a complex network 

of processes. The dynamic behavior of such processes can’t be understood intuitively. 

Only a comprehensive approach allows the understanding of complex system behavior 

like optimal regulation or adaptation. We use mathematical models to describe and investigate 

cellular processes and regulatory links from gene expression to metabolism. 

Projects 

Modeling of Signal Transduction in the yeast Saccharomyces cerevisiae 

Cells are able to react on changes in the environment. Receptor molecules sense the signals, 

several proteins transmit them and, eventually, the expression of several genes will 

be changed. Newly produced or quantitatively changed proteins allow for stress response, 

be it the production of protecting substances, the change in the intracellular medium, or 

the cell cycle arrest to prepare mating. Specific processes under investigation are the 

HOG (high osmolarity glycerol) and the pheromone pathway in yeast (papers in preparation). 

In co-operation with a Swedish experimentally group (Prof. S. Hohmann, Göteborg 

University) we model such processes by identifying individually steps and describing 

their dynamics with a system of ordinary differential equations. The systems behavior is 

analyzed, alternative models are developed, and computer simulations are performed. We 

can reproduce the experimentally observed system behavior in the model and make predictions 

for the behavior of mutants and for the outcome of experiments to be designed. 

Yeast is used as a model organism, since it is easy to handle and many data are already 

available. Signaling pathways are evolutionary highly conserved. From an experimental 

as well as from a modeling viewpoint, the developed techniques, the specific results and 

the art of interaction of modeling and experimental research can be applied to higher 

organisms, in order to arrive at a better understanding of the dynamic operation of those 

pathways and to offer new opportunities for drug discovery.

The investigation of signaling pathways as a coordinated attempt of theoretical and 

experimental groups will be further supported within the 6 th Framework Program of 

the EU based on the STREP “Quantifying signal transduction”, together with the groups 

of Stefan Hohmann, Sweden (co-ordinator), Gustav Ammerer, Austria, Francesc Posas, 

Spain, Matthias Peter, Switzerland, and Björn Fundberg, Sweden. 

Modeling of metabolic deviations in complex diseases 

The gene for the most important antioxidant enzyme, superoxid dismutase (SOD), lies in 

humans on chromosome 21 and its activity is increased in patients with Down syndrome. 

It catalyses the dismutation of superoxide radicals to hydrogen peroxide. But, counterintuitively, 

increased lipid peroxidation and an increased oxidative stress are associated 

with the increased SOD expression. With a modeling approach we investigate how the 

oxidative stress arises and how it changes the cellular balance. Furthermore, the relation 

between damage of mitochondria and aging is investigated. We tested different scenarios 

published in literature and identified an additional mechanism which agrees well with 

experimental observations (paper in preparation). 

Analysis of differential gene expression 

Based on the fact that biological entities are subject to evolution, publicly available gene 

expression pattern have been studied. A relation between the expression of genes and 

their function could be predicted from the postulate of optimal regulation (Liebermeister 

et al., 2003). For the response of yeast cells to glucose starvation a computational approach 

was used to predict temporal pattern of gene expression in the context of metabolic 

regulation (Klipp et al., 2002). 

Implementation of a Modeling- and Simulation Environment 

A computational environment for whole-cell-modeling is under development in co-operation 

with the Bioinformatics group (Ralf Herwig, Christoph Wierling) at our department 

at the MPIMG. The ambition is the automated generation of complex models for 

cellular processes (metabolism, gene expression, transport) under utilization of the potential 

of existing data bases (e.g. KEGG), which can be simulated or examined with analyzing 

tools. Currently, there is a working prototype, which allows the input of a model by 

various means (via user interface or as SBML (Systems Biology Markup Language) script). 

The simulation facility is based on the description of the dynamics with a set of ordinary 

differential equations. The output covers time curves and steady states as graphic or text. 

The analysis tool allows the scan over ranges of parameter values, the determination of 

the stability of steady states as well as a stoichiometric analysis of the system. 

Compared to available modeling tools our modeling and simulation environment is suited 

for data retrieval from the internet and data bases. It is the first step on the way to provide 

a modeling and data integration platform that (i) is able to manage large amount of data 

from diverse functional genomics platforms such as gene expression and protein expression 

data, sequence data, physiological data, (ii) can be used to manage the complexity 

and heterogeneity of the underlying data sources, and (iii) is able to generate hypotheses 

and models for disease processes in order to develop new drugs, diagnostics and therapies. 

Further development in this direction will be supported by he 6th EU Framework 

program, within the STREP “European modeling initiative combating complex diseases” 

together with the groups of Ron Shamir, Tel Aviv University, of Ewan Birney, European 

Bioinformatics Institute (Ensembl Group), and the SMEs LION Bioscience and 

MicroDiscovery. 

High-Throughput – Literature Search 

Understanding and modeling of biological systems relies on the availability of experimental 

results measuring chemical and physical properties and dynamic changes of the 

system. The use of appropriate kinetic parameters is crucial for successful performance of 

numerical simulations. Since there is no collection of preprocessed data for this purpose, 

but a huge amount of these data has been published in scientific journals, a comprehensive 

literature search is necessary. Together with the group of Prof. Ulf Leser (Humboldt 



37


38 

University) we develop an automatic recognition and extraction method, including textmining 

and statistical learning, for the classification of biochemical texts to detect relevant 

data. The long-term goal is the generation of a database containing kinetic information 

for enzymatic reactions and other cellular processes in a multitude of species, which 

can be used in the Modeling and Simulation Environment (Pybios) but also for individual 

modeling purposes. 



Liebermeister W, Klipp E, Schuster S & 

Heinrich R (2003). A theory of optimal differential 

gene expression. BioSystems ( accepted) 

Bakker BM, Assmus HE, Bruggeman F, 

Haanstra JR, Klipp E & Westerhoff H (2002). 

Network-based selectivity of antiparasitic inhibitors. 

Mol Biol Rep 29(1-2):1-5 

Klipp E, Heinrich R & Holzhütter H-G (2002). 

Prediction of temporal gene expression. Metabolic 

optimisation by re-distribution of enzyme 

activities. Eur J Biochem 269: 1-8 

Kowald A (2002). Lifespan does not measure 

ageing. Biogerontology 3(3): 187-190 

Liebermeister W (2002). Linear modes of 

gene expression, determined by independent 

component analysis. Bioinformatics 18:51-60 

Zintzaras E, Bouka P & Kowald A (2002). 

Biometrical evaluation of bioequivalence using 

a bootstrap individual direct curve comparison 

method. Eur J Drug Metabolism & 

Pharmacokinetics 27: 11-16 

Teaching 

Edda Klipp: Mathematische Modellierung von 

Stoffwechselprozessen und Genexpression, 2 

SWS, FB Mathematik und Informatik, 

Bioinformatik, FU Berlin, WS 02/03 

Axel Kowald (with P Hammerstein, M Hennig): 

Evolution of life histories, Block course, Institute 

of Biology, HU Berlin, SS 03 

Lectures in the lecture series Methods of Molecular 

Genetics at MPI-MG and Bioinformatics 

at BCB 

Theses 

Wolfram Liebermeister: Analysis of Optimal 

Differential Gene Expression, PhD Thesis, 

Institute of Biology/Theoretical Biophysics, 

Humboldt University Berlin, 5/2003. 

Co-supervision with Prof. Reinhart Heinrich, 

Institute of Biology, Theoretical Biophysics, 

Humboldt University Berlin 

Michael Rempel: Modellierung des pseudohyphalen 

Wachstums in Saccharomyces cerevisiae, 

Diploma Thesis, Dept. Biology, Chemistry, 

Pharmacy, Free University Berlin, 2/2002 

Sebastian Schmeier: Klassifizierung von 

biochemischen Texten mittels statistischer 

Lernverfahren, Bachelor Thesis, FB Mathematics 

and Informatics / Bioinformatics, Free 

University Berlin, 6/2003. Co-supervision with 

Prof. Ulf Leser, Dept. Computer Science, 


Co-operations 

Prof. Stefan Hohmann, Bodil Nordlander, Peter 

Gennemark, Yeast Centre Göteborg 

Dr. Barbara Bakker, Prof. Hans Westerhoff, 

BioCentrum Amsterdam 

Prof. Tom Kirkwood, University Manchester 

Prof. Reinhart Heinrich, Roland Krüger, 


Dr. Wilhelm Huisinga, Illya Horenko, Free 

University Berlin 

Dr. Ralf Herwig, Christoph Wierling, Prof. 

Hans Lehrach, MPI for Molecular Genetics, 

Dr. Harald Seitz, MPI for Molecular Genetics, 

Dr. Rainer Spang, MPI for Molecular Genetics, 

Prof. Ulf Leser, Jörg Hakenberg, Humboldt 

University Berlin

In vitro Ligand Screening Group 

Head: 

Dr. Zoltán Konthur 

Phone: +49 (0)30-8413 1586 

Fax: +49 (0)30-8413 1380 

Email: konthur@molgen.mpg.de 

Graduate student: 

Gisela Burguera-Hoek (since 5/03) 

Undergraduate student: 

Alexander Sternjak (1/02-1/03) 

Engineer: 

Jeannine Wilde 

Technician: 

Carola Stoschek 

Identification of binding partners by phage display 

Phage display is a well-established system, first reported in 1985 by G. P. Smith, which 

allows the screening of large recombinant molecule libraries for specific binders against 

virtually all types of target molecules, such as proteins, peptides, nucleic acids and chemical 

compounds. The technology is based on the simple but effective principle of physically 

linking the phenotype and the genotype, i.e. the protein and its encoding DNA. This 

is achieved by presenting the protein as a fusion molecule with one of the coat proteins of 

the bacteriophage harbouring the genetic information of the fusion molecule in its genome 

inside the virion capsid. By cloning different DNA-fragments into the phage genome, 

large libraries of different molecules can be generated and presented on the capsid 

surface that can be enriched for specific target binding in an affinity-driven in vitro selection 

process called biopanning. The most commonly applied phage display libraries consist 

of random peptide sequences, recombinant antibody fragments assembled from immunoglobulin 

heavy and light chain sequences of different species including human, and 

tissue specific cDNA expression product libraries. Hence, phage display can be used for 

the identification of artificial ligands (peptides and antibody fragments) and for the identification 

of natural binding partners specific for any given target molecule. 

Current work 

The current work of the group comprises two lines of major research interests: 

(1) The generation of a fast and cost effective pipeline for the isolation of artificial binders 

against given sets of proteins. 

(2) Identification of natural binding partners involved in immunological disorders by selecting 

interaction partners from phage displayed tissue or species-specific cDNA expression 

product libraries. 

(1) Pipeline for the generation of artificial binders 

We have set up a method for selecting specifically binding single chain antibody fragments 

(scFv) from phage display libraries in an automated fashion utilising a magnetic bead-handling 

robot in 96-well plate format (Walter et al., 2001; Konthur & Walter, 2002). During the process, 

specifically binding scFv’s were enriched on target molecules - tag-bound to magnetic beads. 

We were able to demonstrate this working principle on different types of molecules, such as 



39


40 

recombinant and natural proteins, peptides and small chemical compounds (Rhyner et al., 2003; 

Konthur et al., submitted). Interestingly, we found, that panning on the same target in folded and 

denatured form yields partially different antibodies, some recognising conformational epitopes 

only. These antibody fragments are of particular interest for in vivo diagnostic and therapeutic 

applications. 

Automating the selection process increases the general selection throughput, but also shifts the 

bottleneck of the selection pipeline further towards the isolation and evaluation of monospecific 

binders. Therefore, we are developing and testing different techniques for downstream characterization 

of selected antibody fragments. In collaboration with the protein group (J. Kreutzberger), 

we are investigating the use of protein microarrays as a tool for the elucidation of monospecificity 

of individual scFv’s (Konthur et al., unpubl.) and have established a multiplex assay format 

on protein microarrays called MIST (multiple spotting technique; Angenedt et al., 2003), which 

will allow the parallel testing of thousands of single scFv-expressing clones at a time. Also, in 

collaboration with J. Gobom, we are in the process of establishing a mass spectrometry-based 

assay format for the elucidation of antibody complexity in an enriched, target specific oligoclonal 

pool of antibody fragments by peptide mass fingerprinting. 

The successful implementation of these novel evaluation tools will greatly facilitate the scale-up 

of artificial binder selection to high-throughput in the future. The ultimate goal is to obtain large 

sets of artificial binders against given sets of proteins, such as all proteins encoded on the human 

chromosome 21, specific proteins of the human brain, oncoproteins and transcription factors (in 

collaboration with M.L. Yaspo, K. Büssow & B. Korn (RZPD), respectively). The artificial 

binders shall be used to generate binder arrays applicable in protein expression profiling. 

(2) Selection of natural binding partners 

We have established protocols for the identification of natural binding partners utilising M13 

and T7 phage displayed tissue and species specific cDNA expression product libraries. By 

panning these libraries on immunoglobulins (Ig) from sera of individuals with allergies and/or 

autoimmune diseases, we were able to identify novel allergens and autoantigens, which can be 

used for clinical diagnosis in future (Crameri et al., 2001). Since selections on complex mixtures, 

such as immunoglobulins, yield a large number of binding proteins, we have devised a 

DNA-array based method for the elucidation of gene complexity of the enriched library by 

consecutive rounds of hybridisation. For example, in collaboration with Prof. R. Crameri (Swiss 

Institute of Asthma and Allergy Research), we have enriched an Aspergillus fumigatus cDNA 

expression product library on patient IgE, picked ~ 13,000 single clones and identified additional 

60 novel allergens next to the 14 known allergens by less than 15 DNA-hybridisations 

(Kodzius et al., 2003). For the future, we envisage that monitoring the presence or absence of 

IgE recognising a set of allergens can be used for the fine-diagnosis of different clinical manifestations 

of Aspergillus fumigatus allergies. 

In addition to allergy research, we have applied cDNA expression product phage display screening 

to autoimmunity research in collaboration with Prof. G. Burmester and Dr. K. Skriner (Charité 

- Humboldt University, Berlin). By screening a human foetal brain cDNA library displayed on 

T7 phage, we have identified numerous novel autoantigens, which are now under further investigation. 

Ultimately, we would like to use this technology also in functional genomic applications 

for the identification of other than antibody-antigen interactions, such as protein-protein, 

protein-DNA and protein-chemical compound interactions. 

Future development and perspectives 

In future, we would like to extend our portfolio of in vitro ligand screening technologies by 

establishing other methods in the group, such as DNA aptamer technology (SELEX) and ribosome 

display. These technologies will complement limitations observed with phage display. 

The group is participating in numerous NGFN-2, EU FP6, and BMBF proposals.


Publications 1998 – 2003 

Crameri R, Rhyner C, Flückinger S, Konthur 

Z & Weichel M (2003). Identification of natural 

protein-protein interactions with cDNA libraries. 

In Phage Display in Biotechnology 

and Drug Discovery (SS Sidhu, ed.), Marcel 

Dekker, Inc. (in press) 

Konthur Z & Crameri R (2003). Highthroughput 

applications of phage display in 

proteomic analyses. TARGETS (in press) 

Rhyner C, Konthur Z, Blaser K & Crameri R 

(2003). Recombinant antibodies against recombinant 

allergens. Biotechniques 35:672- 

674 

Angenendt P, Glökler J, Konthur Z, Lehrach 

H & Cahill DJ (2003). 3D protein microarrays: 

performing multiplex immunoassays on a 

single chip. Anal Chem 75:4368-4372 

Kodzius R, Rhyner C, Konthur Z, Buczek 

D, Lehrach H, Walter G & Crameri R (2003). 

Rapid identification of allergen-encoding 

cDNA clones by phage display and high-density 

arrays. Combinat Chem & High-Throughput 

Screening 6:143-151 

Walter G, Büssow K, Konthur Z, Lueking A, 

Glökler J, Schneider U (2003). Array-based 

proteomics. In Encyclopedia of the Human 

Genome (DN Cooper, ed.), Nature Publishing 

Group, 182-187 


H, Walter G, Nordhoff E, Nyarsik L, Bussow 



Biochem Engineer/Biotech 77:103-112 

Kersten B, Bürkle L, Kuhn EJ, Giavalisco P, 

Konthur Z, Lueking A, Walter G, Eickhoff H 

& Schneider U (2002). Large-scale plant 

proteomics. Plant Mol Biol 48:133-141 

Konthur Z & Walter G (2002). Automation 

of phage display for high-throughput antibody 

development. TARGETS 1, 30-36 

Büssow K, Konthur Z, Lueking A, Lehrach 

H & Walter G (2001). Protein Array Technology: 

Potential use in Medical Diagnostics. Am 

J Pharmacogenomics 1:37-43 

Crameri R & Kodzius R (2001). The powerful 

combination of phage surface display of 

cDNA libraries and high throughput screening. 

Combinat Chem & High Throughput 

Screening 4:145-55 

Crameri R, Kodzius R, Konthur Z, Lehrach 

H, Blaser K & Walter G (2001). Tapping Allergen 

Repertoires by Advanced Cloning Technologies. 

Int Arch Allergy Immunol 124:43-47 

Lueking A, Konthur Z, Eickhoff H, Büssow 

K, Lehrach H & Cahill DJ (2001). Protein 

Microarrays - A Tool for the Post-Genomic 

Era. Curr Genomics 2:151-159 

Walter G, Konthur Z & Lehrach H (2001). 

High-throughput Screening of Surface Displayed 

Gene Products. Combinat Chem & 

High Throughput Screening 4:193-205 

Holt LJ, Büssow K, Walter G & Tomlinson 

IM (2000). By-passing selection: direct screening 

for antibody-antigen interactions using 

protein arrays. Nucleic Acids Res 28: E72 

Crameri R & Walter G (1999). Selective enrichment 

and high-throughput screening of 

phage surface-displayed cDNA libraries from 

complex allergenic systems. Combinat Chem 

& High Throughput Screening 2: 63-72 

Giege P, Konthur Z, Walter G & Brennicke 

A (1998). An ordered Arabidopsis thaliana 

mitochondrial cDNA library on high-density 

filters allows rapid systematic analysis of plant 

gene expression: a pilot study. Plant J 15:721- 

726 

Theses 

Alexander Sternjak, Search for Autoantigens 

in Rheumatoid Arthritis Utilising Automated 

T7 Phage Display, Diploma Thesis, Vienna 

University, Austria, 2003 (sponsored by Charité) 

Jeannine Wilde, Entwicklung einer neuen 

High-Throughput Methode zur Untersuchung 

auf Expression rekombinanter Proteine aus 

Genbibliotheken, Diploma Thesis, Technische 

Fachhochschule Berlin, 2001 

Patent 

Walter G, Konthur Z & Lehrach H. Method 

for high-throughput selection of interacting 

molecules. WO 0102554, 11. Januar 2001 


BerlInflame, TP D6, Immunomics in entzündlichen 

rheumatischen Erkrankungen 

Co-operations 

Prof. Dr. Xaver Baur, Hamburg University 

Prof. Dr. Harald Stein & Dr. Horst Dürkop, 

UKBF – Free University Berlin, co-operation 

in the context of the following SFBs: 

• SFB 449, TP B5, Strukturelle Grundlagen 

der Interaktionen des menschlichen 

Zellmembranmoleküls CD30 mit 

extra- und intrazellulären Liganden, 

1999-2001 



41


42 

• SFB 506, TP C8, CD30 als therapeutische 

Zielstruktur, 1997-2000 

• SFB 506, TP R9, Humane Antikörper- 

Fusionsproteine zur Therapie des diffusen 

Magenkarzinoms, 2000-2003 

Prof. Dr. Gerd Burmester & Dr. Karl Skriner, 

Charité, Humboldt University Berlin 

Prof. Dr. Reto Crameri, Swiss Institute of 

Asthma and Allergy Research (SIAF), Switzerland 

Prof. Dr. Hannelore Breitenbach-Koller, Paris- 

Lodron University Salzburg, Austria. 

Dr. Jens Coorssen, University of Calgary, 

Canada 

Dr. Sergei Tillib, Institute of Gene Biology 

RAN, Moscow, Russia

Neurodegenerative Disorders Group 

Head: 

Sylvia Krobitsch (since 2/02) 

Phone: +49 (0)30-8413 1351 

Fax: +49 (0)30-8413 1380 

Email: krobitsc@molgen.mpg.de 


Ute Nonhoff (since 5/02) 

Karolin Huckauf (since 9/02) 

Markus Ralser (since 7/03) 


Norbert Mehlmer (11/02-7/03) 

Students worker: 

Annika Quast (since 5/02) 

Dr. Anja Westram (since 10/02) 


The major focus of the group, established in 2002, is to identify pathogenic pathways 

underlying neurodegenerative disorders like spinocerebellar ataxia 2 (SCA2), which accounts 

for nearly 14% and 29% of autosomal dominant SCAs in Germany and Italy, 

respectively, and Parkinson´s disease (PD), the second most frequent neurodegenerative 

disorder. SCA2 is a member of the so-called polyglutamine disorder family that includes 

Huntington’s disease (HD), dentatorubral-pallidoluysian atrophy (DRPLA), spinal and 

bulbar muscular atrophy (SBMA) and spinocerebellar ataxia 1, 3, 6, 7, 12 and 17. The 

basic underlying mutation is an expansion of CAG repeats encoding polyglutamine in the 

respective disease-causing proteins, that otherwise do not share any homology. In PD 

different mutations in several genes are responsible for onset and progression of disease. 

Conformational changes of the disease-causing proteins are mainly responsible for the 

formation of abnormal protein deposits in different regions of the brain of affected 

humans leading to a specific neuropathology in each disorder and for the formation of 

abnormal protein-protein interactions. The processes leading to these abnormal protein 

deposits as well as the cellular function of the relevant proteins and their role and 

involvement in the whole cellular network are far from being entirely understood. 

Exploring cellular mechanisms underlying formation of these abnormal protein deposits 

is one necessary step to take, but in addition, elucidating the cellular function of 

the proteins is crucial to open new perspectives for the development of therapeutic 

strategies for these so far untreatable neurodegenerative disorders. 



43


44 

To gain comprehensive insights into the cellular function of ataxin-2 and the synucleins, 

the disease-causing proteins in SCA2 or PD, respectively, the yeast-2-hybrid system was 

exploited. The use of this system is a simple and fast method to detect protein-protein 

interactions in vivo. The proteins of interest (ataxin-2, synucleins) were screened against 

human fetal and adult brain libraries as well as against a yeast-2-hybrid array (in collaboration 

with Prof. Erich Wanker, MDC, Berlin). With these two approaches several interacting 

proteins have been identified. Strikingly, a few of them have been suggested to be 

involved in other neurodegenerative disorders like HD or Alzheimer´s disease. Therefore, 

we tested further proteins that are involved in Alzheimer’s disease, SCA3 or HD for 

protein interactions with the candidate proteins identified in the yeast-2-hybrid screens 

performed. Remarkably, for a few of these disease-causing proteins the same protein 

interactions were detected. The next challenge is to explore in more detail whether pathways 

exist that might be common or overlapping in polyglutamine disorders, Alzheimer´s 

disease or Parkinson´s disease by using the yeast-2-hybrid system, proteomics and 

bioinformatics. The identification of similar molecular mechanisms within neurodegenerative 

disorders will be extremely valuable for the development of therapeutic strategies 

and will speed up the process of discovering and developing new therapeutics for these so 

far untreatable disorders. 


Diploma thesis 

Markus Ralser, Identifizierung von Interaktionspartnern 

von Ataxin-2, University of 

Salzburg, Austria, 4/02–5/03 

Rotation students (6-8 weeks interns) 

Dr. Anja Westram, FU Berlin, 2002 

Norbert Mehlmer, University of Salzburg, 2002 

Anne Nehring, FU Berlin, 2003 

Franziska Welzel, FU Berlin, 2003 

Anja Röhle, FU Berlin, 2003 

Christina Gruber, University of Salzburg, 2003 

School students (2 weeks interns) 

Marit Zach, 2003 

Hannah-Sophia Ziehe, 2003 

Annika Abraham, 2003 

Jutta Klempert-Bock, 2003 (3 months) 

Co-operations 

Yeast-2-hybrid system, with Prof. Erich 

Wanker, Max-Delbrück Center for Molecular 

Medicine, Berlin, Germany 

Huntington´s disease; mouse models, with 

Prof. Gillian Bates, GKT School of Medicine, 

King´s College, London, England 

Alzheimer´s disease; mouse models, with PD 

Dr. Thomas Bayer, Department of Psychiatry, 

Division of Neurobiology, University of the 

Saarland Medical Center, Homburg/Saar, Germany 

Spinocerebellar ataxia 2, with 

• Prof. Thomas Lengauer, Max-Planck 

Institute for Informatics, Saarbrücken, 

Germany 

• Prof. Friedrich Altmann, Institute for 

Chemistry, University of Natural 

Resources and Applied Sciences, Vienna, 

Austria 

Spinocerebellar ataxia 2, Parkinson´s disease, 

with Prof. Bernd Groner, Georg Speyer Haus, 

Institute for Biomedical Research, Frankfurt, 

Germany

Automation Group 


Serguei Baranov 

Tatiana Borodina 

Martin Kerick 

Andreas Dahl 

Engineers: 

Thomas Przewieslik 

Thomas Nitsche 

Matthias Lange 

Ninette von der Dellen (biotech engineer) 

Head: 

Dr. Wilfried Nietfeld 

Phone: +49 (0)30-8413 1405 

Fax: +49 (0)30-8413 1128 

Email: nietfeld@molgen.mpg.de 

Dr. Claus Hultschig 

Dr. Lajos Nyarsik 

Dr. Aleksey Soldatov 

Dr. Holger Eickhoff (untill 04/2001) 

Scientists: 

Dr. Eckehard Kuhn 

Dr. Claudia Schepers 

Dr. Ingo Fritz 

Dr. Lukas Bürkle 

Dr. Wolfram Brenner 

Technicians: 

Andres Hirsch 

Corinna Kober-Eisenmann 

Antje Krüger 

Nicole Greiner 

Anne Zergiebel 

Regine Schwartz 

Elisabeth Socha 

Guest scientist: 

Prof. Dr. Tarso B. Ledur Kist 

Instituto de Biociencias e PPGBCM do Centro 

de Biotecnologia, Porto Alegre, Brasil (funded 

by DAAD, 12/02-11/03) 

Scientific Overview 

Automation and miniaturization of biological procedures and routines provide the basis 

for a genome wide analysis of the transcriptome and proteome and are essential prerequisites 

for a functional understanding of biological processes. 

In close co-operation with partners from industry and academia, the Automation Group 

pioneered the development of detection devices, novel protocols, robots, robot control 

software, and automation concepts for analyzing the function of all genes of a genome 

and is one of the leading groups in functional genomics and automation technology. Several 

of the patented technologies are licensed by different companies for commercialization 

or were directly used to found spin-off companies e.g. GPC-Biotech AG, Scienion 

AG. The different platforms are constantly improved and adjusted to advanced protocols. 

The most important published achievements have been: 

1) The development of a fully automated multicapillary electrophoresis instrument for 

the high throughput DNA analysis (Behr et al., 1999). This technology was transferred 

after patenting (US 09/701,908) to CyBio AG, Jena. 

2) The generation and application of normalized cDNA libraries for expression profiling 

of different tissues (Eickhoff et al., 2000). 



45


46 

3) The development of protein microarrays and their use for gene expression and antibody 

screening (Luecking et al., 1999) 

4) A new cost and time effective SNP (Single Nucleotide Polymorphism) -detection method 

was developed (European patent applications No. 03008653.2 and No.03019521.8 ) and 

successfully applied for SNP-detection on Arabidopsis and human genomic DNA. The 

method requires no locus specific optimization and allows performing parallel analysis of 

a number of loci on the same sample of genomic DNA. 

Affiliations 

The Automation Group is affiliated as the German Core Center for CATMA/Arabidopsis 

resources (http://www.catma.org), for the NGFN core area platform 2, and the BerlInflame 

project for microarray fabrication. 

Ongoing method and technology development 

The in-house developed control software, printing tools, and robots for fabricating arrays 

on nylon membranes were further optimised and subsequently used for the creation of 

DNA and protein arrays on both filter and chip basis. Both types of DNA arrays have 

been used heavily in a number of expression analysis projects both on projects carried out 

within the department, as well as in a number of collaborations. 

In addition to the the well-established robotic systems originally developed within the 

department, commercial microarray devices have been developed further in terms of accuracy, 

robustness, and flexibility. Among other aspects, this has required the development 

of new control software (in collaboration with Scienion), and has allowed routine 

high-throughput fabrication of high density DNA microarrays. Currently, more than 80 

DNA microarrays - presenting more than 50,000 DNA probes - are spotted in less than six 

days. The arrays manufactured with this novel set-up are designed for automated image 

analysis. All microarrays are evaluated prior to their use for analyzing the transcriptome 

of valuable samples. In addition novel protocols for accelerated DNA probe generation 

were established, reducing the price of DNA microarray experiments by a factor of five or 

more. These procedures and modified robots are currently used in the generation of genome 

wide human and murine DNA Microarrays (ENSEMBL chips, in collaboration 

with the group of Marie-Laure Yaspo and the RZPD) as well as a number of project 

specific, customized DNA microarrays. These microarrays are used in different projects 

outlined below. In close co-operation with the Bioinformatics Group we are currently 

establishing a software system for automated Image analysis and evaluation. In addition, 

protein and peptide arrays have been constructed and used in co-operation to study different 

protein-protein interactions in more detail. 

Development of novel technologies 

Parallel to microarray applications, alternative technologies are adapted for high throughput 

transcriptome analysis. We have started to develop a novel nanowell technology platform 

for versatile multifunctional applications e.g. for PCR reactions in volumes below 

50 nl. New, sophisticated equipments and technologies are currently established for liquid 

handling in nanoliter range or processing and detection in nanowell formats. The main 

aim of our miniaturisation concepts is the reduction of costs and sample requirements for 

large-scale applications. The nanowell technology is currently being established and will 

focus on high throughput analysis in gene expression profiling (real time PCR, in collaboration 

with the groups of Silke Sperling and Marie-Laure Yaspo), oligonucleotide fingerprinting 

(in collaboration with the group of M. Janitz) and SNP genotyping. For this, a 

novel, high throughput protocol for SNP scoring based on optical detection has been 

developed. To complement the technology platforms, we have started the development of 

alternative labeling methods for RNA and proteins relying on nanoparticles of different 

sizes. In comparison to the well-established fluorophores, these particles are more resistant to 

photobleaching and more differently labeled samples can be analyzed in parallel (multiplexing).

In addition, novel methods for the immobilization of DNA on non-modified glass have 

been established to be able to further reduce the cost of fabricating DNA arrays. We also 

anticipate with this novel approach a directed, ordered immobilization of double stranded 

DNA, providing the basis for studying DNA-Protein interactions. 

Application of the developed novel methods& technologies 

In different internal and external co-operations, these different technologies are applied for 

analysing changes in the gene expression pattern associated with disease. A variety of different 

diseases such as Down syndrom (Trisomy 21, collaboration with M. L. Yaspo), neurodegenerative 

diseases such as stroke (K.-A. Hossmann), Alzheimer’s disease (U. Müller), Parkinson’s disease 

(E. Wanker), Rheumatoid Arthritis (T. Häupl & B. Stuhlmüller), different types of inflammatory 

diseases (S. Schreiber) and infections (S. Kaufmann & H. – J. Mollenkopf), heart disease 

(P. Ruiz), Adipositas (S. Engeli), and Diabetes (R. Cox) are studied. In addition, genetic 

changes due to environmental factors are being analyzed in Arabidopsis (M. Kuiper) and in 

different bacteria, e.g. Pirellula sp. str.1. 

Outlook 

In the future, we expect to develop novel methods for analyzing protein-protein or protein-DNA 

interactions. Among other technologies the use of peptide arrays will be expanded 

and suitable robots for high-throughput fabrication of these arrays will be developed. 

In addition, arrays of synthetic chemical components will be fabricated with novel 

arraying robots that will be developed. These novel arrays will be used in the context of 

chemical genomics, e.g. for deriving inhibitors specific for certain types of kinases. 



Borodina TA, Lehrach H & Soldatov AV 

(2003). DNA purification on homemade silica 

spin-columns. Anal Biochem 321(1):135-7 

Borodina TA, Lehrach H & Soldatov AV 

(2003). Ligation-based synthesis of oligonucleotides 

with block structure. Anal Biochem 

318(2):309-13 

Crowe ML, Serizet C, Thareau V, Aubourg S, 

Rouze P, Hilson P, Beynon J, Weisbeek P, van 

Hummelen P, Reymond P, Paz-Ares J, Nietfeld 

W & Trick M (2003). CATMA: a complete 

Arabidopsis GST database. Nucleic Acids Res 

31(1):156-8 

Nabirochkina E, Georgieva S, Krasnov A & 

Soldatov A (2002). Rapid construction of sequencing 

templates by random insertion of 

antibiotic resistance genes. Biotechniques 

32(2):300-304 

Endlich N, Sunohara M, Nietfeld W, Wolski 

EW, Schiwek D, Kränzlin B, Gretz N, Kriz 

W, Eickhoff H & Endlich K (2002). Analysis 

of Differential Gene Expression in Stretched 

Podocytes: Osteopontin Enhances Adaptation 

of Podocytes to Mechanical Stress. FASEB J 

16(13):1850-2 


H, Walter G, Nordhoff E, Nyarsik L & Bussow 



Biochem Eng Biotechnol 77:103-12 

Schmidt F, Lueking A, Nordhoff E, Gobom J, 

Klose J, Seitz H, Egelhofer V, Eickhoff H, 

Lehrach H & Cahill DJ (2002). Generation of 

minimal protein identifiers of proteins from 

two-dimensional gels and recombinant proteins. 

Electrophoresis 23(4):621-5 

Kersten B, Burkle L, Kuhn EJ, Giavalisco P, 



proteomics. Plant Mol Biol 48(1-2):133-41 

Daiber A, Nauser T, Takaya N, Kudo T, Weber 

P, Hultschig C, Shoun H & Ullrich V 

(2002). Isotope effects and intermediates in the 

reduction of NO by P450(NOR). J Inorg 

Biochem 88:343-52 

Weinbauer MG, Fritz I, Wenderoth DF & 

Höfle MG (2002). Simultaneous extraction 

from bacterioplankton of total RNA and DNA 

suitable for quantitative structure and function 

analyses. Appl Environ Microbiol 68(3): 

1082-7 



47


48 

Soldatov AV, Nabirochkina EN, Georgieva 

SG & Eickhoff H (2001). Adjustment of transfer 

tools for the production of micro- and 

macroarrays. Biotechniques 31(4):848 - 854 

Georgieva S, Nabirochkina E, Dilworth FJ, 

Eickhoff H, Becker P, Tora L, Georgiev P & 

Soldatov A (2001). The Novel Transcription 

Factor e(y)2 interacts with TAF(II)40 and Potentiates 

Transcription Activation on Chromatin 

Templates. Mol Cell Biol 21(15): 5223-31 

Thimm T, Hoffmann A, Fritz I & Tebbe CC 

(2001). Contribution of the Earthworm Lumbricus 

rubellus (Annelida, Oligochaeta) to the 

Establishment of Plasmids in Soil Bacterial 

Communities. Microb Ecol 41(4): 341-351 

Mueller U, Nyarsik L, Horn M, Rauth H, 

Przewieslik T, Saenger W, Lehrach H & 

Eickhoff H (2001). Development of a technology 

for automation and miniaturization of 

protein crystallization. J Biotechnol 85(1):7-14 

Herzel H, Beule D, Kielbasa S, Korbel J, Sers 

C, Malik A, Eickhoff H, Lehrach H & 

Schuchhardt J (2001). Extracting information 

from cDNA arrays. Chaos 11(1):98-107 

Nordhoff E, Egelhofer V, Giavalisco P, 

Eickhoff H, Horn M, Przewieslik T, Theiss 

D, Schneider U, Lehrach H & Gobom J (2001). 

Large-gel two-dimensional electrophoresismatrix 

assisted laser desorption/ionizationtime 

of flight-mass spectrometry: an analytical 

challenge for studying complex protein 

mixtures. Electrophoresis 22(14):2844-55 

Guerasimova A, Nyarsik L, Girnus I, Steinfath 

M, Wruck W, Griffiths H, Herwig R, Wierling 

C, O’Brien J, Eickhoff H, Lehrach H & 

Radelof U (2001). New tools for oligonucleotide 

fingerprinting. Biotechniques 31(3):490-5 

Georgieva S, Kirschner DB, Jagla T, Nabirochkina 

E, Hanke S, Schenkel H, de Lorenzo C, 

Sinha P, Jagla K, Mechler B, Tora L (2000). 

Two novel Drosophila TAF(II)s have homology 

with human TAF(II)30 and are differentially 

regulated during development. Mol Cell 

Biol 20(5):1639-48 

Schuchhardt J, Beule D, Malik A, Wolski E, 

Eickhoff H, Lehrach H & Herzel H (2000). 

Normalization strategies for cDNA microarrays. 

Nucleic Acids Res 28(10):E47 

Schürenberg M, Lübbert C, Eickhoff H, 

Kalkum M, Lehrach H & Nordhoff E (2000). 

Prestructured MALDI-MS sample supports. 

Anal Chem 72(15):3436-42 

Schreiber S, Hampe J, Eickhoff H & Lehrach 

H (2000) Functional genomics in gastroenterology. 

Gut 47(5):601-7 

Olivero S, Maroc C, Gabert J, Beillard E, Nietfeld 

W, Chabannon C & Tonnelle C (2000). 

Detection of different Ikaros isoforms in human 

acute leukemias using real time quantitative 

PCR. Br J Haematol 110(4):826-30 

Eickhoff H, Schuchardt J, Ivanov I, Meier- 

Ewert S, O’Brien J, Malik A, Tandon N, Wolski 

E, Rohlfs E, Reinhard R, Nietfeld W & 

Lehrach H (2000). Tissue gene expression 

analysis using arrayed normalized cDNA libraries. 

Genome Res 10(8):1230-40 

Heinrich J, Bosse M, Eickhoff H, Nietfeld 

W, Reinhardt R, Lehrach H & Moelling K 

(2000). Induction of putative tumor-suppressing 

genes in Rat-1 fibroblasts by oncogenic 

Raf-1 as evidenced by robot-assisted complex 

hybridisation. J Mol Med 78(7): 380-8 

Hartmann S, Hultschig C, Eisenreich W, 

Fuchs G, Bacher A & Ghisla S (1999). NIH 

shift in flavin-dependent monooxygenation: 

mechanistic studies with 2-aminobenzoyl-CoA 

monooxygenase/reductase. PNAS USA 96 

(14):7831-7836 

Wanker EE, Scherzinger E, Heiser V, Sittler 

A, Eickhoff H & Lehrach H (1999). Membrane 

filter assay for detection of amyloid-like 

polyglutamine-containing protein aggregates. 

Methods Enzymol 309:375-86 

Behr S, Matzig M, Levin A, Eickhoff H & 

Heller C (1999). A fully automated multicapillary 

electrophoresis device for DNA analysis. 

Electrophoresis 20(7):1492-507 

Lueking A, Horn M, Eickhoff H, Bussow K, 

Lehrach H & Walter G (1999). Protein microarrays 

for gene expression and antibody 

screening. Anal Biochem 270(1):103-11 

Metzger D, Scheer E, Soldatov A, Tora L 

(1999). Mammalian TAFII30 is required for 

cell cycle progression and regulates differentiation 

events. EMBO J 18(17):4823-34 

Soldatov A, Nabirochkina E, Georgieva S, 

Belenkaja T, Georgiev P (1999). TAFII40 protein 

is encoded by the e(y)1 gene: biological 

consequences of mutations. Mol Cell Biol 19: 

3769-78 




antibody screening on high-density filters of 

an arrayed cDNA library. Nucleic Acids Res 

26(21):5007-8

Sittler A, Walter S, Wedemeyer N, Hasenbank 

R, Scherzinger E, Eickhoff H, Bates GP, 

Lehrach H & Wanker EE (1998). Links Abstract 

SH3GL3 associates with the Huntingtin 

exon 1 protein and promotes the formation of 

polygln-containing protein aggregates. Mol 

Cell 2(4):427-36 

Symposium Proceedings 

Obrenovitch TP, Schepers C, Godukhin OV, 

Wachtel A, Urenjak J & Nietfeld W (2003). 

Differential gene expression analysis for cortical 

spreading depression-induced preconditioning. 

Brit Neurosci Ass Abstr 17(56.10): 13 

Schepers C, Obrenovitch TP, Trapp T, 

Hossmann K-A, Nietfeld W & Lehrach H 

(2003). Analysis of changes in gene expression 

produced by ischemia and preconditioning. 

Restorative Neurology and Neuroscience, 

20 (6):289 

Obrenovitch TP, Schepers C, Godukhin OV, 

Wachtel A, Urenjak J, Nietfeld W & Chazot 

PL (2002). Molecular characterisation of 

spreading depression-induced preconditioning. 

In Pharmacology of Cerebral Ischemia, 

Krieglstein J & Klumpp S, eds., MedPharm 

Scientific Publishers, Stuttgart, Germany: 37- 

47 

Nietfeld W, Schuchardt J, Malik A, Tandon 

N, Rohlfs E, Wancker E E, Eickhoff H & 

Lehrach H (2000). Expression analysis and 

functional genomics for brain research: Expression 

profiling in a mouse model for 

Huntington’s Disease. In Pharmacology of Cerebral 

Ischemia, Krieglstein J & Klumpp S, 

eds., MedPharm Scientific Publishers, Stuttgart, 

Germany: 435-48 

Hultschig C, Baensch M, Köhl J & Frank R 

(2000). Multiplexed Affinity Sorting and Analysis 

of Libraries on Libraries: Applications to 

Protein Design and Proteome Research. In 

Innovation and Perspectives in Solid Phase 

Synthesis & Combinatorial Libraries, Hampton 

R, ed., Mayflower Worldwide Limited, 

York,Vol 26:7-10 

Eisenreich W, Hultschig C, Hartmann S, 

Fuchs G, Bacher A & Ghisla S (1999). Hydroxylation 

by flavin enzymes: Evidence for 

NIH-shift mechanism. In Flavins and Flavoproteins. 

Ghisla S, Kroneck P, Macheroux 

P & Sund H, eds., Rudolf Weber, Agency for 

Scientific Publications, Berlin:59-366 

Book chapter 

Eickhoff H, Schneider U, Nordhoff E, 

Nyarsik L, Zehetner G, Nietfeld W & Lehrach 

H (2002). Technology development for DNA 

Chips DNA Arrays: Technology and Experimental 

Strategies, Grigorenko EV, ed., CRC 

Press:1-9 

Appointments, scientific honors & 

memberships 

Eckhard Nordhoff & Holger Eickhoff, Innovation 

award Berlin - Brandenburg 2000 for 

2D/3D-Chips - a new chip technology. 

A Soldatov, M Pustovoitov, N Ladjgina & A 

Krasnov: Awards from “Russian Foundation 

for Basic Research for young scientists” (2001) 

Patents 

Behr S, Eickhoff H & Heller C (1998). 

Verfahren und Struktur zur miniaturisierten, 

hochparallelen elektrophoretischen Trennung 

biologischer Makromoleküle. Patent (DE 198 

26 020.2, PCT/EP99/03834, EP 99929130, 

US 09/701,908) 

Eickhoff H, Kalkum M, Müller M, Nordhoff 

E, Rauth H, Reinhardt R (1998). Vorrichtung 

und Verfahren zum Prozessieren von Kleinsubstanzmengen 

in Mikrodispensern. Patent 

DE 198 23 719.7-52, PCT/EP99/03667, US 

09/701,203) 

Eickhoff H, Nordhoff E, Franzen J, Schurrenberg 

M (1999). Prozessieren von Proben in 

Lösungen mit definiert kleiner Wandkontaktfläche. 

Patent (DPA-Nr. 199 49 73.5) 

Eickhoff H, Lehrach H & Tandon N (1999) . 

Sandwich Inkubationskammer. Patent (DE 100 

14 204.4, PCT/EP01/03210) 

Eickhoff H, Germer R, Kalkum M, Müller 

M (1999). Elektroakustischer Sensor zur 

direkten Bestimmung von Partikel-Auftreffpositionen. 

Patent (DPA-Nr. 100 00 608.6) 

Eickhoff H, Lehrach H, Soldatov A, Ivanov 

A & Nabirochkina E (1999). Methylmethanesulfonate 

induces a more than hundred-fold 

up-regulation of CMV promoter activity. Patent 

(EP 00 10 7052) 

Eickhoff H, Horn M, Nordhoff E, Rosemann 

J (1999). Verfahren und Vorrichtung zur 

Generierung von Biomolekülen aus polymeren 

Materialien. Patent (DPA-Nr. 100 11 235.8) 

Eickhoff H, Lehrach H, Nyársik L, Rohlfs E 

(2000). Vorrichtung und Verfahren zur 

Prozessierung von Mikroarrays. Patent (DPA- 

Nr. 100 27 524.9). 



49


50 

Cahill D, Walter G, Büssow K, Nietfeld W 

&Lehrach H (1998). Novel method for the 

Identification of Clones Conferring a Desired 

Biological Property from an Expression Library. 

(US 09/070590, 30.4.1998/PCT EP99/ 

02963, 30.4.1999) 

Cahill D, Walter G, Büssow K, Nietfeld W, 

Lehrach H (1998). New Method for the Selection 

of Clones of an Expression Library Involving 

Rearraying. (US 09/070547, 

30.4.1998/PCT EP99/02964, 30.4.1999) 

Five patents application were filed; two patent 

applications are currently in preparation. 

Spin off 

Founding of Scienion AG, a new spin-off company 

by Holger Eickhoff, Martin Horn, 

Wilfried Nietfeld and Hans Lehrach in April 

2001. Scienion provides customers with solutions 

in biochip technology. The product portfolio 

includes collections of DNAs, proteins 

and antibodies on 2D/3D biochips. 


BMBF 01GR0105, Verbundprojekt Nationales 

Genomforschungsnetz - Kernbereich, Plattform 

2: Genexpressionsmuster (3/01-10/04) 

BMBF 312274: GABI Ressourcenzentrum/ 

Plant Proteomics - Large-scale automated plant 

proteomics/TP RNA Expressionsanalyse (1/00 

- 12/03) 

EU grant QLK3-CT99-00531: Development 

of high-throughput PNA-based molecular diagnostic 

systems (03/00 - 02/03) 

EU grant QLG3.CT-00-00934: StrokeGene - 

Gene search towards the identification of novel 

therapeutic strategies against brain ischemia 

(9/00 - 8/03) 

EU grant QLRI-CT-00-00233: INFRAQTL - 

Rodent models for oligogenic human diseases: 

Infrastructure facilitating the progression from 

genetics to the gene containing the putative 

aetiological variant & to the functional validation 

of genes & pathways (3/01 - 2/04) 

BMBF/Uni Kiel: Kompetenznetzwerk in der 

Medizin: Chronisch-entzündliche Darmerkrankungen-TP1.14 

Expressionsstudien mit 

DNA- und Protein-Microarrays (7/99 - 6/02) 

BMBF 03F0279C Funktionelle Genomanalyse 

umweltrelevanter mariner und terrestrischer 

Bakterien; Vorhaben: Charakterisierung der 

molekularen Anpassung von umweltrelevanten 

Bakterien auf Umweltveränderungen 

durch funktionelle Genomanalyse auf DNA 

Micorarrays (4/00-3/02) 

BMBF 031U102D (30 05/ 68597) Verbund: 

Entwicklung von Plattformtechnologien für die 

funktionelle Proteomanalyse – Anwendungsgebiet 

Hirnforschung – TP 4 (since 6/01) 

BMBF- 0312275F/2 GABI Arabidopsis Verbund 

I: Genetische Diversität bei Arabidopsis 

thaliana – TP5: Entwicklung SNP-basierender 

Kartierungswerkzeuge 

Humboldt Uni/BMBF Project 01KW0011: 

Differential Expression and In Vivo Modulation 

of Adipose-Tissue Genes in Obesity-Related 

Hypertension in Man using IMAGE 

cDNA microarrays (2/00 - 3/03) 

EU grant QLRI-CT-01-02161: Genetics of 

IBD (1/02 - 12/04) 

Investitions Bank Berlin – 10020682 (EFRE): 

Molekular-diagnostische Microarrays (9/02 - 

11/03) 

EU grant QLK-CT-2002-02035: Compendium 

of Arabidopsis gene expression (CAGE) 

(11/02-10/05) 

Acadamic co-operations 

Prof. Dr. Stefan Kaufmann & Dr. Hans- 

Joachim Mollenkopf, MPI f. Infektionsbiologie, 

Berlin 

Dr. Stefan Engeli, Franz-Volhard-Klinik, 

Medizinische Fakultät der Humboldt- 

Universität zu Berlin 

Prof. Dr. Erich Wanker, Max Delbrück Center 

für Molekulare Medizin Berlin 

Dr. Ulrike Müller, MPI f. Hirnforschung, 

Frankfurt 

Prof. Dr. K.-A. Hossmann, Max-Planck- 

Institut f. Neurologische Forschung, Köln 

Dr. Cécile Tonnelle, Laboratoire de Biologie 

Cellulaire, Institut Paoli Calmettes, Marseille, 

France 

Dr. R.Cox, Diabetes, QTL and Modifier Loci 

Group, MRC Mammalian Genetics Unit, 

Harwell,UK 

Dr. Karlhans Endlich, Universität Heidelberg, 

Institut für Anatomie und Zellbiologie 

Prof. Dr. Harald Stein and Dr. Michael 

Hummel, Institut für Pathologie, UKBF, Berlin 

Stefan Engelhardt, Institute of Pharmacology 

and Toxicology, University of Würzburg 

Prof. Dr. Hartmut Wekerle and Dr. Alexander 

Flügel, MPI for Neurobiology, Martinsried 

Prof. Dr. Rudolf Aman, Dr. Frank Oliver 

Gloeckner, and Dr. Ralf Rabus, MPI für Marine 

Mikrobiologie, Bremen

Prof. Dr. Joachim Klose, Institut für Humangenetik, 

Humboldt University of Berlin 

Prof. Marc Zabeau, Dr. Martin Kuiper, University 

of Gent, Plant Systems Biology, Belgium 

Prof. Dr. Helmut E. Meyer, Ruhr-Universität 

Bochum 

Prof. Dr. Friedrich Herberg, Universität Kassel 

Prof. Dr. Stefan Schreiber, Mukosaimmunologie, 

I. Medizinische Klinik - Klinik für Allgemeine 

Innere Medizin Christian-Albrechts- 

Universität Kiel 

Prof. Dr. Hans-Peter Herzel, Innovationskolleg 

Theoretische Biologie, Humboldt-Universität, 

Berlin 

Prof. Dr. Johannes Heitz, Johannes-Kepler- 

University Linz, Austria 

Dr. Ute Resch, Project Group I.3902 “Analytical 

Applications of Steady State and Time 

Resolved Fluorometry“ Bundesanstalt für 

Materialforschung, Berlin 

Dr. Ronald Frank, AG Molekulare Erkennung, 

Gesellschaft für Biotechnologische Forschung, 

Braunschweig 

Prof. Dr. Cecilia Emanuelsson, Department of 

Biochemistry, Center for Chemistry & Chemical 

Engineering, Lund University, Sweden 

Dr. Bruno Stuhlmüller and Dr. Thomas Häupl, 

Humboldt University, Rheumatology & Clinical 

Immunology, Berlin 

Dr. Ralf Schlappbach and Dr. Jens Sobeck, 

Functional Genomics Center Zurich 

Prof. Dr. Hartmut Schlüter, Charite - Campus 

Benjamin Franklin; Institut für Toxikologie, 

Berlin 


Dr. Holger Eickhoff, Dr. Volker Heiser, and 

Dr. Eckehard Nordhoff, Scienion AG Berlin 

Dr. Johannes Schuchardt and Dr. Arif Malik, 

MicroDiscovery GmbH, Berlin 

Dr. Martin Blüggel, Protagen AG, Bochum 

Till Sörenson and Dr. Michael Liebler, Raytest 

GmbH, Straubenhardt 

Dr. Ralf Beneke, Tecan Austria, Grödig, Austria 

Dr. Johannes Maurer, Dr. Uwe Radelof, Dr. 

Bernhard Korn, RZPD GmbH, Berlin/Heidelberg 

Dr. Andreas Rühlmann, Agilent Technologies, 

Europe 

Mark Reid, Genetix Group plc, New Milton 

England 

Prof. Dr. Hermann Lübbert, Biofrontera Pharmaceuticals, 

Leverkusen 



51


52 

Evolution & Development Group 

Head: 

Dr. Georgia Panopoulou 

Phone: +49 (0)30-8413 1235 

Fax: +49 (0)30-8413 1380 

Email: panopoul@molgen.mpg.de 

Scientist: 

Dr. Albert J. Poustka 


The theme of the group is the sequence level based study of the changes of genes during 

evolution and the impact of these changes on gene function. For our study we have selected 

sea urchins (that represent basal deuterostomes), amphioxus (an invertebrate chordate) 

and zebrafish (vertebrate chordate). The divergence of protostomes and deuterostomes 

and the transition from invertebrates to vertebrates were accompanied by the innovation 

of novel structures and an increase in gene number. Invertebrates have approximately 

half the number of genes than vertebrates. Nevertheless, genome comparisons 

have revealed that 83% of the C.elegans genes have human orthologs and reverse only 

20% of the human genes are vertebrate specific. The above data indicate that these extra 

vertebrate genes are not novel but were amplified from existing gene families. We are 

interested in the nature of the mechanism that has generated these additional genes in 

vertebrates and the mechanisms that genomes have devised in order to cope and accommodate 

these additional genes. Finally we would like to evaluate whether purely the increase 

in gene number can be accounted for the difference in organismal complexity 

between vertebrates and invertebrates. 

During the past years the focus of the group was to generate genomic resources, which were 

virtually non-existent for sea urchin, amphioxus and zebrafish. Embryonic libraries from comparable 

developmental stages were normalised 

by oligonucleotide fingerprinting. Subsequent 

EST sequencing was carried out at the Washington 

University and locally (Poustka et al. 

Figure 1: Distribution of 

the duplicates times of the 

human orthologs of 195 

CDY/CD groups calculated 

by the molecular 

clock approach (red line). 

The times were averaged 

over intervals of 50 Myr. 

The mean value of 91 % 

of all duplication times is 

at 488 Myr. Based on 

single copy genes we estimated 

that cephalochordates 

have diverged from 

vertebrates around 650 

Myr. The duplication time 

measured as the expected 

number of nucleotide 

substitutions per codon 

(blue line) follows the 

distribution of the molecular clock duplication times. The distribution of 

synonymous substitutions per synonymous site (the top right corner of the 

plot) shows 3 peaks, at 4 (the majority of the values of 1414 pairs of human 

genes), at 2 and at 0-0.2. 

Informatics: 

Dr. Detlef Groth 


Anahid Powell 

Technician: 

Vesna Radosavljevic 

1999, Clark et al. 2001, Panopoulou et. al 2003, 

Poustka et. al 2003). Significant effort was invested 

in annotating and organising the ESTs 

and normalisation results in databases to allow 

the maximum exploitation of results locally 

and by external users. In particular, the 

recently released sea urchin database 

(www.molgen.mpg.de/ag_seaurchin/) which 

includes 40,000 5’ and 3’ ESTs clustered in 

20,000 consensus is daily used by the sea urchin 

community. 

On the mechanism of gene increase 

A mechanism that has the potential of generating 

a large number of new genes at once 

is gene duplication with its most extreme 

form being the duplication of the complete 

genome of an organism. Complete genome 

duplica-tion(s) are thought to have happened 

at the origin of vertebrates (2R hypothesis), 

a hypothesis that is heavily debated for sev-

eral years. This ambiguity is partly due to differences in the approaches and data used by 

different groups to resolve this question but also due to the inherent problems that can 

arise when trying to resolve an event that happened almost 600My ago. A significant 

improvement to test this hypothesis, compared to previous studies, can immediately be 

brought by using a larger and unbiased sequence set from organisms that are closer to the 

hypothesised genome duplications such as amphioxus. We have evaluated the 2R hypothesis 

(Panopoulou et al. 2003) through the comparison of the amphioxus catalogue that we 

generated to 3,453 single copy genes orthologous between C.elegans (C), D. melanogaster 

(D) and S.cerevisiae (Y) as well as to a nonredundant collection of ESTs of the chordate 

Ciona intestinalis and the complete predicted mouse and human proteome. We show that 

the gene duplication activity is significantly elevated after the separation of amphioxus 

from the vertebrate lineage, which we estimate at 650Myr. The majority of human orthologs 

of 195 CDY groups that could be dated by the molecular clock appear to be duplicated 

between 300-680Myr. We detected 485 duplicated chromosomal segments in the human 

genome containing CDY orthologs, 331 of which are found duplicated in the mouse 

genome and within regions syntenic between human and mouse, indicating that these 

were generated earlier than the human-mouse split. Our results favour at least one large 

duplication event at the origin of vertebrates, followed by smaller scale duplications closer 

to the bird-mammalian split. 

Comparison of the gene copy number of sea urchin genes contained in the unigene catalogue 

comprised of 20,000 unique genes that we generated, to their chordate and vertebrate 

orthologs via the CD/CDY platform of orthologous groups indicated that similarly 

the sea urchin genome has not undergone extensive gene duplications. In addition, phylogenetic 

comparison of the identified sea urchin genes to predicted genes from the complete 

genome sequence of the urochordate Ciona intestinalis indicated that at least one 

quarter of the genes thought to be chordate specific are already present at the basis of 

deuterostome evolution (Poustka et al. 2003). 

On the mechanisms that genomes have devised in order to cope and 

accommodate these additional genes 

Studies performed using the complete genome 

sequence of S.cerevisiae, C.elegans 

and D. melanogaster estimate that the ma- 

jority of duplicates are lost before 50 Myr 

have elapsed. Then how do gene duplicates 

persist at all and how can eukaryotic genomes 

be full of them? Studies on indi- 

vidual genes suggest that developing partially overlapping functions between duplicates 

could be a way of maintaining all duplicates in a genome. We are currently carrying out a 

whole mount insitu hybridisation (WMISH) screen of sea urchin, amphioxus and zebrafish 

orthologs of genes that are duplicated in zebrafish. The purpose of this screen is to investigate 

how the function of genes (as much as this can be implied by their expression 

pattern) is changing after gene duplication. The amphioxus and sea urchin orthologs are 

valuable guides for assessing the ancestral role of genes prior to duplication. 

Future projects 

Figure 2: Sea urchin apical organ specific genes such 

as Six3 (A), forkhead-like (B,D) and similar to 

vertebrate hypothetical genes (C). 

Mechanisms of gene increase 

As mentioned above, a main obstacle in resolving the 2R hypothesis is the fact that the 

hypothesised event is very old. Studying a vertebrate genome that has undergone a more 

recent duplication event can impart information on the half life of duplicates and on the 

rearrangements that follow a genome scale duplication which will help us to better understand 

the nature of the duplication at the origin of vertebrates. Ray finned fish are good 

candidates as complete genome duplications are thought to have happened at some point 

in their evolution approximately 300My ago. Furthermore, the complete genome sequence 

of two representatives of this clade (Fugu rubripes and Tetraodon fluviatilis) are available 



53


54 

while also the genome of zebrafish (Danio rerio) is expected to be completed within a 

year. In this respect we intend to compare the gene copy rate between Fugu and mammalian 

orthologous genes. 

Increase in gene number versus changes in regulatory elements. 

The opinions on the cause of the increase of organismal complexity are divided. On one hand 

the increase in complexity is attributed to the gene increase, on the other hand to the change of 

the cis regulatory environment of the genes in a given organism. To evaluate the contribution of 

each factor we intend to computationally identify upstream regulatory elements of zebrafish 

genes via the comparison of the respective genomic regions of zebrafish, medaka and fugu 

orthologs of genes included in the WMISH screen that we are carrying out. We then intend to 

compare the type and number of motifs shared between zebrafish duplicates. 

Regulatory network defining the apical plate in sea urchin 

The apical organ contains the serotonergic nervous system of the sea urchin pluteus larva. The 

evolutionary relationship between the apical organ of dipleura type larvae and the dorsal central 

nervous system of chordates remains unresolved. The Garstang theory proposes that the ciliated 

band and the apical organ have moved dorsally during evolution in vertebrates and hence these 

cells are proposed to be of common origin. We have identified apical organ specific genes in sea 

urchin and want to study the gene regulatory network (GRN) defining this new territory in the 

sea urchin embryo and compare it to a GRN operating in the development of a vertebrate CNS 

in order to evaluate the homology of these neuronal domains. 


Publications 1998 - 2003 

Minguillon C, Jimenez-Delgado S, Panopoulou 

G & Garcia-Fernandez J (2003). The amphioxus 

hairy family: differential fate after 

duplication. Development (in press) 

Panopoulou G, Hennig S, Groth D, Krause 

A, Poustka AJ, Herwig R, Vingron M & 

Lehrach H (2003).New evidence for genomewide 

duplications at the origin of vertebrates 

using an amphioxus gene set and completed 

animal genomes. Genome Res 13:1056-66 

Poustka AJ, Groth D, Hennig S, Thamm S, 

Cameron A, Beck A, Reinhardt R, Herwig R, 

Panopoulou G & Lehrach H (2003). Generation, 

annotation, evolutionary analysis and 

database integration of 20,000 unique sea urchin 

EST clusters. Genome Res (in press) 

Stricker S*, Poustka AJ*, Wiecha U, Stiege A, 

Hecht J, Panopoulou G, Vilcinskas A, Mundlos 

S & Seitz V (2003). A single amphioxus 

and sea urchin runt-gene suggests that runtgene 

duplications occurred in early chordate 

evolution. Dev Comp Immunol 27(8): 673-84 

Hennig S, Panopoulou G & Poustka AJ 

(2002). Comparative EST analysis. In 

Analysing Gene Expression, S Lorkowski & 

P Cullen, eds., Wiley 

* Both authors contributed equally to this work. 

Rast JP, Cameron RA, Poustka AJ, Davidson 

EH (2002). Brachyury target genes in the early 

sea urchin embryo isolated by differential macroarray 

screening. Dev Biol 246(1):191-208 

Clark MD, Hennig S, Herwig R, Clifton SW, 

Marra MA, Lehrach H, Johnson SL & Group 

t W (2001). An oligonucleotide fingerprint normalized 

and expressed sequence tag characterized 

zebrafish cDNA library. Genome Res 

11: 1594-602 

Ferrier DE, Brooke NM, Panopoulou G & 

Holland PW (2001). The Mnx homeobox gene 

class defined by HB9, MNR2 and amphioxus 

AmphiMnx. Dev Genes Evol 211(2):103-7 

Knight RD, Panopoulou G, Holland PW & 

Shimeld SM (2000). An amphioxus Krox gene: 

insights into vertebrate hindbrain evolution. 

