biochemical and haematological profile - Universitatea de Ştiinţe ...

UNIVERSITATEA DE ȘTIINȚE AGRICOLE
ȘI MEDICINĂ VETERINARĂ
“ION IONESCU DE LA BRAD” IAȘI
LUCRĂRI ȘTIINȚIFICE
VOL. 53 (12)
MEDICINĂ VETERINARĂ
PARTEA 1
EDITURA “ION IONESCU DE LA BRAD”
IAȘI 2010

COLEGIUL DE REDACȚIE
Redactor responsabil:
Prof. univ. dr. Gheorghe SOLCAN
Redactor adjunct:
Prof. univ. dr. Octavian Zaharie OPREAN
Membri:
Prof. univ. dr. Corneliu COTEA
Prof. univ. dr. Vasile VULPE
Prof. univ. dr. Mihai CARP‐CĂRARE
Prof. univ. dr. Dan DRUGOCIU
COMISIA DE REFERENȚI ȘTIINȚIFICI
Prof. univ. dr. Octavian Zaharie OPREAN
Prof. univ. dr. Abdelfatah NOUR – Universitatea Pudue, SUA
Prof. univ. dr. H.C. Francois CRESPEAU – ENV Alfort, France
Prof. univ. dr. Gheorghe SOLCAN
Prof. univ. dr. Liviu MIRON
Prof. univ. dr. Gheorghe SĂVUȚA
Prof. univ. dr. Gabriel PREDOI – FMV București
Prof. univ. dr. Ioan Ștefan GROZA – FMV Cluj Napoca
Prof. univ. dr. Gheorghe DĂRĂBUȘ ‐ FMV Timișoara
Prof. univ. dr. Corneliu COTEA
Prof. univ. dr. Mihai CARP‐CĂRARE
Conf. univ. dr. Șerban MOROȘAN – INSERM Paris
Prof. univ. dr. H.C. Liviu RUNCEANU
Prof. univ. dr. Tudor PERIANU
Prof. univ. dr. Ioan COMAN
Prof. univ. dr. Elena VELESCU
ISSN: 1454‐7406
Volumul a fost editat cu sprijinul financiar al
Ministerului Educației, Cercetării, Tineretului și Sportului

PARTEA I
CURPINS
ALINA ANTON, GHEORGHE SOLCAN, VASILE BOGHIAN, NICOLAE HAGIU
BIOCHEMICAL AND HAEMATOLOGICAL PROFILE IN THE ADVANCED GESTATION
PERIOD OF COPPER DEFICIENT HOLSTEIN AND BROWN SWISS CATTLE
ATTIA, H.F AND MAZHER, K
HISTOLOGICAL AND IMMUNOHISTOCHEMICAL STUDIES OF THE BUCK'S PINEAL
GLAND DURING LIGHT AND DARK PERIODS
S. BESCHEA‐CHIRIAC
COMPARATIVE STUDY OF VASCULAR ARTERIAL REACTIVITY AT SEVERAL MAMMAL
SPECIES: . THE REACTIVITY OF ARTERIAL SMOOTH MUSCLES AT THE
VASOCONSTRICTOR AGENTS ANTIDIURETIC HORMONE (VASOPRESSIN)
BOGHIAN V., MĂLĂNCUŞ R.N., ACATRINEI D., PAȘCA S., ANTON ALINA, SOLCAN GH.
MORPHOCLINICAL ASPECTS OF BABESIOSIS IN HORSES
IOANA BURCOVEANU, I. BURTAN, ROXANA TOPALĂ,
L.C. BURTAN, M. FÂNTÂNARIU
KERATOPATHIES IN CARNIVORES: CLINICAL SIGNS AND LOCAL PATHOLOGIC
RESPONSES
HÉLÈNE HUET , DELPHINE FRANKO , CHAKIB DJEDIAT, EVA PEREZ , FRANÇOIS
CRESPEAU , AMAURY DE LUZE
PATHOLOGICAL EFFECTS AND TISSUE DISTRIBUTION OF MICROCYSTIN‐LR (MC‐LR)
AFTER 48 HOURS NON INVASIVE EXPOSITION OF NEWLY HATCHED MEDAKA
(ORYZIAS LATIPES) ELEUTHERO‐EMBRYOS
GH. DĂRĂBUŞ , V. COZMA , K. IMRE , A. BEJAN , M.S.ILIE , MIRELA IMRE
PREVALENCE OF CRYPTOSPORIDIUM SPP. AND OTHER ENTEROPATHOGENS
INFECTIONS AT CALVES IN WESTERN, CENTRAL AND NORTH‐WESTERN ROMANIA
GAL A.F. , CATOI C. , BABA AI , MICLAUS V. , BOLFA P. , TAULESCU M , TABARAN F. ,
NAGY A. , MOUSSA R. , COSMINA CUC
ASPECTS REGARDING VASCULOGENIC MIMICRY IN CANINE MAMMARY CANCER
GRECU MARIANA , NĂSTASĂ V. , MAREŞ M. , MORARU RAMONA, HRIȚCU LUMINIȚA
DIANA , ILIE CORNELIA
ASSESSMENT OF THE ANTI‐INFLAMMATORY ACTION OF THE CARPROFEN‐BETA
CYCLODEXTRINS COMPLEX ON EXPERIMENTAL INFLAMMATION MODEL IN RATS
7
13
20
26
30
36
44
49
60

GROZA I.Ș, GROZA DARIA, PALL EMOKE, CENARIU M., CIUPE SIMONA, LAURA
PARLAPAN
EVALUATION OF DEGREE OF ENGRAFTMENT IN MOUSE MODEL OF STEM CELLS
HARVESTED FROM HUMAN PLACENTA
IONELA HOTEA, GH. DARABUS, C. PACURAR, TATIANA RUGEA, P. MUNTEAN, M.S.
ILIE, K. IMRE, MIRELA IMRE, DENISA SORESCU, ADRIAN BALINT, DINU INDRE
PRELIMINARY STUDY ON THE PREVALENCE OF TOXOPLASMA GONDII INFECTION IN
WILD BOARS FROM TIMIS COUNTY
OLIMPIA C. IACOB, B.C. ŞÎŞCĂ
EPIDEMIOLOGICAL INVESTIGATIONS ON DIGESTIVE PARASITOSIS IN RACING PIGEONS
AND THE RISK OF RELEASING PARASITIC ELEMENTS IN FREE AREAS
MARIANA IONITA , D.K. HOWE , I.L. MITREA , B. STEVENSON , MICHELLE YEARGAN
PRELIMINARY DATA CONCERNING OPTIMIZATION OF A PCR‐BASED METHOD FOR
MOLECULAR DETECTION OF TICK‐BORNE PATHOGENS
ISMAIL, S.F ; ABD AL‐GALIL, A.S.A AND GEHAN, B.A.YOUSSEF
PROPOFOL ANAESTHESIA IN DONKEYS IN COMBINATION WITH CHLORAL HYDRATE
ADINA MARIA MANEA, S. E. GEORGESCU, STELIANA KEVORKIAN, SORINA DINESCU,
MARIETA COSTACHE
GENOTYPING ESTROGEN RECEPTOR POLYMORPHISM IN PIGS, USING THE PCR‐RFLP
METHOD
MICLĂUŞ V ., ANNE CLAUDIA ŞTEFĂNUȚ , ADRIANA MUREŞAN , C. OBER , V. RUS
COMPARATIVE TESTING OF SOME EXPERIMENTAL MODELS OF OXYGEN INDUCED
RETINOPATHY IN YOUNG RATS. HISTOLOGICAL STUDY.
MOUSSA RAOUAD.,C CATOI., B SEVASTRE., M TAULESCU., P BOLFĂ., A GAL., ,F.A
TABARAN., A.L NAGY.,C CUC.
EXPRESSION OF THE VIMENTIN MARKER IN DOG MELANIC CUTANEOUS TUMORS
S.OANCEA , G.PAVEL , A.V.OANCEA
ON THE SHAPE OF THE ERYTHROCYTES FROM SOME HERBIVORE MAMMALS
S.OANCEA , S.PADUREANU , A.V.OANCEA
IDENTIFICATION OF PATHOLOGICAL STATES BASED ON RED BLOOD CELL
AGGREGATION
OPREAN O.Z. , GHEBAN DIANA , FORNA NORINA CONSUELA , ŞINDILAR E.V. ,
GRĂMADĂ S.
STRUCTURAL MODIFICATIONS OF THE ORAL MUCOSA AND THE DENTAL APPARATUS
INDUCED BY SOME DRUGS IN LABORATORY MICE
EMOKE PALL , GROZA I. , CENARIU M. , CRISTINA ILEA , OLGA SORITAU , CIPRIAN T .,
BERCE C .
ISOLATION, CHARACTERIZATION, PHENOTYPIZATION AND DIFFERENTIATION OF STEM
CELLS FROM RAT PLACENTA
65
70
74
87
96
103
107
115
121
127
131
141

DUMITRIȚA RUGINA, ADELA PINTEA, ANDREA BUNEA, RALUCA POP, SANDA
ANDREI
LUTEIN PREVENTS HIGH GLUCOSE INDUCED OXIDATIVE STRESS IN HUMAN RPE CELLS
TRIF ALEXANDRA , DUMITRESCU EUGENIA , PETROVICI SNEJANA
ALUMINIUM SULPHATE IMPACT ON FUNDAMENTAL BIOMARKERS OF REPRODUCTIVE
FUNCTIONALITY IN FEMALE RATS (SUCKLING PERIOD EXPOSURE)
WAEL M. EL‐DEEB, S.M. EL‐BAHR
IMPROVEMENT OF GLUCOSE CONCENTRATION, LIPOPROTEIN PROFILE AND
ANTIOXIDANT BIOMARKERS IN BLOOD OF NATURALLY DIABETIC BITCHES
ADMINISTERED INSULIN WITH VITAMIN C OR VITAMIN E
WAEL M. EL‐DEEB, ABD EL‐AZIZ ALMUJALLI, S. M. EL‐BAHR
INVESTIGATION OF SELECTED BIOCHEMICAL INDICATORS OF EXERTIONAL
HABDOMYOLYSIS IN ARABIAN HORSES: PRO‐INFLAMMATORY CYTOKINES AND
OXIDATIVE STRESS MARKERS
IHAB EL_ZOGHBY, AHMED KASSAB
THE PARS DISTALIS (ANTERIOR PITUITARY) IN ONE‐HUMPED CAMEL (CAMELUS
DROMEDARIUS ) : A MORPHOLOGICAL STUDY
IHAB M. EL‐ZOGHBY
LIGHT AND ELECTRON MICROSCOPE STUDIES OF THE ADRENAL GLANDS OF THE
EGYPTIAN GEESE (ALOPOCHEN AEGYPTIACUS)
PARTEA II
GEHAN SAID AHMED AFIFY
DETERMINATION OF SOME ANTIMICROBIAL RESIDUES IN CHICKEN MEAT AND
GIBLETS.
ADRIANA ANIȚĂ, DRAGOȘ ANIȚĂ, GHEORGHE SAVUȚA
RESEARCHES REGARDING THE SEROPREVALENCE OF SWINE HEPATITIS E VIRUS
INFECTION IN THE EAST OF ROMANIA
DRAGOȘ CONSTANTIN ANIȚĂ, ADRIANA ANIȚĂ, GHEORGHE SAVUȚA
SEROEPIDEMIOLOGICAL STUDY REGARDING INFECTIOUS BOVINE RHINOTRACHEITIS
IN COUNTIES FROM NORTH OF MOLDOVA REGION
CRISTINA BULBAŞA (PANAITE), D. DRUGOCIU, DANA DRUGOCIU, PANAITE C.G.
USING SOMATIC CELLS COUNT AND BACTERIAL COUNT TO EVALUATE MILK
PRODUCTION IN ONE DAIRY FARM IN IASSY COUNTRY
PRIMIANI EDIANINGSIH, JAN ALEX SIWI
SELECTION RESPONSES OF ALABIO DUCK (ANAS PLATIRINCHOS BORNEO)
PRODUCTION IN INTENSIVE MAINTENANCE SYSTEM
145
153
158
170
183
195
213
219
222
226
230

EL‐ KOMY. A.A.A, EL‐ZOGHBY. R.R, ABD‐EL‐AZEM .M.A.
TERATOLOGICAL AND PATHOLOGICAL STUDIES OF CEFOPERAZONE IN FEMALE
ALBINO RATS
SERGIU EMIL GEORGESCU, MARIA ADINA MANEA, STELIANA KEVORKIAN, MARIETA
COSTACHE
A NEW METHOD FOR ANALYZING THE AGOUTI LOCUS INVOLVED IN THE COAT
COLOUR OF HORSES
CRISTINA HORHOGEA, IVONA LAIU, CRISTINA RÎMBU, MIHAI CARP – CĂRARE
FELINE INFECTIOUS PERITONITIS – CASE PRESENTATION
STELIANA ELVIRA MARIA KEVORKIAN, S. E. GEORGESCU, MARIA ADINA MANEA,
MARIA GEORGIANA GAVRILA, G. HRINCA, MARIETA COSTACHE
THE SPIDER LAMB SYNDROME ABSENCE IN FIVE ROMANIAN SHEEP BREEDS
HENDRONOTO ARNOLDUS WALEWANGKO LENGKEY, LOVITA ADRIANI
IMPLICATION EFFECT OF PROBIOTIC BACTERIA TO YOGHURT QUALITY AND ENZYME
ACTIVITIES
LOVITA ADRIANI, HENDRONOTO A.W. LENGKEY
PROBIOTIC BACTERIA AS YOGHURT STARTER AND ITS IMPLICATION EFFECT TO THE
PATHOGENIC AND NON PATHOGENIC BACTERIA IN MICE GASTROINTESTINAL
INA IULIANA MACOVEI, S. MANOLESCU, CRISTINA RÎMBU, S. PASCA, G. DRAGAN,
GH.SAVUȚA
STUDY OF AN OUTBREAK OF FOWL TYPHOID IN PHEASANTS
CRISTINA RÎMBU, ELEONORA GUGUIANU, GH. SOLCAN, CRISTINA HORHOGEA,
E.V. ȘINDILAR, C‐TIN. PAVLI, C. CARP‐CĂRARE
CONSIDERATIONS ON THE ASSOCIATION OF PERIODONTAL DISEASE WITH OTHER
ORGANIC DISEASES IN DOGS AND CATS
ROOSTITA L. B., CISSY R. P., ERIC F.S., SRI M., HENDRONOTO A. W. L.
THE INFLUENCE OF SEASONAL CHANGE TOWARDS THE NUMBER OF OUTBREAKS AND
POULTRY DEATH RATE CAUSED BY AVIAN INFLUENZA AT BANDUNG DISTRICT
GH.SAVUȚA , IULIANA ONIȚĂ, ADRIANA ANIȚĂ, D. ANIȚĂ, LUANDA LUDU,
BEJANARIU ANA
EPIDEMIOLOGICAL INVESTIGATIONS IN THE EAST OF ROMANIA REGARDING THE
SEROPREVALENCE OF INFLUENTZA A TYPE VIRUSES IN DIFFERENT SPECIES OF
ANIMALS
JAN ALEX SIWI, PRIMIANI EDIANINGSIH AND DUDUNG MULLIADI
PERFORMANS GENETIC QUALITATIVE AND QUANTITATIVE OF THIN TAIL SHEEP AND
PRIANGAN SHEEP
N. STARCIUC., NATALIA OSADCI., I. SCUTARU., T. SPATARU.
THE OUTBREAKS OF INFECTIOUS BRONCHITIS OF CHICKENS IN PRIVATE POULTRY
FARM
236
246
249
254
259
262
267
271
278
282
286
294

OANA RALUCA STRUGARU, FILIPPO TURRINI, ALESSANDRA SCAGLIARINI, ELENA
VELESCU
THE DETECTION OF ORF VIRUS BY PCR AT THE RUMINANS OF ROMANIA
ALINA VLAD SABIE, VIOREL FLORIŞTEAN, CARMEN CREȚU, MIHAI OBADĂ, CĂTĂLIN
CARP‐ CĂRARE, MIHAI CARP‐ CĂRARE
DETECTION AND QUANTIFICATION OF SALMONELLA SPP. AND CAMPYLOBACTER
JEJUNI ON POULTRY CARCASSES
BY REAL‐TIME PCR
MOHAMED YOUSEF RAMADAN AND ABLA DESOKY ABDEL‐MAGEID
EPIDEMIOLOGICAL STUDY OF ECTOPARASITES IN STRAY DOGS IN KALUBYIA
GOVERNORATE OF EGYPT WITH A SPECIAL REFERENCE TO ITS CONTROL IN PUPPIES
BY DELTAMETHRIN AND IVERMECTIN
MARIA ZAMORNEA, D. ERHAN, Ş.RUSU, NINA TĂLĂMBUȚĂ, O.CHIHAI, VIORICA
COADĂ
ESTIMATION OF VEGETAL EXTRACTS EFFICIENCY IN DOMESTIC BIRDS
ECTOPARASITOSES TREATMENT AND PROPHYLAXIS
297
300
307
318

BIOCHEMICAL AND HAEMATOLOGICAL PROFILE IN THE
ADVANCED GESTATION PERIOD OF COPPER DEFICIENT HOLSTEIN
AND BROWN SWISS CATTLE
Alina ANTON, Gheorghe SOLCAN, Vasile BOGHIAN, Nicolae HAGIU
Faculty of Veterinary Medicine Iasi
Alley Mihail Sadoveanu nr.8; Iasi – 700489, Romania; antonclaraalina@yahoo.com
10 Holstein and 10 Brown Swiss cattle in advanced gestation period, clinically healthy, from a
farm from Romania were divided into 2 groups according to breed (group 1 = Holstein, group 2 =
Brown Swiss) with the aim of evaluating the copper status and correlating these status with
haematological and biochemical profiles.Ceruloplasmin concentrations (the primary Cu‐
containing component of the blood) have been considered as reliable indicators to copper
status.During the protocol, no statistically significant differences were noted in the hematological
and biochemical parameters in Holstein versus Brown Swiss cattle, remaining within their
physiological adult reference range, except plasma ceruloplasmin.These were below cattle
reference range for all 20 cattles.
In our study, the values of plasma ceruloplasmin were significantly increased (P < 0,05) in Brown
Swiss cattle (54.97 ± 15.62 mg/L) than Holstein cattle (40.60 ± 5.18 mg/L), probably due to
genetic predisposition.
Keywords: ceruloplasmin, copper, haematology, blood biochemistry, cattle
Copper is the rate – limiting element in the synyhesis of ceruloplasmin, a glycoprotein that is
synthetized in the liver. Ceruloplasmin concentrations (the primary Cu‐containing component
of the blood) have been considered as reliable indicators to copper status (Jain, 1993). Close
correlation between plasma ceruloplasmine and copper concentration have been reported in
many animal species in cluding sheep, cattle and horses (Arthington et al., 1996; Cerone et al.,
1998).
The aim of the present study was to determine the copper status and the correlation between
these status and haematological and biochemical profiles.
MATERIAL AND METHODS
The present study was carried out on a private farm from Nord‐East of Romania.
Blood samples were collected from 20 cattle in the advanced gestation period grouped by
breeds (group 1 = Holstein, group 2 = Brown Swiss). The animals were clinically normal and
free from any external, and internal parasites. They were fed with corn silage, concentrates
and hay. The animals were supplemented with 250 g/day of a commercial mineral and vitamin
mix. The basal diet was analyzed to contain 9 mg of copper/kg dry matter intake.
Blood samples were collected from the coccygeal vein into heparinized vacutainers for plasma
and uncoated vacutainers for serum. The samples were analysed for glucose, urea nitrogen
(BUN), β‐hydroxybutyrate (β‐OHB), cholesterol, calcium (Ca), phosphorus (P), magnesium
(Mg), alkaline phosphatase (PA), total protein (Pt), albumin (Alb), globulin (Gb), plasma
ceruloplasmin (Cerlp) and plasma haptoglobin (Hapt). Serum levels analysis and plasma were
performed in an automatic biochemical Cormay Accent 200.
7

Lucrări Științifice – vol 53 seria Medicină Veterinară
About 2 ml blood was sampled into small vacutainers containing a dried anticoagulant (EDTA‐
K) and gently mixed for hematological parameter determinations.
Haematological analyses included red blood cells (RBC), haematocrit (Htc), haemoglobin (Hb),
mean cell volume (VEM), mean cell haemoglobin (HEM), mean cell haemoglobin concentration
(CHEM), white blood cells (WBC) and number of platelets. The samples were analysed in an
automated cell counter (Animal Blood Counter Vet) for complete blood count. Differential
leukocyte count was performed microscopically on Giemsa stained blood film.
Statistical analysis was conducted using SPSS 16 for windows. Breeds effect was examined
using Student`s t‐Test. Mean values and standard deviations were calculated from individual
values. The relationship between ceruloplasmin and haematological and biochemical
parameters was calculated through Pearson correlation test.
RESULTS AND DISCUSSION
The values are discussed in relation with the published reference ranges for adult cattle. The
mean (SE) values of RBC, Hb, Htc, VEM, HEM and CHEM at Holstein and Brown Swiss cattle in
advanced gestation are shown in table 1. Regarding RBC, Hb, Htc, VEM, the most elevated
values were observed in Brown Swiss cattle, but the differences were not statistically
significant (P > 0.05). Pregnancy causes minor changes in RBC and WBC concentrations. As
pregnancy advanced, erythrocyte number increased slightly (Wood and Quiroz‐Rocha, 2010).
The lowest values of HEM (16,12 ± 1,23 pg) and CHEM (32,06 ± 1,39 %) have been observed in
Brown Swiss cattle but the differences were not statistically significant (P > 0.05). The same
situation was observed at number of platelets when Holstein cattle showed elevated values
(315 ± 118,21 x 10³/µL) compared with Brown Swiss cattle (227,4 ± 91,84 x 10³/µL) but the
differences were not statistically significant.
During the entire study, the RBC , Hb, Htc, VEM, HEM, CHEM and platelets at Holstein and
Brown Swiss cattle were placed in physiological limits for adult cattle.
In the present study, Pearson correlation test did not show an association (P > 0.05) between
ceruloplasmin values and RBC, Hb, Htc, VEM, HEM and CHEM.
Table 1.
Mean (SE) values of RBC, Hb, Htc, VEM, HEM and CHEM at Holstein and Brown Swiss cattle
in advanced gestation
Cattle
RBC
(x 10 6 /µL)
Hb
(g/dL)
Htc
(%)
VEM
(fL)
HEM
(pg)
CHEM
(%)
Holstein 6,12±0,65 9,98±0,40 29,5±1,47 48,4±3,20 16,38±1,12 33,82±0,85
Brown Swiss
Normal values
6,53±0,63 10,42±0,3 32,64±1,39 50,2±3,34 16,12±1,23 32,06±1,39
for cattle
(after Kramer,
2000)
5‐10 8‐15 24‐46 40‐60 11‐17 30‐36
The mean (SE) values of WBC, Lymph (lymphocytes), Mon (monocytes), Neutroph
(neutrophils), Eos (eosinophils) at Holstein and Brown Swiss cattle in advanced gestation are
shown in figure1.
In the present study, mean values of WBC were within the adult reference range (4‐12 x
10³/µL) (Kramer, 2000).
8

Universitatea de Științe Agricole și Medicină Veterinară Iași
Regarding the number of monocytes there were observed higher values (0,38 ± 0,14 x 10³/μL)
in Holstein cattle, compared with Brown Swiss cattle (0,26 ± 0,08 x 10³/μL), but the differences
were not statistically significant.
In the present study, the mean values of lymphocites were below cattle reference range 2,5‐
7,5 x 10³/μL (Kramer, 2000) for the 2 groups, and the mean values of neutrophils were higher
than cattle reference range 0,6‐4,12 x 10³/μL (Kramer, 2000). In the periparturient period,
cows typically have an stress leukogram characterized by a neutrophilia, lymphopenia,
eosinopenia, and monocytosis. Several studies have shown shifts in proportions of different
lymphocyte populations at the time of parturition. These changes may be partly related to
nutritional status and other health parameters, but pregnancy and lactation appear to have
the primary effect (Torquist and Rigas, 2010)
Pearson correlation test did not show an association between ceruloplasmin values and the
values of leukogram.
Figure 1. Mean (SE) values of WBC, lymphocytes, monocytes, neutrophils and eosinophils at
Holstein and Brown Swiss cattle in advanced gestation
Cattle
Holstei
n
Brown
Swiss
Normal
values
for
cattle
Mean (SE) values of GGT, AST, PA, glucose, β‐OHB, BUN and cholesterol at
Holstein and Brown Swiss cattle in advanced gestation
GGT
UI/L
42,12±12,3
9
30,38±11,3
0
15‐38
(after
Smith,
2009)
AST
UI/L
PA
UI/L
Glucose
mg/dL
81,07±07 32,4±17,43 51,28±6,33
57,20±6,5
6
43‐127
(after
Smith,
2009)
25,04±10,2
3
0‐500
(after
Radostits,
2007)
55,16±10,0
1
45‐75
(after
Radostits,
2007)
β‐OHB
mmol/L
0,82±0,1
8
0,98±0,2
8
0,35‐
0,47
(after
Smith,
2009)
BUN
mg/dL
13,48±3,0
7
8,73±3,31
6‐27
(after
Radostits,
2007)
Table 2.
Cholesterol
mg/dL
138,98±27,2
3
118,12±32,5
3
65‐220
(after
Radostits,
2007)
In the present study the levels of AST, PA, glucose, BUN and cholesterol were consistent with
the amounts in cattle and the differences between breeds were not statistically significant (P >
0.05). The mean (SE) values of GGT, AST, PA, glucose, β‐OHB, BUN and cholesterol at Holstein
and Brown Swiss cattle in advanced gestation are shown in table 2. The higher values of GGT
9

