Neurokinin Bs and neurokinin B receptors in zebrafish- potential role ...

More documents

Recommendations

Info

A 1 ccctgtctctgtgtcttgtctgatagatagtccatcacaaaaggatt 107 taactctccaagcagaaactggaactgagctcttttctacagatctacatcctcagctca 167 gagtaatctgtaaagatgtaccgtggacttgtgttactgttcttggttttggtgctggaa M Y R G L V L L F L V L V L E 247 actcgatggagtgagtcgagctgtcagcagtcagagtctcaaagatcagtttcaagcgag 15 T R W S E S S C Q Q S E S Q R S V S S E 35 307 agtccaagttttcggatgtcgactcataacttgctgaagaggtataatgacatagattat S P S F R M S T H N L L K R Y N D I D Y 55 367 gacagtttcgtcggattaatggggcgcagaaacgccgaaacagatgatataccaccccaa D S F V G L M G R R N A E T D D I P P Q 75 427 cgtaaaagggaaatgcacgatatctttgttggactcatgggtcgacgaagcgctgaacct R K R E M H D I F V G L M G R R S A E P 95 487 gaatccggacgtcaatggaggaaagagtacccagaaccaagcggaggaatcttcttcaac E S G R Q W R K E Y P E P S G G I F F N 115 547 aaatgcaaactgaggtttcgtcgtgggttatag K C K L R F R R G L - 125 B 1 ctgaacagcatcctgttaacaccagctcatacgagtacttggataaggtgtgcgaggatg M 61 tcctgcggctggctgctcgcgctgctcgtccacgtgctgctgctgctcgcgtgcccgaga 1 S C G W L L A L L V H V L L L L A C P R 21 121 ctctcgcggagcgccctcgactactccttcactgacaacagcgacgcccagccggagcgc L S R S A L D Y S F T D N S D A Q P E R 41 181 tacgacaaacgatatgatgatattgattacgacagtttcgtcggcctgatgggcaggagg Y D K R Y D D I D Y D S F V G L M G R R 61 241 agcacaggaataaatcgtgaggcacatttgccatttagaccgaatatgaatgacatcttt S T G I N R E A H L P F R P N M N D I F 301 gtcggactgttaggacggagaaacactttgtcgtctatgagaaaagaaaggagagggaac 81 V G L L G R R N T L S S M R K E R R G N 101 361 attttcttcaaggatggaagactgaggttttgctgtggtgtatga I F F K D G R L R F C C G V - 115 Fig. S1. Nucleotide and deduced amino acid sequences of the zebrafish tac3a (A) and tac3b (B). Numbering of the deduced amino acid sequences begins with the first methionine of the ORF to the right of each line. Nucleotide numbers are to the left of each line. The start and stop codons are shaded in gray, signal peptide amino acids are underlined (as defined by SignalP program analysis http://www.cbs.dtu.dk/services/SignalP/), and the putative secreted peptides are underlined (nucleotides) and bold (amino acids). These sequences have been deposited in the GenBank nucleotide database under accession numbers JN392856 and JN392857, respectively. Prediction of peptides cleavage sites was conducted using NeuroPred application (1). 1. Southey BR, Amare A, Zimmerman TA, Rodriguez-Zas SL, Sweedler JV (2006) NeuroPred: A tool to predict cleavage sites in neuropeptide precursors and provide the masses of the resulting peptides. Nucleic Acids Res 34(Web Server issue):W267–W272. Biran et al. www.pnas.org/cgi/content/short/1119165109 2of9
Fig. S2. Unrooted phylogenetic tree of neurokinin (A) or neurokinin receptor (B) sequences generated with both neighbor-joining (ClustalW 2.1) and maximum likelihood (Phylip 3.69, ProML) on the basis of alignments performed both by ClustalW and Muscle (3.8.31). Trees were visualized with FigTree (1.3.1). The sequences identified in this study are marked in bold. Gene nomenclature has been standardized to tac3, and species are indicated for illustration and comparison. Numbers at nodes indicate the bootstrap values from 1,000 replicates. (Scale bar indicates the substitution rate per residue.) GenBank accession numbers: Ligands: Danio rerio, zebrafish, tac3a (JN392856); zebrafish, tac3b (JN392857); Pimephales promelas, fathead minnow tac3 (BK008100); Ictalurus punctatus, channel catfish, tac3 (BK008101); Salmo salar, Atlantic salmon, tac3a (BK008102); Atlantic salmon, tac3b (BK008103); Dissostichus mawsoni, Antarctic toothfish, tac3 (BK008104); Sebastes rastrelliger, grass rockfish, tac3 (BK008105); Gadus morhua, Atlantic cod, tac3 (BK008107); Boreogadus saida, Legend continued on following page Biran et al. www.pnas.org/cgi/content/short/1119165109 3of9
Page 1 and 2: Neurokinin Bs and neurokinin B rece
Page 3 and 4: explored the genomic locations of t
Page 5 and 6: A B C SRE-Luc activity (fold induct
Page 7: Supporting Information Biran et al.
Page 11 and 12: A 1 tatatctaaatatttctggacatttctggca
Page 13 and 14: Fig. S5. Localization by real-time
Page 15: Table S4. EC 50 values (nM) of huma

Neurokinin Bs and neurokinin B receptors in zebrafish- potential role ...

Create successful ePaper yourself

Delete template?

Save as template?