Dev Genes Evol 210(10):518-21 

Neidert AH, Panopoulou G, Langeland JA 

(2000). Amphioxus goosecoid and the evolution 

of the head organizer and prechordal 

plate. Evol Dev 2(6):303-10 

Schubert M, Holland LZ, Panopoulou G, 

Lehrach H, Holland ND (2000). Characterization 

of amphioxus AmphiWnt8: insights into 

the evolution of patterning of the embryonic 

dorsoventral axis. Evol Dev 2(2):85-92

Clark MD, Panopoulou GD, Cahill DJ, 

Bussow K & Lehrach H (1999). Construction 

and analysis of arrayed cDNA libraries. Methods 

Enzymol 303: 205-33 

Poustka AJ, Herwig R, Krause A, Hennig S, 

Meier-Ewert S & Lehrach H (1999). Toward 

the gene catalogue of sea urchin development: 

the construction and analysis of an unfertilized 

egg cDNA library highly normalized by 

oligonucleotide fingerprinting. Genomics 59: 

122-33 

Panopoulou G, Clark MD, Holland LZ, 

Lehrach H & Holland ND (1998). Amphi 

BMP2/4, an amphioxus bone morphogenetic 

protein closely related to Drosophila decapentaplegic 

and vertebrate BMP2 and BMP4: 

insights into evolution of dorsoventral axis 

specification. Dev Dyn 213(1):130-9 

Co-operations within the institute 

S. Mundlos 

M. Vingron 

R. Reinhardt 

External academic co-operations 

Prof. P.Holland, University of Oxford, UK 

Dr. Nic Holland and Dr Linda Holland, Scripps 

Institution of Oceanography, University of 

California San Diego, USA 

Dr. Patrick Lemaire, LGPD, IBDM, Marseille, 

France 

Prof. Eric Davidson, Division of Biology, California 

Institute of Technology, Pasadena, USA 

Prof. D. McClay, Department of Biology, Duke 

University, Durham, USA 



55


56 

Gene Traps & Microarrays - Molecular 

Analysis of Heart Failure Group 

Head: 

Patricia Ruiz 

Center for Cardiovascular Research 

Hessische Str. 3-4 

10115 Berlin 

Phone: +49 (0)30-450 578 744 

Fax: +49 (0)30-8413 1380 

Email: ruiz@molgen.mpg.de 

Secretary: 

Jutta Bebla (half-time) 

Scientists: 

Chris Hall 

Karin Effertz 

Silvana Di Cesare (01-03) 

Rafal Grzeskowiak (00-02) 



Henning Witt 

Thilo Storm 

Jaizki Fontaneda 

Safak Yalcin 

Alberto Musa 


Anja Angelov 

Technicians: 

Vasiliki Antoniou (SHK) 

Carsta Werner (biotechnologist) 

Beate Walter 

Beata Thalke 

Franziska Köhler 

Aydah Sabah 

Thorsten Beckmann 

A large scale, gene-driven mutagenesis approach for the functional analysis 

of the mouse genome 

(Collaboration with the German Gene Trap Consortium) 

A major challenge of the post-genomic era is the functional characterization of every single gene 

within the mammalian genome. In an effort to address this challenge, we have assembled a 

collection of mutations in mouse embryonic stem (ES) cells, which is the largest publicly accessible 

collection of such mutations to date. Using four different gene trap vectors, we have generated 

5142 sequences adjacent to the gene trap integration sites (gene trap sequence tags, 

GTSTs; http://genetrap.de) from over 11,000 ES cell clones and trapped 3277 known genes as 

well as 889 ESTs. While most of the gene trap vector insertions occurred randomly throughout 

the genome, we found both vector-independent and vector-specific integration “hot spots”. As 

over 50% of the “hot spots” were vector- specific, we conclude that the most effective way to 

saturate the mouse genome with gene trap insertions is by using a combination of gene trap 

vectors. Therefore we are currently developing and optimizing new vectors such as conditional 

vectors and others that preferentially trap secreted proteins. When a random sample of gene trap

integrations were passaged to the germline (e.g. p0071, ect-2 and plectin), 59% (17 out of 29) 

produced an observable phenotype in transgenic mice (e.g. Bruce and neurochondrin) - a frequency 

similar to that achieved by conventional gene targeting. Thus, gene trapping allows a 

large-scale and cost-effective production of ES cell clones with mutations distributed throughout 

the genome - a resource likely to accelerate genome annotation and the in vivo modelling of 

human disease. 

Expression profiling of cardiomyopathies using routine cardiac biopsies 

from patients and mouse models 

(Rafal Grzeskowiak, Henning Witt, Thilo Storm) 

Dilated cardiomyopathy (DCM), a major cause of human heart failure, is characterized by a 

progressive dilation primarily of the left ventricle. In ~30% of DCM patients the disorder has 

been attributed to mutations in proteins of the sarcomere, the cytoskeleton or the cell/nuclear 

membrane (e.g. cardiac β myosin heavy chain, desmin or lamin A/C). The analysis of such 

complex networks demanded global gene expression approaches. Although some expression 

profiling studies on heart failure have been reported these attempts provide rather a preliminary 

picture of the disease pathogenesis. We addressed these issues and expanded previous findings 

by examining the gene expression profiles of myocardial biopsies from clinically stable DCM 

patients using a whole-genome-covering cDNA library. Our results point to global changes in 

the cytoskeleton, in cellular energetics, and in calcium cycling and apoptotic pathways as being 

essential processes underlying dilative remodelling and cardiac dysfunction. We further demonstrate 

the applicability of gene expression profiling on cardiac biopsies, which may have important 

implications for future approaches in clinical diagnostics. 

Our next aim is to identify different classes of cardiomyopathies (e.g. hypertrophic, obstructive, 

non-obstructive, dilated, etc.) based on their specific gene expression fingerprint. Therefore, we 

are hybridizing probes from individual patients suffering from different types of cardiomyopathies 

to a selected gene collection, the CardioChipI. This chip was assembled to encompass all 

the genes expressed in the adult healthy and in the diseased heart. To this end pools of healthy 

and diseased (DCM, HCM, RSE) cardiac probes were hybridizied to the whole-genome covering 

human Unigene Gene set 2 (RZPD2). The cDNAs encoding genes expressed in at least one 

of the hybridized pools were selected, rearrayed and assembled into the CardioChipI comprising 

4378 unique Ensembl gene IDs. 

Furthermore, we use mouse models for cardiomyopathies that mimic the pathophyisiology 

observed in human patients. The gene expression patterns of four mouse models for dilated 

cardiomyopathy are currently being analysed. These include the plakoglobin-deficient mouse, 

the erbB2-cardiac specific knock-out mouse, the erbB4 cardiac-specific knock-out mouse and 

the MLP-deficient mouse. Since the genes inactivated in these mice are involved in several 

biological processes (e.g. cell adhesion, signal transduction, sarcomere function) we hope to 

obtain a broad view of the processes involved in the development and progression of DCM in 

mice and in human patients. 

Functional characterization of differentially expressed genes 

(Silvana Di Cesare, Karin Effertz, Jaizki Fontaneda, Alberto Musa; in collaboration 

with Gregor Eichele, MPI, Hannover) 

To analyse protein cascades and to identify protein interaction partners, the yeast-2-hybrid (Y2H) 

system has developed to a highly sensitive and robust technology. Since many of the differentially 

expressed cardiac genes are also expressed in the developing embryo, we are screening 

two different libraries, a mouse embryonic and a human cardiac library using a semi-automated 

Y2H-system. Interaction partners of several of the identified differentially expressed genes such 

as proteins belonging or associated to the LIM-family and proteins involved in signalling (e.g. 

ErbB2) are being identified and characterized. A protein interaction network will be drawn, 

which will hopefully aid to a better understanding of the molecular mechanisms leading to the 

development and progression of cardiomyopathies. In a first set of experiments we have identified 

a novel interaction partner of the ErbB2 receptor and are characterising the interaction sites. 

The relevance for this interaction is currently being tested in murine cardiomyocytes and during 

Zebrafish development using gene specific morpholinos (see below). 



57


58 

In-situ hybridization (ISH) on whole mount and on tissues sections of the developing embryo is 

a powerful method for analysing the spatial and temporal expression of genes of interest. It also 

allows efficient large-scale screening of collections of anonymous genes that can thereby be 

classified and clustered into geographical and functional categories. We are currently determining 

the expression patterns of mouse and zebrafish homologues of several of the differentially 

expressed genes and ESTs. The systematic whole mount ISH on zebrafish embryos is being 

performed in-house using available equipment and digoxygenin (DIG)-labeled antisense 

riboprobes and ISH on mouse embryos in close collaboration with Prof. G. Eichele, MPI- 

Hannover. Data annotation and archiving follow internationally agreed nomenclature standards. 

Analysis of ErbB-2 signalling in the heart 

(Silvana Di Cesare, Chris Hall, Thorsten Beckmann, Anja Angelov) 

To understand the molecular mechanisms underlying the putative role of ErbB-2 in the maintenance 

of adult cardiac structure and functionality, we searched for novel cardiac interaction partners 

of ErbB-2 using the yeast two-hybrid system. ErbB-2 baits were generated to cover the 

tyrosine residues that are putative autophosphorylation sites. The chimeric ErbB-2 baits were used 

to screen a commercial heart cDNA library (Clontech) and in several independent screens, clones 

encoding the SH2 domains of ShcA and Nck-β were isolated. ShcA has previously been described 

as a substrate of ErbB-2 and Nck-β was identified as a novel interaction partner. The interaction of 

the prey proteins with the baits was confirmed by co-transfection into yeast cells, followed by 

analysis of yeast growth and β-galactosidase activity. We have further mapped the ErbB-2 binding 

sites and confirmed the interaction between ErbB-2 and Nck-β in a mammalian cell system. 

To evaluate the functional role for Nck-β in vivo we are utilizing the well-documented attributes 

offered by the vertebrate Danio rerio (zebrafish). In particular, the ability to conduct rapid 

pseudo loss-of-function experiments through the early delivery of specific translation inhibitors 

(Morpholino oligonucleotides (MOs)). Morpholino oligonucleotides designed to specifically 

target nck-β transcripts were delivered into 1-8 cell-stage zebrafish embryos via microinjection. 

These embryos have been observed throughout development to study early embryogenesis in 

an nck-β-depleted background. We found clear signs of neurodegeneration and defects in cardiovascular 

development and are currently analysing them. 

Identification of new zebrafish genes expressed during early development 

through an automated whole mount in-situ screen using OFP normalized 

cDNA libraries 

(Alberto Musa) 

The combination of gene expression patterns with sequence information allows the assignment 

of putative function(s) to a gene in a given tissue and/or cell-type to a given time point even 

providing hints to functional interactions with other genes and/or proteins. Towards the systematic 

characterisation of all vertebrate genes their spatio-temporal expression patterns are crucial. 

Oligo fingerprinting (OFP) is a high throughput technology, which has been used successfully 

in the mapping of the herpes simplex virus genome, the selection of clones for genomic shotgun 

sequencing, and is a well-established approach to characterize and normalize cDNA libraries. 

By OFP a given cDNA clone is characterised by its own DNA fingerprint enabling the systematic 

identification of genes by clustering. The OFP-based normalisation is particularly efficient 

because it identifies rare and low represented transcripts reducing the intrinsic redundancy present 

in any given cDNA library (Hennig, 2000; Poustka et al., 1999; Radelof et al., 1998). In our 

study we have combined two high-throughput technologies, OFP and automated WMISH and 

examined the expression pattern of 1,440 randomly chosen cDNAs at 6 different stages of 

zebrafish development. 

We identified 319 cDNAs showing restricted expression patterns (>20%), most of them not previously 

described. Documentation and anatomical annotations of 156 of the restricted expression 

domains were integrated in publicly available databases; the RZPD- Deutsches Ressourcenzentrum 

für Genomforschung GmbH (http://www.rzpd.de) and the Zebrafish Information Network (http:/ 

/zfin.org). We have also characterized three of the new genes isolated during the screen, the zebrafish 

ndrg1, madh9, and sox4. Altogether, this work extends the expression data available up to date to 

the zebrafish embryo and accelerates the analysis of the vertebrate embryonic transcriptome.



Grzeskowiak R, Witt, H, Drungowski M, 


KJ, Scheid S, Spang R, Lehrach H & Ruiz P. 

(2003). Profiling of dilated cardiomyopathy 

using routine cardiac biopsies. Cardiovascular 

Res 59:400-411 

Hansen J, Floss T, van Sloun P, Füchtbauer 

EM, Vauti F, Arnold HH, Schnütgen F, Wurst 

W, von Melchner H & Ruiz P (2003). A Large 

Scale, Gene-Driven Mutagenesis Approach for 

the Functional Analysis of the Mouse Genome. 

PNAS 100:9918-9922 

Most P, Remppis A, Pleger ST, Loffler E, 

Ehlermann P, Bernotat J, Kleuss C, Heierhorst 

J, Ruiz P, Witt H, Karczewski P, Mao L, 

Rockman HA, Duncan SJ, Katus HA & Koch 

WJ (2003). Transgenic overexpression of the 

Ca2+ binding protein S100A1 in the heart 

leads to increased in vivo myocardial contractile 

performance. J Biol Chem 278(36):33809- 

17 

Rantanen M, Palmen T, Patari A, Ahola H, 

Lehtonen S, Astrom E, Floss T, Vauti F, Wurst 

W, Ruiz P, Kerjaschki D & Holthofer H 

(2002). Nephrin TRAP mice lack slit diaphragms 

and show fibrotic glomeruli and cystic 

tubular lesions. J Am Soc Nephrol 13:1586- 

1594 

Avner P, Bruls T, Poras I, Eley L, Gas S, Ruiz 

P, Wiles MV, Sousa-Nunes R, Kettleborough 

R, Rana A, Morissette J, Bentley L, Goldsworthy 

M, Haynes A, Herbert E, Southam L, 

Lehrach H, Weissenbach J, Manenti G, 

Rodriguez-Tome P, Beddington R, Dunwoodie 

S & Cox RD (2001). A radiation hybrid transcript 

map of the mouse genome. Nature Genetics 

29(2):194-200 

Smits R, Ruiz P, Diaz-Cano S, Luz A, Jagmohan-Changur 

S, Breukel C, Birchmeier C, 

Birchmeier W & Fodde R (2000). E-cadherin 

and adenomatous polyposis coli (Apc) mutations 

are synergistic in intestinal tumor initiation. 

Gastroenterology 119:1045-1053 

Wiles Mv, Vauti F, Otte J, Füchtbauer EM, 

Ruiz P, Füchtbauer A, Arnold HH, Lehrach 

H, Metz T, von Melchner H & Wurst W (2000). 

Establishment of a gene trap sequence tag 

(GTST) library to generate mutant mice from 

embryonic stem (ES) cells. Nature Genetics 

24:13-14 

Books and published abstracts 

Günthert U, Schwärzler C, Wittig B., Laman 

J, Ruiz P, Stauder R, Bloem A, Smadja-Joffe, 

Zöller M & Rolink A (1998). Functional involvement 

of CD44, a family of cell adhesion 

molecules, in immune responses, tumour progression 

and haematopoiesis. Adv Exp Med 

Biol 451:43-49 

Norman M, Behrends M, McKoy G, Coonar 

AS, Ruiz P, Birchmeier W, Protonotarios N, 

Tsatsopoulou A & McKenna WJ (2001). The 

plakoglobin mouse allows insight into the mechanism 

of Naxos ARVC. Eur Heart J 22:237-237 

Smits R, Ruiz P, Luz A, Fodde R & Diaz- 

Cano SJ (2001). E-cadherin haploinsufficiency 

enhances APC-driven tumorigenesis by 

apoptosis down-regulation in mouse models. 

Laboratory Investigation 81:1251 

Smits R, Ruiz P, Luz A, Fodde R & Diaz- 

Cano SJ (2001). E-cadherin haploinsufficiency 

enhances APC-driven tumorigenesis by 

apoptosis down-regulation in mouse models. 

Modern Pathology 14:1251 

Floss T, Wurst W, von Melchner H, van Sloun 

P, Schnütgen F, Füchtbauer EM, Arnold HH, 

Vauti F, Ruiz P & Hansen J (2002). Gene in 

der Falle, Mutagenese des Mausgenoms. 

Biospektrum 1:84-90 

Teaching 

Vorlesung Mouse Gene Traps for the functional 

anaylsis of genes, WS 1999, WS 2000, 

WS 2001, WS 2002, one lecture/year, Freie 

Universität Berlin 

Vorlesung Mausmutanten in der Analyse 

menschlicher Erkrankungen, WS 2000, 2WS; 

WS 2001, 2WS; WS 2002, 2WS, Paris Lodron 

University of Salzburg, Austria 


Patricia Ruiz: Molecular Approaches to Human 

Disease in General, and to Dilated Cardiomyopathy 

in Particular, Paris-Lodron University, 

Salzburg, June 2003 

Diploma Theses 

Henning Witt, Genexpressionsprofile von 

Mausmodellen kardiomyopathischer Erkrankungen, 

Diploma Thesis, TU Braunschweig, 

January 2001 

Tobias Parikh, Gene expression profiling by 

cDNA arrays for dilated cardiomyopathy: 

Feasibility, validation of known genes, and 

identification of novel genes, Diploma Thesis, 

TU Berlin, December 2002 



59


60 

Boris Ratsch, Molekulare Charakterisierung 

der konditionallen ErbB2 knock-out Maus als 

Modell einer dilatativen Kardiomyopathie, 

Diploma Thesis, FU Berlin, March 2003 

Dirk Klingbiel, Statistical analysis and visualization 

of gene expression data, Diploma 

Thesis, University of Lübeck, April 2003 

Patent 

Novel Markers for Cardiopathies, Application/ 

Patent No. PCT/EP02/12522 

Current external funding 

BMBF/DHGP: Gene Trap analysis: primary 

analysis of gene trap insertions in mouse embryonic 

stem cells, 1999-2004 

BMBF/DHGP: Gene expression profiling of 

normal and cardiomyopathic tissues in humans, 

1999-2003 

BMBF/DHGP: German Gene Trap Consortium: 

Large-Scale Gene Function Studies, 

2001/2004 

BMBF/NGFN: Generation of models in 

mouse and rat, phenotyping center (Construction 

and screening of mutagenized ES cells), 

2000/2004 

BMBF/NGFN: Kooperation zur Untersuchung 

der molekularen Grundlagen der 

kontraktilen Dysfunktion und zur Entwicklung 

dafür geeigneter Modell- und Testsysteme, 

2002-2004

Protein Group 

Scientists: 

Sabine Baars 

Allan Beveridge 

Jörn Glökler 

Angelika Lüking 

Margret Krause 


Philipp Angenendt 

Tanja Feilner 

Claudia Gutjahr 

Sabine Horn 

Heads: 

Harald Seitz (coordinator) 

Phone: +49 (0)30-8413 1614 

Fax: +49 (0)30-8413 1380 

Email: seitz@molgen.mpg.de 

Dolores Cahill (untill 2003) 

Birgit Kersten 

Jürgen Kreutzberger 


Gregor Kijanka 

Armin Kramer 

Engineers: 

Alexandra Poßling 

Sigrid Steller 

Technicians: 

Ulrike Borgmeier 

Christine Gotthold 

Andrea König 

Silke Wehrmeyer 


The main focus of the protein group is the development and improvement of high throughput 

techniques for parallel cloning, expression, purification and characterization 

of proteins. Starting with the work of D.J. Cahill in 1997 the 

protein group developed and applied various kinds of protein array technologies. 

Arraying complete expression libraries in high density on macro 

arrays has led to pro-tein filters that allow the analysis of thousands of 

clones and their expression products in parallel (Lueking et al. 1999). 

Further automatisation and miniaturisation resulted in the generation of 

analytical microarrays (antibody arrays and antigen arrays) used for serum 

screening. 

The proceeding of technology development focused on functional 

microarrays and improvement of analytical microarrays and was mainly 

done in the protein groups of B. Kersten (since 2001), H. Seitz (since 

2001) and J. Kreutzberger (since 2003). To achieve those goals the technology 

development focused on different aspects: 

A first step in all microarray studies is the generation of well-characterized 

protein resources. Therefore we developed high throughput cloning 

strategies (generation of expression libraries, parallel ORF cloning). 

Systems for parallel expression of proteins in E. coli, S. cerevisiae, P. 

pastoris and an in vitro transcription-translation system were established 

(Holz et al. 2001). Generated expression clones (BMBF projects: GABI, 

T-cell; EU project: Neisseria meningitidis) will be accessible for our cooperation 

partners and are a unique resource for future applications. 

Additionally automated systems for the purification of proteins under 

native and denatured conditions were successfully set up. 

For the optimisation of analytical arrays extended studies with different 

kinds of array surfaces were performed and a multiple spotting tech- 



Figure 1: Multiplex chip. Scan and quantification 

of spotted monoclonal anti-HSA and polyclonal 

anti-fibrinogen antibodies in equimolar ratio on a 

protein chip. (A) Scanning at the respective 

wavelength for bound anti-HSA antibodies (Cy5labelled 

anti-mouse antibody; excitation at 649 nm, 

emission at 670 nm). (B) Scanning at the respective 

wavelength for bound anti-fibrinogen antibodies 

(Cy3-labelled anti-rabbit antibody; excitation at 

550 nm, emission at 570 nm). HSA and antibody 

concentrations are indicated on the y- and x-axis of 

the diagrams, respectively, while the signal 

intensities obtained are shown on the z-axis. Signal 

intensities are illustrated in the same spatial 

arrangement as on the chip. (taken from Angenendt 

P, Glökler J, Konthur Z, Lehrach H & Cahill DJ 

(2003). 3D protein microarrays: performing 

multiplex immunoassays on a single chip. Anal 

Chem 75:4368-4372). 

61


62 

nique (MIST) was developed and established (see Figure 1, Angenendt et al. 2003). Analytical 

arrays were used in the EU MenB project for finding new potential candidates for vaccine 

development against a Neisseria meningitidis serogroup B infection and in the DHGP T-cell 

project. In a BMBF founded project for studying DCM (dilated human cardiomyopathy), patient 

sera were screened and potential therapeutic marker could be detected. First protein chips 

from Arabidopsis (Kersten et al. 2003) and Barley were generated in a proteome study (BMBF 

project GABI) in order to profile mono- and polyclonal antibodies. 

Figure 2: Protein-DNA interaction on a protein microarray. 

Binding of Cy5 labelled oligonucleotide R4 

(5‘-Cy5 ATCTACTGTGGATAACTCTGT) to wt 

DnaA domain 4 (A), non-binding mutant A440V 

DnaA domain 4 (B) and a non DNA-binding protein 

(C). Proteins were immobilized on FAST TM slides. 

For a functional understanding of analysed 

proteins the study of molecular interactions is 

essential.Therefore we established different 

functional assays by means of protein microarrays. 

In the Human Brain Proteom Project 

(HBPP) a chip based technique to study protein-protein 

interactions was developed and 

applied. Further on a phosphorylation assay to 

screen for target proteins of protein kinases 

(GABI), and assays to study protein-DNA (see 

Figure 2) as well as protein-small molecule interactions 

were established (HBPP, GABI). 


In the future we will focus our interest on the application of these developed chip 

technologies for serum profiling and protein-interaction partner studies. This will include 

protein-protein, protein-DNA, protein-small molecules interactions. We will apply 

these assays to characterize transcription factors (phosphorylation, target and ligand 

identification). Of special interest is the further improvement of protein-DNA interaction 

assays to understand and combine RNA expression data with data from classical 

proteomic approaches. In the field of chemical genomics (protein-small molecule interactions) 

microarray techniques will help to verify potential drug targets. All these 

methods will help us to reveal the function of proteins and to identify new biologically 

active compounds and will lead to a better understanding of cellular processes. 



(Cahill/Kersten/Kreutzberger/Seitz) 

Angenendt P, Glökler J, Konthur Z, Lehrach 

H & Cahill DJ (2003). 3D protein microarrays: 

performing multiplex immunoassays on 

a single chip. Anal Chem 75:4368-4372 

Angenendt P, Glökler J, Sobek J, Lehrach H 

& Cahill DJ (2003). The next generation of 

protein microarray support materials: an 

evaluation for protein and antibody microarray 

applications. J Chromatography A 1009: 

97-104 

Kersten B, Feilner T, Kramer A, Wehrmeyer 

S, Possling A, Witt I, Zanor MI, Stracke R, 

Lueking A, Kreutzberger J, Lehrach H, 

Cahill DJ (2003). Generation of Arabidopsis 

protein chips for antibody and serum screening. 

Plant Mol Biol 52: 999-1010 

Lueking A, Horn S, Lehrach H, Cahill DJ (2003). 

A dual-expression vector allowing expression in 

E. coli and P. pastoris, including new modifications. 

Methods Mol Biol 205:31-42 

Angenendt P, Glokler J, Murphy D, Lehrach 

H, Cahill DJ (2002). Toward optimized antibody 

microarrays: a comparison of current 

microarray support materials. Anal Biochem 

309(2):253-60 

Egelhofer V, Gobom J, Seitz H, Giavalisco P, 

Lehrach H & Nordhoff E (2002). Protein identification 

by MALDI-TOF-MS peptide mapping: 

a new strategy. Anal Chem Apr 

15;74(8):1760-71 


H, Walter G, Nordhoff E, Nyarsik L & Bussow 



Biochem Eng Biotechnol 77:103-12 (review)

Kersten B, Bürkle L, Kuhn EJ, Giavalisco P, 



proteomics. Plant Mol Biol 48 (special issue):133-141 

(review) 

Kersten B, Kasper P, Brendler-Schwaab SY 

& Müller L (2002). Use of the photo-micronucleus 

assay in Chinese hamster V79 cells to 

study photochemical genotoxicity. Mutation 

Res 519:49-66 

Schmidt F, Lueking A, Nordhoff E, Gobom J, 

Klose J, Seitz H, Egelhofer V, Eickhoff H, 

Lehrach H & Cahill DJ (2002). Generation 

of minimal protein identifiers of proteins from 

2D gels and recombinant proteins. Electrophoresis 

23:621–625 

Walter G, Bussow K, Lueking A & Glokler J 

(2002). High-throughput protein arrays: prospects 

for molecular diagnostics. Trends Mol 

Med 8(6):250-3 (review) 

Weigel C & Seitz H (2002). Strand-specific 

loading of DnaB helicase by DnaA to a substrate 

mimicking unwound oriC. Mol 

Microbiol 46(4):1149-56 

Bussow K, Konthur Z, Lueking A, Lehrach H 

& Walter G (2001). Protein array technology. 

Potential use in medical diagnostics. Am J 

Pharmacogenomics 1(1):37-43 (review) 

Cahill DJ (2001). Protein and antibody arrays 

and their medical applications. J Immunol 

Methods 250(1-2):81-91 

Glinkowska M, Konopa G, Wegrzyn A, 

Herman-Antosiewicz A, Weigel C, Seitz H, 

Messer W & Wegrzyn G (2001). The double 

mechanism of incompatibility between lambda 

plasmids and Escherichia coli dnaA(ts) host 

cells. Microbiol 147(Pt 7):1923-1928 

Holz C, Lueking A, Bovekamp L, Gutjahr C, 

Bolotina N, Lehrach H & Cahill DJ (2001). A 

human cDNA expression library in yeast enriched 

for open reading frames. Genome Res 

11(10):1730-5 

Kersten B, Kasper P, Brendler-Schwaab SY 

& Müller L (2001). Effects of visible light absorbing 

chemicals in the photo-micronucleus 

test in Chinese hamster V79 cells. Environ 

Mutagen Res 23 (special issue):97-102 

Kersten B, Niemann B & Jahn S (2001). 

Development of single-chain Fv fragments 

from a human anti-double-stranded DNA antibody 

to study the influence of somatic mutations 

on antigen binding. Exp Clin Immunogenetics 

18: 96-99 

Lueking A, Holz C, Gotthold C, Lehrach H & 

Cahill D (2000). A system for dual protein 

expression in Pichia pastoris and Escherichia 

coli. Protein Expr Purif 20(3):372-8 

Messer W, Blaesing F, Jakimowicz D, Krause 

M, Majka J, Nardmann J, Schaper S, Seitz H, 

Speck C, Weigel C, Wegrzyn G, Welzeck M 

& Zakrzewska-Czerwinska J (2001). Bacterial 

replication initiator DnaA. Rules for DnaA 

binding and roles of DnaA in origin unwinding 

and helicase loading. Biochimie 83(1):5- 

12 

Müller L, Brendler-Schwaab S, Kasper P & 

Kersten B (2001). In vitro methods for 

phototoxicity and photocarcinogenicity testing 

of drugs. Altex-Alternativen zu 

Tierexperimenten 18:117-121 (review) 

Seitz H, Welzeck M & Messer W (2001). A 

hybrid bacterial replication origin. EMBO 

Rep 2(11):1003-6 

Zhang J, Kersten B, Kasper P & Müller L 

(2001). Photogenotoxicity and apoptosis in 

human HaCaT keratinocytes induced by 8methoxypsoralen 

and lomefloxacin. Environ 

Mutagen Res 23 (special issue):89-96 

Cahill DJ (2000). Protein Arrays: a high 

throughput solution for proteomics research? 

In Blackstock W & Mann M, eds., Proteomics: 

A Trends Guide.Elsevier Science, pp 49-53 

Cahill DJ, Nordhoff E, O´Brien J, Klose J, 

Eickhoff H & Lehrach H (2000). Bridging 

genomics and proteomics. In Pennington S & 

Dunn M, eds., Proteomics, BIOS Scientific 

Publishers Ltd, pp 1-17 

Seitz H, Weigel C & Messer W (2000). The 

interaction domains of the DnaA and DnaB 

replication proteins of escherichia coli. Mol 

Microbiol 37(5):1270-9 

Walter G, Bussow K, Cahill D, Lueking A & 

Lehrach H (2000). Protein arrays for gene 

expression and molecular interaction screening. 

Curr Opin Microbiol 3(3):298-302 (review) 

Duitman EH, Hamoen LW, Rembold M, 

Venema G, Seitz H, Saenger W, Bernhard F, 

Reinhardt R, Schmidt M, Ullrich C, Stein T, 

Leenders F & Vater J (1999). The mycosubtilin 

synthetase of Bacillus subtilis ATCC6633: a 

multifunctional hybrid between a peptide synthetase, 

an amino transferase, and a fatty acid 

synthase. PNAS USA 96(23):13294-9 



63


64 

Lueking A, Horn M, Eickhoff H, Büssow K, 

Lehrach H & Walter G (1999). Protein microarrays 

for gene expression and antibody 

screening. Anal Biochem 270:103-111 

Messer W, Blaesing F, Majka J, Nardmann J, 

Schaper S, Schmidt A, Seitz H, Speck C, 

Tungler D, Wegrzyn G, Weigel C, Welzeck M 

& Zakrzewska-Czerwinska J (1999). Functional 

domains of DnaA proteins. Biochimie 

81(8-9):819-25 

Weigel C, Schmidt A, Seitz H, Tungler D, 

Welzeck M, Messer W (1999). The N-terminus 

promotes oligomerization of the Escherichia 

coli initiator protein DnaA. Mol Microbiol 

34(1):53-66 




antibody screening of high-density filters of an 

arrayed cDNA library. Nucleic Acids Res 26: 

5007-5008 

Kersten B, Zhang J, Brendler-Schwaab SY, 

Kasper P & Müller L (1999). The application 

of the micronucleus test in Chinese hamster 

V79 cells to detect drug-induced 

photogenotoxicity. Mutation Res 445:55-71 

Leibiger H, Kersten B, Albersheim P & Darvill 

A (1998). Structural characterization of the 

oligosacharides of a human monoclonal antilipopolysaccharide 

immunoglobulin M. 

Glycobiol 8:497-507 

Müller L, Kasper P, Kersten B & Zhang J 

(1998). Photochemical genotoxicity and photochemical 

carcinogenesis-Two sides of a 

coin? Toxicol Lett 102-103:383-387 (review) 


Biofuture: 3D Protein and Antibody chips. 

DHGP: Gene expression profiling in murine 

T cells for identification and functional analysis 

of T cell gene regulatory networks that are 

implicated in autoimmune diseases. Subproject 

High-throughput protein expression for functional 

analysis in murine T cells. 

DHGP: Gene Expression profile analysis on 

normal and dilated human cardiomyopathy 

tissues. Subproject Protein catalog of normal 

and dilated human cardiomyopathy tissues, a 

high-throughput approach. 

EU: A new vaccine strategy against serogroup 

B meningococcal infection: from antigen discovery 

to clinical trials. Subproject Brigding 

genomics and proteomics. 

BMBF: Development of Platform Technologies 

for Functional Proteome Analysis. Subproject 

Application to Human Brain. 

GABI: Large-scale automated plant proteomics 

(LAPP). Subproject Generation of 

Arabidopsis and Barley protein expression libraries 

and chips. 

Co-operations 

Mark Achtmann, MPI für Infektionsbiologie, 

Berlin 

Colin Tinsley, Inserm, France 

Elizabeth Wedege, National Institute for Public 

Health, Norway 

Birgit Niemann, Bundesinstitut für Risikobewertung, 

FB Ernährungsmedizin und Lebensmitteltoxikologie, 

Berlin 

Pierre Hilson Group, Gent University-VIB, 

Dept. of Plant Systems Biology, Gent, Belgium 

(co-ordinator of the EU initiative ORFEUS) 

Winfriede Weschke, Volodymyr Radchuk, 

Dept. of Prof. Ulrich Wobus, Institute for Plant 

Genetics and Crop Plant Research (IPK), 

Gatersleben 

Ralf Stracke, Group of Bernd Weisshaar, Max 

Planck Institute for Plant Breeding, Köln 

Richard Immink, Gerco Angenent Group, 

Plant Research International, Wageningen, The 

Netherlands 

Dept. of Bernhard Korn, Forschungs- u. Entwicklungsgruppe, 

RZPD-Deutsches Ressourcenzentrum 

für Genomforschung GmbH, 

Heidelberg 

Isabel Witt, Maria Ines Zanor, Bernd Müller- 

Röber Group, Mirko Glinski, Wolfram 

Weckwerth Group, Uni Potsdam / Max Planck 

Institute of Molecular Plant Physiology, Golm 

Ramón Díaz Orejas, Centro de Investigaciones 

Biológicas, Madrid, Spain 

Wegrzyn Grzegorz, University of Gdansk, 

Gdansk, Poland 

Helmut E. Meyer, Institut für Physiologische 

Medizin, MPC, Ruhr-Universität Bochum 

Joachim Klose, Institut für Humangenetik, 

Charite Berlin 

Friedrich Herberg, Universität Kassel

Cardiovascular Genetics Group 

Head: 

Dr. Silke Sperling 

Phone: +49 (0)30-8413 1232 

Fax: +49 (0)30-8413 1380 

Email: sperling@molgen.mpg.de 

Scientists: 

Dr. Christina Grimm (since 12/02) 

Dr. Andreas Rickert (since 4/03) 

Dr. Martin Hillebrand (since 7/03) 


Bogac Kaynak (since 1/01) 

Martin Lange (since 4/03) 

Dominik Seelow (since 11/00) 


Jan Vogel (since 6/03) 

Katrin Bach (since 8/03) 

Technician: 

Ilona Dunkel (since 1/02) 


Defects in organogenesis underlie a multitude of human birth 

defects. The heart is the earliest organ to form and appears to be 

the most susceptible to perturbations, as congenital heart defects 

(CHD) are the most common birth defect. They arise in utero 

during development of the embryo and affect 1 in every 100 

infants born. Since the majority of CHD can be traced to abnormalities 

in specific developmental milestones, the detailed phenotypical 

description of analysed heart defects remains to be the 

first step for their association with genetic abnormalities and environmental 

influences. Although significant progress has been 

made in mouse genetic models of cardiac development, suggesting 

candidate genes for human CHD, little is known about 

genetics basis of CHD in human. The global genetic network 

and the interaction between genes and environment in the development 

of heart defects remains to be uncovered in the future. 

Our group founded about three years ago includes members with 

clinical, biological and bioinformatic background and aims on a 

long term to partially elucidate the genetic network involved in 

the cardiac development process. During the term, we intended 

to collect patient samples and establish a phenotyping database 

for CHD and to identify genes associated with CHD in human 

using a gene expression profiling approach. 

d-matrix 

We developed a dedicated phenotyping scheme for CHD, which 

is based on the International Classification of CHD but structured 

with regard to the different cardiac segments raising at 

certain developmental milestones. For storage of these phenotype 

information and their association with obtained molecular 

data, we set up a relational database (Oracle 8i). Until now, we 



Figure 1: Overview of probability 

values and expression 

levels for different 

phenotype comparisons. 

Each comparison is represented 

by one column and 

each gene by one row. The 

–log 10 (P) of each gene in 

the particular comparison 

is colour-coded in yellow 

to red for upregulated and 

yellow to green for downregulated 

genes. Comparison 

Tetralogy of Fallot 

(TOF in RV), Ventricle 

Septal Defect (VSD in RA) 

and right ventricular 

hypertrophy (RVH in RV) 

versus normal heart tissue of the same location resp. right 

ventricle (RV) or atrium (RA). Comparison atrium versus 

ventricle (A vs V) and right versus left ventricle (RV vs LV). 

65


66 

collected samples and phenotype information of 350 patients after informal consents. As the 

phenotyping scheme consists of 150 different attributes and 400 values for each dataset, a major 

challenge of the project was the development of a graphical front-end, allowing a dedicated 

user-specified display of the stored information, satisfying the association of phenotype with 

molecular data and handling simple analysing procedures. Based on these needs we developed 

“d-matrix”, a data mining software with a display of three dimensions in form of colour-coded 

boxes or bars arranged as a matrix. Furthermore, d-matrix can normalise and categorise data 

prior to their display. Taking together, our investigation have led us to be a project co-ordinator 

for the development of a European Union database for CHD as part of an “European network 

of the genomics of heart muscle development and diseases”. In addition, we could submit a 

patent for d-matrix and currently investigate the foundation of a company supplying d-matrix as 

software applicable to any database, independent of the data context. 

Array analysis 

Our molecular efforts 

have focused on 

the study of differences 

in transcription 

profiles between normal 

and malformed 

human hearts, which 

can give clues about 

the involved diseases 

genes. We accomplished 

a genomewide 

array analysis 

of cardiac samples 

from different CHD 

(Tetralogy of Fallot 

and Ventricular Septal 

Defect) and from 

Figure 2: Association of functional gene categories (blue) to studied phenotypes 

(red) with respect to differential gene expression received by app. 9 million 

measurements. Biplot obtained from correspondence analysis. Categories that 

are not specifically associated with any phenotype are represented by dots. 

samples reflecting the cardiac adaptation to their aberrant diseases state (right ventricular 

hypertrophy caused by pressure overload) (Kaynak et al., 2003). The statistical analysis 

was undertaken in close collaboration with Dr. A. von Heydebreck at the “Computational 

Biology Department” at the institute. In summary, we have been able to identify distinct 

gene expression profiles for the analysed phenotypes. Our study design allowed the suggestion 

that alterations associated with primary genetic abnormalities can be distinguished 

from those associated with the adaptives response of the heart to the malformation. We 

could present data on chamber-specific gene expression in the normal human heart and 

selected a set of 4300 genes that appeared to be persistently transcribed in the human 

heart. These investigations were presented oral at the Weinstein Meeting (Boston 2003) 

and the International Conference of Genetics (Melbourne 2003). 

Triple A 

In collaboration with Prof. A. Hübner, we identified the diseases causing gene for Triple 

A syndrome, a rare autosomal recessive disorder characterised by adrenal insufficiency, 

achalasia and alacrima (Handschug et al., 2001). 


The above findings have led us to investigate now a broader range of diseases associated 

genes on the genomic, transcriptional and protein level in human and mice models. 

Using whole mount in situ hybridisation, we started to screen the diseases associated 

genes for their expression profile during heart development in mice. Out of 20 

genes analysed so far, we were able to show the expression of 5 genes during cardiac 

development, of which one very promising gene is functionally unknown. Further 

studies of our candidate genes will focus at the protein level on the identification of

protein interaction partners and at the genomic level on the screening for sequence 

alterations in our patient population (Rickert et al., submitted). In addition, we are 

purchasing further bioinformatic and later laboratory investigations of our array-data 

to identify the transcriptional network involved in the regulation of our differentially 

expressed genes. 



Kaynak B, von Heydebreck A, Mebus S, 

Seelow D, Hennig S, Vogel J, Sperling H-P, 

Pregla R, Alexi-Meskishvili V, Hetzer R, Lange 

PE, Vingron M, Lehrach H, Sperling S (2003). 

Genome-wide array analysis of normal and 

malformed human hearts. Circulation 107: 

2467-2474 

Handschug K, Sperling S, Yoon KS, Hennig 

S, Clark A & Huebner A (2001). Triple A syndrome 

is caused by mutations in AAAS, a new 

WD-repeat protein gene. Hum Mol Genet 10 

(3): 283-90 

Patents 

Seelow D, Lehrach H & Sperling S. Verfahren 

und Vorrichtung zur grafischen Darstellung, 

Patent application, GBC Nr.: 0301-3189, 2003 


National Genome Research Network (NFGN), 

TP Patientenmatrix 

Nutrigenomics, BioProfile Potsdam/Berlin: 

Verbundvorhaben Innovation des Therapiekonzeptes 

für das metbalische Syndrom – TP: 

Entwicklung eines “HYPER-Chips” 

MPG-Tandem-Project Differentielle Genexpression 

kongenital malformierter Herzen 

Co-operations 

BMBF Klinisches Kompetenznetz Angeborene 

Herzfehler, Sprecher Prof. Dr. Peter E. 

Lange 

Prof. Dr. Roland Hetzer, Prof. Dr. Peter E. 

Lange, Deutsches Herzzen-trum Berlin 

Prof. Dr. Angela Hübner, Universitätsklinikum 

Dresden 

Prof. Dr. Jochen Kreuder, Universitätsklinikum 

Giessen, Molekulare Kardiologie 

Prof. Dr. Walter Zidek, PD Dr. Eva Brand, 

Charité Universitätsmedizin Berlin, Campus 

Benjamin Franklin 

Dr. Anja von Heydebreck, Dept. Vingron 

Prof. Dr. Martin Vingron, Transcriptional regulation 

Group, Dept. Vingron 

Dr. Edda Klipp, Dept. Lehrach 

Dr. Bernhard Korn, Dr. Uwe Radelof, RZPD 

Heidelberg, Berlin 

Public relations 

Our recent article in Circulation received a 

press release note by the American Heart Association, 

beside the press release of our institute. 

The work was also published in 

GenomXpress: Sperling S (2003), Gen-Chip 

Analyse zeigt genetische Muster bei angeborenen 

Herzfehlern, GenomXpress 2: 8-6 



67


68 

Genomic Sequencing & Gene Function in 

Complex Diseases Group 

Head: 

Ralf Sudbrak, PhD 

Phone: +49 (0)30-8413 1612 

Fax: +49 (0)30-8413 1380 

Email: sudbrak@molgen.mpg.de 

Technicians: 

Karl-Heinz Rak 

Anna Kosiura 


Our group is working on two main subjects: genomic sequencing in human and model organisms 

and clone and transcript mapping for providing sequence-ready maps as well as for disease 

gene identification. 

The team started with the chromosome-wide mapping efforts of human chromosome X, but 

shifted their attention also to other regions of the human genome. Next to chromosome X one 

major region of interest is chromosome 3q21. We contributed sequence-ready maps required 

for the genomic sequencing of human chromosome X and 3. We established a gene catalogue of 

the human X chromosome based on sequencing comparison between genomic sequence and 

UniGene cDNA sequences. Based on this catalogue we generated the first chromosome-specific 

cDNA microarray. The Integrated X Chromosome Database (IXDB) was established in 

1996 and is maintained since than. IXDB serves as a repository for data connected to the X 

chromosome. Since 2000 the team is also involved in the genomic sequencing of selected parts 

of human chromosomes 1, 3, 17, and X. In addition, we are involved in sequencing projects of 

parts of chromosome 2 and 6 of mouse, the MHC of the rat (RT1), and parts of the rhesus MHC. 

Recently, we contributed to the finished sequence of chimpanzee chromosome 22 the equivalent 

of human chromosome 21, a project coordinated in Germany by M.-L. Yaspo. One major 

topic of our group is the experimental verification of differences within the coding regions 

between chimpanzee and human. Projects to contribute to the sequencing of chimpanzee chromosomes 

X and Y are initiated, which special emphasis to Xq28 and regions associated with 

mental retardation. In addition to mapping and sequencing, we are involved in several disease 

gene identification projects. We contributed towards the successful cloning of BSND (Bartter 

syndrome with sensorineural deafness and kidney failure, chromosome 1), NPHP4 

(nephronophthisis and retinitis pigmentosa, chromosome 1), ATPC1 (Hailey-Hailey disease, 

chromosome 3), NPHP3 (adolescent nephronophthisis type 3, chromosome 3), DNAH5 (primary 

cilary dyskinesia, chromosome 5), and TM4SF2 (X-linked mental retardation, chromosome 

X). 

Future developments 

Sequencing selected regions of chimpanzee chromosomes X and Y. Additional disease-related 

projects are well under way e.g. deafness, and various forms of cilary defects.



Olbrich H, Fliegauf M, Hoefele J, Kispert A, 

Otto E, Volz A, Wolf MT, Sasmaz G, Trauer 

U, Reinhardt R, Sudbrak R, Antignac C, Gretz 

N, Walz G, Schermer B, Benzing T, Hildebrandt 

F & Omran H (2003). Mutations in a 

novel gene, NPHP3, cause adolescent nephronophthisis, 

tapeto-retinal degeneration and 

hepatic fibrosis. Nature Genetics 34: 455-459 

Sudbrak R, Reinhardt R, Hennig S, Lehrach 

H, Gunther E & Walter L (2003) . Comparative 

and evolutionary analysis of the rhesus 

macaque extended MHC class II region. Immunogenetics 

54:699-704 

Otto E, Hoefele J, Ruf R, Mueller AM, Hiller 

KS, Wolf MT, Schuermann MJ, Becker A, 

Birkenhger R, R, Sudbrak R, Hennies HC, 

Nurnberg P & Hildebrandt F (2002). A gene 

mutated in nephronophthisis and retinitis 

pigmentosa encodes a novel protein, nephroretinin, 

conserved in evolution. Am J Hum 

Genet 71: 1161-1167 

Schickel J, Stahn K, Zimmer KP, Sudbrak R, 

Storm TM, Durst M, Kiehntopf M & Deufel 

T (2002). Gene for integrin-associated protein 

(IAP, CD47): physical mapping, genomic 

structure, and expression studies in skeletal 

muscle. Biochem Cell Biol 80: 169-176 

Walter L, Hurt P, Himmelbauer H, Sudbrak 

R & Gunther E (2002). Physical mapping of 

the major histocompatibility complex class II 

and class III regions of the rat. Immunogenetics 

54: 268-275 

Olbrich H, Haffner K, Kispert A, Volkel 

A, Volz A, Sasmaz G, Reinhardt R, Hennig 

S, Lehrach H, Konietzko N, Zariwala M, 

Noone PG, Knowles M, Mitchison HM, 

Meeks M, Eddie M.K. Chung EMK, 

Hildebrandt F, Sudbrak R & Omran H 

(2002). Mutations in DNAH5 cause primary 

ciliary dyskinesia and randomization 

of left-right asymmetry. Nature Genetics 

30: 143-144 

Dobson-Stone C, Fairclough R, Dunne E, 

Brown J, Dissanayake M, Munro CS, Strachan 

T, Burge S, Sudbrak R, Monaco AP & 

Hovnanian A (2002). Hailey-Hailey disease: 

Molecular and clinical characterisation of 

novel mutations in the ATP2C1 gene. J Invest 

Dermatol 118: 338-343 

Birkenhager R, Otto E, Schurmann MJ, 

Vollmer M, Ruf E-M, Maier-Lutz I, Beekmann 

F, Fekete A, Konrad M, Jeck N, Feldmann D, 

Milford D,Antignac C, Sudbrak R, Kispert 

A & Hildebrandt F (2001). Mutation of BSND 

causes Bartter syndrome with sensorineural 

deafness and kidney failure. Nature Genetics 

29: 310-314 

Nolte, D, Ramser J, Niemann S, Lehrach H, 

Sudbrak R & Mueller U (2001). ACRC codes 

for a novel nuclear protein with unusual acidic 

repeat tract and maps to DYT3 (dystonia parkinsonism) 

critical interval in Xq13.1. Neurogenetics 

3, 207-213 

International Human Genome Sequencing 

Consortium. (2001). Initial sequencing and 

analysis of the human genome. Nature 409: 

860-921 

The International Human Genome Mapping 

Consortium (2001). A physical map of the 

human genome. Nature 409: 934-94 

Sudbrak R, Wieczorek G, Nuber UA, Mann 

W, Kirchner R, Erdogan F, Brown CJ, Wohrle 

D, Sterk P, Kalscheuer VM, Berger W, Lehrach 

H & Ropers HH (2001). X chromosome-specific 

cDNA arrays: identification of genes that 

escape from X-inactivation and other applications. 

Hum Mol Genet 10:77-83 

Omran H, Haffner K, Burth S, Fernandez C, 

Fargier B, Villaquiran A, Nothwang HG, 

Schnittger S, Lehrach H, Woo D, Brandis M, 

Sudbrak R & Hildebrandt F (2001). Human 

Adolescent Nephronophthisis: Gene Locus 

Synteny with Polycystic Kidney Disease in Pcy 

Mice. J Am Soc Nephrol 12:107-113 

Sudbrak R, Brown J, Dobson-Stone C, Carter 

S, Ramser J, White J, Healy E, Dissanayake 

M, Larregue M, Perrussel M, Lehrach H, 

Munro CS, Strachan T, Burge S, Hovnanian 

A & Monaco AP (2000). Hailey-Hailey disease 

is caused by mutations in ATP2C1 encoding 

a novel Ca(2+) pump. Hum Mol Genet 

9:1131-40 

Jakubiczka S, Mitulla B, Liehr T, Arnemann 

J, Lehrach H, Sudbrak R, Stumm M, 

Wieacker PF & Bettecken T (2000). Incidental 

prenatal detection of an Xp deletion using 

an anonymous primer pair for fetal sexing. 

Prenat Diagn 20: 842-846 



69


70 

McDonell N, Ramser J, Francis F, Vinet MC, 

Rider S, Sudbrak R, Riesselman L, Yaspo 

ML, Reinhardt R, Monaco AP, Ross F, Kahn 

A, Kearney L, Buckle V & Chelly J (2000). 

Characterization of a highly complex region 

in Xq13 and mapping of three isodicentric 

breakpoints associated with preleukemia. 

Genomics 64: 221-229 

Zemni R, Bienvenu T, Vinet MC, Sefiani A, 

Carrie A, Billuart P, McDonell N, Couvert P, 

Francis F, Chafey P, Fauchereau F, Friocourt 

G, Portes Vd, Cardona A, Frints S, Meindl A, 

Brandau O, Ronce N, Moraine C, Bokhoven 

Hv, Ropers HH, Sudbrak R, Kahn A, Fryns 

JP, Beldjord C & Chelly J (2000). A new gene 

involved in X-linked mental retardation identified 

by analysis of an X;2 balanced translocation. 

Nature Genet 24:167-170 

Leser U, Roest Crollius H, Lehrach H & 

Sudbrak R (1999). IXDB, an X chromosome 

integrated database (update). Nucleic Acids 

Res 27:123-127 


EU: QLRT-2001-01049: Clinical features associated 

with Tropheryma whipplei infection 

an European setting – Pathogenesis, diagnosis 

and treatment of Whipple’s disease (11/01 

– 10/05) 

BMBF: 01KW0001: Disease gene-oriented 

genomic sequence analysis of medically important 

regions of the human genome and homologous 

regions of the mouse genome (1/01 

– 6/04) 

EU: CT99-00791: A complete collection of X 

chromosome genes: an important tool for systematic 

expression studies and disease gene 

identification (3/00 – 8/03) 

BMBF 01KW9706: Genomic sequence 

analysis of human chromosoms 21 and selected 

regions of the human genome (5/97 – 6/ 

01) 

EU: CT97-2240: Characterization of the 

CEPH-Genset Bacterial Artificial Chromosome 

(BAC) Library, A European Resource 

for Preparing Sequence Ready Maps (6/ 

97 – 5/00) 

BMBF: 01KW97065 Molecular analysis of 

the Vertebrate genome; part 2: Molecular 

analysis of the human X chromosome (9/96 – 

8/00) 

EU: CT96-1134: Construction of an integrated 

transcriptional map of the human X chromosome 

(7/96 – 6/99)

Chromosome 21 Group 

Head: 

Marie-Laure Yaspo 

Phone: +49 (0)30-8413 1356 

Fax: +49 (0)30-8413 1380 

Email: yaspo@molgen.mpg.de 

Scientists: 

Alia Ben Kahla 

Pascal Kahlem (until 8/2003) 


Hans-Jörg Warnatz 

Marc Sultan 

Ilaria Piccini (visiting PhD student, presently 

in maternity leave) 


Reha Yildirimann 

Technicians: 

Sabine Schrinner (presently in maternity 

leave) 

Daniela Balzereit 

Barbara Eppens 


The team is mainly involved in the molecular genetic analysis of Human chromosome 21 

(HSA21), from the DNA sequence to the identification and characterization of its genes. 

We have co-ordinated the mapping and sequencing of HSA21 in the International consortium 

initiated in 1997, leading to the publication of the complete sequence of this chromosome 

in May 2,000 (Hattori et al. 2000). We contributed a large part of the sequenceready 

maps required for the genomic sequencing of HSA21 (Hildman et al. 1999). For 

this, we also established the fiber fish technique (Horelli-Kuitunen et al. 1999) as a routine 

in co-operation with T. Haaf and HH. Ropers. We were the main player in the establishment 

of the HSA21 gene catalog initially deduced from the genomic sequence analysis. 

HSA21 is a „gene-poor“ chromosome, and our initial publication was one of the first 

reports suggesting that the human genome may contain no more than 40,000 genes. We 

are regularly updating the HSA21 gene catalog and database maintaining a „curated“ 

catalog, which is now estimated to contain 281 protein-coding genes (http:// 

chr21.molgen.mpg.de). The sequencing of the equivalent of HSA21 in chimpanzee, that 

is chimp chr.22 or PTR22, was initiated in June 2001 by an International consortium 

under the co-ordination of RIKEN (Fujiyama et al. 2002). The sequence of chimp PTR22 

was released on October 7, 2003. Chimp is the closest non-human primate and comparative 

genomics between HSA21 and PTR 22 is expected to reveal evolutionary features 

that will contribute to understand better how the two genomes have been shaped. The 

gene promoter analysis is performed in co-operation with A. Kel and M. Vingron. Our 

participation to the PTR22 project is funded by NGFN1, within the German genomic 

sequencing consortium. 

The function of more than half of the human genes is unknown. We are characterizing the 

HSA21 genes using systematic functional genomics approaches contributing to understand 

their biological role in health and disease (funded by NGFN1 platforms 2, 3, 4 and 7). We have 

generated a gene expression map for most of the HSA21 gene orthologs in the mouse, by using 



71


72 

a combination of RNA in situ hybridization 

(ISH), cDNA chip profiling, and EST mining 

(Gitton et al., 2002). Here, we have identified a 

number of genes showing a restricted pattern 

of expression at mid-gestation and/or in neonatal 

brain, identifying potential players in organogenesis 

or/and in brain development (http:/ 

/chr21.molgen.mpg.de/hsa21/, co-operation 

with B. Herrmann). 

This study is now being extended to the 

screening of HSA21 genes that may be involved 

in skeletal growth, in co-operation 

with S. Mundlos. Complementing our work 

on the transcriptome, we are generating tools 

for proteomics studies. We have cloned most 

of the HSA21 open reading frames (ORFs) 

which were expressed either in bacterial systems 

for subsequent generation of antibod- 

Examples of gene expression patterns in the mouse at mid-gestation 

(left) and in neonatal brain (right). 

ies in chicken (GENETEL) and protein and antibody chips, or in eukaryotic cells for 

visualizing their sub-cellular localization (M. Janitz). We are analysing the „interactome“ 

of HSA21 proteins by means of yeast two-hybrid system (S. Krobitch and E. Wanker). 

Further functional characterization of ten selected HSA21 genes in the worm C. elegans 

is explored by using RNAi technology (co-operation with A. Antebi). 

One of the major medical interests of the group is the study of trisomy 21 or Down syndrome 

(DS), affecting 1/1,000 live births and representing the most frequent genetic cause of mental 

retardation in humans. Our goal is to contribute to the understanding of the molecular basis of 

the DS patho-physiology (Kahlem and Yaspo, 2000). In order to identify markers of trisomy, we 

are currently analyzing gene expression profiles of essentially two types of human trisomic 

cells, fibroblasts and trophoblasts, using cDNAchips interrogating the ENSEMBL gene collection 

(co-operation with D. Evain-Brion). We also aim at analyzing trisomic lymphoblastoid cell 

lines. Because of the limited access to human samples, we are working on a previously established 

mouse model of trisomy 21 (Ts65Dn), carrying half of the HSA21 gene orthologs at 

dosage imbalance, and recapitulating several phenotypic features of DS. Looking at nine tissues 

of the Ts65Dn, we showed that most of the trisomic genes were overexpressed by 50% as 

compared to control littermates (co-operation with R. Herwig). Interestingly, we found exceptions 

to this rule for a few genes that appeared compensated in one tissue but not in the others. 

Those projects are funded by Brahms Diagnostica, EU, NGFN1, and Fondation Lejeune. 

In a side project, we have cloned and characterized the AIRE gene, a novel transcription 

factor that we found mutated in a rare human monogenic autoimmune disease named 

APECED (The Finnish-German APECED consortium, 1997; Björses et al., 1998; Rinderle 

et al., 1999; Bleschschmidt et al., 1999). We collected patient samples and established 

lymphoblastoid cell lines in H.H. Ropers department. 

We are involved in several bioinformatics projects aimed at 1) developing tools for mining 

human and mouse EST data (to be extended to more species), and 2) designing cDNA-based 

chips representing the ENSEMBL gene collections in co-operation with the RZPD. We are also 

involved in the concept and development of the GenomeMatrix, a novel web interface for 

functional genomics in co-operation with RZPD and M. Vingron. This system is for instance 

being exploited for extracting functional information on the genes found dysregulated in trisomy. 

Future directions of the group are 1) to continue and expand the gene expression analysis 

with DS patients and mouse models, 2) accumulate knowledge on the function of the 

HSA21 genes and 3) to exploit comparative genomic information for the analysis of the 

promoters of HSA21 genes and their mouse/chimp orthologs.


Publications 12/1997-2003 

Gitton Y, Dahmane N, Baik S, Ruiz i Altaba 

A, Neidhardt L, Scholze M, Herrmann BG; 

Kahlem P, Ben Kahla A, Schrinner S, Yildirimman 

R, Herwig R, Lehrach H & Yaspo 

M-L (2002). A Gene Expression Map of Human 

Chromosome 21 Orthologs in the Mouse. 

Nature 420:586-590 

Fjiyama A, Watanabe I, Toyoda A, Taylor TD, 

Itoh, T, Tsai S-F, Park H-S, Yaspo M-L, 

Lehrach H, Chen Z, Fu G, Saitou N, Osoegawa 

K, de Jong PJ, Suto Y, Hattori M & Sakaki Y 

(2002). Construction and analysis of a Human 

chimpanzee comparative clone map. Science 

295:131-134 

Yaspo M-L (2001). Taking a functional 

genomics approach to molecular medicine. 

Trends Mol Med 7(11): 494-502 

Yaspo M-L (2001). Impact of the genome 

project on the identification of disease genes. 

Dialogues in clinical neurosciences 3(1):58-61 

International Human Genome Sequencing 

Consortium (in supplement. author list) (2001). 

Initial sequencing and analysis of the human 

genome. Nature 409:860-921 

Kahlem P & Yaspo M-L (2000). Human chromosome 

21 sequence: impact for the molecular 

genetics of Down syndrome. Gene Funct 

Dis 5/6:1-9 

Esposito G., Godindagger I, Klein U, Yaspo 

M-L, Cumano A & Rajewsky K (2000). Disruption 

of the Rev31-encoded catalytic subunit 

of polymerase zeta in mice results in early 

embryonic lethality. Curr Biol 5: 10 (19) 1221- 

1224. 

Brunner B, Grutzner F, Yaspo M-L, Ropers 

HH, Haaf T & Kalscheuer VM (2000). Molecular 

cloning and characterization of the 

Fugu Rubripes MEST/COPG2 imprinting 

cluster and chromosomal localization in Fugu 

and Tetraodon Nigroviridis. Chromosome Res 

8(6):465-476 

Guipponi M, Yaspo M-L, Riesselman L, Chen 

H, De Sario A, Roizes G & Antonarakis SE 

(2000). Genomic structure of a copy of the 

human TPTE gene which encompasses 87 kb 

on the short arm of chromosome 21. Hum 

Genet 107(2):127-131 

Hattori M, Fujiyama A, Taylor TD, Watanabe 

H, Yada T, Park HS, Toyoda A, Ishii K, Totoki 

Y, Choi DK, Soeda E, Ohki M, Takagi T, 

Sakaki Y, Taudien S, Blechschmidt K, Polley 

A, Menzel U, Delabar J, Kumpf K, Lehmann 

R, Patterson D, Reichwald K, Rump A, 

Schillhabel M, Schudy A, Zimmermann W, 

Rosenthal A; Kudoh J, Shibuya K, Kawasaki 

K, Asakawa S, Shintani A, Sasaki T, Nagamine 

K, Mitsuyama S, Antonarakis SE, Minoshima 

S, Shimizu N; Nordsiek G, Hornischer K, 

Brandt P, Scharfe M, Schön O, Desario A, 

Reichelt J, Kauer G, Blöcker H; Ramser J, 

Beck A, Klages S, Hennig S, Riesselmann L, 

Dagand E, Wehrmeyer S, Borzym K, Gardiner 

K, Nizetic D, Francis F, Lehrach H, Reinhardt 

R & Yaspo M-L (2000). The DNA sequence 

of human chromosome 21. Nature 405:311-319 

Slavov D, Hattori M, Sakaki Y, Rosenthal A, 

Shimizu N, Minoshima S, Kudoh J, Yaspo M- 

L, Ramser J, Reinhardt R, Reimer C, Clancy 

K, Rynditch A & Gardiner K (2000). Criteria 

for gene identification and features of genome 

organization: analysis of 6.5 Mb of DNA sequence 

from human chromosome 21. Gene 

247(1-2):215-232 

McDonell N, Ramser J, Francis F, Vinet M-C, 

Rider S, Sudbrak R, Riesselman L, Yaspo M- 

L, Reinhardt R, Monaco AP, Ross F, Kahn A, 

Kearney L, Buckle V & Chelly J (2000). Characterization 

of a highly complex region in Xq13 

and mapping of three isodicentric breakpoints 

associated with preleukaemia. Genomics 64 

(3):221-229 

Orti R, Rachidi M, Vialard F, Toyoma K, Lopes 

C, Taudien S, Rosenthal A, Yaspo M-L, Sinet 

P-M & Delabar JM (2000). Characterization 

of a novel gene, C21orf6, mapping to chromosome 

21q22.1 in a critical region involved 

in monosomy 21 phenotype and of its murine 

ortholog. Genomics 64(2): 203-210 

HildmanT, Kong X, O’Brien J, Riesselman L, 

Christensen HM, Dagand E, Lehrach H & 

Yaspo M-L (1999). A contiguous 3 Mb sequence-ready 

map in the S3-MX region on 

21q22.2 based on high throughput non-isotopic 

library screening. Genome Res 9(4):360-372 

Bleschschmidt K, Schweiger M, Wertz K, 

Poulsom R, Christensen H-M, Rosenthal A, 

Lehrach H & Yaspo M-L (1999). The mouse 

AIRE gene: comparative genomic sequencing, 

gene organization and expression. Genome 

Res 9 (2):156-166 



73


74 

Rinderle C, Christensen H-M, Schweiger S, 

Lehrach H & Yaspo M-L (1999). AIRE encodes 

a nuclear protein co-localizing with 

cytoskeletal filaments: altered sub-cellular distribution 

of mutants lacking the PHD zinc fingers. 