Lucrări Științifice – vol 53 seria Medicină Veterinară
in Holstein cattle indicated cholestasis. The higher values of β‐OHB in Holstein cattle and lower
values of glucose may suggest a subclinical ketosis.
In the present study, Pearson correlation test did not show an association (P > 0.05) between
ceruloplasmin values and GGT, AST, PA, glucose, β‐OHB, BUN and cholesterol.
During the entire study, the total protein, albumin and globulin (figure 2) at Holstein and
Brown Swiss cattle were placed in physiological limits for adult cattle and the differences
between breeds were not statistically significant (P > 0.05).
In the present study, Pearson correlation test did not show an association (P > 0.05) between
ceruloplasmin values and Pt, Alb and Gb.
Figure 2. Mean (SE) values of total protein (Pt), albumin (Alb) ang globulin (Gb) at
Holstein and Brown Swiss cattle in advanced gestation
The mean (SE) values of Ca, P and Mg at Holstein and Brown Swiss cattle in advanced gestation
are shown in figure 3. In the present study phosphorus and magnesium at Holstein and Brown
Swiss cattle were placed in physiological limits for adult cattle. The mean (SE) values of calcium
were lower for Holstein and Brown Swiss cattle, than reference values and the differences
between breeds were not statistically significant (P > 0.05).It has been shown that plasma
calcium of 5 mg/dL reduce abomasal motility by 70 % and the strength of the contraction by
50 % (Daniel, 1983). Clearly a reduction in muscle contractility will lead to a decrease in dry
matter intakes as rumen function decrease, leading to a severe negative energy balance. As a
consequence, there is an increase in fat mobilisation that may result in fatty liver syndrome
and ketosis. An excess of ketone bodies can further suppress appetite (Grummer, 1996). Thin
cattle in a negative energy balance are unable to perform at maximum capacity in the herd
(Anton and Solcan, 2008). Hypocalcaemia occurs when the rate of calcium uptake into the
mammary gland for milk production is greater than that which is absorbed from the diet or
resorbed from bone (Wilde, 2006)
In the present study, Pearson correlation test did not show an association (P > 0.05) between
ceruloplasmin values and Ca, P and Mg.
Haptoglobin (protein that increases in acute inflammation) (figure 4) was within the adult
reference range 0‐0,4 g/L (Radostits, 2007). Plasma haptoglobin showed the similar values at
Holstein and Brown Swiss cattle. Pearson correlation test did not show an association between
ceruloplasmin and haptoglobin values.
10

Universitatea de Științe Agricole și Medicină Veterinară Iași
Figure 3. Mean (SE) values of calcium (Ca), phosphorus (P) and magnesium (Mg) at
Holstein and Brown Swiss cattle in advanced gestation
Figure 4. Mean (SE) values of haptoglobine (Hapt) at
Holstein and Brown Swiss cattle in advanced gestation
In the present study, plasma ceruloplasmin (figure 5) were below cattle reference range 120‐
200 mg/L (Radostits, 2007) for all 20 cattle. The diet containing 9 mg of Cu/kg of DM, was near
by the inferior copper limits for adult dairy cattle (9‐18 ppm) (NRC, 2001). The improvement in
nutritional status should improve milk production of the cattle as well as health performance
of the animals (Anton and Solcan, 2008).
*Significant difference with Holstein cattle sampling.
Figure 5. Mean (SE) values of ceruloplasmin (Cerlp) at
Holstein and Brown Swiss cattle in advanced gestation
Dashed lines represent reference values for adult cattle
Plasma ceruloplasmin activity is decreased by copper deficiency, the relative activity of this
enzyme increases during infection and inflammation (Neve et al. 1988). Large quantities of Cu
are deposited in the fetus during late gestation, and this can decrease Cu status of the dam if
dietary Cu is low (Gooneratne and Christensen, 1989). The lowest levels of plasma
ceruloplasmin were found in Holstein cattle 40,60 ± 5,18 mg/L but the differences were not
11

Lucrări Științifice – vol 53 seria Medicină Veterinară
statistically significant (P > 0.05) compared to Brown Swiss cattle. The reduction of digestive
capacity in advanced gestation may limit copper intake for the cattle and fetus needs.
Plasma ceruloplasmin may show a genetic difference in Cu absorption and metabolism
postabsorption between Holstein and Brown Swiss breeds. The genetic difference may be
related to the efficiency of dietary Cu absorption, the excretion of endogenous Cu, or amount
of feed intake (Du et al., 1996).
CONCLUSIONS
1) Pearson correlation test did not show an association between ceruloplasmin and
biochemical and haematological measurements in the advanced gestation.
2) Copper deficiency in Holstein and Brown Swiss cattle was not sufficient to cause
hypochromic and microcytic anemia.
3) The diet containing 9 mg of Cu/kg of DM, did not meet the requirements of Holstein and
Brown Swiss cattle in advanced gestation.
4) Plasma ceruloplasmin were below cattle reference range 120‐200 mg/L for all 20 cattle, but
the lowest levels of plasma ceruloplasmin were at Holstein group 40,60 ± 5,18 mg/L.
REFERENCES
1. Anton A.,Solcan G., 2008 ‐ Body condition scoring with Romanian Black Pie dairy cow, Scientific
works, Univ. of Agr. Sci. And Vet. Med. Bucharest, C series, Veterinary Medicine, 53, p. 12‐15.
2. Arthington J.D., Corah L.R., Blecha F., 1996 ‐ The effect of molybdenum induced copper
deficiency on acute phase protein concentrations, superoxide dismutase activity, leukocyte
numbers and lymphocyte proliferation în beef heifers inoculated with bovine herpes virus 1, J.
Anim. Sci., vol. 74, p. 211‐217.
3. Cerone S.I., Sansinanea A.S., Streitenberger S.A., Garcia M.C., Auza N.J., 1998 ‐ The effect of
copper deficiency on the peripheral blood cells of cattle, Vet. Res. Commun, 22, p. 47‐57.
4. Du Z., Hemken R.W., Harmon R.J., 1996 – Copper metabolism of Holstein and Jersey cows and
heifers fed diets high in cupric sulfate or copper proteinate, J. Dairy Sci., vol. 79, p. 1873‐1880.
5. Gooneratne S.R., Christensen D.A., 1989 – A survey of maternal copper status and fetal tissue
copper concentrations in Saskatchewan bovine, Can. J. Anim., vol. 69, p. 141‐150.
6. Grummer R.R., 1996 – Close‐up dry period: feeding management for a smooth transition. In:
Proceedings WCDS, Red Deer, Alberta.
7. Jain N.C., 1993 – Essentials of veterinary hematology, Ed. Lea and Febiger, Philadelphia, p. 173‐
175.
8. Kramer J.W., 2000 ‐ Normal hematology of cattle, sheep and goats. In: Schalm’s veterinary
hematology. 5 th ed. Philadelphia: Lippincott Williams and Wilkins, p. 075‐84.
9. National Research Council, 2001 ‐ Nutrient requirements of dairy cattle. 7 th rev. ed. Natl. Acad.
Sci. Washington, D.C., p. 236‐267
10. Radostits O.M., Gay C.C., Blood D.C., Hinchcliff K.W., 2007 ‐ Veterinary Medicine. A textbook of
the diseases of cattle, sheep, pigs, goats and horses, Ed. Saunders W.B. Co.,Philadelphia, 10 th
ed., p. 1707‐1732.
11. Smith B.P., 2002 ‐ Large animal internal medicine 3 th. ed. Mosby, London, Philadelphia, Sydney,
Toronto, p. 783‐786.
12. Wilde D., 2006 – Influence of macro and micro minerals in the peri‐parturient period on fertility
in dairy cattle, Animal Reproduction Science, vol. 96, p. 240‐249.
13. Wood D., Quiroz‐Rocha G.F., 2010 – Normal hematology of cattle, In: Schalm’s veterinary
hematology. 6 th edition, Blackwell Publishing, Iowa, p. 829‐835.
14. Tornquist S., Rigas J., 2010 – Interpretation of ruminant leukocyte responses, In: Schalm’s
veterinary hematology. 6 th edition, Blackwell Publishing, Iowa, p. 307‐320.
12

HISTOLOGICAL AND IMMUNOHISTOCHEMICAL STUDIES OF THE
BUCK'S PINEAL GLAND DURING LIGHT AND DARK PERIODS
Attia, H.F and Mazher, K
Department of Histology and Cytology, Faculty of Veterinary Medicine,
Benha and Beni‐Suef Universities
Corresponding author: Hossam Attia, Benha University. Egypt.P.O. 13736
Abstract: the present investigation was conducted on the pineal organs of 12 healthy bucks. Sixth
samples collected during dark period (at mid night) while the other six collected during light
period (at noon).The samples were processed and prepared for light and electron microscopic
examination. The pineal organ of bucks was surrounded by a thin fibrous capsule, the pia matter,
while the parenchyma was supported by extensive reticular network.The parenchyma of the
gland was formed of clusters or groups of pinealocytes intermingled with astroglia cells. Bundles
of unmyelinated nerve fibers were noticed in the organ. During dark period the pinealocytes
were large in size with finely granular cytoplasm containing well developed rER, mitochondria
and many secretory granules. Long branched cytoplasmic processes arised from the pinealocytes
to terminate near blood vessels or synapse with a nerve. The pinealocytes reacted positively with
antimelatonin antibodies. During the light period the pinealocytes appeared smaller in size with
clear non granular cytoplasm. The pinealocytes ahowed a very slight reaction to the
antimelatonin antibodies.
Keywords: buck, pineal gland, histology, immunostochemistry
INTRODUCTION
During the last few years, the study of the pineal gland (epiphysis cerebri) attracts the
attention of many authors at different aspects of biological sciences specially the histologists
and the physiologists.
Historically, the location of the pineal gland deep in the brain suggested to the philosophers
that it is a mystery gland with myth, superstition and metaphysical theories surrounding its
perceived function. Descartes (2002&2003) called it the seat of the soul. He believed that the
gland is the point of connection between the intellect and the body.
The pineal gland is occasionally associated with the sixth chakra (also called Ajna or third eye
chakra in yoga) or sometimes seventh chakra (crown). It is believed to be a dormant organ
that can be awakened to enable telepathic communications (Uz, et al , 2003).
Arendt and Skene (2005) discovered that melatonin, the most potent compound then known
to lighten frog skin, was present in highest concentration in the pineal body and its production
is stimulated by darkness and inhibited by light.
Histologically, the pineal gland of rat, pig, fish, bird, rabbit and hamster is thoroughly studied
by Ferreira‐Medeiros, et al (2007), Przyblyska‐Gornowicz and Lewczuk (1997), Hafeez (2005),
Ueck (1973), Romijn (1973) and matsushima, et al (1990) respectively while that of goat not
yet investigated.
Our study aimed to elucidate the light and electron microscopic pictures of pineal gland of the
buck beside the immunohistochemical localization of melatonin in the gland during dark and
light periods.
MATERIALS AND METHODS
Twelve healthy bucks aging 10‐12 months‐old were subjected to the present investigation. The
animals were subjected to a photoperiod of 12 hours dark and 12 hours light from rearing up
to the time of slaughtering. Six animals were sacrificed at midnight (at 12 O'clock) while the
13

Lucrări Științifice – vol 53 seria Medicină Veterinară
other six were sacrificed at noon (at 12 O'clock). The skull is opened carefully and the whole
brain is taken, then the cerebral hemispheres were gently removed and excluded while the
remained part was sagitally sectioned through the pineal body then quickly put into 20%
neutral buffered formalin. After fixation the specimens were processed to obtain histological
sections of about 4‐6 micrometers‐thick to be stained with hematoxylin and eosin, Gomori
reticulin method, silver impregnation technique and indirect immunoperoxidase
antiperoxidase PAP unlabelled antibody method using STAT polyclonal kits from diagnostic
Products Corporation, Los Angelos, USA. The above mentioned methods were applied as
outlined by Drury and Wallington (1980) and Bancroft and Steven (1995).
For electron microscopic examination, small pieces 1mmX1mm of the collected specimens
were fixed in 3% glutraldhyde in 1M phosphate buffer (pH=7.3) for 24 hours then post fixed in
1M cold phosphate buffered 1% osmium tetroxide (pH=7.3) for 3 hours, rinsed in phosphate
buffer then dehydrated (Hayat,1986). Ultra thin sections were obtained and mounted on
cupper grids then stained with uranyl acetate and lead citrate (Reynolds, 1965) to be
examined by Joel 100 CX transmission electron microscope in the unit of electron microscopy,
Assuit University.
RESULTS
The pineal gland was covered by a thin fibrous capsule, the pia matter, from which very short
septa penetrate the gland. Extensive network of reticular fibers were noticed among the
parenchymatous elements (Fig.1). The parenchymal cells were arranged in clusters, columns,
rows or irregular groups permeated by many blood capillaries (Fig.2). Pineal sands, a small
calcified dark patches, also noticed in the pineal parenchyma. Bundles of unmyelinated nerve
fibers run in different directions in the parenchyma of the gland supported by glia cells
(Figs.3&4).
The parenchymal cells took different characteristic features according to light or dark periods.
During dark period (at midnight)
The gland appeared highly vascularized and the blood vessels became engorged with blood.
The pinealocytes appeared large polyhedral cells with faintly stained and finely granular
cytoplasm (Fig.5). The nuclei appeared large spherical, vesicular and somewhat eccentrically
situated with a prominent nucleolus.
The pinealocyte showed multiple (4‐6) branched cytoplasmic processes which either
terminated in flattened dilatations adjacent to blood capillaries or synapses with nerve fibers
(Fig.6).
The pinealocyte appeared large and slightly electron dense cell containing a large euchromatic
nucleus with a prominent nucleolus. The cytoplasm contained a well developed rough
endoplasmic reticulum, Golgi complex, many rounded and filamentous mitochondria and
numerous free ribosomes. Secretory granules of variable shapes and sizes as well as fat
droplets were also noticed (Fig.7).
By using indirect immunoperoxidase technique the pinealocytes showed a strong positive
reaction to the antimelatonin antibodies (Fig.8).
The astroglial cells appeared elongated or oval cells irregularly distributed between the
pinealocytes. They had oval darkly stained centrally situated nuclei in a scant cytoplasm (Fig.5).
These cells possessed numerous short and branched cytoplasmic processes (Fig.6).
14

Universitatea de Științe Agricole și Medicină Veterinară Iași
During the light period (at noon)
The pinealocytes became smaller in size , polyhedral in shape and the cytoplasm became
lighter in stain and non granular (Fig.9). The nuclei remain spherical, vesicular and eccentric
with a prominent nucleolus. The blood vessels became smaller in caliper and not engorged
with blood.
The pinealocytes appeared more electron lucent, free from secretory granules and the nucleus
became slightly irregular in outline. The profiles of the other organelles remained as the
previous stage (Fig.10).
By using the indirect immunohistochemical technique the pinealocytes showed a very faint or
slight reaction to the antimelatonin antibodies (Fig.11).
DISCUSSION
The epiphysis cerebri has a very interesting histological structure based on its unique
anatomical position. It is generally accepted that the pineal body develop as an upward
growth from the diencephalon to which it is connected by a short stalk (Ferreira‐Medeiros et
al. 2007 and Borregon et al. 1997).
The gland under investigation was covered by a thin fibrous capsule, the pia matter, from
which short septa penetrate the gland as mentioned by Hafeez (2005); Kus et al. (2004) and
Reus et al. (1990). The parenchymatous elements of the gland were supported by an extensive
network of reticular fibers (Borregon et al. 1997). Beside its role as a protective coat, the
fibrous stroma carry blood vessels, lymph and nerve supply of the gland (Kus etal. 2004).
There is a general agreement that the histological picture of the pineal parenchyma differs
according to light or dark period to which the individual exposed (Ferreira‐Medeiros et
al.2007; Kus et al. 2004 and Matsushima et al 1990). The authors stated that the gland
becomes well developed with a pronounced proliferation and activity of its parenchymal cells
during dark period while during light, the activity of the gland is greatly decreased. In this
respect, our study revealed that the pinealocytes of the glands collected during dark period
showed a marked proliferation as they become larger in size with finely granular cytoplasm
together with a marked congestion of the pineal blood vessels. The above mentioned
histological signs indicate a higher activity of the organ (Macchi and Bruce 2004). Moreover,
the pinealocytes showed a well developed rough endoplasmic reticulum, Golgi complex as
well as many mitochondria as mentioned by Ueck (1973) and Oksche et al. (1972). The authors
explained the role of each of these organelles in the secretory activity of the cell. The presence
of electron dense secretory granules as well as lipid droplets in the cytoplasm of pinealocytes
of buck at dark periods is an absolute sign of the increased secretory activity of the gland as
explained by Uria et al. (1992) and Owman and Rudeberg (1970). The pinealocytes of buck
showed long and branched cytoplasmic processes which either terminate in a flat dilatation
adjacent to blood capillaries or synapses with unmyelinated nerve. Similar observations were
also reported by Reuss et al. (1990) and Oksche et al. (1972). The latter explained the role of
cytoplasmic processes in the secretion on the other hand Mutsushima et al. (1990) explained
them as stimuli receivers. Both opinions could be met in the buck pineal where the
cytoplasmic processes joining blood capillaries play a role in secretion while that synapses with
nerve act as stimuli receivers.
The immunohistochemical reaction in our study augments the electron microscopic findings
and indicates that the buck pinealocytes produce considerable amount of melatonin during
darkness as stated by most researchers studying the pineal gland. Alexandr (1970) and Moore
et al. (1967) mentioned that the production of melatonin by the pineal gland is stimulated by
15

Lucrări Științifice – vol 53 seria Medicină Veterinară
darkness and inhibited by light. Photosensitive cells in the retina detect light and directly signal
the suprachiasmatic nucleus and extending it to the 24 hours clock. Fibers from SCN to the
paraventricular nucleus which relay the circadian signals to the spinal cord and out via
sympathetic system to the superior cervical ganglia and from these to the pineal gland.
Barrenefxe et al. (2004) and Ekstron and Meissl (2003) stated that melatonin is synthesized
from amino acid tryptophan within the pinealocytes during darkness and it is said to have
neurological properties for resynchronization of sleep and circadian rhythms disturbances. In
the periphery, melatonin is also involved in the regulation of several complex cycles as
seasonal reproduction, body weight and energy balance. Arendt and Skene (2005) decided
that exogenous melatonin has sleeping‐inducing and temperature‐lowering effects during
biological daytime and when suitably timed it will shift the phase of human circadian clock
(sleep, endogenous melatonin, core body temperature and cortisol) to earlier (advance phase
shift) or later (delay phase shift) times.
As mentioned by Borregon et al. (1993) the astroglial cells appeared oval or elongated with
short and branched cytoplasmic processes. The authors suggest a supportive role of the glial
cells while Ekstron and Meissl (2003) explained the role of these cells in transmission of nerve
impulses between pinealocytes.
The presence of calcified dark patches of variable quantities is also recorded in most species
especially at the age of puberty till senility and called corpora arenacea (Baconnier et al. 2002).
Chemical analysis of these patches shows that they are composed of calcium phosphate,
calcium carbonate, magnesium phosphate and ammonium phosphate (Bocchi and Valdre
1993).
The pinealocytes of the samples collected during light periods showed a marked decrease in
cell size and absence of secretory granules which reflected on the very weak
immunohistochemical reaction as stated by Barrenefxe et al. (2004), Ekstron and Meissl (2003)
and Alexandr (1970). The latter refers to the pineal gland during light as a gland in resting
stage. The similarity of the cytoplasmic organelles between the pinealocyte of dark and light
samples indicate that the pinealocyte in light is an active cell but wait a nerve stimulus to
synthesize and secrete melatonin (Matsushima et al. 1990).
REFERENCES
Alexandr,J., 1970: The pineal gland. Endeavour. 29(108): 144‐148.
Arendt,J. and D.Skene, 2005: Melatonin as a chronobiotic. Sleep Med. Rev. 9(1): 25‐39
Baconnier,S., S. Lang, M. Polomska, B. Hilczer, G. Bekcovic and G. Meshulam, 2002: Calcite
microcrystals in the pineal gland of the human brain (physical and chemical studies). Bioelectromagneticc
23(7): 488‐495.
Bancroft and Steven, 1996: Theory and practice of histological techniques. 4 th Ed., Churchill‐Livingstone,
Edinburgh, London, Melborne, New York
Barrenefxe,J., P. Delagorange and J.Martinez, 2004: Physiological and metabolic functions of melatonin.
J. Physiol. Biochem. 60(1): 61‐72
Bocchi,G. and G.Valdre, 1993: Physical, chemical and mineralogical characterization of carbonate‐
hydroxyapatite concretions of the human pineal gland. J. Inorg.. Biochem. 49(3): 209‐220.
Borregon,A., J. Boya, L. Calvo and F. Lopez‐Munoz, 1993: Immunohistochemical studies of the pineal
glial cells in the postnatal development of the rat pineal gland. J. Pineal Res. 14(2): 78‐83
Descartes, R., 2002: The Passion of The Soul" excerpted from "Philosophy of The Mind" Chalmers, D.
New York: Oxford University Press, Inc.
Descartes, R., 2003: Treatise of Man. New York, Prometheus books.ISBN.
Drury R. and E. Wallington, 1980:Carleton's histological technique. 4 th Ed. Oxford Univ. Press. London,
New York and Toronto.
16

Universitatea de Științe Agricole și Medicină Veterinară Iași
Ekstrom,P. and H. Meissl, 2003: Evolution of photosensory pineal organs in new light: the
fateneuroendocrine photosensors.Philos.trans.Soc. Lond. Biol.Sci. 358(1438): 1679‐1700.
Ferreira‐Medeiros,M., C. Mandarim and E. Correa‐Gillieron, 2007: Pineal gland postnatal growth in rat
revisited. Anat. Histol. Embryol. 36(4): 284‐289.
Hafeez,M., 2005: Light microscopic studies on the pineal organ in teleost fishes with special regard to its
function. J. Morph. 134(3): 281‐313
Hayat, M, 1986: Basic techniques for transmission electron microscopy. 1 st Ed. Academic press, Inc.
Florida
Kus,I., M. Sarsilmaz, O. Ozen, A. Turkoglu, H. Pekmez, A. Songur and H. Kelestimur, 2004: Light and
electron microscopic examination of pineal gland in rats exposed to constant light and constant darkness.
Neuroendocrinol. Lett. 25(2).
Macchi,M. and J. Bruce, 2004: Human pineal physiology and functional significance of melatonin. Front.
Neuroendocrinol. 25 (3‐4): 177‐195
Matsushima,S., Y. Sakia and Y. Hira, 1990: Effect of photoperiod on pineal gland volume and
pinealocyte size in the chinease hamster (cricetulus griseus). Am. J. Anat. 187(1): 32‐38
Moore,R., A. Heller, R. Wurtman and J. Axelrod 1967: Visual pathway mediating pineal response to
environmental llight. Science, 155(759): 220‐223.
Osche,A., H. Kirschstein, H. kobayashi and D. Farner, 1972: Electron microscopic and experimental
studies on the pineal organ of white crowned sparrow, Zonotrichia leucophrys gambelii.
Z.Zellforsch.Mikrosk. Anat. 124(2): 247‐274
Owman,C. and C. Rrudeberg, 1970: light, fluorescence and electron microscopic studies on the pineal
gland of pike, Esox lucius L, with special regard to 5‐hydroxytryptaminase. Z.Zellforsch.Mikrosk.
Anat.107(4): 522‐550.
Przyblyska‐Gornowicz,B. and B. Lewezuk, 1997: cytoplasmic dense bodies in pig pinealocyte during
postnatal development: Quantitative and ultrastructural study.Folia Morphol. (Warsz). 56(1): 13‐21.
Reus,S., C. Spies, H. Shroder and L. Vollrath, 1990: The aged pineal gland: reduction in pinealcyte
number and adrenergic innervation in male rats. Exp. Gerontol. 25(2): 183‐188
Reynolds, E., 1965: The use of lead citrate at high pH as an electron opaque in electron microscopy. J.
Cell Biol., 26: 208‐215
Romijn,H., 1973: Structure and innervation of the pineal gland of the rabbit, An electron microscopic
investigation. Z.Zellforsch.Mikrosk. Anat. 141(4): 545‐560.
Ueck,M., 1973: fluorescence and electron microscopic studies of the pineal body in different species of
birds. Z.Zellforsch.Mikrosk. Anat. 137(1): 37‐62
Uria,H., I. Antolin, D. Tolivia, M. Rodrigues and P. Menendes, 1992: the pineal gland of the trumpet‐
tailed rat (Octodon degus).J. pineal Res. 13(4): 174‐183.
Uz,T., M. Akhisaroglu, R. Ahmed and H. Manev, 2003: The pineal gland is critical for circadian period 1‐
expression in striatum and for circadian cocaine sensitization in mice. Neuropsychopharmacology 28(12):
2117‐23.
LIST OF FIGURES
Figure (1) : A photomicrograph of the pineal gland of a buck showing a thin capsule © and extensive
network of reticular fibers supporting the pineal parenchyma. Gomori reticulin method, X 400
Figure (2) : A photomicrograph of the pineal gland of a buck showing pinealocytes arranged in clusters or
irregular groups permeated by blood vessels (V). Note, the pineal sand (arrow). Hx&E stain, X, 200
Figure (3) : A photomicrograph of the pineal gland of a buck showing bundles of unmyelinated fibers (F)
run in different directions. Hx&E stain, X,200
Figure (4) :An electron micrograph of the pineal gland of a buck showing cross sections of unmelinated
axons (F). Uranyl acetate and lead citrate stain, X10000
Figure (5) : A higher magnification of the pineal gland of a buck during dark period showing pinealocyte
(arrow) is large polyhedral cells containing large oval to spherical nucleus. The gland contains blood
vessels (V) engorged with blood. Hx&E stain, X1000
Figure (6) : A photomicrograph of the pineal gland of a buck during dark period showing pinealocyte (P)
with its long and branched cytoplasmic processes which terminate in blood vessel (V) or synapsed with a
17

