tjh-v38i3

More documents

Recommendations

Info

LETTERS TO THE EDITORTurk J Hematol 2021;38:228-2456. Wen F, Cao YX, Luo ZY, Liao P, Lu ZW. LncRNA MALAT1 promotes cellproliferation and imatinib resistance by sponging miR-328 in chronicmyelogenous leukemia. Biochem Biophys Res Commun 2018;507:1-8.7. Sun Y, Jiang T, Jia Y, Zou J, Wang X, Gu W. LncRNA MALAT1/miR-181a-5paffects the proliferation and adhesion of myeloma cells via regulation ofHippo-YAP signaling pathway. Cell Cycle 2019;18:2509-2523.8. Wu J, Zhang H, Zheng Y, Jin X, Liu M, Li S, Zhao Q, Liu X, Wang Y, Shi M, ZhangS, Tian J, Sun Y, Zhang M, Yu B. The long noncoding RNA MALAT1 inducestolerogenic dendritic cells and regulatory T cells via miR155/dendritic cellspecificintercellular adhesion molecule-3 grabbing nonintegrin/IL10 axis.Front Immunol 2018;9:1847.©Copyright 2021 by Turkish Society of HematologyTurkish Journal of Hematology, Published by Galenos Publishing HouseAddress for Correspondence/Yazışma Adresi: Rong Fu, M.D., Tianjin Medical University General Hospital,Department of Hematology, Tianjin, ChinaPhone : (086) 02260817181E-mail : florai@sina.com ORCID: orcid.org/0000-0002-9928-9224Received/Geliş tarihi: January 22, 2021Accepted/Kabul tarihi: March 16, 2021DOI: 10.4274/tjh.galenos.2021.2021.0065Supplemental Table 1. Clinical characteristics of 30 paroxysmal nocturnal hemoglobinuria patients.CharacteristicsTotal no. of patients 30ValuesGender, M/F 19/11Age, years, median (range) 41 (16-68)Clinical classification, n (%)Classical PNH 22 (73.33)AA-PNH 8 (26.67)History of thrombosis, n (%) 11 (36.67)Hb (g/L) 79.71±23.97Ret (%) 8.285±5.589WBC (x10 9 /L) 5.47±3.29PLT (x10 9 /L) 116.00±95.03TBIL (µmol/L) 34.53±18.59LDH (U/L) 1543.00±1181.0Granulocyte CD59– (%) 74.90±24.39Erythrocyte CD59– (%) 47.50±31.77PNH: Paroxysmal nocturnal hemoglobinuria; AA-PNH: aplastic anemia-paroxysmal nocturnal hemoglobinuria; Hb: hemoglobin; Ret: reticulocytes; WBC: white blood cell count; PLT:platelet count; TBIL: total bilirubin; LDH: lactate dehydrogenase.Supplemental Table 2. Gene primer sequences.Gene Forward Reverse Annealing temperature, °CMALAT1 GCAGCAGTTCGTGGTGAAGATAGG TCGCCTCCTCCGTGTGGTTG 58.0GAPDH CAGGAGGCATTGCTGATGAT GAAGGCTGGGGCTCATTT238
Turk J Hematol 2021;38:228-245LETTERS TO THE EDITORDicentric (7;12)(p11;p11) in T/Myeloid Mixed-Phenotype AcuteLeukemiaT/Myeloid Karışık-Fenotip Akut Lösemide Disentrik (7;12)(p11;p11)Smeeta Gajendra 1 , Akshay Ramesh Gore 2 , Nitin Sood 3 , Manorama Bhargava 21Department of Laboratory Oncology, All India Institute of Medical Sciences, Dr. B.R.A. Institute Rotary Cancer Hospital, New Delhi, India2Department of Hematopathology, Medanta - The Medicity, Gurgaon, India3Department of Medical Oncology & Hematology, Medanta - The Medicity, Gurgaon, IndiaTo the Editor,Mixed-phenotype acute leukemia (MPAL) is a rare heterogeneousgroup of acute leukemias with immunophenotypicco-expression of more than one cell lineage, which could bebilineal or biphenotypic. MPAL could be further classifiedas B/myeloid, T/myeloid, B/T-lymphoid, and, more rarely,trilineage B/T/myeloid. “MPAL, T/myeloid, not otherwisespecified” is a rare variant of this disease accounting for <1%of all leukemias [1]. It is associated with male predominance,frequent lymphadenopathy, and poor prognosis [2]. Most ofthe cases have clonal chromosomal abnormalities, but noneare specific for this group. Here, we report a case of T/myeloidbilineage acute leukemia with unusual cytogenetic featuresupon karyotyping and fluorescence in situ hybridization (FISH),with karyotyping showing a dicentric chromosome betweenthe derivative chromosome 7 and chromosome 12, dic(7;12)(p11;p11).A 51-year-old male presented with generalized weakness andloss of appetite. On examination, he had pallor and abdominalmass with hepatomegaly (2 cm below the right costal margin).Abdominal computed tomography showed multiple largelymph nodes in the paraaortic, aortocaval, paracaval, celiacaxis, periportal, and mesenteric regions, the largest measuring3.0x2.5 cm in the left paraaortic region. Fine-needle aspirationof the paraaortic lymph node showed