Hum Mol Genet 8(2): 277-290 

Horelli-Kuitunen N, Aaltonen J, Yaspo M-L, 

Eeva M, Wessman M, Peltonen L & Palotie A 

(1999). Mapping ESTs by fiber fish. Genome 

Res 9(1):62-71 

Björses P, Aaltonen J, Horelli-Kuitunen N, 

Yaspo M-L, Peltonen L (1998). Gene defect 

behind APECED: a new clue to autoimmunity. 

Hum Mol Genet 7(10): 1547-1553 

Yaspo M-L & Gardiner K (1998). Report of 

the 7th International workshop on human chromosome 

21. Cytogenet Cell Genet 82:1-12 

Groet J, Ives JH, South AP, Baptista PR, Jones 

TA, Yaspo M-L, Lehrach H, Potier MC, 

Vanbroeckhoven C & Nizetic D (1998). Bacterial 

contig map of the 21q11 region associated 

with Alzheimers-disease and abnormal 

myelopoiesis in down-syndrome. Genome Res 

8(4):385-398 

Yaspo M-L, Aaltonen J, Horelli-Kuitunen N, 

Peltonen L & Lehrach H (1998). Cloning of a 

novel human putative type Ia integral membrane 

protein mapping to 21q22.3. Genomics 

49:133-136 

Dahmane N, Ghezala GA, Gosset P, Chamoun 

Z, Dufresne-Zaccharia M-C, Lopes C, Rabatel 

N, Gassnova-Maugenre S, Chettouh Z, 

Abramowski V, Fayet E, Yaspo M-L, Korn 

B, Blouin J-L, Lehrach H, Poustka A, 

Antonorakis SE, Sinet P-M, Creau N, Delabar 

J-M (1998). Transcriptional map of the 2,5 Mb 

CBR-ERG region of chromosome 21 involved 

in Down syndrome. Genomics 48:12-23 

The Finnish-German APECED consortium. 

Group 1: Aaltonen J, Björses P, Perheentupa 

J, Horelli-Kuitunen N, Palotie A, Peltonen L; 

& Group 2: Lee YS, Francis F, Hennig S, Thiel 

C, Lehrach H, Yaspo, M-L (1997). An autoimmune 

disease, APECED, caused by mutations 

in a novel gene featuring two PHD-type zincfinger 

domains. Nature Genet 17:399-403 

Co-operations within the institute 

H. H Ropers 

S. Mundlos 

M. Vingron 

A. Antebi 

R. Reinhardt 

External academic co-operations 

Sequencing of human chromosome 21, with 

• RIKEN Genomic Sciences Center, 

Yokohama, Japan 

• GBF, Dept. of Genome Analysis, 

Braunschweig 

• Institute for Molecular Biotechnology, 

Jena 

Sequencing and annotation of chimpanzee 

chr.22, with 

• Chinese National Human Genome 

Center at Shanghai, China 

• KRIBB Genome Research Center, 

Daejeon, Korea 

• National Yang Ming University Genome 

Research Center, Taipei, Taiwan 

• National Institute of Genetics, Mishima, 

Japan 

• RIKEN Genomic Sciences Center, 

Yokohama, Japan 

• GBF, Dept. of Genome Analysis, 

Braunschweig 

• Institute for Molecular Biotechnology, 

Jena 

• Svante Pääbo, Max-Planck-Institute 

for Evolutionary Biology, Leipzig 

• Alexander Kel, Biobase 

• Martin Vingron, MPIMG 

Other external co-operations 

RZPD 

Roger Reeves, John Hopkins, Baltimore, USA 

Daniele Evain-Brion, INSERM U427, Universite 

of Pharmacie, Paris 

Leena Peltonen, National Public Health Institute, 

Dpt. of Molecular Medicine, Helsinki, 

Finland 

A. Richter, Prof. Hauffe, Kinderklinik Essen 

K. Rajewsky, Cologne University 

Ariel Ruiz i Altaba, Skirball Institute, NYU 

School of Medicine, USA 

Bernhard G. Herrmann, Max-Planck-Institute 

for Immunology, Dept. of Developmental Biology, 

Freiburg 

E. Wanker, MDC, Berlin 


Brahms Diagnostica 

ABI

Department of Human Molecular 

Genetics 

Introduction 

Head: 

Prof. Dr. Hans-Hilger Ropers 

Phone: +49 (0)30-8413 1240 

Fax: +49 (0)30-8413 1383 

Email: ropers@molgen.mpg.de 

Secretary: 

Hannelore Markert 

Phone: +49 (0)30-8413 1241 

Fax: +49 (0)30-8413 1383 

Email: markert@molgen.mpg.de 

The search for genetic factors in common diseases is hampered by their complexity and 

heterogeneity, which has been widely underestimated, and by the enormous size and variability 

of the human genome. Indeed, it has become apparent that several dozen genes 

contribute to the genetic predisposition for diabetes, and the same is true for a wide variety 

of other common disorders. Each of these genes increase or lower the individual 

disease risk only marginally, and because of the massive effects of lifestyle and other 

environmental factors, it is easy to see that the identification of these genetic risk factors 

will have little or no diagnostic consequences. The involvement of so many genes and 

non-genetic factors in the aetiology of common diseases must also greatly complicate the 

search for commercially attractive ‘block-buster’ drugs that are effective in the majority 

of the patients. Above all, the identification of specific base changes in the human DNA 

sequence conferring specific disease risks in a sea of functionally neutral sequence variants 

is a truly Herculean task. 

The crucial step for such attempts is the mapping of these risk factors to specific chromosomes 

and chromosomal regions. Unfortunately, the resolution of the population-based 

methods that are commonly employed in this context (such as the affected sib pair method) 

is relatively low, which explains the slow progress in this field. The identification of 

conserved haplotypes encompassing one to hundred thousand base pairs will not solve 

this problem, but it may reduce its size by an order of magnitude. Once the haplotype 

structure of all human populations is known, typing five hundred thousand instead of all 

five million individual single nucleotide polymorphisms may suffice to extract most of 

the relevant information. However, linking these haplotypes to disease and identifying the 

relevant genes will remain a major challenge. 

For almost all common disorders, including cardiovascular diseases, diabetes, dementia 

or cancer, there are varieties which are transmitted as monogenic traits. This is particularly 

striking for mental retardation, a common disorder with a prevalence (in Western societies) 

of about 2,5 percent, since most of the severe cases, with an IQ of below 50, are due 



75

76 

Department of 

Human Molecular Genetics 

to defects of single genes or to chromosomal abnormalities. To date, about 5,500 single 

gene disorders are known, and only a quarter of these have been elucidated. However, 

with the human genome comprising about 30,000 genes, this cannot be more than the 

proverbial tip of the iceberg, and it is safe to predict that many more disorders will be 

identified that are due to defects of single genes. 

The recent completion of the human genome sequence has greatly facilitated the identification 

of the molecular defects underlying monogenic disorders. If one and a half decades ago, it took 

several years to map and identify the gene defects underlying Duchenne muscular dystrophy 

and cystic fibrosis by positional cloning, today this task would be completed within weeks if not 

days, and at a tiny fraction of the previous costs. Indeed, in the Eighties, the central argument for 

sequencing the human genome has been the prediction that it would lead to the diagnosis and 

prevention of all genetic disorders, and eventally, to therapy. It is somewhat ironic, therefore, 

that since several years, government-funded genome research in developed countries has concentrated 

almost exclusively on common complex disorders. On the other hand, no systematic 

attempts have been made so far anywhere in the world to accomplish the original mission of the 

human genome programme, i.e. to elucidate the molecular basis of the genetic diseases that are 

due to defects of single genes. 

Focusing initially on eye disorders and deafness, our group has been one of the first in 

Europe to use positional cloning strategies for the identification of the underlying genetic 

defects (Cremers et al, 1990). We were also the first to perform large-scale characterization 

of disease-associated balanced chromosome rearrangements (DBCRs) as a way to 

clone disease genes in a systematic fashion (see below). Roughly 50 percent of these 

DBCRs were found to be associated with (syndromic or non-syndromic) forms of mental 

retardation (MR). These findings, and the fact that mental retardation is one of the biggest 

unsolved problems in Clinical Genetics, have convinced us that MR should become the 

central research theme of our department. 

Recruitment and clinical characterization of patients and 

families 

The most important factor limiting large-scale research into monogenic disorders is the 

availability of clinically well-characterized patients and families with Mendelian phenotypes. 

Since almost all of these families are seen by the Clinical Geneticist, we had proposed 

to generate a network linking all major Clinical Genetic Centres in Germany for the 

recruitment and clinical characterization of such families. Despite unanimously positive 

recommendations by international reviewers, this proposal was eventually rejected because 

it ‘did not fit into the framework of the NGFN’. Therefore, we have established 

formalized bilateral and multilateral collaborations with suitable partners in Europe and 

elsewhere for collaborative, systematic research into mental retardation and other disorders. 

In 1996, together with groups from France, Belgium and the Netherlands, we have founded 

the European MRX Consortium to systematically study X-linked MR (XLMR), which is 

believed to account for at least 25 percent of all genetic forms of MR. To date, more than 

450 XLMR families have been collected by this Consortium and associated partners, and 

this unique resource was instrumental in the identification of many novel XLMR genes. 

X-linked MR is also the central research theme of a Polish ‘Partner Group’ of our department 

founded in 2002 at the Medical University in Poznan with the support of the Max- 

Planck Society (collaboration with A. Latos-Bielenska). Since early 2003, we are jointly 

funded by an EU grant as part of the 5th Framework. 

Also in 1996, in close collaboration with N. Tommerup (Copenhagen), the world-wide 

Mendelian Cytogenetic Network (MCN) was founded which comprises >300 cytogenetic 

laboratories. The aim of this network with its two Reference Centres in Copenhagen 

and Berlin is the recruitment and systematic clinical, cytogenetic and molecular characterization 

of patients with DBCRs. The Max Planck Society supports the ascertainment and 

clinical (re-) examination of patients with DBCRs through a Tandem Project grant, while 

the bulk of the support for this project has come from the National Genome Research

Network (NGFN). Recently, DNA from > 200 clinically and cytogenetically well characterized 

patients with conspicuous, ‘chromosomal-looking’ phenotypes but apparently 

normal karyotypes have been obtained for CGH array-based high-resolution deletion and 

duplication screening (collaboration with C. Lundsteen, Copenhagen; supported by the 

NGFN). Most of the defects detected by studying patients with balanced and unbalanced 

chromosome rearangements will be due to haplo-insufficiency and thus behave as autosomal 

dominant traits. 

In 2003, we have also concluded far-reaching, formalized collaboration agreements with 

potent partners in India and Iran, respectively, to study X-linked and autosomal recessive 

forms of MR (ARMR) in a systematic fashion. ARMR may account for up to 60 percent 

of all mentally retarded patients in our population, but due to small family sizes, most of 

them appear as ‘idiopathic’ sporadic cases, and almost nothing is known so far about the 

underlying gene defects. Therefore, an important aim of our collaborations (with J.R. 

Singh, Amritsar; B.T. Thelma, New Delhi; S.Hasnain, Hyderabad, India; and H. Najmabadi, 

Tehran, Iran) is the recruitment and systematic autozygosity mapping in large consanguineous 

families with ARMR and related monogenic disorders as a prerequisite for 

mutation screening and gene finding. Wherever possible, these collaborations will be put 

under the umbrella of already existing or future bilateral research agreements between 

Germany and India or Iran. 

Systematic search for gene defects underlying monogenic 

disorders 

Thus, we employ several complementary strategies to identify the molecular defects underlying 

MR, including the characterization of balanced and unbalanced chromosome 

rearrangements in patients (with autosomal dominant and X-linked MR), autozygosity 

mapping in large consanguineous families (with ARMR) as well as linkage mapping and 

large-scale mutation screening (in XLMR families). It goes without saying that these 

strategies can and will also be employed for elucidating other monogenic forms of disease. 

The systematic characterization of DBCRs, performed in the group of V. Kalscheuer, has 

turned out to be a particularly successful strategy to identify disease genes that play a role 

in MR and related disorders. In total, more than 30 candidate genes have been identified 

in this way, and the identity of several X-linked ones could be confirmed by mutation 

screening in unrelated families. For several years, our department has also been engaged 

in the development and implementation of methods allowing rapid detection of unbalanced 

submicroscopic rearrangements in the human genome. Subtelomeric deletions are 

a frequent cause of idiopathic mental retardation, but there is compelling evidence that 

small unbalanced genome rearrangements also occur in other regions of the genome and 

form a major cause of disease. As one of few laboratories worldwide, we have recently 

introduced DNA array-based Comparative Genomic Hybridization (array CGH, U. Nuber 

and co-workers, collaboration with R. Ullmann, Graz), a novel technique allowing highresolution 

detection of unbalanced chromosome rearrangements which does not depend 

on the availability of metaphase chromosomes. With the support of the NGFN, a CGH 

array with a resolution of 1 megabase has been generated. This array is being validated by 

serial investigation of DNA from 200 clinically and cytogenetically well-characterized 

patients, and its BAC density will be further improved, subject to continued funding (application 

pending). Thus, the analysis of balanced or unbalanced chromosome rearrangements 

in mentally retarded patients is a suitable strategy for finding gene defects underlying 

autosomal dominant and X-linked forms of MR. 

In parallel, by analysing linkage intervals from a large number of XLMR families, regions 

on the human X-chromosome with a high density of causative gene defects could be 

identified. Subsequent high-throughput mutation screening of genes in a pericentromeric 

X-chromosome segment has led to the identification of several novel candidate genes for 

XLMR (Ropers, Lenzner and co-workers). A prerequisite for these studies was the implementation 

of DHPLC-based high-throughput mutation detection. Presently we are imple- 



77

78 

Department of 


menting a novel endonuclease-based method for mismatch detection which may allow us 

to scale up mutation screening even further (S. Lenzner, collaboration with R.Plasterk et 

al, Utrecht, R. Reinhardt et al. and Transgenomic Inc.). Recent studies of this group have 

also included the search for low-copy repeats on the X-chromosome, which may predispose 

to genomic disorders or form hotspots of mutation due to gene conversion. 

Linkage or rather, autozygosity mapping in large consanguineous families followed by 

mutation screening in genes of the relevant interval is the strategy of choice for elucidationg 

autosomal recessive forms of MR, as outlined above. Through our fomalized collaborations 

with groups in India and particularly, Iran, we are in an excellent position for making 

rapid progress in this field, which is still largely unexplored. To map the respective gene 

defects, several different options for high-throughput/low cost genome scanning are being 

considered (collaboration with P. Nürnberg). 

Elucidating the function of MR genes in health and 

disease 

Compared to gene finding, unraveling the function of these genes in the normal brain and 

elucidating their role in the pathogenesis of MR is a much bigger challenge, which requires 

various different approaches. These include in silico sequence comparisons, analysis 

of intracellular and tissue-specific expression patterns, protein-protein and protein- 

DNA interactions, as well as the study of cellular and animal models at various levels. 

Complementary expertise in this area is available in most groups, and this is where many 

research lines of our department converge. 

Protein-protein interaction and biochemical studies are the domain of S. Schweiger, who 

focuses on defects of the ventral midline which frequently involve the brain, and on the 

role of ubiquitin-mediated protein degradation. Her expertise is the mainstay in present 

and future attempts of our department to unravel the function of novel proteins which are 

mutated in MR. 

Chip-based chromatin immuno-precipitation (ChIP on chip) is being introduced by the 

group of U. Nuber to study protein-DNA interactions. This group has also long-standing 

experience with cDNA array-based gene expression profiling, employing different human, 

mouse, tissue and chromosome-specific arrays. Recent work on the transdifferentiation 

of murine bone marrow stromal cells and the differentiation of neurospheres in vitro is 

beginning to shed light on the molecular basis of neuronal differentiation and may even 

have implications for the molecular diagnosis of MR. 

siRNA-mediated knock-down experiments are being performed in the group of C. Scharff, 

an experienced neurobiologist with profound knowledge of neuroanatomy and histology, 

who is involved in the generation and characterization of cellular models for MR. Moreover, 

her work on zebra finches suggests that birds may be suitable model organisms for 

studying genetic defects of speech development in humans. 

H. Scherthan, an experienced cytologist and cytogeneticist with a focus on telomere topology 

and function, has expertise in yeast genetics and is involved in complementation 

tests performed to unravel the function of novel human genes. 

D. Walther has a central role in the generation of transgenic, knock-out or knock-down 

mouse models for human disease, employing classical targeting procedures as well as a 

novel method allowing to introduce specific point mutations in a single step (collaboration 

with H. te Riele, Amsterdam). His recent work on the serotonin modification of 

regulatory proteins provides exciting links to mental retardation and related disorders 

given the important role of Rho and Rab GTPases in neurite outgrowth and synaptic 

vesicle transport. 

The experience of M. Hoeltzenbein as Clinical Geneticist is indispensable for recruiting 

patients and families, and for characterizing the clinical phenotype of patients with chromosomal 

rearrangements. Together with her, A. Tzschach plays a pivotal role in ongoing 

activities to include patients with late-onset and complex diseases in these studies in the 

context of the NGFN.

Finally, several of these groups are actively involved in a DFG-funded Collaborative 

Research Program (SFB 577) entitled ‘Molecular Basis of Clinical Variability in Mendelian 

Disorders’ which was founded almost three years ago. The aim of this program is the 

identification of modifier genes and regulatory pathways. This will enable more reliable 

prognoses about the severity and course of monogenic disorders and shed more light on 

their pathogenesis. 

Conclusion and outlook 

Despite substantial ‘brain drain’ due to the appointment of group leaders as department 

heads in Düsseldorf (B. Royer-Pokora), Mainz (T. Haaf), Zürich (W. Berger) and Uppsala 

(R. Fundele), the Department of Human Molecular Genetics has established itself as one 

of the major players in its field. Its long-term investments into the systematic investigation 

of Mendelian disorders, and mental retardation in particular, are already beginning to pay 

off. This holds for the establishment of formalized collaborations with research institutions 

in Denmark, Poland, Iran and India, but also for the implementation of pivotal concepts 

and methods for gene finding and functional studies. Given the increasing awareness 

of the difficulties inherent in the search for risk factors for common diseases and 

their limited relevance for health care, our activities promise to bear even more fruit in the 

years to come - provided continued funding can be obtained, through the NGFN or from 

other sources. 



BMBF-DHGP, 01KW9908/7: Systematic 

clinical, cytogenetic and molecular characterization 

of balanced chromosome rearrangements 

that are associated with disease 

BMBF-NGFN, Platform 6.4: Translokationsbruchpunkte 

EFRE, 01GR0203: Zentrale Einrichtung für 

die systematische Suche nach submikroskopischen 

Deletionen und Duplikationen bei 

monogenen und komplexen Krankheiten 

DFG, Ro389/17-3: Schwerpunktprogramm 

Dysmorphie 

DFG, BE 1559/2-1: Molekulare Aufklärung 

X-chromosomaler Netzhaut-Degeneration 

und Funktionsstörungen 

British Retinitis Pigmentosa Society: Molecular 

and functional characterization of the gene 

for retinitis pigmentosa 3 and cloning of the 

genes underlying other X-linked forms of RP 

and related disorders, jointly with F. Cremers, 

Nijmegen, until 2002 

5th EU Framework (QLRT-2001-01810): Xlinked 

Mental Retardation, 2003-2005 

Tandem Project MPG: Ascertainment of patients 

with disease-associated balanced chromosome 

rearrangements for the systematic, 

large-scale elucidation of genetic disorders, 

2001-2005 

MPG-Partner Group in Poznan, collaboration 

with Prof. A. Latos-Bielenska, 2002-2006 


memberships 

Thomas Haaf, C4 Professorship at University 

Mains, 2001 

Wolfgang Berger, C4 Professorship at University 

Zürich, 2002 

Reinald Fundele, C4 Professorship at University 

Uppsala, 2002 

H.-H. Ropers, Elected Member Berlin 

Brandenburg Academy of Sciences (2002) 

H.-H. Ropers, member of Royal Netherlands 

Academy of Arts and Sciences (2002) 

H.-H. Ropers, member of HUGO Council 

(2003) 


Berger, W.: Aufklärung von Gendefekten 

hereditärer Augenerkrankungen. Habilitationsschrift, 

Humboldt Universität Berlin, 1999 



79

80 

Department of 


Theses 

Meunier, D.: Functional analysis of the 

mouse G90 gene. Albert-Ludwigs-Universität 

Freiburg, 2003 

Zend-Ajusch, E.: Die Evolution des menschlichen 

Chromosoms 3 in Primaten. PhD Thesis, 

Technische Universität Berlin, 2002 

Grützner, F.: Vergleichende Gen- und Genomkartierung 

in Vertebraten unter besonderer Berücksichtigung 

der Geschlechtschromosomen. 

PhD Thesis, Freie Universität Berlin, 2001 

Hardt, T.: Neue Fluoreszenzmethoden zur 

strukturellen und funktionellen Genomanalyse 

(Fish and Chips). PhD Thesis, Justus-Liebig- 

Universität Gießen, 2001 

Raderschall, E.: Zytochemische und funktionelle 

Analyse des Rekombinase/DNA Reparatur-Proteins 

Rad51. PhD Thesis, Freie Universität 

Berlin, 2001 

Voigt, R.M: Mikrodeletionen bei 100 Patienten 

mit konotrunkalen Herzfehlern auf Chromosom 

22q11 und Chromosom 10p13/14. PhD 

Thesis, Humboldt Universität Berlin, 2001 

Hamel, B.: X-linked mental retardation: A clinical 

and molecular study. PhD Thesis, 

Katholieke Universiteit Nijmegen, 1999 

Hemberger, M.: Genetische und molekulare 

Ansätze zur Identifizierung von Plazentagenen. 

PhD Thesis, Albert-Ludwigs-Universität, 

Freiburg, 1999 

Hol, F.A.: Genetic factors in human neural 

tube defects. PhD Thesis, Katholieke Universiteit 

Nijmegen, 1999 

Schröer, A.: Genetische Ursachen der unspezifischen 

geistigen Behinderung – zytogenetische 

und molekulargenetische Untersuchungen 

an einer geistig behinderten Patientin 

mit einer t(X;20)-Translokation. PhD 

Thesis, Humboldt Universität Berlin, 1999 

Grandy, I.: Häufigkeit und Kernorganisation 

von strahleninduzierten Translokationen in 

Mikro- und Makrochromosomen des Hühnchens 

(Gallus gallus). Diploma Thesis, Ludwig-Maximilians-Universität 

München, 2002 

Hägebarth, A.: Analyse einer möglichen 

Funktion des G90 Gens in der Regulation des 

Zellzyklus. Diploma Thesis, Humboldt 

Universität Berlin, 2002 

Pantchechnikova, E.: Zytogenetische Charakterisierung 

von krankheitsassoziierten balancierten 

Chromosomenbruchpunkten bei Patienten 

mit autosomalen Translokationen 

mittels FISH-Analyse. Diploma Thesis, Freie 


Zwintscher, A.: Molekulare Charakterisierung 

von Kandidatgenen für familiäre Netzhautdystrophien. 

Diploma Thesis, Technische Universität 

Berlin, 2001 

Münscher, S.: Identifizierung und Charakterisierung 

neuer, augenspezifischer Gene. Diploma 

Thesis, Technische Fachhochschule 

Berlin, 2000 

Scheer, M.: Funktionelle Studien zu DXS6673E, 

einem Kandidatengen für X-gekoppelte geistige 

Behinderung, und seinem Mausortholog. 

Diploma Thesis, Freie Universität Berlin, 1999 

Schlosser, T.: Charakterisierung differenziell 

exprimierter Gene in einem Tiermodell für congenitale 

Blindheit (Norrie-Krankheit). Diploma 

Thesis, Freie Universität Berlin, 1999 

Techritz, S.: Retinopathia pigmentosa 2 (RP2): 

Untersuchungen zur intrazellulären Lokalisation 

des Genproduktes. Diploma Thesis, Fachhochschule 

Lausitz, 1999 

Vester, A.: Cytogenetische und molekulare Charakterisierung 

von krankheitsassoziierten chromosomalen 

Rearrangements zur Identifizierung 

und Isolierung von Krankheitsgenen. Diploma 

Thesis, Technische Universität Berlin, 1999 

Weber, A.: Zytogenetische und molekulare 

Charakterisierung von krankheitsassoziierten 

chromosomalen Rearrangements zur Identifizierung 

und Isolierung von Krankheitsgenen. 

Diploma Thesis, Rheinisch-Westfälische 

Technische Hochschule Aachen, 1999 

Wuttke, R.: Molekulare Charakterisierung des 

X-chromosomalen Bruchpunktes einer mit geistiger 

Behinderung assoziierten balancierten 

X;17-Translokation. Diploma Thesis, Freie 


Zeitz, C.: Mutationsanalysen bei Patienten mit 

X-chromosomaler Retinopathia pigmentosa 

und Untersuchungen zur Transkription des 

RPGR Gens. Diploma Thesis, Freie Universität 

Berlin, 1999 

Collaboration agreements 

Prof. Jai Rup Singh, Guru Nanak Dev University, 

Amritsar, India 

Dr. Sayed Hasnain, Institute for DNA Fingerprinting 

and Diagnosis, Hyderabad, India 

Dr. Hossein Najmabadi, Genetics Research 

Center, University of Social Welfare and Rehabilitation, 

Teheran, Iran 

Prof. Thelma B.K., Department of Genetics, 

University of Delhi South Campus, New Delhi, 

India

Neurochemistry Group & Mouse Lab 


Victor Alamo-Bethencourt (since 2/03) 

Maik Grohmann (since 5/03) 

Nils Paulmann (since 9/03) 

Jens-Uwe Peter (since 3/03) 


Sylvana Henschen (since10/03) 

Yong-joon Suh (since 9/03) 

Technicians: 

Monika Dopatka 

Angela Lüttges 

Sabine Otto 

Tanja Skladnikiewicz 

Head: 

Dr. Diego Jacinto Walther (since 2/03) 

Phone: +49 (0)30-8413 1664 

Fax: +49 (0)30-8413 1383 

Email: dwalther@molgen.mpg.de 

Introduction 

Diego J. Walther leads the „Neurochemistry Group and Mouse Lab“ at the MPIMG since 

February 2003. After finishing his scholar education in Guatemala, and his studies in 

chemistry, biochemistry and molecular biology at the Technical University in Berlin, the 

german scientist, born in Buenos Aires Argentine, finished his Diploma thesis in chemistry 

(biochemistry) in 1996. Then he worked on the establishment and histologic and physiologic 

characterization of different transgenic animal models especially focused on models 

with defined dysfunction of the serotonergic system, and finished his PhD thesis at the 

Max-Delbrück-Center (MDC) for Molecular Medicine and the Free University Berlin in 

2000. During his postdoc time and as stipendiate of the „Verbund Klinische Pharmakologie 

Berlin-Brandenburg“ at the MDC, he expanded his research interests onto the interdisciplinary 

analysis of serotonin-producing tumors and the development of tryptophan hydroxylase-dependent 

procytostatic agents, the mechanistical elucidation of the role of 

serotonin in primary hemostasis and the immune system, as well as on the characterization 

of a novel, receptor-independent signaling mechanism of serotonin and other biogenic 

monoamines. He moved to the MPIMG and now co-operates with other groups of 

the institute and with groups at the MDC, the Charité and the Free University of Berlin on 

the field of neurochemisty and neurobiology and the establishment of further animal models 

for neuroendocrine disorders, vesicular trafficking defects, and mental retardation. 


The use of transgenic mice is one of the most straightforward tools to study gene function. Our 

facility offers the generation of transgenic and knockout mice to all groups in the Department, 

the Max-Planck-Institute and other interested laboratories. Our group is focused on the elucidation 

of molecular causes of human diseases by the generation, analysis, and rescue experiments 

of transgenic and knockout mouse models. We generate transgenic and knockout mice using 

classical methods and novel gene targeting procedures that allow the specific integration of 



81

82 

Department of 


point mutations and frame shifts into genes of interest. Currently we work on animals with 

defined genetic dysfunctions in the serotonergic system and related biochemical pathways aiming 

the elucidation of the numerous hormonal and neurotransmitter effects of serotonin. Furthermore, 

we study the uptake and release mechanisms from vesicles and the involved signal 

transduction, using platelets as model system for neuronal vesicular processes. Moreover, we 

are establishing a mouse model for choroideremia to evaluate possible genetherapeutic approaches 

in the treatment of this X-linked eye-disease. 

Another field is the use of harmless prodrugs that are enzyme-specifically toxified in 

tissues expressing either endogeneous tryptophan hydroxylase or transgenic nitroreductase 

of E. coli to induce defined lesions in tissues of interest. 

Characterization of tryptophan hydroxylase 1 (TPH1) 

Tryptophan hydroxylase 1 catalyzes the rate-limiting step of serotonin biosynthesis in 

extraneuronal tissues. Extraneuronal serotonin is involved in: 

• primary hemostasis 

• T cell-mediated immune responses 

• gastrointestinal function, water and electrolyte homeostasis 

Our collaborators and we are working on these items and also on the analysis of tissuespecific 

expression of splicing isoforms of TPH1. 

Characterization of tryptophan hydroxylase 2 (TPH2) 

Tryptophan hydroxylase 2 catalyzes the rate-limiting step of serotonin biosynthesis in 

neurons. The neurotransmitter serotonin is involved in multiple facets of mood control 

and the regulation of sleep, anxiety, alcoholism, drug abuse, food intake, and sexual behavior. 

Our collaborators and we are working on the elucidation of TPH2-dependent 

human psychiatric disorders. 

Tryptophan hydroxylase-based cytotoxic prodrug development 

Tryptophan hydroxylase metabolizes 7-hydroxytryptophan to 5,7-dihydroxytryptophan, 

which is rapidly decarboxylated to 5,7-dihydroxytryptamine (5,7-DHT) only in tryptophan 

hydroxylase-expressing cells. 5,7-DHT is a potent cytotoxic agent in the cytoplasma but 

not in the extracellular milieu. Therefore, its synthesis in situ can be used to specifically 

target serotonin-producing tumors, such as small cell lung carcinomas and carcinoids. 

Moreover, this prodrug can be used as an experimental tool for the induction of specific 

lesions of tryptophan hydroxylase-expressing tissues, when applied at high dosage. 

NTR-based transgenic lesion models 

Ecstasy abuse leads to the degeneration and death of serotonergic neurons, thereby causing 

anxiety and depressive syndromes. Using transgenics expressing E. coli nitroreductase 

under control of the Tph2 promotor and the prodrug CB 1954 we are able to analyze the 

effect of the loss of serotonergic neurons in the adult brain. This model allows testing 

therapeutical approaches after the loss of serotonergic neurons. Moreover, we can use our 

NTR-cassette also to target other neuroendocrine systems, thereby obtaining models for 

parkinsonism and other neurodegenerative diseases. 

Ribozyme-based transgenics 

Ribozymes cut target mRNAs with high sequence-specificity. Together with the group of 

M. Bader at the Max-Delbrück-Center for Molecular Medicine we are working on animal 

models with reduced expression of genes of interest, based on tRNA-fused ribozymes. 

CHM knockout 

A mouse knockout model for the X-linked human eye disease choroideremia will be 

established. At first instance male chimeras and heterozygous Chm+/Chm- females are 

viable, but hemizygous Chm-/Y males and heterozygous Chm-/Chm+ females are not. 

Our rescue strategy focuses in the correction of the placental defect to obtain viable animals. 

These rescued-mutant mice will then be used for gene therapy and gene expression

studies. Furthermore, these mice will be useful for the identification of genetic modifiers, 

which in the human disease are responsible for a pronounced clinical variability. 

IDO and TDO animal models 

Indoleamine-2,3- (IDO) and tryptophan-2,3- dioxygenases (TDO) compete with tryptophan 

hydroxylase for their substrate: tryptophan. However, little knowledge has been 

accumulated for the influence of the dioxygenase pathways on the serotonin biosynthesis. 

We hope to elucidate the biochemical interaction of these three enzymes using trangenic 

and knockout animal models. 

Platelets as models for synaptic processes 

Platelets can be easily obtained from peripheral blood. Washed platelets are an accepted 

model for synaptic vesicle metabolism mechanisms. Therefore, the platelets of our tryptophan 

hydroxylase 1 knockout mice deliver the first opportunity to study transmitterdevoid 

vesicles. G. Ahnert-Hilger at the Institute for Anatomy, Charite, and we are cooperating 

to elucidate the vesicular trafficking mechanisms. 


Selected Publications 2003 

Walther DJ, Peter JU, Bashammakh S, 

Hörtnagl H, Voits M, Fink H & Bader M 

(2003). Synthesis of serotonin by a second tryptophan 

hydroxylase isoform. Science 299 :76 

Höltje M, Winter S, Walther D, Pahner I, 

Hörtnagl H, Ottersen OP, Bader M & Ahnert- 

Hilger G (2003). The vesicular monoamine 

content regulates VMAT2 activity through Gaq 

in mouse platelets: Evidence for autoregulation 

of vesicular transmitter uptake. J Biol 

Chem 278:15850-15858 

Walther DJ (2003). Die Serotonin-Biosynthese 

wird im zentralen Nervensystem von 

einem neuronenspezifischen Tryptophan-Hydroxylase-Isoenzymgeschwindigkeitsbestimmend 

katalysiert. BIOspektrum 9:184-186 

Walther DJ & Bader M (2003). A unique central 

tryptophan hydroxylase isoform. Biochem 

Pharmacol 66:1673-1680 (review) 


DFG, SFB 577: Analysis of clinical variability 

in Mendelian disorders, subproject Establishing 

a mouse model for the degenerative human 

eye disease choroideremia, 1 PhD student 

and 1 technician funded 

Patents 

Walther DJ & Bader M. Verwendung von 

Tryptophan-Derivaten zur zytostatischen 

Behandlung von Serotonin-produzierenden 

Tumoren. Amtliches Aktenzeichen 101 12 

882.7, März 2001. Internationale Anmeldung 

PCT/DE Verfahren läuft. 

Walther D & Bader M. Neuronal exprimierte 

Tryptophan-Hydroxylase und ihre Verwendung. 

Amtliches Aktenzeichen 102 32 151.5, 

Juli 2002. Internationale Anmeldung PCT/DE 

Verfahren läuft. 



83

84 

Department of 


Clinical Genetics 

Head: 

Dr. med. Maria Hoeltzenbein (since 10/2001) 

Phone: +49 (0)30-8413 1656 

Fax: +49 (0)30-8413 1383 

Email: hoeltzen@molgen.mpg.de 

Scientist: 

Dr. med. Andreas Tzschach (since 1/2002) 


The clinical genetics group was set up in October 2001 to improve clinical characterisation 

and recruitment of patients with disease-associated balanced chromosomal rearrangements. 

Disease-associated balanced chromosomal rearrangements 

The systematic study of disease-associated balanced chromosomal rearrangements 

(DBCRs) is a powerful tool for identifying genetic changes underlying human disease. 

We have re-examined and characterized patients with DBCRs analysed in V. Kalscheuer´s 

group. For example, patients with balanced translocations had varying degrees of mental 

retardation with or without epilepsy due to truncation of STK9, KIAA1202 or ZNF41 

(further details are given under “Chromosome rearrangements and disease”). Detailed 

knowledge about the phenotype is also a prerequisite for the identification of further 

patients suitable for mutation analysis of those genes identified by breakpoint analysis. 

Whereas initially we concentrated on characterization of patients with DBCRs already 

under investigation at our department, we are now focussing on recruiting new patients 

with DBCRs and interesting phenotypes. 

To gain more insight into the role of balanced chromosomal rearrangements (BCRs) in 

complex late-onset diseases, we have started a survey among previously healthy carriers 

of balanced chromosomal rearrangements in Germany, Denmark (in close collaboration 

with N. Tommerup), and Poland (collaboration with A. Latos-Bielenska). Questionnaires 

are being sent to adult carriers of BCRs covering numerous health-related aspects, with a 

focus on neurodegenerative, cardiovascular and metabolic disorders as well as cancer and 

infertility. Sixteen potential disease-associated breakpoints have already been identified, 

including a patient with psoriasis carrying a translocation involving chromosome 4q31.1, 

which has been shown to harbour a psoriasis susceptibility locus. 

X-linked mental retardation 

We are continuing to collect families with X-linked mental retardation (XLMR) in collaboration 

with clinical geneticists from Germany and Poland (A. Latos-Bielenka). Phenotypes 

of those families investigated in the familial mental retardation group are further 

characterized clinically. Among the syndromic forms with XLMR are families with Lujan- 

Fryns syndrome, Renpenning syndrome, a family with mental retardation and retinitis 

pigmentosa and a family with primary ciliary dyskinesia.

Noonan syndrome and related disorders 

We have collected more than 100 patients with Noonan syndrome and similar phenotypes 

for mutation analysis in the PTPN11-gene (close collaboration with V. Kalscheuer´s group) 

and genotype-phenotype correlation. As only about 30% of these patients have mutations 

in the PTPN11-gene and the remaining families are too small for linkage analysis, breakpoint 

mapping in a patient with Noonan syndrome and another patient with a Noonan-like 

phenotype both with balanced translocations are currently performed (collaboration with 

V. Kalscheuer´s group). Within the group of patients referred for investigation of Noonan 

syndrome a 5 generation family with isolated Pterygium colli was identified and linkage 

analysis is planned. In 7 clinically well characterized patients with the rare LEOPARD 

syndrome 3 different missense mutations were found (Hoeltzenbein et. al in preparation). 

Genetic counseling and clinical genetics 

We offer genetic counseling for patients and their families at the Institute of Medical 

Genetics, Charité, Berlin. Ongoing projects comprise further clinical investigations of 

large families with autosomal dominant inheritance of Emery-Dreifuss muscular dystrophy 

(collaboration with M. Wehnert, Greifswald and P. Nürnberg, Berlin), spastic paraplegia 

and paroxysmal kinesigenic choreoathetosis, all without mutations in known genes. In 

addition we are trying to establish genotype-phenotype correlations in patients with small 

chromosomal deletions or duplications, i.e. in a large family with mental retardation and 

peripheral neuropathy with an unusually large 17p11.2-12 duplication (collaboration with 

B. Rautenstrauss, Erlangen), and a patient with dystrophy and mental retardation with a 

deletion of 5q23-31 (Tzschach et. al in preparation). 



Capone Mori A, Hoeltzenbein M, Poetsch M, 

Schneider JF, Brandner S & Boltshauser E 

(2003). Lhermitte-Duclos disease in 3 children: 

a clinical long-term observation. 

Neuropediatrics 34(1):30-5 

Huehne K, Benes V, Thiel C, Kraus C, Kress 

W, Hoeltzenbein M, Ploner CJ, Kotzian J, 

Reis A, Rott HD & Rautenstrauss BW (2003). 

Novel mutations in the Charcot-Marie-Tooth 

disease genes PMP22, MPZ, and GJB1. Hum 

Mutat 21(1):100 

Kalscheuer VM, Freude K, Musante L, Jensen 

LR, Yntema HG, Gécz J, Sefiani A, Hoffmann 

K, Moser B, Haas S, Gurok U, Haesler S, 

Aranda B, Nshedjan A, Tzschach A, 

Hartmann N, Roloff TC, Shoichet S, Hagens 

O, Tao J, van Bokhoven H, Turner G, Chelly J, 

Moraine C, Fryns JP, Nuber U, Hoeltzenbein 

M, Scharff C, Scherthan H, Lenzner S, Hamel 

BCJ, Schweiger S & Ropers HH (2003). 

Mutations in the polyglutamine-binding protein 

1 gene cause X-linked mental retardation. 

Nat Genet (in press) 

Kalscheuer VM, Tao J, Donnelly A, Hollway 

G, Schwinger E, Kubart S, Menzel C, 

Hoeltzenbein M, Tommerup N, Eyre H, 

Harbord M, Haan E, Sutherland GR, Ropers 

HH & Gecz J (2003). Disruption of the serine/ 

threonine kinase 9 gene causes severe X-linked 

infantile spasms and mental retardation. Am 

J Hum Genet 72(6):1401-11 

Musante L, Kehl HG, Majewski F, Meinecke 

P, Schweiger S, Gillessen-Kaesbach G, 

Wieczorek D, Hinkel GK, Tinschert S, 

Hoeltzenbein M, Ropers HH & Kalscheuer 

VM (2003). Spectrum of mutations in PTPN11 

and genotype-phenotype correlation in 96 patients 

with Noonan syndrome and five patients 

with cardio-facio-cutaneous syndrome. Eur J 

Hum Genet 11(2):201-6 

Ropers HH, Hoeltzenbein M, Kalscheuer V, 

Yntema H, Hamel B, Fryns JP, Chelly J, 

Partington M, Gecz J & Moraine C (2003). 

Nonsyndromic X-linked mental retardation: 

where are the missing mutations? Trends 

Genet 19(6):316-20 



85

86 

Department of 


Shoichet SA, Hoffmann K, Menzel C, 

Trautmann U, Moser B, Hoeltzenbein M, 

Echenne B, Partington M, van Bokhoven H, 

Moraine C, Fryns JP, Chelly J, Rott HD, 

Ropers HH & Kalscheuer VM (2003). Mutations 

in the ZNF41 gene are associated with 

cognitive deficits: identification of a new candidate 

for X-linked mental retardation. Am J 

Hum Genet (in press) 

Horvath R, Scharfe C, Hoeltzenbein M, Do 

BH, Schroder C, Warzok R, Vogelgesang S, 

Lochmuller H, Muller-Hocker J, Gerbitz KD, 

Oefner PJ & Jaksch M (2002). Childhood 

onset mitochondrial myopathy and lactic acidosis 

caused by a stop mutation in the mitochondrial 

cytochrome c oxidase III gene. J 

Med Genet 39(11):812-6 

Kotzot D, Dufke A, Tzschach A, Baeckert- 

Sifeddine IT, Geppert M, Holland H, Florus 

JM & Froster UG (2002). Molecular breakpoint 

analysis and relevance of variable mosaicism 

in a woman with short stature, primary 

amenorrhea, unilateral gonadoblastoma, 

and a 46,X,del(Y)(q11)/45,X karyotype. 

Am J Med Genet 15;112(1):51-5. 

Munier FL, Frueh BE, Othenin-Girard P, Uffer 

S, Cousin P, Wang MX, Heon E, Black GC, 

Blasi MA, Balestrazzi E, Lorenz B, Escoto R, 

Barraquer R, Hoeltzenbein M, Gloor B, 

Fossarello M, Singh AD, Arsenijevic Y, 

Zografos L & Schorderet DF (2002). BIGH3 

mutation spectrum in corneal dystrophies. Invest 

Ophthalmol Vis Sci 43(4):949-54 

Book contributions 

Hoeltzenbein M & Wehnert M (2003). Emery-Dreifuss 

Muskeldystrophie. In: Spuler, 

Simone, Moers, Arpad, eds., Muskelkrankheiten, 

Schattauer 2003 (in press) 

Hoeltzenbein M (2003). Genetische Beratung. 

In: Spuler, Simone, Moers, Arpad, eds., 

Muskelkrankheiten, Schattauer 2003 (in press) 

Teaching 

Andreas Tzschach: Seminars and practical 

courses Human Genetics, for 1 st and 3 rd year 

medical students at the Humboldt University, 

summer term 2002- winter term 2003/2004 

Awards 

Award for the best poster in „Syndromology” 

of the German Society of Human Genetics 

2003. Hoeltzenbein M, Musante L, Neubauer 

B, Stephani U, Wiegand U, Tzschach A, 

Kalscheuer V, Ropers HH, Tinschert S & 

Meinecke P. Clinical features of 6 patients with 

LEOPARD-Syndrome and mutation analysis 

of the PTPN11-gene. Medgen (2003)15: 309 


Tandem Project MPG: Ascertainment of 

patients with disease-associated balanced 

chromosome rearrangements for the systematic, 

large-scale elucidation of genetic 

disorders, 2001-2005

Chromosome Rearrangements & Disease 

Scientist: 

Dr. Luciana Musante 


Barbara Dlugaszewska 

Kristine Freude 

Olivier Hagens 

Magdalena Mayer 

Sarah Shoichet 

Jiong Tao 

Technicians: 

Sabine Kübart 

Marion Klein 

Ute Fischer 

Corinna Menzel 

Petra Viertel 

Kirsten Hoffmann 

Dietmar Vogt 

Head: 

Dr. Vera M. Kalscheuer 

Phone: +49 (0)30-8413 1293 

Fax: +49 (0)30-8413 1383 

Email: kalscheu@molgen.mpg.de 


To identify new genes that play a role in the development and function of the human 

brain and other organs, we systematically study disease-associated balanced chromosome 

rearrangements (DBCRs). With this powerful approach, we have found >25 new 

candidates for MR and related disorders. 

One example is serine/threonine kinase 9 

(STK9), located on Xp22.2. The gene is disrupted 

in two female patients with severe Xlinked 

West-syndrome (WS), also called Xlinked 

infantile spasms (ISSX), characterized 

by early onset generalised seizures, hypsarrhythmia 

and mental retardation (collaboration 

with J. Gécz, Adelaide) (Kalscheuer et al, 

2003). Functional absence of STK9 in two unrelated 

patients with almost identical phenotype 

suggests its causal role in this disorder. To 

gain more insight into STK9 function and the 

pathomechanism of ISSX, we currently establish 

a mouse model (in collaboration with D. 

Walther). A search for STK9 interacting proteins 

by yeast-two hybrid screen elucidated three putative partners. One of the candidates has 

been shown previously to play a role in non-syndromic X-linked mental retardation. The findings 

in yeast are currently being confirmed in mammalian cells. 

Another example is a female patient with severe non-specific mental retardation and a de 

novo balanced translocation t(X;7)(p11.3;q11.21) with a zinc finger gene truncated by the 

X-chromosomal breakpoint. Moreover, screening of a panel of MRX patients led to the 

identification of two other ZNF41 mutations that were not found in healthy controls 

(Shoichet et al, in press). The function of ZNF41 is presently unknown but other zinc 

finger genes have been implicated in a variety of disorders. 



87

88 

Department of 


Likewise, in two female patients with breakpoints in Xp11.2, the KIAA1202 gene was found 

disrupted (collaboration with A. Hanauer, Strasbourg) (Hagens et al, in preparation). Current 

studies aim to unravel the role of KIAA1202 protein. In one of the translocation patients cloning 

of the junction fragment revealed that the autosomal breakpoint also truncated a gene, FBX25, 

which is a member of the F-box protein family. Detailed characterisation of the mouse orthologue 

showed that in adult brain transcription is confined to the hippocampus and the cerebral cortex, 

suggesting a major role for mouse Fbx25, and most likely also for human FBX25, in neuronal 

development and hippocampal function during adulthood (Hagens et al, in preparation). 

Regarding other autosomal breakpoints, we recently found the gene defect in a family with nonprogressive 

and mild cerebellar ataxia co-segregating with a familial balanced translocation 

t(8;20)(p22;q13) (Hertz et al, in press, Silahtaroglu et al, in preparation). Likewise, breakpoint 

mapping in two unrelated patients with mild MR, respectively severe MR and dysmorphic 

features, revealed disruption of the same large gene. The function of its product is presently 

unknown. Remarkably another group found this gene truncated in a twin pair with MR and 

autism. Truncation of the same gene in three unrelated patients suggests that MR likely resulted 

from the chromosomal rearrangement event. 

In another project we investigated three patients displayed with limb malformations, and additional 

MR in one of the patients. All rearrangements included the chromosomal region 2q31. 

Fine-mapping of the breakpoints revealed that they map proximal, respectively distal in the 

vicinity of the HOXD cluster (collaboration with N. Tommerup, Kopenhagen, S. Mundlos, and 

H. Neitzel, Berlin) (Dlugaszewska et al, in preparation). 

During the characterization of the chromosome 12 breakpoint region in a patient with a balanced 

t(2;12)(q37;24) translocation and a clinical diagnosis of Noonan syndrome (NS), we 

identified a novel gene, thyroid hormone receptor-associated protein 2 (THRAP2). Interestingly 

this gene is expressed at a lower level in a patient cell line than in control cell lines, 

although the breakpoint maps 28 kb to its 5’ end. We therefore characterized THRAP2 and its 

mouse counterpart in more detail (Musante et al, submitted). In addition, we have screened the 

first known NS gene, PTPN11, which maps to chromosome 12q24 in a distance of about 3.4 

Mb proximal to THRAP2, for mutations in >160 clinically well characterised NS patients (collaboration 

with M. Hoeltzenbein). PTPN11 encodes the non-receptor protein tyrosine phosphatase 

SHP-2, which is an important molecule in several intracellular signal transduction pathways 

that control diverse developmental processes. Most mutations identified were clustered in 

the SH2 domain at the N-terminus of the SHP-2 proteins which acts as a molecular switch 

between the inactive and active protein form (Musante et al, 2003). 

Additionally, in a male patient with a balanced t(Y;4)(q11.2;q21) and a severe neurode-generative 

disorder, accompanied by MR and seizures, the breakpoint on chromosome 4 disrupts the 

JNK3 gene. JNK3 is predominantly expressed in the central nervous system and the protein has 

been implicated in both apoptosis and neuronal differentiation. Interestingly a truncated JNK3 

protein is present in a patient cell line, suggesting that the phenotype may result from a dominant 

effect, rather than a loss of function of the normal protein. Current studies aim to understand the 

mechanism by which this truncated protein may result in neurodegeneration and MR (collaboration 

with S. Schweiger, T. Herdegen, Kiel). 

Past activities included the search for novel imprinted genes of human chromosome 7 and their 

possible involvement in Silver-Russell syndrome (SRS) (Mergenthaler et al, 2001, Blagitko et 

al, 2000, 1999, Riesewijk et al, 1998).


Selected Publications 

Hertz JM, Sievertsen B, Silahtaroglu A, Bugge 

M, Kalscheuer V, Weber A, Wirth J, Ropers 

HH, Tommerup N & Tümer Z (2003). Earlyonset, 

non-progressive and mild cerebellar 

ataxia co-segregating with a familial balanced 

translocation t(8;20)(p22;q13). J Med Genetics 

(in press) 

Kalscheuer VM, Freude K, Musante L, 

Jensen LR, Yntema HG, Gécz J, Sefiani A, 

Hoffmann K, Moser B, Haas S, Gurok U, 

Haesler S, Aranda B, Nshedjan A, Tzschach 

A, Hartmann N, Roloff TC, Shoichet S, 

Hagens O, Tao J, van Bokhoven H, Turner G, 

Chelly J, Moraine C, Fryns JP, Nuber U, 

Hoeltzenbein M, Scharff C, Scherthan H, 

Lenzner S, Hamel BCJ, Schweiger S & Ropers 

HH (2003). Mutations in the polyglutaminebinding 

protein 1 gene cause X-linked mental 

retardation. Nature Genetics (in press) 

Kalscheuer VM, Tao J, Donnelly A, Hollway 

G, Schwinger E, Kübart S, Menzel C, 

Hoeltzenbein M, Tommerup N, Eyre H, 

Harbord M, Haan E, Sutherland GR, Ropers 

HH & Gécz J (2003). Disruption of the Serine/ 

Threonine Kinase 9 gene causes severe Xlinked 

infantile spasms and mental retardation. 

Am J Hum Genetics 72:1401-11 



Wieczorek D, Hinkel GK, Tinschert S, Hoeltzenbein 

M, Ropers HH, Kalscheuer VM. 

(2003). Spectrum of mutations in PTPN11 and 

genotype-phenotype correlation in 96 patients 

with Noonan syndrome and 5 patients with 

cardio-facio-cutaneous syndrome. Eur J Hum 


Prudlo J, Alber B, Kalscheuer VM, Roemer 

K, Martin T, Dullinger J, Sittinger H, Niemann 

S, Heutink P, Ludolph AC, Ropers HH, Zang 

K & Meyer T (2003). Chromosomal translocation 

t(18;21)(q23;q22) indicates novel susceptibility 

loci for frontotemporal dementia in 

ALS. Annals Neurology (in press) 

Ropers HH, Hoeltzenbein M, Kalscheuer V, 

Yntema H, Hamel B, Fryns JP, Chelly J, 


Non-syndromic X-linked mental retardation: 

where are the missing mutations in Xp11. 

Trends Genetics 6:316-20 

Shoichet SA, Hoffmann K, Menzel C, 

Trautmann U, Moser B, Hoeltzenbein M, 

Echenne B, Partington M, van Bokhoven H, 

Moraine C, Fryns JP, Chelly J, Rott HD, 

Ropers HH & Kalscheuer VM (2003). Mutations 

in the ZNF41 gene are associated with 

cognitive deficits: identification of a new candidate 

for X-linked mental retardation. Am J 

Hum Genetics (in press) 

Borg I, Squire M, Menzel, Stout K, Morgan 

D, Willatt L, O’Brien P, Ferguson Smith MA, 

Ropers HH, Tommerup N, Kalscheuer VM 

& Sargan DR (2002). A cryptic de novo deletion 

of 2q35 including part of the PAX3 gene 

detected by breakpoint mapping in a child with 

autism. J Med Genet 6:391-9 

Blagitko N, Mergenthaler S, Schulz U, Wollmann 

HA, Craigen W, Eggermann T, Ropers 

HH & Kalscheuer VM (2000). Human 

GRB10 is imprinted and expressed from the 

paternal and maternal allele in a highly tissue- 

and isoform-specific fashion. Hum Mol 

Genet 9:1587-95 

Blagitko N, Schulz U, Schinzel AA, Ropers 

HH & Kalscheuer VM (1999). Gamma2- 

COP, a novel imprinted gene on chromosome 

7q32, defines a new imprinting cluster in the 

human genome. Hum Mol Genet 8:2387-96 

Brunner B, Todt T, Lenzner S, Stout K, Schulz 

U, Ropers HH & Kalscheuer VM (1999). Genomic 

structure and comparative analysis of 

nine Fugu genes: conservation of synteny with 

human chromosome Xp22.2-p22.1. Genome 

Res 9:437-48 

Riesewijk AM, Blagitko N, Schinzel AA, Hu 

L, Schulz U, Hamel BC, Ropers HH & 

Kalscheuer VM (1998). Evidence against a 

major role of PEG1/MEST in Silver-Russell 

syndrome. Eur J Hum Genet 6:114-20 


DFG, SFB 577: Analysis of Clinical Variability 

in Mendelian Disorders, subproject Molecular 

Pathology and Embryology of HOXDrealted 

Limb Malformations, 1 position funded 

DAAD-DST (D0209618): Identification and 

characterization of new genes for X-linked 

mental retardation. Joint with Prof. Dr. B.K. 

Thelma, University of Delhi South Campus, 

New Delhi, India 

Teaching 

Seminar and practical course Biologie für 

Mediziner, WS 1998, SS 1999, Freie Universität 

Berlin 



89

90 

Department of 


Theses 

Luciana Musante, Molecular Characterization 

of Noonan Syndrome. PhD Thesis, Universita’ 

Degli Studi Di Torino, Italy, 2003 

Nadja Blagitko-Dorfs, Novel imprinted genes 

from human chromosome 7 and study of their 

possible involvement in Silver-Russell syndrome. 

PhD Thesis, Humboldt-Universität 

Berlin, 2001 

Bodo Brunner, Der Kugelfisch als Modellorganismus 

für die Identifizierung funktionell 

relevanter Genomabschnitte in höheren Vertebraten. 

PhD Thesis, Humboldt Universität Berlin, 

2001 

Jens Ruschmann: Funktionelle Untersuchungen 

zum KIAA1202 Protein, einem neuen 

Kandidaten für X-chromosomal vererbte 

geistige Behinderung. Diploma Thesis, Freie 

Universität Berlin, 2003 

Kirsten Lenzen, Zytogenetische und molekulargenetische 

Charakterisierung von krankheitsassoziierten 

Chromosomenbruchpunkten. 

Diploma Thesis, Technische Fachhochschule 

Berlin, 2002 

Rainer Kalamaijka, Isolierung und Charakterisierung 

von neuen, human Genen der 

chromosomalen Abschnitte Xp22 und 7q32. 

Diploma Thesis, Märkische Fachhochschule 

Iserlohn, 2000 

Michael Lang, Isolierung und molekulargenetische 

Charakterisierung des 2-COP- 

Gens der Maus. Diploma Thesis, Freie 

Universität Berlin, 1999

DNA Microarrays 

Scientists: 

Dr. Fikret Erdogan 

Dr. Christine Steinhoff (joint with Dept. Vingron) 


Georg Wieczorek 

Ulf Gurok 

Tim-Christoph Roloff 


Sandra Szameit 

Technicians: 

Bettina Lipkowitz 

Ines Müller 

Ralph Schulz 

Annekatrin Wernstedt (until 9/03) 


Adult stem cells 

We make use of the cDNA array technology to determine molecular profiles of adult stem 

cells and to monitor gene expression patterns during their differentiation. In the adult 

organism, stem cells are mainly present in regenerative organs and give rise to differentiated, 

specialized cell types of the respective tissue (e.g. bone marrow, liver, skin). One of 

the most fascinating and highly specialized types of cells are those of the nervous system: 

neurons and glial cells. In contrast to regenerative tissues, it was a long-held dogma in 

neuroscience that in the mature brain no new neurons can be generated. However, stem 

cells are now also known in the adult brain. We isolate neural stem cells from the 

subventricular zone and study dynamic gene expression changes during their in vitro 

differentiation. These studies revealed genes known or suggested to play a role in neurogenesis, 

but in addition many new interesting 

genes with potential relevance for the 

maintenance and differentiation of neural 

progenitor cells. 

Figure: In vitro differentiation of neural progenitor 

cells into neurons (ß III tubulin staining, red) and 

astrocytes (GFAP staining, green). 

Head: 

Dr. Ulrike A. Nuber 

Phone: +49 (0)30-8413 1243 

Fax: +49 (0)30-8413 1383 

Email: nuber@molgen.mpg.de 

Recent findings indicate that neuron-like 

cells can also be generated from other types 

of adult stem cells that are derived from 

bone marrow. The unexpected plasticity of 

bone marrow stromal cells (BMSC) has 

gained increased attention, yet major gaps 

of knowledge concerning the exact identity 

of these cells and their potential remain. We 

have established and characterized mouse 

BMSC cultures and analyzed three indepen- 



91

92 

Department of 


dent samples by cDNA microarrays. As a probabilistic model for the expression of genes 

in these cells, the fitting of a mixture of normal densities was applied to the dataset (Steinhoff 

et al., 2003). To gain clues about the positional context and biology of the isolated cells 

within the bone marrow stroma, we searched our data for genes which encode proteins of 

the extracellular matrix, cell adhesion proteins, cytoskeletal proteins and cytokines / cytokine 

receptors. This analysis revealed a close association of BMSC with vascular cells and 

indicated that BMSC are highly similar to pericytes (Wieczorek et al., 2003). 

Rett syndrome 

Among the different means of gene expression control, epigenetic mechanisms play an 

important role. A fundamental epigenetic mechanism is methylation at CpG dinucleotides 

in genomic DNA. Effects of DNA methylation are mediated through proteins which bind 

to symmetrically methylated CpGs. Many of these proteins contain a specific domain, the 

methyl-CpG-binding domain (MBD). So far, five vertebrate MBD proteins have been 

identified as members of the MBD protein family: MBD1, MBD2, MBD3, MBD4 and 

MECP2. Loss of MECP2 function in the nervous system is implicated in a human neurological 

disorder called Rett syndrome. Symptoms of this syndrome are mental retardation, 

loss of speech and purposeful hand use, autism, ataxia, and stereotypic hand movements. 

It remains unknown, why these patients present with a neurological phenotype, although 

MECP2 is ubiquitously expressed. A possible explanation is the complementation of 

MECP2 by other MBD proteins in non-neural tissues. We have found two new polypeptide 

sequences with an MBD as well as four MBD proteins in man and mouse that had not 

been mentioned as MBD protein family members up to date. Analysis of their amino acid 

sequence revealed additional domains associated with chromatin and point to a function 

in transcription control (Roloff et al., 2003). 

Array CGH 

Unbalanced chromosomal aberrations (deletions, amplifications) can lead to abnormal 

gene expression through the disruption or abolishment of coding sequences or 

regulatory sequences, increased gene or regulatory element dosage, or an altered chromatin 

environment. Many diseases are caused by unbalanced chromosomal aberrations. 

In a pilot array CGH study that involved the investigation of two X-chromosomal 

deletions at Xq21, we found TBX22 to be deleted in one male patient that had 

been earlier described with a cleft lip and palate. TBX22 codes for a transcription 

factor of the T-box gene family, mutated in patients with X-linked cleft palate and 

ankyloglossia (CPX), but the underlying pathogenetic mechanism remained unknown 

so far. We have identified mouse Tbx22 and analyzed its expression during embryogenesis 

by RT-PCR and in situ hybridization. In mouse embryos, it is expressed in 

distinct areas of the head, namely the mesenchyme of the inferior nasal septum, the 

posterior palatal shelf before fusion, the attachment of the tongue, and mesenchymal 

cells surrounding the eye anlage. The localization in the tongue frenulum perfectly 

correlates with the ankyloglossia phenotype in CPX. We furthermore identified positionally 

conserved binding sites for transcription factors, two of which (MSX1, PRX2) 

have been previously implicated in palatogenesis (Herr et al., 2003). 

Mouse placentopathies 

Together with Reinald Fundele (previously at the MPIMG, now University of Uppsala, Sweden), 

we performed gene expression studies of three different models of placental hypoplasia to 

identify genes and gene networks involved in this disorder (Singh et al., submitted 2003). 

