Neurokinin Bs and neurokinin B receptors in zebrafish- potential role ...
Neurokinin Bs and neurokinin B receptors in zebrafish- potential role ...
Neurokinin Bs and neurokinin B receptors in zebrafish- potential role ...
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
Fig. S5. Localization by real-time PCR of <strong>zebrafish</strong> tac3a, tac3b, tac3ra, <strong>and</strong> tac3rb mRNA <strong>in</strong> various tissues. The relative abundances of the mRNAs were<br />
normalized to the amount of elongation factor 1-α (ef1α) by the comparative threshold cycle method, where the comparative threshold reflects the relative<br />
amount of the transcript. Ant. Intest+ panc., anterior <strong>in</strong>test<strong>in</strong>e <strong>and</strong> pancreas; post. Intes, posterior <strong>in</strong>test<strong>in</strong>e. We found low levels of mRNA expression of all<br />
four transcripts <strong>in</strong> the liver, ret<strong>in</strong>a, <strong>and</strong> adipose tissue. However, relatively high mRNA levels of tac3a <strong>and</strong> tac3rb were expressed <strong>in</strong> the gills, tac3a <strong>in</strong> the<br />
posterior <strong>in</strong>test<strong>in</strong>e <strong>and</strong> tac3ra <strong>in</strong> the muscle.<br />
Table S1. Primers used for clon<strong>in</strong>g, quantitative real-time PCR, <strong>and</strong> <strong>in</strong> situ hybridization<br />
Primer Position 5′ to 3′ sequence Slope R 2<br />
Application<br />
zf ef1a-1237F 1,237 aagacaaccccaaggctctca −3.708 0.999 Quantitative<br />
zf ef1a-1419R 1,491 cctttggaacggtgtgattga<br />
real-time PCR<br />
GnRH2-36F 36 gctgatgctgtgtctgagt −3.337 0.994<br />
GnRH2-196R 196 tgtcttgaggatgtttcttc<br />
GnRH3-47F 47 gtgtgttggaggtcagtct −3.103 0.997<br />
GnRH3-208R 208 tccacctcattcactatgtg<br />
kiss1-10F 158 acagacactcgtcccacagatg −3.468 0.991<br />
kiss1-210R 357 caatcgtgtgagcatgtcctg<br />
kiss2-137F 137 gcgttttctgtcaatggag −3.475 0.998<br />
kiss2-317R 317 cgcttcgtttctctttccg<br />
kiss1ra-856F 856 cctaacttcaaggccaac −3.424 0.987<br />
kiss1ra-1095R 1,095 cctctcagtgttgctttc<br />
kiss1rb-755F 755 agacgtcatcggagcgtg −3.305 0.954<br />
kiss1rb-1041R 1,041 cctccttttgaagatcagaggac<br />
zf tac3a-F29 29 tggttttggtgctggaaacc −3.513 0.997<br />
zf tac3a-R191 191 tctgtttcggcgtttctgc<br />
zf tac3b-F86 86 ctccttcactgacaacagcgac −3.239 0.988<br />
zf tac3b-R246 246 gtttctccgtcctaacagtccg<br />
zf tac3ra F154 154 gctcataagcggatgcgaac −3.502 0.969<br />
zf tac3ra R334 334 tggcaaacacggaggtgac<br />
zf tac3rb F343 343 tccatgacagcgattgcagt −3.322 0.964<br />
zf tac3rb R523 523 cgtagcaaatggttctgcgag<br />
zf tac3a F-122 −122 ccctgtctctgtgtcttgtctg In situ<br />
zf tac3a R360 360 gcctataacccacgacgaaac<br />
hybridizaiton/<br />
zf tac3b F-17 −17 ggataaggtgtgcgaggatg<br />
Clon<strong>in</strong>g<br />
zf tac3b stop 382 tcatacaccacagcaaaacctcag<br />
zf tac3Ra start 1 atggcacagtcacagaacgg Clon<strong>in</strong>g<br />
zf tac3Ra stop 1,180 tcaggagaattcctccttcg<br />
zf tac3Rb start 1 atggctggtcctcagagcgg<br />
zf tac3Rb stop 1,161 tcagctgagctgctctgttgc<br />
Biran et al. www.pnas.org/cgi/content/short/1119165109 7of9
Change language