Lucrări Științifice – vol 53 seria Medicină Veterinară
nerve (N). Note astroglia (A) with its short processes. Silver impregnation technique (Cajal's method).
X1000
Figure (7) : An electron micrograph of the pinealocyte of a buck during dark period showing numerous
endoplasmic reticulum ®, mitochondria (M), secretory granules of variable shapes (arrow) and lipid
droplets (V). Uranyl acetate and lead citrate stain, X10000
Figure (8) : A photomicrograph of the pineal gland of adult a buck dark period showing a strong reaction
(dark brown) in the pinealocytes. Indirect immunoperoxidase technique. X400
Figure (9) : A photomicrograph of the pineal gland of a buck during light period showing pinealocytes
(arrow) with clear non granular cytoplasm. Hx&E stain, X1000
Figure (10) :An electron micrograph of the pinealocyte of a buck during light period showing many
mitochondria (M), endoplasmic reticulum ®, and lipid vacuoles (V).Note the absence of secretory
granules. Uranyl acetate and lead citrate stain, X10000
Figure (11) : A photomicrograph of the pineal gland of a buck during light period showing very faint
reaction in the pinealocyte. In direct immunoperoxidase technique. X400
18

Universitatea de Științe Agricole și Medicină Veterinară Iași
19

COMPARATIVE STUDY OF VASCULAR ARTERIAL REACTIVITY AT
SEVERAL MAMMAL SPECIES:
1. THE REACTIVITY OF ARTERIAL SMOOTH MUSCLES AT THE
VASOCONSTRICTOR AGENTS ANTIDIURETIC HORMONE
(VASOPRESSIN)
S. Beschea‐Chiriac
University of Agricultural Sciences and Veterinary Medicine, Iasi
Faculty of Veterinary Medicine
Vascular reactivity is one of the three pillars on which lies the regulation of arterial pressure in
living organisms. Arterial pressure is one of the main determinants of the activity state of various
organs and systems both in healthy and in pathologically‐altered states. The present study aims
toward identifying similarities and differences between the resistance arteries belonging from
various mammal species that are most involved in veterinary practice: rats, cats, dogs and horses.
The arterial fragments prelevated from animals dead due to various clinical and traumatic
conditions unrelated to vascular pathology were normalized using a newly‐introduced system of
quantification, the force index system. This has been calculated using the wet‐weight parameter
and the force generated after administration of various pharmacological agents that cause
vasoconstriction. The artery fragments were fitted in organ baths using the Krebs‐Henseleit
saline, thermostated at 37° C and bubbled with a mixture of 95% O 2 and 5%CO 2. Vascular
endothelium was either kept or removed using gentle rubbing with moist filter paper. Control of
endothelial removal was made both functionally, using carbachol (synthetic derivative of
acetylcholine) and microscopically, after testing. The force generated was measured using
isometric force transducers coupled to a computerized acquisition system. The pharmacological
vasoconstricting agents used were phenylephrine (synthetic derivative of epinephrine), KCl
(potassium chloride 40‐80 mM, as depolarizing agent) angiotensin II, and vasopressin. The results
were statistically investigated using the t‐test and ANOVA testing. The preliminary results show a
dependence of the force generated an the amount of muscle present in the various species from
which the arteries were taken, a specifically increased response of feline‐derived arteries to
angiotensin and a specifically increased response of canine‐derived arteries to vasopressin. These
results will be used as controls for further testing in various pathological conditions and for
various other pharmacological agents used in the therapy of vascularly‐induced pathological
states.
Key words: vascular, reactivity, arterial, vasoconstrictor agent
The aim of this study is to investigate the most common modifications encountered in the
veterinary practice in the vascular arterial reactivity that could be involved in the pathogenesis
of various animal species. We also wish to make a comparative investigation of the vascular
reactivity at the arterial segments collected from different mammal species the veterinary
pathology has most frequently to deal with, segments which are histologically and functionally
similar.
The investigation of the methods that are at the basis of the arterial tonus adjustment and of
the metabolism of the arterial smooth muscle fiber relied in the last two decades on the very
well known isometric transducers pattern and on that of the annular preparation of different
arteries. The arterial duct of election used for these types of investigations is the rat aorta, as
20

Lucrări Științifice – vol 53 seria Medicină Veterinară
it combines most of the stability, accessibility, disposability and controllability conditions
required for a trustworthy investigation. The price is also an important criterion in this matter.
Although the above mentioned pattern is so very well known, still, the rat is not a perfect
model in what the cardiovascular modeling is concerned; it is not similar with the human being
and even less with other mammals. This experimental model was used in studies as from half
century ago [3].
Thus fragments of arteries collected from dogs, cats and horses were used as subject to an
experimental comparative investigation with standardized thoracic aorta rings taken from
Wistar rats.
MATERIALS AND METHOD
The reactivity of the arterial rings was measured in terms of both absolute force, measured as
force index (the force in mN of the preparation reported at its weight in mg) and relative
reaction towards a standardized witness. Also, where possible (considering the preparations
availability) curves dose/effect were made, involving the majority of the known vasorelaxing
and vasoconstrictor substances that are pharmacologically well characterized.
The comparative study was made on similar arteries in what their dimensions are concerned,
being part of the resistance segment, in this situation branches from the gastric coronary
artery or the superior mesentery which had similar dimensions: maximum length: 2 mm, = 1
mm, weight 10‐15 mg. The force of contraction was quantified in N/mg wet weight.(4) The
organ parts were taken from the Medical Clinique and the Surgery Clinique from the Faculty of
Veterinary Medicine, from dead animals that were not subject of legal euthanasia nor had
affections with vascular implications. [8]
After dissection the vessels were exsanguinated, washed in a solution of physiological salt,
sectioned in fragments of 5‐10 cm and then put into Krebs‐Henseleit serum (prepared
according to the formula) and transported in maximum 30 minutes to the place of the
experiment.
The aorta fragments were fixated through a metallic serfina on the bottom of the isolated
organ baths, and the ring tensioned through the verniers of the tensiometrical stamps to an
initial tension of 100 mN.
The vascular endothelium was removed by gentle rubbing with damp filter paper whenever
the experimental characteristics required it. The presence of the functioning vascular
endothelium was pharmacologically verified using carbachol and through direct microscopy.
The aorta rings were set in organ baths containing 4 ml of Krebs‐Henseleit physiological salt,
(composition (mN): NaCl 118; KCl 4.7; 2.52; MgSO4 1.64; NaHCO3 24.88; KH2PO4 1.18; glucose
5.55), thermostated at 37°C and bubbled with carbogen (a mixture of 95% oxygen and 5%
carbon dioxide).
Isometric force transducers connected to a computerized system for data acquisition were
used for detecting the contractions of the vascular smooth muscles ...
The preparations were allowed to equilibrate for 60‐90 minutes under a rest tension of 100
mN.
The aorta rings were afterwards precontractated with phenylephrine (10 ‐7 – 10 ‐6 )M and K + (40‐
70 mM) and treated with carbachol (10 ‐6 M) for releasing endothelial NO [6]. The absolute
magnitude of the contractions was of 175 ± 25 mN for the phenylephrine (10 ‐6 M) and K + (40‐
70 mM)
21

RESULT AND DISCUTION
Universitatea de Științe Agricole și Medicină Veterinară Iași
The effects of administering antidiuretic hormone (Vasopressin) on the contractility of the
arterial preparations
The ADH hormone, also known as Vasopressin, is an essential neuropeptide for the
cardiovascular homeostasis. Vasopressin was among the first peptide hormones ever
described and it is clinically used for more than five decades, especially in treatment of
diabetes insipidus and of upper gastrointestinal bleeding due to esophageal varices.
Vasopressin is also more and more often used in therapeutic management of shock, whether
it is septic or vasodilator due to different reasons.
The ADH is a nonapeptide having a disulfide bridge between two cysteinic amino acids. It is
synthesized in the paraventricular and supraoptic nucleuses of the hypothalamus, transported
coupled to the neurophysins along the hypothalamohypophyseal tract to the neurohypophysis
and stored in granules.
The effect of this hormone is achieved through two types of receptors, V1, found in the blood
vessels (on the vascular smooth muscle) and which mediates the vasoconstriction through a
cascade of mediators involving phospholipase C and release of calcium ions from intracellular
stores through the inositol‐phosphate system.
The V2 receptors are located in the distal renal tubule and kidney collecting tube. Their effect
is to stimulate the expression of aquaporines (water channel proteins) in the tubule, thus
allowing re‐uptake of water and antidiuretic effect.
In normal conditions, AHA has little effect on arterial pressure and the doses at which its
vasoconstrictor effect becomes noticeable are at least 10 times higher than normal plasmatic
concentrations. However, in conditions of hypotension, its plasmatic concentration increases
greatly and its vasoconstrictor effect allows keeping a high arterial pressure in the initial
period.
Forta (mgF)
2000
1950
1900
1850
1800
1750
1700
1650
1600
1550
1500
3300 3800 4300 4800 5300
timp (sec)
Figure no. 1 – Characteristic aspect of vasopressin contraction on the rat aorta
But as the ADH neurohypophyseal reserves lessen, its plasmatic concentration decreases and
its benefic effects – those of keeping the arterial pressure at quasi‐physiological levels are
fading.
22

FI
9
8
7
6
5
4
3
2
1
0
Universitatea de Științe Agricole și Medicină Veterinară Iași
1 2 3 4
Figure no. 3 –Vasopressin contraction force after administration of 10 ‐10 M desmopresin. The
differences between endothelized and de‐endothelized preparations do not exhibit statistic
significance
It also should be said that in dog’s case, the effect was significantly stronger, considering the
fact that the thickness of the muscular layer was smaller than that of the horse’s, which leads
to the assumption that dogs have a particular reactivity in what the vasopressin mediation is
concerned (Fig. no 3).
CONCLUSION
1. Vasopressin reactivity produces the highest force, except for the ‐adrenergic agonist
phenylephrine.
2. From the dose‐effect curve configuration it can be seen that very low doses (10‐12 M
– physiological) produce little contractile effects, while with higher (pharmacological)
doses, from 10 ‐10 M, the contractile effects are close to maximum, having a curve with
biphasic aspect. The curve aspect suggests the presence of quantum effects at the
V1‐type receptors.
3. In dog’s case the effect was significantly stronger, considering the fact that the
thickness of the muscular layer was smaller than that of the horse’s, which leads to
the assumption that dogs have a particular reactivity in what the vasopressin
mediation is concerned.
BIBLIOGRAPHY
1. Armstead WM, Lippton HL, Hyman AL, Kadowitz PJ., 1984 ‐ Analysis of adrenergic responses
in the mesenteric vascular bed of the cat; evidence that vascular beta 2‐adrenoceptors are
innervated. Can J Physiol Pharmacol. 62(12):1470‐8.
2. Beşchea Chiriac Sorin, Serban DN., 2001 ‐ Mechanisms involved in the vascular action of
phenamyl, Lucr. St. vol. 44., USAMV Iaşi, p. 151‐159;
3. Beznak M., 1956 ‐ Hemodynamic changes following aortic constriction in normal and in
hypophysectomized rats. ‐ Can J Biochem Physiol., 34(4):791‐8.
4. Guimarães S. Moura D., 2001 ‐ Vascular Adrenoceptors: An Update ‐ Pharmacol Rev. 53: 319‐
356.
24
Rat
Cat
Dog
Horse

Lucrări Științifice – vol 53 seria Medicină Veterinară
5. Haulica I, Bild W, Mihaila CN, Ionita T, Boisteanu CP, Neagu B., 2003 ‐ Biphasic effects of
angiotensin (1‐7) and its interactions with angiotensin II in rat aorta. ‐ J Renin Angiotensin
Aldosterone Syst. 4(2):124‐8
6. Jiang H, Halayko AJ, Rao K, Cunningham P, Stephens NL., 1991 ‐ Normalization of force
generated by canine airway smooth muscles. ‐ Am J Physiol. 260(6 Pt 1):L522‐9.
7. Moncada S., Palmer R.M.J., Higgs E.A., 1991 ‐ Nitric oxide: physiology, pathophysiology, and
pharmacology. Pharmacol. Rev., 43: 109‐142
8. Rozenfeld V, Cheng JW., 2000 ‐ The role of vasopressin in the treatment of vasodilation in
shock states ‐ Ann Pharmacother. 34(2):250‐4.
9. * * * LEGE nr.471 din 9 iulie 2002 – Buletinul Oficial al României, privind aprobarea Ordonantei
Guvernului nr. 37/2002 pentru protectia animalelor folosite în scopuri stiintifice sau în alte
scopuri experimentale.
10. Holmes Cheryl, Patel B. M., Russell J. A. Walley K.R., 2001 ‐ Physiology of Vasopressin Relevant
to Management of Septic Shock – Chest. 120;989‐1002
25

MORPHOCLINICAL ASPECTS OF BABESIOSIS IN HORSES
Boghian V., Mălăncuş R.N., Acatrinei D., Pașca S.,
Anton Alina, Solcan Gh.
Faculty of Veterinary Medicine Iasi
Alley M. Sadoveanu no. 8
vboghian@yahoo.com
Abstract:
In 7 horses with clinical signs of cortical syndrome in the inhibition phase, subicter and dark urine
were performed blood counts (HLG), cytomorphological examination of the blood smear (May
Grunwald Giemsa stained), biochemical profile and macroscopic examination of the internal
organs. Blood count revealed normochromic normocytic regenerative anemia with a low number
of red blood cells (5.3 x103/mm3). Blood biochemical examination revealed hepato‐biliary
insufficiency (ALT = 88.9 IU / L, ALP = 222.7 IU / L) and renal insufficiency (BUN = 35.7 mg / dl =
2.8 mg CRTN / dL).
Disease has been confirmed by observing endoglobular merozoits of B. equi and in
morphopathological examination were found bleeding points in the heart and splenomegaly.
Keywords: babesiosis, equine, B. equi
Babesiosis is a hemosporidiosis also called piroplasmosis produced by sborozoa from
Babesiidae family disseminated by hematophagous mites from Ixodidae family, also known as
tick. Each species of Babesia species corresponds to a tick. In horses the disease is caused by B.
equi, B. cabali, Nutallia equi and newer by B. canis. The disease is characterized by the
modified general condition, anemia and nervous manifestations predominantly represented
by cortical inhibition, which leads to death unless etiological treatment is applied. (3, 4).
In this paper we present some morphoclinical aspects of babesiosis in horses that are useful
to guide diagnosis, so etiotropic treatment can be applied.
MATERIAL AND METHOD
Observations were made on seven horses (4 stallions, two mares and a horse) aged between
two and eight years presented to the Medical Clinic of the Faculty of Veterinary Science from
Iași. Diagnosis was established by collating data obtained at clinical examination with some
laboratory data. Such was performed blood counts (CBC), biochemical profile, and
cytomorphological blood smear examination using May Grunwald Giemsa staining. After the
performed treatment, 6 animals were cured and one died because of complications
(pulmonary edema). In this animal was performed a macroscopic examination of the internal
organs.
RESULTS AND DISCUSSION
Guideline the diagnosis to babesiosis started from a similar clinical environment in all seven
cases: loss of appetite, signs of cortical inhibition (tolerance, adynamie, drowsiness) and rectal
temperature exceeding the upper limit of reference (39.50 C). The mucous membranes had a
subicteric character, cyanotic appearance and the urine was brown (fig. 1)
26

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 1.
The subicteric mucous membrane and brown urine
Haematological examination results are shown in Table 1 and 2.
Blood
Paramet
ers
Measure
ment
units
Referenc
e
Horses
with
babesios
is (n=7)
Haematological parameters in horses with babesiosis
Blood smear
Leu Mat You
Baz
Erythro
co‐ ure ng Eosi
Hb Ht
o‐ Mono
cytes
cyte neut neut no‐
phi cyte
s ro‐ ro‐ phils
ls
phils phils
mil/μl
6‐12
5,3
g/
dl
10
‐
18
20
,4
% mii/
μl
32
‐
48
49
,2
6‐
12
Table 1.
Limpho
cyte
% % % % % %
30‐
75
0‐1 1‐10 0‐3 1‐8 25‐60
5,0 76,0 2,0 4,0 1,0 2,7 21,3
Derived blood constant in horses with babesiosis
Blood
parameters
VEM HEM CHEM
Measurement
units
μ 3 picograme (pg) g/dl
Reference
Horses with
34‐58 13‐19 31‐37
babesiosis
(n=7)
47,0 16,6 35,2
Table 2.
Haematological examination revealed the existence of an anemic syndrome, normochromic
normocytic regenerative anemia with a low number of red blood cells (5,3 mil/μl).
27

Universitatea de Științe Agricole și Medicină Veterinară Iași
We also observed a low number of leucocytes (5.0 thousand / ml). Increased hemoglobin (Hb
= 20.4 g / dL) and hematocrit (Ht = 49.2%) showed the presence of dehydration.
Biochemical profile results are presented in Table 3.
Table 3.
Biochemical
Profile
Measuremen
t units
Reference
Horses with
babesiosis
(n=7)
Biochemical profile in horses with babesiosis
Hepatic profile
Renal profile
TP AST ALT ALP GGT TBIL DBIL BUN CRTN
g/d
l
UI/L UI/L UI/L UI/L mg/d
l
mg/d
l
mg/d
l
mg/d
l
5,7‐
7,9
116
‐
287
2,7‐
21
70‐
227
2,7‐
22
0,3‐
3,0
‐
10,4‐
25,0
0,9‐
2,0
6,3 31,3
88,
9
222,
7
23,
9
3,3 0,5 35,7 2,8
As seen in Table 3 there exists an hepatobiliary failure: ALT (alanine amino transferase)=88.9
IU/L, ALP (alkaline phosphatase)=222.7 IU/L, GGT (gamma‐glutamyl‐transferase)=23.9 IU/L,
TBIL (total bilirubin)=3.3 mg/dL and renal failure: BUN (blood urea nitrogen)=35.7 mg/dL,
CRTN (creatinine) = 2.8 mg/dL.
Cytomorphological examination of the blood smear stained May Grunwald Giemsa revealed
the existence of Babesia equi endoglobular merozoits and intense hemolysis (fig. 2).
Fig. 2.Babesia equi merozoits and hemolysis
Fig. 3.Splenomegaly and bleeding points in the heart base
28

Lucrări Științifice – vol 53 seria Medicină Veterinară
Macroscopic examination of internal organs from an animal died due to complications
revealed splenomegaly and bleeding points in the heart base (Fig. 3).
Cause of death was acute pulmonary edema and hemolytic anemia due to heavy parasitism
(Fig. 4.)
Fig. 4.Acute pulmonary edema and tick parasitism
From the peripheral blood smear stained May Grunwald Giemsa were identified endoglobular
parasites in all cases fact that confirmed the diagnosis.
The treatment with Berenil in a dose of 0.0035 g/kg 7% extemporaneus prepared solution or
Imizol in a dose of 4 ml/100 kg led to remission of clinical signs starting with the second day
and clinical cure in 6 cases after about 3 days in which symptomatic treatment was also
performed.
CONCLUSIONS
1. Diagnosis of babesiosis has gone from a common hemosporidiosis clinical framework:
cortical syndrome cortical in inhibition phase, subicter and dark urine.
2. Blood count revealed normochromic normocytic regenerative anemia, with a low number of
red blood cells (5.3 x103/mm3).
3. Blood biochemical examination revealed hepato‐biliary insufficiency (ALT = 88.9 IU / L, ALP =
222.7 IU / L) and renal insufficiency (BUN = 35.7 mg / dl = 2.8 mg CRTN / dL).
4. Morphopatological were found bleeding points in the heart and splenomegaly.
5. The diagnosis of babesiosis was confirmed by eidentification of B. Equi endoglobular
merozoits.
BIBLIOGRAPHY
1. BOGHIAN V., SOLCAN GHE., LUMINIȚA DIANA HRIȚCU, BEŞCHEA‐CHIRIAC S. I., 2003, Particularități
morfoclinice ale babesiozei canine, al IX‐lea Congres Național de Medicină Veterinară, Iaşi, Rev. Rom.
Med. Vet., vol. 13, nr. 3‐4, p.288 şi Lucr. Şt. USAMV Iasi, Medicina Veterinara, vol. 46, p. 362‐364, ISSN
1454‐7406.
2. MORAILLON R., FOURRIER P., LEGEAY Y., LAPEIRE C., 1997, Dictionnaire pretique de therapeutique
canine et feline, 4 e ed, Masson, Paris.
3. DULCEANU N., CRISTINA TERINTE, MITREA L.I., CARMEN POLCOVNICU, 2000, Dicționar enciclopedic
de parazitologie, Ed. Academiei Române, Bucureşti.
4. DULCEANU N., CRISTINA TERINTE, 1994, Parazitologie veterinară, vol. 1, Ed. Moldova, Iaşi.
5. THE MERCK VETERINARY MANUAL, 1998, eighth edition, Merck & Co., Inc. Whitehouse Station, NJ
USA.
29

KERATOPATHIES IN CARNIVORES: CLINICAL SIGNS AND LOCAL
PATHOLOGIC RESPONSES
IOANA BURCOVEANU, I. BURTAN, ROXANA TOPALĂ,
L.C. BURTAN, M. FÂNTÂNARIU
University of Agricultural Sciences and Veterinary Medicine, Iasi
ioana.burcoveanu@gmail.com
The cornea is the perfectly transparent, avascular, anterior component of the fibrous,
outer coat of the eye, along with the opaque, posterior sclera. Corneal pathology varies
from congenital disorders to tumors, primary or by extension. Keratitis define the
inflammation of the cornea, that may have numerous causes, like trauma, noninfectious
(physical, chemical) or infectious (bacterial, viral, fungal, parasitic) agents, immune
reactions. Acquired corneal pathology may be categorized as ulcerative or
nonulcerative, infectious or noninfectious, or by cause, topography, depth, etc.
Clinical signs can also vary greatly. Generally, we observe blepharospasm, photophobia,
hyperemic conjunctiva, epiphora, serous or mucopurulent discharge that clings to the
ocular surface. Because of its compact construction, pathologic reactions in the cornea
tend to evolve differently, regarding their speed of onset and recovery. The majority of
clinically important keratopathies develop one or more of the following local signs:
edema, vascularisation, pigmentation, cellular infiltrates, accumulation of lipid or
mineral material in the stroma and corneal fibrosis, with scar formation.
Optimal aetiologic diagnosis and clinical management require knowledge of the clinical
signs listed above.
Key words: cornea, keratopathies, symptoms, carnivores
The cornea is the perfectly transparent, anterior component of the eye, playing the role of a
convex ‐concave lens. It has no blood vessels or pigments, its thickness varying in animals
from 0,56 to 1 mm (0.5 – 0.8 mm) (5), becoming less thicker at the perifery in dogs and cats
(4). The posterior part of the outer, fibrous coat of the eye is the sclera. The point at which the
cornea and sclera merge is called the limbus (1, 3, 4, 5). The cornea plays many roles, such as:
mechanical, optical, immunological and tissue healing. (4)
From outside to inside, the cornea has 5 layers: epithelium, its basement membrane
(Bowman), stroma, Descemet’s membrane, endothelium (posterior epithelium). It is avascular
and it has no pigments, but it has a sensitive innervation, provided by nasociliary nerves of the
ophthalmic branch of the trigeminal nerve (cranial nerve V) (3, 5). The density of terminal
nerves is higher in the center and lesser at the periphery of the cornea.
The cornea is the first barrier of the globe, being exposed to exogenous disorders (trauma),
endogenous factors (corneal dystrophies, which are inherited) or to the extension from other
ocular tissues (anterior lens luxation, uveitis, neoplasia).
The present paper resumes the symptoms of clinically important keratopathies:
blepharospasm, epiphora, conjunctival hyperaemia, as well as the major pathologic responses:
corneal edema, vascularisation, fibrosis (scar formation), melanosis, accumulation of an
abnormal substance within the cornea (lipid, mineral), stromal malacia.
30

MATERIAL AND METHOD
Lucrări Științifice – vol 53 seria Medicină Veterinară
Research has been achieved on the number of cases presented for ophthalmic examination at
the Faculty of Veterinary Medicine in Iasi, the Surgical Clinic, throughout the years 2007‐2010
and at the Alfort Veterinary University Hospital Centre (Centre Hospitalier Universitaire
Vétérinaire Alfort – Ecole Nationale Vétérinaire Alfort (CHUVA‐ENVA), Maisons‐Alfort, France),
in mars‐april 2010. From the total number of carnivores, we collected those presented for an
ophthalmic disorder, especially that of the cornea. A relevant and thorough history, completed
by an orderly and extended ocular examination, give a correct diagnosis and the possibility of
successful clinical results.
RESULTS AND DISCUSSIONS
The general symptoms of keratopathies, that first draw the owner’s attention and after that of
the veterinarian, are the ocular pain, translated by the blepharospasm, photofobia, epiphora,
ocular discharge. Blepharospasm can be present at one eye or at both eyes, depending on the
nature of the aetiological agent (virus, bacteria, immune complexes) (photos 1‐3). Discharge
that accompany different corneal diseases can be serous or mucopurulent (photos 4‐6).
1. Bilateral blepharospasm 2. Right blepharospasm 3. Right blepharospasm
4. Unilateral epiphora 5. Mucopurulent discharge 6. Diffuse conjunctival hiperaemia,
mucopurulent discharge
The healthy cornea is completley transparent, due to the lack of blood vessels or pigments,
but when pathologic disorders appear, we can observe some local pathologic changes that are
important for the clinician.
Clinically, the loss of corneal transparency is translated by corneal edema. Normally, corneal
structures fight against water entry, especially the endothelium and the epithelium. The
endothelium extracts water form the stroma, maintaining a relative dehydration. Any lesion of
those two components of the cornea results in edema.
Accumulation of water between the stromal colagen fibers gives the cornea a blue coloration,
which becomes opaque. Corneal edema can be localized or diffuse, epithelial or endothelial,
the latter being more intense and diffuse. (photos 7, 8).
31
CHUVA‐ENVA
CHUVA‐ENVA