BRCA1-mediated repression of select X chromosome genes 

The influence of BRCA1 on the expression of X-chromosomal genes was investigated in 

a collaboration with scientists from the NCI and the Memorial Sloan-Kettering Cancer 

Center, USA (Jazaeri et al., submitted 2003).


Publications 

Herr A, Meunier D, Muller I, Rump A, Fundele 

R, Ropers HH & Nuber UA (2003). Expression 

of mouse Tbx22 supports its role in 

palatogenesis and glossogenesis. Dev Dyn 

226(4):579-86 




Aranda B, Nshedjan A, Tzschach A, Hartmann 

N, Roloff TC, Shoichet S, Hagens O, Tao J, 

van Bokhoven H, Turner G, Chelly J, Moraine 

C, Fryns JP, Nuber U, Hoeltzenbein M, 

Scharff C, Scherthan H, Lenzner S, Hamel 

BCJ, Schweiger S & Ropers HH (2003). Mutations 

in the polyglutamine-binding protein 1 

gene cause X-linked mental retardation. Nature 


Nuber UA, Tinschert S, Mundlos S, Hausser 

I (2003). Dyschromatosis universalis hereditaria: 

familial case and ultrastructural skin investigation. 

Am J Med Genet (in press) 

Roloff TC, Ropers HH & Nuber UA (2003). 

Comparative study of methyl-CpG-binding 

domain proteins. BMC Genomics 4(1):1 

Steinhoff C, Müller T, Nuber UA & Vingron 

M (2003). Gaussian Mixture Density Estimation 

applied to Microarray Data. LNCS (Lecture 

Notes in Computer Sciences) 2810:418- 

429 

Wieczorek G, Steinhoff C, Schulz R, Scheller 

M, Vingron M, Ropers HH & Nuber UA 

(2003). Gene expression profile of mouse bone 

marrow stromal cells determined by cDNA 

microarray analysis. Cell Tissue Res 311(2): 

227-37 

Lenzner S, Prietz S, Feil S, Nuber UA, Ropers 

HH & Berger W (2002). Global gene expression 

analysis in a mouse model for Norrie disease: 

late involvement of photoreceptor cells. 

Invest Ophthalmol Vis Sci 43(9):2825-33 

Erdogan F, Kirchner R, Mann W, Ropers HH 

& Nuber UA (2001). Detection of mitochondrial 

single nucleotide polymorphisms using 

a primer elongation reaction on oligonucleotide 

microarrays. Nucleic Acids Res 29(7):E36 


W, Kirchner R, Erdogan F, Brown CJ, Wohrle 





Hum Mol Genet 10(1):77-83 

Teaching 

Seminar and practical course Humangenetik 

für Medizinstudenten, Charité, Humboldt University 

Berlin, WS 2001/2002 

Seminar Humangenetik für Medizinstudenten, 

Charité, Humboldt University Berlin, SS 2002, 

WS 2002/03, SS 2003 

Lecture Genetik für Bioinformatiker, Free 

University, Berlin, SS 2003, 2 SWS 

Theses 

Fikret Erdogan: Typisierung biallelischer 

Marker (SNPs) mit DNS-Mikrorastern. 

PhD Thesis, Freie Universität Berlin, 2003 

Wieczorek, G.: Untersuchung der X-Inaktivierung 

beim Menschen mit X-Chromosomspezifischen 

cDNS Chips. Diploma Thesis, 

Rheinische Friedrich-Wilhelms-Universität 

Bonn, 2000 


SFB 577: Analysis of clinical variability in 

Mendelian Disorders, Project C3 Rett syndrome, 

Z1 project DNA Microarrays 

BMBF: Fördermaßnahme Verbesserung der 

Leistungsfähigkeit der klinischen Forschung 

an den medizinischen Fakultäten der neuen 

Bundesländer 

NGFN, Platform 6.7: Matrix-CGH 

EFRE, 01GR0203: Zentrale Einrichtung für 

die systematische Suche nach submikroskopischen 

Deletionen und Duplikationen bei 

monogenen und komplexen Erkrankungen 

EU FP6: Integrated Project Genostem 



93

94 

Department of 


Neurobiology Group 

Head: 

Dr. Constance Scharff 

Phone: +49 (0)30-8413 1214 

Fax: +49 (0)30-8413 1383 

Email: scharff@molgen.mpg.de 


Since the inception of our group in the fall of 2001 our efforts have been directed towards two 

main goals: we are aiming to complement the MR gene identification efforts in the department 

by establishing in vitro methods to functionally characterize candidate MR genes. In addition, 

we are investigating the ‘human speech gene’ FoxP2 in songbirds. 

Establishing in vitro methods to functionally characterize candidate MR genes 

In collaboration with Dr. Schweiger’s group, we are applying siRNA technology in cell culture 

to investigate the Opitz BBB/G syndrom (OS). OS is a congenital disorder, affecting ventral 

midline development. It is often accompanied by mental retardation. OS can be caused by 

mutations in the MID1 gene whose product is a microtubule-associated protein with E3 Ubiquitin 

ligase activity. We are targeting the mRNA of MID1 by RNA interference (RNAi) to assess 

effects of reduced MID1 levels on other pathway components and on cell behavior. Knockdown 

of MID1 in HeLa cells induced cell death as shown by the presence of a prominent 

SubG1 peak in FACS. This indicates fragmentation of genomic DNA, which is a late sign of 

apoptosis. Apoptosis was confirmed using TUNEL staining as well as Annexin 5 labeling. In a 

complementary approach, we also targeted ALPHA4 mRNA, because ALPHA4 protein connects 

Protein Phosphatase 2A (PP2A) to 

MID1. Binding of PP2A to MID1 via AL- 

PHA4 leads to ubiquitinylation of PP2A and 

subsequent degradation. In Opitz patients, the 

MID1-ALPHA4 interaction is compromised 

leading to elevated levels of PP2A. In HeLa 

cells we found that the subcellular localization 

of ALPHA4 is cell cycle dependent. Interestingly, 

the siRNA induced knockdown of AL- 

PHA4 leads to dramatically attenuated cell 

growth. This attenuated cell growth is due to 

reduced cell division rate, as shown by an approximately 

50% reduction of BrdU labeled 

S-phase cells. The absence of a subG1 peak in 

ALPHA4 knowdown excludes the possibility 

Scientists: 

Dr. Sophie Scotto 

Dr. Ingrid Ghattas 

Dr. Martin Begemann 


Sebastian Haesler 


Alexander Garthe 

Technician: 

Arpik Nshdejan 

Technical assistant (HiWi): 

Katrin Guse 

Figure 1: Microtubules of HeLa cells revealed by 

antibodies against tubulin and PP2Ac resulting in 

yellow color. Nuclei are blue.

that in addition to reduced proliferation there was increased apoptosis. Our working hypothesis 

is that RNAi mediated reduction of ALPHA4 prevents PP2A from binding to MID1 which 

recapitulates the situation in OS patients. To test this hypothesis we are quantifying the amount 

of ubiquitinylated PP2A by immunoprecipitation. One of the candidate developmental processes 

affected in OS patients is the epithelial-mesenchymal transition (EMT) of premigratory 

cells from the neural crest. Therefore we will analyze the reported cell cycle effect also in these 

cells. In addition, in collaboration with Dr. Schweiger’s and Dr. Nuber’s group we are extending 

the use of RNAi to other cell types (primary neurons, neurospheres, human melanoma cell line, 

bone marrow stromal cells) to screen for function of additional candidate MR genes. 

Using songbirds as a model to study the FoxP2 gene, which is implicated 

in a human speech and language deficit 

Human speech and birdsong share behavioral and neural similarities. Both are learned during a 

critical period via the interaction of auditory and motor centers and require a set of specialized 

cerebral structures. While innate dispositions to learn and produce species-appropriate sounds 

are present in both humans and birds, until recently no genes had been linked to learned vocalizations. 

Mutations of the FOXP2 gene (of the winged-helix/forkhead box (Fox) transcription 

factor gene family) were identified in related individuals with severe difficulty articulating speech 

(Lai et al., 2001, Nat 413; 519-23). Structural and functional brain anomalies of affected individuals 

implicate the basal ganglia as one of the key affected brain regions. Since vocal learning 

in songbirds depends in part on a specialized pathway through the basal ganglia, we cloned the 

FoxP2 gene from zebra finch, and compared its expression pattern with eight other species of 

‘vocal learners’ and two species of vocal non-learners. The latter lack specialized telencephalic 

vocal structures but vocalize innately via a set of sub-telencephalic nuclei common to both vocal 

learners and non-learners. Sequence homology between human, mouse and songbird FoxP2 

was >90%. Amino acids previously reported to be unique for the human lineage were not 

‘human’like in zebra finch. FoxP2 was expressed by embryonic day 3.5 and was strongest 

during development, but persisted in attenuated form into adulthood. During the vocal learning 

phase of zebra finches, FoxP2 was upregulated in Area X, a striatal nucleus characteristic for 

learners only. In adults, different types of vocal learners showed species specific expression 

differences limited to Area X. The rest of the striatum and non-telencephalic auditory and visual 

regions, among them nuclei of the dorsal thalamus, nucleus rotundus, the inferior olive and 

Purkinje cells of the cerebellum expressed FoxP2 in both vocal learning and non-learning birds. 

FoxP1, FoxP2’s closest homologue, was expressed in a partly overlapping but distinct pattern. 

Double labeling with FoxP2 and a number of markers for distinct populations of striatal neurons 

are in progress. These findings are compatible with a role of FoxP2 in shaping the neural 

circuits that are necessary but not sufficient for vocal learning. 

A second project investigates 

whether the FOXP2 

gene has evolved differently 

in birds that learn their song 

from those whose song is 

innate. Analysis of the molecular 

evolution of human 

FOXP2 showed a high degree 

of conservation among 

all vertebrates tested so far. 

Furthermore human FOXP2 



Figure 2: FoxP2 is differentially expressed in a song learning region (‘Area X’) within the basal ganglia of 

different avian species. 

contains changes in amino-acid coding and a pattern of nucleotide polymorphism that suggest 

that this gene has been the target of selection during recent human evolution (Enard et al., 2002, 

Nat 418:869-72; Zhang et al., 2002, Genetics 162:1825-35). This indicates that FOXP2 might 

have been pivotal for the development of human language. Although language is a uniquely 

human trait, learned vocalizations are also found in a few other species, among them whales, 

bats, and most prominently three orders of only distantly related birds. To address the question 

of whether a selective sweep towards learned vocalization also occurred in FoxP2 during songbird 

evolution, we have sequenced and are currently analyzing the FOXP2 ORF from 12 species 

of avian vocal learners, non-learners and evolutionary more distant relatives. 

95

96 

Department of 




Doetsch F & Scharff C (2001). Challenges 

for brain repair: insights from adult 

neurogenesis in birds and mice. Brain Behav 

Evol 58(5):306-322 

Nehrbass N, Jarvis E, Scharff C, Nottebohm 

F & Mello CV (2000). Site-specific retinoic 

acid production in the brain of adult songbirds. 

Neuron 27:359-370 

Scharff C (2000). Chasing fate and function 

of new neurons in adult brains. Curr Opin 

Neurobiol 10:774-783 

Scharff C, Kirn J, Macklis J, Nottebohm F 

(2000). Targeted neuronal death affects neuronal 

replacement and vocal behavior in adult 

songbirds. Neuron 25:481-492 

Jarvis E, Scharff C, Ramos J, Grossman M 

& Nottebohm F (1998). For whom the bird 

sings: Context-dependent gene expression. 

Neuron 21:775-788 

Scharff C, Nottebohm F & Cynx C (1998). 

Conspecifc and heterospecific song discrimination 

in male zebra finches with lesions in 

the anterior forebrain pathway. J Neurobiol 

36:81-90 

Constance Scharff: Invited lectures 

Insights from bird brains: pathways for learned 

vocal communication, regulation of adult neurogenesis, 

and characterization of a “speech” 

gene. Max-Planck-Institute for Neurobiology, 

Martinsried, 14/1/2003 

On the trail of bird speech: cloning of a “language” 

gene and its expression patterns in zebra 

finch brain. SFB 515 symposium, Berlin, 

21/2/2003 

Insights from bird brains: pathways for learned 

vocal communication, regulation of adult neurogenesis, 

and characterization of a ‘speech’ 

gene. Max-Delbrück-Center for Molecular 

Medicine, Berlin-Buch, 13/3/2003 

On the Trail of Bird Speech: Cloning of the 

‘Language Gene’ FoxP2 and its Expression 

in the Avian Brain. Symposium ‘Evolution of 

Institute of Cognitive Neuroscience, Dept. Biopsychology 

& International Graduate School 

for Neuroscience, Ruhr-Universität Bochum 

GAFO 03/252, 20/3/2003 

Regulation and function of adult neuronal replacement 

in songbirds. Philippe Laudat Conference 

INSERM. Neural stem cells: from development 

to the clinic. 20/2/2002 

Killing me softly with your song: regulation 

and function of adult neuronal replacement in 

adult zebra finches. Berlin Neuroscience Forum, 

Liebenwalde, Brandenburg, 18/4/2002 

On the trail of bird speech: cloning of a “language” 

gene and its expression patterns in 

zebra finch brain. Behavioral Neurobiology 

of Birdsong 16th Annual Symposium of 

the Center for Study of Gene Structure & 

Function, Hunter College, CUNY, New York, 

12/12/20002 

Teaching 

Lecture Behavioral plasticity in songbirds. Biology 

Department, Free University Berlin, 

Seminar for High-School Teachers, 12/10/ 

2001 

Lecture Neuronal control of song. Free University 

Berlin, Ornithology lecture series, 11/ 

6/2002 

Lecture Hormones and neurogenesis in songbirds. 

Free Universtiy Berlin, Ornithology lecture 

series, 18/6/2002 

Lecture Neurogenesis and behavior: song development 

in zebra finches. Humboldt University 

Berlin, 25/6/2002 

Lecture Acoustic communication, birdsong. 

Part of the series: from the brain to behavior – 

from behavior to the brain. Free University 

Berlin, 1/7/2003 

Lecture Sexual Dimorphism in communication 

behavior. Part of the series: from the brain 

to behavior – from behavior to the brain. Free 

University Berlin, 8/7/2003 


DFG, SFB 515, Developmental and experience-dependent 

neural plasticity, Subproject 

Behavioral and cellular consequences of targeted 

cell death in songbirds, PhD student and 

technical assistant funded, 2002-2004 

NIH, RO1 Mental Health 63132-01 (collaborator), 

Functional recovery after induced neuronal 

death, one Postdoc funded 

Organization of scientific events 

Organization of the 1st day of Scientific Exchange 

at Harnack House, February 28th , 2002 

I hosted the following speakers for the Dahlem 

Colloquia series 

Luis Puelles, PhD, University of Murcia, 

Spain: A molecular Bauplan of the vertebrate 

nervous system

Christoph Redies, Prof. Dr., Institute of 

Anatomy, University Hospital Essen, Germany: 

Cadherins: An adhesive code for brain 

development 

Jeffrey D. Macklis, M.D., D.HST, Associate 

Professor of Neurology and Neuroscience, 

Harvard Medical School, Director, MGH- 

HMS Center for Nervous System Repair, 

Massachusetts General Hospital, Boston: Cellular 

Repair of Complex Cortical Circuitry by 

Neural Precursors: Induction of Neurogenesis 

Fiona Doetsch, Ph.D., Dept. of Molecular and 

Cellular Biology, Biolabs, Harvard University, 

Cambridge, MA, USA: Biology of Stem Cells 

in the Adult Mammalian Brain 

Rogier Versteeg, Department of Human Genetics, 

Academic Medical Center, University 

of Amsterdam, The Netherlands: The Human 

Transcriptome Map: visualization of absolute 

gene expression levels by SAGE for cancer 

and genome research 

Pierre-Marie Lledo, Prof. Dr., Dept. of Neuroscience, 

Lab of Olfactory Perception and 

Memory, Institut Pasteur, Paris, France: Importance 

of newly formed neurons for adult 

olfaction 

Public relations work 

I presented career options in Molecular Biology 

in general and at the MPIMG specifically 

at a career orientation evening at the Sophie- 

Charlotte-Gymnasium 

‘Personal Portrait’ article appeared in Max 

Planck Research 3/2002 



97

98 

Department of 


Cytology Group 

Head: 

PD Dr. Harry Scherthan (since 11/01) 

Phone: +49 (0)30-8413 1251 

Fax: +49 (0)30-8413 1383 

Email: schertha@molgen.mpg.de 

Scientist: 

Dr. Edgar Trelles-Sticken 

Dr. Caroline Adelfalk 


Bodo Liebe 

Nils Hartmann 

Technician: 

Barbara Meinck 


Aneuploidy represents the leading genetic cause of developmental disabilities and mental retardation 

among neonates – ~30% of all miscarriages are aneuploid – a major cause of pregnancy 

loss. Chromosome rearrangements and missegregation that are transmitted to the offspring often 

occur in the germ line. A major interest and focus of our study is the chromosome behavior 

in germ cell differentiation. Moreover, we investigate the mechanism of chromosome rearrangements 

during karyotype evolution. 

Meiosis 

Because all evolutionarily fixed rearrangements have been disseminated in a population, one 

line of our research centers on chromosome behavior in germ cell differentiation. The nucleus at 

meiosis sees a drastic rearrangement of chromosome structure and location which culminates in 

the formation of bivalents, paired homologous chromosomes, that are requisite for segregation 

of the homologues in the meiosis I division that lies at the heart of gamete formation. Meiosis 

reduces the chromosome complement to the haploid, thereby compensating for the genome 

doubling at fertilization. 

Homologous recombination occurs during first meiotic prophase and provides for physical 

links (chiasmata) between homologues, which are the cytological manifestation of homologous 

recombination. Recombination at illegitimate 

sites is thought to fuel the 

chromosome rearrangements, also 

those that are seen in evolution. It is 

thus imperative to understand the location 

of break points, fragile sites 

and recombinogenic sequences in 

the context of genome architecture 

and nuclear topology. Since many of 

Figure 1: (A) Human microchromosomes (MC, red) escape the pachytene 

checkpoint by association with the transcriptionally inactive XY body (green, 

Xmr fluorescence; A.B’) in transchromosomal mice. (B,C) 3D reconstructions 

of a portion of a spermatocyte the XY body chromatin and a MC. The MC is 

embedded in the XY chromatin (green) but do not adopt the γ-H2ax histone 

chromatin mark specific for this compartment (C). MCs (green) off the XY-body 

are transcriptionally active since they lack the γ-H2ax fluorescence (red) (Voet 

et al. 2003). 

. 

the genes involved in meiotic differentiation 

are required for fertility, we 

have established tools to fine-stage 

prophase I progression in the model 

systems budding yeast and mouse, 

which allow to detect errors in this 

complex differentiation progress.

Since my move to the MPIMG in 11/2001 we were able to transfer our molecular cytological 

techniques and could show in budding yeast meiosis that SIR3, KAR3, SPO13 gene products 

are involved in the control of meiotic chromosome dynamics off the telomeres. In a collaboration 

with Dr. A. Goldman, Sheffield, we were able to show that double strand break (DSB) 

formation is required for homologue pairing in yeast meiosis and that a single DSB can not 

rescue defects in chromosome pairing in the presence of a catalytic inactive form of the SPO11 

transesterase. 

In the mouse we have recently used trans-chromosomal mice (collaboration with P. Marynen 

and T. Voet, Leuven Univ., Belgium) to investigate checkpoint response and germ line transmission 

of telomere-less mini-ring chromosomes. We could delineate a novel way of how mini 

ringchromosomes bypass to the need for telomere clustering for pairing by association with the 

sex body (Figure 1) and how they escape checkpoints during pachytene. We have also shown 

that failure of ring-chromosome cohesion during metaphase I was sensed by the spindle checkpoint. 

These strategies may be applicable to human microchromosomes that are transmitted 

to the offspring and are occasionally associated with mental retardation. 

In an attempt to understand the role of the nuclear envelope for the pairing of meiotic chromosomes 

and telomere attachment, we are currently investigating the spermatogenesis of Lmna 

and Sycp3 knockout mice. Furthermore, we test the impact of the DSB repair pathway on 

meiotic telomere behavior in that we investigate the spermatogenesis of Spo11, Dmc1, Gadd45, 

and H2ax knockout mice. 

Altogether our efforts will establish a cytological map of prophase I arrest phenotypes and help 

to build a circuitry around the meiotic telomere, which may aid analysis of failure of germ cell 

differentiation in infertile patients. Furthermore, our analysis will help to understand why up to 

one third of fertilized human eggs are trisomic or monosomic, with aneuploidy representing the 

leading genetic cause of developmental failure and pregnancy loss. 

Karyotype evolution 

In the past I have worked with model species like the Indian muntjac deer (Muntiacus 

muntjac vag.) which has the lowest chromosome number in all mammals. Its 2n=6 

fusion chromosomes have likely been formed by chromosome fusions and translocations, 

while it is still a phenocopy of its close relative the Chinese muntjac that harbours 

2n=46 chromosomes. My group was among the pioneers to establish molecular cytogenetic 

tools that allow for demonstrating regions of conserved synteny among mammalian 

genomes. We have also provided first evidence on the nature of sequences 

located at evolutionary breakpoints in the fusion genome of the Indian muntjac. After 

my arrival at the MPI-MG, Nils Hartman 

joined the group as Ph.D. student. He has 

a strong interest in chromosome evolution 

and he continued research in muntjac chromosome 

fusions. We were able to am-plify 

sequences from the ancestral chromosome 

fusion points that contain GC-rich repetitive 

satellite DNA sequences and telomere repeats 

(Fig. 2), confirming hypotheses that these sequences 

were involved in muntjac ka-ryotypic 

evolution. A manuscript on this topic has recently 

been submitted for publication. 

Figure 2: Detection of ancestral chromosome fusion 

points by FISH of telomere &/ breakpoint satellite 

PCR products. Interstitial telomere repeats (green in 

A,C; gray in B and C left) colocalize with remnants 

of centromeric sequences (red in A,C; arrows) in 

Indian muntjac chromosomes 1 (A,B) and 2 (C). 

Currently, Nils is cloning the Terf1 and Terf2 genes, which encode telomere-binding proteins 

and confer karyotype stability, from two muntjac genomes. He is currently analyzing Terf expression 

and could detect Muntjac-specific alternatively spliced transcripts. We are planning to 

investigate the role of these transcripts for chromosome stability by knocking them down by 

RNAi in cell culture systems and by over-expressing them in muntjac fibroblasts and HeLa 

cells. 

Finally, I have provided expertise in advanced immunofluorescence and FISH methods as well 

as microscopy to the department and its students, which is reflected in a shared first author paper 

with the Berger/Schweiger groups. 



99

100 

Department of 



Selected Publications 2002 – 2003 

Fernandez-Capetillo O, Liebe B, Scherthan H 

& Nussenzweig A (2003). H2AX regulates 

meiotic telomere clustering. J Cell Biol 163(1): 

15–20 







C, Fryns JP, Nuber U, Hoeltzenbein M, Scharff 

C, Scherthan H, Lenzner S, Hamel BCJ, 

Schweiger S & Ropers HH (2003). Mutations 

in the polyglutamine-binding protein 1 gene 

cause X-linked mental retardation. Nat Genet 

(in press) 

Pfeifer C, Scherthan H & Thomsen PD 

(2003). Sex-specific telomere redistribution 

and synapsis initiation in cattle oogenesis. Dev 

Biol 255:206-215 

Trelles-Sticken E, Loidl J & Scherthan H 

(2003). Increased ploidy as well as KAR3 and 

SIR3 disruption alter meiotic chromosome 

behavior and bouquet formation. J Cell Sci 

116:2431-2442 

Voet T, Liebe B, Labaere C, Marynen P & 

Scherthan H (2003). Telomere-independent 

homologue pairing and checkpoint escape of 

accessory ring chromosomes in male mouse 

meiosis. J Cell Biol 162:795-808 

Zeitz C * , Scherthan H * , Freier S, Feil S, 

Suckow V, Schweiger S & Berger W (2003). 

NYX (nyctalopin on chromosome X), the gene 

mutated in congenital stationary night blindness, 

encodes a cell surface protein. Inv Ophth 

Vis Sci 44:4184-4191 

Scherthan H (2003). Interphase cytogenetics 

in understanding chromosome and telomere 

dynamics during prophase I: implications 

for meiotic telomere movements. Chromosomes 

Today 14 (in press) 

Lorenz A, Fuchs J, Trelles-Sticken E, 

Scherthan H & Loidl J (2002). Spatial 

organisation and behaviour of the parental 

chromosome sets in the nuclei of Saccharomyces 

cerevisiae × S. paradoxus hybrids. J 

Cell Sci 115:3829-3835 

Neale MJ, Ramachandran M, Trelles-Sticken 

E, Scherthan H & Goldman ASH (2002). 

Wild-type levels of Spo11-induced DSBs are 

required for normal single-strand resection 

during meiosis. Mol Cell 9:835-846 

*shared first author 

Selected Invited Plenary Lectures 

Gordon Research Conference on Meiosis. 

Colby Sawer College, NH, USA, 6/2002 

DFG Priority Program Functional Architecture 

of the Cell Nucleus, Heidelberg, 4/2004 

Gordon Research Conference on Meiosis; 

Chair and plenary lecture, NH, USA, 6/2004 

Teaching 

Special practical course Molekulare Cytologie/ 

Cytogenetik; lecture Grundlagen der 

molekularen Cytologie/Cytogenetik, each term; 

University of Kaiserslautern 


DFG, Sche 350/8-4: Bukettbildung, 1 Postdoc 

& 2 PhD students funded 

Co-operations 

Chromosome dynamics in S. cerevisiae meiosis, 

with Prof. Dr. J. Loidl, Botanisches Institut, 

Abt. Genetik und Cytologie der Universität 

Wien, Österreich 

Nuclear periphery, telomeres and DNA repair 

state, with Dr. U. Nehrbass, Institut Pasteur, 

Paris, France 

The role Histone methyltransferases for meiotic 

progression, with Dr. V. Geli, CRNS, 

Marseille, France 

Interdependence of DSB repair and Telomere 

clustering in mice, with Dr. S. Keeney, Sloan 

Kettering Cancer Center, NYC, USA 

Germ line transit of accessory chromosome 

vectors, with Prof. P. Marynen, Human Genetics, 

University of Leuven, Belgium 

Meiotic telomere behavior in histone H2axdeficient 

mice, with Dr. A. Nussenzweig, NIH, 

Bethesda, USA 

Meiosis in FancA-mutant mice, with Dr. M. 

Digweed, Charité Berlin

Biochemistry of Inherited Brain Disorders 

Head: 

Dr. Susann Schweiger 

Phone: +49 (0)30-8413 1254 

Fax: +49 (0)30-8413 1383 

Email: schweiger@molgen.mpg.de 

Scientist: 

Jennifer Winter 


Beatriz Aranda 

Sybille Krauss 

Technicians: 

Vanessa Suckow 

Zofia Kijas 


While transgenic mice are firmly established as an indispensable model for the study of 

human disease, there are obvious limitations to this approach, the most striking being the 

modelling of complex traits such as intelligence and behaviour. Nature’s own knock-out 

experiments leading to monogenic disorders can efficiently fill this gap. For the last couple 

of years my group has been focussing on the elucidation of human pathology starting 

from the underlying genetic defect of a monogenic disorder characterized by developmental 

defects of the ventral midline, the so-called Opitz BBB/G-syndrome (OS). 

Most important symptoms of OS are hypertelorism and hypospadias. In addition, a variable 

set of midline defects, such as agenesis of the corpus callosum, cleft lip and palate, 

laryngo-tracheo-esophageal clefts, congenital heart defects and intestinal malformations 

have been observed in OS patients. Some (10-30 %) of the patients are mentally retarded. 

Taking advantage of a balanced translocation associated with the OS phenotype in a three 

generation pedigree, we identified the causative gene for the X-linked form of the syndrome, 

MID1, in a positional cloning approach (Quaderi et al. 1997). 

We could show that the gene product of the 

MID1 gene, a member of the RING finger 

protein family, associates to microtubules. 

Mutations found in OS patients prohibit microtubules-association 

and lead to the formation 

of intracytosolic clumps instead 

(Schweiger et al. 1999). Further studies 

showed that, similar to other members of 

the RING finger protein family, the MID1 

protein exhibits ubiquitin ligase activity. Via 

interaction with the α4 protein it triggers microtubules-associated 

protein phosphatase 2A towards ubiquitin specific degradation 

(Trockenbacher et al. 2001). Aberrant MID1 protein detached from the microtubules, can 

no longer fullfil this function which leads to an enrichment of microtubules associated 

PP2A. In line, we could demonstrate hypophosphorylation of microtubules-associated 

proteins in OS embryonic fibroblasts compared to age-matched controls. 

On the basis of the work summarized above, we hypothesized that the MID1 protein 

might be involved in the regulation of the sonic hedghog (shh) signalling pathway. This 



101

102 

Department of 


conclusion was made due to striking phenotypic overlaps of OS and Greig-syndrome, a 

developmental malformation syndrome caused by mutations in the Gli3 gene, which codes 

for a major transcription factor of the shh pathway. In addition, a central regulatory role of 

microtubule-associated serine/threonine phosphorylation in the hedgehoc signaling cascade 

in drosophila had been demonstrated previously. In extensive experiments, we could 

indeed show that the MID1/PP2A complex regulates the subcellular localisation of the 

Gli3 protein. Further studies showed that the activity of PP2A phosphatase in this signaling 

network is counter-acted by a kinase which we identified as glycogen synthase kinase 

3 (GSK3). We went on to show that, depending on the balance between the activities of 

PP2A and GSK3, yet another protein, humanFused, which binds Gli3, is phophorylated, 

thus causing retention of Gli3 in the cytosol (manuscript in preparation). Our data allowed 

the identification of a previously unknown, and completely unsuspected, signalling network 

which is illustrated below. 

The ubiquitious expression pattern of MID1 

transcripts and the central cellular role of its 

gene product poses the question as to how 

mutations in the MID1 gene lead to the highly 

specific OS phenotype despite ubiquitous expression 

of the MID1 message. This could be 

mediated through alternative splicing leading 

to the expression of tissue-specific mRNAs and 

protein isoforms with specified functions. By 

in-silico analysis of the available genomic sequences 

of the MID1 gene in human, mouse 

and Fugu, we have now identified a complex 

pattern of alternative splicing of the MID1 

RNA. Taking this as a basis we discovered 

several mechanisms mediating a subtle regulation of MID1 protein function that could be observed 

in all three organisms (manuscript submitted). 

The discovery of the MID1/α4/PP2A regulatory complex, its participation in the shh 

pathway and the establishment of GSK3 as antagonistic kinase of PP2A connects the shh 

pathway with two other major signalling pathways: the wnt-signalling cascade and the 

TOR pathway. One main purpose of future work will be to further characterize the complex 

interactions of these pathways in order to define the interdependent network elements 

in detail, as well as to elaborate their relevance for development, tumorogenesis 

and the pathogenesis of neurodegenerative disorders. This will also pave the way for the 

identification of novel drug targets for the treatment of cancer and Alzheimer’s dementia. 

Closely related to this, in an affinity-chromatographie-approach employing domains of 

the α4 protein, we are currently trying to identify the components of the MID1 protein 

complex. The identified proteins will enhance the complexicity of the suggested network. 

In addition, if one maps to chromosome 22, it would form a candidate for causing the 

autosomal form of OS. 


Selected Publications 1998-2003 







C, Fryns JP, Nuber U, Hoeltzenbein M, Scharff 

C, Scherthan H, Lenzner S, Hamel BCJ, 

Schweiger S & Ropers HH (2003). Mutations 

in the polyglu-tamine-binding protein 1 gene 

cause X-linked mental retardation. Nature 




Wieczoreck D, Hinkel GK, Tinschert S, 

Hoeltzenbein M, Ropers HH & Kalscheuer 

VM (2002). Spectrum of mutations in PTPN11 

and genotype-phenotype correlation in 96 patients 

with Noonan syndrome and five patients 

with cardio-facio-cutaneous syndrom. EJHG 

11:201-206

Schweiger S, Chaoui R, Tennstedt C, 

Lehmann K, Mundlos S & Tinschert S (2003). 

Antenatal onset of cortical hyperostosis (Caffey 

disease): Case report and review. Am J Med 

Genet (in press) 

Schweiger S & Schneider R (2003). The 

MID1/PP2A complex: a key to the pathogenesis 

of Opitz BBB/G syndrome. Bioassays 25: 

356-366 (invited review) 

Winter J*, Lehmann T*, Suckow V, Kijas Z, 

Kulozic A, Hamel B, Opitz J, Lenzner S, 

Ropers HH & Schweiger S (2003). Duplication 

of exon 1 of the MID1 gene in a patient 

with Opitz G/BBB syndrome. Hum Genet 112: 

249-254 

Raderschall E, Stout K, Freier S, Suckow V, 

Schweiger S & Haaf T (2002). Elevated levels 

of Rad51 Recombination Protein in Tumor 

Cells. Cancer Res 69:219-225 

Trockenbacher A, Suckow V, Foerster J, Winter 

J, Krauß S, Ropers HH, Schneider R & 

Schweiger S (2001). MID1, mutated in Opitz 

syndrome encodes an ubiquitin ligase that targets 

phosphatase 2A for degradation. Nature 


Scheer MP, van der Maarel S, Kubart S, Schulz 

A, Wirth J, Schweiger S, Ropers H, Nothwang 

HG (2000). DXS6673E encodes a predominantly 

nuclear protein, and its mouse ortholog 

DXHXS6673E is alternatively spliced in a 

developmental- and tissue-specific manner. 


Rinderle C, Christensen H-M, Schweiger S, 

Lehrach H & Yaspo M-L (1999). AIRE encodes 

a nuclear protein co-localizing with 

cytoskeletal filaments: altered sub-cellular distribution 

of mutants lacking the PHD zinc fingers. 

Hum Mol Genet 8(2):277-290 

Schweiger S, Foerster J, Lehmenn T, Suckow 

V, Muller YA, Walter G, Davies T, Porter H, 

van Bokhoven H, Lunt PW, Traub P, Ropers 

HH (1999). The Opitz syndrome gene product, 

MID1, associates with microtubules. 

PNAS USA 96:2794-2799 

Vonrhein C, Schmidt U, Ziegler GA, Schweiger 

S, Hanukoglu I & Schulz GE (1999). Chaperone-assisted 

expression of authentic bovine 

adrenodoxin reductase in Echerichia coli. FEBS 

Lett 443:167-169 

Suckow V, Fartmann B, Todt T, van der Maarel 

S, Foerster J & Schweiger S (1998). A rapid 

and inexpensive method for large-scale DNA 

sequencing of regions with large amounts of 

repetitive elements. TIGS, TTO 01332 

Teaching 

Seminar Klinische Genetik und Humangenetik 

für Medizinstudenten, FB Medizin, Charité, 

SS 2001, 1 SWS 

Seminar Klinische Genetik und Humangenetik 

für Medizinstudenten, FB Medizin, Charité, 

SS 2002, 1 SWS 

Lecture (Praktikumsbegleitende Vorlesung) 

Biochemie, FB Chemie, Freie Universität Berlin, 

SS 2002, WS 2002/03, je 3 SWS 

Lecture and practical course Genetik für 

Bioinformatiker, Freie Universität Berlin SS 

2003, 3 SWS 

Theses 

T. Lehmann, Isolierung und Charakterisierung 

exprimierter Sequenzen im Bereich des MID1- 

Gens. PhD Thesis, Humboldt Universität Berlin, 


J. Winter, Molekulare Charakterisierung des 

MID1 Gens. PhD Thesis (submitted), Freie 

Universität Berlin, 2003 

S. Krauss, Molekulare Charakterisierung des 

MID1 Gens bei Mensch, Maus und Fugu. 

Diploma Thesis, Fachhochschule Berlin, 2002 


SFB 557: Analysis of clinical variability 

in Mendelian disorders, Teilprojekt C04 

Patents 

US-Patentanmeldung 60/380,590: Intervention 

in intracellular PP2A levels via its interaction 

with the a4 protein: implications for 

Alzheimer and cancer treatment 

Co-operations 

Biochemistry of the MID1 protein, with Prof. 

Rainer Schneider, University Innsbruck, Austria 

Structural analysis of the MID1/α4 complex, 

with Prof. Konrat, Biocenter Vienna, Austria 

The MID1 gene during development, with Dr. 

Nandita Quaderi, MRC, London, UK 

The MID1/PP2A complex, with Prof. Brian 

Wadzinski, Nashville, USA 

Shh and rapamycin, with Dr. John Foerster, 

Dr. Uwe Trefzer, Charité, Berlin 



103

104 

Department of 


Familial Mental Retardation 

Head: 

Prof. Dr. Hans-Hilger Ropers 

Phone: +49 (0)30-8413 1240 

Fax: +49 (0)30-8413 1383 

Email: ropers@molgen.mpg.de 

Scientists: 

Dr. Steffen Lenzner 

Dr. Lars Riff Jensen 


Chen Wei 

Bartlomiej Budny 

Technicians: 

Melanie Rosenkranz 

Marion Amende 


In our population, monogenic forms of mental retardation (MR) appear usually as 

sporadic, because dominant MR will not be transmitted unless it is mild, and in small 

families, recessive forms will be rarely observed more than once. 

The only exception is X-linked MR (XLMR) where pedigrees with several affected patients 

are not uncommon. Because of the well established preponderance of mentally 

retarded males, about 25 percent of the severe forms of MR are thought to be due to Xchromosomal 

gene defects. One third of these patients have syndromic forms of XLMR, 

where MR is associated with recognisable clinical signs such as skeletal abnormalities or 

dysmorphic facial features. So far, the underlying gene defect has been identified in 30 

clinically distinguishable forms of syndromic XLMR. In contrast, finding the molecular 

causes of non-syndromic (NS-) XLMR has turned out to be very difficult because of 

genetic heterogeneity, which precludes pooling of linkage data from different families. 

Against this background, we and four other European laboratories (Chelly et al, Paris; 

Moraine et al, Tours; Frijns et al, Leuven; and Hamel et al, Nijmegen) have founded the 

European MRX Consortium, which aims to elucidate all frequent forms of X-linked mental 

retardation, with a focus on non-syndromic XLMR. For several years, our most significant 

contribution to this consortium was the mapping and cloning of breakpoints in 

numerous mentally retarded patients with balanced X-chromosome rearrangements (see 

group Kalscheuer). Only in 2002, at about the same time when we started our collaboration 

with A. Latos-Bielenska in Poznan (Poland), a separate group was formed at our 

department to search for XLMR genes by studying families in a systematic fashion.

Until 2002, 13 genes have been implicated in NS-XLMR, and the European XLMR Consortium 

was involved in the isolation of 8 of these. However, with one possible exception, 

mutations in these genes turned out to be very rare. Extrapolation of these findings suggested 

that close to 100 different genes might be involved in non-syndromic XLMR, 5-10 

times more than previously thought, and that mutations in the known genes accounted for 

less than 20 percent of all families with NS-XLMR. 

To find out how these missing mutations are 

distributed on the X-chromosome and whether 

they are clustered in specific regions, we have 

recently compiled and analysed linkage data 

from all published and numerous unpublished 

families with NS-XLMR. As shown in Figure 

1, the causative mutations in non-syndromic 

XLMR are conspicuously clustered at Xq28, 

and even more so in the proximal Xp11 region 

where no single XLMR gene had been detected 

so far. 

This observation has prompted us to screen 30 

European and Australian XLMR families with 

overlapping linkage intervals for mutations in 

all known and several not well-annotated brainexpressed 

genes that are located in a 7.7 Mb 

interval of the Xp11 region that is flanked by 

ELK1 and ALAS2. Subsequent screening of 

>200 XLMR families revealed multiple mutations 

in at least 5 genes (Kalscheuer et al, under 

revision; Freude et al, in preparation; 

Lenzner et al, in preparation; Gurok et al, unpublished). 

Several of these are frame shift, 

stop codon or splice site mutations which are expected to truncate and inactivate the gene 

products. Together, mutations in these genes have been found in 12 of the 30 Xp11 families 

tested. Thus, defects of these genes may be responsible for >30 percent of the missing mutations 

in this region, and for 10 percent of all defects that give rise to NS-XLMR (reviewed by Jensen, 

Lenzner et al, in preparation). A list of the genes tested is given in Figure 2. 

Figure 2: Survey of brain-expressed genes from a 7.7 Mb interval 

of the Xp11 region flanked by ELK1 and ALAS2 screened for 

mutations in 30 European and Australian XLMR families with 

overlapping linkage intervals. Altogether, 769 amplicons from 46 

different genes comprising 94.390 coding and 61.904 non-coding 

bases were analysed. 

Figure1: Regional distribution of mutations in families 

with non-syndromic X-linked mental retardation (NS- 

XLMR) (a) and gene density on the human X-chromosome 

(b). (a) Upper curve: all families analysed; lower 

curve: families with known mutations analysed. The 

surface under these curves corresponds to the sum of 

the ´weighted´ linkage intervals for individual families, 

each of which is represented by bars of different height, 

to compensate for different lengths of these intervals. 

Triangles indicate the map positions of known NS- 

XLMR genes (b) Distribution of genes on the human 

X-chromosome (blue bars: known genes, red bars: other 

genes) (from:http://www.ensembl.org/Homo_sapiens/ 

mapview?chr=X) 

Presently, 30 additional brainexpressed 

genes from the pericentric 

region of the X-chromosome 

are being screened, 

which had not been fully annotated 

at the outset of this 

project or had been omitted for 

other reasons. Since there are 

numerous examples for MR 

being due to mutations in 

genes which are not highly expressed 

in the brain (such as 

phenylalanine hydroxylase in 

PKU), our next step will be to 

include such genes in this 

study, again with a focus on 

genes in regions of the X-chromosome 

with a high mutation 

density. The identification of 

novel inborn errors of metabolism 

that give rise to MR would 

not only open up possibilities 



105

106 

Department of 


for the development of universal biochemical tests, suitable for the diagnosis of all kinds of 

mutations in these genes, but might also have therapeutic consequences. 

Another promising approach is the search for low-copy repeats (LCRs) on the X-chromosome, 

which may give rise to disease through unequal pairing and recombination, or through gene 

conversion between duplicated (pseudo) genes. Recent in silico studies (of Chen Wei et al., see 

Figure 3) have revealed >400 LCRs with a minimum length of 5 kb and a sequence identity of 

>98 percent, which are present on the X-chromosome in at least two copies. Many of these 

LCRs could be confirmed in ‘wet’ experiments. It is tempting to speculate that such LCRs and 

their interaction play a role in the aetiology of several of the mutations which cannot be detected 

by conventional mutation screening. Given our unique collection of XLMR families, we are in 

an excellent position to test this hypothesis. 

Finally, clinically relevant mutations may lead 

to reduced mRNA concentrations in cells of 

patients, e.g. due to nonsense-mediated RNA 

decay if they result in a frame shift or stop codon 

causing early truncation of the gene product. 

To identify these mutations by cDNA array- 

Figure 3: Distribution of 437 low-copy repeats (LCRs) on the human X 

based gene expression profiling in lympho- 

chromosome. LCRs in non-identical positions are connected by straight lines. 

blastoid cell lines from patients with XLMR, a 

cDNA array representing most of the genes encoded by the human X-chromosome (Sudbrak et 

al, Hum. Mol.Genet 10:77, 2001) was employed (by U.Nuber and co-workers). However, due 

to widely varying gene expression patterns in cultured cells and to experimental variation, results 

of these studies were largely disappointing. Ongoing studies in our laboratory utilize semiquantitative 

RT-PCR methods to search for mutations altering the expression of positional or 

functional candidate genes, as well as Northern blotting to search for aberrant splicing. 

Recent, as yet unpublished, observations from several laboratories indicate that none of the 

known genes for XLMR, not even the gene for the fragile X-syndrome, accounts for more than 

2 percent of all mutations in large series of unselected patients with idiopathic MR. One explanation 

for this unexpected finding could be that X-linked MR is less frequent than commonly 

thought, and that there are also other causes for the higher prevalence of MR in males. If so, this 

would probably mean that autosomal recessive defects, generally thought to account for 60 

percent of severe MR, are even more important in the aetiology of this disorder. 

So far, next to nothing is known about the genes that play a role in autosomal recessive MR 

(ARMR), because in Western civilizations, small family sizes preclude the mapping and identification 

of these genes. In contrast, very large families are common in Iran where 70 percent of 

the population is below 30 years, and mapping is greatly facilitated by the fact that in the Western 

provinces, 60 percent of the children are born to parents that are first cousins. In many parts of 

India, the situation is similar. Because of our formalized collaborations with three different 

institutes in India and a far-ranging agreement with a particularly potent partner in Iran, prospects 

are excellent for making rapid progress in this field. Apart from the recruitment and detailed 

clinical examination of large families (some with a theoretical lod score of >8), genome 

scanning will be performed to localize the respective genes by autozygosity mapping. Initially, 

commercial (Affymetrix) SNP chips will be employed for this purpose, but other cost-effective 

options are also being considered (collaboration with P. Nürnberg). 

In collaboration with E. Cuppen and R. Plasterk (Utrecht), R. Reinhardt and Transgenomic Inc., 

experiments are in progress to replace the existing DHPLC (=WAVE) technology by an endonuclease-based 

mutation screening procedure that lends itself to automation and promises to be 

both faster and less expensive than the established method. Since screening numerous genes in 

a given linkage interval for a single mutation can be quite demanding and costly, high-throughput/high 

resolution/low cost mutation detection is of crucial importance for gene finding in 

ARMR and related disorders. 

Functional studies will be performed in collaboration with other groups of the department, the 

institute, from the EURO-XLMR Consortium and elsewhere third parties. E.g., close collaborations 

exist (with G. Eichele, Hannover) to study the expression of these genes in early developmental 

stages of the mouse. Through collaborations within an ongoing EU project on XLMR, 

neurobiological and behavioural studies in mice will be possible if required.


Selected publications 1998-2003 

Kalscheuer VM, Freude K, Musante L, 

Jensen LR, Yntema HG, Gécz J, Sefiani A, 

Hoffmann K, Moser B, Haas S, Gurok U, 

Haesler S, Aranda B, Nshedjan A, Tzschach 

A, Hartmann N, Roloff TC, Shoichet S, 

Hagens O, Tao J, van Bokhoven H, Turner 

G, Chelly J, Moraine C, Fryns JP, Nuber U, 

Hoeltzenbein M, Scharff C, Scherthan H, 

Lenzner S, Hamel BCJ, Schweiger S & 

Ropers HH (2003). Mutations in the polyglutamine-binding 

protein 1 gene cause X-linked 

mental retardation. Nature Genetics (in press) 

Ropers HH, Hoeltzenbein M, Kalscheuer 

V, Yntema H, Hamel B, Fryns JP, Chelly J, 


Non-syndromic X-linked mental retardation: 

where are the missing mutations? Trends in 

Genetics 19(6):295-352 

Shoichet SA, Hoffmann K, Menzel C, Trautmann 

U, Moser B, Hoeltzenbein M, Echenne 

B, Partington M, van Bokhoven H, Moraine 

C, Fryns JP, Chelly J, Rott HD, Ropers HH 

& Kalscheuer VM (2003). Mutations in the 

ZNF41 gene are associated with cognitive deficits: 

identification of a new candidate for Xlinked 

mental retardation. Am J Hum Genetics 

(in press) 

Lenzner S, Prietz S, Feil S, Nuber UA, 

Ropers HH & Berger W (2002). Global gene 

expression analysis in a mouse model for 

Norrie Disease: late involvement of photoreceptor 

cells. Invest Ophthal & Visual Science 

43:2825-2833 

Meloni I, Muscettola M, Raynaud M, Longo 

I, Bruttini M, Moizard MP, Gomot M, Chelly 

J, des Portes V, Fryns JP, Ropers HH, Magi 

B, Bellan C, Volpi N, Yntema HG, Lewis SE, 

Schaffer JE & Renieri A (2002). FACL4, encoding 

fatty acid-CoA ligase 4, is mutated in 

nonspecific X-linked mental retardation. Nature 



W, Kirchner R, Erdogan F, Brown CJ, Wöhrle 





Hum Mol Genetics 10:77-83 

Kutsche K, Yntema H, Brandt A, Jantke I, 

Nothwang HG, Orth U, Boavida MG, David 

D, Chelly J, Fryns JP, Moraine C, Ropers HH, 

Hamel BCJ, van Bokhoven H & Gal A (2000). 

Mutations in ARHGEF6, encoding a guanine 

nucleotide exchange factor for Rho GTPases, 

in patients with X-linked mental retardation. 

Nature Genetics 26:247-250 

Zemni R, Bienvenu T, Vinet MC, Sefiani A, 

Carrie A, Billuart P, McDonnell N, Couvert P, 

Francis F, Chafey P, Fauchereau F, Friocourt 

G, Portes VD, Cardona A, Frints S, Meindl A, 

Brandau O, Ronce N, Moraine C, Bokhoven 

H, Ropers HH, Sudbrak R, Kahn A, Fryns JP 

& Beldjord C (2000). A new gene involved in 

X-linked mental retardation identified by analysis 

of an X;2 balanced translocation. Nature 


Carrié A, Jun L, Bienvenu T, Vinet M-C, 

McDonell N, Couvert P, Zemni R, Cardona A, 

van Buggenhout G, Frints S, Hamel B, Moraine 

C, Ropers HH, Strom T, Howell GR, Whittaker 

A, Ross MT, Kahn A, Fryns J-P, Beldjord C, 

Marynen P & Chelly J (1999). A new member 

of the IL-1 receptor family highly expressed in 

hippocampus and involved in X-linked mental 

retardation. Nature Genetics 23: 25-31 

Kirschner R, Rosenberg T, Schultz- 

Heienbrok R, Lenzner S, Feil S, Roepman 

R, Cremers FP, Ropers HH & Berger W 

(1999). RPGR transcription studies in mouse 

and human tissues reveal a retina-specific 

isoform that is disrupted in a patient with Xlinked 

retinitis pigmentosa. Hum Mol Genetics 

8:1571-1578 

Lenzner S, Brunner B, Feil S, Niesler B, 

Schulz U, Pinckers AJLG, Blanken-nagel A, 

Ruether K, Kellner U, Rappold G, Ropers HH, 

Kalscheuer VM, Berger W & The 

Retinoschisis Consortium (1998). Functional 

implications of the spectrum of mutations 

found in 234 cases with X-linked juvenile 

retinoschisis (XLRS). Hum Mol Genetics 

7:1185-1192 

Schwahn U, Lenzner S, Dong J, Feil S, Hinzmann 

B, Duijnhoven GV, Kirschner R, Hemberger 

M, Bergen AAB, Rosenberg T, Pinckers 

AJLG, Fundele R, Rosenthal A, Cremers FPM, 

Ropers HH & Berger W (1998). Positional 

cloning of the gene for retinitis pigmentosa 2. 

Nature Genetics 19:327-332 



107

108 

Department of 


Book contributions 

Berger W & Ropers HH (2001). Norrie disease. 

In: Scriver CR, Beaudet AL, Sly WS, 

Valle D, Childs B, Kinzler KW & Vogelstein 

B, eds., The Metabolic and Molecular Bases 

of Inherited Disease 8(239): 5977-5985. New 

York, McGraw-Hill Inc. 

Cremers FPM & Ropers HH (2001). 

Choroideremia. In: Scriver CR, Beaudet AL, 

Sly WS, Valle D, Childs B, Kinzler KW & 

Vogelstein B, eds., The Metabolic and Molecular 

Bases of Inherited Disease 8(236): 

5935-5945 

Teaching 

H.-Hilger Ropers: Lecture Genetics for Bioinformaticians, 

Free University Berlin, SS 

2002, 2SWS 

Theses 

S. Prietz: Expressionsanalysen mit cDNS- 

Mikroarrays – Aufklärung der Pathogenesemechanismen 

einer seltenen 

Augenkrankheit. PhD Thesis, Freie Universität 

Berlin, 2002 

R. Kirschner: Zur Struktur und Funktion des 

Gens für die X-chromosomale Retinitis 

pigmentosa 3. PhD Thesis, Humboldt- 


U. Schwahn, Positionsklonierung des Gens für 

Retinopathia Pigmentosa 2 (RP2) und molekulare 

Analyse der Pathogenesemechanismen. 


M.R. Toliat, Molekulargenetische Charakterisierung 

von neuroendokrinen Tumoren des 

gastroenteropankreatischen Systems. PhD 


B. Meyer, Identifizierung und Charakterisierung 

früher Genomveränderungen in 

benignen Hirntumoren. PhD Thesis, 

Humboldt-Universität Berlin, 2001 

Collaboration with other groups of 

the department and the MPIMG 

Balanced chromosome rearrangements with 

MR, with V. Kalscheuer and co-workers 

Gene expression profiling, with U. Nuber and 

co-workers 

Protein interactions, biochemical studies, with 

S. Schweiger and co-workers 

Cell and animal models, RNAi, with D. Walther 

and co-workers, C.Scharff and co-workers 

Recruitment of patients, clinical characterization, 

with M. Hoeltzenbein, A. Tzschach 

Technical support, with R. Reinhardt and coworkers 

Bioinformatics, with M.Vingron, S.Haas and 

co-workers, A. Beck 

External co-operations 

EURO-MRX Consortium 

A. Latos-Bielenska, Poznan 

J. R. Singh, Amritsar 

E. Hasnain, Hyderabad 

A. Gal and K. Kutsche, Hamburg 

G. Rappold, Heidelberg 

and numerous other colleagues from Germany 

and elsewhere. 


Max-Planck-Gesellschaft 

Nationales Genomforschungsnetzwerk 

(NGFN) 

Deutsches Humangenomprojekt (DHGP) 

European Union (5th Framework) 

Deutsche Forschungsgemeinschaft (DFG)

Department of Computational 

Molecular Biology 

Introduction 

Head: 

Prof. Dr. Martin Vingron 

Phone: +49 (0)30-8413 1150 

Fax: +49 (0)30-8413 1152 

Email: vingron@molgen.mpg.de 

Co-ordination: 

(Berlin Center for Genome Based Bioinformatics) 

Dr. Patricia Béziat 

Phone: +49 (0)30-8413 1716 

Fax: +49 (0)30-8413 1671 

Email: beziat@molgen.mpg.de 

Secretary: 

Birgit Löhmer 

Phone: +49 (0)30-8413 1151 

Fax: +49 (0)30-8413 1152 

Email: vinoffic@molgen.mpg.de 

The research of the Computational Molecular Biology Department focuses on the analysis 

of the data generated by today’s sequencing and functional genomics programs. 

Numerous challenging questions can be posed based on these data concerning, e.g., 

the description of gene structure of human and mouse genes, gene regulation, the mapping 

of protein sequence space, whole genome comparison, the analysis of large scale 

gene expression data, and their utilization for disease diagnosis. 

The department is structured into several smaller research units looking into certain of 

these questions. Where meaningful, groups interact very closely with each other. Depending 

on the methods required, some of the groups are more mathematical, while 

others apply existing methods to pursue their biological questions. Overall, department 

staff comes from various backgrounds including computer science, mathematics, 

genetics, biochemistry, biology, and physics. 

Some significant research results of the last years are: 

• the resolvent method for computing an amino acid exchange matrix (Müller, Spang); 

• the “variance stabilization” normalization method for microarrays (von Heydebreck, 

in collaboration with W. Huber, DKFZ, Heidelberg) 

• the online databases SYSTERS (protein families, Krause), GeneNest & SpliceNest 

(gene structure, Haas), and CORG (Comparative Regulatory Genomics, Dieterich) 

• the establishment of the connection between protein-protein interactions of yeast 

transcription factors and the co-occurrence of their binding sites (Manke); 

• collaborative projects on ancient genome duplications (Krause, with Panopoulou, 

Dept. Lehrach), and analysis of gene expression data on heart disease (von 

Heydebreck, with Sperling, Dept. Lehrach). 

The department was founded in October 2000 with the new director taking office in 

October of that year. The rooms, then still at Harnackstraße, were quickly filled, partly 

with people coming along from Heidelberg to Berlin, and additionally with newly re- 



109

110 



cruited scientists. Jens Stoye, who at the time was a group leader for algorithmics on a C3 

position, has meanwhile received an offer for a professorship in Bielefeld which he accepted. 

He left in spring 2002 and was succeeded by Alexander Schliep. More recently, 

Jörg Schulz, group leader protein function analysis, has received and accepted an offer for 

a professorship in Würzburg. In his place, Peter Arndt will build up a new group starting 

in October 2003. Early 2002 the department moved from Harnackstraße to the third floor 

of tower 2 of the main institute building. As of fall 2003, just above 30 people work in the 

department. 

The computer equipment of the department comprises PCs under Linux or workstations 

on the desks, a central 16 processor compute server with large memory, a specialized 

computer for data base searching, and 2 TB of disk space. This set-up is maintained by the 

department system administrator in close cooperation with the institute computing unit. 

Department members contribute substantially to the bioinformatics curriculum at Free 

University of Berlin. We teach a number of courses and offer students to do internships, 

practical courses, and thesis work with us. This is bringing many bright, young students to 

the department and at the same time allows the university to show the students a much 

larger spectrum of bioinformatics than would normally be possible in the university framework. 

We are involved in a number of national and international projects and collaborations. 

Most prominently, we are part of the Berlin Center for Genome Based Bioinformatics 

(BCB), a large network made up of several Berlin bioinformatics groups and funded 

by the German Federal Minstry of Education and Research (BMBF). The “Computational 

Diagnostics” group headed by R. Spang is part of BCB. This group is also active 

in the German National Genome Research Network (NGFN) providing education and 

know-how in microarray data analysis. 

With support from BCB and Max Planck Society, the department has organized a major international 

conference. RECOMB, the Annual International Conference on Computational Molecular 

Biology was held in Berlin in April 2003. This event brought more than 500 attendees to 

Berlin and presented a selection of highest quality up-to-date research in the field. 


(also see group reports for further information) 


DFG, Vi 160/3: Rechnergestützte phylogenetische 

Analyse großer genomischer Abschnitte. 

Joint with Prof. Dr. A. von Haeseler, MPI für 

evolutionäre Anthropologie, Leipzig, ended in 

2002, 1 position 

DFG, SFB 1904 „Theoretische Biologie: Robustheit, 

Modularität und evolutionäres Design 

lebernder Systeme”, subproject Correlation 

between regulatory DNA sequences and 

gene expression data, 1 position 

BMBF-DHGP, 01KW9911/9: Erstellung von 

Genexpressionsprofilen von Tumor- und Normalgewebe 

mittels komplexer Hybridisierung 

und mathematischer Analysen der Expressionsmuster. 

Joint with Prof. Dr. Annemarie 

Poustka, Deutsches Krebsforschungszentrum, 

Heidelberg. Currently in its 2nd funding period, 

1 position 

BMBF-DHGP, 01KW9955/3: Auswertung 

von EST-Daten in Hinblick auf Genstruktur, 

funktionale Annotation und Expressionsanalyse. 

Joint with Dr. Bernhard Korn, 

Deutsches Krebsforschungszentrum, Heidelberg. 

Currently in its 2nd funding period, 1 

position. 

BMBF, (031U109/C): Berlin Center for Genome 

Based Bioinformatics (BCB). Center 

grant to a consortium of Berlin research institutions 

and universities, 2 scientists, 1 administrative 

position 

BMBF-NGFN Grant 031U117 (Optimierungsfond): 

Bereitstellung von Ressourcen und 

Transfer von Know-how für die Analyse von 

Genexpressionsprofilen im NGFN, 2 positions 

BMBF: Helmholtz Netzwerk Bioinformatik. 

Consortium of German bioinformatics groups 

establishing a common, web-based infrastructure 

for bioinformatics. Ended in 02, 1 position

EU: The European Molecular Biology Linked 

Original Resources (TEMBLOR). 1 position. 

EU: BioSapiens: Bioinformatics Excellence 

Network 

PhD Theses 

Antje Krause: Large Scale Clustering of Protein 

Sequences. PhD Thesis, University of 

Bielefeld, June 2002 

Heiko Schmidt: Phylogenetic Trees from 

Large Datasets. PhD Thesis, University 

of Düsseldorf, July 2003 


memberships 

Ina Koch, C2 Professorship at Technical University 

of Applied Sciences, Berlin (from 

1.4.03) 

Jörg Schulz, C3 Professorship at University 

of Würzburg (from 1.9.03) 

Jens Stoye, C4 Professorship at University of 

Bielefeld (from 2002) 

Sven Rahmann: Best paper Award, IEEE Computer 

Society Bioinformatics Conference, Palo 

Alto, USA, 2002 

Anja von Heydebreck: Submission for Jahrestagung 

der Dtsch. Gesellschaft für Pathologie 

2003 was awarded for one of four best research 

contributions 


Vingron M, organizer of a MPG-Polish workshop 

on Bioinformatics, Berlin, 2001 

Vingron M & Freytag J-C, organizer of the 

International BCB-Workshop on Data Bases 

and Data Integration in Genome Research, 

Berlin, 7.+8.2.2002 

Vingron M, local organizer of The Seventh 

Annual International Conference on Research 

in Computational Molecular Biology - 

RECOMB 2003, Berlin, 10.-13.4.2003 

Indo-German workshop on Proteomics and 

Bioinformatics, Berlin, 2003 

Co-operations 

Detecting SNPs in regulatory regions, with 

Jörg Hoheisel, DKFZ, Heidelberg 

Protein sequence analysis, reliability of multiple 

alignments, Andrei Lupas, Tübingen 

Maximum Likelihood methods for computing 

phylogenetic trees, Arndt von Haeseler 

Düsseldorf 

Gene structure and alternative splicing, experimental 

validation by PCR and by microarrays, 

with Annemarie Poustka, Bernhard Korn, 

Deutsches Krebsforschungszentrum, Heidelberg 

Gene regulatory networks, with Ricardo 

Bringas-Perez, Habana, Cuba 

Experimental verification of predicted SRF 

target genes, with Alfred Nordheim, Tübingen 

Gene expression analysis, EST assembly and 

clustering, probe design, with Inge Jonassen, 

Eivind Coward, University of Bergen, Norway 

Graph algorithms for the analysis of protein 

protein interactions, with David Sherman, 

Bordeaux, France 

Gene regulation and microarray data in fruit 

fly, with Alvis Brazma, European Bioinformatics 

Institute, Hinxton 

Pattern recognition in DNA sequences, with 

Jerzy Tiuryn, Warsaw, Poland 

Tree models of chromosomal aberrations in 

tumors, with Simon Tavare, USC, Los Angeles, 

USA 

Pattern recognition in DNA sequences; 

orthology detection and synteny, with Pavel 

Pevzner, UC San Diego, USA 


Organization of a public discussion Hype 

oder Hoffnung - Podiumsdiskussion zur 

Rolle der Bioinformatik am Standort Berlin, 

Berlin, 9.9.2002 

Organization of the public seminar Chancen 

der Bioinformatik in Berlin-Brandenburg - 

Die Biotechnologie und die Informatik 

lernen sich kennen, Berlin, 1.4.2003 



111

112 



Gene Structure & Array Design Group 


Shobhit Gupta 

Sven Rahmann 

Head: 

Dr. Stefan Haas 

Phone: +49 (0)30-8413 1164 

Fax: +49 (0)30-8413 1152 

Email: stefan.haas@molgen.mpg.de 

Scientists: 

Dr. Eivind Coward (until 12/2001) 

Dr. Ina Koch (until 3/2003) 


Marc Brüning (until 9/2002) 

Stéphanie Boué (until 10/2002) 


The main interest of our group is the development of tools that enable the analysis of 

the exon-intron structure of genes with special emphasis on the evaluation of alternative 

splicing. In collaboration with experimentalists we are aiming to substantiate our 

in silico predictions by wet lab experiments. 