clusters of pleomorphiccells, suggesting a lymphoproliferative lesion. Complete bloodcount showed hemoglobin of 7.7 g/dL, total leukocyte counts of9.0x10 9 /L, and platelets of 156x10 9 /L. Peripheral blood smear andbone marrow aspirate showed 70% and 85% blasts, respectively.Morphologically, there were two distinct populations of blasts,one that was larger with 2-3 prominent nucleoli and moderateto abundant amounts of granular cytoplasm (Figure 1A), whilethe other was of medium size with inconspicuous nucleoli andscanty agranular cytoplasm (Figure 1B). Upon flowcytometricimmunophenotyping (Figure 1E), there were two differentblast populations seen in the CD45-moderate blast region,extending into the monocytic region: a blast population in theCD45-moderate region with high side scatter (~60% of blasts),extending to the monocytic region, was positive for cMPO, CD13,CD33, CD64, CD14, HLA-DR, CD38, CD11b, CD71, CD123, CD56,CD4, CD117, CD7, and CD11c and negative for cCD79a, CD19,CD10, cCD3, CD8, CD3, CD5, CD2, CD1a, and CD16, while theblast population present in the CD45-moderate region with lowside scatter (~40% of blasts) was positive for cCD3, CD3, CD7,CD5, CD34, HLA-DR, CD38, CD99, TdT, and CD33 and negativefor cCD79a, cMPO, CD19, CD10, CD1a, CD2, CD4, CD8, CD13,CD14, and CD64. Immunohistochemistry based on bone marrowbiopsy also showed sheets of blasts comprising two populationsof blasts with myeloid (CD33, CD117) and T lymphoid markers(CD3, CD5, CD7). The overall features were consistent with MPALof myeloid and T lymphoblastic lineage (MPAL: T/myeloid).Karyotyping (Figure 1C) showed a dicentric chromosome formedbetween chromosome 7 and 12: 45,XY, dic(7;12)(p11;p11).Dicentric chromosomes involving 12p are associated with lossof 12p material, often including the ETV6 (TEL) gene localized in12p 13.2. The karyotyping findings were supported by FISH usingthe ETV6/RUNX1 probe (Figure 1D), which showed deletion ofthe ETV6 (TEL) gene localized on 12p13.2. Real-time quantitativepolymerase chain reaction results for PML-RARA, AML1-ETO,RUNX1:RUNX1T1, CBFB - MYH11, FLT3 ITD and TKD, D835,NPM1, BCR-ABL1, and KIT were negative. The patient beganhyper-CVAD induction chemotherapy comprisingcyclophosphamide, vincristine, doxorubicin, and dexamethasone.On day 19, he developed febrile neutropenia. Blood cultureshowed growth of Pseudomonas, for which he was treated, andhe recovered. The patient was assessed after completion of fourcycles and he achieved a complete morphological remissionwith this regimen.T/myeloid MPAL is rare and characterized by the presence ofboth T and myeloid lineage markers in immunophenotyping.Although the specific type and frequency of geneticabnormalities associated with T/myeloid MPAL are largelyunknown, some chromosomal abnormalities described inthe literature commonly include recurrent monosomies 7pand/or 12p [2,3,4,5]. Structural abnormalities in the shortarm of chromosome 12 are observed in a broad spectrum ofhematological malignancies including myeloid malignancies239
Page 1:
Volume 38 Issue 3September 2021E-IS
Page 4 and 5:
Contact InformationEditorial Corres
Page 6 and 7:
TURKISH JOURNAL OF HEMATOLOGYINSTRU
Page 8 and 9:
important findings should be highli
Page 10 and 11:
Full instructions and support are a
Page 12 and 13:
226 Giant Cell Arteritis with Conco
Page 14 and 15:
Guarina A. et al: Association of Im
Page 16 and 17:
Page 18 and 19:
Page 20 and 21:
Uğur M.C. et al: Immune Thrombocyt
Page 22 and 23:
Page 24 and 25:
Page 26 and 27: Wang L. et al: Characteristics and
Page 34 and 35: Yılmaz F. et al: Stem Cell Transpl
Page 42 and 43: Demiroğlu H. et al: Prediction of
Page 50 and 51: Mersin S. et al: Evaluation of a Ge
Page 56 and 57: Mina S.A. et al: Peripheral Neuropa
Page 58 and 59: Mina S.A. et al: Peripheral Neuropa
Page 60 and 61: Beken S. et al: Intrauterine Arteri
Page 62 and 63: Filizoğlu and Özgüven: Myeloid S
Page 64 and 65: Öztaş M. et al: Giant Cell Arteri
Page 66 and 67: LETTERS TO THE EDITORTurk J Hematol
Page 84: Advisory Board of This Issue (Septe
show all

tjh-v38i3

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?