Universitatea de Științe Agricole și Medicină Veterinară Iași
7. Diffuse corneal edema 8. Localized corneal edema
When it appears, corneal vascularization is always pathological. Blood vessels can be
superficial, deep or both. Superficial neovascularisation are „treelike” vesseles, originating in
conjunctival circulation. They occur whenever there is a lesion in the epithelium or the
anterior stroma. Deep vessels are short, parallel, „hedgelike”, originating in the cilliary
circulation. The depth of new formed vessels is a good indicator of the depth of the initiating
lesion. In cases of persistent or complicated lesions, a granulation tissue can occur. The
CHUVA‐ENVA
dinamic of corneal neovascularisation is presented in photos 9‐14.
9.Superficial neovascularisation, cat. 10.Superficial vessels, cat. 11. Superficial vessels, dog.
CHUVA‐ENVA
12. Granulation tissue, dog. 13. Granulation tissue, cat 14.Deep vascularisation, dog.
Corneal vascularisation is generally beneficial in stromal repair. Blood vessels advance from
the limbus, until they invade the lesion, corneal healing and regain of transparency starting
from the limbus, as it can be seen in photo 9. Keeping in mind those facts, although blood
vessels can result in influx of pigments and inflammatory cells, easing corneal fibrosis, control
if neovascularisation with the use of steroids is not always indicated.
Corneal pigmentation is also called pigmentary keratitis. These terms ignore the possibility of
other pigments, like hemoglobin or the soluble pigment in corneal sequestra in cats, than
melanin to cause corneal opacity. Nevertheless, it must not be used as a diagnosis, for it is only
a sign of chronic, persistent corneal irritation, that may have many causes, each with a
different treatment. Melanin is deposited in the epithelium and the anterior stroma, migrating
along with blood vessels, during the inflammatory process.
Corneal melanosis is a sign of chronic irritation, as seen in cases of eye exposure due to facial
nerve paralysis, lagophtalmos, frictional irritation (distichiasis, entropion) (photo. 15), tear film
CHUVA‐ENVA
32
CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA

Lucrări Științifice – vol 53 seria Medicină Veterinară
abnormalities (keratocojunctivitis sicca) (photo 16), chronic immunologic stimulation (pannus)
(photos 17, 18).
15.Ventral corneal pigmentation, dog. 16.Diffuse corneal pigmentation, dog.
17.Lateral corneal pigmentation, dog. 18. Ventral and lateral corneal melanosis, dog.
Corneal fibrosis appears as a consequence of the stromal repair process, when collagen fibrils
don’t order themselves in a parrallel manner, thus interfering with light transmission. The
opacity is localised in the stroma, the epithelium being intact, with some new vessels being
able to persist. Meanwhile, the scar can become clear, but will not disappear completely. The
tendency to clear is greater in young animals and more often in cats. Scar melanosis and lipid
accumulation often occurs in dogs. As it develops, the scar can be named nubecula, macula,
albugo and leukoma. If iris fibers are attached to the corneal endothelium, the scar is named
an adherent leukome, with an anterior synechia (photos 19‐23).
19.Macula, dog. 20, 21.Adherent leukoma, cat – profile, face.
CHUVA‐ENVA
22, 23.Adherent leukoma, cat, profile and face.
CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA
Lipid or mineral accumulations appear as sparkly, white deposits in the corneal stroma,
situated underneath the epithelium. This type of lesion can be a primary disease in breeds like
Beagle, Boxer, Airedale Terrier, Caniche, Cocker, Doberman (photos 24‐26).
33
CHUVA‐ENVA

Universitatea de Științe Agricole și Medicină Veterinară Iași
CHUVA‐ENVA
CHUVA‐ENVA
24.Corneal lipid dystrophy 25.Lipid‐calcium degeneration, 26.Lipid‐calcium
in a Beagle. dog. degeneration, dog.
Lipid dystrophy evolves bilaterally, it is not painful, with minimum implications on the animal’s
sight and requires no treatment. Lipid degeneration is associated with signs of inflammation
(keratitis, scleritis, uveitis), having the possibility to be the result of corneal ulcers or corneal
traumatisms having scarred with lipid accumulation. In some animals, we may notice high
levels of cholesterol in the blood, or other metabolic disorders, such as diabetes mellitus,
hypothyroidism, hyperadrenocorticism or primaryhyperlipidemia.
Stromal malacia or „melting” occurs when collagenase, the enzyme responsible of
collagenolysis, is liberated by cells, especially neutrophils. The cornea becomes soft, due to its
loss of rigidity (loss of collagen structure). The process is followed by developement of a deep
corneal ulcer or descemetocele (photo 27).
27.Stromal melting, dog.
CONCLUSIONS
1. The cornea is the perfectly transparent, anterior component of the eye, playing the role of
a convex ‐concave lens, having no blood vessels or pigments.
2. The general symptoms of keratopathies, that first draw the owner’s attention and after
that of the veterinarian, are the ocular pain, translated by the blepharospasm, photofobia,
epiphora, ocular discharge.
3. The majority of keratopathies develop one or more of the following local signs: corneal
edema, vascularisation, pigmentation, cellular infiltrates, accumulation of lipid or mineral
material in the stroma and corneal fibrosis, with scar formation.
4. Clinically, the loss of corneal transparency is translated by corneal edema, when water
accumulates in the corneal stroma. Edema can be diffuse or localised.
5. Corneal vascularization is always pathological. Blood vessels can be superficial, deep or
both. It has caracteristic aspects, indicating the depth of the initial lesion.
6. Corneal melanosis is not a diagnosis, but a sign of chronic irritation. Although it doesn’t
require a treatment, we must determine the cause of irritation, to prevent further
extension of pigmentation.
34

Lucrări Științifice – vol 53 seria Medicină Veterinară
7. Lipid or calcium can accumulate in the superficial part of the stroma, without affecting the
corneal epithelium.
8. Corneal fibrosis appears as a consequence of the stromal repair process, when collagen
fibrils don’t order themselves in a parrallel manner, thus interfering with light transmission.
Corneal scars are called: nubecula, macula, albugo and leukoma (simple or adherent, with
iris participation).
REFFERENCES
1. Burtan I., 2000 – Chirurgie veterinară regională, ed. Ion Ionescu de la Brad, Iaşi;
2. Cernea P., Dumitrache L., 1986 – Fiziologie oculară, ed. Medicală, Bucureşti;
3. Cotea C., 2003 – Histologie specială, ed. Tehnopress, Iaşi;
4. Ionaşcu Iuliana, Miclăuş I., 2009 – Oftalmologie veterinară din Tratat de Medicină Veterinară, vol. V.,
coordonator Constantin N., ed. Tehnică, Bucureşti;
5. Maggs D.J., Miller P.E., Ofri R., 2008 – Slatter’s Fundamentals of Veterinary Ophthalmology, 4th
edition, ed. Saunders Elsevier, Missouri;
35

PATHOLOGICAL EFFECTS AND TISSUE DISTRIBUTION OF
MICROCYSTIN‐LR (MC‐LR) AFTER 48 HOURS NON INVASIVE
EXPOSITION OF NEWLY HATCHED MEDAKA
(ORYZIAS LATIPES) ELEUTHERO‐EMBRYOS
Hélène Huet 1 , Delphine Franko 2 , Chakib Djediat 2 ,
Eva Perez 2 , François Crespeau 1 , Amaury de Luze 2
1 Ecole Nationale Vétérinaire d’Alfort (France)
2 Muséum National d’Histoire Naturelle de Paris (France)
Abstract
Medaka fishes eulethero‐embryos were submitted at 48 hours period of immersion in MC‐LR
containing media at 1, 5, 10, 15 and 20 µg/ml concentration. Significant mortality (>10%) is only
observed for higher MCLR concentration (20µg/ml) in medium.
Microscopic pathological effects after 48 hours immersion in MC‐LR solution were searched on
transverse sections of paraffin embedded embryos fixed in formaldehyde. Histopathologic
studies of paraffin embedded embryos shows, from 10 µg/ml MC‐LR concentration, with variable
intensity, vacuolization of enterocytes and hepatocytes, degenerative and necrotic changes.
On same material, immuno‐labeling with specific monoclonal antibodies against MC‐LR was also
performed and appeared constantly and strongly positive in intestine (enterocytes and lamina
propria), liver (hepatocytes and probably macrophagic cells along sinusoids border). A faint
labeling was also characterized in kidneys epithelial cells, pancreas and yolk vesicle epithelial
border. No labeling was observed in skin, gills, oral epithelium, esophagus and stomach, heart
and vascular system, muscles, nervous central system…
Ultramicroscopic pathological effects after 48 hours immersion in MCLR solution were also
searched on ultrathin sections of embryos fixed in paraformaldehyde and embedded in resin.
From 10 µg/ml MC‐LR concentration, transmission electronic microscopy clearly shows disruption
of intercellular junctions in enterocytes and hepatocytes, some cytoplasmic vacuolation of
enterocytes, alteration of hepatocytes membrane with regression of microvillous cell border with
reduction of Disse space length and abnormal biliary canaliculi border.
INTRODUCTION
Microcystins (MCs) are a family of hepatotoxic cyclic heptapeptides comprising at least 80
variants and congeners. All toxic microcystin variants contain a unique hydrophobic amino acid
3‐amino‐9‐methoxy‐10‐phenyl‐2,6,8‐trimethyl‐deca‐4(E)‐dienoic acid (ADDA) (kongsuwan et
al., 1988). The prototype compound is MC‐LR, which have Leucine (L) and arginine (R) at the
two hypervariable positions in the ring structure (Rinehart et al., 1988; Carmichael, 1992).
These toxins are produced by a wide variety of planktonic cyanobacteria, which are one of the
most primitive and worldwide distributed families of photosynthetic organisms (Brock, 1973,
Ueno et al., 1998).
MCs represent potential environmental fresh water toxins, mainly when climatic conditions
promote blooms of cyanobacteria in pools, pond or lakes.
The primary toxic effect of microcystins is inhibitory reversible binding at the catalytic site of
protein phosphatases 1 and 2A. This interaction involved principally the ADDA group. The
presence of the methyl‐dehydro‐alanine (Mdha) inducted an irreversible inhibition by covalent
linkage to the cystein sulphur on the phosphatases PP1 and PP2A (MacKintosh et al., 1995;
Runnegar et al., 1995). Direct injection of MCLR in mammals induced protein phosphatases
36

Lucrări Științifice – vol 53 seria Medicină Veterinară
inhibition, hyperphosphorylation of membrane cellular proteins including the hepatocellular
cytoskeleton and loss of cell‐cell contacts in intrahepatic necrosis and hemorrhage. Death is
due to hypovolemic shock (Hooser et al., 2000, Beasley et al., 2000). After administration, MCs
cellular uptake is performed via specific organic anion transport proteins (Runnegar et al.,
1991, 1995). MCs exhibit a predominantly hepatic organotropism, althought mesenteric and
even dermal effects have been demonstrated.
In fish as in mammals, gavage, intraperitoneal, intravascular or intravitellin injection of
purified MC‐LR are all invasive approaches corresponding to acute exposure and lethal toxic
effects (Phillips et al., 1985, Raberg et al., 1991, Tencalla et al., 1994, Bury et al., 1997).
However there are few indications of whether and how fish are sensitive to purified MC‐LR by
in vivo immersion (Oberemm et al., 1999).
Our studies were designed in view to develop a rapid sub‐lethal bioassay allowing not only a
general assessment on uptake and tissue distribution of MC‐LR, but also indicating potential
whole body external MC‐LR‐induced developmental abnormalities. Thus, our experimental
studies was mainly realized in view to set up a low cost, sensitive and reproducible bioassay
with some degree of the certainty on the absorption, distribution and effects of MC‐LR in fish
after natural exposure. In these animals, the less invasive experimental approach to study MC‐
LR effects is after natural immersion and the duration of our experimental procedure
correspond to a short and acute exposure of two days.
Medaka fish eleuthero‐embryos (Balon, 1975) could be contaminated by MC‐LR only via
environmental water intake or by absorption of the purified toxin by skin or gills. Immersion
also represents the most current way of exposure among human and animal populations
having contact with cyanobacterial contaminated water (Funari and Testai, 2008).
MATERIAL AND METHODS
Products
According to the recommendation of the manufacturer (Alexis, Switzerland), dissolution of
purified MC‐LR in water is always incomplete; in absolute ethanol dissolution of MC‐LR is
complete. A mixed procedure was used in our study: MC‐LR was first dissolved in four volume
absolute ethanol, followed by addition of 1 volume of water. Ethanol was totally evaporated in
a speedvac (37°C) during 4 hours and the mixture completed with water at the end of the
procedure to a final concentration of 0.2 µg/ml (stock solution). A control solvent stock
solution was performed using the same procedure.
Medaka breeding and experimental procedure
Medaka (Oryzias latipes) progenitors of the inbred cab strain were kept in 8‐L glass aquaria at
26‐28°C under artificial reproductive cycle (14h Light‐10h Dark cycle). Fertilized egg clusters
were carefully removed from the female progenitors and 100‐200 post‐fertilized (pf) eggs of
medaka fishes were collected and gathered in Petri dishes containing Yamamoto’s embryo
rearing medium (Yamamoto, 1975). The embryos were maintained in an incubator (XBR125,
France Etuve) at 25°C with a photoperiod (L:12h‐D:12h). The rearing medium was changed
every day until the hatching period, beginning at the tenth day.
Eleuthero‐embryo exposures and assessment
All embryos hatching during the 24 hours interval of the tenth and eleventh day post
fertilization were termed J0 embryo and used for experimental purpose in our acute eleuthero
fish embryo test. During this interval of time and under our rearing condition, the percentage
37

Universitatea de Științe Agricole și Medicină Veterinară Iași
of hatched embryos represented approximately 60% (45 to 75%) of the collected eggs. The
vesiculated eleuthero‐embryos were transferred in 12 wells microplates (5 eleuthero‐embryos
in 2ml medium/well). Negative controls and MCLR media were not changed during the 48
hours experimental procedure. The vesiculated fish larvae being fully autotrophic, no food was
given during the time course of the 48h experimental period. Non‐invasive observations of
eleuthero‐embryos behavior were performed and eleuthero‐embryos were handled in
accordance with European Union regulations concerning the protection of experimental
animals.
Histopathology process
At the end of the immersion experiment, surviving hatched embryos treated or not (control)
with MC‐LR were fixed in buffered formaldehyde solution 10% (v/v) for 24h. Fixed embryos
were then clarified and dehydrated in successive baths of ethanol (70% and 95%) and butanol,
and finally transferred into baths of liquid paraffin at 56°C. They were individually oriented and
embedded into blocks of paraffin wax. Transverse sections (3,5µm thickness) were hydrated in
successive baths of ethanol (100% and 95%) and routinely stained with Hematoxyline‐Eosine‐
Saffron (HES, Sigma‐Aldrich, France). Microphotograph observations of histological transverse
sections were carried out with an Axio‐Imager Z1 Zeiss microscope at various magnifications.
The all embryo being cut, an constant anatomical level was chosen in the pectoral fin region to
perform observations on intestine and liver.
Immunohistochemistry process
Sections of paraffin‐embedded tissues were deparaffined in toluene and hydrated gradually in
ethanol (100% and 95%), washed in distilled water and then in 10mM phosphate buffered
saline (PBS, Sigma‐Aldrich, France). Tissue sections were microwaved in 10mM citrate buffer,
pH 6.0 for 30min (350w microwave oven). Two different primary anti‐MCLR monoclonal
antibodies (Alexis Biochemicals, Switzerland) were tested: AD4G2 which recognizes all
microcystins because of its Adda specification and MC10E7 which recognizes all 4‐Arg
microcystins. The immunoassay was routinely performed with the NexES system (Ventana,
Tucson, USA). As positive control, we choose an adult medaka fish liver, which proceeded from
a gavage experiment with MCLR (Mezhoud and al, 2008), and tissue sections proceeded
without primary antibody were chosen as negative control.
Transmission electron microscopy
Embryos were preserved in 0.5% glutaraldehyde in 2% paraformaldehyde solution for
transmission electron microscopy study during 24 hours and then, washed three times in
Sorensen phosphate buffer (0.1M, pH 7.4) in three successive 10min baths; finally embryos
were dehydrated in ethanol (50°, 70°, 90° and 100°) by three baths at each step of dehydration
and the embedded in a epoxy mixture (Spur). Medium and ultrathin sections were sliced with
diamond knives (Diatome) on a Reichert‐Jung Ultracut microtome. Ultrathin sections on grid
were then observed by transmission electronic microscope (Hitachi H 700S) with a camera
(LCD, Hamamatsu) at various magnifications.
38

RESULTS
Lucrări Științifice – vol 53 seria Medicină Veterinară
1) Pathological effects of MCLR in eleuthero‐embryos medaka after 48 hours toxic exposure
by immersion
The intestine wall of control eleuthero‐embryo medaka fish is organized in folds lined by
simple columnar epithelium composed of enterocytes and not associated with any kind of
mucosal or submucosal glands; MC‐LR treatment appears to induce a slight reduction of the
intestinal folds associated with a moderate enlargement of the intestinal lumen and variable
degree of vacuolization of enterocytes with, sometimes, focal cleavage between epithelium
and lamina propria.
In liver, the normally dense network of hepatocytes and vascular sinuses is observed in
control. In treated embryos, degenerative more or less megalocytic hepatocytes with
sometimes anisocytosis, anisocaryosis and nucleus pycnosis are clearly observed; furthermore
some necrotic hepatocytes are also apparent in 20µg MC‐LR/ml treated embryos.
In some embryos, vacuolization of kidney epithelial is sometimes observed. Another
happening modification concerns yolk vesicle seeming to have late regression without clear
lesions of syncytial epithelial cells at photonic microscopic observation level.
No significant lesions are observed in other tissues or organs: skin, gills, oral and esophagus
mucous membrane, nervous system tissue, muscle, spleen, cardiovascular system, pancreas,
esophagus…
1) Immuno‐localization of MCLR
Using MCLR specific antibodies as described supra, a strong labeling is observed at 48 hours in
eleuthero‐embryos treated by MCLR in intestinal mucous membrane (enterocytes and lamina
propria) and liver (hepatocytes and probably sinusoidal border associated macrophages).
Labeling is more intense in 20µg than in 10µg MCLR/ml treated embryos. No labeling is
observed in other organic structures (nervous tissue, other mucous membranes, spleen,
muscle, skin and gills, cardiovascular organs….) but in yolk vesicle epithelial membrane where
very light labeling is sometimes observed.
2) Ultra structural observation
Ultrastructural analysis performed on surviving eleuthero‐embryos indicated in enterocytes
and hepatocytes of treated animals, a complex set of changes on cytoskeletal structures with
no clear changes of nuclear chromatin, Golgi apparatus or mitochondria. In the liver,
endothelial cells appeared normal but a reduction of length of Disse's space was noticed in
treated fishes, due to reduction of the microvillus border of hepatocyte vascular faces. A
reduction of microvillus hepatocyte border was also noticed at the biliary surface of these cells
(in biliary canaliculi). Disjunction between hepatocytes was also observed and some
vacuolization of the cytoplasm. In enterocytes, a clear dissociation of the apical junction
complex was noticed, associated to vacuolization of the cytoplasm.
39

DISCUSSION
Universitatea de Științe Agricole și Medicină Veterinară Iași
Immersion in elevated MC‐LR concentrations had apparently no significant external effect in
fish and amphibian, in contrast to the lethal observations performed after intra‐peritoneal
injection and oral application (gavage) of MC‐LR (Phillips et al., 1995, Tencella et al., 1994,
Oberemm, 1999).
However, in fish eleuthero‐embryos species transferred in toxin‐free media after embryonic
development and hatching pre‐exposure to MCs, usually malformations, embryonic growth
inhibition and hepatocellular toxicity occurred (Zhang et al., 2008, El Ghazali et al., 2009) with
apparently weak desire for food (Zhang et bal., 2008).
Medaka fish at the eleuthero‐embryo stage are fully autotroph during the first four days after
hatching. In our experience, these vesiculated larvae expressed no significant external and
histopathological effects when exposed by immersion during 48 hours in medium containing 1
to 10 µg MC‐LR/ml.
Significant mortality (>10%) during the experimental period (48 hours) was only observed
when vesiculated embryos were immersed at the highest concentration of MC‐LR (20µg/ml).
Our observation agrees Oberemm et al. data (1999) who did not observed any effect of MCLR
at concentration as high than 0.1, 1 and 5 µg/ml in zebrafish eleuthero‐embryos (Danio rerio)
after 48 hours exposure. However, the same embryos showed, at the dose of 10µg MCLR/ml,
pectoral edema and enlarged and opaque yolk after 24 hours exposure. Similarly, no effect on
morphological development or survival during 10 days exposure were noticed during larval
development (tailbud stage) in the toad (Bufo arenarum) at concentrations of 1‐20mg MC‐LR
/l (Chernoff et al., 2002). Nevertheless, one study showed during embryonic and larval stages
of loach (Misgursuns mizolepis) a very high sensitivity to MC‐LR exposure, resulting in
pericardial edema and tubular heart, bradycardia, poor yolk absorption, small head, curved
body and tail, and abnormal hatching. Heart and liver were found to be primary targets of MC‐
LR in this later study (Liu et al., 2002). Therefore, the loach (Misguruns mizolepsis) appears the
most sensitive fish species tested.
In our medaka eleuthero‐embryos toxic test, using available commercially monoclonal
antibodies, we could clearly immunolocalize MC‐LR, mainly in intestine and liver whereas
some faint localization of MC‐LR was also detected in pancreas, kidney and yolk vesicle.
At histological examination (paraffin embedded tissue with trichromic stain), lesions of
enterocytes and hepatocytes were clearly detected; mainly vacuolization but also variation of
size cells with anisocytosis and anisocaryosis and necrotic changes with pycnosis in
hepatocytes. At ultrastructural level, one of the main observed effects of MC‐LR was the
rupture of the junction systems on the latero‐apical side of the enterocytes and between
hepatocytes; these observations are in good agreement with Wang’s publication (Wang et al.,
2005) describing loss of blastomere coherence by interfering the distributions of β‐catenin and
cadherines in zebrafish embryo after MC‐LR microinjection.
During our 48 hours toxic assay, immunolocalization of MC‐LR could be obtained mainly in
intestine and liver, likely indicating uptake and binding of MC‐LR by enterocytes and transfer
and bioaccumulation into the liver (hepatocytes and probably local macrophages).
MCLR was also labeled with lighter intensity in pancreas and kidneys epithelial cells.
In contrast, oral, esophagus and stomach mucosa did not show any sign of MC‐LR fixation or
accumulation. No other labeling was observed in skin, gills, heart and vascular system, central
nervous tissue or muscle. Furthermore, no rupture of intercellular junction complex or other
significant lesions were observed in these organs and tissues.
40

Lucrări Științifice – vol 53 seria Medicină Veterinară
Nevertheless, we are interested in tracing MC‐LR in epithelial syncytia cells of yolk vesicle
(data not shown) and some further studies are required during the early time of immersion to
precise the toxico‐dynamic of MCLR uptake.
Normal liver tissue in fish is organized in a tubulo‐sinusoidal pattern and differs from the
lobular pattern characteristic of mammalian liver. Medaka liver consists of sheet‐like
arrangements of parenchymal cells with interlacing sinusoids and few bile ducts and caniculi
(Hinton and Couch, 1998; Boorman et al., 1997). The fenestrated endothelium of sinusoids
acts as a sieve, preventing passage of blood cells in the Disse’s space, but allowing some blood
proteins and small lipoproteins to pass through. Indeed, microvilli of hepatocyte membrane
increase the exchange surface of these cells along the Disse’s space border and also along the
bile canaliculi border. Ultrathin sections observations using microscopy approach indicated
that medaka fish embryos exposed to 10 or 20µg MC‐LR/ml showed a clear reduction of
membrane hepatocyte microvilli on the Disse’s space and on the biliary canaliculi surfaces.
These clear ultrastructure changes certainly results in a reduced exchange efficiency in
hepatocyte of MC‐LR‐treated medaka eleuthero‐embryos. Microcystin is known to cause liver
damages in fish (Philipps et al., 1985, Rabergh et al., 1991, Tencalla and Dietrich, 1997) and to
affect the bile acid transport system involved in MC‐LR transport in hepatocyte (Runnegar et
al., 1995).
Controversial data are found depending of the species in the literature concerning the
bioaccumulation of MC in the liver following gill membrane absorption of MC (Casenave et al.,
2005, Xie et al., 2005) whereas others studies suggest that epithelia of gills and skin of
freshwater fish form a barrier to MC transport (Tencalla et al., 1994, Bury et al., 1995). In
contrast to others studies (Gaete et al., 1994, Bury et al., 1995, Zambrano and Canelo, 1996)
no gills damaging was observed in our study whatever was MC‐LR concentrations of the
medium.
Finally, histopathological and immuno‐histopathological studies permit to have better
comprehension of MCs toxicity and better knowledge about ways of penetration, tissue
repartition and pathological effect of this important class of natural environmental toxins.
Bibliography
1. Azevedo SM, Carmichael WW, Jochimsen EM, Rinehart KL, Lau S, Shaw GR, Eaglesham GK
(2002). Human intoxication by microcystins during renal dialysis treatment in Caruaru‐Brazil.
Toxicology. 181‐182:441‐6.
2. Balon, E. K. J Fish Res Board Canad 1975, 32, 1663 1670
3. Beasley VR, Lovell RA, Holmes KR, Walcott HE, Schaeffer DJ, Hoffmann WE, Carmichael WW.
2000. MCLR decreases hepatic and renal perfusion, and causes circulatory shock, severe
hypoglycemia, and terminal hyperkalemia in intravascularly dosed swine. J Toxicol Environ
Health A. 61(4):281‐303
4. Brock TD. 1973. Lower pH limit for the existence of blue‐green algae: evolutionary and
5. ecological implications. Science. 179(72):480‐3.
6. Bury, N. R.; McGeer, J. C.; Eddy, F. B.; Codd, G. A. J Fish Diseases 1997, 20, 209 215.
7. Carbis, CR, Rawlin, GT, Grant, P, Mitchell, GF, Anderson, JW, McCauley, I (1997) A study of feral
carp, Cyprinus carpio L., exposed to Microcystis aeruginosaat Lake Mokoan, Australia, and
possible implications for fish health. JFish Dis 20: 81‐91
8. Carmichael WW. 1992. Cyanobacteria secondary metabolites—the cyanotoxins. J Appl
Bacteriol. 72: 445–59
9. Carmichael WW, Azevedo SM, An JS, Molica RJ, Jochimsen EM, Lau S, Rinehart KL, Shaw GR,
Eaglesham GK. 2001. Human fatalities from cyanobacteria: Chemical and biological evidence
for cyanotoxins. Environ Health Perspect. 109:663‐68
41