ESTs and gene structure 

Expressed sequence tags (ESTs) reflect semi-random parts of transcripts expressed in 

a defined tissue. Caused by the cost-efficient generation of ESTs the reliability of their 

sequence and annotation may vary strongly. However, the huge amount of EST sequences 

available in public databases comprises a valuable source for the reconstruction 

of so far unknown transcripts as well as for the analysis of gene expression. We 

developed the database GeneNest that represents genes by clusters of EST/mRNA 

sequences that share sequence similarities. Based on the subsequent sequence assembly 

these cluster are subdivided into contigs reflecting different transcripts of the respective 

gene. The consensus sequences derived from these contigs summarize the 

redundant EST sequence information and are usually of higher quality than the underlying 

ESTs. Therefore, our comprehensive set of consensus sequences can be efficiently 

used for database searches or further analysis of the respective transcripts. 

By mapping these consensus sequences to the genome sequence using our SpliceNest 

software we derive potential exon-intron boundaries of the respective transcripts. Despite 

the improved sequence quality of the consensus sequences the predicted boundaries might 

still include artefacts, caused for instance by ESTs that originate from genomic DNA. In 

order to reliably detect real splicing events, we compute a confidence value for every exon 

based on the existence of splicing signals, the alignment quality, the redundant coverage 

by ESTs, etc. Similarly, we assign a confidence value to every potential splicing events 

thus prioritising the variants for validation in large-scale experiments.

EST tissue distribution 

Besides the sequence information ESTs also provide details about the tissue or developmental 

stage from which these cDNAs descended. Despite the fact that these annotations 

are prone to errors they still provide a means to evaluate the expression of genes/transcripts. 

We simulated EST clusters with a random distribution of ESTs from different 

tissues in order to derive a p-value that describes the likelihood of observing the given 

number of ESTs present in a tissue by chance. Sorting EST-clusters according to their pvalue 

provides us with a list comprising genes that are highly and/or specifically expressed 

in certain tissues. Since tissue-specific expression is more frequently observed 

for transcripts rather than genes we are currently focusing on the prediction of tumour/ 

tissue-specific alternative transcripts. Such a collection of genes/transcripts showing tissue-specific 

expression will provide a basis for the analysis of diseases that are connected 

to a specific type of tissue such as many kinds of tumours. In a tight collaboration with the 

Resource Center (RZPD) we experimentally verify the predicted transcripts and their 

expression on a variety of tissues, aiming to define a reliable set of alternative transcripts 

for the design of a DNA microarray. We are especially focusing on splice isoforms for all 

genes on human chromosome 21 as well as for disease related genes on chromosome X 

that will be experimentally analysed by our in-house collaborators. A set of splice variants 

was also analysed on the level of protein structure in order to evaluate if alternative splicing 

leads to structural differences between isoforms. 

Chip design 

In the context of the construction of DNA-microarrays we developed algorithms based 

on a ‘Longest Common Factor’ approach aiming to generate microarrays that represent 

genes by a minimal set of short oligomers. In addition, we developed the software 

GenomePRIDE for the design of PCR- and long oligomer-based DNA-microarrays, 

which primarily computes PCR-primers or long oligomers that reflect unique parts of 

a set of genes. We successfully applied the software to the design of PCR-based whole 

transcriptome arrays for Drosophila melanogaster, Schizosaccharomyzes pombe, Listeria 

monocytogenes etc. We also addressed further applications like the use of specific 

PCR-amplicons in RNAi experiments, the design of genomic tiling path arrays, and 

the design of splice isoform specific amplicons. 

All tools developed in our group are either licensed (GenomePRIDE) or are presented via 

interactive WWW-interfaces (GeneNest, SpliceNest) that visualize all data related to ESTclusters, 

and the genomic mapping of the EST consensus sequences directly linking to inhouse 

database as well as to external databases such as the EMBL- and the RZPD-database. 

These graphical web sites are particularly designed to support the efficient analysis 

of splice variants and/or tissue-specifically expressed transcripts covered by ESTs. 



Haas SA, Hild M, Wright APH, Hain T, Talibi 

D & Vingron M (2003). Genome-scale design 

of PCR primers and long oligomers for DNA 

microarrays. Nucleic Acids Res 31(19):5576-81 

Kriventseva EV, Koch I, Apweiler R, Vingron 

M, Bork P, Gelfand MS & Sunyaev S (2003). 

Increase of functional diversity by alternative 

splicing. Trends in Genetics 19(3):124-128 

Rahmann S (2003). Fast large scale oligonucleotide 

selection using the longest common 

factor approach. J Bioinf Comp Biol 1(2): 

343-361 

Rahmann S & Rivals E (2003). On the distribution 

of the number of missing words in 

random texts. Combinatorics, Probability and 

Computing 12:73-87 

Xue-FranzenY, Haas SA, Brino L, Gusnanto 

A, Reimers M, Talibi D, Vingron M, Ekwall 

K & Wright APH (2003). A DNA microarray 

for fission yeast: minimal changes after a temperature 

shift to 36 C. Yeast (in press) 

Boué S, Vingron M, Kriventsevea E & Koch 

I (2002). Theoretical analysis of alternative 

splice forms using computational methods. 

Bioinformatics 18(Suppl 2), eds. T. Lengauer, 

H.-P. Lenhof, 65-73 



113

114 



Coward E, Haas SA & Vingron M (2002). 

SpliceNest: visualization of gene structure and 

alternative splicing based on EST clusters. 

Trends Genet 18(1): 53-55 

Krause A, Haas SA, Coward E, Vingron 

M (2002). SYSTERS, GeneNest, SpliceNest: 

Exploring sequence space from genome to 

protein. Nucleic Acids Res 30(1): 299-300 

Boer JM, Huber W, Sültmann H, Wilmer F, 

von Heydebreck A, Haas S, Korn B, 

Gunawan B, Vente A, Füzesi L, Vingron M 

& Poustka A (2001). Identification and classification 

of differentially expressed genes in 

renal cell carcinoma by expression profiling 

on a global human 31,500 element cDNA array. 

Genome Res 11(11): 1861-1870 

Petersohn A, Brigulla M, Haas S, Hoheisel J, 

Völker U & Hecker M (2001). Global analysis 

of the general stress response of Bacillus 

subtilis. J Bacteriol 183(19): 5617-5631 

Invited talks 

Stefan Haas: EST clustering, Dept. of Informatics, 

University of Bergen, Norway, 2002 

Stefan Haas: Primer design for DNA-microarrays, 

Natural Sciences Section, Södertörns 

Hökskola, Huddinge, Sweden, 2002 

Sven Rahmann: Rapid large-scale oligonucleotide 

selection for microarrays. Research seminar 

Affymetrix Corp., Emeryville, CA, USA, 

8/2002 

Teaching 

Sven Rahmann, Praktikum und Seminar Sequence 

comparison, 6 SWS, SS 03, Freie Universität 

Berlin 

Sven Rahmann, teaching assistant and tutor 

for the lecture Algorithmische Bioinformatik”, 

WS 2002/03, Freie Universität Berlin 

Invited lectures 

Stefan Haas, Biologische Sequenzanalyse, 

Akademie für Weiterbildung, Universities of 

Heidelberg/Mannheim, 2001-2003 

Sven Rahmann, Spezielle Methoden der 

Statistik, and Molekulare Evolution, Akademie 

für Weiterbildung, Universities of Heidelberg/ 

Mannheim, 2002 

Diploma Theses 

Stéphanié Boué, Computational investigation 

of alternative splicing. Master’s thesis in 

Bioinformatics at Max Planck Institute for 

Molecular Genetics Berlin & ESBS École 

supérieure de biotechnologie Strasbourg at 

ULP - Université Louis Pasteur Strasbourg, 

France, August 2002 

Marc Bruning, Genomweite Analyse von Expressed 

Sequence Tags zur Identifizierung 

gewebsspezifisch exprimierter Gene, Diploma 

Thesis, Technical University of Berlin, 2002 

Co-operations 

Design of a whole genome microarray of 

Drosophila melanogaster, with M Hild, R 

Paro, J Hoheisel, ZMBH+DKFZ, Heidelberg 

(2001-2003) 

Design of a whole genome microarray of 

Schizosaccharomyces pombe, with A Wright, 

Södertörns Hökskola, Huddinge, Sweden 

(2002-2003) 

Design of a flexible DNA-microarray for parallel 

use of PCR fragments in expression cloning 

and RNAi (Anopheles gambiae), with G 

Christophides, F Kafatos, EMBL, Heidelberg 

(2003) 

Representing genes on DNA-chips by a minimal 

set of short oligonucleotides, with M Beier, 

FeBit AG, Mannheim 

Analysis of conserved intronic sequences in 

the context of alternative splicing, with A 

Bindereif, University of Giessen 

Prediction and experimental analysis of alternative 

splice variants based on ESTs, with B 

Korn, Resource Centre, Heidelberg

Protein Families & Evolution Group 

Protein Families 

With the overwhelming growth of biological sequence databases, handling these 

amounts of data has increasingly become a problem. Protein sequences constitute one 

such data type for which the databases have grown to an impressive size. A protein 

family contains sequences that are evolutionarily related. Generally, this is reflected 

by sequence similarity. Therefore, one aims at organizing the set of all protein sequences 

into clusters based on their sequence similarity. Clustering a large set of sequences 

as opposed to dealing only with the individual sequences offers several advantages. 

A frequent problem is the identification of sequences that are similar to a 

new query sequence. This task can be executed much quicker when only one comparison 

to an entire cluster has to be performed rather than one comparison per database 

sequence. Another important application lies in the possibility of analysing evolutionary 

relationships among the sequences in a cluster and the species they come from. 

We designed a collection of graph-based algorithms to hierarchically partition a large 

set of protein sequences into homologous families and superfamilies (see Figure 1). 

The methods unified now under the name SYSTERS (short for SYSTEmatic Re-Searching) 

are based on an all-against-all database search and run fully automated. Using 

these methods, we clustered a non-redundant union of the SWISS-PROT and TrEMBL 

databases as well as of the predicted protein sequence sets of several completely sequenced 

organisms into families and superfamilies. 

Figure 1: Overview of the graph-based SYSTERS clustering procedures 

Head: 

Dr. Antje Krause 

Phone: +49 (0)30-8413 1155 

Fax: +49 (0)30-8413 1152 

Email: antje.krause@molgen.mpg.de 

Scientists: 

Thomas Meinel 

Dr. Eike Staub (starting 09/03) 


Hannes Luz 


Ralf Mehle (10/03-02/04) 

Due to the huge amount of data (in 2003 about 1,000,000 non-redundant sequences) 

the computational requirements for processing are constantly growing. Therefore, only 

few such initiatives worldwide exist. 



115

116 



For optimal utility the clustering was postprocessed by multiply aligning the families, 

computing trees for them, annotating domain information, and extracting consensus 

sequences descriptive for groups of sequences. Based on either the multiple alignments 

or the consensus sequences a user can search the database, thus using it, e.g., for 

annotation of new sequences.The database and the associated services are available at: 

http://systers.molgen.mpg.de/. 

Taxonomical analysis 

Every protein sequence in the sequence set underlying the SYSTERS database originates 

from one species. On the other hand, most protein family clusters contain sequences 

from several different species. Thus, querying the protein family database, 

one is often interested in: 

• the taxonomical complexity of a protein family, 

• all protein families a specific taxon belongs to, 

• protein families specific for one taxon, or 

• protein families shared by several different taxa. 

With taxon we do not only mean a species, but any arbitrary taxonomical level as given 

by the NCBI taxonomy. To facilitate phylogenetic studies, the SYSTERS web server 

now provides an interface to select protein family clusters satisfying a user defined set 

of taxa. 

Evolutionary analysis 

In collaboration with the Dept. Lehrach of the MPI for Molecular Genetics, we have 

derived the COPSE database for evolutionary analyses. COPSE (short for Clusters of 

Orthologous and Paralogous SEquences) is a clustering of invertebrate and vertebrate 

sequence data as a prerequisite for the analysis of vertebrate evolution and functional 

annotation. Major duplication events are assumed to have happened during vertebrate 

evolution. To prove this hypothesis one depends on well separated vertebrate gene 

families having only one orthologous representative in the invertebrates. 

Algorithms developed for this project were applied to other data sets, e.g., for the 

comparison of the complete sequence sets of man and mouse. The resulting groups of 

orthologous sequences were used in the CORG (COmparative Regulatory Genomics) 

project (Ch. Dieterich / M.Vingron, MPI) for the detection of conserved non-coding 

blocks in the upstream regions of orthologous human and mouse genes. 

The GenomeMatrix (A.Hewelt, RZPD / H.Lehrach, MPI) is a platform integrating 

data from several completely sequenced organisms thus simplifying multi-gene crossspecies 

analyses. Orthology relationships are used to combine information originating 

from different organisms. The calculation of orthology relationships in the 

GenomeMatrix was done in our group. 

Another effort in the group focuses on the estimation of the speed of evolutionary 

changes within specific protein families. Results will be presented in the near future. 

Sequence analysis platform 

SYSTERS is together with GeneNest (S.Haas, MPI) and SpliceNest (S.Haas, MPI / 

E.Coward, formerly MPI) integrated now into one framework. This allows the user an 

over-all exploration of the whole sequence space covering protein, mRNA and EST 

sequences, as well as genomic DNA. The databases are available for querying and 

browsing at: http://cmb.molgen.mpg.de. 

Future work 

The SYSTERS data set will be regularly updated, thus providing an up-to-date resource 

for the scientific community. 

The work of the group will further continue in the direction of evolutionary analyses. 

It will be extended in the direction of the analysis of protein domain composition and 

domain arrangement and will serve as a basis for the detection of new domains.



Panopoulou G, Hennig S, Groth D, Krause 

A, Herwig R, Vingron M & Lehrach H 

(2003). New evidence for genome wide duplications 

at the origin of vertebrates using an 

amphioxus gene set and completed animal 

genomes. Genome Research 13(6a):1056- 

1066 

Dieterich C, Wang H, Rateitschak K, Luz 

H & Vingron M (2003). CORG: a database 

for Comparative Regulatory Genomics. 

Nucleic Acids Research 31 (1): 55-57 

Dieterich C, Cusack B, Wang H, Rateitschak 

K, Krause A & Vingron M (2002). 

Annotating regulatory DNA based on manmouse 

genomic comparison. Bioinformatics 

18 (Suppl 2): S84-S90 

Krause A, Haas SA, Coward E & Vingron 

M (2002). SYSTERS, GeneNest, SpliceNest: 

Exploring sequence space from genome to 

protein. Nucleic Acids Research 30(1): 299- 

300 

Haas S, Beissbarth T, Rivals E, Krause A & 

Vingron M (2000). GeneNest: automated 

generation and visualization of gene indices. 

Trends in Genetics 16(11): 521-523 

Krause A, Stoye J & Vingron M (2000). The 

SYSTERS protein sequence cluster set. Nucleic 

Acids Research 28(1): 270-272 

Talks 

Krause A, Stoye J, Vingron M. Large scale 

hierarchical clustering of protein sequences. 

26th Annual Conference of the Gesellschaft für 

Klassifikation, Mannheim, 22.– 24.7.2002 

Krause A. Clusterung großer 

Proteinsequenzdatenmengen. Universität 

Bielefeld, 19.6.2002 (Disputation) 

Krause A, Panopoulou G, Hennig S, 

Vingron M. Determination of vertebrate gene 

families. 8th Congress of The European Society 

for Evolutionary Biology, Aarhus, Denmark, 

20.– 25.8.2001 

Krause A. Determination of protein families 

with special interest in vertebrate evolution. 

Universität Bielefeld, 21.5.2001 

Krause A, Panopoulou G, Hennig S, 

Vingron M. Determination of verte-brate gene 

families. DIMACS Workshop on Whole Genome 

Comparison, Rutgers University, 

Piscataway, NJ, USA, 28.2.– 2.3.2001 

Krause A, Stoye J, Vingron M. Clustering 

in processing of nucleotide and protein sequence 

databases. 7 th Conference of the International 

Federation of Classification Societies, 

Namur, Belgium, 11.– 14.7.2000 (invited 

talk) 

Patents 

Verfahren zur Eingruppierung von Sequenzen 

in Familien. 

Patent-Nr.: 197 45 665 C1 

Patentinhaber: Deutsches Krebsforschungszentrum 

Heidelberg 

Erfinder: M.Vingron, A.Krause 

Teaching 

Bioinformatics, Studiengang Biosystemtechnik 

/ Bioinformatik, WS 2003, 2x 4 SWS, 

Technische Fachhochschule Wildau 

Assistent Bioinformatik, lectures during an 

advanced training (Assistent Bioinformatik, 8 

days full-time, 2002, 2003, Berufsbildungszentrum 

C&Q 

Interns 

Ralf Mehle (10/03 – 02/04) 

Andrea Y. Weiße (12/02 – 02/03) 

Thomas Meinel (10/01 – 12/01) 

Work as scientific referee 

Referee for Bioinformatics 

Sub-reviewer for 

• RECOMB 

• WABI 

• ECCB 

• GCB 

Co-operations 

Integration of SYSTERS, GeneNest and 

SpliceNest into a sequence analysis platform, 

with SA Haas, MPI for Molecular Genetics, 

Berlin 

Comparative Regulatory Genomics, with 

Ch.Dieterich / M.Vingron, MPI for Molecular 

Genetics, Berlin 

GenomeMatrix, with A. Hewelt, RZPD Berlin 

and H.Lehrach, MPI for Molecular Genetics, 

Berlin 

A Platform for reconstructing vertebrate phylogeny, 

with G. Panopoulou / H.Lehrach, MPI 

for Molecular Genetics, Berlin 

The SYSTERS protein family database is part 

of the “Helmholtz Netzwerk für Bioinformatik” 

(HNB) 



117

118 



Algorithms Group 

Head: 

Dr. Alexander Schliep (since 5/02) 

Phone: +49 (0)30-8413 1166 

Fax: +49 (0)30-8413 1152 

Email: alexander.schliep@molgen.mpg.de 


Martin Oksrlar (until 7/03) 

Harindar Singh Keer (until 8/03) 

Ivan Gesteira Costa Filho (since 10/03) 

Wasinee Rungsarityotin (since 10/02) 


Benjamin Georgi (since 9/03) 

Jonas Heise (since 7/03) 

Research themes 

Our research focuses on novel machine learning methods and algorithms which we apply 

to a range of biological problem settings. An emphasis is put on analyzing high-dimensional, 

heterogeneous and time-series data. 

Algorithmics and machine learning 

One key area, to which we apply machine learning techniques, is the annotation of protein 

sequences. We developed a cluster-based approach for the detection of remote homologs which 

exceeds the sensitivity of PSI-Blast, the most widely used tool for finding homolog sequences, 

by 40%. Currently we are employing Support-Vector-Machines for deciding significance of 

sequence similarity (thus circumventing the problems with the typically used statistics), information-theoretic 

methods for detecting key residues ab initio, and a decision-tree variant for 

classifying Kinases. The main focus in the future will be an integration of the learning process of 

the underlying statistical models and the classifier, to improve overall performance. 

Hidden-Markov-Models (HMMs) 

Hidden-Markov-Models, originally developed for speaker-independent speech recognition, 

have been widely used in their basic form as so-called Profile HMMs for the detection 

of remote homologs, or in the slightly more complex form of labeled HMMs, for 

finding eukaryotic genes. The basic framework supports a number of extensions; they 

can also be used for either classification or clustering. 

On one hand our work with HMMs concerned itself with learning HMM topology and different 

training methods. On the other hand, we investigated novel applications using HMMs as 

qualitative time-series models and, among others, non-Markovian HMM extensions applied to 

the detection of circular permutations. Also, we are the first to propose the framework of 

partially supervised learning for both clustering and mixture modeling. This has been employed 

with great success for gene expression time-series data. Furthermore, we develop the only free 

(licensed under the LGPL) library for HMMs, the General Hidden Markov Model Library 

(GHMM), which is widely used both in industry and academia. To the best of our knowledge, 

we also introduced the first XML-format for HMMs as well as a graphical tool to edit HMMs 

with discrete or continuous emissions. We developed a number of novel extensions to the 

HMM formalism - non-homogeneous Markov chains, clustering and mixture modeling - and 

implemented them in the library.

We make use of the well-known HMMer-package, which implements profile HMMs and 

loosely collaborate with the well-established groups developing HMMs, Anders Krogh, 

Soren Brunak, Kevin Karplus and David Haussler, on file formats and the graphical editor. 

Our work complements the existing body of work uniquely. 

Future work planned includes development of new learning algorithms geared towards discriminative 

classification, mixed-domain multi-variate emissions, and a hierarchical HMM framework 

supporting for example protein-domain combinations or custom gene finders. 

Besides their use in finding remote homologue proteins, Hidden Markov Models can for example 

be used in time-course analysis. One important application area is analyzing gene expression 

over time. A graphical user interface (left) allows to specify a HMM encoding a particular 

qualitative behaviour of time-courses. This can be used to query large data sets interactively or 

for clustering. Other HMM algorithms such as computation of the Viterbi-path allow to decompose 

similar time-courses according to their phase (right). 

Group Testing 

A prototypical problem in molecular biology is the screening of a large collection of samples 

with some specific test. If a positive test outcome is a rare event, analyzing several samples 

simultaneously — this is also called multiplexing or pooling — can provide substantial savings 

of experimental effort, for example in screening clonal DNA-libraries. The mathematical formulation 

of this problem is known as statistical group testing, and bridges across a number of 

mathematical fields such as combinatorial design theory, Bayesian statistics and Markov Chain 

Monte Carlo methods for the design and analysis of experimental protocols. The same problem 

arises for — superficially unrelated — problems such as picking oligos which detect and differentiate 

between the presence of closely related species, e.g. virus subtypes, in a sample, or in 

picking Single Nucleotide Polymorphisms (SNP) markers to infer haplotypes. 

Based on prior work at Los Alamos National Laboratory we have implemented a method to 

select oligos for DNA chips in situations where due to a high degree of sequence similarity 

unique oligos cannot be found. This will be applied to the analysis of meiobenthos samples, as 

well as to HIV subtyping, where the very high incidence of multi-viral HIV infections such as in 

populations in Southern Africa make analysis difficult. Further work on the theoretical side 

includes optimization of the underlying combinatorial designs and modeling more of the underlying 

biology — e.g. phylogenetic information in the analysis step. 

Research to use this approach for selecting most informative SNPs for haplotype detection, 

simultaneously for several individuals, is underway. We closely collaborate with David Torney, 

who first proposed and implemented group testing to reduce the experimental work in the 

context of the first physical map of Human chromosome 16. 

Visualization 

Both teaching and research in algorithms are accelerated by computer tools which allow 

to experience the dynamic nature in a rich multi-medial environment. Gato, the Graph 

animation toolbox, provides such an environment. Due to its flexibility and (semi-) automated 

visualization of user-implemented graph algorithms, it surpasses the capabilities of 

existing products. A Springer textbook, covering an introduction to combinatorial optimization, 

is forthcoming. As an extension, visualization of bioinformatics algorithms is under 

research as well as a graphical tool for working with Hidden-Markov-Models. 



119

120 




Publicatons 2000 - 2003 

Schliep A, Torney DC & Rahmann S (2003). 

Group Testing With DNA Chips: Generating 

Designs and Decoding Experiments. Proceedings 

of the 2nd IEEE Computer Society 

Bioinformatics Conference (CSB 2003) 

Schliep A, Schönhuth A & Steinhoff C (2003). 

Using Hidden Markov Models to Analyze 

Gene Expression Time Course Data. Proceedings 

of the ISMB 2003. Bioinformatics 

19(Suppl 1): I255-I263 

Knab B, Schliep A, Steckemetz B & Wichern 

B (2003). Model-based clustering with Hidden 

Markov Models and its application to financial 

times series data. Proceedings of the 

GfKl 2002 conference. In M. Schader, W. 

Gaul, M. Vichi (eds). Between Data Science 

and Applied Data Anaylsis. Springer, 2003 

Pipenbacher P, Schliep A, Schneckener S, 

Schönhuth A, Schomburg D & Schrader R 

(2002). ProClust: Improved clustering of Protein 

Sequences with an extended graph-based 

approach. Proceedings of the ECCB 2002. 

Bioinformatics 18 (Suppl 2): S182-S191 

Kaderali L & Schliep A (2002). An algorithm 

to select target specific probes for DNA chips. 

Bioinformatics 18(10):1340-9 

Schliep A & Hochstättler W (2002). Developing 

Gato and CATBox with Python: Teaching 

graph algorithms through visualization and 

experimentation. Multimedia Tools for Communicating 

Mathematics. Springer Verlag, 

2002, 291-310 

Talks 

Gato & CATBox: Teaching Graph Algorithms 

through visualization and experimentation. 

Workshop on Visualization and Mathematics, 

Berlin, 23.5.2002 

Model-based Clustering with Hidden Markov 

Models and its Application to Financial Timeseries 

Data. Jahrestagung der deutschen 

Gesellschaft für Klassifikation, Mannheim, 

24.7.2002 

Selecting target-specific probe sets for DNA 

chips. University of California at Irvine, 

26.7.2002 (invited talk) 

GHMM & HMMed: A comprehensive HMM 

toolkit. Bioinformatics Open Source Conference 

(BOSC), Edmonton, Canada, 2.8.2002 

Experimenting on Algorithms: Teaching 

Bioinformatics methods visually. Workshop on 

Education in Bioinformatics (WEB 02), 

Edmonton, Canada, 8.8.2002 

Group testing and DNA chips. Center for Nonlinear 

Studies, Los Alamos National Laboratory, 


Proclust: Improved Clustering of Protein Sequences 

with an Extended Graph-Based Approach. 

European Conference on Computational 

Biology (ECCB), Saarbrücken, 9.10.02 

Proclust: Graph-Based Clustering of Protein 

Sequences. Berlin Center for Genome Based 

Bioinformatics, Berlin, 13.11.2002 (invited talk) 

Dealing with Non-Unique Probes: DNA Chips 

and Group Testing. Dagstuhl Seminar “Computational 

Biology³, Schloß Dagstuhl, 


Using Hidden Markov Models to Analyze 

Gene Expression Time Course Data. Intelligent 

Systems in Molecular Biology (ISMB) , 

Brisbane, Australien, 30.6.2003 

A Model-based framework for time-course 

analysis. Center for Non-linear Studies, Los 

Alamos National Laboratory, 25.9.2003 (invited 

talk) 

Analyzing gene expression over time using a 

mixture approach. University of California at 

San Francisco, 3.10.2003 (invited talk) 

Mixtures of Hidden-Markov-Models. University 

of California at Berkeley, 8.10.2003 (invited 

talk) 

Teaching 

Vorlesung Algorithmische Bioinformatik, 

WS02/03, 4 SWS, Freie Universität Berlin 

Seminar Markov Ketten, WS02/03, 2SWS, 

Freie Universität Berlin 

Vorlesung Statistische Mustererkennung in der 

Bioinformatik, SS03, 2SWS, Freie Universität 

Berlin 

Softwarepraktikum zur Vorlesung Statistische 

Mustererkennung in der Bioinformatik, SS03, 

2SWS, Freie Universität Berlin 

Vorlesung Algorithmische Bioinformatik, 

WS03/04, 4SWS, Freie Universität Berlin 

Seminar Clusteranalyse Heterogener Daten, 

WS 03/04, 2SWS, Freie Universität Berlin 

Seminar Classification: Contrasting Statistics 

with Machine learning”, WS 03/04, 2SWS, 

Freie Universität Berlin 

Kompaktkurs Angewandtes Data Mining, WS 

03/04, 4SWS, Freie Universität Berlin 

Lecture Statistical Pattern Classification in 

Bioinformatics. Ringvorlesung Bioinformatik, 

Berlin Center of Genome Based Bioinformatics 

and FU Berlin, 29.1.2003

Theses 

Benjamin Georgi: A graph-based approach 

to Clustering of Profile HMMs, Bachelor Thesis, 

Bioinformatik, Freie Universität Berlin 

Olaf Wendisch: Klassifizierung entfernt 

homologer Proteinsequenzen mit Support Vector 

Maschinen, Diploma Thesis, 

Mathematisches Institut, Universität zu Köln 

Andrea Weiße: Detection of circular permutations 

in proteins, Bachelor Thesis, 


Jonas Heise: Using phylogenetic information 

in the design of DNA chips, Bachelor Thesis, 


Interns 

Holger Meyer, bioinformatics student, Freie 

Universität Berlin (3 month internship) 

Melanie Kaspar, bioinformatics student, 

Universität des Saarlandes (3 month internship) 

Work as scientific referee 

Referee for 

• Bioinformatics 

• BMC Bioinformatics 

• Proteins 

• Functional and Integrative Genomics 

• Jahrestagung der Gesellschaft für 

Klassifikation 

• Springer Verlag 

Sub-reviewer for 

• RECOMB 

• WABI 

Academical co-operations 

Analyis of bacterial MLST data, with Mark 

Achtman, Max-Planck-Institut für Infektionsbiologie, 

Berlin 

Machine learning approaches for detection of 

remote homolog proteins, with Lars Arvestad, 

Stockholm Bioinformatics Center, KTH, 

Stockholm 

HIV virus subtyping with DNA chips, with 

Winston Hide, South African National 

Bioinformatics Institute, University of the 

Western Cape 

Visualisation of graph algorithms - multimedia 

for computer science education, with 

Winfried Hochstättler, Institut für Mathematik, 

BTU Cottbus 

Combinatorial optimization methods for group 

testing designs, with Knut Reinert, Fachbereich 

Mathematik und Informatik, Freie Universität 

Berlin 

Genotyping ADHD and Autism, inference of 

complex phenotypes, with Anne Spence, College 

of Medicine, Human Genetics, University 

of California at Irvine 

Analysis of gene expression time-series data, 

with Alexander Schönhuth, Zentrum für 

Angewandte Informatik Köln (ZAIK), 

Universität zu Köln 

Clustering protein sequences, with Dietmar 

Schomburg, Institut für Biochemie, Universität 

zu Köln 

Identifying members of microbacterial communities 

with DNA chips, with Diethard Tautz, 

Instiut für Genetik, Universität zu Köln 

Group testing DNA chips, Genotyping ADHD 

and Autism, Statistical methods for analyis of 

sequence data with long-range correlations, 

with David C. Torney, Los Alamos National 

Laboratory 


Clustering protein sequences, with Sebastian 

Schneckener, Science Factory, Cologne 

Clustering heterogenous data, Olav Zimmermann, 

Science Factory, Cologne 


Member of the local organizing committee 

of of The Seventh Annual International 

Conference on Research in Computational 

Molecular Biology - RECOMB 2003, Berlin, 

10.-13.4.2003 


A primer in Bioinformatics: theory and practice, 

one-day workshop for high-school students 

(25.6.2002, Heinrich-Hertz Gymnasium) 

A primer in Bioinformatics: theory and practice, 

one-day workshop for high-school students 

(17.12.2002, Walter-Rathenau Oberschule) 

Co-organization of a public discussion Hype 

oder Hoffnung - Podiumsdiskussion zur 

Rolle der Bioinformatik am Standort Berlin, 

Berlin, 9.9.2002 



121

122 



Protein Function Analysis Group 

Head: 

Dr. Jörg Schultz (until 8/03) 

Email: joerg.schultz@molgen.mpg.de 


Birgit Pils (since 2/02) 

Research 

The focus of the group is the understanding of protein function and evolution using 

genomic, structural and proteomic data. Central to this question is the concept of the 

domain: a structurally conserved, genetically mobile unit. When viewed at the threedimensional 

level of protein structure, a domain is a compact arrangement of secondary 

structures connected by linker polypeptides. It usually folds independently and 

possesses a relatively hydrophobic core. The importance of domains is that they cannot 

be diveded into smaller units – they represent a fundamental building block that 

can be used to understand the evolution and function of proteins. In collaboration with 

the group of Dr. P. Bork, we are developing the SMART (Simple Modular Architecture 

Research Tool) domain database, which, to date, allows the identification of more 

than 600 divergent domain homologues in user supplied sequences and provides rich 

manual and automatic annotation for each domain. Furthermore, we are active in the 

hunting of novel domains to further complete the description of evolutions domain 

repertoire (Schultz, submitted). Having access to the whole set of building blocks used 

by protein evolution, we now can start to analyse domains in their protein context. In 

a recent project, we have used co-occurrence of domains to predict their cellular 

localisation and, following, the localisation of whole proteins (Mott et al., 2002). 

Ongoing experimental characterisation of domain families revealed, that the ‘one domain 

– one function’ concept does not hold true. On the contrary, function can diverge 

heavily within a single, homologous domain family. Prediction of a protein’s domain 

architecture will be sufficient to roughly characterise it; it will not give insights into 

molecular details of its function. To overcome this strong hindrance in function prediction, 

we are working on more advanced methods with the goal to make the step 

from domain to function prediction. One direction is the identification of functional 

sites within domains to use these for a more detailed function prediction. We have 

applied this approach to predict functional regions and catalytic sites of N-acetyl-b-Dglucosaminidase 

(O-GlcNAcase) (Schultz and Pils, 2002). This protein, which is linked 

to different diseases as diabetes and cancer, is involved in the reversible, intracellular 

modification of proteins by O-linked N-acetylglucosamine. Our hypotheses are currently 

tested experimentally in collaboration with Prof. Dr. Schmidt, Universität Bonn. 

The anecdotal description of tyrosine phosphatases with mutations in catalytic sites 

raised our interest in the evolution of these so-called ‘anti-phosphatases’. A genome

wide analysis of tyrosine as well as dual specific phosphatases revealed, that these 

mutations are more frequent than expected. Using phylogenetics, we could show, that 

these mutations occurred multiple times independently and are conserved within evolution. 

Site-specific analysis of the evolutionary rates allowed a functional subclassification 

of this large protein family and gave insights into the evolution of these subtypes 

(Pils and Schultz, submitted). 

As a member of the protein analysis group of the mouse genome project, we compared 

proposed functional sites of human disease proteins with the corresponding mouse 

sequences. This analysis revealed a small but significant number of cases where the 

mouse wildtype equals the human disease mutation, either caused by differences in the 

function of the corresponding proteins or filtered out by corresponding mutations 

(Mouse Genome Sequencing Consortium, 2002). 

In summary, the development and application of more advanced methods for function 

prediction will further increase the amount of information we can get by sequence and 

structure. This new level of information raises new problems. Currently, the function 

of a protein is stored mainly as free text in databases. This blocks the integration of 

data from genomic projects with data from e.g. proteomic and gene expression projects. 

Therefore, we are developing methods to represent the function of a protein in a ‘computer-understandable’ 

way. Currently, we are focussing on signalling and protein interaction 

networks, as their features are largely determined by the activity and not by 

the expression level of the involved proteins (Ratsch et al, 2003). In a pilot project, we 

combined domain based function prediction with protein interaction data to reconstruct 

and annotate bacterial signalling networks (Schultz, submitted). This project 

underlined the value of this method, as it even allowed to predict the influence of 

mutations to pathways and the whole network. 



Ratsch E, Schultz J, Saric J, Cimiano Lavin P, 

Wittig U, Reyle U & Rojas I (2003). Developing 

a protein interactions ontology. Comp Func 


Mouse Genome Sequencing Consortium 

(2002). Initial sequencing and comparative 

analysis of the mouse genome. Nature 420: 

520-562 

Schultz J & Pils B (2002). Prediction of structure 

and functional residues of O-GlcNAcase, 

a divergent homologue of Acetyltransferases. 

FEBS Letters 529:179-182 

Mott R, Schultz J, Bork P & Ponting CP 

(2002). Predicting Protein Cellular Localisation 

Using a Domain Projection Method. Genome 

Res 12:1168-1174 

Interns 

Jonas Heise (2 month internship) 

Co-operations 

Functional characterisation of GlcNAcase, 

with Prof. Dr. B. Schmitz, Universität Bonn 

Protein Analysis Group of the Mouse genome 

project, with Prof. C.P. Ponting, MRC Functional 

genetics unit 

Development of the SMART domain database, 

with Dr. P. Bork, EMBL Heidelberg 

Developing an ontology for protein interaction, 

with Dr. I. Rojas, EML Heidelberg 



123

124 



Computational Diagnostics Group 

Head: 

Dr. Rainer Spang 

Phone: +49 (0)30-8413 1175 

Fax: +49 (0)30-8413 1152 

Email: rainer.spang@molgen.mpg.de 

Scientist: 

Dr. Claudio Lottaz 


Jochen Jäger 

Dennis Kostka 

Florian Markowetz 

Stefanie Scheid 


Jörn Tödling 

The focus of this group is on developing statistical methodology for the use of gene 

expression profiles in medical diagnostics. We aim to identify pattern in expression 

profiles that improve or facilitate diagnosis, help to predict clinical outcome or refine 

common diagnostic schemes. Our work includes both theoretical projects in which we 

aim to develop novel analysis methodology and applied data analysis projects with 

clinical cooperation partners. 

Methods development 

In a project on molecular symptoms we combine gene expression data with functional 

annotations of the genes on the microarray. Statistical models for microarray data produce 

lists of genes that are up/down regulated, that constitute clusters of genes with 

correlated expression or that form predictive signatures for microarray based diagnosis 

of diseases. It is common practice to use the functional annotations of the identified 

genes for further biological interpretation. In this posterior use of annotations the gene 

functions have no influence on the statistical model at all. The expression levels exclusively 

drive the models. In this project we explore the a priori use of functional annotations 

for model building and structuring. Our aim is the identification of molecular 

subtypes of a disease. In order to exploit functional annotations, we structure the variable 

space (genes) using a functional grid, provided by the biological processes branch 

of the gene ontology graph. 

Another project aims at detecting the loss of co-regulation mechanisms. The task is to 

identify sets of genes that display strongly correlated expression in a control group of 

patients but loose this pattern of co-regulation in the disease group. We have developed 

a score for loss of co-regulation that we can apply to any subset of genes in a 

microarray study. We (heuristically) optimize this score over all possible such subsets 

and have developed a permutation-based test to check for the significance of such a 

result in this extreme multiple testing setting. 

In view of future developments in the context of genome wide RNAi screens, we 

started investigating how expression profiles from RNAi assays can improve network 

reconstruction using Bayesian networks. We have recently started to collaborate with 

Dr. Michael Boutros from the German Cancer Research Center for investigating possibilities 

of applying our theoretical results on signaling network reconstruction to real 

large scale RNAi data.

Further projects include multiple testing problems when screening for differentially 

expressed genes, the analysis of learning curves to decide on an optimal time point for 

switching from genome wide expression screening to expression analysis with a smaller 

and cheaper customized chip with which diagnostic signatures can be fine tuned, significance 

testing of groups of genes for weak but consistent up and down regulation, 

and cross platform analysis of microarray data. 

Co-operative projects 

In co-operation with biologists and clinicians from the Charite medical school in Berlin 

we have started analyzing expression profiles from childhood ALL relapse patients. 

The goal of this project is the identification of molecular risk factors characteristic 

for all or part of the patients with a poor treatment response. In co-operation with 

pathologists from the UBK Berlin, the medical school of Free University, we started 

analyzing a data set of expression profiles from Hodgekin lymphomas and B-cell cell 

lines, with the goal of defining subtypes of Hodgekin lymphomas corresponding to 

developmental stages of B-cells. In co-operation with the group of Patricia Ruiz from 

the Department of Hans Lehrach and a group of cardiologists from the university of 

Heidelberg we work on the design of a gene expression chip for cardiac diseases with 

a focus on cardiomypathies. Further collaborations include the analysis of breast cancer 

profiles, gene expression in neural development, and heart failure in mice. 

Standing and future plans 

Microarray data analysis both in its theoretical and applied form is a highly competitive 

field worldwide. Our strength is that we have brought together people with different backgrounds 

into one group. These people work together in the same office, discuss their 

different points of view and hence develop adequate data analysis strategies, that are 

backed up by a solid understanding of both their biological and theoretical foundations. 

Our theoretical projects have been, on average, running for a little more than one year. 

They all have produced first promising results, but none of them is finished. Several 

publications are in preparation. In terms of applied work we plan to focus on cancers 

of the immune system. In this field we plan to extend the scope of our collaborators, 

from ALL and Hodgekin lymphoma to leukemia and lymphoma in general. We jointed 

in the grant application on nationwide network for the analysis of gene expression 

analysis in malignant lymphoma (Funding: Deutsche Krebshilfe) and found the support 

of an also nation wide leukemia research network (Funding: NGFN). 



125

126 





Scheid S & Spang R (2003). A False Discovery 

Rate Approach to Separate the Score 

Distributions of Induced and Non-induced 

Genes. Proceedings of the 3nd International 

Workshop on Distributed Statistical Computing 

(accepted) 

Markowetz F & Spang R (2003). Evaluating 

the Effect of Perturbations in Reconstructing 

Network Topologies. Proceedings 

of the 3nd International Workshop on Distributed 

Statistical Computing (accepted) 

Grzeskowiak R, Witt H, Drungowski M, 


KJ, Klingbiel D, Scheid S, Spang R, Lehrach 

H & Ruiz P (2003). Expression profiling of 

human idiopathic dilated cardiomyopathy. 

Cardiovascular Research (to appear) 

Lottaz C, Iseli C, Jongeneel CV & Bucher P 

(2003). Modeling Sequencing Errors by Combining 

Hidden Markov Models, to be published 

in The 2nd European Conference on Computational 

Biology ECCB’03, Paris, France 

Jäger J, Sengupta R & Ruzzo WL. Improved 

Gene Selection for Classification of 

Microarrays. Biocomputing - Proceedings 

of the 2003 Pacific Symposium, 53-64 

Spang R, Blanchette C, Zuzan H, Marks 

JR, Nevins J & West M (2002). Prediction 

and uncertainty in the analysis of gene expression 

profiles. In Silico Biol 2 

Markowetz F & von Heydebreck A 

(2002). Class discovery in gene expression 

data: characterizing splits by support vector 

machines. Proceedings of the 26th Annual 

Conference of the Gesellschaft für 

Klassifikation 2002: 662-669 

Spang R, Rehmsmeier M & Stoye J (2002). 

A Novel Approach to Remote Homology Detection: 

Jumping Alignments. J Comput 

Biol 9(5): 747-760 

Müller T, Spang R & Vingron M (2002). 

Estimating Amino Acid Substitution Models: 

A Comparison of Dayhoff’s Estimator, the 

Resovent Approach and a Maximum Likelihood 

Method. Mol Biol Evol 19(1): 8-13 

West M, Blanchette C, Dressman H, Huang 

E, Ishida S, Spang R, Zuzan H, Olson JA 

Jr, Marks JR & Nevins JR (2001). Predicting 

the clinical status of human breast cancer 

by using gene expression profile. PNAS 

USA 98(20): 11462-7 

Ishida S, Huang E, Zuzan H, Spang R, 

Leone G, West M & Nevins JR (2001). Role 

for E2F in control of both DNA replication 

and mitotic functions as revealed from DNA 

microarray analysis. Mol Cell Biol 

21(14):4684-99 

Spang R & Vingron M (2001). Limits of 

homology detection by pairwise sequence 

comparison. Bioinformatics 17(4): 338-342 

Book contributions & reviews 

Spang R (2003). Diagnostic signatures from 

microarrays: a bioinformatics concept for 

personalized medicine (Review). Biosilico 

1(2): 64-68 

Spang R, Béziat P & Vingron M (eds.). Currents 


2003. RECOMB 2003, Berlin 

Teaching 

Practical Microarray Data Analysis Courses 

Rainer Spang: Vorlesung Genomische Datenanalyse, 

4 SWS, SS 2003, FU Berlin 

Stefanie Scheid, Dennis Kostka, Florian 

Markowetz: Übungen Genomische Datenanalyse, 

2 SWS, ss 2003, FU Berlin 

Theses 

Jörn Tödling: Cross-Platform Assessment 

of Microarray Experiments on Gene Expression 

Profiles. Bachelor Thesis in Bioinformatics, 

FU Berlin 

Stefan Bentink: Gene ontology as a tool for 

the systematic analysis of large-scale geneexpression 

data. Master Thesis in Bioinformatics, 

TFH Berlin 

Internships 

Joern Toedling, Bachelor student, Freie 

Universität Berlin, 8 weeks internship 

Martin Held, Bachelor student, Freie 

Universität Berlin, 8 weeks internship 

Julie Floch, Student, post graduate degree 

in bioinformatics, Université Evry-Val 

d’Essonne, France, 6 month internship 

Guest scientists 

Dr. Nicola Armstrong, ESF supported visitor 

from EURANDOM, Eindhoven, Netherland, 

will be visiting 2003-2004 (6 month) 

Xinan Yang, DAAD supported visitor 

from the Southeast University, China, will 

be visiting 2003-2005 (2 years)

Co-operations 

Identification and functional characterization 

of molecular risk factors in 

acute leukemias, with Prof. Dr. Christian 

Hagemeier, Prof. Dr. Wolf-Dieter Ludwig, 

Prof. Dr. Karl Seeger, Prof. Dr. Leonid 

Karawajew, Dr. Renate Kirschner, Charité, 

Humboldt-Universität Berlin 

Gene expression analysis in Hodgekin lymphoma, 

with Prof. Dr. Harald Stein, Dr. 

Michael Hummel, Universitätsklinikum Benjamin 

Franklin, Freie Universität Berlin 

Deriving Signaling Networks by Integrating 

Genome-wide RNAi, Expression Profiling and 

Computational Analysis, with Dr. Michael 

Boutros, Deutsches Krebsforschungszentrum, 

Heidelberg 

Design of a diagnostic cardio chip, with Dr. 

Patricia Ruiz, Max-Planck–Institut für 

molekulare Genetik, and Dr. Boris Ivandic, 

Dr. Dieter Weichenhan, Universitätsklinikum 

Heidelberg 

Courses in practical microarray data analysis, 

with Dr. Wolfgang Huber, Deutsches 

Krebsforschungszentrum, Heidelberg, Dr. 

Ulrich Mansmann, Universitätsklinikum 

Heidelberg, Dr. Jörg Rahnenführer, Max- 

Planck-Institut für Informatik, Saarbrücken 

Predictive Bayesian modeling using 

microarray data with applications to breast 

cancer, with Prof.Dr. Mike West, Prof. Dr. Joe 

Nevins, Duke University and Duke medical 

center, USA 

Jumping Alignments, with Prof. Dr. Jens 

Stoye, Universität Bielefeld 


Member of the organizing committee of 

RECOMB 2003 and editor of the Currents 


2003, Berlin, 10.-14.4.2003 

Organizer of the “International BCB-workshop 

on statistics and cancer genomics 

2003”, Berlin, 21.8.2003 



127

128 



Transcriptional Regulation Group 

Head: 

Prof. Dr. Martin Vingron 

Phone: +49 (0)30-8413 1150 

Fax: +49 (0)30-8413 1152 

Email: vingron@molgen.mpg.de 

Scientists: 

Dr. Thomas Manke 

Dr. Stefan Röpcke 

Dr. Christine Steinhoff (joint with Dept. Ropers) 

Dr. Steffen Grossmann 

Dr. Lloyd Demetrius 


Christoph Dieterich 

Holger Klein 

Haiyan Wang (until 07/2003) 

Affiliated researcher: 

Anja von Heydebreck 

The availability of complete genomes for several organisms has opened up new possibilities 

of studying gene regulatory mechanisms and in particular cis-regulatory elements. 

The gene regulation group focuses on the delineation of regulatory motifs and interactions 

based on an integration of a variety of information sources. In yeast, where extensive 

protein-protein interaction data have been generated, this information can serve to aid in 

the identification of regulatory modules. In mammalia, comparison of non-coding, upstream 

sequences of orthologous genes can pinpoint regions that are likely to have a 

regulatory role. This can be extended by comparing sequences to binding site descriptors 

that have been collected in publicly available databases. Microarray generated gene expression 

data may further serve to understand regulatory interactions between genes. 

Gene regulation in yeast 

In yeast, only a small number of transcription factor binding sites have been described. 

The focus of our work lies on the combinatorial interplay of transcription factors as 

they interact with regulatory DNA regions. We have, for the first time, fully integrated 

the protein-DNA binding data into the larger network of protein-protein interactions. 

This allowed for the identification of modules of transcription factors which co-regulate 

sets of functionally related genes. From this information we construct regulatory 

motifs, and computationally search for further targets in a genome-wide scan. Our 

results also demonstrate that, despite the inherent noise in large-scale data sets, there 

are significant commonalities which can be exploited to increase the reliability of network 

predictions (Manke et al., 2003). 

Predicting regulatory elements in the human genome 

Comparative sequence analysis of two or more genomes is an appropriate tool to investigate 

gene structure and surrounding functional elements in the vast sequence space of 

non-coding DNA. This assumption is validated by the observation that experimentally 

verified transcription factor binding sites map to highly conserved regions in man-mouse 

sequence comparisons. An initial large-scale in silico study on sequence conservation

upstream of the translational start site demonstrated the power of the comparative approach 

(Dieterich et al., 2002). Our principal repository for annotated conserved blocks 

(CNBs) in homologous upstream regions of man and mouse is CORG, the database for 

Comparative Regulatory Genomics (Dieterich et al., 2003a). CORG contains a precomputed 

set of CNBs for the upstream regions of more than 12,000 orthologous gene groups. 

The origin of sequence conservation is often explained by the functional annotation of the 

CNBs. We distinguish untranslated exons from other conserved regions by screening all 

CNBs with pre-assembled EST clusters. Here, an important part of our research concerns 

the reliable annotation of transcription factor binding sites within CNBs. 

Microarray data and the identification of target genes 

An imminent subsequent step is to associate evolutionarily conserved predicted binding 

sites with complementary biological data like time-course microarray data. In an 

on-going collaboration, suggested downstream genes of the transcription factor SRF 

have been scanned for evolutionarily conserved SREs (the SRF binding site). These 

hypothetical direct target genes are currently under investigation in the laboratory of 

A. Nordheim (Tübingen). A further study was performed on another much-studied 

biological process: the response of dendritic cells to LPS, a component of the cell wall 

of gram-negative bacteria (Dieterich et al., 2003b). An analysis of the upstream regions 

of genes that appear to be co-regulated in the respective microarray experiment 

allows to identify the endpoints of Toll-receptor signalling which is involved in this 

pathway. Likewise, regulation of the cell cycle in human (HeLa) cells has been studied. 

Some transcription factor binding sites, like those of the E2F family, show a strong 

enrichment in the upstream regions of genes that fall into particular cell cycle phases. 

We have now initiated a co-operation with the research group of Constance Scharff at 

the MPIMG to assess the impact of selected transcription factors on cell cycle progression 

using RNA-interference technology. 

Evolution of binding sites 

Binding sites evolve and certainly play a role in phenotypic diversity and species diversity. 

Although an understanding of the evolution of regulatory elements my be far away, 

this is a key question in understanding cellular processes. Multi-species comparisons are 

key to elucidate patterns of appearing and disappearing functional elements over time. 

Multiple alignments facilitate to trace the history of individual binding sites. Good examples 

to study are developmental processes, which are remarkably conserved in vertebrates. 

We have teamed up with the research group of Stefan Mundlos at the MPIMG to 

detect potential bindings sites of RUNX2, which are conserved in many vertebrate genomes. 

The promoter regions of interest are being sequenced in the laboratory. 

Microarrays: Data normalization and statistics 

A line of work that goes back to the time of the group at DKFZ, Heidelberg, is concerned with 

gene expression profiles in renal carcinoma and within the department is mostly pursued by 

Anja von Heydebreck. Starting with the comparison of renal carcinoma to healthy kidney tissue, 

her research has resulted in a number of data analysis papers (e.g., Boer et al., 2001) as well as 

some significant methodological advances (Huber et al, 2003a, 2003b). The method of normalization 

that was developed in this context is called “normalization by variance stabilization” and 

has found wide acceptance. The major achievement of this new method is that it simultaneously 

solves the treatment of the technical features of an array with the basic problem that expression 

level changes in low intensitiy genes appear much more dramatic than in highly expressed 

genes. The variance stabilization step maps all changes to a common interval and thereby allows 

for comparison of changes across intensities. In that, it is superior to the commonly used foldchange 

measure. 

Spawned by the research on kidney carcinoma, a new problem has caught our attention: tracing 

the development of chromosomal aberrations in tumors Novel mathematical methods have now 

been developed to tackle this question and have successfully been applied to cytogenetic data on 

renal carcinoma (von Heydebreck et al, 2003; Gunawan et al., 2003). 



129

130 




Selected publications 2001-2003 

Dieterich C, Wang H, Rateitschak K, Luz 

H & Vingron M (2003a). CORG: a database 

for COmparative Regulatory Genomics. 

Nucleic Acids Res 31(1):55-7 

Dieterich C, Herwig R & Vingron M 

(2003b). Exploring potential target genes of 

signalling pathways by predicted conserved 

transcription factor binding sites. Bioinformatics 

(to appear) 

Gunawan B, Heydebreck A v, Fritsch T, 

Huber W, Ringert R-H, Jakse G & Füzesi L 

(2003). Cytogenetic and Morphologic Typing 

of 58 Papillary Renal Cell Carcinomas: Evidence 

for a Cytogenetic Evolution of Type 2 

from Type 1 Tumors. Cancer Research (to appear) 

Heydebreck Av, Gunawan B, Huber W, 

Vingron M & Füzesi L (2003). Mathematical 

tree models for cytogenetic development 

in solid tumors. Proceedings of the German 

Society for Pathology (to appear) 

Huber W, Heydebreck A v, Sültmann H, 

Poustka A & Vingron M (2003a). Parameter 

estimation for the calibration and variance 

stabilization of microarray data. Statistical 

Applications in Genetics and Molecular Biology 

2(1), Art 3 (online publication) 

Huber W, Heydebreck A v & Vingron M 

(2003b). Analysis of microarray gene expression 

data. In Handbook of Statistical Genetics, 

Bulding DJ, Bishop M, Canning C, eds., 

Wiley, Chichester, West Sussex, Vol 1 (2nd 

edition):162-187 

Manke T, Bringas R & Vingron M (2003). 

Correlating Protein-DNA and protein-protein 

interactions. J Mol Biol 333:75-85 

Marchfelder U, Rateitschak K & Ehrenhofer-Murray 

AE (2003). SIR-dependet repression 

of non-telomeric genes in Saccharomyces 

cerevisiae? Yeast (to appear) 

Steinhoff C, Müller T, Nuber UA & Vingron 

M (2003). Gaussian Mixture Density Estimation 

applied to Microarray Data. LNCS (Lecture 

Notes in Computer Sciences) 2810:418- 

429 

Dieterich C, Wang H, Rateitschak K, 

Krause A & Vingron M (2002). Annotating 

regulatory DNA based on man-mouse genomic 

comparison. Bioinformatics 18(Suppl 

2): S84-90 

Boer JM, Huber W, Sültmann H, Wilmer F, 

Heydebreck A v, Haas S, Korn B, Gunawan 

B, Vente A, Füzesi L, Vingron M & Poustka 

A (2001). Identification and classification of 

differentially expressed genes in renal cell carcinoma 

by expression profiling on a global 

human 31,500 element cDNA array. Genome 

Res 11(11): 1861-1870 

Martin Vingron: Selected Invited talks 

UC San Diego, USA (8/2003) 

Joint Statistics Meeting, San Francisco, USA 

(8/2003) 

Royal Statistical Society Topic Meeting Genetics 

and Statistics, Belgium (8/2003) 

University of Gießen (6/2003) 

Conference on the occasion of M. Water-man’s 

60th birthday, Los Angeles, USA (3/2003) 

DMV Tagung 2002, Leipzig (2002) 

LMU München (2/2002) 

Universität Dortmund (12/2002) 

Eurandom, TU Eindhoven (12/2002) 

ETH+Univ. Zürich joint statistics colloquium 

IWR, Universität Heidelberg (11/2001) 

Teaching 

Martin Vingron, within bioinformatics curriculum 

at Free University: 

• Seminar Biological Sequence Analysis, 

SS 2001 

• Course Algorithms for phylogeny 

construction, WS 2001/02 

• Seminar Molecular evolution, SS 2002 

• Course Algorithmic bioinformatics, WS 

2002/03 

• Bioinformatics Software Exercises, SS 


• Seminar Sequence comparison algorithms, 

WS 2003/04: 

Lectures at ESF International Genetics and 

Bioinformatics School, Portofino, 10/2001 

Lectures at the International Summer School 

Computational Biology, Warsaw, Poland, 9/ 


Martin Vingron: Others 

Associate editor of J Comp Biol 

Editorial Board Member of 

• Bioinformatics 

• Briefings in Bioinformatics 

• J Mol Med

Department of Developmental 

Genetics 

Head: 

Prof. Dr. Bernhard G. Herrmann (since 10/03) 

Phone: +49 (0)30-8413 1203 

Fax: +49 (0)30-8413 1229 

Email: herrmann@molgen.mpg.de 

Scientists: 

Dr. Hermann Bauer (since 10/03) 

Dr. Ralf Spörle (since 10/03) 


Arnold Schröder (since 10/03) 

Technician: 

Jürgen Willert (since 10/03) 

Scientific development and future orientation 

In mammals, formation of the trunk and tail is organised in the primitive streak and tail 

bud. Epithelial stem cells are subjected to multiple growth factors, become transiently 

motile, leave the epithelium and take a paraxial, intermediate or lateral mesenchymal, or 

an endodermal fate. Cells remaining in the epithelium take a neuroectodermal or ectodermal 

route. The spinal cord, vertebral column, striated muscle, limbs, gonads and kidneys, 

mid- and hindgut, etc. develop from these cells. But cell fate decisions are already taken in 

the primitive streak and tail bud. 

The overall goal of our work is to understand the regulatory networks controlling organogenesis 

and differentiation processes in the mid-gestation mouse embryo, as animal model 

for the human. Our main focus is on the analysis of early cell fate decisions in the primitive 

streak and tail bud, utilizing a range of molecular genetic tools. The epithelial-mesenchymal 

transition (EMT) is of particular interest. It shows strong parallels to metastasis 

formation of human tumours, which will be subject of future studies. Down-stream differentiation 

processes resulting in the formation of tissues and organs shall also be investigated. 

Finally, the knowledge gained from such analyses shall be applied to engineering 

tissues and possibly organs in the future. 

Identification and functional analysis of regulatory networks 

controlling differentiation processes in the mouse embryo 

High-throughput technology is utilized where possible to generate standardized data on 

large scale, which serve as valuable resource in hypothesis driven work tackling well 

defined scientific questions. In principle we will generate 4 types of data resources suitable 

for analysing regulatory networks: 

1) high resolution gene expression data in mid-gestation mouse embryos, 

2) data on the activity of promoter elements defined by bioinformatic means, in the embryo, 

3) target gene collections of particular signal cascades and transcription factors, 

4) functional data created by knock-down or knock-out mutagenesis. 

Preferentially, genes encoding transcription factors, signals and members of signal cascades 

will be analysed. 



131


132 

Large-scale gene expression analysis in mouse embryos 

The main approach we have taken in the last few years to identify genes participating in 

the regulatory networks controlling embryogenesis as a whole is based on the concept that 

distinct genome read-outs control the differentiation of different cell types. Thus, genome-wide 

mRNA expression analyses should mirror the gene activities controlling differentiation 

processes and allow imaging the molecular anatomy of the embryo. We have 

developed whole-mount in-situ hybridisation (WISH) into a high-throughput tool for expression 

analysis of individual genes in mid-gestation mouse embryos (Neidhardt et al., 

Figure 1: Selection of tissue restricted patterns identified by gene expression analysis. Main sites of 

gene expression are: A, tailbud and notochord (T), B, presomitic mesoderm and neural tissue 

(Notch1), C, caudal half of somite and mesonephros (Uncx4.1), D, sclerotome and pharyngeal 

endoderm (Pax9), E, heart and somite/myotome, F, heart (Casq1), G, blood vessel endothelium 

(Endoglin), H, blood cells, I, hindbrain and trunk (Hoxb2), K, neural crest cells (Crabp1), L, 

neuroblasts, M, dorsal neural tube excluding fore- and midbrain (Msx3), N, forelimb buds, O, 

urogenital ridge and part of septum transversum (Wt1), P, mesothelium, Q, endoderm and otic 

vesicle (Cldn6); all embryos except those in B, C, Q, M, L were cleared, thus paired organ anlagen 

may appear double or partially superimposed on the photographs.

2000; see figure 1). So far, we have collected expression data on appr. 10.000 genes, 

which are stored in a custom made database developed by us (MAMEP: Molecular 

Anatomy of the Mouse Embryo Project). This is by far the largest collection of gene 

expression data on mouse embryos and unique in the world. 

As part of this endeavour we have also analysed the expression of 158 mouse orthologues 

of human chromosome 21 genes in mid-gestation mouse embryos. This study was carried 

out in collaboration with Dr. Yaspo (Dept. Lehrach) from the MPIMG. A number of candidates 

potentially involved in the pathogenesis of Down Syndrome were identified (Gitton 

et al., 2002). 

Gene expression data can be exploited to derive putative functional groups (co-expression 

groups, syn-expression groups), which may be assayed e.g. with respect to their 

involvement in particular signal pathways or processes. The identification of Wnt3a as 

“master” regulator controlling the segmentation process in vertebrates is an example of a 

successful application of this strategy (Aulehla et al., 2003; see figure 2). 

Functional grouping of genes via expression analysis may also facilitate the identification 

of new members of signal cascades using protein interaction assays. 

The long-term goal of this project is a complete analysis of the mouse genome for expression 

of individual genes in mid-gestation mouse embryos (stage E8.5-11.5). We will also 

soon embark on creating 3-D images using the OPT system. A 3-D digital image database 

shall be set up which may hopefully trigger the development of bioinformatic tools enabling 

computer-aided image comparisons. 

Defining tissue specific promoter elements 

Expression data can be related to genomic data by bioinformatic means (collaboration with 

Dept. Vingron) to identify e.g. elements common to a group of genes expressed in the same cell 

types. These may be tested experimentally and verified in the mouse. Such analyses will provide 

tissue specific promoter elements instrumental for tissue-restricted analyses of gene function, 

and may also serve as valuable tools for tissue engineering. Analyses of this type also promise to 

provide valuable insights into the evolution of mice and humans. We plan to identify and test a 

number of putative promoter elements in mouse embryos. 

