- Page 1: UNIVERSIDAD DE SALAMANCA FACULTAD D
- Page 7: DR. JOSÉ MARÍA DÍAZ MÍNGUEZ, PR
- Page 11: Quisiera dar las gracias a todas aq
- Page 15: ÍNDICE
- Page 18 and 19: 4. CONCLUSIONES ………………
- Page 21 and 22: 1.1. Consideraciones generales sobr
- Page 23 and 24: 5 Introducción general 1.2. Hongos
- Page 25 and 26: 7 Introducción general Fig. 1. A.
- Page 27 and 28: 9 Introducción general Europa, ent
- Page 29 and 30: 11 Introducción general B. bassian
- Page 31 and 32: 13 Introducción general genomas de
- Page 33: 15 Introducción general compatible
- Page 37 and 38: 19 Objetivos, metodología, resulta
- Page 39 and 40: 21 Capítulo I Capítulo I. Abundan
- Page 41: 23 Capítulo I aunque se necesitar
- Page 44 and 45: Capítulo I The associations betwee
- Page 46 and 47: Capítulo I Table 1. Endophyte taxa
- Page 48 and 49: Capítulo I similar dsRNA banding p
- Page 50 and 51: Capítulo II M. anisopliae o de hip
- Page 53 and 54:
35 Capítulo II Tick pathogenicity,
- Page 55 and 56:
37 Capítulo II humans (Vial, 2009)
- Page 57 and 58:
39 Capítulo II Growth response to
- Page 59 and 60:
41 Capítulo II RNA viruses can be
- Page 61 and 62:
43 Capítulo II concordance with it
- Page 63 and 64:
% mo rta lity % m ortali ty 45 Cap
- Page 65 and 66:
47 Capítulo II Mortality was signi
- Page 67 and 68:
49 Capítulo II Presence of viruses
- Page 69 and 70:
51 Capítulo II T. cylindrosporum i
- Page 71:
53 Capítulo II in livestock (Polar
- Page 74 and 75:
Capítulo III 4. Estudio de la infl
- Page 77 and 78:
59 Capítulo III Mycoviruses infect
- Page 79 and 80:
61 Capítulo III 2006; Herrero et a
- Page 81 and 82:
63 Capítulo III mixed virus infect
- Page 83 and 84:
65 Capítulo III (Zabalgogeazcoa et
- Page 85 and 86:
67 Capítulo III and the LSD proced
- Page 87 and 88:
69 Capítulo III The above results
- Page 89 and 90:
71 Capítulo III DsRNA3 had a lengt
- Page 91 and 92:
73 Capítulo III Fig. 4. Alignment
- Page 93 and 94:
75 Capítulo III DsRNA influence in
- Page 95 and 96:
77 Capítulo III substrate for coni
- Page 97:
79 Capítulo III a hypothetical mem
- Page 100 and 101:
Capítulo IV Resultados 1. Establec
- Page 102 and 103:
Capítulo IV study of this group of
- Page 104 and 105:
Capítulo IV temperatures that osci
- Page 106 and 107:
Capítulo IV of infected leaf piece
- Page 108 and 109:
Capítulo IV The results obtained d
- Page 110 and 111:
Capítulo V Resultados 1. Incidenci
- Page 113 and 114:
95 Capítulo V Molecular characteri
- Page 115 and 116:
97 Capítulo V (Meyling and Eilenbe
- Page 117 and 118:
99 Capítulo V Table 1. B. bassiana
- Page 119 and 120:
101 Capítulo V cDNA synthesis Stra
- Page 121 and 122:
Results 103 Capítulo V Incidence a
- Page 123 and 124:
105 Capítulo V The heterogeneity o
- Page 125 and 126:
107 Capítulo V strains collected f
- Page 127 and 128:
109 Capítulo V Fig. 6. Genome orga
- Page 129 and 130:
111 Capítulo V Fig. 8. Northern bl
- Page 131 and 132:
113 Capítulo V Spain and Portugal
- Page 133:
115 Capítulo V 2010; Wu et al., 20
- Page 137 and 138:
119 Discusión general 3.1. Inciden
- Page 139 and 140:
121 Discusión general La diversida
- Page 141 and 142:
123 Discusión general 2010). Como
- Page 143 and 144:
125 Discusión general En cuanto a
- Page 145 and 146:
127 Discusión general como B. bass
- Page 147:
129 Discusión general micovirus, p
- Page 151 and 152:
133 Conclusiones 1. Los micovirus s
- Page 153:
5. APÉNDICE
- Page 156 and 157:
Apéndice ctctccccggctcgatgctggttga
- Page 158 and 159:
Apéndice 2082 atcgaggtgggtcgtcctgt
- Page 160 and 161:
Apéndice 4629 ctccctccgcaacacaggga
- Page 162 and 163:
Apéndice gcggttgatggtgatctactatact
- Page 164 and 165:
Apéndice S T H K Q L I S T S D Y E
- Page 166 and 167:
Apéndice gtacgcgtcaatggtgttgaaggct
- Page 168 and 169:
Apéndice S V G R P Q G L A N G P S
- Page 170 and 171:
Apéndice S L L I A S S Y S K G L N
- Page 173 and 174:
155 Bibliografía Aarnio, T.H., Aga
- Page 175 and 176:
157 Bibliografía Eusebio-Cope, A.,
- Page 177 and 178:
159 Bibliografía Herrero, N., Pér
- Page 179 and 180:
161 Bibliografía Melzer, M.S., Ike
- Page 181 and 182:
163 Bibliografía Rodríguez, R.J.,
- Page 183 and 184:
165 Bibliografía Urayama, S., Kato
- Page 185:
167 Bibliografía Zhang, X, Nuss, D