Universitatea de Științe Agricole și Medicină Veterinară Iași
10. Chernoff N, Hunter ES 3rd, Hall LL, Rosen MB, Brownie CF, Malarkey D, Marr M,
11. Herkovits J. 2002. Lack of teratogenicity of microcystin‐LR in the mouse and
12. toad. J Appl Toxicol. 22(1):13‐7
13. Donnan GA, Fisher M, Macleod M, Davis SM (2008). "Stroke". Lancet 371 (9624): 1612–23.
14. Funari E, Testai E. (2008) Human health risk assessment related to cyanotoxins exposure. Crit
Rev Toxicol.. :38(2):97‐125
15. Hindman SH, Favero MS, Carson LA, Petersen NJ, Schonberger LB, Solano JT. 1975. Pyrogenic
reactions during haemodialysis caused by extramural endotoxin. Lancet. 2: 732–34
16. Hooser SB. 2000. Fulminant hepatocyte apoptosis in vivo following microcystin‐LR
administration to rats. Toxicol Pathol. 28(5):726‐33
17. Kungsuwan A, Noguchi T, Matsunaga S, Watanabe MF, Watabe S, Hashimoto K. (1988)
Properties of two toxins isolated from the blue‐green alga Microcystis aeruginosa. Toxicon.
26(2):119‐25.
18. Liu Y, Song L, Li X, Liu T. 2002. The toxic effects of microcystin‐LR on embryo‐larval and juvenile
development of loach, Misguruns mizolepis Gunthe. Toxicon. 40(4):395‐9
19. Magalhães VF, Soares RM, Azevedo SM. (2001)‐ Microcystin contamination in fish from the
Jacarepaguá Lagoon (Rio de Janeiro, Brazil): ecological implication and human health risk.
Toxicon, 39(7):1077‐85
20. MacKintosh RW, Dalby KN, Campbell DG, Cohen PT, Cohen P, MacKintosh C. 1995. The
cyanobacterial toxin microcystin binds covalently to cysteine‐273 on protein phosphatase 1.
FEBS Lett. 371(3):236‐40.
21. Mezhoud K, Bauchet AL, Château‐Joubert S, Praseuth D, Marie A, François JC, Fontaine JJ, Jaeg
JP, Cravedi JP, Puiseux‐Dao S, Edery M. (2008)‐ Proteomic and phosphoproteomic analysis of
cellular responses in medaka fish (Oryzias latipes) following oral gavage with microcystin‐LR .
Toxicon.;51(8):1431‐9
22. Mezhoud K, Praseuth D, Puiseux‐Dao S, François JC, Bernard C, Edery M. (2008)‐ Global
quantitative analysis of protein expression and phosphorylation status in the liver of the
medaka fish (Oryzias latipes) exposed to microcystin‐LR I. Balneation study. Aquat Toxicol.;
86(2):166‐75.
23. Mezhoud K, Praseuth D, Francois JC, Bernard C, Edery M. (2008)Global quantitative analysis of
protein phosphorylation status in fish exposed to microcystin. Adv Exp Med Biol; 617:419‐26
24. Phillips, M. J.; Roberts, R. J.; Stewart, J. A.; Codd, G. A. J. Fish Diseases 1985, 8, 339 344.
25. Rabergh, C. M. I.; Bylund, G.; Eriksson, J. E. Aquat Toxicol ̊ 1991, 20, 131‐146
26. Rinehart KL, Harada K‐I, Namikoshi M, Chen G, Harvis C, Munro MHG, Blunt JW, Mulligan
PE,Beasley VR, Dahlem AM, Carmichael WW. 1988. Nodularin, microcystin and the
configuration of ADDA. J Am Chem Soc 110:8557‐58
27. Runnegar M, Berndt N, Kong SM, Lee EY, Zhang L. (1995a). In vivo and in vitro binding of
microcystin to protein phosphatases 1 and 2A. Biochem Biophys Res Commun. 216(1):162‐9
28. M.T. Runnegar, R.G. Gerdes and I.R. Falconer, The uptake of the cyanobacterial hepatotoxin
microcystin by isolated rat hepatocytes, Toxicon 29 (1991), pp. 43–51.
29. M. Runnegar, N. Berndt and N. Kaplowitz, (1995b) Microcystin uptake and inhibition of protein
phosphatases: effects of chemoprotectants and self‐inhibition in relation to known hepatic
transporters, Toxicology and Applied Pharmacology 134 (1995), pp. 264–272
30. Soares RM, Yuan M, Servaites JC, Delgado A, Magalhães VF, Hilborn ED, Carmichael WW,
Azevedo SM (2006). Sublethal exposure from microcystins to renal insufficiency patients in Rio
de Janeiro, Brazil. Environ Toxicol. 21(2):95‐103
31. Tencalla, F. G., Dietrich, D. R. and Schlatter, C. (1994) Toxicity of Microc~stis aeruginosa peptide
toxin to rainbow trout (Oncorhynchus mykiss). Aquatic toxic. 30, 215‐224.
32. Tencalla, F. and Dietrich, D., 1997. Biochemical characterization of microcystin toxicity in
rainbow trout (Oncorhynchus mykiss). Toxicon 35, pp. 583–595.
33. Ueno Y, Nagata S, Suttajit M, Mebs D and Visconcelos V.1998. Immunochemical survey
34. of microcystins in environmental water in various countries. Eds.M Miragala, H van Egmond, C
Brera and J Gilbert. In. Mycotoxins and Phycotoxinsdevelopments in chemistry, toxicology and
42

Lucrări Științifice – vol 53 seria Medicină Veterinară
food safety. Alaken Inc. Fort Collins, Colorado.
35. Watanabe MF, Oishi S. 1985 Effects of environmental factors on toxicity of a
36. cyanobacterium (Microcystis aeruginosa) under culture conditions. App Environ
37. Microbiol. 49: 1342‐44
38. Wiegand, C., Pflugmacher, S., Oberemm, A., Meems, N., Beattie, K.A., Steinberg, C.E.W. and
Codd, G.A., 1999. Uptake and effects of microcystin‐LR on detoxication enzymes of early life
stages of zebrafish (Danio rerio). Environ.
43

PREVALENCE OF CRYPTOSPORIDIUM SPP. AND OTHER
ENTEROPATHOGENS INFECTIONS AT CALVES IN WESTERN,
CENTRAL AND NORTH‐WESTERN ROMANIA
Gh. DĂRĂBUŞ 1 , V. COZMA 2 , K. IMRE 1 , A. BEJAN 2 , M.S.ILIE 1 , MIRELA IMRE 1
1 – Faculty of Veterinary Medicine Timişoara, Calea Aradului, nr. 119
2 ‐ Faculty of Veterinary Medicine Cluj‐Napoca, Calea Mănăştur, nr. 3‐5
e‐mail: gheorghe.darabus@fmvt.ro
Summary: The aim of the research was to reveal the most important enteropathogen agents in
calves in the first months of life and to establish their prevalence in Western, Central and North‐
Western Romania. The study was carried out on 370 calves, with or without diarrhea, in seven
Counties.
Based on the copro‐ELISA test, infections with Cryptosporidium (41.4%), rotavirus (16.2%),
coronavirus (10.3%) and Escherichia coli F5 (K99) enteropathogen (1.08%), were identified. The
most common association was semnalated between Cryptosporidium spp. and coronavirus (5.9%)
followed by Cryptosporidium spp. ‐ rotavirus (5.4%) mixed infection.
Higher prevalence observed in monoinfections (38.4%) compared with associated infections
(14.3%), may suggest a possible competition for the same biotope.
Key words: Cryptosporidium spp; rotavirus; coronavirus; Escherichia coli F5.
Discovered in 1907 by Tyzzer in the gastric glands of mice, protozoans to the genus
Cryptosporidium are present in many domestic animals, humans and other vertebrates, having
large host specificity. In the last decades, given the pathological and zoonotic implications,
interest in studying this parasite has increased enormously, many knowledge being
accumulated on biology, epidemiology, diagnosis and control of this parasitosis (3, 4, 10, 11,
12, 17, 18, 19, 31).
In mammals, especially in calves, in uncomplicated infections with microbial agents,
cryptosporidiosis causes an increased morbidity but generally, low mortality. Calves, especially
during the first month of life, are most frequently affected by Cryptosporidium, which is one of
the major enteropathogens involved in neonatal diarrhea. Infection with Cryptosporidium spp.
is often associated with coronavirus, rotavirus and Escherichia coli F5 (K99) (1, 8, 9, 13, 14, 27,
30).
As the diarrheal disease syndrome in calves is very important, conventional diagnosis methods
were improved with immunological methods, for detection of oocysts and other
enteropathogens in faeces (22, 28). The sensitivity and specificity of immunological methods is
undoubtedly (21, 22, 26).
The aim of this study was to determine the prevalence of cryptosporidiosis and other
infections with three enteropathogen agents, in calves, in the first month of life, using ELISA
test in Western, Central and North ‐ Western Romania.
MATERIALS AND METHODS
The study was carried out in Western, Central and North‐Western Romania in seven Counties
(Arad, Bihor, Caraş‐Severin, Timiş, Cluj, Mureş and Satu Mare). A number of 370 calves, aged
44

Lucrări Științifice – vol 53 seria Medicină Veterinară
between 1‐30 days, with or without diarrhea, were examined between January 2008 and
December 2009. Faecal samples were collected directly from the rectum in sterile plastic
bottles. Recipients were stored at 4°C and the samples were processed using a coproantigen‐
ELISA test within 24 hours.
The ELISA kit used were: BioX Easy‐Digest (BIO K 151) and BioX Duo Digestive ELISA Kit (BIO K
083) according to the manufacturer’s instructions.
RESULTS AND DISCUSSIONS
The prevalence of infection with Cryptosporidium and other enteropathogens in calves, in the
first month of life, in investigated areas from Romania, are summarized in table 1.
Table 1
Infections with enteropathogens in calves, in the first months of life, in Western, Central and
North‐Western Romania
Investigated areas
Infection with
Western Romania
(n=315)
Central and North‐
Western Romania
(n=55)
Total
(n=370)
Cryptosporidium spp. 140 (44.4)
number of positive samples (%)
13 (23.6) 153 (41.4)
Rotavirus 52 (16.5) 8 (14.5) 60 (16.2)
Coronavirus 33 (10.5) 5 (10) 38 (10.3)
E. coli F5 (K99) 4 (1.3) 0 4 (1.08)
Negative 86 (27,3) 29 (52.7) 115 (31.08)
Legend: n = number of animals investigated.
On the whole, the prevalence of Cryptosporidium spp. infections was 41.4%. The investigations
carried out in Western Romania revealed a significant higher prevalence (p

Universitatea de Științe Agricole și Medicină Veterinară Iași
found in calves in this study is close to that obtained from De la Fuente et al. (1998b) in
Central Spain (52.3%) which also made epidemiological investigations in young cattle in the
first month of life. Similarly, in Germany, Otto et al. (1995), found in calves, in the first three
weeks of life, a prevalence of Cryptosporidium infection of 52.5%.
Table 2
Prevalence of infection with enteropathogens in calves in the first months of life in
investigated areas of Romania
Infection(s) with Positive samples (%) (n=370)
Cryptosporidium alone 103 (27.8)
Rotavirus alone 31 (8.4)
Coronavirus alone 7 (1.9)
E. coli F5 (K99) alone 1 (0.3)
Cryptosporidium + Coronavirus 22 (5.9)
Cryptosporidium + Rotavirus 20 (5.4)
Cryptosporidium +E. coli F5 (K99 2 (0.5)
Coronavirus + Rotavirus 3 (0.8)
Cryptosporidium + Rotavirus + Coronavirus 5 (1.3)
Cryptosporidium + Rotavirus + Coronavirus
1 (0.3)
+E. coli F5 (K99)
Total 195 (52.7)
Legend: n = number of animals investigated
The second enteropathogen agent, as prevalence (16.2%), was rotavirus. It is however less
prevalent than reported by other authors in Israel (41.4%), Spain (42.7%), Ireland (38.9%) (6,
15, 16). Values close to those reported by us were reported by Abraham et al. (1992) in
Ethiopia (16.7%), Garcia et al. (2000) in Spain (20.4%) and Pérez et al (1997) in Costa Rica (7%).
Coronavirus infection prevalence in calves (10.3%) found in the investigated areas are
comparable to that found by Akam et al. (2004) in Algeria (7.5%).
Lower prevalence of E. coli F5 (K99) infection found in our study may be a consequence of
reduced sensitivity of tetravalent ELISA‐kit, fact reported in a paper by de Fuente et al.
(1998a).
Mixed infections were found in 14.3% of the investigated calves. The most common
association observed was between Cryptosporidium and coronaviruses (5.9%) followed by
Cryptosporidium – coronavirus association (5.4%). This fact is in contradiction with the results
published in the majority of studies worldwide, who sustained that the most common mixed
infection is with Cryptosporidium and rotaviruses (6, 13, 16, 20).
The four pathogen agents identified by ELISA, evoluated as unique infections and lass as
associated infections. This may suggest a competition between different enteropathogen
agents for the same biotope.
CONCLUSIONS
� The epidemiological screening carried out using ELISA double‐sandwich technique at
young calves, in the first month of life, from Western, Central and North‐Western Romania
revealed a prevalence of 41.4% for cryptosporidiosis, 10.3 for coronavirosis, 16.2% for
rotavirosis and 1.08% for enterotoxigen E. coli F5 infection.
46

Lucrări Științifice – vol 53 seria Medicină Veterinară
� The most common association was semnalated between Cryptosporidium spp. and
coronavirus (5.9%) followed by Cryptosporidium spp. ‐ rotavirus (5.4%) mixed infection.
� Higher prevalence observed in monoinfections (38.4%) compared with associated
infections (14.3%), may suggest a possible competition for the same biotope.
ACKNOWLEDGEMENTS
The current research was based on grant (51‐034/2007 PN II ‐ Parteneriate) obtained by Prof.
Dărăbus from CNMP.
REFERENCES
1. ABRAHAM, G., ROEDER, P.L., ROMAN, ZEWDU, 1992. Agents associated with neonatal
diarrhoea in Ethiopian dairy calves. J. Trop. Animal Health and Production., 24: 1573‐1589.
2. AKAM A., KHELEF, D., KAIDI R., LAFRI, M., RAHAL, KH., CHIRILA, F., COZMA V., 2004.
Frequency of Cryptosporidium parvum, Escherichia coli K99 and Salmonella spp. isolated from
calves in six breeding farms from Mitidja, Algeria, Bull. USAMV Cluj Napoca, Seria. Med Vet. 61:
287‐290.
3. AKIYOSHI, D.E., FENG, X., BUCKHOLT, M.A., WIDMER, G., TZIPORI, S., 2002. Genetic analysis of
a Cryptosporidium parvum human genotype 1 isolate passaged through different host species.
Infect. Immun., 70: 5670‐5675.
4. AL‐BRIKAN, F.A., SALEM, H.S., BEECHING, N., HILAL, N., 2008. Multilocus genetic analysis of
Cryptosporidium isolates from Saudi Arabia. J. of Egyptian Society of Parasitol., 38: 645‐658.
5. ANGUS, K.W., 1987. Cryptosporidiosis in domestic animals and humans. In Practice, March.,
47‐49
6. BRENNER, J., ELAD, D., MARKOVICS, A., GRINBERG, A., TRAININ, Z., 1993. Epidemiological
study of neonatal calf diarrhoea in Israel‐a one‐year survey of faecal samples. Isr. J. Vet. Med.,
48: 113‐116.
7. CHERMETTE, R., BOUFASSA, S., 1988. Cryptosporidiose: une maladie animale et humaine
cosmopolite, O.I.E., Série Technique, Nr. 5
8. CHINSANGARAM, J., SCHORE, C.E., GUTERBOCK, W., 1995. Prevalence of group A and group B
rotaviruses in the feces of neonatal dairy calves from California. Com. Immunol. Microbiol.
Infect. Dis., 18: 93–103.
9. CLARK, M.A., 1993. Bovine coronavirus. Br. Vet. J., 149: 51–70.
10. CURRENT, W.L., 1988. The biology of Cryptosporidium. A. S. M. News., 54: 605‐611.
11. DĂRĂBUŞ, GH., 1996. Criptosporidioza: cercetări privind etiologia, epidemiologia, patogenia,
diagnosticul şi tratamentul în infecțiile naturale şi experimentale. Teză de doctorat, Facultatea
de Medicină Veterinară ‐Timişoara.
12. DĂRĂBUŞ, GH., 1997. Criptosporidioza la om şi animale. Ed. Brumar, Timişoara.
13. DE GRAAF, C.D., VANOPDENBOSCH, E., ORTEGA‐MORA, L.M., ABBASSI, H., PEETERS, J.E.,
1999. A review of the importance of cryptosporidiosis in farm animals. Int. J. Parasitol., 29:
1269‐1287.
14. DE LA FUENTE, R., GARCIA, A., RUIZ‐SANTA‐QUITERIA, J.A., LUZON, M., CID, D., GARCIA, S.,
ORDEN, J.A., GOMEZ‐BAUTISTA, M., 1998. Proportional morbidity rates of enteropathogens
among diarrheic dairy calves in central Spain. Prev. Vet. Med., 36: 145‐152.
15. DE LA FUENTE, R., LUZON, M., RUIZ‐SANTA‐QUITERIA, J.A. GARCIA, A., CID, D., ORDEN, J.A.,
GARCIA, S., SANZ, R., GOMEZ‐BAUTISTA, M., 1998. Cryptosporidium and concurrent infections
with other major enteropathogens in 1 to 30‐Zile‐old diarrheic dairy calves in central Spain. Vet.
Parasitol., 80: 179‐185.
16. FAGAN, J.G., DWYER, P.J., QUINLAN, J.G., 1995. Factors that may affect the occurence of
enteropathogens in the faeces of diarrhoeic calves in Ireland. Irish Vet. J., 48: 17‐21.
47

Universitatea de Științe Agricole și Medicină Veterinară Iași
17. FAYER, R., 2008. The general biology of Cryptosporidium, p. 1‐41. In R. Fayer, L. Xiao, (ed),
Cryptosporidium and cryptosporidiosis. CRC Press, Inc., Boca Raton, Fla.
18. FAYER, R., MORGAN, U., UPTON, S. J., 2000. Epidemiology of Cryptosporidium: transmission,
detection and identification. Int. J. Parasitology., 30: 1305‐1322.
19. FAYER, R., UNGAR, B.L.P., 1986. Cryptosporidium spp. and Cryptosporidiosis. Microbiol. Rev.,
50: 458‐483.
20. GARCIA, A., RUIZ‐SANTA‐QUITERIA, J.A., ORDEN, J.A., CID, D., SANZ, R., GOMEZ‐BAUTISTA,
M., FUENTE, R., 2000. Rotavirus and concurrent infections with other enteropathogens in
neonatal diarrheic dairy calves in Spain. Comp. Immun. Microbiology & inf. Diseases., 23: 175‐
183.
21. GRACZYK, T.K., CRANFIELD, M.R., FAYER, R., 1996. Evaluation of commercial enzyme
immunoassay (EIA) and immunofluorescent antibody (IFA) test kits for detection of
Cryptosporidium oocysts of species other than Cryptosporidium parvum. Am. J. Trop. Med.
Hyg., 54: 274‐279.
22. IMRE, K., DĂRĂBUŞ, GH., ILIE, M.S., MIRELA PALCA, TAMASY L., 2008. Evaluation of some
diagnosis methods in cryptosporidiosis. Scientific Works ‐ Veterinary Medicine C Series., 53:
269‐276.
23. IMRE, K., MATOS OLGA, DĂRĂBUŞ, GH., NARCISA MEDERLE, OPRESCU, I., MORARIU, S., ILIE,
M., IONELA HOTEA, MIRELA IMRE, 2009. First genetic identification of Cryptosporidium spp. in
cattle in Romania. Lucrări Ştiințifice Medicină Veterinară, 52:26‐30.
24. OTTO, V.P., ELSCHNER, M., GÜNTHNER, H., SCHULZE, F., 1995. Vergleichende Untersuchungen
yum nachweis von Rotaviren, Coronaviren, Kryptosporidien und enterotoxigen E. coli im Kot
durchfallkranker Kälber. Tierärztl Umschau., 50: 80‐86.
25. PÉREZ, E., KUMMELING, A., JANSSEN, M.M.H., JIMÉNEZ, C., ALVARADO, R., CABALLERO, M.,
DONADO, P., DWINGER, R.H., 1997. Infectious agents associated with diarrhoea of calves in
the canton of Tilárán, Costa Rica. Prev. Vet. Med., 33: 195‐205.
26. RODAK, L., BABIUK, L.A., ACRES, S.D., 1982. Detection by radioimmunoassay and
enzymelinked immunosorbent assay of coronavirus antibodies in bovine serum andlacteal
secretions. J Clin Microbiol., 16: 34–40.
27. SCHLAFER, D.H., SCOTT, F.W., 1979. Prevalence of neutralizing antibody to the calf rotavirus in
New York cattle. Cornell. Vet., 69: 262–71.
28. SMITH, H.V., 2007. Diagnostics p. 173‐203. In Fayer, R., Xiao, L. (ed.), Cryptosporidium and
cryptosporidiosis. Second Edition. CRC Press and IWA Publishing., Boca Raton, Fla.
29. SNODGRASS, D.R., TERZOLO, H.R., SHERWOOD, D., CAMPBELL, I., MENZIES, J.D., SYNGE B.A.,
1986. Aetiology of diarrhoea in young calves. The Veter. Record., 119: 31‐34.
30. TORRES‐MEDINA, A., SCHLAFER, D.H., MEBUS, C.A., 1985. Rotaviral and coronaviral diarrhea.
Vet. Clin. North. Am. Food. Anim. Pract., 1:471–93.
31. XIAO, L., FENG, Y., 2008. Zoonotic cryptosporidiosis. FEMS Immunology and Medical Microbiol.,
52: 309‐323.
48

ASPECTS REGARDING VASCULOGENIC MIMICRY IN CANINE
MAMMARY CANCER
GAL A.F. 1 , CATOI C. 1 , BABA AI 1 , MICLAUS V. 2 , BOLFA P. 1 ,
TAULESCU M 1 , TABARAN F. 1 , NAGY A. 1 , MOUSSA R. 1 , Cosmina CUC
1 Department of Pathology, Necropsy and Forensic Medicine
2 Department of Histology
Faculty of Veterinary Medicine Cluj‐Napoca, 3‐5 Mănăştur Street, Romania,
AGAL_77_2001@yahoo.com.
Abstract: This article describes and investigates intratumor angiogenesis in canine
mammary tumors, respectively the presence of vasculogenic mimicry pattern of
angiogenesis in canine mammary cancer. Vasculogenic mimicry suppose the forming of
blood flowing channels in continuation of existing vessels especially in fast growing
tumors with extended hypoxic areas. The channels are lined directly by tumoral cells
that generate a PAS positive material to the inner part of the”vessel”. Mammary
tumors had been provided by corps or tumor biopsies originated from different dog
breeds and age. Detection and monitoring of intratumor angiogenesis and especially of
blood flowing channels was evaluated using immunohistochemical LSAB reaction
or/and double reaction, respectively immunohistochemical and PAS reactions.
Elaborated work analyzed eight canine mammary tumors, respectively one benign and
seven malign tumors. The occurrence of blood flowing channels was higher in vicinity of
intratumor necrotic areas, knowing that hypoxia stimulate angiogenesis. Vasculogenic
mimicry was notified more frequent in tumors with reduced stroma and numerous
cancerous cells (compact mammary cancer), and in poorly differentiated canine
mammary cancers. Some peculiarities of some blood flowing channels was represented
by discreet immunohistochemical reaction that often was restricted only to a region of
vascular wall not to all vessel’s circumference.
INTRODUCTION
Key words: angiogenesis, immunohistochemistry, PAS reaction, vasculogenic mimicry.
Vasculogenesis is a complex multistage process characterized by formation of new vessels
from preexisting ones (1, 5, 7). Angiogenesis is essential for tumoral growing and metastasis,
that’s why in more aggressive tumors the angiogenesis is more intense due to increased
demands for newly formed structure. There are three main theories regarding intratumor
angiogenesis, respectively (I) The theory of multistage angiogenesis, (II) The theory of cooption
of preexisting vessels by the tumor, and (III) The theory of vasculogenic mimicry (1).
Angiogenesis is a complex process that leads to generation of new capillaries from preexisting
vascular network (multistage angiogenesis), or by forming of blood flowing channels delimited
directly by tumoral cells (vasculogenic mimicry). Endothelial cell proliferation is 30‐40 folds
higher in tumor structure comparing from normal tissues. Multistage angiogenesis begin with
degrading of the basal membrane, followed by proliferation and migration of endothelial cells
outside from the vessel structure. These cells are organizing into a tubular structure that forms
49

