Neurokinin Bs and neurokinin B receptors in zebrafish- potential role ...

More documents

Recommendations

Info

Table S2. Percent amino acid sequence identities (black) and similarities (red) among Tac3 of different species as determined by EMBOSS* Stretcher alignment tool Zebrafish Tac3a Zebrafish Tac3b Human Tac3 Sheep Tac3 Mouse Tac2 Salmon Tac3a Salmon Tac3b European Seabass Tac3 Medaka Tac3a Rainbow Smelt Tac3 Zebrafish Tac3A (cypriniformes) — 35.7 25 18.1 24.8 55.3 43.9 27.8 52 59.2 50 31.8 25.4 Zebrafish Tac3B (cypriniformes) 45.2 — 18.2 19.7 18.9 40.2 40.4 30.4 36.3 40.6 38.3 30.7 20.5 Human Tac3 41.7 34.7 — 55.6 61.1 24.2 24.4 13.2 25.2 25.8 28.6 29.1 39.2 Sheep Tac3 37 38.5 66.7 — 66.7 23 18.9 14.2 24.6 23.4 26 34.9 38.5 Mouse Tac3 45 37.7 73 73.3 — 26.9 27.6 17.2 24.6 26 28.5 36.7 43.9 Salmon Tac3A (salmoniformes) 71.2 50.8 43.2 37.8 41 — 38.2 23.6 56.1 65.9 57.2 40.2 28.6 Salmon Tac3B (salmoniformes) 62.1 52.9 34.4 32.6 38.1 55.9 — 35.1 38.9 39.7 34.1 32.1 20.3 European Seabass Tac3 (perciformes) 42.1 43.2 32.6 30 33.6 41.4 43.3 — 24.4 25.6 26.7 21.8 18 Medaka Tac3A (beloniformes) 72.8 48.4 40.2 41.5 40.5 72 53.4 43 — 64.5 56.2 31.2 27.2 Rainbow Smelt Tac3A (osmeriforms) 74.4 48.4 43 39.1 42.5 77.3 54.2 41.4 78.2 — 63.4 36.4 29.6 Arctic Cod Tac3 (gadiforms) 68.9 49.2 42.1 38.9 43.8 69.6 54.1 40 70.8 73.3 — 34.6 23.4 Frog Tac3 53.5 40.9 48 47.3 50.8 60.6 49.3 39.1 55.5 60.5 54.9 — 36 Aligator Tac3 45.2 37.7 56 54.1 59.3 45.9 38.3 33.1 43.2 47.2 35.9 51.2 — —, Same species, not applicable. *http://www.ebi.ac.uk/Tools/psa. Arctic Cod Tac3 Frog Tac3 Aligator Tac3 Table S3. Percent amino acid sequence identities (black) and similarities (red) among Tac3r of different species as determined by EMBOSS* Stretcher alignment tool Zebrafish Tac3ra Zebrafish Tac3rb Zebrafish Tac3rc Human TAC3R cow Tac3r Mouse Tac3r Chicken Tac3r medaka Tac3ra Medaka Tac3rb Tetraodon Tac3ra Tetraodon Tac3rb Zebrafish TacR3A (cypriniformes) — 74.9 60.7 56.4 57.3 59.2 60.6 73.8 68.4 71.8 65.7 60 Zebrafish TacR3B (cypriniformes) 85 — 61.3 57.5 57.7 59.7 62 74.5 72.7 73.3 71.1 59.4 Zebrafish TacR3C (cypriniformes) 75.9 71.7 — 50.5 51.3 53.1 52.2 61.9 61.3 62.4 58.6 52.3 Human TacR3 67.6 67.3 63.8 — 90.1 86 75.3 59.3 54.2 57.6 52.5 68.8 Cow TacR3 67.9 67.4 64.2 93.1 — 86 76.3 60.3 54 57.2 52.1 69.7 Mouse TacR3 70.4 69.5 64.9 90.5 90.3 — 76.6 59.7 54.6 59.7 54 70.3 Chicken TacR3 73.8 72.7 67.4 82.6 83.8 84.1 — 61.7 57.9 60.7 55.1 71.2 Medaka Tac3RA (beloniformes) 84 84 71.4 69.5 70.2 71.7 74 — 70.4 83.3 67.2 61 Medaka Tac3RB (beloniformes) 80.5 82 74.7 63.7 63.3 65 68.8 79.9 — 68.8 74.9 54.4 Tetraodon Tac3RA (tetraodontiformes) 82.5 82.3 75.5 68 68.3 70.4 73.5 92 77.2 — 66.7 57.4 Tetraodon Tac3RB (tetraodontiformes) 75.2 79 72.3 62.2 61.3 63.3 64.5 75.7 82.7 74 — 53.2 Frog TacR3 73.8 72.4 68.3 78.6 78.2 80.4 83.4 75.9 67.8 73.6 66 — —, Same species, not applicable. *http://www.ebi.ac.uk/Tools/psa. Biran et al. www.pnas.org/cgi/content/short/1119165109 8of9 Frog Tac3r
Table S4. EC 50 values (nM) of human and unique piscine NKBs CRE or SRE NKBR zfTac3ra zfTac3rb huNK3R NKBRs EC 50s CRE-Luc (nM) zfNKBa 5.75 ± 1.45 4.55 ± 1.57 3.73 ± 1.25 zfNKBb 237.20 ± 134.20 519.20 ± 160.30 605.00 ± 132.00 zfNKF 4.94 ± 1.83 1.80 ± 1.55 4.36 ± 1.25 huNKB 12.94 ± 13.3 8.12 ± 1.56 4.71 ± 2.08 Senktide 48.95 ± 14.89 20.10 ± 15.1 17.41 ± 1.26 NKBRs EC 50s SRE-Luc (nM) zfNKBa 0.50 ± 0.17 1.47 ± 1.66 0.49 ± 0.18 zfNKBb 8.96 ± 1.19 33.83 ± 14.7 204.40 ± 138.60 zfNKF 0.54 ± 0.13 0.36 ± 0.16 0.52 ± 0.18 huNKB 2.20 ± 1.49 0.82 ± 0.16 0.67 ± 0.16 Senktide 2.67 ± 1.44 2.72 ± 1.54 1.51 ± 1.63 Serum responsive element (SRE)-Luc was used as a reporter gene that follows PKC activation; cAMP responsive element (CRE)-Luc was used to follow PKA activation. Mean ± SEM. Biran et al. www.pnas.org/cgi/content/short/1119165109 9of9
Page 1 and 2: Neurokinin Bs and neurokinin B rece
Page 3 and 4: explored the genomic locations of t
Page 5 and 6: A B C SRE-Luc activity (fold induct
Page 7 and 8: Supporting Information Biran et al.
Page 9 and 10: Fig. S2. Unrooted phylogenetic tree
Page 11 and 12: A 1 tatatctaaatatttctggacatttctggca
Page 13: Fig. S5. Localization by real-time

Neurokinin Bs and neurokinin B receptors in zebrafish- potential role ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?