Identification of target genes of signal cascades and transcription factors 

An important aspect in the analysis of regulatory networks controlling differentiation 

processes is the identification of the read-out of signal cascades. We are utilizing three 

complementary tools to isolate putative target genes of signal pathways. First, high-throughput 

gene expression analyses provide, as mentioned earlier, groups of genes expressed in 

the tissue of interest. The candidates identified in this way can be assayed e.g. in mutants, 

for their involvement in a particular pathway. Second, expression profiling of mutant 

versus wild type tissue on conventional gene CHIPs may provide candidates which may 

again be confirmed by WISH analyses. Third, we have developed a screening system for 

direct target genes of transcription factors comprising a) immunoprecipitation of protein/ 

DNA complexes in vitro and b) selection of target fragments in yeast. The latter may be 

assigned to genes by bioinformatic means, and the genes are assayed by WISH for expression 

in the signal receiving cells or co-expression with the transcription factor of interest. 

Standard assays are then employed to verify the genes identified as targets. 

(High-throughput) functional analyses 

Functional analysis is indispensable for elucidating the role of a gene of interest in the whole 

organism. We have successfully employed gene targeting in ES-cells in the past for that purpose. 

However, RNA interference has become a versatile tool for “lack-of-function” analysis in cultured 

cells and has a high potential for successful application in whole organisms. Therefore, we 

will develop vector-based strategies for inducible and/or conditional “knock-down” mutagenesis 

in mouse embryos, which may be used as high-throughput tool for functional analysis in the 

whole organism. These systems will be complemented by the “classical”, more time intensive 

knock-out strategies. 



133


134 

Figure 2: Model of segmentation process, inte-grating 

“the gradient and the clock”. (A) The segmentation 

clock: presomitic mesoderm (psm) cells oscillate 

between two states, “Wnt on-Notch off” and “Wnt 

off-Notch on”. Wnt, Wnt signalling; Dvl, vertebrate 

dishevelled; N ICD , Notch intra-cellular domain; 

arrow: activation, bar: inhibition (B) The gradient 

and the clock: While the embryo elongates caudally, 

Wnt3a expression is restricted to the tail bud; Wnt3a 

protein/signalling forms a gradient along the psm 

and suppresses differentiation; below a threshold 

value (black/black-dotted line), Wnt signalling 

becomes permanently inactivated (Wnt off). The 

position along the A-P axis having threshold value of 

Wnt signalling activity shifts posteriorly with time, 

due to decay of Wnt3a protein; segment boundary 

positions (black arrow heads) are defined during the 

“Wnt on” phase between (posterior) cells undergoing 

another oscillation cycle (Wnt on) and (anterior) cells 

in which Wnt signalling is switched off (Wnt off); the 

latter have escaped suppression by Wnt and are free 

to form a segment. (C) The gradient and clock in a 

single psm cell: oscillations of Wnt signalling (red) 

and Axin2 protein (blue) alternate out of phase; Notch 

signalling (green) oscillates in phase with Axin2 

protein. Notch is up-regulated when Wnt activity has 

fallen below the threshold (Wnt off); Axin2 is 

stabilized. P, posterior; A, anterior. 

The next step: tissue engineering in vitro 

The characterisation of a large number of genes controlling embryonic processes by many 

groups in the past has provided valuable insight into the mechanisms regulating tissue and 

organ formation. Regeneration processes in the adult are controlled by similar or identical 

regulatory networks. 

The time is ripe for applying this knowledge to generating tissues and organs in vitro. We 

will set up systems for gene driven tissue engineering in vitro. For a first start, we will try 

to simulate the epithelial-mesenchymal transition taking place in the primitive streak of 

the embryo, in vitro. This will provide sufficient material for investigating this process in 

detail, and may serve as starting point for generating more differentiated and complex 

tissues in vitro in the future. 

Elucidating the molecular basis of non-mendelian inheritance 

in mouse, and application to farm animal breeding 

A considerable proportion of wild mice carry two variant forms of chromosome 17. One, 

called the t-haplotype, is transmitted at a high ratio to the offspring, on the expense of the 

wild type chromosome. Mouse geneticists have identified several closely linked mutant 

loci involved in this phenomenon. The central factor is the t-complex responder (Tcr). 

Transmission of the chromosome carrying Tcr, is supported and enhanced by loci encoding 

t-complex distorters (Tcd1 to Tcd3). Absence of Tcd factors is disadvantageous for 

Tcr; its transmission ratio drops to about 20%, whereas expression of all Tcds may enhance 

the transmission of Tcr to over 95%. 

The molecular nature of Tcr has been revealed by us (Herrmann et al., 1999). It encodes a 

dominant negative variant of a novel Ser/Thr protein kinase, named Smok. It is expressed 

in spermatids in the testis. Since spermatozoa derived from t/+ males show impaired 

flagellar behaviour, we believe that Tcr and the Tcds act in the control of sperm motility. A 

model how Tcr may act to cause non-mendelian inheritance is shown on figure 3. 

We are investigating how and where Tcr functions in the cell, and what its interaction

partners are. We also want to find out how the products of Tcr are restricted to the 

spermatids carrying the gene, which is unexpected since all spermatids are connected 

in a syncytium. In addition, we want to unravel the molecular nature of Tcds, which 

have not been cloned yet. With respect to the latter we have recently identified a candidate 

for Tcd1. Analysis of this gene promises to enhance our understanding of the 

molecular processes resulting in non-mendelian inheritance in mouse. 

Co-operation with other departments 

There are multiple possibilities for co-operation with other departments and groups. I want to 

restrict myself to a few examples for possible interactions. We have collaborated with the department 

of Hans Lehrach in the past, and these interactions will be intensified. The expertise in 

the department of Martin Vingron will be instrumental e.g. in the full exploitation of the expression 

data we have generated on mouse embryos, and in the analysis of regulatory networks 

controlling differentiation processes. Interactions with the department of Hilger Ropers may 

e.g. be based on exploitation of our gene expression database in the search for candidate genes 

for human disease. Other groups of the institute working on disease models or organogenesis 

projects may also profit from the MAMEP database. 


Selected publications 

Herrmann BG, Koschorz B, Wertz K, 

McLaughlin J & Kispert A (1999). A protein 

kinase encoded by the murine t-complex 

responder gene causes non-mendelian 

inheritance. Nature 402: 141-146 

Neidhardt L, Gasca S, Obermayr F, Wertz K, 

Worpenberg S, Lehrach H & Herrmann BG 

(2000). Large scale screen for genes controlling 

embryogenesis, using high-throughput 

gene expression analysis in mouse embryos. 

Mech Development 98: 77-93 

Figure 3: Proposed mechanism producing 

non-mendelian inheritance. 

Heterozygous t/+ males produce two 

types of sperm, t-sperm and wild type 

sperm. Smok, the wild type form of Tcr, 

and Tcr proteins are restricted to the 

sperm cells carrying the gene, while 

Tcd proteins (wild type forms are not 

indicated) are shared by all sperm 

cells. Tcd proteins act upstream of 

Smok and enhance its activity resulting 

in abnormal flagellar function. Tcr acts 

as a dominant negative protein 

counterbalancing the effect of Tcd 

proteins. Thus the t-sperm are rescued 

by Tcr and gain an advantage over 

wild type sperm, which behave 

abnormally, and the t-chromosome is 

transmitted at high ratio (>95%) to 

the offspring. 

Group 1: Gitton Y, Dahmane N, Baik S, Ruiz 

A, Altaba I; group 2: Neidhardt L, Scholze M, 

Herrmann BG; group 3: Kahlem P, Kahla 

AB, Schrinner S, Yildirimman R, Herwig R, 

Lehrach H, Yaspo M-L (2002). A gene expression 

map of human chromosome 21 orthologs 

in the mouse. Nature 420: 586-590 

Aulehla A, Wehrle C, Brand-Saberi B, Kemler 

R, Gossler A, Kanzler B & Herrmann BG 

(2003). Wnt3a plays a major role in the segmentation 

clock controlling somitogenesis. 

Dev Cell 4: 395-406 



135


136

Emeritus Group 

General Molecular Genetics 

Head: 

Prof. Dr. Dr. h.c. Thomas A. Trautner 

Phone: +49 (0)30-8413 1260 

Fax: +49 (0)30-8413 1382 

Email: trautner@molgen.mpg.de 

Biographical Notes 

In addition to my obligations in Berlin I served as the “Geschäftsführender Direktor” of 

the MPI für experimentelle Medizin in Göttingen from February 1998 through February 

2000. 

The Biologisch-Medizinische Sektion elected me in 2001 as their Ombudsmann 

I retired in. April 2000. I acknowledge that the president of the MPG provided me upon 

recommendation of the institute until the end of 2003 with an emeritus-laboratory and 

office plus appropriate staff and funds to wind up work, which had initiated before my 

retirement. The institute has been generous to also provide access to all general use facilities 

of the institute. Laboratory work terminated at the end of August 2003. 

Development of group leaders in the course of my retirement 

It is a pleasure to report that the closing of my department did not lead to a break of the 

careers of the various leaders of groups, which had been established during my active 

duty. Almost all group leaders found respectable positions at other institutions.At the 

same time, virtually all positions of scientists of the department became vacant around 

2000 and hence available for new appointments now or in the forseeable future. 

Dr. Mark Achtman together with Dr. Giovanna Morelli joined in 2000 the MPI of 

Infection Biology as a permanent group leader(C 3 ) continuing his remarkable studies 

on epidemiology of bacterial diseases and of bacterial evolution. 

Dr. Juan Alonso left the department already in 1994 to obtain one of the tenured group 

leader positions at the Centro Nacional de Biotecnologia, CSIC, in Madrid. Experimental 

co-operation between his and my group here in Berlin on bacteriophage DNA 

packaging continued after his departure. 

Dr. Regine Hakenbeck accepted a C4 chair for microbiology at the University of Kaisers-lautern, 

where she has expanded studies on penicillin resistance of Pneumococci 

into bacterial immunolgy and evolution. 

Dr. Walter Messer, an internationally recognized authority on DNA replication, retired 

in 2000. 

Dr. Enzo Russo joined the Department Lehrach. 



137

138 


General Molecular Genetics 

Dr. Paulo Tavares with whom my group had co-operated very intensively has now a 

permanent group leader position with the CNRS at Gif-s-Y, where work on morphogenesis 

of bacterial and animal virus morphogenesis is continuing. 

Dr. Jörn Walter’s work is characterized by a switch already performed here in Berlin 

from studies on enzymology of DNA – methyltransferases, which were performed in 

association with my group, to studies on DNA-methylation during mammalian embryogenesis. 

He has now the chair for Genetics(C4) at the University of Saarbrücken. 

Recent work performed in my group 

Following up the characterization of DNA, not representing housekeeping-genes, in 

dispensable regions of some 25 different Bacillus subtilis strains ( see “Present Work”, 

pg 61 of Scientific Report 1999/2000) we have completed the DNA sequencing of 

such DNA. Using “blast” analyses of the material with the most recent data bases, we 

realized that contrary to our previous interpretations, we do not find eukaryotic genes 

in such DNA. We have realized furthermore that insert DNA frequently contains previously 

identified elements known to be associated with illegitimate recombination in 

B. subtilis, derived from prophages like SPbeta, 6, or SKIN. All fragments which we 

have analyzed show irrespective of their size very sharp (within 10 bps) transitions 

from resident to insert DNA. 

Future work will be to write up several papers on work performed during the last years 

by my laboratory. 



Orlova EV, Gowen B, Dröge A, Stiege A, Lurz 

R, Weise F, van Heel M & Tavares P (2003). 

Structure of a viral DNA gatekeeper at 10 angstrom 

resolution by cryo-electron microscopy. 

EMBO J 22:1255-1262 

Markmann-Mulisch U, Masood Z, Hadi MZ, 

Koepchen K, Alonso J, Russo VE, Schell J & 

Reiss B (2002). The organisation of Physcomitrella 

patens rad51 genes is unique among eukaryotic 

organisms. PNAS USA 99:2959-2964 

Glinkowska M, Konopa G, Wegrzyn A, 

Herman-Antosiewicz A, Weigel C, Seitz H, 

Messer W & Wegrzyn G (2001). The double 

mechanism of incompatibility between l plasmids 

and Escherichia coli dnaA(ts) host cells. 

Microbiology 147:1923-1928 

Seitz H, Welzeck M & Messer W (2001). A 

hybrid bacterial replication origin. EMBO 

Reports 2:1003-1006 

Achtman M & Suerbaum S (2000). Sequence 

variation in Helicobacter pylori. Trends 

Microbiol 8:57–58 

Dröge A, Santos MA, Stiege AC, Alonso JC, 

Lurz R, Trautner TA & Tavares P (2000). 

Shape and DNA packaging activity of bacteriophage 

SPP1 procapsid: protein components 

and interactions during assembly. J Mol 

Biol 296:117–132 

Oswald J, Engemann S, Lane N, Mayer W, 

Olek A, Fundele R, Dean W, Reik W & Walter 

J (2000). Active demethylation of the paternal 

genome in the mouse zygote. Curr Biol 10:475– 

478 

Paulsen M, El-Maarri O, Engemann S, Strodicke 

M, Franck O, Davies K, Reinhardt R, 

Reik W & Walter J (2000). Sequence conservation 

and variability of imprinting in the 

Beckwith-Wiedemann syndrome gene cluster 

in human and mouse. Hum Mol Genetics 9: 

1829– 1841 

Achtman M, Azuma T, Berg D. E.,. Ito Y, 

Morelli G., Pan Z.-J., Suerbaum S.,. Thompson 

S, van derEnde A. and van Doorn L. J.( 

1999). Recombination and clonal groupings 

within Helicobacter pylori from different geographical 

regions. Mol Microbiol 32:459–470 

Orlova E, Dube P, Beckmann E, Zemlin F, 

Lurz R, Trautner TA, Tavares P & van Heel 

M (1999). Structure of the 13-fold symmetric 

portal protein of bacteriophage SPP1. Nature 

Struct Biol 6:842–846 

Reik W, Kelsey G & Walter J (1999). Dissecting 

de novo methylation. Nature Genetics 

23:380–382

Sethmann S, Ceglowski P, Willert J, Iwanicka- 

Nowicka R, Trautner TA & Walter J (1999). 

M(phi)BssHII, a novel cytosine-C 5-DNAmethyltransferase 

with target recognizing domains 

at separated locations of the enzyme. 

EMBO J 18:3502–3508 

PhD Theses 

Seitz H, Interaktionen des E. coli Initiator-proteins 

DnaA mit der replikativen Helikase 

DnaB. Freie Universität Berlin, 2000 

Speck C, ATP- und ADP-DnaA Protein: Neue 

Modelle und Mechanismen zur Regulation der 

dnaA Transkription und zur Initiation der 

DNA-Replikation. Freie Universität Berlin, 

2000 

Bläsing F, Analyse der DNA-Bindungsdomäne 

des DnaA Proteins von E. coli. Freie 


Engemann S, Stammspezifische Untersuchungen 

zu transgenen Insertionen in der Maus. 

Freie Universität Berlin, 1999 

Schenker M, Mikoroevolution in Neisseria 

meningitidis am Beispiel der 25kb Region 

zwischen tbpAB und opaA. Freie Universität 

Berlin, 1999 

Zhu P, The opc gene region in Neisseria. Freie 




139

140 


General Molecular Genetics


Scientists: 

Dr. rer. nat. Volkhard Seitz 

Dr. med. Georg Schwabe 

Dr. rer. nat. Sigmar Stricker 

Dr. rer. nat. Uwe Kornak 

Dr. med. Katrin Süring 

Dr. rer nat. Mateusz Kolanczyk 


Andrea Albrecht 

Michael Niedermaier 

Nicole Verhey van Wijk 

Jochen Hecht 

Petra Seemann 

Barbara Dlugaszewska 


Ulrike Wiecha 

Maren Urban 

Michael Toepfer 

Manuela Magarin 

Technicians: 

Norbert Brieske 

Asita Stiege 

Britta Hofmann 

Head: 

Prof. Dr. Stefan Mundlos 

Phone:+49 (0)30-8413 1263 

Fax: +49 (0)30-8413 1385 

Email: mundlos@molgen.mpg.de 

Overview 

The research group Development & Disease was established in October 2000. In August 2001 

the group moved into the renovated laboratories on the 3rd floor. The group is part of and works 

in close collaboration with the Institute for Medical Genetics, which is located at the Campus 

Virchow of the Charité, Humboldt University, Berlin. The Institute for Medical Genetics provides 

clinical and diagnostic service for the Charité and the Berlin/Brandenburg area. Research 

at the Institute covers a broad spectrum of clinical and molecular analysis of genetic malformation 

syndromes and, as another major focus, tumor genetics. The combination of the basic 

science-oriented research group at the MPIMG with the more clinically oriented Medical Genetics 

group provides a unique opportunity for interaction. It has set the basis for many projects 

that focus on the molecular pathology of clinically defined conditions. 

One of the fundamental questions in modern biology and medicine are the mechanisms by 

which the genotype determines the phenotype. Human genetics is a paradigm for this problem. 

In spite of our increasing knowledge about genetic diseases and the causative genes involved, 

we are frequently unable to predict the outcome, i.e. the phenotype or the course of a condition. 

Our focus is on the mechanisms by which the skeleton forms. The skeleton is a particularly 

useful system to study phenotype-genotype correlations because of the innumerable possibilities 

of phenotypic expression and the involvement of a limited number of cell-types (chondrocytes, 

osteoblasts and osteoclasts). The field of skeletal biology has expanded considerably in the last 

decade and has produced a number of breakthroughs that have led to a clearer understanding of 

skeletal development and function. Patterning genes such as the Hox-, Pax-genes control the 

overall bauplan of the skeleton and instruct mesenchymal cells where and how to differentiate 

into the skeletal anlagen. Sox9, Sox5, Sox6, and Runx2 have been identified as essential transcription 

factors that control the differentiation of determined precursor cells into chondrocytes 

or osteoblasts, respectively. Factors that control proliferation and differentiation such as the 

FGFs and their receptors and extracellular matrix proteins such as the proteoglycans or the 



141


142 

collagens are essential for proper growth of the skeleton before and after birth. Genes that 

control differentiation and function of osteoclasts are important for the regulation of bone resorption 

and homeostasis. The focus of our research is on the molecular basis by which the 

structure and function of the skeleton is regulated during vertebrate development. On a longer 

term, we want to understand the function of all relevant genes expressed in cartilage/bone and 

unravel their regulatory network. 

Results 

To reach a better understanding of bone development and maintenance, we use three major 

approaches. First, we take a more comprehensive approach to identify and eventually characterize 

all relevant genes in this process. Second, we have established in vitro and in vivo systems to 

evaluate the function of selected genes, and third, we use a classic human genetics approach to 

identify novel disease related genes. Thus, our goal is to combine Human Genetics with functional 

genomics in order to understand pathology and normal development of the skeleton. 

Using this strategy, we have established the following projects: 

Gene expression in bone/cartilage 

We have chosen the E14.5 mouse humerus as a model system for all further studies. At 

this stage, the humerus contains all cells and differentiation steps neccessary for bone 

development, i.e. undifferentiated mesenchymal progenitor cells (perichondrium), undifferentiated, 

proliferating and hypertrophic chondrocytes (growth plate), osteoblasts (bone), 

invading blood vessels, and osteoclasts. Thus, with a single histological section through 

the E14.5 humerus, all of these differentation stages can be captured at once in a twodimensional 

system. We have extensively characterized this system histologically and by 

in situ hybridization to detect specific expression patterns of genes. Furthermore, we have 

conducted expression array analysis based on Affymetrix chip technology to gain information 

on the number and type of genes expressed. Based on this system we compare the 

expression of different mutants with the wt expression to identify regulated genes. 

In order to get information on the expression on the cellular level, we have established an 

automated non-radioactive in situ hybridization methodology that allows for a relatively high 

throughput analysis of gene expression. Analysis of the first large scale expression studies shows 

multiple unique patterns that can easily be linked to certain cells types and differentiation steps 

and thus gives important information about gene function. This system has proved to be an 

invaluable tool for all further studies. Together with M.L. Yaspo, Dept Lehrach, MPIMG, we are 

investigating the expression of all chromosome 21 genes in our system in order to identify genes 

that have a role in cartilage/bone growth. It can be expected that the overexpression of one of 

these genes or a combination of them is reponsible for the short stature and brachydactyly in 

trisomy 21. We have established a database with the expression patterns of the genes already 

studied to provide a tool for further analysis. 

Genetic and functional analysis of hereditary skeletal phenotypes 

(A) Hand malformations. Hand malformations are caused by defects in patterning genes. Brachydactyly, 

a special form of hand malformation, refers to shortening of the hands/feet due to absent 

or small fingers/toes. Our group has contributed to unravel the genetic basis of several brachydactylies. 

To investigate the molecular pathology of these conditions we have established model 

systems in the mouse (transgenic, knock out, spontaneous mutations), the chick embryo 

(overexpression using retroviral systems) and in vitro (micromass). Our results show that the 

genes involved in the pathogenesis of brachydactyly are part of a molecular network regulating 

early chondrocyte differentiation and joint formation. 

We were able to show that specific mutations in the ROR2, a receptor tyrosine kinase, result in 

brachydactyly type B (BDB), a human limb malformation syndrome with hypoplasia/aplasia of 

distal limb structures. The mutations identified in BDB patients are predicted to result in truncation 

of the receptor, either before or after the tyrosine kinase. Our studies aim at the functional 

analysis of Ror2 during development. In order to recapitulate this disease phenotype we have 

expressed the BDB-mutations in the chick embryo system. In collaboration with P. Knaus, 

Institute of Physiological Chemistry, University of Würzburg, we were able to show that Ror2



interacts with the BMP-pathway through a negative feed back loop, 

and that Ror2 is cartilage-inductive through Smad-independent pathways. 

Using the yeast two-hybrid-system we have identified components 

of the intracellular signaling cascade of Ror2 that give novel 

insights into the signal transdution pathway of this receptor. RNAprofiling 

using Affymetrix chip technology has identified a number 

of regulated genes in E14.5 humeri of Ror2-/- mice. 

In previous studies we have identfied mutations in the transcription 

factor HOXD13 as the cause of human synpolydactyly. The mutation 

is an in-frame expansion of an alanine-coding repeat in the 5‘region 

of the gene. To get further insight into the mechanisms of the 

mutation we are investigating the mouse mutation spdh, which carries 

the identical alanine-expansion in Hoxd13. We were able to 

show that the brachdactyly observed in spdh mice (and humans) is 

due to the persistent expression of Hoxd-genes resulting in a) a reduced 

rate of chondrocyte proliferation, b) a block in chondrocyte 

differentiation, and c) a lack of phalangeal joint formation. Using 

the cre-loxP system we are selectively inactivating Hox-genes from 

the 5’ D-cluster in order to dissect the different functions of Hox 

genes during development of the limb skeleton. In vitro experiments 

using Hoxd13 with different alanine repeat expansions have revealed 

a novel mechanism by which these mutations are likely to function. 

Expansion of the repeat beyond a certain threshold results in the Section (top) and whole mount (bottom) in situ 

accumulation of misfolded protein outside of the nucleus. Further- hybridization of E13.5 hands of normal (left) and 

more, the mutated protein prevents wt protein from entering the Dsh (right) mice. Gene expression is indicated by 

nucleus, possibly explaining the dominant nature of the condition. the presence of white (top) or brown (bottom) color. 

This mechanism may explain the molecular pathogenesis of other The developing joints between the phalanges, as 

alanine-expansion diseases as well and could thus provide the basis labeled by the presence or absence (arrows) of gene 

for a new mutational mechanism. Together with V. Kalscheuer, Dept. expression, are disturbed in the mutant. 

Ropers, MPIMG, patients with translocations 5‘ and 3‘ of the HOXD-cluster have been investigated 

in order to identify regulatory elements that are disrupted by the translocations. 

The mouse mutant short digits (Dsh) has a similar phenotype as human brachydactyly type A1, 

but has no mutation in Indian hedgehog (IHH), as its human counterpart. We have extensively 

studied this mutant and were able to show that Dsh is allelic with Sonic hedgehog (Shh), a 

secreted signaling molecule with a central role during development. Using a positional cloning 

approach, we are investigating the region around Shh for regulatory mutations. In addition, we 

have carried out extensive studies to characterize the mechanism of brachydactyly in Dsh/+ 

embryos. The results suggest that Dsh is caused by a regulatory mutation affecting Shh expression 

and a mutation in a second gene responsible for the brachydactyly phenotype. 

Brachydactyly type A2 caused by a mutation 

in the bone morphogenetic protein receptor 

1B (BMPR1B). 

Through national and international collaborations we 

have been able to study several families with brachydactyly. 

Using a positional cloning approach, we were 

able to identify the gene for brachydactyly type A2, a 

condition characterized by shortening of the index finger. 

Two mutations were identified in the bone morphogenetic 

protein (BMP) receptor 1B, a serine threonine 

receptor kinase known to play an essential role in several 

developmental processes. The mutations result in a 

dominant inactivation of the receptor, as shown by in 

vitro experiments due to a lack of Smad activation. 

Overexpression of the mutant receptors in chick embryos 

results in a brachydactyly similar to the human 

phenotype. Several other families with limb brachydactyly 

phenotypes have been ascertained that are currently 

being mapped. 

143


144 

(B) Other skeletal conditions. In a previous study we were able to show that Runx2 is essential 

for the differentiation of precursor cells into osteoblast and for the differentiation of chondrocytes. 

Using in vivo approaches including transgenic mice and overex-pression in chick embryos as 

well as an in vitro micromass system we were able to show that Runx2 is a) not sufficient to 

induce bone and b) a positive regulator of chondrocyte differentiation. 

In a complimentary approach, we are using RNA-profiling techniques 

to isolate regulated genes that are differentially expressed in 

the E14.5 humerus of Runx2-/- vs. wt mouse embryos. The comparison 

of gene expression has revealed approx. 80 regulated genes. 

All of these genes have been evaluated for their expression patterns 

using the automated in situ hybridization system. Through this screen 

we were able to identify a large number of so far unknown boneexpressed 

genes. Interesting candidates are being evaluated for their 

function and regulation. Together with the Dept. Vingron, MPIMG, 

Runx target genes are identified by searching promotor sequences 

for Runx binding sites. Candidates are tested by in situ hybridization 

analysis and quantification of mRNA levels in wt vs. Runx2-/- mice. 

Preparation of a chick skeleton with cartilage 

staining blue and bone staining red. Overexpression 

of a transcription factor identified 

in the Runx2 screen results in severe bending 

of the tibia and a retardation of bone formation 

(right side). 

Recently, we are able to identify mutations in the membrane transporter 

Ank as the cause of craniometaphyseal dysplasia (CMD), a 

dominantly inherited skeletal dysplasia with increased bone formation 

and density (sclerosis). Ank has been shown to transport inorganic 

pyrophosphate (PPi) from the cytoplasma to the extracellular 

space. We use the ank/ank mouse as a model to study bone homeostasis 

and have established in vivo and in vitro assay systems to monitor 

bone density/degradation. 

Identification of disease genes 

An important part of our project includes the clinical evaluation and ascertainment of individuals 

and families with hereditary conditions. During the past year, the clinical genetics unit at the 

Charité has been restructured and now provides an excellent tool for this purpose. In collaboration 

with P. Nürnberg, MDC, several other conditions with skeletal dysplasia or decreased bone 

density have been mapped. In one, the causative gene defect has been identified (SED Omani 

type). Mapping is an extremely powerful approach to identify disease genes but in the great 

majority of cases no large pedigrees are available. Together with the Dept. Ropers, MPIMG, we 

are establishing a center for array CGH (comparative genome hybridization). This technology 

will enable us to screen genome wide for deletions at a very high resolution, opening up new 

avenues in the identification of genotype-phenotype correlations. 

Molecular biology of fracture repair 

In the event of injury, bones heal by generating new bone rather than by scar tissue. 

Recent studies have provided evidence that skeletal regeneration as it occurs in fracture 

repair is similar to embryonic bone development. In this project we intend to systematically 

evaluate and categorize genes that are expressed during the early phase of fracture 

repair. To do this we use the controled fracture of the sheep tibia as a model and callus 

from these fractures as a source of material. We have established a cDNA library of the 

fracture tissue. In collaboration with the Dept. Lehrach, MPIMG, we will use this library 

as a basis for a comprehensive study of genes involved in fracture repair. 

Evolution of the skeleton 

Cartilage/bone and haematopoesis evolved in a multi-step process in early chordata evolution. 

In mammals there are only three runt-transcription factors. Whereas Runx2 is essential 

for bone development, Runx1 is of crucial importance for haematopoesis. Runt 

genes appear to be particularly useful to analyze in which way gene duplications are 

related to the evolution of new characters. The aim of the project is to analyze the number, 

structure and expression of runt genes in branchiostoma, hagfish, lampery and sharks. 

According to our phylogenetic analyses two runt gene duplications occurred in early 

chordata evolution.

Goals 

An important future goal is to expand our knowledge of pathogenetic pathways by studying 

factors that modify a phenotype known to be caused by a certain mutation. Our approach 

to this problem will include extensive studies of downstream factors that are regulated 

by a certain mutation in order to identify interacting genes. For an effective functional 

testing of genes we will have to optimize our systems of gene/mutation testing. A 

complementary approach will be to systematically identify all genes that are relevant for 

the formation of the skeleton. Systematic in situ hybridization will greatly enhance our 

knowledge about gene function in this system. It will thus be of utmost importance to 

obtain a sufficient amout of data in this system. 



Kornak U & Mundlos S (2003). Genetic disorders 

of the skeleton: a developmental approach. 

Am J Hum Genet 73(3): 447-74 

Lehmann K, Hecht J, Stricker S, Sammar M, 

Meyer B, Süring K, Majewski F, Tinschert S, 

Müller D, Knaus P, Nürnberg P & Mundlos S 

(2003). Mutations in Bone morphogenetic protein 

receptor 1B cause brachydactyly type A2. 

PNAS USA (in press) 

Schwabe GC, Trepczik B, Süring K, Brieske 

N, Tucker AS, Sharpe PT, Minami Y & 

Mundlos S (2003). The Ror2 knock out mouse 

as a model for the developmental pathology 

of autosomal recessive Robinow syndrome. 

Dev Dyn (in press) 

Schwabe GC, Türkmen S, Leschik G, 

Palanduz S, Stöver B, Goecke TOG, Majewski 

F & Mundlos S (2003). Brachydactyly Type 

C Caused by a Homozygous Missense Mutation 

in the Prodomain of CDMP1. Am J Med 

Genet (in press) 

Stock M, Schafer H, Stricker S, Gross G, 

Mundlos S & Otto F (2003). Expression of 

galectin-3 in skeletal tissues is controlled by 

Runx2. J Biol Chem 278(19): 17360-7 

Stricker S, Poustka AJ, Wiecha U, Stiege A, 

Hecht J, Panopoulou G, Vilcinskas A, 

Mundlos S & Seitz V (2003). A single amphioxus 

and sea urchin runt-gene suggests that 

runt-gene duplications occurred in early chordate 

evolution. Dev Comp Immunol 27(8): 

673-84 

Türkmen S, Gillessen-Kaesbach G, Meinecke 

P, Albrecht B, Neumann LM, Hesse V, 

Palanduz S, Balg S, Majewski F, Fuchs S, 

Zschieschang P, Greuwe M, Mennicke K, 

Kreuz FR, Dehmel HJ, Rodeck B, Kunze J, 

Tinschert S, Mundlos S & Horn D (2003). 

Mutation in NSD1 are responsible for Sotos 

syndrome, but are not a frequent finding in 

other overgrowth phenotypes. Eur J Hum Gen 

(in press) 

Albrecht AN, Schwabe GC, Stricker S, 

Boddrich A, Wanker EE & Mundlos S 

(2002).The synpolydactyly homolog (spdh) 

mutation in the mouse — a defect in patterning 

and growth of limb cartilage elements. 

Mech Develop 112(1-2): 53-67 

Stricker S, Fundele R, Vortkamp A & Mundlos 

S (2002). Role of Runx genes in chondrocyte 

differentiation. Dev Biol 245(1) : 95-108 

Kruger M, Mennerich D, Fees S, Schafer R, 

Mundlos S & Braun T (2001). Sonic hedgehog 

is a survival factor for hypaxial muscles 

during mousedevelopment. Development 

128(5): 743-52 

Nurnberg P, Thiele H, Chandler D, Hohne W, 

Cunningham ML, Ritter H, Leschik G, 

Uhlmann K, Mischung C, Harrop K, Goldblatt 

J, Borochowitz ZU, Kotzot D, Westermann F, 

Mundlos S, Braun HS, Laing N & Tinschert 

S (2001). Heterozygous mutations in ANKH, 

the human ortholog of the mouse progressive 

ankylosis gene, result in craniometaphyseal 

dysplasia. Nat Genet 28(1): 37-41 

Schwabe GC, Tinschert S, Buschow C, 

Meinecke P, Wolff G, Gillessen-Kaesbach G, 

Oldridge M, Wilkie AO, Komec R & Mundlos 

S (2001). Distinct mutations in the receptor 

tyrosine kinase gene ROR2 cause brachydactyly 

type B. Am J Hum Genet 67(4): 822-31 



145


146 

Books 

Mundlos S (2000). Skeletal morphogenesis. 

Methods Mol Biol 136: 61-70 

Mundlos S & Olsen BR (2002). Defects in 

skeletal morphogenesis. In: Royce PM & 

Steinmann B (eds), Connective Tissue And Its 

Heritable Disorders, Wiley Liss, Chap.23, Part 

V: 993-1023 

Mundlos S (2003). Konnatale anatomische 

Entwicklungsstörungen. In: Lentze MJ, 

Schaub J, Schulte FJ, Spranger J (eds), 

Pädiatrie, Grundlagen und Praxis, Springer 

Verlag, Chapt. V, 31: 278-284 

Mundlos S (2003). Genetics of bone Disease 

and Skeletal Disorders. In: Ganten D & 

Ruckpaul K, eds., Encyclopedic Reference of 

Genomics and Proteomics in Molecular Medicine, 

Springer Verlag (in press) 

Mundlos S (2003). Molekulare Ursachen von 

Fehlbildungen des Skeletts bei Neugeborenen. 

In: Ganten D & Ruckpau K, eds., Molekularmedizinische 

Grundlagen von fetalen und neonatalen 

Erkrankungen. Springer Verlag (in press) 

Mundlos S, ed. (2003). Genetik der Skelettdysplasien, 

Z Med Genetik (in press) 

Co-operations 

Function of Ror2 in chondrocyte differentiation, 

with Prof. Sebald, PD Dr. Knaus, Institute 

of Physiological Chemistry, University 

of Würzburg 

Signaltransduction of Ror2, with Prof. W. 

Birchmeier, Max-Delbrück-Center of Molecular 

Medicine (MDC), Berlin-Buch 

Down stream targets of Runx2, with Dr. F. Otto, 

Dept. of Haematology and Oncology, University 

of Freiburg 

Mechanisms of brachydactyly in humans, with 

Dr. M. Warman, Dept. of Genetics and Center 

for Human Genetics, Case Western Reserve 

University, Cleveland, Ohio, USA 

Mapping of disease genes, with PD Dr. P. 

Nürnberg, Mikrosatelittenzentrum, MDC, 

Berlin-Buch 

Mouse models for brachydactyly, with Dr. D. 

Chan, University of Hong Kong 

Sheep fracture model. Mechanotransduction 

in bone, with Prof. Dr. G. Duda, Charité, Dept 

of Surgery, Humboldt University of Berlin 

Mapping of disease genes. Expression patterns 

of cartilage specific genes, with Dr. D. Cohn, 

Dept of Genetics, UCLA, USA 

Mechanisms of Gdf5 function, with Dr. J. Pohl, 

BioPharm, Heidelberg 

Mapping of disease genes, with K. Kjaer, Dept 

of Medical Genetics, University of Copenhagen, 

Denmark 

ANABONOS EU-project, with Prof. S. 

Ralston, Institute of Medical Science, University 

of Aberdeen 

Function of NF1 in bone, with Prof. L. Parada, 

Center for Developmental Biology, University 

of Texas Southwestern Medical Center at Dallas, 

USA 

External funding (MPIMG projects) 

Establishment of Array-CGH-Comparative 

genome hybridization (EFRE - EU, 1/03-12/ 

05) 

Klinische Forschergruppe TP 9: Molecular 

mechanism of fracture healing (DFG, 1/02- 

12/03) 

Identification of theurapeutic relevant genes 

for cartilage/bone formation through analysis 

of a mouse model for cleidocranial dysplasia 

(Fritz-Thyssen-Stiftung, 3/03-2/05) 

SFB 577, TP A4: Craniometaphyseal dysplasia 

(CMD) – Clinical Variability and Pathogenic 

Pathways (DFG, 7/01-6/04) 

SFB 577, TP A6: HOXD-gene. Molecular 

Pathology and Embryology of HOXD-related 

Limb Malformations (DFG, 7/01-6/04) 

Neurofibromatosis type 1 as a bone dysplasia? 

Analyzing the role of neurofibromin in 

maintenance and development of the skeleton 

(US-Army, 3/03-3/03)

Independent Junior Research Groups - 

Otto-Warburg-Laboratory 

The Otto-Warburg-Laboratory consists of three independent Junior Research Groups, 

headed by Adam Antebi, Ann Ehrenhofer-Murray, and Andrea Vortkamp. 

Endocrine regulation of C. elegans development 

& aging 

Head: 

Dr. Adam Antebi 

Phone: +49 (0)30-8413 1302 

Fax: +49 (0)30-8413 1130 

Email: antebi@molgen.mpg.de 

Summary 

All animals develop through successive stages and have defined life spans determined by their 

genome and modulated by environment. What are the underlying molecular mechanisms that 

specify life stages and influence the pace of aging? Using C. elegans as a genetic model, my 

laboratory has discovered that a nuclear receptor signaling cascade works downstream or parallel 

to insulin/IGF signaling to influence life histo-ry decisions. Our work provides powerful insights 

into how nuclear receptor signaling pathways behave in the context of organismal endocrine 

networks, with medical relevance to our understanding of diabetes, obesity and aging. 

Background 

Scientist: 

Dr. Birgit Gerisch 


Andreas Ludewig (Ph.D. 4/2003) 

Nicole Fielenbach 

Veerle Rottiers 

Axel Bethke 


Daniela Gibis 

Nanyi Park 


Phillip Thoman 

Technicians: 

Cindy Weitzel 

Kerstin Neubert 

Anne Frenzel 

Visiting scientists/students: 

Dr. Paul Dowell (Johns Hopkins U.) 

Neal Freedman (UCSF) 

A striking finding is that single-gene mutations can transform the identity of C. elegans life 

stages and regulate life span. A handful of genes, the heterochronic loci, act as “stage selectors” 

or master regulators of stage-specific temporal fates. They encode diverse transcriptional and 

translational regulators, many of them conserved. Another set of genes, the dauer loci, regulate 

a “developmental checkpoint”, the choice between reproductive development and developmental 

arrest at an alternate third larval stage, the dauer diapause, in response to starvation cues. 



147

Independent Junior Research Groups / 


148 

Dauer larvae store fat, are stress 

resistant and long-lived. Identified 

signaling pathways, including 

insulin/IGF and TGFβ, 

act by a neuroendocrine mechanism 

to regulate the dauer 

decision (Figure 1). Interestingly, 

it has been shown that 

insulin/IGF signaling also influences 

adult longevity. For 

example, mutations in the daf- 

2/insulin/IGF receptor (InsR) 

double adult life span. Remark- Figure 1: Endocrine regulation of C. elegans life history 

ably, recent work in flies and mice suggests that reduced insulin/IGF signaling similarly affects 

life span, revealing that this constitutes an ancient mechanism to promote survival under stress. 

Evidence suggests that insulin/IGF signaling regulates diapause and life span cell-nonautonomously 

by a downstream hormonal signal. We have likely found part of this hormonal signal 

with the discovery of nuclear hormone receptor, daf-12 and functionally related genes, which 

act at the nexus of pathways regulating temporal identity, diapause and life span. 

Results 

DAF-12 nuclear receptor 

We originally discovered that daf-12 links dauer and heterochronic pathways, coupling 

environmental cues to developmental timing circuits. In collaboration with Don Riddle 

(U. Missouri) we showed that daf-12 encodes a nuclear hormone receptor (nhr), transcription 

factors responsive to lipophilic hormones such as steroids and retinoids. DAF- 

12 is most similar to vertebrate vitamin D, pregnane, and androstane receptors. This molecular 

identity predicts life history regulation by lipophilic hormones. 

A hormone metabolic pathway 

Consistent with this prediction, we found that daf-9, a locus with phenotypes similar to 

daf-12, encodes a cytochrome P450 (cyp450) related to vertebrate steroidogenic and fatty 

acid hydroxylases, suggesting a function in the metabolism of a DAF-12 hormone (Figure 

1). Interestingly, strong daf-9 mutants are modestly long-lived, and weak alleles enhance 

daf-2/InsR longevity to fourfold. In addition, daf-9(+) and daf-12(+) are required for the 

longevity of animals whose germline has been removed. Importantly, the molecular identities 

of daf-9 and daf-12 together provide the first strong evidence of lipophilic hormone 

signaling in C. elegans, implying that such hormones modulate life plans and life spans. A 

sterol derivative may be the hormone, since cholesterol deprivation phenocopies daf-9 

defects (Birgit Gerisch, Veerle Rottiers). 

Another locus, daf-36 phenotypically resembles daf-9, and likely defines part of the same 

pathway. Indeed, we have recently molecularly identified daf-36 and shown that it encodes 

an Rieske type FeS dioxygenase most related to bacterial steroid metabolizing enzymes, 

consistent with a role in hormone metabolism (Veerle Rottiers). 

Figure 2: daf-9 ist expressed in XXX endocrine cells. 

Hormonal regulation 

Importantly, daf-9 expressing cells 

identify novel nematode endocrine tissues, 

and include hypodermis, spermatheca, 

and a mysterious pair of neuron-like 

cells, aptly named XXX (Figure 

2). We have shown that daf-9 acts 

cell non-autonomously and is feedback 

regulated by daf-12 itself, consistent 

with a hormonal mechanism. More-

over, daf-9 is tightly regulated by nutritional cues and genetic inputs, demonstrating that it is a 

central point of control. Finally, daf-9 overexpression rescues larval defects of daf-2/insulin 

receptor mutants, suggesting that sterol hormones work downstream of insulin signal transduction. 

daf-36 is expressed in different tissues than daf-9 (intestine, a few neurons) showing that 

hormone biosynthesis is distributed (Birgit Gerisch, Veerle Rottiers). 

DAF-12 transcriptional complexes 

In the presence of hormone, nuclear receptors typically assemble coactivator complexes that 

turn on transcription, whereas in the absence of hormone they assemble corepressor complexes 

that turn off the same targets. Through yeast two-hybrid screens, we identified din-1, a homolog 

of the human SHARP transcriptional corepressor. We propose that din-1 comprises part of a 

hormone regulated binary switch that together with apo-DAF-12 implements developmental 

arrest, diapause and long life (Figure 1). Although nuclear receptors are typically known for 

hormone activation, our work points to the diametric possibility that repressor function is central 

to animal development (Andreas Ludewig, Axel Bethke). 

New heterochronic genes 

In mutant screens for enhanced gonadal heterochrony of daf-12 null alleles we found two loci, 

dre-1 and dre-2. dre-1 displays heterochronic phenotypes in epidermal seam cells as well as in 

gonad. In double mutant combinations with other heterochronic loci, dre-1 reveals previously 

unseen roles in the gonad, opening up gonadal heterochrony to systematic investigation. Finally, 

dre-1 affects molting, suggesting a functional link between two developmental timers, the molt 

cycle, and the heterochronic circuit. It encodes a highly conserved protein that contains F-box, 

Zinc finger (Zf_UBR-1) and carbohydrate binding domains, implying a role in ubiquitin mediated 

proteolysis (Nicole Fielenbach). 

Target genes 

Given daf-12´s multiple functions, it is vital to identify target genes. In collaboration with Keith 

Yamamoto (UCSF) a daf-12 binding site has been defined. Now we are examining physiological 

targets such as daf-9 and other genes using a bioinformatic approach, to test whether transcription 

is affected (Axel Bethke). 

Other aging genes 

RNAi by feeding affords a high throughput method for analyzing gene function. We are systematically 

screening for candidates that give long-lived phenotypes, as well as performing enhancer 

and suppressor screens with dauer pathway mutants. After having screened through 

genes on Chr I we have found that among other things, reduced mitochondrial gene function 

extends life span. In addition, many of these same genes apparently enhance dauer formation 

(Gudrun Peiler, Nanyi Park, Daniela Gibis). 

Significance and future plans 

My goal is to understand how identified endocrine signaling pathways, as well as new components 

regulate life stage programs and life spans. In the short term, I will continue work on the 

DAF-12 hormone signaling pathway in a broad sense, including dissecting endocrine inputs 

and transcriptional outputs. 

1. We wish to understand more precisely how insulin/IGF and nuclear receptor signaling are 

coupled, since they show both epistatic and synergistic interactions. Are they connected through 

kinase cascades, transcriptional control or other ways? Such studies might shed light on disease 

states where insulin and nhr signaling converge, e.g. diabetes, ischemia. 

2. Identification of daf-9 and daf-36 expressing tissues has opened up the field of worm endocrinology. 

Subsequently, several labs have found that Niemann-Pick C1 homologs, which mediate 

sterol transport, are expressed in the same cells and function in dauer formation. Cholesterol 

transport and metabolism are now intensely studied, given the connection to hormone 

production, as well as the medical relevance to age related diseases, such as arteriosclerosis and 

inflammation. 



149



150 

3. Understanding how nuclear coactivators and corepressors modulate nhr activity in 

this context may reveal how different life stages and life spans are specified. Genetic 

screens to identify further corepressor and coactivator components are underway, as 

are biochemical/proteomic approaches to identify transcriptional complexes, so that 

we can better study events at the molecular level. 

4. A current challenge is to now biochemically identify the DAF-12 ligand, as well as 

other putative hormones. We have initiated several collaborations to see if daf-9, daf- 

12 and other mutants have altered sterol profiles. In addition, we have begun pilot 

screens using sterol compounds to look for biological activity. 

5. We will continue the hunt for daf-12 target genes, both by characterizing specific 

candidates to connect genetic circuits, as well as whole genome microarray approaches 

to illuminate new physiological roles. Target genes will also provide an important tool 

to assay the activity of a DAF-12 ligand. 

6. We will also continue exploratory systematic genome wide RNAi screens for other 

genes influencing longevity, diapause and developmental timing. High throughput 

methods will be developed so that we can rapidly run whole genome scans by RNAi 

feeding in various genotypes. 

7. In the long term, I am excited to find out if functional vertebrate homologs of daf-12 

and related genes work analogously to affect metabolism, developmental timing, and 

life span. It is well known for example, that the timing of mammalian puberty is contingent 

upon appropriate nutritional signals. At the molecular level, insulin/IGF, estrogen 

receptors and other related molecules may mediate some of these effects. Whether 

or how these pathways influence life span is not yet known. 



Tatar M, Bartke A & Antebi A (2003). Endocrine 

Regulation of Aging by Insulin-like signals. 

Science 299:1346-1351 

Gerisch B & Antebi A. Hormonal signals 

produced by DAF-9/cytochrome P450 regulate 

C. elegans dauer diapause in response to 

environmental cues (submitted) 

Ludewig A, Kober-Eisermann C, Weitzel 

C, Neubert K, Bethke A, Gerisch B, Hutter 

H & Antebi A. A complex of nuclear corepressor 

DIN-1 and nuclear receptor DAF-12 

specify C. elegans dauer diapause (submitted) 

Shostak Y, Van Gilst MR, Antebi A & 

Yamamoto K. In Vitro Genomic Selection: 

From C. elegans DAF-12 Binding Sites To 

Target Gene (submitted) 

Gerisch B, Weitzel C, Kober-Eisermann C, 

Rottiers V & Antebi A (2001). A hormonal 

signaling pathway influencing C. elegans 

metabolism, reproductive development and life 

span. Dev. Cell 1: 841-851 (featured article on 

Science SAGE/ke website, News Focus Dec. 

12, 2001) 

Antebi A, Yeh WH, Tait D, Hedgecock EM 

& Riddle D (2000). daf-12 encodes a nuclear 

receptor that regulates the dauer diapause and 

developmental age in C. elegans. Genes & Dev 

14: 1512-1527 

Antebi A, Culotti JG & Hedgecock EM 

(1998). daf-12 regulates developmental age 

and the dauer alternative in C. elegans. Development 

125: 1191-1205 

Invited talks at meetings and symposia 


Jacques Monod Conference, Form and 

Function in Development and Disease, La 

Londe-les-Maures (6/2003) 

The Biology of Human Aging, Brown University, 

Providence (5/2993) 

Gordon Research Conference on Biology 

of Aging, Ventura (3/2003) 

Senior Seminar on Aging, Swarthmore College, 

Swarthmore (9/2002) 

Buck Symposium on Neuroendocrine Systems 

and Life Span Determination, Novato 

(9/2002)

European C.elegans Meeting, Blankenberge 

(5/2000) 

Keystone Symposium on Nuclear Receptors, 

Steamboat Springs (3/2000) 

Japanese Worm Meeting, Kanazawa (7/1998) 

European Worm Meeting, Cambridge (6/ 

1998) 

Teaching 

C. elegans practical course, Freie Universität, 

Berlin (5/2003, 3 weeks) 

Invited lecturer, Universität Göttingen, 

Göttingen (7/2002) 

Invited lecturer, Dept. of Biochemistry and 

Ecotoxicology, Freie Universität, Berlin (4/ 

2002) 

Invited lecturer, Dept. of Parasitology, 

Humboldt-Universität, Berlin (2/2002) 

Invited lecturer, University of Ghent, Ghent 

(9/1998) 

Theses 

Andreas Ludewig: Nuclear receptor pathways 

in C. elegans: DIN-1, a DAF-12 

coregulator of dauer diapause and developmental 

arrest. PhD Thesis at Freie 

Universität Berlin (4/2003, MPG and EC 

Agegen grants) 


memberships 

Participant of Science SAGEKE website 

(2002-present) 

Member of the German Genetics Society 

(1999-2000) 


QLK6-CT-1999-02071, European Community 

Grant, Agegen: The identification 

and characterisation of effector genes in 

the C. elegans enhanced life maintenance 

program (2000-2003) 

Institute collaborations 

Functional genomic analysis of Chromosome 

21 homologs in C. elegans, with Marie 

Laure Yaspo, Dept. Lehrach 

Molecular evolutionary studies on C. 

elegans runt homolog, with Volkhard Seitz, 

Research Group Mundlos 

Transcriptional complexes in dauer formation, 

with Johan Gobom, Dept. Lehrach 

Bioinformatic discovery of DAF-12 target 

genes, with Christoph Dieterich, Dept. Vingron 

Consulting activities 

Scientific Advisory Board, Wellcome Trust 

Grant on Functional Genomics of Aging 

(2002-07) 

Consultant, Devgen Corporation (1997-98 ) 

Institute activities 

initiated Institute-wide seminar series and chair 

of seminar committee (5/2000-present) 

served on MPIMG election committee (2/ 

2002-present) 

served on steering committee for Institute 

Day of Scientific Exchange (2/2002) 


Featured scientist on Max Planck Forum on 

Aging, Deutsche Welle TV (5/2003) 

Featured scientist on Science´s SAGEKE 

website (4/2003) 

Berlin Long Night of Sciences, open house 

visit and presentation of the laboratory to 

the public (6/2002) 

Featured scientist on Swedish National 

Radio (2/2002) 

Featured scientist in television production 

on aging, channel ZDF (4/2000) 



151



152 

Gene silencing in Saccharomyces cerevisiae 

Head: 

PD Dr. Ann Elizabeth Ehrenhofer-Murray 

Phone: +49 (0)30-8413 1329 

Fax: +49 (0)30-8413 1130 

Email: ehrenhof@molgen.mpg.de 

Summary 

The expression and integrity of genetic information is directly coupled to the packaging of DNA 

into higher-order chromatin in the eukaryotic nucleus. Our aim is to understand the molecular 

basis of how chromatin controls gene expression. We have identified a novel mechanism for the 

reestablishment of histone acetylation patterns on chromatin after DNA replication. Furthermore, 

we have found a new targeting mechanism for heterochromatin, and we have discovered 

a regulatory function for amino-terminal protein acetylation in gene silencing. Taken together, 

our findings reveal a complex interplay of protein factors and their modifications in establishing 

functional domains within the genome. 

Current state of research 

Scientists: 

Dr. Jacqueline Franke (since 6/02) 

Dr. Sigrid Schaper (since 7/01) 

Dr. Arnold Grünweller (until 1/02) 


Stefan Ehrentraut (since 8/03) 

Antje Geissenhöner 

Horst Irlbacher 

Daniela Kasulke (until 5/02) 

Sebastiaan H. Meijsing (until 6/02) 

Stefanie Seitz 

Matthias Sieber (since 9/03) 


Anya Elstner (January – September 02) 

Muna Krings (September 02 – February 03) 

Corinna Schirling (since 4/03) 

Stefanie Seitz (April – October 2000) 

Technicians: 

Anne Barduhn (until 6/03) 

Uta Marchfelder 

The organization of DNA into chromatin and chromosomal structures plays a central role 

in many aspects of cell biology and development in eukaryotes. Processes ranging from 

chromosome stability and segregation to gene expression are intimately linked to chromatin 

configuration. Chromatin function is modulated by posttranslational modifications on 

the basic unit of chromatin, the nucleosome. Perhaps best studied is the influence of 

histone acetylation on transcription initiation, whereas histone methylation, phosphorylation 

and ubiquitination regulate various other aspects of chromatin biology. A current 

model posits that combinations of modifications are recognized and bound by effector 

proteins that translate such epigenetic patterns of nucleosome modifications into a gene 

expression state. 

We are studying the relationship between chromatin structure and gene repression in the 

model organism Saccharomyces cerevisiae. In S. cerevisiae, repressed genome regions 

are found at the cryptic silent mating-type loci HML and HMR, in subtelomeric regions

and at the ribosomal DNA locus. One hallmark of these regions is the binding of the 

heterochromatic proteins Sir3 and Sir4 to unacetylated nucleosomes. Histone deacetylation 

in these regions is accomplished by Sir2, an NAD-dependent histone deacetylase that is 

essential for all forms of silencing in yeast. The focus of our research is to understand how 

repressive chromatin structures are targeted to a particular genomic region, how these 

structures are established and maintained during DNA replication, and how histone and 

protein modifications influence their structure and function. 

Results and their significance 

Reestablishment of epigenetic patterns of histone modification after DNA 

replication and chromatin assembly 

The duplication of chromatin during the cell cycle requires that epigenetic patterns of 

histone modifications be reestablished on the newly formed chromatin after DNA replication. 

Chromatin acetylation coupled to replication is essential in order to ensure that repressor 

proteins like Sir3 and Sir4 don’t spread inappropriately on unmodified nucleosomes 

in chromatin. We have gained mechanistic insight into this process by uncovering 

a novel interaction of the chromatin assembly factors CAF-I and Asf1 with the histone 

acetyltransferase complex SAS-I. We have shown that SAS-I acetylates lysine 16 of histone 

H4 (H4 K16) both in vivo and in vitro. Interestingly, Sir3/4 protein binding to chromatin 

is particularly sensitive to acetylation at this position. We propose that the SAS-I 

complex is recruited to the freshly assembled chromatin through CAF-I or Asf1 in order 

to acetylate H4 K16 in a global fashion, which prevents the spreading of heterochromatin 

components into euchromatic genome regions (Figure 1). Thus, this represents a new 

class of histone acetylation that is distinct from the known classes of acetylation like 

transcription initiation or elongation coupled acetylation. Furthermore, since other histone 

modifications like methylation or deacetylation are also reset after replication, we 

likewise propose that other chromatin modifying activities are recruited to new chromatin 

by their interaction with chromatin assembly factors. 

Novel functions for the SAS-I histone acetyltransferase complex 

Our work described above has firmly established a role for SAS-I in gene silencing and 

chromatin assembly. We have further asked whether SAS-I carries out other, hitherto 

unknown functions, by searching for new interaction partners of the SAS-I components. 

We found that SAS-I interacted with the centromeric histone H3 variant Cse4. Cse4 replaces 

H3 in the nucleosome at the yeast centromere and is essential for its structure and 

Figure 1: Model for the recruitment of the SAS-I complex to newly assembled chromatin. (A) The ringshaped 

PCNA trimer associates with DNA and enhances DNA polymerase processivity during DNA 

replication. (B) After replication, PCNA remains topologically linked to the replicated DNA. PCNA recruits 

CAF-I and Asf1 to assemble nucleosomes onto the DNA. (C) Upon nucleosome assembly, Cac1 and Asf1 

remain associated with chromatin and recruit the SAS-I complex to acetylate histone H4 K16. 



153



154 

function. In its C-terminal half, Cse4 is most similar to histone H3, but unlike conventional 

histones, it contains a long (127 amino acids) amino-terminal tail that interacts with 

kinetochore components, for instance the centromeric protein Ctf19. The observation that 

SAS-I interacted with Cse4 implies a function for SAS-I at the centromere. Indeed, we 

found that the deletion of SAS2 (sas2∆) interfered with plasmid segregation in yeast strains 

whose kinetochore was compromised by additional mutations. Furthermore, we found 

that SAS-I interacted with the amino-terminal part of Cse4, and that sas2∆ abrogated the 

interaction between Cse4 and Ctf19. One interpretation of these findings is that the SAS- 

I complex has a structural role at the centromere. Alternatively, since SAS-I is an enzyme, 

it may acetylate Cse4 and thus may modify its role at the centromere. 

Furthermore, we have discovered an interaction between SAS-I and nuclear import 

factors. Sas5 interacted with the importin β-like factor Pse1, which serves as a shuttle 

for proteins synthesized in the cytoplasm to reach their nuclear destination. Sas5 lacks 

a classical nuclear localization signal (NLS), which fits well with the fact that importin 

β-like factors are specialized to transport such proteins. Significantly, Sas5 concentration 

in the nucleus was reduced in strains mutated in PSE1 or KAP123, which encodes 

a second importin β-like protein, whereas other importin β mutants did not affect Sas5 

localization. Interestingly, both mutants also reduced the nuclear concentration of Sas2, 

but not Sas4. Thus, we hypothesize that the complex components are transported individually 

into the nucleus, where they are then assembled into a functional complex. 

Moreover, we found the SAS-I complex to interact with the protein Tgs1. Tgs1 is an RNA 

methyltransferase that methylates the cap structure of small nuclear and nucleolar RNAs which 

classically are required for splicing. This interaction suggests a functional link between the 

processes of histone acetylation and RNA processing, which we are currently investigating. 

Regulation of ORC silencing function by amino-terminal protein acetylation 

In recent years, the function of a variety of posttranslational protein modifications in 

chromatin has been elucidated, whereas some protein modifications have remained 

poorly characterized. One such modification concerns the N-terminal processing of 

proteins after synthesis at the ribosome. Depending on the penultimate amino acid of 

a protein, the initiator methionine is cleaved off, and the newly exposed residue is then 

acetylated by one of several N-terminal acetyltransferases. Hence, this type of acetylation 

differs chemically from the well characterized acetylation of lysine side chains 

in histone acetylation, and is also expected to be functionally distinct. 

Interestingly, one of the N-terminal acetyltransferases in yeast, the Nat1/Ard1 complex, 

has long been known to be required for gene silencing, thus implying that one or 

several silencing proteins require N-terminal acetylation for full function. Genetic 

analyses led us to postulate that the large subunit of the Origin Recognition Complex 

(ORC), Orc1, is one such substrate. ORC is required to target silencing complexes to 

the HM loci and the telomeres. We demonstrated that Orc1 is fully acetylated in wildtype 

cells and completely unacetylated in nat1∆ cells. Furthermore, the mutation of 

the penultimate alanine of Orc1 to amino acids that abrogated its ability to be acetylated 

by Nat1/Ard1, also caused silencing defects. Taken together, our experiments 

showed that Orc1 was a target of Nat1/Ard1, and that the lack of acetylation compromised 

Orc1’s silencing function. Hence, we have discovered a novel role for N-terminal 

protein acetylation in regulating the role of ORC in silencing. Since the effect of 

these orc1 mutations on silencing is weaker than the effect of nat1∆, there may be 

other silencing relevant targets for Nat1/Ard1, and we are currently evaluating additional 

candidates. 

Characterization of a novel silencer binding factor 

Repression of the mating-type genes located at HML and HMR is exerted by control 

elements termed silencers. In essence, they consist of combinations of binding sites 

for the replication initiator ORC, the telomere binding factor Rap1, and the Abf1 protein, 

which together recruit the heterochromatic Sir proteins to establish repressive 

chromatin. One silencer element, the so-called HML-D region within the HML-E si-

lencer, has so far remained uncharacterized. We hypothesize that HML-D contains a 

binding site for an as yet unknown silencer binding protein. We have narrowed down 

HML-D to a 14-basepair core sequence, and we have taken genetic and biochemical 

approaches in order to identify the putative D-binding protein. We have preliminary 

evidence that the Sum1 protein binds to HML-D. Sum1 is well known as a repressor 

protein that binds to middle sporulation element (MSE) and represses sporulation genes 

during vegetative growth. We found that the SUM1 deletion caused a predicted set of 

silencing defects at HML, but not at HMR, which lacks the “D” element. Sum1’s function 

in HML silencing has so far not been recognized. Hence, with our studies, we are 

uncovering a novel function for Sum1 and are expanding our knowledge of how heterochromatin 

components are targeted to specific regions within the genome. 

Future directions 

Understanding the relationship between genome sequence, epigenetic patterns of chromatin 

modification and gene expression will become increasingly important in the era 

of post-genomic science. Our goal is to obtain an integrated view of the composition 

and chemical modifications of chromatin in all genomic regions and to relate them to 

gene expression states in order to dissect the functional organization of the eukaryotic 

genome. In the future, we will make use of systematic approaches to investigate chromatin 

modifications and gene function on a genome-wide scale in S. cerevisiae. Since 

many of the components are evolutionarily conserved, it will be important to determine 

whether they are functionally linked in larger eukaryotes. Thus, in the long term, 

we will expand our studies to multicellular organisms (flies, worms) in order to investigate 

the influence of chromatin states on genome structure and development on an 

organismal level. Taken together, we will thus provide new insights into the mechanism 

of assembly and propagation of epigenetic information in eukaryotes, and how it 

controls the expression and integrity of genetic information. 



Margot JB, Ehrenhofer-Murray AE, 

Leonhardt H (2003). Interactions within the 

mammalian DNA methyltransferase family. 