Lucrări Științifice – vol 53 seria Medicină Veterinară
some vascular buds originated in existing vessels. Finally, there it is formed a new blood vessel
that supply a territory from tumor. Regarding the second theory of angiogenesis, the tumor
entity subdue preexisting vessels, especially that ones from the periphery of tumor (1).
The vasculogenic mimicry pattern of angiogenesis shows the plasticity and increased
adaptability of tumoral cells to some injurious conditions such as hypoxia. This model is
characterized by the formation of some PAS positive channels lined directly by tumoral cells
not by endothelial cells, contributing in this manner to intratumor blood flow. Vasculogenic
mimicry was firstly described in uveal melanoma, malignant astrocytoma, breast cancer,
osteosarcoma, etc (21).
There are many reports concerning intratumor angiogenesis and its importance in cancer
progression and development. The vasculogenic mimicry pattern of tumor angiogenesis was
and is an interesting idea that suggests the abilities of tumoral cells to avoid necrosis due to
hypoxia. Vasculogenic mimicry was noticed also in cell cultures originated from aggressive
melanomas; the cells had the abilities to form PAS positive channels without endothelium (4).
Furthermore, some studies proved that presence of vasculogenic mimicry is related with
unfavorable prognosis. Initially was thought that blood flowing channels are generated by
stromal cells originated in fibrovascular septa (3, 6, 18), but subsequent was noticed that the
channels are bordered directly by tumoral cells, which generate PAS positive material to the
channel’s lumen (19).
MATERIAL AND METHODS
Mammary tumor formations had been provided by corps or tumor biopsies reached to
Pathology department from the University of Agricultural Science and Veterinary Medicine,
Faculty of Veterinary Medicine Cluj‐Napoca, Romania. There were utilized 7 malign and 1
benign tumors provided by different bitch breeds, such as: Cocker (3 subjects), Teckel (2
subjects), Amstaff (1 subject), German Sheppard (1 subject) and Mioritic Sheppard (1 subject).
The mammary tumors are from 8 bitches, with the age of 2‐13 years.
Had been recorded several dates from anamnesis and tumoral characteristics (tumor
size, consistence, gross section aspect, lymph nodes state). From the tumors and lymph nodes
were harvested samples for histological exam avoiding tumoral necrotic or cystic areas,
samples being immersed in buffered 10% formalin, and then process by paraffin technique.
Slides were stained by usual techniques, respectively tricrom Masson and hematoxylin eosin.
Mammary tumors were framed conformal to WHO classification for mammary tumors and
graded into three types (from grade I‐less aggressive, to grade III‐high aggressivity). To
establish histological grading was quantified the following: nuclear grade, mitotic index and
extending of tubular structures in tumoral mass.
Detection and monitoring of intratumor angiogenesis and especially of blood flowing
channels was evaluated using immunohistochemical LSAB reaction or/and double reaction,
respectively immunohistochemical and PAS reactions. Immunohistochemical reaction used
CD31 monoclonal antibody (Dako – clone JC70A, izotype IgG1 kappa). Histological slides had
about 5 μm thicknesses and were fixed on silanized slides (Dako) during 24 hours in 37°C,
followed by deparaffination in xylen. Antigen retriever had been made using a pressurized
cooker in citrate solution, pH=6.0 (Dako); endogenous peroxidase was inactivated by
peroxidase blocking reagent (Dako ‐ Peroxidase and PA blocking reagent 3%) during 5 minutes
at the room temperature. Primary monoclonal antibodies (anti‐CD31) were maintained
overnight, during 18 hours at 4°C, using a dilution of 1:30 (Dako antibody diluent). The
visualization of immunological reaction was performed using Universal LSAB+Kit/HRP,
50

Lucrări Științifice – vol 53 seria Medicină Veterinară
Rb/Mo/Goat (DAB+) system (Dako); the counterstaining was performed by Mayer
hematoxylin. To evaluate the antibody specificity were used negative control (replacing the
primary antibody with antibody diluent) and internal positive tissue control (immunolabel of
large vessels). Using PAS reaction may be highlighted mucopolysaccharides, which are present
toward the inner part of the blood flowing channels. Double staining procedure
(immunohistochemical and PAS reactions) had been realized at the end of
immunohistochemical staining, before staining with Mayer hematoxylin. The slides were
immersed in periodic acid (aqueous solution 0,5%) and Schiff reactive (30 minutes). Slides
were rinsed with tap water and counterstained with Mayer hematoxylin.
To evaluate the microvessel number, perimeter and aria, we used a semiautomatic
computerized analysis technique (Olympus Soft imaging solutions Cell B). There were analyzed
5 microscopic fields on every tumor, magnified of 200x. The microscopic images were
obtained by Olympus BX51 microscope, connected to a photo digital camera (Olympus DP‐25).
Total vascular aria (total intratumor area expressed in µm 2 /image area, and its percentage;
average vessel area for each tumor), total vascular perimeter (average perimeter expressed in
µm/image area), and the microvessel number were related to microscopic image area
(144352,00 μm 2 ). Any isolated but immunohistochemically labeled endothelial cell (vessels
without lumen) was quantified as distinct microvessel.
PAS positive blood flowing channels from different canine mammary tumor types were
examined by monitoring all clear spaces bordered PAS positive material and/or directly by
tumoral cells. The occurrence of vasculogenic mimicry pattern was evaluated as follow:
relatively frequent encountered (++), rarely met but present (+), and absent (‐).
RESULTS AND DISCUSSIONS
In 1948 in human pathology Willis et al. (1948) showed that some tumors with a fast
growing rate presents some channels similarly in structure with blood vessels but without
endothelium (20). The author mentions the bordering of the channel directly by tumoral cells.
Later this feature was termed vasculogenic mimicry, being encountered in several aggressive
tumors (1, 3, 4, 6, 14, 19, 21). Nasu et al. (1999) describe a similar type of intratumor
angiogenesis, describing some non‐endothelial channels where endothelial cells are scattered
and without PAS positive material. The author considers these non‐endothelial channels
something different from vasculogenic mimicry (15). Elaborated work analyzed eight canine
mammary tumors, respectively one benign and seven malign tumors originated from different
dog breeds of different age (2‐13 years). Tumor size varied from 0,35 cm until to 20 cm. There
were elected several histologic types of malignant tumors, such as: more differentiated
mammary tumors and highly aggressive mammary tumors; it is known that vasculogenic
mimicry is more frequent in poorly differentiated cancers.
Regarding intratumor angiogenesis, there were studied the main parameters which
indicate angiogenic profile of a tumor, such as: microvessel number/microscopic field area,
total vascular area and perimeter, average vascular area and perimeter, the structure of
vascular walls, intensity of immunohistochemical reaction in vessel’s wall. All of these were
monitored to detect blood flowing channels and to debate intratumor angiogenesis. Double
staining procedure (immunohistochemical and PAS reaction) made possible evidence of
aspects regarding vasculogenic mimicry almost in all poorly differentiated tumors (cases 1, 2,
4, 5, 6, 7). Blood flowing channels were more obvious using this method comparing with the
other CD31‐immunolabeling method. There should be mentioned that numerous blood
51

Lucrări Științifice – vol 53 seria Medicină Veterinară
flowing channels without endothelium were noticed in vicinity of intratumor necrotic areas
(case 5), being known that hypoxia is a stimulus for angiogenesis.
The location of blood flowing channels occur in both, connective tissue stroma (cases
2, 4, 7) and between neoplastic cells in the case of compact tumors with scattered sustaining
stroma and numerous tumoral cells (cases 5, 7). In blood flowing channels without
endothelium from sustentacular connective tissue, the misinterpretation of some empty
spaces to be considered blood channels is minimal using double staining procedure. Also,
there can be noticed blood flowing channels in which immunohistochemical reaction is
discreet or more often restricted to a limited portion of the vessel wall not to all vessel
circumference how is normal in blood vessels with continuous endothelium (cases 4, 5, 6, 7).
This aspect was also encountered by Nasu et al. (15). The PAS reaction highlights
mucopolysaccharidic structure that line these channels, which don’t have endothelium (4, 14,
21). In many situations red blood cells can be seen into the channel’s lumen aiding with their
notification.
Fig.1. Carcinoma in benign mixed tumor, grade II (case 8); double staining ‐ IHC
anti‐CD31 and PAS reactions, counterstaining with Mayer’s hematoxylin x400.
52

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 2. Compact carcinoma, grade II (case 1.); blood vessel with discreet immunohistochemical
reaction (arrow), labeling being not present to all circumference of the vessel; IHC reaction
anti‐CD31, counterstaining with Mayer’s hematoxylin x400.
Fig. 3. Cystic papillary mammary carcinoma, grade I (case 4) – presence of blood flowing
channel (arrow), discreet IHC reaction anti‐CD31 (black arrow); counterstaining with Mayer’s
hematoxylin x 400.
53

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 4. Cystic papillary mammary carcinoma, grade I (case 4) – presence of blood flowing
channel in continuity of blood vessel positive to IHC anti‐CD31; counterstaining with Mayer’s
hematoxylin x200.
Fig. 5. Solid anaplastic mammary carcinoma, grade III (case 7) – presence of blood flowing
channel with red blood cells in lumen (light arrow) and of blood vessels with intense IHC
reaction (black arrows); IHC reaction anti‐CD31; counterstaining with Mayer’s hematoxylin
x400.
54

Lucrări Științifice – vol 53 seria Medicină Veterinară
In tumors with reduced sustaining connective tissue, vasculogenic mimicry pattern
may be easily recognized. In this tumor types, between malignant cells are obvious PAS
positive channels from which some of them presents a discreet immunolabel of the wall,
during some others have only mucopolysaccharides that line the channel (cases 5, 7). There
are scattered fibroblasts (which can also produce these mucopolysaccharides), indicating this
material is generated directly by tumoral cells lining the “sanguine vessels” without
endothelium. Described aspect is known in the literature as vasculogenic mimicry, showing
once again the plasticity and adaptability of malignant cells. This feature reveals the ability of
malignant tumor to find “solutions” to minimize or to avoid intratumor necrosis.
The presence or not of vasculogenic mimicry was correlated with histologic grade,
and also with vascular parameters (intratumor microvessel density, average microvascular
area and perimeter). The presence of blood flowing channels was directly related with
histologic grade, such as: the pattern is more frequent encountered (++) in grade II and III
canine mammary cancers (cases 5, 6, 7), and less extended in (+) in grade I mammary tumors
(cases 2, 4) and in some of poorly differentiated (grade II) mammary tumors (case 1);
vasculogenic mimicry wasn’t encountered in benign mammary tumor (case 3) and
interestingly in one grade II malign mammary cancer (case 8). Described aspects show that
vasculogenic mimicry is more prevalent in poorly differentiated canine mammary cancers
(grade II and III tumors) and less frequent or absent in more differentiated ones or in benign
tumors.
Regarding the incidence of vasculogenic mimicry depending of histologic type of
canine mammary tumor, the prevalence is higher in solid carcinomas (cases 1, 5, 7 – 37,5%),
followed by carcinoma in benign mixed tumor (case 2 – 12,5%), simple tubule‐papillary
carcinoma (case 6 – 12,5%), and papillary‐cystic carcinoma (case 4 – 12,5%).
Fig. 6. Solid mammary carcinoma, grade III (case 5) – presence of numerous blood flowing
channels with PAS positive material toward the lumen missing IHC reaction (light arrow), and
numerous isolated IHC positive endothelial cells into tumor mass (black arrows); double
staining – IHC anti‐CD31 and PAS reactions, counterstaining with Mayer’s hematoxylin x200.
55

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 7. Solid mammary carcinoma, grade III (case 5) – presence of numerous blood flowing
channels with PAS positive material toward the lumen missing IHC (arrows); tumoral cells
border direcly the channels; double staining – IHC anti‐CD31 and PAS reactions, counterstaining
with Mayer’s hematoxylin x400.
By comparing the relation between vasculogenic mimicry and intratumor microvessel
density (IMD), blood flowing channels have a higher occurrence in tumors with an increased
number of microvessels/microscopic field (cases 1, 6). Thus, blood flowing channels without
endothelium were more frequent prevalent in malignant tumors with IMD between 18,2‐49,2
(cases 1, 2, 4, 5, 6, 7). The bibliography rapports indicate an association between an increased
intratumor microvessel density and a faster development of the tumor, being also correlated
to a reduced survivor rate (13, 16, 17). On the other hand there are some reports where,
statistically, weren’t find correlations between IMD and tumoral aggressivity (8‐11).
Regarding the other vascular parameters (total microvascular area and perimeter),
there weren’t established interrelations with vasculogenic mimicry. Despite of that, a quite
interesting thing was noticed as follow: in mammary cancers that had numerous vessels with
reduced perimeter and area (average vascular perimeter and area) vasculogenic mimicry
occurrence is higher. Also, it was observed that mammary tumors where predominate
microvessels with small caliber (implicitly with reduced vascular perimeter and area) had the
most numerous blood flowing channels without endothelial lining (cases 5, 6, 7). By increasing
the values of average vascular area and perimeter, the frequency of vasculogenic mimicry
pattern is rarely encountered (cases 1, 2, 4). Domination of newly formed microvessels of
reduced caliber indicates an increased intratumor angiogenesis and, on the other hand, an
increased risk for tumoral growing.
56

Cas
e
nr.
Lucrări Științifice – vol 53 seria Medicină Veterinară
Table 1. General aspects regarding intratumor angiogenesis in different canine mammary
tumors.
Histologic
diagnose
Histologi
c grade
Mitoti
c
index
Intratumor angiogenesis
IMD TM
A
(%)
MP
Sum
Averag
e MA
Averag
e MP
1 Solid
II 19 27 5.81 2492.5 310.93 92.32 +
carcinoma
9
2 Tubule‐
I 5 18.2 5.36 2013.4 425.89 110.63 +
papillary
6
carcinoma in
3
benign mixed
tumor
Adenoma ‐ ‐ 14.8 2.26 1140.7
5
221.20 77.08 ‐
4 Cystic‐
I 14 22.6 6.07 2250.7 388.17 99.59 +
papillary
carcinoma
5
5 Solid
III 24 24.4 2.34 1540.1 166.76 63.12 ++
carcinoma
6
6 Tubulopapillar II 33 49,2 5,40 3085,6 158,72 62,72 ++
y carcinoma
8
7 Solid
III 13 22.3 3.28 1760.9 212.56 78.85 ++
anaplastic
carcinoma
3
4
8 Carcinoma in II 12 18,8 4,10 1876.2 314,96 99,80 ‐
benign mixed
tumor
8
IMD: Intratumor microvessel density (microvessel number)/area of microscopic image.
TMA: Total microvascular area (%)/area of microscopic image – average value obtained by
monitoring five microscopic fields magnified of media 200x.
MA: Microvascular area (μm 2 ) ‐ average value obtained by monitoring five microscopic fields
magnified of media 200x.
MP: Intratumor microvessel perimeter (μm) ‐ average value obtained by monitoring five
microscopic fields magnified of media 200x.
The new findings regarding angiogenesis deliver some important and useful dates not
only about growing rate and prognosis, but also to improve antitumoral therapeutic protocols
some of them involving the destruction of blood vessels which supply the neoformation. Anti‐
angiogenic therapies may be realized using natural or synthetic inhibitors of angiogenesis,
such as angiostatin, endostatin, tumtatina, etc. Endothelial cells were and are considered,
genetically, more stable structure than cancerous cells. This genomic stability confers an
advantage in elaboration of antitumoral therapies that have as target endothelial cells using
anti‐angiogenic agents. Because of that, endothelial cells may represent ideal targets for
antitumor therapy. Nevertheless, antitumor therapheutic protocols using antiangiogenic
agents (targeting vascular endothelium) may be useles for cancerous areas where the
vascularisation occur using vasculogenic mimicry, which don’t have endothelium.
57
V
M

CONCLUSIONS
Lucrări Științifice – vol 53 seria Medicină Veterinară
1. Utilizing either double staining procedure (immunohistochemical anti‐CD31 and PAS
reactions) or single immunohistochemical anti‐CD31 technique made possible notification of
vasculogenic mimicry in highly aggressive tumors, such as grade II and III canine mammary
cancer. Nonendothelial blood channels were less extended to differentiated tumors,
practically being absent in benign tumor.
2. The occurrence of blood flowing channels was higher in vicinity of intratumor necrotic areas
knowing that hypoxia stimulate angiogenesis.
3. Vasculogenic mimicry was notified less frequent in sustaining connective tissue and more
frequent in tumors with reduced stroma and numerous cancerous cells, such as compact
carcinomas and simple carcinomas.
4. Some peculiarities of some blood flowing channels were represented by discreet
immunohistochemical reaction that often was restricted only to a region of vascular wall not
to all circumference of the vessel. This indicates that some vessels are incompletely lined by
endothelial cells, the rest of the vessel’s lumen being bordered by tumoral cells. Furthermore,
PAS reaction highlighted mucopolysaccharides which lined the channels without endothelium.
5. Occurrence of blood flowing channels was higher in tumors with increased microvessel
density/microscopic field, and in tumors that had numerous microvessels with reduced
caliber, both features indicating increased intratumor angiogenesis and alert tumor growth.
BIBLIOGRAPHY
1. Baba A.I., Cătoi C., 2007 – Comparative Oncology, Romanian Academy Ed, pg. 423 ‐ 447.
2. Blood C.H., Zetter B.R., 1990 ‐ Tumor interaction whit the vasculature: angiogenesis and tumor
metastasis. Biochim. Biophys. Acta., 1032, 89‐118.
3. Clarijs R., Otte‐Holler I., Ruiter D.J., de Waal R.M., 2002 ‐ Presence of a fluid‐conducting meshwork in
xenografted cutaneous and primary human uveal melanoma. Invest Ophthalmol Vis Sd.;43:912‐918.
4. Folberg R., Hendrix M. J. C., Maniotis A. J., 2000 ‐ Vasculogenic Mimicry and Tumor Angiogenesis, Am.
J. of Pathology, vol. 156, No. 2.
5. Folkman J., 1995 ‐ Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med, 1:27‐31.
6. Foss A.J., Alexander R.A., Hungerford J.L., Harris A.L., Cree I.A., Lightman S., 1997 ‐ Reassessment of
the PAS patterns in uveal melanoma. Br J Ophthalmol, 81:240–246.
7. Fox S.B., Gatter K.C., Harris A., 1996 ‐ Tumour angiogenesis. J. Pathol., 179, 232–237.
8. Gal A., C. Cătoi, I. Iulia Robu, Baba A.I., Miclaus V., Rus V., Taulescu M., Bolfă P., 2009 – Correlation
between intratumor microvessel density and Ki‐67 malignancy marker in bitch mammary cancer,
Buletin USAMV‐CN, 66 (1)/2009, ISSN 1843‐5270: 55 ‐ 62.
9. Gal A., C. Cătoi, I. Rus, M. Taulescu, P. Bolfă, I. Lakatos, A.I. Baba, 2008 – The study of vascularisation in
bitch mammary tumors, Buletin USAMV‐CN, 65 (1)/2008, ISSN 1843‐5270: 388 ‐ 394.
10. Gal A., C. Cătoi, I., A.I. Baba, V. Miclaus, Daniela Cerbu, I. Lakatos, 2009 – Relationship between PCNA
proliferating marker and Angiogenesis in bitch mammary cancer, Buletin USAMV‐CN, 66 (1)/2009,
ISSN 1843‐5270: 490.
11. Gal A., Hener Adriana, A.I. Baba, C. Catoi, I. Rus, 2007 – Prognosis significance of intratumor
microvessel density in bitch and cat mammary tumors, Bulletin USAMV‐CN, vol. 64 (1‐2): 151, print
ISSN 1843‐5270, electronic ISSN 1843‐5378.
12. Hashizume H., Baluk P., Morikawa S., McLean J.W., Thurston G., Roberge S., Jain R.K., McDonald
D.M., 2000 ‐ Openings between defective endothelial cells explain tumor vessel leakiness. Am J
Pathol, 156:1363‐1380.
13. Luong R.H., Baer K.E., Craft D.M., Ettinger S.N., Scase T.J., Bergman P.J., 2006 ‐ Inttratumoral
microvessel density and canine STS, Vet. Pathol., 5‐43.
58

Lucrări Științifice – vol 53 seria Medicină Veterinară
14. Maniotis A.J., Folberg R., Hess A, Seftor E.A., Gardner L.M., Pèer J., Trent J.M., Meltzer P.S., Hendrix
M.J., 1999 ‐ Vascular channel formation by human melanoma cells in vivo and in vitro: vasculogenic
mimicry. Am J Pathol, 155:739‐752.
15. Nasu R., Kimura H., Akagi K., Murata T., Tanaka Y., 1999 ‐ Blood flow influences vascular growth
during tumour angiogenesis. Br J Cancer, 79:780–786.
16. Page D., Jensen R., 1995 ‐ Angiogenesis in human breast carcinoma; what is the question? Hum.
Pathol., 26: 1173‐1174.
17. Restucci B., De Vico G., Maiolino P., 2000 ‐ Evaluation of angiogenesis in canine mammary tumors by
quantitative platelet endothelial cell adhesion molecule immunohistochemistry. Vet. Pathol.,37:
297‐301.
18. Ruiter D., Bogenried T., Elder D., Herlyn M., 2002 ‐ Melanoma‐stroma interactions: structural and
functional aspects. Lancet Oncol.3:35‐43.
19. Wei‐Ying Y., Zhong‐Ping C., 2005 ‐ Does Vasculogenic Mimicry Exist in Astrocytoma?, J Histochem
Cytochem 53:997–1002.
20. Willis R.A., 1948 ‐ Pathology of Tumours. London, Butterworth & Co., Ltd., p 136.
21. Zhenhong X.; Yongwei J.; Xuansong C.; Jiong M.; Liming C.; Guangrong Y., 2008 ‐ Vasculogenic
Mimicry in Osteosarcoma : Histomorphologic Studies in Vivo and in Vitro; Tang Ruyong
Bioinformatics and Biomedical Engineering, Page(s): 915 – 918.
59

ASSESSMENT OF THE ANTI‐INFLAMMATORY ACTION OF THE
CARPROFEN‐BETA CYCLODEXTRINS COMPLEX ON EXPERIMENTAL
INFLAMMATION MODEL IN RATS
GRECU Mariana 1 , NĂSTASĂ V. 1 , MAREŞ M. 1 , MORARU Ramona 1 ,
HRIȚCU Luminița Diana 1 , ILIE Cornelia 2
1
USAMV Iassy, Faculty of Veterinary Medicine
2
Institute of Physical Chemistry “Ilie Murgulescu” Bucharest
marianagrecu_drd@yahoo.com
Abstract:The main aim was the comparative testing of the carprofen and carprofen‐β
cyclodextrin using an experimental inflammation model in rats. The improvement of carprofen
bioavailability was tested by complexing it with β‐cyclodextrin, as carrier molecules, in the
conditions of dosage reduction to limit the side effects that are common in NSAIDs therapy
(dyspepsia, gastritis, ulcerations etc.). The obtained results sustain a higher therapeutical
efficacy/non‐inferiority of carprofen‐beta cyclodextrins over carprofen only.
INTRODUCTION
Key words: carprofen, β‐cyclodextrin, experimental model, inflammation, rat
The efficacy of many active ingredients is limited by their capacity to reach the target
site. In most of the cases, only a small quantity of the administered dose reaches this site,
while the rest of the dosage is distributed throughout the body, depending on the physico‐
chemical and biochemical properties of the molecule (2).
Most of the molecules in the active ingredient, such as: non ‐ steroidal anti ‐
inflammatories (NSAIDs), antifungals, antiparasitic drugs etc., are insoluble in a aqueous
environment, which leads to a major problem in their conveyance and absorption.
Furthermore, these molecules are showing a high toxicity degree towards the major structures
of the body (especially towards the digestive system, liver and kidney). To avoid these
drawbacks, the use of some carrier molecules, that can improve the bioavailability of the
active ingredients and reduce the side effects, has been considered necessary. Therefore,
during the last years, there has been a rise in interest towards the interactions between
different active substances and ciclodextrines – natural polymers ( 1, 3, 4), that could enhance
the drugs’ therapeutical properties, lowering as much as possible their toxicity and rising their
efficiency.
In this study, we have observed and evaluated the effectiveness of the combination
carprofen – β cyclodextrin compared to the administering of carprofen, in a model of
experimental inflammation.
60

METHODS AND EQUIPMENT
Universitatea de Științe Agricole și Medicină Veterinară Iași
The study used 18 young male white rats, Wistar, weighting 200 ± 10 grams, acquired
from the Cantacuzino Institute, Bucharest, that have been bred in a germ‐free environment
and to whom has been induced a plantar inflammation, in the hind right paw, by injecting an
aqueous suspension of kaolin 10%, intraplantary, 0.15ml per rat. The animals were then
divided in 3 groups, with 6 rats in every group (n = 6), group A – the control group, group B, in
which carprofen has been administered per os, in a dose of 5mg/kg, and group C whose
individuals were administered, per os, 2.5mg/kg of the carprofen – β cyclodextrine complex,
both substances being administered once a day, with a feeding tube, for two days. The
carprofen – β cyclodextrine complex has been prepared at the Macromolecular Chemistry
Institute „Petru Poni” in Iassy, through lyophillization.
Before inducing the inflammatory process, every rat’s hind right paw has been
marked near the point where the paw was completely immersed in the measuring cell. After
marking, the paw diameter has been measured and calculated, using pletysmography; the
procedure was repeated after inducing the inflammation after 1, 3, 6, 9, 12, 24 and 48 hours,
following the dynamics of the inflammatory process and evaluating through pletysmography
the differences between the groups.
After 9 – 12 hours since the inducing of the inflammation, blood was collected in vials
containing clot activators, for determining the C reactive protein (CRP), an important marker in
acute inflammatory processes. The samples have been placed in the centrifuge at 8000 rpm
for 2 minutes and then were placed in the refrigerator at a temperature of +4˚C for 48 hours,
because the analyze of CRP requires stable serum samples.
All the experimental procedures used in this study have been in accordance to
international ethical regulations regarding the manipulation and use of laboratory animals,
using the method recommended by OECD guidelines for the Testing of Chemicals
425/17.12.2005.
RESULTS
When measuring the paw diameter, before administering the substances, the values
obtained were 1.0 – 1.1 cm 3 , with minor variations between the rats from the 3 groups.
The inflammation had a rapid onset and course, so that 9 hours after the exposure to
the inflammatory stimulus, considered the peak moment of inflammation, paw diameters had
increased greatly in the control group rats and those treated with carprofen and less in rats
treated with carprofen + β cyclodextrin complex (image 1).
61

Universitatea de Științe Agricole și Medicină Veterinară Iași
Figure 1. Dynamic of the inflammatory process at 9 hours
a b
c
Figura 2. Diameter of path at 9 hours: a) control; b) group treated with
carprofen; c) group treated with cu carprofen + β ciclodextrină
These values were maintained in a plateau period of several hours ‐ between 9 and
12 hours since the exposure – then the inflammatory edema began regressing with ease, at a
slow pace, in comparison with its appearance speed, immediately after the stimulus trigger.
Clinical symptoms were manifested by marked congestion of the paws, the local temperature
and increased pain sensitivity, keeping a suspended position of the member, functional
impotence, and were correlated with marked impairment of general status of rats (image 2).
At 24 hours after induction of inflammation in group C treated with carprofen + β
cyclodextrin, when measuring the paw diameter through pletysmography, the result showed a
significant regression of the edema and also a decrease in congestion, the local temperature
and pain sensitivity, animals resumed their daily activities ‐ grooming, food and water
62

Universitatea de Științe Agricole și Medicină Veterinară Iași
consumption. In group B, treated with carprofen, the rate of the edema reduction was
moderate, but significantly faster compared to the rats in the control group, where paw
edema was prominent and had a slow regression (Figure 2).
After 48 hours, the inflammation was still present in the control group, the
pletysmographic measurements showing a 60% decrease of the edema (Figure 2).
Figure 2. Dynamic of the inflammatory process at 48 hours
The results showed a significant difference between control group and groups of rats
treated with NSAIDs, especially for the group treated with carprofen + β cyclodextrin, where
the complex efficacy was observed through the rapid inhibition of paw edema. Anti‐
inflammatory effect of the complex was found to be maximum at 6‐8 hours after
administration, producing an inhibition of the occurrence of the inflammation in
approximately 40% of the individuals, compared to 20% of rats showing a response in the
group treated with carprofen and no evident response in the control group.
For detecting C reactive protein (CRP), the latex agglutination test was used.
Determination of protein C results in our study showed positive results in a small number of
animals from the three batches (only eight positive samples from a total of 18 rats), especially
in the control group where there was evidence of serum agglutination in all six rats. In the
group treated with carprofen, positive results were evident only in two rats, the remaining
samples being negative, and in group C which received carprofen complexed with β
cyclodextrin, in all 12 rats the CRP results were negative.
Serum samples that gave positive results in qualitative screening evidencing
agglutination presence after two minutes since the homogenization of the mixture, were
taken to determine titres, taking the quantitative variant of the test. Thus, in samples from the
rats in control group the agglutination was observed as far as the dilution ¼, the titer being 24
mg/l CRP, and the positive samples from the rats in group treated with carprofen,
agglutination was observed as far as the dilution ½, value titer being 12 mg/l CRP. Thus,
63

Universitatea de Științe Agricole și Medicină Veterinară Iași
elevated titres in test ‐ detectable CRP is an argument towards the presence of high
concentrations of proteins pertaining the inflammatory process in serum.
The pletysmography measurements used in our experimental studies have allowed,
as much as possible, accurate and sensitive measurements of plantar edema. Using this
modern method has particularly proved the influence that carprofen complexed with
cyclodextrin have on acropodium edema in rats after intraplantary injections with kaolin, 10%
aqueous suspension. The results are consistent with literature data (5), which is considered
encouraging for using this protocol in order to validate the test method inflammatory
products.
CONCLUSIONS
1. Experimental models of inflammation induction gave significant results to assess
the effectiveness of NSAIDs, both complexed with beta cyclodextrin and simple.
2. It was noted that in this model of plantar inflammation, rats have a clear local
reaction that is significant from pharmacokinetic and pharmacodynamic point of view.
3. Experimental studies have confirmed the efficacy of carprofen ‐ cyclodextrin
complex, even if the dose was lower (2.5 mg) compared with the group that was treated with
carprofen at a dose of 5 mg / kgcorp.
BIBLIOGRAPHY
1. Fu‐An Chen, An‐Bang Wu and Chau‐Yang Chen, 2003 ‐ Inclusion Complex of Carprofen with
Hydroxypropyl‐β‐cyclodextrin Journal of Inclusion Phenomena and Macrocyclic Chemistry 46:
111–115.
2. Goodman and Gilman's, 2006 ‐ "The pharmacological Basis of Therapeutics", 11th ed., (Laurence
L. Brunton, John S. Lazo, Keith L. Parker); Mc Graw ‐ Hill, New – York, Saint Louis, San Francisco, p.
671‐685,687‐705.
3. Jicsinszky L., Petrikovics I., Petro M., Horvath G., Szejtli J., Way JL., 2007 ‐ Improved drug delivery
by conjugation with cyclodextrins. Proceedings of 14th European Carbohydrate Symposium,
September 2–7, Lubeck, Germany.
4. Thorsteinn Loftsson, Dominique Duch, 2007 ‐ Cyclodextrins and their pharmaceutical
applications. International Journal of Pharmaceutics 329, 1–11.
5. Vlase E., Coman C., Szegli G., Lupu Andreea‐Roxana, Cremer Lidia, Barzu Natalia Simona,
Badulescu Maria‐Mihaela, Calugaru Ana, Ionescu G., 2008 ‐ „Pletismometria computerizată –
metodă performantă de măsurare a edemului inflamator acut indus la şoarece prin injectarea
intraplantară de Carrageenan”, Sepsis Granada, Spania, 19‐22 Nov.2008 si Sesiunea de
Comunicari Stiintifice a INCDMI Cantacuzino, ianuarie 2009.
64

EVALUATION OF DEGREE OF ENGRAFTMENT IN MOUSE
MODEL OF STEM CELLS HARVESTED
FROM HUMAN PLACENTA
Groza I.Ș, Groza Daria, Pall Emoke, Cenariu M., Ciupe Simona, Laura
Parlapan
University of Agricultural Science and Veterinary Medicine,
Cluj‐Napoca, 3‐5 Manastur street, Cluj‐Napoca,
isgroza@yahoo.com
Abstract: Recent interest in stem cell biology and its therapeutic potential has led to the search
for accessible new sources of stem cells. Fetal stem cells from umbilical cord blood and placenta
are less ethically contentious than embryonic stem cells and their differentiation potential
appears greater than adult stem cells. Fetal stem cells represent powerful tools for exploring
many aspects of cell biology and hold considerable promise as therapeutic tools for cell
transplantation. In this study, we established a mouse model for in utero transplantation of
human placental mesenchymal stem cells (hPMCs) to investigate if these cells would affect long‐
term, organ‐specific engraftment.
KEYWORDS: placenta, mesenchymal stem cells, engraftment, prenatal diagnosis
Early prenatal diagnosis and in utero therapy of certain fetal diseases have the
potential to reduce fetal morbidity and mortality. The intrauterine transplantation of stem
cells provides in some instances a therapeutic option before definitive organ failure occurs.
Clinical experiences show that certain diseases, such as immune deficiencies or inborn errors
of metabolism, can be successfully treated using stem cells derived from bone marrow.
However, a remaining problem is the low level of engraftment that can be achieved. Efforts
are made in animal models to optimize the graft and study the recipient’s microenvironment
to increase long‐term engraftment levels. It is known that some diseases, such as
haemoglobinopathies (Fanconi’s anaemia, thalassaemia), immunological defects (SCID) or
certain inborn errors of metabolism can be treated by transplantation of stem cells (Shapiro E.
et al., 2000). If the stem cell transplantation is performed before symptoms of the disease
occur, organ function can be preserved (Newsome P.N. et al., 2003). However, if
transplantation is performed after delivery of the baby, intensive immunosuppression and
myoablation have to be used to minimize the risk of Graft‐versus‐host disease and to empty
the bone marrow.
Cells of different origins have been used for in utero transplantation in a number of
models. Human bone marrow‐derived mesenchyamal stem cells have been transplanted into
fetal sheep and shown to persist for as long as13 months with multilineage differentiation
potential (Liechty et al., 2000).
In this study, we established a mouse model for in utero transplantation of human
placental mesenchymal stem cells to investigate if these cells would affect long‐term, organ‐
specific engraftment.
65

MATERIALS AND METHODS
Lucrări Științifice – vol 53 seria Medicină Veterinară
Biological material, clinically normal human term placentas (37– 40 weeks of
gestation, n =3) were collected after Cesarean section. Placentas were obtained after informed
consent of the women, and all experiments were approved by the ethics committee of the
University of Medicine and Pharmacy Iuliu Hatieganu Cluj‐Napoca. Term placentas from
healthy donor mothers were obtained with informed consent approved according to the
procedures of the institutional review board. The harvested pieces of tissue were washed
several times in phosphate‐buffered saline (PBS) and then mechanically minced and
enzymatically digested with 0.25% trypsin‐EDTA (Gibco) for 30 min at 37 ° C. After
centrifugation the cell suspension was filtered to eliminate undigested fragments. For lysis the
erythrocytes, cells suspensions were treated with FACS Lysing Solution 10x (BD Biosciences)
for 15 min. The suspension pelleted by centrifugation (1500 rpm/7 min) and suspended in
propagation medium, which consist of Dulbecco’s Modified Eagle’s medium (Gibco)
supplemented by 10 % fetal calf serum (FCS), 100 U/ml penicillin‐streptomycin (Gibco).
Cultures were maintained in DMEM with 10% fetal bovine serum (FBS; Hyclone, USA)
at 37 ° C with 5% CO2. Approximately 2 – 3 weeks later, some colonies consisting of fibroblast‐
like cells were observed. These cells were trypsinized and replated for expansion. In order to
obtain single cell‐derived hPMC clones, cells were serially diluted in 96‐well culture plates (BD
Biosciences) at a final density of 60 cells/ plate. Colonies that grew with homogeneous bipolar
morphology were expanded.
Identification of cell phenotypic markers by FACS (Fluorescence‐Activated Cell Sorter)
passage 5. After the second passage, the cells were trypsinised (0.25% trypsine EDTA), washed
twice with PBS and stained according to the recommendation of the manufacturer with the
monoclonal antibodies, FITC‐CD44, examined with a FACS CantoII Apparatus (Becton–
Dickinson). For in utero transplantation of mesenchymal stem cells from placentas, were
prepared single cell suspensions. On day 13.5 after mating, pregnant mice were anesthetized
with avertin. Under aseptic conditions, the uterine horns were exposed, and donor cells were
injected through a glass micropipette (inserted through the uterine wall and into the
peritoneal cavity of each fetus under direct visualization. The injection consisted of 1 x 10 6
hPMCs in 5 µl of PBS. The abdominal incision was closed in two layers using 4‐0 silk, and the
mice were allowed to complete pregnancy to term.
On E20, a low abdominal midline incision was made and the number of live fetuses in
each uterine horn was recorded. Then, placenta, fetal blood and fetal organs including brain,
heart, lung, liver, spleen and bone marrow were collected. To obtain single cell suspension as
chopped tissues were processed by the Medimachine device. For evidence of placental stem
cells in mice organs the samples were treated with 20 µl fluorescent antibody (anti ‐ human
CD45 PE‐Cy5 antibody (PE‐Cy5: phycoerythrin‐Cy5), (FITC: fluorescein isothiocyanate), anti –
human CD34‐FITC antibody (FITC: fluorescein isothiocyanate) and anti‐ human CD44 antibody).
Have prepared two samples for each antibody in the study: a sample and a sample labeled
with antibody as blank unmarked. For positive control were used MSCs isolated from placenta
and CD34 + cells from cord blood.
RESULTS AND DISCUSSION
To show that hPMCs injected in utero on E13.5 engrafted in fetal organs, we collected
fetal organ samples at E20. Most fetal tissues had demonstrable hPMC engraftment at E20.
Although the distribution pattern and numbers of cells in individual fetuses varied, hPMCs
66

Universitatea de Științe Agricole și Medicină Veterinară Iași
were detectable in more than 60% of the fetus. The first experiment conducted fetal loss rate
was high: 93.75% most likely due to lack of experience in producing labor in utero
transplantation. Engraftment analysis was done using FACS Diva software and results are
presented as histograms. We assessed the presence of hPMCs in various fetal mouse tissues
(fig.1, 2, 3, 4).
Figure 1 – Flow cytometric analysis of hPMCs in the mouse fetus after in utero transplantation
of hPMCs
Figure 2 – Histogram representation of engraftment
67

Lucrări Științifice – vol 53 seria Medicină Veterinară
Figure 3 – Histogram representation of engraftment of human mesenchymal stem cells
Figure 4 – Histogram representation of engraftment in negative and positive control
Trans species animal models have been widely used in the study of stem cell
migration and engraftment (Liechty et al., 2000; Saito et al., 2002). It has been shown that
human cord blood‐derived cells can differentiate into hepatocytes in the mouse liver without
evidence of cellular fusion (Newsome et al., 2003). Human microchimerism was observed in
various organs and tissues at 4 months after transplan‐tation of human amnion and chorion
mesenchymal progenitors in neo‐natal swine and rats (Bailo et al., 2004). Human
mesenchymal stem cells colonized multiple fetal sheep tissues for as long as 13 months after
in utero transplantation (Liechty et al., 2000). Differences observed in cell numbers may be
due to colonization efficiency in different tissue environments or the rate of cell turnover in
each organ (Krause et al., 2001). Our study adds to this body of work by establishing an in
utero (E13.5) model of xenogeneic hPMC transplantation in immunocompetent mice.
68

CONCLUSIONS
Universitatea de Științe Agricole și Medicină Veterinară Iași
Mesenchymal stem cells (MSCs) are widely distributed in a variety of tissues in the
adult human body (e.g., bone marrow, kidney, lung, and liver). These cells are also present in
the fetal environment (e.g., blood, liver, bone marrow, and kidney). However, MSCs are a rare
population in these tissues. The most well studied and accessible source of MSCs is bone
marrow, although even in this tissue the cells are present in a low frequency.
The human placenta is an attractive new source of mesenchymal stem cells (MSCs),
but the biological characteristics of placenta‐derived MSCs have not yet been characterized.
Our results show that mesenchymal stem cells are present in the human term placenta and
may be a potential source of cells for transplantation therapy. Using routine cell culture
techniques, placental derived mesenchymal stem cells can be successfully isolated and
expanded in vitro.
Mesenchymal stem cells are mainly derived from bone marrow (Orlic et al., 2001),
but it may be difficult to obtain sufficient autologous cells from some patients, particularly
those who are older or who have malignancies. Therefore, alternative sources are needed. It
appears that hPMCs from an allogeneic donor might constitute such a source. A further
potential benefit is the exposure of the fetus to allogeneic cells, inducing tolerance such that
future treatment.
BIBLIOGRAPHY
1. Bailo M, Soncini M, Vertua E, Signoroni PB, Sanzone S, Lombardi G, Arienti D, Calamani F, Zatti D,
Paul P et al. Engraftment potential of human amnion and chorion cells derived from term placenta.
Transplantation 2004;78:1439 – 1448:
2. Carolyn Troegera, Daniel Surbeka, Andreina Schöberleina, Stephan Schatt, Lisbeth Dudlera, Sinuhe
Hahna, Wolfgang Holzgreve, In utero haematopoietic stem cell transplantation, SWISS MED
WKLY2006;136:498–503
3. Krause DS, Theise ND, Collector MI, Henegariu O, Hwang S, Gardner R, Neutzel S, Sharkis SJ. Multi‐
organ, multi‐lineage engraftment by a single bone marrow‐derived stem cell. Cell 2001;105:369–
377
4. Liechty KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW.
Human mesenchymal stem cells engraft and demonstrate site‐specific differentiation after in utero
transplantation in sheep. Nat Med 2000;6:1282 – 1286:
5. Liechty KW,MacKenzie TC,Shaaban AF, Radu A,Moseley AM, Deans R, Marshak DR, Flake AW.
Human mesenchymal stem cells engraft and demonstrate site‐specific differentiation after in utero
transplantation in sheep. NatMed 2000;6:1282–1286.
6. Newsome PN, Johannessen I, Boyle S, Dalakas E, McAulay KA, Samuel K, Rae F, Forrester L, Turner
ML, Hayes PC et al. Human cord blood‐derived cells can differentiate into hepatocytes in the mouse
liver with no evidence of cellular fusion. Gastroenterology 2003;124:1891 –1900;
7. Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, Pickel J, McKay R, Nadal‐Ginard B,
Bodine DM et al. Bone marrow cells regenerate infarcted myocardium. Nature 2001;410:701– 705;
8. Saito T, Kuang JQ, Bittira B, Al‐Khaldi A, Chiu RC. Xenotransplant cardiac chimera: immune tolerance
of adult stem cells. Ann Thorac Surg 2002;74:
9. Shapiro E, Krivit W, Lockman L, et al. Long‐term effect of bone‐marrow transplantation for
childhood‐onset cerebral X‐ linked adreno‐leukoldystrophy. Lancet 2000;356:713–8.
69

PRELIMINARY STUDY ON THE PREVALENCE OF TOXOPLASMA GONDII
INFECTION IN WILD BOARS FROM TIMIS COUNTY
Ionela HOTEA¹, Gh. DARABUS¹, C. PACURAR², Tatiana RUGEA², P. MUNTEAN², M.S. ILIE¹, K. IMRE¹,
Mirela IMRE¹, Denisa SORESCU¹, Adrian BALINT¹, Dinu INDRE¹
¹ Faculty of Veterinary Medicine, No. 119, Calea Aradului, Timisoara, Romania
² DSVSA Timis, No. 4, Surorile Martire Caceu, Timisoara, Romania
hotea_ionela@yahoo.com
Abstract: 52 blood samples from wild boars were studied to determine the seroprevalence of
Toxoplasma gondii infection. The animals came from different animals hunting areas from Timis
County.Serum samples were examined by ELISA method. Of the 52 samples from wild boars, 49 of
them (94.23%) had anti‐Toxoplasma Ig G antibodies.
Key words: Toxoplasma gondii, wild boars, prevalence, Timis County
Toxoplasmosis is one of the most common parasitosis in humans and animals, it being
placed on the top three global spread (4). The cat is the key element in the epidemiology of
toxoplasmosis (6). For toxoplasmosis transmission, a very important role it have raw meat
consumption. In pigs, infection occurs by eating kitchen scraps unsterilized or rodents. In certain
circumstances, pigs become cannibals biting their tails or ears. T. gondii tissue cysts of wild boar
meat are considered sources of infection for humans (9).
Necropsy diagnosis in the slaughterhouse, it is very difficult to done, because very small
necrotic lesions are difficult to observe. Serological diagnosis is possible to made in the
slaughterhouse, but is not warranted in our economic Country's conditions (3).
Reporting an increased incidence of toxoplasmosis in humans and animals worldwide and
the small number of bibliographic data in our Country about Toxoplasma infection, motivates our
study.
MATERIALS AND METHODS
The 52 blood samples collected from wild boars, between 2008‐2009, were sent by AJVPS
representatives (County Association of Hunters and Fishermen Sports) Timis at DSVSA (Department
Veterinary and Food Safety) for other types of analysis. The animals were hunted in Timis County,
in different localities (FV – hunting areas), as follows:
� 3 wild boars – Buzias,
� 3 wild boars – Brestovat,
� 5 wild boars – Surduc,
� 4 wild boars – Buzias,
� 3 wild boars ‐ Ohaba Lunga,
� 4 wild boars – Paniova,
� 6 wild boars ‐ Sacosu Mare,
� 5 wild boars ‐ Cheveresu Mare,
� 3 wild boars ‐ Racovita,
� 4 wild boars – Secas,
� 4 wild boars – Culina,
70

Lucrări Științifice – vol 53 seria Medicină Veterinară
� 5 wild boars – Zolt,
� 3 wild boars ‐ Topolovatu Mare.
Collected blood was left to express serum and it was kept in a freezer until the month of
November 2009 when samples were processed in the laboratory of Parasitology and Parasitic
Diseases of Faculty of Veterinary Medicine of Timisoara.
Serum samples were examined by indirect ELISA method using ID Screen Multi‐species kit
(ID.VET., France) for anti‐Toxoplasma specific Ig G antibodies, resulting from infection with
Toxoplasma gondii. Kit can be used for determination of anti‐Toxoplasma specific Ig G antibodies
from sera of ruminants, pigs and cats. We respect technology manufacturing indicates by producer
company.
The S/P values above 200% were considered strongly positive, between 50 and 200%
samples were considered positive, between 40% and 50% were doubtful, while values below 40%
were considered negative.
RESULTS AND DISCUSSIONS
From Timis County were collected and examined 52 serological samples from wild boars.
Of processed serum samples from wild boars, 49 of them (94.23%) had anti‐Toxoplasma Ig
G antibodies. Antibody titre values were between 36.24 and 133.18, and the positive samples
values were between 68.25 and 133.18 (Table 1).
For studied Counties, information obtained are particularly important as they are the first
reported data on Toxoplasma infection in the area.
High prevalence, approaching 100%, obtained from wild boar shoot the alarm on the
infestation degree of the environment with oocysts and massive infestation of wild animals (Fig. 1).
This should scare us more considering to consumption, quite frequently, of game meat, especially
wild boars meat.
The study found the absolute need to best practice animal husbandry and food to reduce
the risk of transmission of infection with T. gondii in humans and other animals.
By indirect immunofluorescence, the Czech Republic has a prevalence of 26.2% in wild
boars and the Slovak Republic, 8.1% (1, 2). In Spain, the prevalence of Toxoplasma gondii infection
in wild boars was 38.4% and in Japan ranged from 5.6% in 1999 to 0% in 2006 (5, 7, 8).
Toxoplasma infection of pigs in Timis County matters both because of neonatal death can
occur in pigs, and the possibilities of disease transmission to humans through inadequately cooked
meat.
Insufficiently cooked pork meat is an important source for the T. gondii infection
transmission to humans. It would be necessary to implement programs for disease control as
among animals, from cats and continuing with farm animals to reduce the infestation degree of the
environment and thus, economic losses in animal products and in people, especially those engaged
in the highest risk category, ie pregnant women and immunosuppressed persons.
CONCLUSIONS
‐Wild boars showed Toxoplasma seroprevalence of 94.23%, with variations between 50 and 100%.
‐Not having sufficient information about examined animals can't refer to the distribution of
prevalence by age or gender.
ACKNOWLEDGMENTS
This work was supported by CNCSIS, Bd, grant No. 87/2008 obtained by Ionela Hotea and
by CNMP, grant PC No. 51‐013/2007.
71

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 1. Geographical distribution of Toxoplasma gondii infection positive wild boars, in
Timis County
Prevalence of Toxoplasma gondii infection in wild boars in Timis County
No. No examinated wild boars
Cheveresu
Mare100%
No. positive
samples (%)
Racovita 100%
Buzias 100%
Brestovat
100%
Paniova 50%
Sacosu Mare
83.33%
The minimum and
maximum titres
values
Secas
100%
Culina
100%
Ohaba
Lunga 100%
Surduc
100%
Table 1.
Total
prevalence
1. 3 wild boars ‐ Buzias 3 (100%) 124.87‐133.18
2. 3 wild boars ‐ Brestovat 3 (100%) 112.39‐126.86
3. 5 wild boars ‐ Surduc 5 (100%) 80.01‐103.26
4. 4 wild boars ‐ Buzias 4 (100%) 95.06‐99.22
5. 3 wild boars ‐ Ohaba Lunga 3 (100%) 89.45‐129.75
6. 4 wild boars ‐ Paniova 2 (50%) 36.24‐98.67
7. 6 wild boars ‐ Sacosu Mare 5 (83.33%) 31.05‐92.81
8. 5 wild boars ‐ Cheveresu Mare 5 (100%) 101.64‐130.71
9. 3 wild boars ‐ Racovita 3 (100%) 68.25‐99.41
10. 4 wild boars ‐ Secas 4 (100%) 75.68‐121.72
11. 4 wild boars ‐ Culina 4 (100%) 96.35‐127.27
12. 5 wild boars ‐ Zolt 5 (100%) 92.08‐110.85
13.
3 wild boars ‐ Topolovatu
Mare
3 (100%) 120.38‐132.40
Total 52 49 94.23 %
72
Topolovatu
Mare 100%
Zolt 100%

REFERENCES:
Lucrări Științifice – vol 53 seria Medicină Veterinară
1. Antolova D, Reiterova K, Dubinsky P., 2007. Seroprevalence of Toxoplasma gondii in wild
boars (Sus scrofa) in the Slovak Republic. Ann. Agric. Environ. Med., 14, 71‐73.
2. Bartova E., Sedlak K., Literak I., 2006. Prevalence of Toxoplasma gondii and Neospora
caninum antibodies in wild boars in the Czech Republic. Veterinary Parasitology, 142, 150 –
153.
3. Chitimia, Lidia, Cosoroaba, I., Cozma, V., 2007. Toxoplasmoza. Prevenirea transmiterii la om
prin alimente de origine alimentara, Rev. Rom. Med. Vet., 3, 11‐30.
4. Darabus, Gh., Oprescu, I., Morariu, S., Mederle, Narcisa, 2006. Parazitologie si boli parazitare,
Ed. Mirton, Timisoara.
5. Gauss CB, Dubey JP, Vidal D, Ruiz F, Vicente J, Marco I, Lavin S, Gortazar C, Almería S., 2005.
Seroprevalence of Toxoplasma gondii in wild pigs (Sus scrofa) from Spain. Veterinary
Parasitology, 131, 151‐156.
6. Hotea Ionela, Darabus Gh., Mederle Narcisa, Ilie M.S., Imre K., Balint A., Indre D., 2009.
Prevalenta infectiei cu Toxoplasma gondii la pisici in judetul Arad. Lucrari stiintifice Iasi, 52,
587‐592.
7. Nogami S., Tabata A., Morimoto T., Hayashi Y., 1999. Prevalence of anti‐Toxoplasma gondii
antibody in wild boar (Sus scrofa riukiuanus) on Iriomte Island. Japan, Veterinary Research
Communications, 23, 211 – 214.
8. Omata, Y, Murata, K., Ito, K., Ishiguro, N., 2005. Antibodies to Toxoplasma gondii in free‐
ranging wild boar (Sus scrofa leucomystax) in Shokoku, Japan. Japan. J. of Zoo and Wild.
Med., 10, 99‐102.
9. Tenter, A.M., Heckeroth, A.R., Weiss, L.M., 2000. Toxoplasma gondii: from animals to
humans, Internat. J. for Paras., 30, 1217‐1258.
73