BMC Molecular Biology 4(1):7 

Marchfelder U, Rateitschak K, Ehrenhofer-Murray 

AE (2003). SIR-dependent repression 

of non-telomeric genes in Saccharomyces 

cerevisiae? Yeast 20(9): 797-801 

Gautschi M, Just S, Mun A, Ross S, Rücknagel 

P, Dubaquie Y, Ehrenhofer-Murray 

AE, Rospert S (2003). The yeast Nαacetyltransferase 

NatA is quantitatively anchored 

to the ribosome and interacts with nascent 

polypeptides. Mol Cell Biol (in press) 

Kasulke D, Seitz S, Ehrenhofer-Murray 

AE (2002). A role for the Saccharomyces 

cerevisiae RENT complex protein Net1 in 

HMR silencing. Genetics 161: 1411-1423 

Grünweller A, Ehrenhofer-Murray AE 

(2002). A novel yeast silencer: The 2 micron 

origin of Saccharomyces cerevisiae 

has HST3-, MIG1- and SIR-dependent silencing 

activity. Genetics 162: 59 - 71 

Meijsing SH, Ehrenhofer-Murray AE 

(2001). The silencing complex SAS-I links 

histone acetylation to the assembly of repressed 

chromatin by CAF-I and Asf1 in 

Saccharomyces cerevisiae. Genes Dev 15: 

3169-3182 

Ehrenhofer-Murray AE, Kamakaka RT, 

Rine J (1999). A role for the replication proteins 

PCNA, RF-C, polymerase epsilon and 

Cdc45 in transcriptional silencing in Saccharomyces 

cerevisiae. Genetics 153: 1171- 

1182 



155



156 

Selected invited talks and seminars 

1998 – 2003 

Silencing speaks up: Epigenetic mechanisms 

of gene regulation in the yeast Saccharomyces 

cerevisiae, EMBL Heidelberg, 6/03 

SAS and CAF: Restoration of histone modification 

patterns after DNA replication, Keystone 

Meeting “Enzymology of Chromatin and 

Transcription”, Santa Fe, NM, 3/03 

SAS and CAF: A link between chromatin assembly 

and histone acetylation, DFG Meeting 

Schwerpunkt Epigenetik, Berlin, 11/02 

Resetting of epigenetic marks after replication: 

Interaction between SAS-I and chromatin assembly 

factors, Deutsche Hefetagung Ober- 

Ramstadt, 9/02 

SAS and CAF: Connections between histone 

acetylation and chromatin assembly, EURES- 

CO Conference on Gene Transcription in 

Yeast, Castelvecchio Pascoli, Italy, 5/02 

SAS and CAF: A link between histone acetylation 

and chromatin assembly, FASEB Meeting 

on Chromatin and Transcription, 

Snowmass, CO, USA, 7/01 

A link between histone acetylation and histone 

acetylation: The SAS-I complex interacts with 

the chromatin assembly complex CAF-I, 

Jacques Monod Conference on Signaling & 

Control of Transcription, Aussois, France, 6/01 

The acetyltransferase homolog Sas2 in transcriptional 

silencing in Saccharomyces 

cerevisiae, University Center of Molecular Pathology, 

University of Umea, Sweden, 10/00 

ORC and other replication factors in transcriptional 

silencing in S. cerevisiae, 23rd Annual 

Meeting of the German Society of Cell Biology, 

Rostock, Germany, 3/99 

The Origin Recognition Complex, the acetyltransferase 

homolog Sas2 and other replication 

proteins in transcriptional silencing in S. 

cerevisiae, EMBO Workshop, Coupling of 

DNA Replication to Cell Growth, Geilo, Norway, 

6/98 

Teaching 

Grundvorlesung Genetik, WS 01/02 + 02/03, 

1 SWS, Humboldt University Berlin 

Blockpraktikum “Methoden der Hefegenetik”, 

WS 2001/02, WS 2000/01, SS 2000, 

4 SWS, Humboldt University Berlin 

Vorlesung (Hauptstudium) “Molekulare und 

zelluläre Biologie der Hefe Saccharomyces 

cerevisiae”, SS 2001, 2 SWS, Humboldt University 

Berlin 

Vorlesung (Hauptstudium) “Epigenetische 

Mechanismen der Genregulation”, WS 2000/ 

01, 1 SWS, Humboldt University Berlin 


Ann E. Ehrenhofer-Murray, On the mechanisms 

of transcriptional repression in the 

yeast Saccharomyces cerevisiae, Humboldt 

University Berlin, January 2003 

Theses 

Sebastiaan H. Meijsing, The silencing complex 

SAS-I links histone acetylation to the 

assembly of repressed chromatin by CAF-I 

and Asf1 in Saccharomyces cerevisiae, PhD 

Thesis, Humboldt University Berlin, January 

2002, sponsored by the Max-Planck-Society 

Daniela Kasulke, Die Rolle der RENT- 

Komponente Net1 in der HMR Repression der 

Hefe S. cerevisiae, PhD Thesis, Humboldt University 

Berlin, May 2002, sponsored by the 

Max-Planck-Society. 

Stefanie Seitz, Interaktion des centromerischen 

Histon H3-Homologs Cse4 mit der Acetyltransferase 

Sas2 und dem Chromatin Assembly 

Faktor CAF-I aus Saccharomyces cerevisiae, 

Diploma Thesis, Humboldt University 

Berlin, October 2000 

Anya Elstner, Charakterisierung von Chromatin-Assemblierungsfaktoren 

in Saccharomyces 

cerevisiae, Diploma Thesis, Humboldt University 

Berlin, September 2002 

Muna Krings, Interaktionen zwischen Chromatin-Assemblierungsfaktoren 

und Histondeacetylasen 

in S. cerevisiae”, Diploma Thesis, 

Humboldt University Berlin, February 2003 


memberships 

Member of the Deutsche Gesellschaft für 

Genetik 

Member of the Deutsche Gesellschaft für 

Biochemie und Molekularbiologie 

Member of the Genetics Society of America 

Member of the American Association for the 

Advancement of Science 


Characterization of the silent mating-type locus 

HML of S. cerevisiae: Identification of a 

silencer binding factor and of a silencing protein 

that is regulated by N-terminal acetylation 

(DFG EH194/1-1, 1-2, Staff funded: Horst 

Irlbacher, Stefanie Seitz)

Molecular control of skeletal development 

Head: 

Dr. Andrea Vortkamp 

Phone: +49 (0)30-8413 1332 

Fax: +49 (0)30-8413 1130 

Email: vortkamp@molgen.mpg.de 

Scientists: 

Eleonora Minina (until 11/2003) 

Manuela Wülling (since 10/2002) 


Lydia Koziel 

Milana Tchinenkova 

Andreas Ratzka 

Summary 

Technicians: 

Conny Kreschel 

Melanie Kunath 

Sabine Schneider 

Students: 

Theresa Bergann 

Daniela Kosslick 

Franziska Zabel 

The aim of my research is the analysis of the signaling network controlling embryonic 

bone formation. Using mouse mutants and an organ culture system for embryonic limb 

explants we have for the first time integrated three signaling systems, the Ihh/PTHrP, 

BMP and FGF signaling systems, into a common control network. These investigations 

led to a new understanding of the molecular origins of Achondroplasia, which 

results from activated FGF signaling. They furthermore identified the BMP signaling 

pathway as a new target to treat Achondroplasia. 

To understand signal propagation in the growth plate we have started to investigate the 

interaction of Ihh with the extracellular matrix. We found that heparan sulfates sequester 

Ihh signals, strongly indicating that Ihh can act as a long range signal. In addition these 

studies revealed activated Ihh signaling as the likely cause for the development of the 

human ‘Hereditary Multiple Exostoses Syndrome’. We have started to extend our studies 

on signal interactions and signal transport to transcription factors regulating downstream 

gene expression. 



157



158 

Current state of research in the field and significance 

The vertebrate skeleton is a complex organ necessary for the survival and the quality 

of vertebrate life. This is reflected in the large number of inherited disorders characterized 

by malformations of the skeleton. Moreover, age related bone diseases affecting 

for example bone stability (Osteoporosis) or the joint cartilage (Osteoarthrosis), have 

become a new focus of scientific research. The aim of my laboratory is to decipher the 

control mechanisms regulating embryonic bone formation. We hope that such an understanding 

will not only lead to new insight into developmentally derived skeletal 

disorders but will ultimately result in new ways to treat adult bone diseases by reactivating 

the embryonic program in vivo or in stem cell cultures. 

Most of the bones of the skeleton are formed by endochondral ossification, a multistep 

process in which a cartilage skeleton is initially formed, that is later replaced by bone. 

Although endochondral ossification has been extensively studied on a morphological 

level, the various signaling systems regulating this complex process and their interactions 

are just being elucidated. We are concentrating our analysis on the early steps of 

endochondral ossification, when chondrocytes proliferate and differentiate into hypertrophic 

chondrocytes, which are subsequently replaced by bone (Figure 1). As longitudinal 

growth of endochondral bones is dependent on the proliferation and hypertrophic 

differentiation of chondrocytes, the tight regulation of these two steps is crucial 

to balance growth and stability of the bones. 

Figure 1: Endochondral Ossification - mesenchymal cells condense and differentiate into chondrocytes, 

which form cartilage elements, the precursors of the later bones (turquise). The cartilage 

elements are surrounded by a layer of fibroblastic cells, the perichondrium (black). Starting from 

the center of the cartilage anlagen chondrocytes differentiate into a hypertrophic chondrocytes 

(blue). The hypertrophic region is invaded by blood vessels (Red) osteoclast and osteoblasts, which 

start to replace the hypertrophic chondrocytes by bone (red) and bone marrow (red). 

Results 

Interaction of signaling systems controlling chondrocyte differentiation 

My previous work on Ihh has uncovered a first important feedback loop in which Indian 

hedgehog (Ihh) expressed in the differentiating chondrocytes and Parathyroid Hormone 

related Protein (PTHrP) expressed in the periarticular chondrocytes interact to regulate 

the onset of hypertrophic differentiation. To integrate the Ihh/PTHrP signaling system 

with that of other signaling pathways regulating chondrocyte differentiation we have established 

a culture system for embryonic limb explants. This system allows the epistatic 

analysis of different signaling systems by co-treatment of explants with combinations of 

growth factors and by utilizing limbs of various mutants as source for the explants. We 

have for the first time integrated three signaling systems, that of Ihh/PTHrP, FGFs and

BMPs, into a common control network (Figure 2). We demonstrated that BMP and FGF 

signals antagonize each other in regulating at least three distinct steps of chondrocyte 

development. They regulate (1) chondrocyte proliferation independent of the Ihh/PTHrP 

system, (2) the onset of hypertrophic differentiation by acting upstream of the Ihh/PTHrP 

system and (3) the process of hypertrophic differentiation independent of Ihh/PTHrP 

(Minina et al. 2001, 2002). 

These investigations led furthermore to a new 

interpretation of the molecular origin of achondroplasia, 

the most common form of human 

dwarfism, which results from activated FGF 

signaling. In contrast to the established model 

that activated FGF signaling in Achondroplasia 

delays hypertrophic differentiation we could 

demonstrate that it in fact accelerates this process, 

a finding of high importance for the development 

of specific treatment strategies. 

Building on our signaling network we could 

consequently demonstrate that BMP signaling 

rescues the reduced regions of proliferating and 

hypertrophic chondrocytes in a mouse model 

for achondroplasia implicating manipulation 

of the BMP signaling system as a new target to treat Achondroplasia (Minina et al., 2002). 

This work has demonstrated that our explant system provides a unique, powerful tool for dissecting 

the regulation of chondrocyte differentiation. Accordingly, we have started to extend this 

control network by integrating further secreted factors like TGF-ßs, Wnts and others. Preliminary 

results indicate that TGF-ß, like FGFs, accelerate hypertrophic differentiation. In addition 

we have started to explore techniques to introduce siRNA into the organ cultures, a technique, 

which - if successful - will enable us to rapidly analyze the function of newly identified genes 

before generating mouse models. 

Signal propagation in the growth plate 

As described above a large number of growth factors, each produced in a discrete location, 

interact to regulate chondrocyte proliferation and differentiation. To understand how 

these signals relate to one another one must have an understanding of how their respective 

ranges of action are determined. To this end, we have started to investi-gate the role of the 

extracellular matrix (ECM) in Ihh propagation. The glycosyl transferase Ext1 is one of 

the key enzymes for the synthesis of heparan sulfates (HS). Mutations in Ext1 in human 

result in benign bone tumors and short stature (Heritable multiple exostoses’ (HME)). We 

are analyzing a gene trap mouse line carrying a hypomorphic allele of Ext1, which leads 

to reduced HS synthesis. These mice are characterized by delayed hypertrophic differentiation 

of chondrocytes. Analysis of the Ihh/PTHrP system revealed an activation of Ihh 

signaling. Correspondingly, treatment of limbs in culture with heparin restricts Ihh signaling 

in wild type and mutant animals and blocks PTHrP expression. In contrast FGF signaling 

seems to be not affected at the stages analyzed (Koziel, in preparation). 

Several important conclusions can be drawn 

from these experiments: 1) Although the 

Drosphila homolog of Ext1has been shown 

to be necessary for hedgehog transport Ext1 

dependent HS in mice seem to restrict Ihh 

signaling and might thus regulate the establishment 

of an Ihh signaling gradient. 2) In 

contrast to the current model, which predicts 

a secondary mediator, our experiments 

strongly indicate that Ihh travels through the 

growth plate to directly induce PTHrP ex- 

Figure 3: Heparansulfates restrict Ihh signaling. 

pression. Culture experiments, demonstrat- 



Figure 2: Ihh/PTHrP, BMP und FGF signals interact to regulate 

chondrocyte differentiation. 

159



160 

ing that neither of the predicted signals, BMPs or TGF-ßs, can activate PTHrP expression 

in absence of Ihh signaling support this result (Minina et al., 2001; Kreschel, unpublished). 

3) Activated Ihh signaling acting either on neighboring chondrocyte or on the 

flanking perichondium is the most likely cause for the development of exostoses in human. 

These investigations have for the first time addressed the role of the ECM in Ihh 

distribution and have resulted in a new understanding of Ihh acting as a long range signal. 

We are planning to extend these studies to other growth factors that depend on interactions 

with HS. Because of its size the developing bone seems to be a very sensitive model 

to investigate long distance signaling events, and results from such investigations might 

be applicable to other organs. 

Transcription factors acting downstream of Ihh 

To understand how signals regulate gene expression it is necessary to investigate the 

downstream transcription factors. Zinc finger transcription factors of the Gli family, 

like Gli3, act downstream of hedgehog signaling. We have started to analyze the specific 

roles of Gli3, which can act as an activator and repressor, in regulating chondrocyte 

proliferation and differentiation. 

Trich-rhino phalangeal-syndrome affects craniofacial and skeletal development in human. 

During cartilage development the underlying gene Trps1, a GATA zinc finger transcription 

factor is expressed partially overlapping with PTHrP and Ptc. (Kunath et al. 

2002). First analyses of Trps1 null mice indicate a delay in hypertrophic differentiation. 

After a detailed analysis of the Trps-/- phenotype it will be highly interesting to investigate 

a possible interaction of the Ihh signaling system and Trps1. 

Identification of new genes regulating endochondral ossification 

The experiments described above are focused on the analysis of known genes. However, 

we expect that a large number of genes regulating bone development has not been identified 

yet. Using PCR based subtraction approaches we have identified more than 20 genes 

with specific expression patterns in the developing skeletal elements. One of the most 

interesting candidates is highly conserved and exclusively expressed in the developing 

bone. We have started to generate gain and loss of function mutants hoping that these will 

give new insight into how Ihh regulates the ossification process. 

Another gene, PERP, which is expressed overlapping with Ihh, has originally been isolated 

as a target of p53. We found PERP expression overlapping with both, p53 and p63, 

indicating that PERP might act downstream of both genes. Accordingly we found PERP 

expression reduced in the skin p63-/- mice (Lintermann, in preparation). 

Four-jointed (Fj) is a type II transmembrane protein, which is widely expressed in the mouse 

embryo including the central nervous system, joints and tendons (manuscript in preparation). 

We have deleted Fjx in mice but did not detect a phenotype on a 129SvEv background. We are 

therefore planning to reinvestigate the phenotype on a C57B6 background. 

Gene expression profiling 

To be able to analyze gene expression in a broader way we have started to carry out 

complex hybridizations on cDNA chips (Affimetrix). We plan to establish gene expression 

profiles of limb cultures, in which different signaling pathways have been manipulated. 

In addition to isolating new cartilage specific genes, we hope to identify groups of 

genes that react to different signals in similar ways. Recognizing such groups will extend 

the understanding of the signaling network and facilitate the integration of new candidates 

in the future. 

Interaction of positional information and bone differentiation 

From a developmental perspective, a key question that is still poorly addressed is how 

patterning of the skeleton is linked to the process of bone formation. Most differences 

between skeletal elements arise by differential growth after the initial cartilage anlagen 

are laid down. Thus the signals that regulate bone formation are likely points at 

which positional information might act to regulate the shape of the bones. Towards

this end I plan to analyze mouse mutants in which the skeletal anlagen form normally, 

but certain elements fail to develop the proper final bone structure as for example the 

Hox mutant ulnaless. We have started to analyze the specific steps at which bone 

formation is disturbed by gene expression analysis in situ and on chips. Subsequently 

we will try to rescue the phenotypes by manipulating the affected downstream signaling 

systems. 

Goal 

The goal of my laboratory is to identify the network of signaling systems regulating 

embryonic bone formation. I plan to understand the specific function of each of these 

signals and to place them into the context of the control network of genes regulating 

skeletal development. In addition to the interaction of signals we will concentrate our 

studies on the role of the ECM on the distribution of growth factors and on the regulation 

of gene expression by downstream transcription factors. We will further use gene 

expression analysis to identify the majority of genes regulating chondrocyte differentiation 

and to investigate gene regulation in a global way. In the long run we will 

extend these studies to mechanisms translating positional information into a bone pattern. 

The combination of the experimental approaches used should result in an in depth 

understanding of the basic mechanisms of bone formation and ultimately lead to new 

insight into the molecular origins of bone diseases. 



Zhou H, Weskamp G, Chesneau V, Sahin U, 

Vortkamp A, Horiuchi K, Chiusaroli R, Hahn 

R, Wilkes D, Fisher P, Baron R, Manova R, 

Basson CT, Hempstead B & Blobel CP (2003). 

Essential role for ADAM19 in cardiovascular 

morphogenesis. Mol Cell Biol (in press) 

Kunath M, Luedecke H-J & Vortkamp A 

(2002). Expression of Trps1 during mouse embryonic 

development. Mech Dev 119S: 117- 

120. 

Minina E, Kreschel C, Naski MC, Ornitz DM 

& Vortkamp A. (2002). Interaction of FGF, 

Ihh/Pthlh and BMP signaling integrates chondrocyte 

proliferation and hypertrophic differentiation. 

Dev Cell 3: 439-449 

Stricker S, Fundele R, Vortkamp A & 

Mundlos S (2002). Role of Runx genes in 

chondrocyte differentiation. Dev Biol 245: 95- 

108 

Minina E, Wenzel M, Kreschel C, Karp S, 

Gaffield W, McMahon AP & Vortkamp A 

(2001). BMP and Ihh/PTHrP signaling interact 

to coordinate chondrocyte proliferation and 

differentiation. Development 128: 4523-34 

Vortkamp A (2001). Interaction of growth 

factors regulating chondrocyte differentiation 

in the developing embryo. Osteoarthritis and 

Cartilage 9: 109-117 

Shan Z, Nanda I, Wang Y, Schmid M, 

Vortkamp A & Haaf T (2000). Sex-specific 

expression of an evolutionarily conserved male 

regulatory gene, DMRT1, in birds. Cytogenet 

Cell Genet 89: 252-7 

Vortkamp A (2000). The Indian hedgehog- 

PTHrP system in bone development. Ernst 

Schering Res Found Workshop: 191-209 

Pathi S, Rutenberg JB, Johnson RL & 

Vortkamp A (1999). Interaction of Ihh and 

BMP/Noggin signaling during cartilage differentiation. 

Dev Biol 209: 239-53 

Vortkamp A, Pathi S, Peretti GM, Caruso EM, 

Zaleske DJ & Tabin CJ (1998). Recapitulation 

of signals regulating embryonic bone formation 

during postnatal growth and in fracture 

repair. Mech Dev 71: 65-76. 



161



162 

Oral presentations on conferences 


5th EMBL Mouse Molecular Genetics Meeting. 

Heidelberg (2003) 

Gordon Conference: Cartilage Biology and 

Pathology. Ventura, USA (2003) 

1st Wittgenstein Conference. Lucca, Italy 

(2002) 

2nd European Conference on Bone Morphogenetic 

Proteins. Zagreb, Kroatia (2002) 

14th International Congress of Developmental 

Biology. Kyoto, Japan (2001) 

Basic and Applied Research in Skeletal Tissue 

Engineering: Perspectives. Camogli 

Genova, Italy (2001) 

Belgische Vereniging voor Biochimie en 

Moleculaire Biologie. Antwerpen, Belgium 

(2001) 

3. MSD Kolloquium “Seeoner Gespräche”. 

Bad Sarow (2000) 

Deutsche Gesellschaft für Genetik: Genetik 

der Entwicklung. München (1999) 

Sulzer Surlej Meeting on Cartilage Biology. 

Surlej Silvaplana, Switzerland (1999) 

4th International Skeletal Dysplasia Meeting. 

Baden Baden (1999) 

Ernst Schering Research Foundation, Workshop 

29, Of Fish, Fly Worm and Man: Lessons 

from Developmental Biology for Human 

Gene Function and Disease. Berlin 

(1999) 

EMBO workshop on Skeletal Development. 

Heidelberg (1998) 

Molecular Signaling in Development, Cell 

Differentiation and Proliferation. Tokyo, Japan 

(1998) 

Teaching 

Practical course and lecture Biologie für 

Mediziner, Humboldt University Berlin, SS 

2003 (2x3SWS), SS 2001 (2x3SWS), WS 

2000/01 (1x3SWS), SS 2000 (2x3SWS), 

WS 1999/00 (1xSWS) 


Andrea Vortkamp, Molekulare Kontrolle der 

Skelettentwicklung (submitted April 2003) 

Theses 

Eleonora Minina: Interaction von Ihh/Pthlh, 

BMP and FGF signaling in regulating chondrocyte 

proliferation and differentiation. PhD 

Thesis, FU Berlin (February 2002) 

Markus Wenzel: Identifizierung neuer 

Zielgene im Indian-Hedgehog Signalweg, 

PhD Thesis, FU Berlin (March 2003) 

Averhoff, P.: Analyse der Aufgabe von EXT1 

als potentieller Mediator des Hedgehog- 

Signales während der Chondrozytendifferenzierung 

im sich entwickelnden Embryo. 

Diploma Thesis, Freie Universität 

Berlin, 2001 


memberships 

Speaker of the Independent Junior Research 

Groups of the Max Planck Society (since 1999) 

Member of the German Society for Developmental 

Biology 

Member of the International Society for Developmental 

Biology 


Symposium der Selbständigen Nachwuchsgruppen 

• October 14, 1999, Heidelberg 

• October 19, 2000, Berlin 




SKELNET- German Skeletal Dysplasia 

Network (in BMBF Rare diseases program, 

funding since 10/2003) 

Analysis of Ext1 and its potential role in 

propagating Ihh signaling during endochondral 

ossification. (DFG Vo/620-4-1, 

since 2002) 

‘Schwerpunkt Molekulare Dysmorphogenese’ 

Interaction of FGF and Ihh signals 

in regulating chondrocyte differentiation 

during embryonic endochondral 

ossification. (DFG Vo/6-2, 2000-2001) 


Minima et al. featured in: 

Wenn Knochen nicht mehr wachsen, Max 

Planck Forschung aktuell, 2002(4):10-11 

Von Knochen und Knorpeln, Spektrum der 

Wissenschaft 6/2003:22-24


The Ribosome group consists of three groups headed by Richard Brimacombe, Paola 

Fucini, and Knut Nierhaus. Research topics are structure and function of ribosomes 

applying biochemical, cryo-electron-microscopic and crystallographic methods. 

Ribosomal RNA Structure 

Research report 

Head: 

Dr. Richard Brimacombe 

Phone: +49 (0)30-8413 1592 

Fax: +49 (0)30-8413 1690 

Email: brimacombe@molgen.mpg.de 

Scientists: 

Dr. Jutta Rinke-Appel 

Dr. Florian Mueller 

Technicians: 

Klaus von Knoblauch 

Uschi Gruber 

The work of this group has for many years been concerned with the development and 

application of cross-linking techniques as a tool for studying the structure and function 

of bacterial ribosomes. During the late ‘nineties significant advances were made 

in cryo-electron microscopy (cryo-EM), which led to the derivation of 3D structures 

for ribosomes and their subunits at a resolution of 10 – 15 Å. In collaboration with the 

cryo-EM group of Marin van Heel (Imperial College, London) we used our crosslinking 

data, combined with the known secondary structures of the 16S and 23S rRNA 

molecules, to fold the rRNA into three dimensions so as to fit these cryo-EM envelopes. 

The cryo-EM structures could also be used by ribosomal crystallographers to phase 

their crystals, with the result that in the year 2000 crystallographically derived atomic 

structures for the ribosomal subunits became available for the first time. This dramatic 

development obviously had a profound effect on all structural research in the ribosome 

field. In our case we have shifted emphasis so as to study complexes between 

ribosomes and functional ligands which are not so far amenable to crystallography; 

cross-links between the ligand and the ribosome are identified, and – if possible with 

the help of cryo-EM data from similar complexes – are used to dock the ligand onto 

the crystallographic atomic structure of the corresponding ribosomal subunit. 



163

164 


Two such complexes are currently being studied. The first is the ribosomal complex 

formed with 4.5S RNA and the small protein Ffh, which is the prokaryotic equivalent 

of the eukaryotic signal recognition particle (SRP). The SRP recognizes proteins destined 

for export as they emerge newly-synthesized from the ribosome. Here a crystal 

structure has been determined for a fragment of the 4.5S RNA complexed with Ffh, 

A cryo-EM silhouette of the E. coli 50S ribosomal 

subunit, showing two docked positions for 4.5S RNA 

based on cross-linking data. The 4.5S molecule is 

coloured green and magenta, the magenta portion 

corresponding to the crystallized fragment. The docked 

position at lower right corresponds to the Ffh-dependent 

cross-link to 23S rRNA (the Ffh molecule can just be 

seen as the yellow structure behind the subunit), and the 

other position (upper left) to an Ffh-independent crosslink 

to the 30S subunit. The orange structure represents 

elongation factor EF-G (also implicated in interactions 

with 4.5S RNA), and the red loop shows the position of a 

10-nucleotide sequence in 23S rRNA that is identical to 

part of the 4.5S molecule. 

and we were able to precisely identify an Ffh-dependent cross-link between 4.5S RNA 

and the 23S rRNA, which allowed us to dock the 4.5S /Ffh complex onto the 50S 

subunit at the exit site for the nascent protein chain (see Diagram). However, 4.5S 

RNA is suspected of having multiple functions, and we observed a second (Ffh-independent) 

4.5S RNA cross-link at an entirely different location on the ribosome, on the 

shoulder of the 30S subunit; the functional significance of this has yet to be elucidated. 

The second system concerns the “tmRNA”, a molecule which functions both as mRNA 

and tRNA, and which in prokaryotes “rescues” ribosomes that are stalled on a damaged 

mRNA molecule. The secondary structure of the tmRNA has the shape of the 

letter “P”, with the “stalk” of the letter being formed by the tRNA-like portion of the 

molecule, and the “ring” by a complex group of four pseudo-knot structures. Recent 

cryo-EM studies have shown that in the presence of elongation factor EF-Tu and the 

small protein SmpB the tRNA-like part of the tmRNA lies as expected in the subunit 

interface space (in a normal tRNA binding site), whereas the ring of pseudo-knots is 

arranged on the head of the 30S subunit. Our cross-linking studies are currently being 

made in the absece of the protein SmpB and our preliminary results strongly suggest 

that in this inactive state the ring of pseudoknots is arranged in a similar way to that in 

the active state (in the presence of SmpB) but that the whole “stalk” containing the 

tRNA-like portion is swung back onto the solvent side of the 30S subunit. In such a 

position, normal protein synthesis could take place but the tmRNA would be in a “standby” 

state, ready to move into action if needed. 

Many of our cross-linking projects have been and are being carried out in close collaboration 

with the group of Professors Olga Dontsova and Alexey Bogdanov in Moscow 

State University (see sections on “Personnel” and “External funding”). The 

Brimacombe research group will dissolve in mid-2005, when the group leader (RB) 

goes into retirement.


Selected Publications 1998 - 2003 

Choi KM & Brimacombe R (1998). The path 

of the growing peptide chain through the 23S 

rRNA in the 50S ribosomal subunit; a comparative 

cross-linking study with three different 

peptide families. Nucleic Acids Res 26: 

887-895 

Baranov PV, Gurvich OL, Bogdanov AA, 

Brimacombe R & Dontsova OA (1998). New 

features of 23S ribosomal RNA folding: the 

long helix 41-42 makes a “U-turn” inside the 

ribosome. RNA 4: 658-668 

Sergiev P, Dokudovskaya S, Romanova E, 

Topin A, Bogdanov A, Brimacombe R & 

Dontsova O (1998). The environment of 5S 

rRNA in the ribosome: cross-links to the 

GTPase-associated area of the 23S rRNA. 

Nucleic Acids Res 26: 2519-2525 

Osswald M & Brimacombe R (1999). The 

environment of 5S rRNA in the ribosome: 

cross-links to 23S rRNA from sites within helices 

II and III of the 5S molecule. Nucleic Acids 

Res 27: 2283-2290 

Greuer B, Thiede B & Brimacombe R 

(1999). The cross-link from the upstream region 

of mRNA to ribosomal protein S7 is located 

in the C-terminal peptide; experimental 

verification of a prediction from modelling 

studies. RNA 5: 1521-1525 

Mueller F, Sommer I, Baranov P, Matadeen 

R, Stoldt M, Wöhnert J, Görlach M, van Heel 

M & Brimacombe R (2000). The 3D arrangement 

of the 23S and 5S rRNA in the E. 

coli 50S ribosomal subunit based on a 

cryoelectron microscopic reconstruction at 7.5 

Å resolution. J Mol Biol 298: 35-60 

Matadeen R, Sergiev P, Leonov A, Pape T, van 

der Sluis E, Mueller F, Osswald M, von 

Knoblauch K, Brimacombe R, Bogdanov 

A, van Heel M & Dontsova O (2001). Direct 

localization by cryo-electron microscopy of 

secondary structural elements in E. coli 23S 

rRNA which differ from the corresponding 

regions in Haloarcula marismortui. J Mol Biol 

307: 1341-1349 

Sergiev P, Leonov A, Dokudovskaya S, 

Shpanchenko O, Dontsova O, Bogdanov A, 

Rinke-Appel J, Mueller F, Osswald M, von 

Knoblauch K & Brimacombe R (2001). 

Correlating the x-ray structures for halo- and 

thermophilic ribosomal subunits with biochemical 

data for the E. coli ribosome. Cold 

Spring Harbor Symp Quant Biol 66: 87-100 

Rinke-Appel J, Osswald M, von Knoblauch 

K, Mueller F, Brimacombe R, Sergiev P, 

Avdeeva O, Bogdanov A & Dontsova O 

(2002). Cross-linking of 4.5S RNA to the E. 

coli ribosome, in the presence or absence of 

Ffh. RNA 8: 612-625 


Structural and functional investigations of the 

E. coli ribosome at quasi-atomic resolution, 

(DFG, Br 632/5-1;5-2, 2002-2004, 2 scientists) 

Collaboration with Moscow State University/ 

exchange of scientists (DFG, 436 RUS 113/639) 

Study of structure and function of rRNA in the 

ribosome: a new look at the old problem”. 

(Humboldt Foundation, Grant No. IV-3-7122- 

1070296, 2001/2002). 

DAAD: “sur place” stipendia under the 

Leonhard-Euler Programm for five Russian 

students in Moscow, each for nine months, in 

the framework of our collaboration with Moscow 

State University (ref: 325/lin). 

Theses 

Kyoung-Moo Choi, Studies on the path of 

the growing peptide chain through the ribosome, 

PhD Thesis, Freie Universität Berlin, 

1998 (funded by DFG under the special 

programme (Schwerpunktpro-gramm) RNA 

Biochemistry) 

Ingolf Sommer, Interactive and computational 

methods for molecular modelling applied 

to the bacterial ribosome, PhD Thesis, 

Technische Universität Berlin, 1999 (funded 

by DFG under the special programme 

(Schwerpunktprogramm) RNA Biochemistry) 

Visiting scientists 

Regular visitors from Moscow State University : 

Prof. Alexey Bogdanov 

Prof. Olga Dontsova 

Dr. Petr Sergiev 

Dr. Andrej Leonov 

Olga Avdeeva (graduate student) 


memberships 

Member of Editorial or Advisory Board 

for the following Journals: 

• Nucleic Acids Research 

• RNA 

• European Journal of Biochemistry 



165

166 


Ribosome crystallography 

Head: 

Dr. Paola Fucini (since 6/02) 

Dr. Francois Franceschi (until 6/02) 

Phone: +49 (0)30-8413 1691 

Fax: +49 (0)30-8413 1690 

Email: fucini@molgen.mpg.de 

Overview & general aim 

Scientists: 

Dr. Daniel Wilson 

Technicians: 

Renate Albrecht 

Jörg Bürger 

Barbara Schmidt 

Uwe Vogel 

The principal aim of the ribosome crystallography group has been for more than 20 years 

the development of suitable techniques for the crystallization of ribosomal particles. The 

steady advancement of this powerful knowledge, initially started to reap its reward three 

years ago (1-3), under the leadership of Dr. Francois Franceschi, with the breath-taking 

atomic structures of the small ribosomal subunit from Thermus thermophilus (4) and 

large ribosomal subunit from Deinococcus radiodurans (5). Both structures, resulting 

from ribosomes and crystals prepared in the group of Berlin, were solved in collaboration 

with the group of Prof. Ada Yonath, at the MPG für strukturelle Molekularbiologie in 

Hamburg and Weizmann Institute in Israel. In addition to the collaborative Berlin-Hamburg 

unit, only three other groups worldwide have made such major contributions to 

ribosome studies using the same crystallographic approach. 

Atomic structures of the ribosomal subunits have been a revolutionary milestone in our 

understanding of the translational apparatus, initiating a new era in comprehension of the 

key activities associated with each ribosomal subunit: the decoding process, peptide-bond 

formation and factor-mediated translation regulation. In this respect, the crystallography 

group of Berlin, has mainly concentrated its research activity on the mode of binding and 

action of various antibiotics; from those targeting the large subunit (6), such as the clinically 

relevant macrolides (7), as well as puromycins and sparsomycins (8); to those that 

bind the small subunit, such as aminoglycosides, tetracyclines, pactamycin and edeine. 

The results obtained have shed light on the mechanism of action of these drugs and because 

of their importance in the pharmaceutical field have resulted in at least one patent, 

stipulated with the help of Garching Innovation and YEDA (the corresponding Institution 

for Ada Yonath’s group in Israel). 

After the departure of Dr Francois Franceschi in June 2002, the ribosome crystallography 

group has continued its research activity under the leadership of Dr. Paola Fucini, with 

invaluable assistance from Dr. Daniel Wilson, an experienced postdoc who entered the

group during the same period. In addition to continuing the antibiotic studies in collaboration 

with Prof. Yonath (9), a number of new projects were undertaken. These studies 

mainly focus on the next awaited breakthrough of the ribosome field: Crystallization of 

the complete 70S ribosome alone and in functional complexes, among which, in particular, 

the study of ribosomal particles stalled during the translation of the nascent polypeptide 

chain. The studies are made possible by the stimulating environment and advanced 

technical equipment available in the institute. Whenever possible, these projects are undertaken 

in collaboration with the appropriate expert groups, within or separate from the 

institute, increasing the success and speed of project completion. A more specific description 

of the studies that are in process in the group, and the predicted impact that they will 

have for the scientific community at large, is reported in the following section. 

Status of the scientific achievements obtained 

Crystallization of functional complexes 

Currently, the ribosome crystallography group is in the unique position of being able to reproducibly 

prepare four different types of ribosomal crystals: T. thermophilus 30S, 50S, 70S and 

D. radiodurans 50S subunit. The T. thermophilus 30S subunit and D. radiodurans 50S subunit 

diffract to high resolution and have been used as a platform for the preparation and study of 

novel ribosomal complexes containing small regulatory ligands. The results obtained so far can 

be classified within four distinct research areas: i) The mechanism of peptide-bond formation 

(10), ii) Egression of the newly synthesised polypeptide (11); iii) The regulation of ribosomal 

activity by various protein factors: ribosome modulation factor (RMF), the GTPase Era and 

r-protein S1; iv) Antibiotic inhibition of translation (12). 

The ribosomal tunnel and the newly synthesized nascent chain 

The preparation of ribosomal complexes stalled during the act of translating a polypeptide 

nascent chain that are suitable for crystallography studies, is a project started 

during the post-doctoral studies of Dr. Fucini under the supervision of Prof. Dobson 

and Prof. Robinson (Cambridge). The study has lead to the preparation of particles 

that, as yet not suitable for crystallography, have been successfully analysed by cryoEM, 

in collaboration with the group of Prof. David Stuart (Oxford). The results lead to the 

supposition that the ribosomal tunnel could play an important and active part during 

translation and that its role could depend on the type of protein synthesized. 

The L7/L12 ribosomal stalk 

The L7/L12 stalk, which is a highly dynamic ribosomal element and thus absent from 

the X-ray diffraction maps, is being investigated using NMR, also in collaboration 

with the group of Prof. Dobson. The study has allowed the structure determination of 

the C-terminal domain and the analysis of the dynamic of this essential ribosomal 

protein ON the ribosome thus demonstrating that this technique will also be applicable 

for study of nascent chain ribosomal complexes. 

Characterization of the translational apparatus 

Taking advantage of the advanced technology within the MPI for Molecular Genetics, 

we are collaborating with the mass spectrometry group of Lehrach department (Dr. 

Patrick Giavalisco in Dr. Johan Gobom group), to exhaustively characterize the composition 

of the ‘cloud’ of translational factors that surround the ribosome in vivo. The 

automated MS analysis, of more than 1000 proteins selected from 2D-IEF gels, has so 

far revealed two important aspects: 1) the first detailed investigation into the actual 

composition of the translational apparatus, and 2) the potential to utilize the same 

approach to prepare and analyse other macromolecular complexes. For example, during 

our analysis we have found at least three other macromolecular complexes: the 

degradosome, the chaperone apparatus and in plants, rubisco, the latter of which has 

been crystallized and will be further investigated as a side project. 



167

168 


Future orientation 

The ribosome crystallography group should theoretically terminate its activities in June 

2004, with the retirement of Prof. Ada Yonath. However, a request for the prolongation 

of this group has been submitted to the MPG. In the event that the prolongation 

will be granted, the Berlin group will continue on the research lines delineated over the 

last years, the results obtained have in fact created the ideal basis for the successful 

preparation of new funcional ribosomal complexes suitable for x-ray crystallography. 

The group in addition is ready to extend its activities to also encompass the crystallographic 

analysis side of the projects which will continue unhindered under the leadership 

of Dr. Frank Schluenzen, presently principal crystallographer in the group of Prof 

Yonath. To this end, external funding are being organized through the participation in 

the ‘Ribosome’ FP6 Integrated Project and through pharmaceutical companies which 

have shown their interest to finance long-term projects for the screening and analysis 

of various antibiotics. 



1) Weinstein S, Jahn W, Glotz C, Schlunzen F, 

Levin I, Janell D, Harms J, Kolln I, Hansen 

HA, Gluhmann M, Bennett WS, Bartels H, 

Bashan A, Agmon I, Kessler M, Pioletti M, 

Avila H, Anagnostopoulos K, Peretz M, 

Auerbach T, Franceschi F & Yonath A (1999). 

Metal compounds as tools for the construction 

and the interpretation of medium-resolution 

maps of ribosomal particles. J Struct Biol 

127(2):141-51 

2) Tocilj A, Schlunzen F, Janell D, Gluhmann 

M, Hansen HA, Harms J, Bashan A, Bartels 

H, Agmon I, Franceschi F & Yonath A (1999). 

The small ribosomal subunit from Thermus 

thermophilus at 4.5 A resolution: pattern fittings 

and the identification of a functional site. 

PNAS USA 96(25):14252-7 

3) Bartels H, Gluehmann M, Janell D, 

Schluenzen F, Tocilj A, Bashan A, Levin I, 

Hansen HA, Harms J, Kessler M, Pioletti M, 

Auerbach T, Agmon I, Avila H, Simitsopoulou 

M, Weinstein S, Peretz M, Bennett WS, 

Franceschi F & Yonath A (2000). Targeting 

exposed RNA regions in crystals of the small 

ribosomal subunits at medium resolution. Cell 

Mol Biol 46(5):871-82 

4) Schluenzen F, Tocilj A, Zarivach R, Harms 

J, Gluehmann M, Janell D, Bashan A, Bartels 

H, Agmon I, Franceschi F & Yonath A (2000). 

Structure of functionally activated small ribosomal 

subunit at 3.3 angstroms resolution. Cell 

102(5):615-23 

5) Harms J, Schluenzen F, Zarivach R, Bashan 

A, Gat S, Agmon I, Bartels H, Franceschi F 

& Yonath A (2001). High resolution structure 

of the large ribosomal subunit from a mesophilic 

eubacterium. Cell 107(5):679-88 

6) Schlunzen F, Zarivach R, Harms J, Bashan 

A, Tocilj A, Albrecht R, Yonath A & 

Franceschi F (2001). Structural basis for the 

interaction of antibiotics with the peptidyl 

transferase centre in eubacteria. Nature 

413(6858):814-21 

7) Schlunzen F, Harms JM, Franceschi F, 

Hansen HA, Bartels H, Zarivach R & Yonath 

A (2003). Structural basis for the antibiotic 

activity of ketolides and azalides. Structure 

11(3):329-38 

8) Pioletti M, Schlunzen F, Harms J, Zarivach R, 

Gluhmann M, Avila H, Bashan A, Bartels H, 

Auerbach T, Jacobi C, Hartsch T, Yonath A & 

Franceschi F (2001). Crystal structures of complexes 

of the small ribosomal subunit with tetracycline, 

edeine and IF3. EMBO J 20(8): 1829-39 

9) Bashan A, Agmon I, Zarivach R, Schluenzen 

F, Harms J, Berisio R, Bartels H, Franceschi 

F, Auerbach T, Hansen HA, Kossoy E, Kessler 

M & Yonath A (2003). Structural basis of the 

ribosomal machinery for peptide bond formation, 

translocation, and nascent chain progression. 

Mol Cell 11(1):91-102 

10) Bashan A, Zarivach R, Schluenzen F, 

Agmon I, Harms J, Auerbach T, Baram D, 

Berisio R, Bartels H, Hansen HA, Fucini P, 

Wilson D, Peretz M, Kessler M & Yonath A 

(2003). Ribosomal crystallography: Peptide 

bond formation and its inhibition. Biopolymers 

70(1):19-41

11) Agmon I, Auerbach T, Baram D, Bartels 

H, Bashan A, Berisio R, Fucini P, Hansen HA, 

Harms J, Kessler M, Peretz M, Schluenzen F, 

Yonath A & Zarivach R (2003). On peptide 

bond formation, translocation, nascent protein 

progression and the regulatory properties 

of ribosomes. Eur J Biochem 270(12): 

2543-56 

12) Berisio R, Harms J, Schluenzen F, Zarivach 

R, Hansen HA, Fucini P & Yonath A (2003). 

Structural insight into the antibiotic action of 

telithromycin against resistant mutants. J 

Bacteriol 185(14):4276-9 

Thesis 

M Pioletti, Structure of functional complexes 

of the small ribosomal subunit, PhD 



Analysis of the mode of binding and action 

of a new class of ribosome translation inhibitors, 

collaboration with an American Pharmaceutical 

Company, 1 scientist funded 

Preparation and crystallization of Denococcus 

radiodurans ribosomal particles, 

collaboration with Prof. Ada Yonath, 1 technician 

funded 

Co-operations 

Structure determination of ribosomal complexes 

by X-ray crystallography, with Prof. 

Ada Yonath, MPI für strukturelle Molekularbiologie, 

Hamburg & Weizmann Institute, 

Israel 

NMR structure determination of sub-components 

of the translational apparatus, with 

Prof. Christopher Dobson, Department of 

Chemistry, Cambridge University, UK 

Mass Spectrometry characterization of 

functional ribosome complexes, with Prof. 

Carol Robinson, Department of Chemistry, 

Cambridge University, UK 

Cryo-electron microscopy analysis of Escherichia 

coli nascent chain ribosomal 

complexes, with Prof. David Stuart, Welcome 

Trust Centre for Human Genetics, 

Oxford, UK 

Preparation of some ribosomal ligands used 

for the crystallization of ribosomal complexes, 

with Prof. Yokoyama, RIKEN Genomic Sciences 

Center, Yokohama, Japan 

Cryo-electron microscopy analysis of 

Thermus thermophilus ribosomal complexes, 

with Prof. Christian Spahn, Charite, 

Humboldt University of Berlin 

Mass Spectrometry identification of still unknown 

components of the translational apparatus, 

with Dr. Patrick Giavalisco, AG Klose, 

Institute of Human Genetics, Charité, Humboldt 

University of Berlin 

Biochemical characterization of ribosome 

translational inhibitors, with Dr. George 

Dinos, Laboratory of Biochemistry, University 

of Patras, Greece 

Analysis of the mode of binding and action 

of a new class of ribosome translation 

inhibitors, with an American Pharmaceutical 

Company 

Co-operation within the institute 

Mass Spectrometry characterization of 

modified ribosomal proteins, with Dr. 

Johan Gobom, Dept. Lehrach 



169

170 


Ribosomal Function 

Head: 

Prof. Dr. Knud H. Nierhaus 

Phone: +49 (0)30-8413 1700 

Fax: +49 (0)30-8413 1690 

Email: nierhaus@molgen.mpg.de 

Scientist: 

Dr. Viter Marquez 

Technicians: 

Edda Einfeldt 

Detlev Kamp 

Introduction 


Madina Iskakova 

Yan Qin 

Witold Szaflarski 

Yoshika Teraoka 

Oliver Vesper 


Handan Uenlue 

During the last three decades the group follows three experimental lines that are not 

strictly separated: 

1: 1974 we have developed a method to take apart the large subunit of E. coli ribosomes 

and reassemble them again to fully active particles (total reconstitution). Since then we 

are applying this method to study the role of single ribosomal components for assembly 

and function of the ribosome. 

2: 1980 we detected a third tRNA binding site on E. coli ribosomes, which we could 

confirm subsequently with ribosomes from all three kingdoms (evolutionary domains). 

This third tRNA site was termed E site, which has been accepted by the scientific 

community with the advent of cryo-electron microscopy (cryo-EM) and crystal structures 

where the tRNA in the E site could be visualized. In the last two decades we 

developed and mastered an arsenal of functional assays for ribosome studies with the 

result that functional studies as well as structural analysis of functional complexes 

of the ribosome are in the focus of our work. Accordingly, I will discuss our work 

since 1998 in three sections: (1) reconstitution and function, (2) structural analysis of 

functional complexes, and (3) functional studies.

Reconstitution & function 

The ribosomal protein L2 is one of the universal ribosomal proteins that is - at the same 

time - one of the best conserved proteins. We could demonstrate that without L2 50S 

subunits assemble normally, but cannot form 70S ribosomes with 30S subunits. Mutational 

studies revealed the importance of L2 for tRNA binding to the A and P sites as well 

as for peptide-bond formation. The results can be reconciled with the assumption that L2 

is essential for the formation of a bridge between the subunits, and that this bridge binds 

tRNAs and probably translocates them from A and P to P and E sites, respectively (Diedrich 

et al., 2000). Structural studies are consistent with this interpretation. 

Structural analysis of functional complexes 

Most ribosomal proteins have multiple contacts with the rRNA in situ as demonstrated 

with crystal structures of ribosomes. It therefore prohibitively difficult to extract the 

primary binding site of a ribosomal protein from ribosome crystals, a site that might 

define the entry site of this protein into the process of ribosomal assembly. We developed 

a technique for the identification of the primary binding site (Stelzl et al., 2000) 

and demonstrated its usefulness. 

The first correct tRNA localization was derived from neutron scattering studies 

(Nierhaus et al., 1998, together with the Stuhrmann group at the GKSS, Hamburg), 

where even the correct angle between the tRNAs was determined to 40° as later confirmed 

by cryo-EM and crystal structures. Later, we cooperated with the Frank group 

(Albany, NY), probably the best group for cryo-EM work in translation. The result of 

this fruitful cooperation was a series of seven papers, the main results were: (i) we 

could precisely determine the tRNA positions in A, P and E sites thus leading to the 

first movie showing how the tRNAs are moving through the ribosome during protein 

synthesis (Agrawal et al., 2000). (ii) We demonstrated that a deacylated tRNA is found 

at the hybrid-site P/E under unfavorable buffer conditions, but at the canonical P site 

under in vivo near conditions (Agrawal et al., 1999). This observation represents the 

first evidence that the hybrid-site model is not an appropriate description of the elongation 

cycle, the central functional phase of protein synthesis. (iii) In a collaboration 

with Diane Taylor in Edmonton, Canada, Sean Connell came to my group for three 

years, and he solved one of the two most important mechanisms of resistance against 

tetracycline, an antibiotic widely used in medicine. The resistance is mediated by a 

protein Tet(O) that is a derivative of the elongation factor G and exploits the tricks of 

the elongation factors in order to cause resistance (Connell et al., 2003). Together with 

Spahn in the Frank group we determined the position of Tet(O) on the ribosome (Spahn 

et al., 2001). (iv) The binding of the ternary complex before accommodation of the 

aminoacyl-tRNA into the A site was analyzed by cryo-EM, and a kink in the anticodon 

arm of the L-shaped tRNA was detected that provides an important detail, namely how 

the tRNA anticodon of the incoming ternary complex can contact the codon at the A 

site, a prerequisite for decoding the genetic message (Valle et al., 2002). 

Functional studies 

Phosphorothioated tRNA was used to assess the contact patterns of tRNA in each of 

the three tRNA binding sites A, P and E. The tRNAs were analyzed during the elongation 

cycle, and the most important outcome was that the two tRNAs on the ribosomes 

had strikingly different contact patterns, but which did not change when translocated 

from A and P sites to the P and E sites, respectively. We concluded that the ribosomal 

microenvironment of the tRNAs during the translocation did not change, in other words, 

there seems to be a ribosomal conveyor that binds tightly two tRNAs and carries them 

from A+P to P+E sites (Dabrowski et al., 1998). The corresponding model for the 

elongation cycle, the α−ε model, is at the moment the most appropriate explanation of 

the plethora of observations concerning the ribosomal elongation cycle (Wilson & 



171

172 


Nierhaus, 2003). We further demonstrate with the same technique that codon-anticodon 

interaction is essential for tRNA-30S contacts within the 70S ribosome, in other 

words, codon-anticodon interaction at the P site is sensed by the ribosome and triggers 

tRNA-30S interactions (Schäfer et al., 2002). This observation explains a number of 

features of tRNA binding to ribosomes. 

Norbert Polacek from Andrea Bartas’s group in Vienna analysed in my group features 

of tertiary structure of tRNAs and rRNAs during the elongation cycle. A Pb2+ cleavage 

pattern changed periodically before and after translocation demonstrating for the first 

time a dynamic and mobile role for the 23S rRNA during translocation (Polacek et al., 

2000). 

Finally, the RelA mechanism was dissected, the central factor for the stringent response, 

the most important regulation circle in bacteria. We demonstrated that RelA 

binds with high affinity to idle ribosomes, but as soon as (p)ppGpp is made the affinity 

drops and RelA dissociates and will bind to another idle ribosome (Wendrich et al., 

2002, together with the Marahiel group in Marburg, Germany) . This observation explains 

why one RelA molecule per 200 per ribosomes can synthesize (p)ppGpp at 

levels that accurately reflect the starved ribosome population (Wendrich et al., 2002). 

At the moment we prepare a manuscript describing experiments where we show that 

codon-anticodon interaction is essential for maintaining the reading frame thus giving 

another functional reason for the universal presence of the ribosomal E site. Another 

manuscript is ready for submission that defines the inhibition mechanism of the antibiotics 

edeine and pactamycin and their antagonistic relationship (together with Georg 

Dinos from the Kalpaxis group in Patras, Greece). 

For the last three years in my scientific carrier at the MPI I identified three main topics 

I would like to concentrate on provided continuing support of the MPG for our work: 

1: We would like to extend our experience of the elongation phase to problems of 

termination: (a) which mechanism frees the E site from deacylated tRNA? (b) does 

EF-G translocate the termination factor RRF during termination? 

2: the tmRNA monster binds efficiently to the ribosomal A site if a peptidyl-tRNA is at 

the P site and no intact codon at the A site due to mRNA fragmentation. What are the 

conditions for the efficient binding? 

3: We would like to isolate physiological tRNA fragments that bind to the peptidyl 

transferase center of 50S crystals to answer a number of unresolved questions. We 

also would like to prepare authentic pre- and post-translocational complex to crystallize 

them and to analyze the problem of translocation, one of the most challenging 

problems of ribosomology. This project is a collaboration with the Fucini group. 



Connell SR, Trieber CA, Dinos GP, Einfeldt 

E, Taylor DE & Nierhaus KH (2003). Mechanism 

of Tet(O)-mediated tetracycline resistance. 

EMBO J 22:945-953 

Wilson DN & Nierhaus KH (2003). The Ribosome 

through the looking glass. Angew 

Chem Int Ed Engl 42: 3464-3486 / Das 

Ribosom unter der Lupe. Angew Chem 

115:3586–3610 

Schäfer MA, Tastan AÖ, Patzke S, Blaha 

G, Spahn CMT, Wilson D & Nierhaus KH 

(2002). Codon-anticodon interaction at the P 

site is a prerequisite for tRNA interaction with 

the small ribosomal subunit. J Biol Chem 

277:19095-19105 

Valle M, Sengupta J, Swami NK, Grassocci 

RA, Burkhardt N, Nierhaus KH, Agrawal 

RK & Frank J (2002). Cryo-EM reveals an 

active role for aminoacyl-tRNA in the accommodation 

process. EMBO J 21:3557-3567

Wendrich TM, Blaha G, Wilson DN, Marahiel 

MA & Nierhaus KH (2002). Dissection of 

the mechanism for the stringent factor RelA. 

Mol Cell 10:779-788 

Blaha G & Nierhaus KH (2001). Features 

and functions of the ribosomal E site. In The 

Ribosome. Cold Spring Harbor Symposium 

66, Cold Spring Harbor Laboratory Press, pp. 

135-146 

Spahn CMT, Blaha G, Agrawal RK, Penczek 

P, Grassucci RA, Trieber CA, Connell SR, 

Taylor DE, Nierhaus KH & Frank J (2001). 

Localization of the ribosomal protection protein 

Tet(O) on the ribosome and the mechanism 

of tetracycline resistance. Mol Cell 

7:1037-1045 

Agrawal RK, Spahn CMT, Penczek P, 

Grassucci RA, Nierhaus KH & Frank J 

(2000). Visualization of tRNA movements on 

the Escherichia coli 70S ribosome during the 

elongation cycle. J Cell Biol 150:447-459 

Diedrich G, Spahn CMT, Stelzl U, Schäfer 

MA, Wooten T, Bochkariov DE, Cooperman 

BS, Traut RR & Nierhaus KH (2000). Ribosomal 

protein L2 is involved in the association 

of the ribosomal subunits, tRNA binding 

to A and P sites and peptidyl transfer. EMBO 

J 19:5241-5250 

Polacek N, Patzke S, Nierhaus KH & Barta 

A (2000). Periodic conformational changes 

in rRNA: Monitoring the dynamics of translating 

ribosomes. Mol Cell 6:159-171 

Stelzl U, Spahn CMT & Nierhaus KH 

(2000). Selecting rRNA binding sites for the 

ribosomal proteins L4 and L6 from randomly 

fragmented rRNA: Application of a method 

called SERF. PNAS USA 97:4597-4602 

Agrawal RK, Penczek P, Grassucci RA, 

Burkhardt N, Nierhaus KH & Frank J 

(1999). Effect of buffer conditions on the position 

of tRNA on the 70S ribosome as visualized 

by cyoelectron microscopy. J Biol Chem 

274:8723-8729 

Dabrowski M, Spahn CMT, Schäfer MA, 

Patzke S & Nierhaus KH (1998). Protection 

patterns of tRNAs do not change during 

ribosomal translocation. J Biol Chem 273: 

32793-32800 

Nierhaus KH, Wadzack J, Burkhardt N, 

Jünemann R, Meerwinck W, Willumeit R & 

Stuhrmann HB (1998). Structure of the elongating 

ribosome: Arrangement of the two 

tRNAs before and after translocation. PNAS 

USA 95: 945-950 

Teaching 

Kurs Proteinbiosynthese, 21.2.- 10.3.2000 

(three weeks full-time), Technical University 

of Berlin and Free University of Berlin 

Kurs Proteinbiosynthese, 17.2.- 7.3.2003 

(three weeks full-time), Technical University 

of Berlin and Free University of Berlin 

Theses 

Ullrich Stelzl, In vitro Selektion der RNA- 

Binde-stelle von Proteinen aus statistischen 

RNA-Fragmenten (SERF): Charakterisierung 

neuer rRNa-Protein Wechselwirkungen im Escherichia 

coli Ribosom, PhD Thesis, University 

of Vienna, 1999 

Gregor Blaha, Strukturforschung am Ribosom, 

PhD Thesis, Technical University of Vienna, 

2000 

Viter Marquez, Switching off the Mechanism 

for Maintaining the Ribosomal Reading 

Frame: Translational Regulation of Release 

Factor 2, PhD Thesis, Free University of Berlin, 


Ayse Özlem Tastan, How Lazy are the tRNAs 

on the Ribosome? New Insights for the á-å 

Model, Free University of Berlin, 2003 

Guest scientists 

Pavel Ivanov 

Dr. George Dinos, University of Patras 

Dr. Jean-Hervé Alix, University of Paris, 

France 

Dr. Tetyana Budkevich, University of Kiev 

Dr. Sean Connell, University of Edmonton, 

Canada 

Dr. Daniel Wilson, Newzealand, Humboldt 

Stipendiat 

Dr. Norbert Polacek, University of Vienna, 

Austria 



· 

173

174 

Ribosome Group


There are four miscellaneous research groups at the institute, headed by Erich Lanka, 

Rudi Lurz, Richard Reinhardt, and Enzo Russo. 

Phage & Conjugation Group 

Head: 

Dr. Erich Lanka 

Phone: +49 (0)30-8413 1696 

Fax: +49 (0)30-8413 1130 

Email: lanka@molgen.mpg.de 

Scientists: 

Dr. Günter Ziegelin (DFG/EU) 

Dr. Franca Blaesing (EU/Combinature) 


Sabine Krause (10/96 – 9/99, DFG) 

Ralf Eisenbrandt (10/96 – 9/99, DFG) 

Jan Deneke (7/99 – 6/02, DFG) 

Christian Rabel (12/99 – 11/02, DFG) 

Gunnar Schröder (1/00 – 12/02, DFG) 

Isabel Pasch (1/02 - 6/02, Combinature) 


Renate Kühn (3/98 – 9/98) 

Tobias Reick (12/98 – 9/99) 

Stefan Ehrentraut (4/02 – 4/03) 

Technician: 

Marianne Schlicht 

Guest scientists: 

Dr. A. Marika Grahn (2/99) 

Dr. Ramón Díaz Orejas (10/02 – 12/02) 

Dr. Beth Traxler (9/98) 

Enzymology of bacterial conjugation & bacteriophage & 

plasmid replication 

Two topics were pursued in recent years on both of which we continued working for more than 

two decades. The work started in the former department of Heinz Schuster. Beside our primary 

effort to unravel the enzymology of bacterial conjugation, bacteriophage and plasmid replication 

we have vigorously increased our input towards structural biology. Currently we collaborate 

with two NMR groups and three crystallographer groups. Although these collaborations 

adsorb a good deal of our working power the payback is reasonably good in terms of the number 

of publications (1, 5, 8, 10, 17, 24, 28). Currently, the structure of KorB is being solved as a 

DNA-protein complex to a resolution of 2 Å. The protein is encoded by IncP plasmids exerting 

dual roles as a ParB analogue and a global transcriptional repressor for replication, maintenance 

and conjugative transfer genes. The preparation of a manuscript is in progress describing structural 

properties of a partitioning protein for the first time. 

Horizontal gene transfer and type IV secretion 

In the model system for bacterial conjugation, the broad host range P-type plasmids, we localised 

the 12 plasmid-encoded components of the mating pair formation (Mpf) complex to the cell 

envelope. Hence, the proteins seem to bridge inner and outer membrane in the Gram-negative 

organism E. coli (22). Conjugative junctions were found in between cell envelopes of donor and 



175

176 


Figure 1: Maturation cascade of the RP4 pilin. TrbC, 145 

residues in length, is represented by a bar. Defined sections of 

TrbC are marked: signal peptide (red), core region (yellow), 

trans-membrane helix (olive), carboxy-terminal end (light blue) 

and tetra-peptide, the leaving group (blue). TraF is a RP4encoded 

specialized protease that catalyses the circularization 

of TrbC* by the formation of a new peptide bond between the 

N and C terminus. 

recipient in mating cells in analogy to the F-system 

(26). The nature of these junctions still remains a mystery 

because the components which make up these 

electron dense contact zones of mating cells are unknown. 

One of the major roles of the Mpf complex is 

the assembly and erection of conjugative pili on the 

cell surface. According to current models, pili are 

needed to establish the first contact of the donor to 

the recipient cell. Our work concentrated on the dissection 

of the 12 Mpf components that are essential 

for the maturation process of the pre-pilin. The pilin, 

a ribosome-synthesized protein, consists of a circular 

structure that is formed after several proteolytic steps, 

in the last of which the circularization is catalysed by 

the formation of a new peptide bond. The catalysis is 

due to a novel mechanism exerted by an IncP-encoded 

signal peptidase-like enzyme, that in principle 

resembles the reverse reaction of proteolytic cleavage 

(Figure 1) (13, 14, 21, 30). 

Pilus assembly and substrate secretion (Type IV secretion) are most likely energy consuming 

processes as indicated by three potential NTP hydrolysing enzymes that are present among the 

transfer components. In other words the proteins contain distinct motifs for interaction with 

nucleotides. The prediction proved to be valid for at least one protein class, analogues of the 

VirB11 protein family. These hexameric proteins (24, 25) associated with the cytoplasmic side 

of the inner membrane (22), hydrolyse preferentially ATP (25). Structural analyses suggest that 

they function as chaperons although the specific substrate remains to be discovered (5, 28). The 

two other proteins, a VirB4-like protein and the potential DNA-transporter, a TraG-like protein, 

also called coupling protein, bind NTPs but do not hydrolyse them (4, 6, 15, 23). Both proteins 

may alter their conformation upon binding and release of NTPs, or they might hydrolyse NTPs 

in the presence of other proteins. The challenge now is to continue and extend the dissection of 

Mpf, to put the 12 component system together and define the role of each of the components in 

form of a realistic model. 

Our collaborative efforts also focussed on the discovery of new conjugative transfer systems 

because it became clear that certain questions may only be solved by applying not only one 

system but introducing new ones as well (7, 16, 18, 34). There is still no structure for a relaxase, 

the key component in DNA processing. Thus we are looking for systems with smaller enzymes 

since they may prove as better crystallisation substrates as the ones which have been tried 

already. 

Helicases, primases and protelomerases 

Origin binding (17), DNA strand separation by replicative helicases (3, 8, 19, 27, 35) and the 

telomere resolution reaction in the generation of linear genomes (2, 11, 12, 20) were our topics 

in phage and plasmid replication. Since the replicative hexameric helicase of the broad host 

range plasmid RSF1010 is the smallest known helicase that is independent of a helicase loader 

and its structure is known we use the system for searching and assaying potential inhibitors of 

the DNA strand separation activity (8, 19, 35). Enzymatic trials with a set of polyketide compounds 

are in progress. The analysis of the structure-function relationship of the enzyme re- 

Figure 2: Scheme for N15 telomere resolution. The telomere resolution site telRL (black segment) is 

recognized by TelN (red) sequence specifically. In a concerted action cleavage and covalent bond formation 

yield hairpin ends on the linear DNA molecule.

vealed that the extraordinary stability of the oligomeric subunit arrangement is due to an eyehook 

principle (8). 

A fascinating topic in phage biology is the discovery of the enzyme involved in the generation of 

linear DNA with covalently closed hairpin ends. This topic has a direct connection to the long 

standing continuing interest in the transient formation of covalent protein-DNA linkages similar 

to those we have described previously in relaxases. The enzyme processes a 56-bp palindrome 

that might prove to contain a 14-bp stretch of Z-DNA (Figure 2) (2, 11, 20). 

We look forward to collaborate with the Ultrastrukturnetzwerk (USN) to be set up at the Institute. 

The analysis of some of our structures by cryo electron microscopy is likely to yield additional 

conformations that may not be obtained by crystallization. 

The group produced 35 peer-reviewed publications in the six-year evaluation period, six of 

which are review articles (9, 13, 27, 29, 31, 33). In addition, invitations to the major international 

meetings in the field underline the creative scientific potential of the small group. The work was 

sponsored by the Deutsche Forschungsgemeinschaft and by grants of the European Commission. 

We also have a close connection to a small innovative Biotech company. 

General information 8. Ziegelin G, Niedenzu T, Lurz R, Saenger 

Publications1998 -2003 

1. Dostál L, Khare D, Bok J, Heinemann U, 

Lanka E & Welfle H (2004). RP4 repressor 

binds to the major groove of the operator DNA 

– a Raman study. Biochemistry 43 (in press) 

2. Hertwig S, Klein I, Lurz R, Lanka E & 

Appel B (2003). PY54, a linear plasmid prophage 

of Yersinia enterocolitica with covalently 

closed ends. Mol Microbiol 48: 999-1003 

3. Lemonnier M, Ziegelin G, Reick T, Muños 

Gómez A, Diaz Orejas R & Lanka E (2003). 

Bacteriophage P1 Ban protein is a hexameric 

DNA helicase that interacts with and substitutes 

for Escherichia coli DnaB. Nucleic Acids 

Res 31: 3918-3928 

4. Rabel Ch, Grahn M, Lurz R & Lanka E 

(2003). The VirB4 family of proposed traffic 

NTPases: common motifs in plasmid RP4 

TrbE protein are essential for conjugation and 

phage adsorption. J Bacteriol 185: 1045-1058 

5. Savvides SN, Yeo H-J, Beck MR, Blaesing 

F, Lurz R, Lanka E, Buhrdorf R, Fischer W, 

Haas R & Waksman G (2003). VirB11 AT- 

Pases are dynamic hexameric assemblies: new 

insights into bacterial type IV secretion. EMBO 

J 22:1969-1980 

6. Schröder G & Lanka E (2003). TraG-like 

proteins of type IV secretion systems: functional 

dissection of multiple activities of TraG (RP4) 

and TrwB (R388). J Bacteriol 185: 4371-4381 

7. Strauch E, Goelz G, Knabner D, Konietzny 

A, Lanka E & Appel B (2003). A cryptic plasmid 

of Yersinia enterocolitica encodes a conjugative 

transfer system related to regions of 

CloDF13 Mob and IncX Pil. Microbiology 

149:2829-2845 

W & Lanka E (2003). Hexameric RSF1010 

helicase RepA: alanine-scan of single amino 

acid residues proposed to play key roles in the 

pro-tein’s function. Nucleic Acids Res 31:5917- 

5929 

9. Baron C, O’Callaghan D & Lanka E 

(2002). Bacterial secrets to secretion: 

EuroConference on the biology of type IV secretion. 

Mol Microbiol 43: 1359-1365 

10. Delbrück H, Ziegelin G, Lanka E & 

Heinemann U (2002). A SH3-like domain is 

responsible for dimerization of the repressor 

protein KorB encoded by the promiscuous 

IncP plasmid RP4. J Biol Chem 277: 4191- 

4198 

11. Deneke J, Ziegelin G, Lurz R & Lanka 

E (2002). Phage N15 telomere resolution: target 

requirements for recognition and processing 

by the protelomerase. J Biol Chem 277: 

10410-10419 

12. Heinrich J, Schultz J, Bosse M, Ziegelin 

G, Lanka E & Moelling K (2002). Linear 

closed mini DNA generated by the prokaryotic 

cleaving-joining enzyme TelN is functional 

in mammalian cells. J Mol Med 80: 648-654 

(published ONLINE August 28, 2002) 

13. Kalkum M, Eisenbrandt R, Lurz R & 

Lanka E (2002). Tying rings for sex. Trends 

Microbiol 10: 382-387 

14. Lai E-M, Eisenbrandt R, Kalkum M, 

Lanka E & Kado CI (2002). Biogenesis of Tpili 

in Agrobacterium tumefaciens requires 

precise VirB2 propilin cleavage and cyclization. 

J Bacteriol 184: 327-330 



177

178 


15. Schröder G, Krause S, Traxler B, Zechner 

EL, Lurz R, Yeo H-J, Waksman G & Lanka 

E (2002). TraG-like proteins of DNA transfer 

systems and of the Helicobacter pylori type IV 

secretion system: the inner membrane gate for 

exported substrates? J Bacteriol 184:2767-79 

16. Tauch A, Schneiker S, Selbitschka W, 

Pühler A, van Overbeek LS, Smalla K, Thomas 

CM, Bailey MJ, Forney LJ, Weightman 

A, Ceglowski P, Pembroke T, Tietze E, 

Schröder G, Lanka E & van Elsas JD (2002). 

The complete nucleotide sequence of the cryptic, 

conjugative, broad-host-range plasmid 

pIPO2 isolated from bacteria of the wheat 

rhizosphere. Microbiology 148: 1637-1653 

17. Yeo H-J, Ziegelin G, Korolev S, Calendar 

R, Lanka E & Waksman G (2002). Phage P4 

origin-binding domain structure reveals a 

mechanism for regulation of protein activity 

by homo and heterodimerization of winged 

helix proteins. Mol Microbiol 43: 855-867 

18. Schneiker S, Keller M, Dröge M, Lanka 

E, Pühler A & Selbitschka W (2001). The genetic 

organization and evolution of the broadhost-range 

mercury resistance plasmid 

pSB102 isolated from a microbial population 

residing in the rhizosphere of alfalfa. Nucleic 

Acids Res 29:5169-5181 

19. Xu H, Ziegelin G, Schröder W, Frank J, 

Ayora S, Alonso JC, Lanka E & Saenger W 

(2001). Flavones inhibit the hexameric replicative 

helicase RepA. Nucleic Acids Res 29: 

5058-66 

20. Deneke, J, Ziegelin G, Lurz R & Lanka 

E (2000). The protelomerase of temperate E. 

coli phage N15 has cleaving-joining activity. 

PNAS USA 97:7721-7726 

21. Eisenbrandt R, Kalkum M, Lurz R & 

Lanka E (2000). Maturation of IncP-pilin 

precursors resembles the catalytic dyad-like 

mechanism of leader peptidases. J Bacteriol 

182:6751-6761 

22. Grahn AM, Haase J, Bamford DH & 

Lanka E (2000). Components of the RP4 conjugative 

transfer apparatus form an envelope 

structure bridging inner and outer membranes 

of donor cells: implications for related macromolecule 

transport systems. J Bacteriol 182: 

1564-1574 

23. Hamilton CM, Lee H, Pei-Li L, Cook DM, 

Piper KR, Beck von Bodman S, Lanka E, 

Ream W & Farrand SK (2000). TraG and its 

homologs from pTiC58 and RP4 confer 

relaxosome specificity to the Ti plasmid conjugal 

transfer system. J Bacteriol 182:1541-1548 

24. Krause S, Bárcena M, Pansegrau W, Lurz 

R, Carazo JM & Lanka E (2000). Sequencerelated 

protein export NTPases encoded by 

the conjugative transfer region of RP4 and by 

the cag pathogenicity island of Helicobacter 

pylori share similar hexameric ring structures. 

PNAS USA 97:3067-3072 

25. Krause S, Pansegrau W, Kühn R, de la 

Cruz F & Lanka E (2000). Enzymology of 

type IV macromolecule secretion systems: the 

conjugative transfer regions of plasmids RP4 

and R388 and the cag pathogenicity island of 

Helicobacter pylori encode structurally and 

functionally related NTP-hydrolases. J 

Bacteriol 182:2761-70 

26. Samuels AL, Lanka E & Davies JE 

(2000). Conjugative junctions in RP4-mediated 

mating of E. coli. J Bacteriol 182:2709-15 

27. Waksman G, Lanka E & Carazo JM 

(2000). Helicases as nucleic acid unwinding 

machines. Nature Struct Biol 7:20-22 

28. Yeo, H-J, Savvides S, Herr AB, Lanka E 

& Waksman G (2000). Crystal structure of the 

hexameric traffic ATPase of the Helicobacter 

pylori type IV secretion system. Mol Cell 6: 

1461-1472 

29. Zechner EL, de la Cruz F, Eisenbrandt 

R, Grahn AM, Koraimann G, Lanka E, Muth 

G, Pansegrau W, Thomas CM, Wilkins BM & 

Zatyka M (2000). Conjugative-DNA transfer 

processes. In The Horizontal Gene Spread. 

Thomas CM, ed., Harvard Academic Publishers 

GmbH, Amsterdam, pp. 87-174 

30. Eisenbrandt R, Kalkum M, Lai E-M, 

Lurz R, Kado CI & Lanka E (1999). Conjugative 

pili of IncP plasmids and the Ti plasmid 

T-pilus are composed of cyclic subunits. J Biol 

Chem 274: 22548-22555 

31. Pansegrau W & Lanka E (1999). Genetic 

exchange between microorganisms. In Biology 

of the Prokaryotes, Lengeler JW, Drews 

G & Schlegel HG, eds., Thieme Verlag, Stuttgart-New 

York, pp. 386-415 

32. Ziemienowicz A, Görlich D, Lanka E, 

Hohn B & Rossi L (1999). Import of DNA 

into mammalian nuclei by proteins originating 

from a plant pathogenic bacterium. PNAS 

USA 96: 3729-3733 

33. de la Cruz F & Lanka E (1998). Function 

of the Ti-plasmid Vir proteins: T-complex formation 

and transfer to the plant cell. In The 

Rhizobiaceae, Spaink HP, Kondorosi A & 

Hooykaas PJJ, eds., Kluwer Academic Publishers, 

pp. 281-301

34. Thorsted PB, Macartney DP, Akhtar P, 

Haines AS, Ali N, Davidson P, Stafford T, 

Pocklington M, Pansegrau W, Wilkins BM, 

Lanka E & Thomas CM (1998). Complete 

sequence of the IncPb plasmid R751: implications 

for evolution and organisation of the 

IncP backbone. J Mol Biol 282: 969-990 

35. Scherzinger E, Ziegelin G, Bárcena M, Carazo 

JM, Lurz R & Lanka E (1997). The RepA 

protein of plasmid RSF1010 is a replicative 

DNA helicase. J Biol Chem 272: 30228-37 

Teaching 

Project students of the Freie Universität Berlin, 

the Ernst-Moritz-Arndt-Universität 

Greifswald and the Fachhochschule Lausitz 

Theses 

Christian Rabel: Enzymologie der bakteriellen 

Konjugation: Hydrolysieren Vertreter der 

VirB4-Proteinfamilie während der Pilusbiogenese 

Nukleosid-Triphosphate?, PhD Thesis, 

Technische Universität Berlin, 2003 

Gunnar Schröder: TraG-Like Transporter Proteins 

of Type IV Secretions Systems, PhD Thesis, 

Freie Universiät Berlin 2003 

Jan Deneke: Das Tyrosinintegrase-Analog 

TelN katalysiert die telomere resolution im Bacteriophagen 

N15, PhD Thesis, Freie Universität 

Berlin, 2002 

Susanne Schneiker: Das konjugative Hg- 

Resistenzplasmid pSB102 aus der bakteriellen 

Gemeinschaft der Luzernenrhizosphäre: Isolierung, 

Sequenzierung und Sequenzinterpretation, 

PhD Thesis, Universität Bielefeld, 

2001 (E. Lanka as an external advisor) 

Ralf Eisenbrandt: Macromolecular Export 

Systems, Identification of Conjugative Pilins 

and their Modification, PhD Thesis, Technische 


Markus Kalkum: Massenspektrometrische 

Methoden für die biochemische Proteomforschung: 

Identität, Primärstruktur und Prozessierung 

funktioneller Proteine der bakteriellen 

Konjugation, PhD Thesis, Freie Universität 

Berlin, 1999 (E. Lanka as an external advisor) 

Sabine Krause: Die Transferproteine TraG und 

TrbB des konjugativen Plasmids RP4: Strukturelle 

und funktionelle Gemeinsamkeiten zu 

analogen Proteinen anderer Transportsysteme, 


Stefan Ehrentraut: Spezifische DNA-Bindung 

von TelN erfordert N- und C-terminale Domänen, 

Diploma Thesis, Fachhochschule Lausitz, 

Senftenberg, 2003 

Tobias Reick: Das Ban-Protein des Bakteriophagen 

P1, eine DnaB-ähnliche replikative 

Helikase, Diploma Thesis, TU Berlin, 1999 

Renate Kühn: Gerichtete Mutagenese in der 

Nukleotidbindungsstelle des Genprodukts B 

(TrbB), einer essentiellen Komponente des 

konjugativen Transferapparates des Plasmids 

RP4, Diploma Thesis, TFH Berlin, 1998 

Stefan Ehrentraut: Inhibitoren für die 

konjugative Helikase TraI (R1), Project Thesis, 

Fachhochschule Lausitz, Senftenberg 2001 


EU, BIO4-CT98-0106: Novel Strategies for 

the Design of Helicase Inhibitors , 10/98-9/00 

EU, BIOTECH 970099: MECBAD Mobile 

Elements’ Contribution to Bacterial Adaptability 

and Diversity, 1/98 – 9/01 

EU, QRLT-1999-31624: COINS Discovery of 

a New Class of Bioactive Compounds: Bacterial 

Conjugation Inhibitors, 4/01 – 5/03 

EU, QLRT-1999-30634: DNA REPLICA- 

TION INHIBITORS Replication Initiation 

Proteins as New Targets for Bacterial Growth 

Inhibitors, 9/00 – 8/03 

INTAS, 96-1492: Evolution of Self-Transmissible 

Genetic Elements: Replication Mechanisms 

and Control of Phage-Plasmids N15 and 

P4 , 1/98 – 1/01 

DFG, La 672/3-4: Die Aktivitäten des Replikationsinitiator-Proteins 

des E. coli Satellitenphagen 

P4, 9/99 – 8/01 

DFG, La 672/6-1: DNA-Transfer durch 

bakterielle Konjugation, 1/00 – 12/02 

DFG, La 672/8-1: Replikation linearer Plasmid 

DNA aus Gram-negativen Bakterien, 9/ 

03–8/05 

Industrial co-operation 

Combinature Biopharm AG, Berlin 


The 6th International Workshop on P2, P4 and 

Related Bacteriophages, 23.-26.10.1998, 

Harnack-Haus, Berlin 

Workshop on Helicases as Molecular Motors 

in Nucleic Acid Strand Separation, 20.- 

22.11.1999, Instituto Juan March de Estudios 

e Investigaciones, Madrid, Spain 

MECBAD Workshop on Conjugation Systems 

Viewed as Protein Secretion Pathways, 21.- 

24.5. 2000, Schloß Ringberg 

3rd Symposium of the EU-Concerted Action 

on Mobile Genetic Elements’ Contribution to 

Bacterial Adaptability and Diversity, 21.- 

25.9.2001, Harnack-Haus, Berlin 



179

180 


Microscopy Group 


Head: 

Dr. Rudi Lurz 

Phone: +49 (0)30-8413 1644 

Fax: +49 (0)30-8413 1385 

Email: lurz@molgen.mpg.de 

Technician: 

Gerhild Lüder 

The microscopy group provides a central scientific service unit of the institute. Therefore, we 

collaborate on various subjects with different groups from this institute but also from outside. 

Beside general service support and smaller projects, the main focus of our methods is on: 

• immuno labelling on ultra-thin sections and of isolated structures; 

• nucleic acid - protein interactions; 

• fine structural analysis of oligomeric proteins, organelles or phages after negative staining 

or cryo preparation of the samples in vitreous ice. 

The lab is running two transmission electron microscopes (EM400 and CM100). The CM100 

is designed for cryo work and equipped with a slow scan CCD camera that in addition has 

widely replaced traditional photographic film for routine work. A confocal microscope (Zeiss 

LSM510) for 3D analysis of samples labelled with fluorescent dyes is attended. 

In collaboration with AG Lanka we are analysing different aspects in conjugation and DNA 

replication. Only to mention a few topics: The components of the MPF complex were analysed 

by immuno labelling, structure and binding properties to DNA. Pili of different incompatibility 

groups like IncP, IncW and IncF were visualized after negative staining. Linear plasmids derived 

from Phages N15 or PY54 have covalently closed hairpins at their ends which we have 

demonstrated by showing them denatured as ssDNA rings. The binding site of the telomerase 

was mapped by binding to the DNA. 

The group of E. Wanker (Berlin-Buch) is focused on 

the molecular pathomechanism of Huntington’s disease 

and related illnesses, which are caused by formation 

of insoluble aggregates in neuronal cells. We are 

monitoring by EM the effect of selected drugs on the 

aggregation of huntingtin, α-synuclein or β-amyloid 

fibrils. Proteins formed aggregates in transformed cells 

that were localized on thin sections by immuno-gold 

labelling. 

The bacteriophage SPP1 was investigated by T. A. 

Trautner for many years in our institute. We are still 

co-operating in different aspects of the morphogen-

esis and DNA packaging of this phage with two former members of his group (P. Tavares, Paris; 

J.C. Alonso, Madrid). One project was the structure of the head to tail interface at one vertex of 

the phage capsid. The main protein of this connector structure is the portal (gp6) which has a 

13fold symmetry in solution but is 12fold in the phage. We have solved the 3D-structures of the 

portal protein and the connector (see figure) from negatively stained and from in vitrified ice 

embedded samples in collaboration with M. van Heel’s group (FHI in Berlin, now London). 

Determining the 3D structure of complex biological structures by cryo EM and image processing 

will be the main focus for the next years. The UltraStrukturNetzwerk (USN) has started end 

of last year. First work has already started but at the time the main focus this year is in planning 

and organizing the setup and facilities for the new cryo EM. 



Jensen, RB, Lurz R & Gerdes K (1998). 

Mechanism of DNA seggregation in prokaryotes: 

Replicon pairing by parC of plasmid R1. 

PNAS USA 95:8550-8555 

Deneke J, Ziegelin G, Lurz R & Lanka E 

(2000). The protelomerase of temperate Escherichia 

coli phage N15 has cleaving-joining 

activity. PNAS USA 97: 7721-7726 

Friedhoff P, Lurz R, Lueder G & Pingoud A 

(2001). Sau3AI, a monomeric type II restriction 

endonuclease that dimerizes on the DNA 

and thereby induces DNA loops. J Biol Chem 

276:23581-88 

Lurz R, Orlova E, Günther D, Dube P, Dröge 

A, Weise F, van Heel M & Tavares P (2001). 

Structural organisation of the head-to-tail inter-face 

of a bacterial virus. J Mol Biol 

310:1027-37 

Sittler A, Lurz R, Lueder G, Priller J, Lehrach 

H, Hayer-Hartl MK, Hartl FU & Wanker 

EE (2001). Geldanamycin activates a heat 

shock response and inhibits huntingtin aggregation 

in a cell culture model of Huntington’s 

disease. Hum Mol Genet 10: 1307-1315 

Waelter S, Boeddrich A, Lurz R, Scherzinger 

E, Lueder G, Lehrach H & Wanker EE 

(2001). Accumulation of mutant huntingtin 

fragments in aggresomes-like inclusion bodies 

as a result of insufficient protein degradation. 

Mol Biol of the Cell 12:1393-1407 

Deneke J, Ziegelin G, Lurz R & Lanka E 

(2002). Phage N15 telomere resolution. Target 

requirements for recognition and processing 

by the protelomerase. J Biol Chem 277: 

10410-19 

Kalkum M, Eisenbrandt R, Lurz R & 

Lanka E (2002). Tying rings for sex. Trends 

in Microbiol 10:382-387 

Hertwig S, Klein I, Lurz R, Lanka E & Appel 

B (2003). PY54, a linear plasmid prophage of 

Yersinia enterocolitica with covalently closed 

ends. Mol Microbiol 48:989-1003 

Orlova E, Gowen B, Dröge A, Stiege AC, 

Weise F, Lurz R, van Heel M & Tavares P 

(2003). Structure of a viral DNA gatekeeper 

at 10 Å resolution by cryo-electron microscopy. 

J Mol Biol 22:1255-1262 

Pingoud V, Conzelmann C, Kinzebach S, 

Sudina A, Metelev V, Kubareva E, Bujnicki 

JM, Lurz R, Lüder G, Xu S-Y & Pingoud A 

(2003). PspGI, a type II restriction endonuclease 

from the extreme thermophile 

Pyrococcus sp.: structural and functional studies 

to investigate an evolutionary relationship 

with several mesophilic restriction enzymes. J 

Mol Biol 329:913-929 

Co-operations 

Traditionally electron microscopists co-operate 

with different groups. Many of our co-operations 

started within this institute and were 

continued when the scientists moved to new 

positions. At the time we are working on 

projects with following external groups: 

1. Alonso JC, CSIC, Madrid, Spain 

2. Carazo JM, CNB, Madrid, Spain 

3. Orlova EV, Birkbeck College, 

London, UK 

4. Pingoud A, Justus Liebig University, 

Giessen 

5. Reeve JN, Ohio State University, 

Columbus, USA 

6. Surayanarayana T, University of 

Hyderabad, India 

7. Tavares P, CNRS, GIF-sur-Yvette, 

France 

8. Weinhold E, RWTH Aachen 



181

182 


High Throughput Technology (htpt) Group 

Head: 

Dr. Richard Reinhardt 

Phone: +49 (0)30-8413 1226 

Fax: +49 (0)30-8413 1365 

Email: reinhardt@molgen.mpg.de 

Secretary: 

Tamara Safari 

Phone: +49 (0)30-8413 1126 

Fax: +49 (0)30-8413 1365 

Email: safari@molgen.mpg.de 


Scientists: 

Carola Burgtorf 

Michael Kube 

Giannino Patone 

Sascha Sauer 


Heiner Kuhl 

Technicians/TFH: 

Stephen Gelling 

Verena Gimmel 

Thomas Honeck 

Oliver Rüffer 

Ilka Slosarek (part-time) 

Anett Smyra 

Gregor Wozniak 

Technicians: 

Beatrice Baumann 

Gabriele Bläß (part-time) 

Susan Böhm 

Christin Bunk 

Daniela Gröger 

Pamela Kepper 

Ines Müller 

Ines Pickersgill 

Mario Sontag 

Janina Thiel 

The recent publication of the completed human genome sequence was the ultimate success 

of our major effort within the last 6 years period. Important steps on this successful 

way are also the sequencing and final analysis of chromosome 21, the second finished 

human chromosome, still one of the most accurately analysed one, and our contribution to 

several regions of the human chromosomes 1, 3, 17, and X. Our latest finalised project 

along this line is the completed elucidation of chimpanzee chromosome 22, the ortholog 

to human chromosome 21. The whole project was organised by an German-Asian consortium, 

wherein MPIMG was responsible for the German part. These results, being presently 

summarised, are not only important because chimpanzee is our closest relative, it is 

the first time that a large genomic arrangement, two complete chromosomes of man and 

chimpanzee, are comparatively analysed. Therefore, not only genes and variations within 

the coding elements are comparable, but also intronic regions and even more important, 

promoter elements are accessible for any comparative analysis and elucidation. 

In addition, we are involved in the analysis of model organisms such as mouse (chromosome 

2 and 6), rhesus MHC and the complete analysis of the rat MHC (RT1) complex, 

which plays an important role in infectious diseases. The MHC region belongs to 

the most densely packed, gene rich regions and although it spans only over a 4 Mbases 

area, we have identified 220 genes, nearly as many as in the human chromosome 21 

region, which is about 34 Mbases large.

Other launched projects concern contributions to the final sequence of chimpanzee 

chromosomes X and Y, with special interest to Xq28 and regions associated with mental 

retardation. We are also involved in national and international projects, from bacterial 

genomes to model organisms (Michael Kube) like the urochordate Oikopleura, as 

listed below (project grants and MPG projects). 

The early scientific interest related to Oikopleura 

dioica was focused on questions 

of systematics, the phenomenon of “marine 

snow” and of bioluminousity, research 

in Oikopleura´s nervous system, and ecological 

questions, like the influence on 

picoplancton. With a genome size of only 

around 75 Mbases (estimated number of 

15.000 genes), smaller than C. elegans, 

and less than half that of D. melanogaster, 

the genome of Oikopleura dioica gives the 

chance for a closer look inside an early 

chordate genome. In addition, this organism 

has also other interesting features, 

making it a key system to understand the 

functions of human/ vertebrate genome. 

Oikopleura in its house (E. Thompson, Norway) 

Today we have a good molecular base for completing the genome sequence, as our 

norwegian partners at SARS established a culture line for Oikopleura. More than 170’000 

reads from a whole genome shotgun were assembled into 45’000 contigs with a total 

contig length of more than 41Mb at Berlin. These sequences cover more than half of the 

genome. The sequencing of more than 50 selected BACs from a BAC library, covering 

the whole genome 10fold are finalized or near finished status. The determination of all 

BAC-end-sequences, nearly 10.000 BACs, is in progress and will be finished about the 

end of year 2003. 

The htpt-group (which is completely externally funded, except for 30% of RR and 

TS) is also a co-operation partner for all departments within the institute and has established 

a good infrastructure for large-scale genomic analysis projects such as sequencing, 

mutation analysis and mass spectrometry. In addition, we are also managing several 

projects for disease gene identification and systematic re-sequencing of candidate 

genes or genomic regions of interest (http://www.resequencing.mpg.de/ ). Finished 

genomic sequence data are submitted to public data bases and presented on our project 

Web pages. 

Furthermore our work (Sascha Sauer) is focused on technology development for detection 

of DNA variations and protein-ligand interaction by mass spectrometry. Sample preparation 

methods for genotyping of SNPs by MALDI-MS, termed GOOD assays, were 

modified to significantly reduce costs and adapted to our automated liquid handling. With 

the current equipment at MPIMG we could maintain a routine throughput of ca. 10,000 

genotypes per day. Moreover, a novel approach for molecular haplotyping (haplotypes 

are the phase of several marker alleles on a single chromosome) by means of pooled 

fosmid/cosmid libraries and seamless analysis by mass spectrometry was elaborated. Due 

to our recent adoption of photocleavable linker and charge-tag technology we are able to 

make use of the multichannel detection capa-bility of mass spectrometers and apply this 

approach for a novel, parallel oligonucleotide fingerprinting approach (ONF) by MALDI- 

MS to provide pre-selection of cDNA and shotgun clones from large libraries. 

We will focus on HT-genotyping in collaboration with NGFN and Génoplante and will 

develop procedures for DNA analysis with partners as the Centre National de Génotypage 

and Bruker Daltonik. An issue of prior importance, to detect binding of ligands (natural or 

chemical compounds) with proteins, is soft ionisation of non-covalent interactions by 

ESI-MS (together with Protein Structure Factory and Analyticon Discovery). 



183

184 




Glöckner FO, Kube M, Bauer M, Teeling H, 

Lombardot T, Ludwig W, Gade D, Beck A, 

Rabus R, Schlesner H, Amann R & Reinhardt 

R (2003). Complete genome sequence of the 

marine planctomycete Pirellula sp. strain 1. 

PNAS 100(14): 8298 – 8303 

Olbrich H, Fliegauf M, Hoefele J, Kispert A, 

Otto E, Volz A, Wolf MT, Sasmaz G, Trauer U, 

Reinhardt R, Sudbrak R, Antignac C, Gretz 

N, Walz G, Schermer B, Benzing T, Hildebrandt 

F & Omran H (2003). Mutations in a novel gene, 

NPHP3, cause adolescent nephronophthisis, 

tapeto-retinal degeneration and hepatic 

fibriosis. Nature Genetics 34:455-459 

Sauer S, Lehrach H & Reinhardt R (2003). 

MALDI mass spectrometry analysis of single 

nucleotide polymorphisms by photocleavage 

and charge-tagging. Nucleic Acids Res 31: e63 

Olbrich H, Häffner K, Kispert A, Völkel A, Volz 

A, Sasmaz G, Reinhardt R, Hennig S, Lehrach 

H, Konietzko N, Zariwala M, Noone PG, 

Knowles M, Mitchison HM, Meeks M, Chung 

EMK, Hildebrandt F, Sudbrak R & Omran H 

(2002). Mutations in DNAH5 cause primary 

ciliary dyskinesia and randomization of leftright 

asymmetry. Nature Genetics 30:143–144 

The Schizosaccharomyces pombe sequencing 

consortium (MPI contributors: Borzym K, 

Langer I, Beck A, Lehrach H & Reinhardt 

R) (2002). The genome sequence of Schizosaccharomyces 

pombe. Nature 415:871–880 

Seo HC, Kube M, Edvardsen RB, Jensen MF, 

Beck A, Spriet E, Gorsky G, Thompson EM, 

Lehrach H, Reinhardt R & Chourrout D 

(2001). Miniature Genome in the Marine 

Chordate Oikopleura dioica. Science 

294:2506 

The International Human Genome Mapping 

Consortium (MPI contributors: Ramser J, 

Reinhardt R & Lehrach H) (2001). A physical 

map of the human genome. Nature 

409(6822):934-941 

The International Human Genome Sequencing 

Consortium (MPI contributors: Ramser 

J, Lehrach H & Reinhardt R) (2001). Initial 

sequencing and analysis of the human genome. 

Nature 409:860-921 

Paulsen M, El-Maarri O, Engemann S, 

Strodicke M, Franck O, Davies K, Reinhardt 

R, Reik W & Walter J (2000). Sequence 

conservation and variability of imprinting in 

the Beckwith-Wiedemann syndrome gene cluster 

in human and mouse. Hum Mol Genetics 

9(12):1829-1841 

The chromosome 21 consortium (MPI contributers: 

Ramser J, Beck A, Klages S, 

Hennig S, Riesselmann L, Dagand E, Haaf 

T, Wehrmeyer S, Borzym K, Francis F, 

Lehrach H, Reinhardt R & Yaspo ML) 

(2000). The DNA sequence of human chromosome 

21. Nature 405(6784):311-319 

Duitman EH, Hamoen LW, Rembold M, 

Venema G, Seitz H, Saenger W, Bernhard F, 

Reinhardt R, Schmidt M, Ullrich C, Stein T, 

Leenders E & Vater J (1999). The mycosubtilin 

synthetase of Bacillus subtilis ATCC6633: A 

multifunctional hybrid between a peptide synthetase, 

an amino transferase, and a fatty acid 

synthase. PNAS USA 96(23):13294 – 13299 

Radelof U, Hennig S, Seranski P, Steinfath 

M, Ramser J, Reinhardt R, Poustka A, 

Francis F & Lehrach H (1998). Preselection 

of shotgun clones by oligonucleotide fingerprinting: 

an efficient and high throughput 

strategy to reduce redundancy in large-scale 

sequencing projects. Nucl Acids Res 26(23): 

5358-5364 

Theses 

Michael Kube, Sequenzierung und Struktur 

von Pirellula sp. Stamm 1, PhD Thesis, University 

of Bremen, 7/2003 

Heiner Kuhl, Multiplex PCR Screening einer 

genomischen BAC Library des Organismus 

Oikopleura dioica zur Identifikation von mHC 

verwandten Genen, Students Thesis, Technical 

University of Berlin, 11/2001 


EU BIO4-CT 96-0159: European schizosaccharomyces 

genome sequencing project, 12/ 

1996-12/2000 

BMBF 01KW97065: Genomic sequence 

analysis of human chromosome 21 and selected 

regions of the human genome, 5/1997 - 

6/2001 

EU BIO-98-0079: European Leishmania 

major Friedlin genome sequencing project, 12/ 

1998 – 11/2001 

BMBF 03F0279C: Funktionelle Genomanalyse 

umweltrelevanter mariner Bakterien, 

4/2000 – 3/2002 

Magnanomed EU CT00-00375: Magnetic 

nanoparticles for medical and biological diagnostics 

and devices, 1/2001 – 4/2003 

BMBF 01KW0001: Disease gene-oriented 

genomic sequence analysis of medically important 

regions of the human genome and homologous 

regions of the mouse genome, 1/01 – 6/04

BMBF 01GR0105, Plattform 1.1: NGFN Core 

Area Genomic sequencing and mapping, 3/ 

2001 – 10/2004 

BMBF 01GR0105, Plattform 6.2: NGFN Core 

Area Wave-technology, 3/2001 – 10/2004 

BMBF 01GR0105, Plattform 6.8.2: NGFN 

Core Area Comparative candidate gene sequencing, 

6/2002 – 06/2004 

BMBF Uni Göttingen 031U113A / U213A: 

Netzwerk GenoMik Göttingen, Genomanalyse 

noch nicht kultivierter mariner und terrestrischer 

methanoxidierender Mikroorganismen 

und Konsortien, 7/2001 – 6/2004 

Joint projects with the MPI for Marine 

Microbiology, Bremen 

Pirellula, 7,15 Mbases, finished, cosmid 

verfication 

EBN1, ca. 4,8 Mbases, finishing 

Magnetospirillum, ca. 4,5 Mbases, finishing 

Five other bacterial projects of similar size are 

curently in data collection or data assembling 

status (GhdN, HxN, MxyN, ToN1 and Pcy) 

(2001-2002). 

Oikopleura (joint project between MPG & 

SARS Bergen), ca. 75 Mbases, working draft 

BAC-ends 

Patents 

Kalkum M, Müller M, Nordhoff E, Reinhardt 

R, Eickhoff H, Rauth H. Method and Device 

for processing extremely small substance 

quantities, PCT/EP99/02964 / Verfahren und 

Vorrichtung zum Prozessieren von Kleinstsubstanzmengen, 

DE 198 23 719 A1 

Rauth H, Reinhardt R, Nordhoff E. Verfahren 

zum Anbinden von Nukleinsäuren an eine 

Festphase. PCT/EP00/08807, DE, EU, US 

Rauth H, Reinhardt R, Nordhoff E. Verfahren 

zur Umkehrphasenaufreinigung und -konzentrierung 

von Peptiden und Proteinen an 

magnetischen Partikeln. PCT Nr. 60/175,958 

Rauth H, Reinhardt R, Starke A. Verfahren und 

Vorrichtung zur Gelelektrophorese. DE 199 

26 985.8 

Selected academic co-operations 

Varies bacterial genomic and metagenomic 

projects, with MPI for Marine Microbiology, 

Bremen 

German-Deep Phylogeny-Consortium, with 

Prof. J. W. Waegele, Ruhr-University, Bochum 

Development of tailored magn. nanoparticles, 

with Prof. H. Hofmann, EPFL-Laboratoire de 

Technologie des Poudres, CH-Lausanne 

NoE Marine Genomics consortium (member 

of scientific steering committee) 

MolTools Consortium (IP of EU 6th framework) 

SNP-technology, with Centre National de 

Génotypage 

Selected industrial co-operations 

Bruker Daltonik, Bremen and Leipzig 

micromod Partikeltechnologie GmbH, 

Rostock 


Chimpanzee Chromosome 22 consortium 

meeting, Harnack-Haus, Berlin-Dahlem, 16.- 

17.7.2002 

MAGNANOMED exploitation workshop and 

satellite meetings, Harnack-Haus, Berlin- 

Dahlem, 3.- 5.12.2002 



185

186 


Analysis of Protein Evolution Group 

Head: 

Dr. Vincenzo E. A. Russo 

Phone: +49 (0)30-8413 1264 

Fax: +49 (0)30-8413 1394 

Email: russo@molgen.mpg.de 

Scientist: 

Yean-Su Lee (until 1/98) 

Technician: 

Uta Marchfelder (until 6/01) 

About the tree of life 

My work until June 2001 was mainly concerned with the moss Physcomitrella patens 

where we found, for the first time in a land plant, a way to obtain high homologous 

recombination. Since July 2001 I have been working alone on a fascinating problem of 

theoretical biology, the Tree of Life. 

Charles Darwin was the first to suggest that all living organisms are descended from 

one common ancestor (“The origin of the Species”, 1859). The exponential growth of 

the number of completely sequenced genomes, today 140 Bacteria/Archaea and 13 

Eukarya (and these numbers probably will double in the next year), provided a great 

hope to realize the dream of Darwin, namely to identify LUCA (Last Common Cellular 

Ancestor). Until now, however, there is little consensus regarding LUCA except 

that it was living circa 3.4-3.8 billions years ago. 

1) Russell Doolittle et al. (Determining divergence times of the major Kingdoms of 

living organisms with a protein clock (1996), Science 271:470-477) suggested that 

LUCA was a Eubacterium. 

2) William Martin (Mosaic bacterial chromosomes: a challenge en route to a tree of 

genomes (1999), BioAssays 21:99-104) draws a Tree of Life which has two roots: the 

Eubacteria and the Archaeabacteria. The Eukaryotes are then a complicated mixture of 

the two Kingdoms. 

3) Forterre and Philippe (Where is the root of the universal tree of life? (1999), 

BioAssays 21:871-879) argue that the very first cell was a Eukaryote. 

4) Woese (On the evolution of cells (2002), PNAS 99:8742-8747) states that “Extant life 

on Earth is descendent not from one, but from three distinctly different cell types. However, 

the designs of the three have developed and matured in a communal fashion”. 

Despite these models and a plethora of phylogenetic trees and bioinformatic analysis 

published to date, there is no detailed information on the evolution of proteins in well 

known biosynthetic pathways. Without this information I believe that it will be not 

possible to fully understand evolution. 

Making the bold assumption that Homo sapiens is at the top of the evolutionary tree, I 

asked if the human proteins of important cellular pathways (transcription, translation,

DNA synthesis, lipid biosynthesis, glycolysis, biosynthesis of amino acid, purines, pyrimidines) 

are more similar to the equivalent of Eubacteria, or of Archaea, or equal similar 

to both, or have no counterpart in Prokaryotes. 

The technique I have employed is simple: I blasted each of the 281 human proteins involved 

in these pathways, on one hand against the proteins data base and on the other 

hand against the genomic sequences of the completely sequenced Eubacteria and Archaea 

genomes (both kind of databases at NCBI in Washington). 

Preliminary data are summarized in table 1. It is immediately apparent that different proteins 

have different origins, however it is not a random process, but seems to follow a 

pattern, suggesting a logical choice in evolution. 

The eukaryotic genome was shown already to have a mosaic structure (Horiike T. et al. (2001), 

Origin of eukaryotic cell nuclei by symbiosis of Archaea in Bacteria is revealed by homologyhit 

analysis, Nature Cell Biology 3:210-214). In this paper there is also a table where thousands 

of eukaryotic genes (S. cerevisiae) in 43 pathways were classified as of Archaea or of Eubacteria 

origin. However this table is often misleading, as I will show below with one example: 

Under amino-acid metabolism all the 201 proteins considered to be in this pathway are reported 

to be of Eubacteria origin. In contrast, my table shows that only 7 out 16 of the enzymes analyzed 

are of Eubacteria origin while 7 are of Archaea AND Eubacteria origin (common origin), 

and for two is difficult to make a decision. Two examples out of those 7 proteins of common 

origin: 

a) The human 3-phosphoglycerate dehydrogenase, an enzyme of the serine biosynthetic 

pathway, has 533 amino acids; the sequence of this protein blasted against all Archaea proteins 

show 43% identity (ID) with a M. jannashii protein, 524 amino acids (aa) long, over 447 aa, 

45% ID with a M. acetivorans protein (523 aa) over 405 amino acids and 41% ID with a A. 

fulgidus protein (527 aa) over 401 amino acids; blasted against all Eubacteria proteins show a 

43% ID with a M. loti protein (533 aa) over 399 aa, 42% ID with a B. subtilis protein (525 aa) 

over 416 aa and 42% ID with a B. melitensis protein (538 aa) over 400 aa. 

b) The human serine hydroxymethytransferase, 

an 

enzyme that catalyzes glycine 

from serine, has 483 aa; the sequence 

of this protein blasted 

against all Archaea proteins 

show 46% ID with a M. mazei 

protein (419 aa) over 402 aa, 

43% ID with a Halobacterium 

protein (424 aa) over 415 aa 

and a 32% ID with a A. 

fulgidus protein (451 aa) over 

444 aa; blasted against all 

Eubacteria proteins show a 

47% ID with an A. tumefaciens 

protein over 440 aa, 49% ID 

with a T. maritima protein 

(427 aa) over 389 aa, and 47% 

ID with a C. acetobutylicum 

protein (411 aa) over 406 aa. 

Table 1: Origin of nuclear-coded cytoplasmic proteins from selected 

biochemical pathways of H. sapiens 

In each of these cases it would 

be incorrect to conclude that 

the human genes evolved from 

either the Eubacteria or the 

Archaea for several reasons: 1) 

the length of the Eubacteria or 

Archaea proteins most homologous 

to the human pro- 



187

188 


tein is very similar to each other; 2) The percentage of identity is very similar over a long stretch 

of amino acids of comparable length in both cases; 3) The best hits with Eubacteria are with 

bacteria coming from very divergent families like bacillus (B. subtilis ), clostridium (C. 

acetobutylicum), rhizobiaceae group (A. tumefaciens, M. loti, B. melitensis ), thermotogales (T. 

maritima). The best explanation for these results to me is to assume that these particular proteins 

are very ancient and have developed to a form of “perfection” and have remained so in the three 

different kingdoms. 

A similar analysis reported in my table 1 show, for example, that 6 enzymes out 7 enzymes of 

the biosynthetic pathway of pyrimidines are of Archaea & Eubacteria origin contrary to the 

results published by Horiike et al. who states that nucleotide metabolism enzymes are all of 

Eubacteria origin; 8 out 19 aa-tRNA synthetases were found to be of Archaea & Eubacteria 

origin, 5 are of Eubacteria origin, and only 5 are of Archaea origin, while the just quoted authors 

state that all the enzymes for protein biosynthesis are of Archaea origin. However, there are 

human proteins that have much higher identity to Archaea than to Eubacteria proteins, such as 

the great majority of ribosomal proteins. 

Similarly there are clearly human proteins that have much higher identity to Eubacteria proteins 

than to Archaea proteins, such as the 8 enzymes involved in glycolysis. 

My studies to date are a warning against quick bioinformatic analysis. I believe that each protein 

and enzyme must be studied carefully, and comprehensive information about the origin of 

human protein must be collected and discussed, for all biochemical pathways known, before we 

can make any reasonable model about the Tree of Life. It is a long way to go. But the real 

challenge will be then to understand why Nature decided that the archaea proteins of transcription 

and translation were the best ones to select for the Eukarya, while for glycolysis, the biosynthesis 

of lipids and of small molecules Nature selected the eubacteria proteins for the Eukarya. 



Ayora S, Piruat JI, Luna R, Reiss B, Russo 

VEA, Aguilera A & Alonso JC (2002). Characterization 

of two highly similar Rad 51 homologs 

of Physcomitrella patens. J Mol Biol 

316:35-49 

Markmann-Mulisch U, Hadi MZ, Koepchen 

K, Alonso JC, Russo VEA, Schell J & Reiss 

B (2002). The organization of Physcomitrella 

patens RAD51 genes is unique among the eukaryotic 

organisms. PNAS 99: 2959-2964 

Musa A, Lehrach H & Russo VEA (2001). 

Distinct expression patterns of two zebrafish 

homologues of the human APP gene during 

embryonic development. Dev Genes Evol 211: 

563-567 

Schulz P, Hofmann AH, Russo VEA, 

Hartmann E, Lalouche M & von Schwartzenberg 

K (2001). Cytokinin overproducing ove 

mutants of Physcomitrella patens show increased 

riboside to base conversion. Plant 

Physiology 126:1-8 

Hofmann AH, Codón AC, Knight C, Cove 

D, Schaefer DG, Chakparonian M, Zryd J-P 

& Russo VEA (1999). A specific member of 

the CAB multigene family is efficiently targeted 

and disrupted in the moss Physcomitrella patens. 

MGG 261:92-99 

Russo VEA (Editor-in-chief), Cove D, Edgar 

L, Jaenisch R & Salamini F (1999). Development 

- Genetics, Epigenetics and Environmental 

Regulation. Monography, Springer-Verlag, 

Berlin Heidelberg 

Yarden O & Russo VEA (1999). Genetic and 

Environmental Influence on the Development 

of the Filamentous Fungus Neurospora crassa. 

In Development - Genetics, epigenetics and 

environmental regulation, Russo VEA, Cove 

D, Edgar L, Jaenisch R & Salamini F, eds., 

Springer-Verlag, Berlin Heidelberg 

Lauter F-R, Marchfelder U, Russo VEA, 

Yashamiro C, Yatzkan E & Yarden O (1998). 

Photoregulation of cot-1, a kinase-encoding 

gene involved in hyphal growth in Neurospora 

crassa. Fungal Gen Biol 23:300-310


Head: 

Dr. Manuela B. Urban, MBA 

Phone: +49 (0)30-8413 1399 

Fax: +49 (0)30-8413 1394 

Email: urban@vw.molgen.mpg.de 

Administration 

Personnel department: 

Ruth Schäfer 

Hannelore Feiks 

Jeannette Bertone (part-time) 

Jeanette Brylla 

Pamela Haas (part-time, temporary) 

Hilke Wegwerth 

Accounting department: 

Angelika Brehmer 

Petra Saporito 

Peter Jahn (part-time, temporary) 

Malgorzata Klemm (part-time) 

Ursula Schulz (part-time) 

External project funding: 

Anke Badrow 

Joachim Gerlach 

Purchasing department: 

Jutta Roll 

Carola Baumgarten (on leave) 

Ute Müller 

Rita Röfke-Bohnau 

Kerstin Steudtner (temporary) 

Sebastian Klein (trainee, temporary) 

Secretary: 

Jeannine Moisel 

Phone: +49 (0)30-8413 1399 

Fax: +49 (0)30-8413 1394 

Email: moisel@vw.molgen.mpg.de 

Stock room: 

Jürgen Joch 

Dirk Grönboldt-Santana 

Iranmodai Maki (on leave) 

Chris Imöhl (temporary) 

Guest houses, apartments: 

Rosemarie Wolniak (part-time) 

Helena Netzer 

Reception, post office: 

Barbara Gibas (part-time) 

Monika Schweizer-Annecke (part-time) 

Driver: 

Claus Langrock 



189


190 

Overview 

In the last several years the central services’ work has been determined mainly by the 

growth of the institute due to the increase in externally funded projects. According to 

payroll figures, the Max Planck Institute for Molecular Genetics has grown to the fifth 

largest institute of the Max Planck Society. 

However, the number of permanently funded staff positions in the administration could 

not be increased to adjust the infrastructural backbone to the growing institute. This is 

important, as the rigorous German industrial law makes temporary employment of service 

staff extremely difficult. Better legal conditions, which take the particularities of science 

and research management into consideration, are highly desirable. 

Major problems arose from the 2003 collective bargaining round of the state of Berlin. 

Berlin salary scales now differ significantly from the “Bund” (federal) scales and, at the 

time of this writing, the Berlin universities were still negotiating individual agreements. It 

is feared that, as a result, the conditions of employment for the research institutions and 

universities in Berlin will become more and more heterogeneous and will severely hamper 

cooperation and flexibility. 

Concerning the technical development of the institute, the most important issues in the 

next several years are the refurbishment of towers I and II and planning the construction 

of tower III (for details see “Technical Management and Workshops”). 

Recently, an institute specific cost accounting system within the framework of the Max 

Planck Society concept has been developed comprising cost type, cost centre, and cost 

unit accounting. The introduction of cost accounting is supposed to improve resource 

planning and budgetary control and to maintain financial flexibility despite considerable 

budget constraints. Primary aims for the coming year are implementing the system and 

integrating external funding. 

In 2003 the personnel department implemented a new personnel administration system 

(SAP R/3 HR), which facilitates the integration with the accounting system. However, the 

system requires reorganisation of certain procedures and still needs much improvement. It 

should take another few months before the system is up and running optimally. 

An electronic materials logistic system, to be developed in the next year, will also enable 

us to connect the storeroom records to the integrated accounting system. 

During the last year, a public relations and communication concept for the institute has 

been developed. Primary aims are promoting an ongoing dialogue with the general public, 

enhancing in-house communication and, in the long run, establishing public relations as a 

strategic means. 

First steps have been taken to realise this concept. The new institute’s website was launched 

in fall 2001. It now conforms to the corporate design of the Max Planck Society. 

A brochure describing the research program and the organisation of the institute is in 

progress. It will be targeted specifically at the general public. 

In June 2002 and 2003 the MPIMG participated in the “Long Night of Sciences”, where 

universities and research institutes in Berlin open its doors to the public. The MPIMG is 

also engaged in inviting school classes, providing them the opportunity to learn about the 

institute’s research and the researchers’ daily work. 

Addressing the wider scientific community, the “Dahlem Colloquia”, a lecture series with 

renowned speakers in the field of genome research, has been held since 2001. 

Resoundingly successful were the “Science Days” in spring 2002 and 2003. These inhouse 

conferences bring together all research members of the institute for a day of exchange 

and support inter-departmental communication and co-operation. 

An exceptional event was the visit of the Prime Minister of Canada, Jean Chrétien in 

February 2002. On this occasion an agreement between the Canadian Institute of Health 

Research, the Canadian Genetic Disease Network, and the MPIMG was signed to collaborate 

on the elucidation of human genetic disease using genomic technologies.

Technical Management and Workshops 

Head: 

Dipl.-Ing. (FH) Ulf Bornemann 

Phone:+49 (0)30-8413 1424 

Fax: +49 (0)30-8413 1394 

Email: bornemann@vw.molgen.mpg.de 

Technical staff: 

Detlef Becker (master craftsman) 

Carsten Arold 

Gisela Bosse (on leave until 04, temporary) 

Thomas Gessner (temporary) 

Florian Zill (temporary) 

Klaus Krüger (master craftsman) 

Udo Abratis 

Claus Hoffmann 

Günter Ihlenfeld 

Frank Kalaß 

Tobias Kleint 

Manfred Lemke 

Lars Radloff 

Bernd Roehl 

Bernd Roßdeutscher 

Reinhardt Strüver (temporary) 

Bernd Zabka 

In the next several years the renovation and modernisation of the technical infrastructure, as well 

as the improvement of the structural condition of towers 1 and 2 (constructed 1968-1970) are of 

utmost importance. 

The renovations will encompass the new installation of media providers, and an air circulation 

system, as well as laboratories outfitting. Structurally speaking, the composition floor and floor 

coverings will be replaced on all floors, the toilets renovated, and steps will be undertaken for 

energy conservation. 

These fundamental modernisations in Tower 1 and 2 can begin in 2006. Because work cannot 

be conducted during regular research activities, relocation will be necessary to space made 

available in other towers, in our branch in Fabeckstraße, or in Tower 3, which will be being built 

at the same time. The institute management hopes the plans for the new construction of Tower 

3 can begin in 2004 and that the hoped for construction start in 2006 will follow. 

In March 2002 a long term lease was taken out for a raw space of 800 m² in Fabeckstr. 60-62 

from the Benjamin Franklin University Clinic, Freie Universität Berlin. This was converted into 

laboratory space. Eight laboratories and adjoining rooms were completed in April 2003. The 

laboratory floor contains room for 40 to 50 employees. 

In 2002 the workshop area in the Ihnestraße 73 was reworked. Through new organisation and 

merging the House/Operations and Mechanics workshops, room was made in the basement for 

research groups. The space is now being used for microscope work stations and for using 

robots. 



191


192 

Analytics & Computing 

Head: 

Dr. Richard Reinhardt 

Phone: +49 (0)30-8413 1226 

Fax: +49 (0)30-8413 1365 

Email: reinhardt@molgen.mpg.de 

Analytics Group 

Technicians: 

Katja Borzym (part-time) 

Katja Heitmann (part-time, temporary) 

Sylvia Lehrack (part-time, temporary) 

Sven Klages 

Bettina Moser (temporary) 

Roman Pawlik 

Students: 

Florian Arlen 

Florian Knaust 

Daniel Rhiel 

Lab kitchen: 

Hüysametin Altin (temporary) 

Secretary: 

Tamara Safari 

Phone: +49 (0)30-8413 1126 

Fax: +49 (0)30-8413 1365 

Email: safari@molgen.mpg.de 

Computing Group 

Dr. Alfred Beck 

Donald Buczek 

Olde Hansen 

Dirk-Robert Jacobs 

Peter Marquardt 

Sven Püstow 

Frank Rippel 

Jürgen Witczak-Losekandt (temporary) 

Students: 

Andreas Schebesch 

Marius Tolzmann 

The scientific service group Analytics is active in the fields of DNA template preparation, 

purification, sequencing and sequence analysis, protein purification and analysis by Edman 

sequencing, MALDI-MS methods, enzyme preparation and purification, as well as synthesis 

of highly specific oligonucleotides like Energy-Transfer primers etc. 

Automation of procedures in any of these methods plays an important role. Another very 

important feature of our work is the miniaturisation, e.g. the down-scaling of reaction 

volumes and costs per reaction. The group has a good infrastructure for Mutation analysis 

and DNA-sequencing, especially for genome sequencing and analysis. Concurrently with 

conventional sequencing, we examine approaches designed at improving the efficiency 

of large-scale projects, like MS-MALDI methods for base determination and SNP detec-

tion based on the simplified GOOD assay and Mini-sequencing. The service costs for our 

main issues are calculated and those requesting the service are charged on a monthly basis 

of an individually assembled cost calculation. 

In addition to the service aspects of our work, the group is a co-operation partner, together 

with Depts. Lehrach, Ropers and Vingron, of the international HUGO project, European 

based projects and the national DHGP and NGFN projects. For this purpose several software 

tools using advanced UNIX based (HP / Compaq Alpha systems and LINUX-PCcluster) 

hardware were optimised or developed in close co-operation with the computing 

people of the group. For future needs we will extend new clustering strategies (multiprocessor 

PC-based LINUX-cluster) for the automated assembly of very large data sets, 

automated checking, editing steps and web based software tools for co-ordinating projects 

with external partners. Most of this will be done in close co-operation with Dept. Vingron 

at the institute, the Sanger Centre (UK), and the University of Washington (US). 

The computing group is responsible for updating and servicing the biological databases 

and the corresponding software tools. It is also responsible for the operation and development 

of the whole IT-infrastructure of the institute which includes workstation and server 

systems, wireless and wire based LAN, Internet access and services and remote access via 

modem, ISDN and DSL, and security devices (anti-virus and anti-SPAM software, data 

back-up and firewall). Our online storage capacity on disk-based file servers exceeds 6 

TB of data, while the monthly backup volume is about 9 TB, summing up to a total 

backup capacity of 100 TB on tape robot systems. To manage and control the massive 

flow of data, our fibre based GigaBit-LAN, connecting laboratories in Fabeck- and 

Harnackstrasse to the campus Ihnestrasse, is segmented by about 100 manageable switches 

giving us the ultimate flexibility to control each segment and if necessary to configure 

each switch port individually. Presently we serve about 450 Windows based PCs and 67 

Linux systems with a variety of hard- and software components, about 80 MAC systems 

and 54 Alpha based Unix systems of various hardware configuration. A variety of webservers 

are protected by our firewall installation, 10 web-servers are actively run and 

maintained by us, including hard- and software development and are serving the scientific 

departments as well as the service and administration groups. In the future, Voice overIP 

(VoIP) might be a new field to be serviced. 

Both scientific groups are very active in the field of training and education for young 

technicians to promote their further job career. During the period of this research report, 

the analytic group has organised the laboratory training for 5 persons for about 16 month 

time. Due to the still increasing demands for training in IT infrastructure, the computing 

group has even extended this effort and has organised training for 6 persons for about 39 

month time: 

Analytics: 

• Susann Thiele, TFH Berlin, 7/98-1/99 

• Heiner Kuhl, TU Berlin, 2/99-4/99 

• Martin Schulze,TU Berlin, 2/00-4/00 

• Oliver Klein, TFH Berlin, 9/02-1/02 

• Hayri Gündogan, Seminarzentrum 

Göttingen, 7/02-8/02 

Computing: 

• Dunja Neubauer, TFH Berlin, 10/98-1/99 

• Irene Sakoulas, TFH Berlin, 10/98-1/99 

• Ronny Loose, System Data, 5/00-3/01 

• Kay Fechner, System Data, 11/01-11/02 

• Matthias Schmelz, OSZ Technik Teltow, 

8/02-7/03 

• Marco Ecker, System Data, 11/02-10/03 



193


194 

Animal Facility 

Head: 

Dr. Ludger Hartmann 

Phone: +49 (0)30-8413 1189 

Fax: +49 (0)30-8413 1197 

Email: hartmann@molgen.mpg.de 

Staff: 

Dipl.-Ing. (FH) Ingo Voigt ( temporary) 

Ulf Schroeder (master) 

Janine Berger (temporary) 

Janett Birkenfeld (temporary) 

Nicole Heidemann (temporary) 

Sylvia Perkiewicz 

Katja Pokrandt 

Julia Wiesner (temporary) 

Sina Ackermann (trainee) 

Elisa Hinz (trainee) 

Carolin Willke (trainee) 

In 2002 the construction of a new animal laboratory was completed. It was brought 

fully into service in June 2003. The central animal laboratory (animal house) contains 

animal rooms for maintaining and breeding up to 20,000 mice. There are in total 3,500 

IVC (individually ventilated cages). The mouse space will be expanded to include a 

final number of 4,600 IVC by 2004. The animal house also contains aquariums for 

maintaining and breeding up to 20,000 zebrafish. The animal laboratory houses a 

transgen unit to generate transgenic and knock out mice and zebrafish. In addition, the 

institute has rooms outside of the animal house with bird cages and aviaries for maintaining 

and breeding up to 500 zebra finches.

Library 

Librarians: 

Dipl.-Fachinf. Sylvia Elliger 

Praxedis Leitner, M.A. 

Phone: +49 (0)30-8413 1314 

Fax: +49 (0)30-8413 1309 

Email: library@molgen.mpg.de 

Scientific advisor: 

Dr. Vera Kalscheuer 

Library committee: 

Anja v. Heydebreck, Dept. Vingron 

Vera Kalscheuer, Dept. Ropers 

Knud Nierhaus, Ribosome Group 

Enzo Russo, Dept. Lehrach 

Georg Schwabe, Research Group Mundlos 

Silke Sperling, Dept. Lehrach 

Ralf Sudbrak, Dept. Lehrach 

Andrea Vortkamp, Otto Warburg Laboratory 

The library covers all research areas of the institute and is organized as a reference library. 

It holds about 50,000 volumes and subscribes to 268 scientific journals and series (130 

print journals and more than 141 e-journals plus online cross access full text linking to 

several publishers and societies). In 2004 the library will begin, step by step, to reduce the 

costs for print journals but improve the electronic spectrum of scientific information. In 

addition to the web catalogue, 22 databases and 18 CD-ROMs, as well as electronic 

interlibrary loan service are offered. The library team undertakes searches in numerous 

online databases. It also offers introduction courses in how to use the databases (a basic 

handout packet is available in the library), as well as courses in how to use other services. 

Seminars, with guest speakers, about recent changes in electronic information systems are 

offered for the scientists of the institute. The library team is part of the pilot program 

within the Max-Planck-Society project “e-document server”. 

The goal for the further development of the library is to improve the “Virtual Library”, a 

network of knowledge systems ensuring the delivery of information to researchers’ desktops 

wherever and whenever they need it. 



195


196 

Graphics/Photo 

Graphics: 

Monica Shevack (part-time) 

Phone: +49 (0)30-8413 1313 

Fax: +49 (0)30-8413 1309 

Email: shevack@molgen.mpg.de 

Photo: 

Katrin Ullrich (part-time) 

Phone: +49 (0)30-8413 1311/1312 

Fax: +49 (0)30-8413 1309 

Email: foto@molgen.mpg.de 

Scientific advisor: 

Dr. Rudi Lurz 

In the graphic department designing figures and drawings, including tracing work has 

completely changed from classical drawing to Mac (Photoshop, Freehand) and PC 

(Photoshop, CorelDraw) based systems. 

In the photo lab all the classic photographic work in the darkroom can still be done. 

Here, however, is also a general shift from traditional silver technology to digital work. 

All kinds of photographs of people and objects are taken as needed. For slides there is 

a digital slide maker (Lasergraphics Personal LFR plus), but most presentations are 

prepared now exclusively for PowerPoint. Negatives and slides can be scanned with 

two scanners (Minolta Dimage and Nikon Coolscan). A flatbed Epson DINA3 scanner 

has an adapter for transmitter light to be used also for (wet) gels and big films. Results 

are finished mainly using Adobe Photoshop. The digital equipment of the photo lab is 

open to members of the institute.

How to get to the Institute 

Max Planck Institute for Molecular Genetics 

Ihnestr. 63 - 73 

D-14195 Berlin 

Phone: ++49 / 30 / 8413 - 0 

Fax: ++49 / 30 / 8413 - 1394 

Email: info@molgen.mpg.de

Research Report 2003 - Max-Planck-Institut für molekulare Genetik

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?