EPIDEMIOLOGICAL INVESTIGATIONS ON DIGESTIVE PARASITOSIS
IN RACING PIGEONS AND THE RISK OF RELEASING PARASITIC
ELEMENTS IN FREE AREAS
Olimpia C. IACOB, B.C. ŞÎŞCĂ
Faculty of Veterinary Medicine Iasi
Abstract
Investigations were conducted during March 2008 ‐ May 2009 on some lofts of racing pigeons
(464 pigeons) from six private property holdings, located in different locations (four in area B and
two in area I), in order to study the digestive parasitosis and to reveal the epidemiological role of
racing pigeons in dissemination and transmission of parasitic diseases in free areas during
training or competition flights.
Farms have optimal growth conditions ensuring the comfort of pigeons to achieve maximum
results in competitions. Excessive sensitivity of pigeons in stress conditions calls attention from
pigeon fanciers to ensure housing conditions, feeding and water consumption, administration of
medicinal preparations, sanitary and medical preventive measures, a specialist being required in
exceptional cases; sometimes the faulty intervention led to expensive loss by death or by
compromising pigeons next flying season.
Regular investigations revealed that digestive parasitosis were within 10% of all illnesses. Among
the digestive parasitosis that developed were trichomonosis, ascaridiosis in adult birds and
intestinal Eimeriosis in squabs confirming the source of invasive elements (Eimeria oocysts,
Trichomonas trofozoits, Ascaridia and Capillaria eggs), not only for pigeons from other
geographic areas but also for other susceptible birds, given the impressive distances traveled by
pigeons during training and racing. In cases of severe episodes of illness in the loft of pigeons, the
pigeon fanciers practice the ”stamping out” method thus limiting the diffusibility of the illnesses.
INTRODUCTION
Keywords: racing pigeons, digestive parasites, flights, epidemiological risk
The beauty, gentleness and delicacy of the pigeons and also their sports skills have
definitely captured man. Great interest into the racing pigeons, their movement and sporting
events, calls for greater attention from the pigeon fanciers and an increased wariness on the
part of veterinary medical personnel (1, 4).
Digestive based parasitosis (Trichomonosis, Eimeriosis, Toxoplasmosis,
Echinostomosis, Cestodosis, Ascaridiosis, Capillariasis, Trichostrongyliasis, Tetramerosis,
Acuariosis etc..) affects both young and adult pigeons, given the location of many species of
parasites from the mouth up to cloaca. Epidemiological surveillance prevents transmission of
parasitosis both to the loft of pigeons and to other susceptible birds and not least, the
transmission of disease to man (Toxoplasmosis, Psittacosis, Pseudotuberculosis, Salmonellosis,
Paramyxovirosis, etc.). (2)
The emergence and evolution of parasitosis in pigeons are conditioned by
environmental factors, interrelations between ecosystems, microorganisms and parasites, the
interdependence between them, the emergence of new bacterial, viral or parasitic strains.
Adult pigeons contracts generally mild forms, asymptomatic, that sometimes pass unnoticed,
thus becoming carriers and eliminators of invasive elements transported over long distances in
74

Lucrări Științifice – vol 53 seria Medicină Veterinară
free areas. Squabs and the young pigeons are extremely vulnerable to failure to the
antiparasitic and antiinfectous prophylaxic measures and often end in death. (3, 5).
Racing pigeons, through all their qualities, continue to provide services to humanity
even in the century of cosmic flights, maintaining their quality of outstanding carrier under
certain circumstances. (1, 4)
The aim of the paper
Investigations were conducted in order to study the digestive parasitosis in racing
pigeons and to reveal the epidemiological role in the transmission and dissemination of
parasitic elements in the free areas and / or their contamination with new invasive elements
at their return to the farm after sporting events.
MATERIAL AND METHOD
The epidemiological study was conducted during March 2008 ‐ May 2009, through
investigation of six racing pigeons farms situated in different locations and long distance (four
located in city B and 2 located in the city I). Number of pigeons in these farms was of 434
pigeons in peak season, including all age groups (from 10 days to 18 to 20 years) and both
sexes, pairs and unpaired. Since pigeons are highly sensitive to stress, access to farms was
periodically or only when the owners have announced cases of disease.
The epidemiological investigation recorded: the placement of the farm, the housing
spaces, the material used to build shelters, the surface reported to the pigeons density, the
division of housing space, the lighting and ventilation level that each shelter gives.
There have been analyzed the epidemiological history regarding the emergence and
evolution of diseases in farms of racing pigeons, their incidence, morbidity and mortality,
immune status, the presence of a register or record book where is recorded the situation of
pairs, spawns date, the hatching, squabs in nests, effectively applied immunoprophylaxis
measures, etc.
There have been investigated the administration of food, quantity and content of the
diet, how the food is stored (in warehouses or storage), watering system used in farming,
water source and frequency of its use, method of manure disposal and discharge frequency,
collection and disposal of residues resulting from mechanical cleaning, the conduct of
decontamination and the materials used for this purpose in each farm.
If participating in competitions, the investigations recorded the pigeons training
mode, the frequency of competitions, transportation to the place of shipment, the vehicle
used, mode of shipment and transportation to launch site, food rations and structure. The
recovery protocol has also been analyzed for the pigeons returning home after 3‐4 days of
flight, period of time they have been exposed to contamination with infectious and parasitic
elements.
It has been also investigated the specialized veterinary assistance and the prophylaxia
measures adopted, looking at the mode of administration and dosage of medicinal
preparations, the time of treatment and results, immunological situation of the loft,
mandatory vaccinations (Influenza, Pseudopesta, Paramixovirosis, Salmonellosis etc.). and
more. The mode of vaccination, type of vaccine used (fluid/oil, live attenuated / inactivated)
type of strain, the date of vaccination and training protocol that preceded the operation has
also been investigated.
The results were classified in tables and expressed graphically, and the images were
taken with a digital camera.
75

RESULTS AND DISCUSSIONS
Universitatea de Științe Agricole și Medicină Veterinară Iași
Monitored farms are organized on pigeon fanciers principles, built and equipped
properly to provide optimum comfort conditions to the lofts of pigeons (80‐100 pigeons each).
The dimensions of the shelters are variable and between 4‐12 m long, 2‐4 m wide and 3.2 m
high. Some farms have shelters suspended at a height of 2‐3 m above the ground (Fig. 1),
others are on the ground, facing south or southwest. The roof is normaly made from asbestos
or tiles, and the walls of wood or hardboard. The facade consists of windows, net access door
and flap doors for pigeons entering and leaving. Access is through a system of ”needles”,
metal rods sliding towards the entrance or exit. In general, the shelters present aviaries in
front.
Fig. 1. Farm
1‐ pigeons in aviaries
Inside, the shelters are divided for each age: squabs, young pigeons, for flight,
breeding, ensuring feeding and watering devices, accommodation and recreation or nests (Fig.
2, 3, 4).
Feeding is carried by each pigeon fancier regarding the posibilities and goal, based on
a mixture of grain, to varying degrees depending on the period of growth and training,
supplemented with vitamins and minerals. Breeding material is domestic or from import:
Janssen, Aarden, Wim Muller, van Roy, van der Weggen. Predominant colors are red, scaly and
black, dark, genetically dominant. In most farms pigeons have performance results in fond,
semifond or marathon competitions. Prevention measures are applied rigorously, since on
their outcome depends the participation in competitions. On return from the race pigeons are
receiving vitamin‐mineral supplements purchased from specialized companies, antiparasitic
treatments and preventive antiinfectous drugs.
76

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 2. Farm 1. Flying pigeons compartment with pigeons in boxes and paired
Fig. 3. Farm 2.Young pigeons compartment
77

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 4. Farm 6. Flying pigeons compartments
The incidence of diseases in racing pigeons from the six farms has been analyzed
periodically, revealing the different aspects. Pigeons examination results from January 2008
are listed in Table 1.
Table 1.
The structure of the flock of pigeons and the suspected cases of ilness in January 2008
Farm
(F)
Number of
adult
pigeons
Number of
squabs
Examined
Adults Squabs
Suspected of ilness
Adults Squabs
1. 28 0 4 0 0 0
2. 70 0 2 0 0 0
3. 62 0 6 0 0 0
4. 110 4 8 4 0 2
5. 72 0 6 0 0 0
6. 66 0 8 0 0 0
Total 408 4 34 4 0 2
Analyzing the data in Table 1, note that in January, the loft of pigeons in the study
totalize a number of 408 pigeons, of which four were squabs that appeared accidentally in F
4. Clinically examined were 34 adults and four squabs suspected with Trichomonas columbae
infestation. Of the four squabs, two were positive infestated with T. columbae (F 4).
78

Lucrări Științifice – vol 53 seria Medicină Veterinară
All specimens examined showed signs of irregularity, mild loss of appetite and the 4
squabs manifested additional symptoms as diarrhea, prostration, and difficulty in swallowing
or horiplumation. The dynamics of disease incidence within these six farms in January 2008 is
shown in Fig. 5.
Fig. 5. The dynamics of pigeons ilness within the six studied farms in January 2008
Pigeons examination results in April, 2008 are included in Table 2.
Table 2.
The structure of the flock of pigeons and the suspected cases of ilness in April 2008
Number of
Examined
Suspected of ilness
Farm
Number of
adult
(F)
squabs
pigeons
Adults Squabs Adults Squabs
1. 28 16 2 6 0 2
2. 70 32 6 12 1 4
3. 60 45 12 16 0 2
4. 104 36 8 4 0 1
5. 72 26 6 12 1 2
6. 62 27 2 8 0 0
Total 396 182 36 58 2 11
Analyzing the data in Table 2, it is observed that in April breeding is already
underway, with a total of 182 offspring, thus totaling 578 actual specimens older than 10 days.
Clinically examined were 36 adult pigeons two of them being suspected of disease
and 58 squabs, of which 11 were suspected, totalizing 13 pigeons with altered state. Pigeons
had diarrhea, irregularity, mild loss of appetite, the clinical signs being more pronounced in
79

Universitatea de Științe Agricole și Medicină Veterinară Iași
squabs, in addition being found and dull plumage. It is noted that the number of birds affected
is higher in F 2 (5 pigeons, about 39% of total), where pigeon fancier started breeding first
from all other six fanciers (March 6). The dynamics of disease incidence in pigeons within the
six studied farms in April is depicted in Fig. 6.
2008
Farm (F)
Fig. 6. The dynamics of pigeons ilness within the six studied farms in April 2008
Pigeons examination results in August 2008 is included in Table 3.
Table 3.
The structure of the flock of pigeons and the suspected cases of ilness in August
Number of
adult
pigeons
Number of
squabs
Examined
Suspected of ilness
Adults Squabs Adults Squabs
1. 18 29 4 12 1 2
2. 52 46 6 16 1 4
3. 48 34 12 10 2 3
4. 68 42 10 8 2 5
5. 64 32 9 6 1 2
6. 52 34 8 5 0 1
Total 302 217 49 57 7 17
In Table 3 it can be observed the decrease in the number of adults because the
competion season is in full swing, and the increase in the number of young pigeons seeking to
balance the loft. There were clinically examined 106 specimens from the age of 10 days and
80

Lucrări Științifice – vol 53 seria Medicină Veterinară
were identified as suspicious of disease 24 pigeons. Symptoms were typical for nematodosis
and intestinal trichomonosis characterized by digestive syndrome, weakness, difficulty in
swallowing, the presence of fibrinous deposits in the mouth, prostration, left wing. The
dynamics of disease incidence in pigeons within the six studied farms in April is depicted in Fig.
7.
2008
Farm
(F)
Fig. 7. The dynamics of pigeons ilness within the six studied farms in August 2008
Pigeons examination results in December is included in Table 4.
Table 4.
The structure of the flock of pigeons and the suspected cases of ilness in December
Number of
adult
pigeons
Number of
squabs
Examined
Suspected of ilness
Adults Squabs Adults Squabs
1. 22 16 6 6 0 0
2. 54 22 10 8 1 2
3. 50 20 16 12 0 1
4. 54 18 12 8 0 0
5. 60 22 18 6 1 0
6. 48 24 9 8 0 2
Total 288 122 71 48 2 5
In Table 4 is observed that the number of adult birds decreased compared with the
summer season: in August, adult birds were sorted through competitive stages (marathon,
national contests), through sales, or losses and youth has also been sorted through training
flights and squabs trials.
81

Universitatea de Științe Agricole și Medicină Veterinară Iași
There have been 119 pigeons clinically examined of which five pigeons had digestive
disorders. The symptoms presented by the sick pigeons were similar to those described above,
specifying that in this case they had a common character regardless of pigeons age. Reduced
incidence of cases of disease can be explained because there were applied prevention
measures in farms in September‐October and the youth through growth have strengthened
their immune status, the lofts reaching an immunological uniformity.
The dynamics of disease incidence in pigeons in December 2008 is depicted in Fig. 8.
2009
Farm
(F)
Fig. 8. The dynamics of pigeons ilness within the six studied farms in December 2008
Examination result for the flocks of pigeons in March 2009 is contained in Table 5.
Table 5.
The structure of the flock of pigeons and the suspected cases of ilness in March
Number
of adult
pigeons
Number of
squabs
Examined
Suspected of ilness
Adults Squabs Adults Squabs
1. 38 0 4 0 0 0
2. 74 0 2 0 0 0
3. 72 0 6 0 1 0
4. 70 0 2 0 0 0
5. 94 0 7 0 0 0
6. 69 12 10 8 3 2
TOTAL 417 12 35 8 4 2
In Table 5 can be observed that in March 2009 pigeons examination included a
reduced number of pigeons, 35 adults four of them being suspected of disease and eight
squabs in which two suspected. During this time most farms applied spring prophylactic
82

Lucrări Științifice – vol 53 seria Medicină Veterinară
measures with positive results on lofts of pigeons and reduce cases of disease. The dynamics
of disease in lofts of pigeons in March 2009 is depicted in Fig. 9.
Fig. 9. The dynamics of pigeons ilness within the six studied farms in March 2009
Following further demands expressed by other pigeon fanciers, was conducted clinical
examination of pigeons with impaired health who presented polymorphic symptoms. Note
that in June and September 2008 were examined 20 cases, in April 2009, 34 cases and in May
2009, 12 cases (Table 6).
Table 6.
The incidence of the supplementery demands of examination for the pigeons that expressed
impaired health from the six studied farms, March 2008 – May
Pigeon
s Farm
Examined pigeons (March 2008‐May 2009)
Mar May Jun Jul Sep Oct Nov Jan Feb Apr May
1. 2 0 0 0 6 0 0 0 5 0 5
2. 0 4 0 0 0 0 11 0 0 9 0
3. 0 0 8 0 14 0 0 0 0 0 0
4. 0 0 12 0 0 6 0 0 0 0 7
5. 0 6 0 0 9 0 0 0 0 13 0
6. 4 0 0 0 0 0 0 0 0 12 0
TOTAL 6 10 20 0 20 6 11 0 5 34 12
In Table 6 it appears that following the additional claims arised from the occurrence
of morbid states, were clinically examined a number of 124 racing pigeons of all ages and both
sexes stressing that regular examinations were not sufficient. The dynamics of disease in
pigeons with polymorphic symptoms indicated by additional requests in 2008‐2009 is shown in
Fig. 10.
83

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 10. The dynamics of the supplementary examinations in pigeons from the six
studied farms in March 2008 – May 2009
The incidence of digestive parasitic diseases detected in pigeons that were
supplemetary examined during March 2008‐May 2009 is contained in Table 7.
Pigeon
s Farm
Table 7.
The incidence of the digestive parasitosis suspected cases after the supplementary
examinations of pigeons in March 2008 – May 2009
Pigeons suspected of digestive parasitosis
Mar May Jun Jul Sep Oct Nov Jan Feb Apr May
1. 0 0 0 0 1 0 0 0 1 0 1
2. 0 0 0 0 0 0 0 0 0 0 0
3. 0 0 1 0 2 0 0 0 0 0 0
4. 0 0 2 0 0 0 0 0 0 0 3
5. 0 0 0 0 0 0 0 0 0 2 0
6. 2 0 0 0 0 0 0 0 0 0 0
TOTAL 2 0 3 0 3 0 0 0 1 2 4
In Table 7 is observed the incidence of disease cases in pigeons examined following
additional requests and, based on the clinical picture were suspected of an ongoing digestive
parasitosis, the ratio beetween the number of examined pigeons (124) and the number of
suspects (15) being relatively low. The dynamics of digestive parasitosis suspected in the lofts
of pigeons examined following additional requests is depicted in Fig. 11
84

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 11. The dynamics of the digestive diseases incidence in pigeons from the six studied
farms in March 2008 – May 2009
The monitoring of the six farms of racing pigeons has been regularly made and added
the supplementary investigations for defining the intensivity and extensivity of the invasive
elements and their transmission to free areas or contamination of pigeons during training and
competitions with new parasitic elements and their dissemination at the return to nest. The
medical history reveals that four of the six pigeon fanciers use the”stamping‐out'' method in
case of severe disease, removing the specimens from the farm or isolating them in quarantine
boxes and applying appropriate treatment measures in order to reduce or block the horizontal
transmission of disease. Housing spaces for ground holdings (and those suspended uncleaned
and unsanitized), are a spore‐starting favorable environment for the oocysts of Eimeria, and
preservation of eggs of Ascaridia, and Capillaria eliminated by adult carrier pigeons and the
infestation of the squabs or young pigeons. Any parasitic aggression exerted on the digestive
tube has direct consequences for the harmonious development of pigeons, flight capacity and
also reduce sports performance. Permanent epidemiological surveillance represents the basis
to prevent the occurrence of morbid states of parasitic, infectious, nutritional origin in lofts of
pigeons and to limit the risk of transmission of zoonoses in humans.
CONCLUSIONS
Epidemiological investigations were conducted during January 2008 ‐ May 2009 on
some lofts of racing pigeons from six private farms to highlight the presence of invasive
parasitic elements and the risk of their dissemination during flight in free areas.
Of all cases studied (464 pigeons), 80% were suspected as bacterial or viral diseases,
10% were suspected as digestive parasitosis (46 pigeons) and 10% as other disorders.
The clinical expression of the morbid states was reduced during January‐March 2008,
then from April until August, there was an upward curve of disease which peaked in June.
85

Universitatea de Științe Agricole și Medicină Veterinară Iași
In the monitored farms the flight was performed and the pigeons were selected
based on their sports performance and not their phenotypic characters; the studies have
shown that following sports season, several pigeons are lost or suffering from the insidious
nature diseases that determine a decrease in resistance to stress and sustained exercise.
It was noted the important role of hygiene, proper nutrition, preventive measures
and compliance with density, but above all, vigilance and knowledge of the most common
parasitic diseases to intervene in time and to minimize the future economic and emotional
losses.
During training and sports competitions pigeons fly huge distances (thousands of km)
increasing the risk of disseminating invasive elements (and not only) in areas free of
infestation followed by the infestation of other lofts of pigeons or responsive gallinaceae and
also their contamination when travelling endemic areas and infestation of the loft at their
return.
Pigeons are meant to fly free and for racing pigeons to return to their nest regardless
of where they are released, requiring constant epidemiological surveillance and a real
collaboration between fanciers and veterinary service.
BIBLIOGRAPHY
1. Bilius, M., 2000 ‐ ,,Paranormal sau intuiție la porumbelul călător’’, Revista Voiajorul.
2. Iacob, Olimpia, 2002 – Parazitologie şi clinica bolilor parazitare‐ Protozooze. Ed. “Ion Ionescu
de la Brad” Iaşi pag. 66‐69; 102; 135‐143.
3. Iacob Olimpia, 2006‐ Parazitologie şi clinica bolilor parazitare la animale –Helmintoze. Ed. “Ion
Ionescu de la Brad” Iaşi pag. ; 344‐ 347; 396‐398; 402‐407
4. Iftode, Ghe., Georgiana Iftode, Cristina Iftode, Mirela Iftode, 2006 – Porumbeii de agrement şi
sport din România. Ed. Lidana, Suceava
5. Severeanu, I., F. I., Ivana, 1991 ‐ ,,Bolile porumbeilor’’ Ed. Ceres, Bucureşti pag.177‐206
86

PRELIMINARY DATA CONCERNING OPTIMIZATION
OF A PCR‐BASED METHOD FOR MOLECULAR DETECTION
OF TICK‐BORNE PATHOGENS
Mariana IONITA 1 , D.K. HOWE 2 , I.L. MITREA 1 , B. STEVENSON 3 , Michelle YEARGAN 2
1 UASVM Bucharest, Faculty of Veterinary Medicine, Splaiul Independentei 105, sector 5,
050097, Bucharest, Romania, ionitamvet@yahoo.com
2 Department of Veterinary Science, Gluck Equine Research Center, University of Kentucky,
Lexington, KY 40546‐0099, USA; 3 Department of Microbiology, Immunology, and Molecular
Genetics, College of Medicine, University of Kentucky, Lexington, KY 40536‐0298, USA
Tick‐borne zoonotic infections are among the most diffuse vector borne diseases. Approximately
10% of the currently known 867 tick species act as vectors of a broad range of pathogens
(protozoa, rickettsia, spirochaetes and viruses) of domestic animals and humans, and a significant
number of these pathogens are agents of emerging infectious diseases. One of the first step for
tick‐borne risk assessment is the detection of these pathogens in their vectors. PCR amplification
of pathogen DNA using species‐specific primers is now the standard for pathogen detection in
ticks.
In this paper are presented some preliminary data of our trials on optimizing the general and
particular conditions of a PCR‐based RLB assay for molecular detection of Borrelia burgdorferi –
the agent of Lyme disease, one of the most important tick‐borne zoonotic disease. We used the
23S‐5S rRNA spacer region of B. burgdorferi sensu lato as the target for PCR and determined the
genomic group of B. burgdorferi sensu stricto (B31 strain) by hybridization of the PCR product to
four genomic‐specific oligonucleotide probes immobilized on a membrane. The PCR was shown
to be species specific; in RLB assay the anticipated genomic group ‐ B. burgdorferi sensu stricto
was identified in all positive samples. No cross hybridization with other genomic group were
registered in RLB assay. The genomic group was confirmed also by DNA sequencing, and in
consequences the method was validated.
Key words: ticks, pathogens, detection, Borrelia burgdorferi, PCR, RLB hybridization
Vector‐borne diseases are currently considered a major health risk, not only in
tropical and subtropical regions, but in temperate regions as well, where climate change could
create conditions suitable for outbreaks of a such diseases. Predicting the effects of global
warming on health requires an examination of the current incidence and distribution of major
vector‐borne diseases. Ticks are considered, after mosquitoes, the most important vectors for
infectious diseases worldwide. Ticks transmit a greater variety of pathogenic microorganisms
(protozoa, rickkettsiae, spirochaetes and viruses) than any other arthropod vector group, and
a significant number of these pathogens are agents of emerging infectious diseases (Jongegan
and Uilenberg, 2004).
Tick‐borne zoonotic infections are among the most diffuse vector borne diseases
(Sambri et al., 2004). Approximately 10% of the currently known 867 tick species act as vectors
of a broad range of pathogens of domestic animals and humans (Jongejan and Uilenberg,
2004), which cause diseases such as anaplasmosis, babesiosis, ehrlichiosis, Lyme borreliosis,
and rickettsiosis (Estrada‐Pena and Jongegan, 1999). Lyme borreliosis is the most significant
vector‐borne disease in Europe and the United States. One of the first step for tick‐borne risk
assessment is the detection of these pathogens in their vectors. PCR amplification of pathogen
87

Lucrări Științifice – vol 53 seria Medicină Veterinară
DNA using species‐specific primers is now the standard for pathogen detection in ticks (Parola
and Raoult, 2001; Sparagano et al., 1999).
Tick‐borne pathogens (protozoa, rickettsia or viruses) can co‐exist in the same tick
vector or be carried by different tick species, and it is difficult to identify a pathogen in carrier
animals or ticks which are carrying low level of infection. In this situation, molecular tools,
particularly amplification of specific markers using the polymerase chain reaction (PCR) have
revolutionized detection and identification of pathogenic organisms (Sparagano et al., 1999).
Although many useful species‐specific PCR assays have been developed to detect a
particular tick‐borne pathogen, however, PCR assays can be time‐consuming, labor‐intensive
and expensive, particularly when testing for multiple pathogens in a large number of samples.
For this purpose, it is recommended the use of a test where it is possible to simultaneously
detect and differentiate all protozoan and ehrlichial parasites that could possibly be present in
a vector ticks or in the blood of an infected host (Sparagano et al., 1999). Reverse line blot
(RLB) hybridization, where multiples samples can be analyzed against multiple probes to
enable simultaneous detection, fulfils these criteria.
In this paper we presented some preliminary data of the trials on optimizing the
general and particular conditions of the PCR‐based RLB assay for molecular detection of some
tick‐borne pathogens, such as Borrelia burgdorferi – the agent of Lyme disease. Borrelia
burgdorferi sensu lato, the causative agent of the zoonosis Lyme borreliosis (LB), is
transmitted by ticks of the genus Ixodes (Burgdorfer et al., 1982). The infection may affect the
nervous system, cause arthritis, or result in a chronic cutaneous manifestation, acrodermatitis
chronica athrophicans (Steere, 1989). B. brugdorferi sensu lato has been divided into three
groups on the basis of DNA relatedness: B. burgdorferi sensu stricto, B. garinii, and B. afzelii
(Baranton et al., 1992, Canica et al., 1993).
In the study described here, we used the spacer region between the 5S‐23S rRNA
genes (rDNA) of Borrelia burgdorferi sensu lato as the target for PCR. The 23S and 5S rRNA
genes are tandemly duplicated in the order 23s‐5S‐23S‐5S in B. burgdorferi sensu lato, and this
arrangement has not been found in other members of the genus Borrelia or other eubacteria
(Schwartz et al., 1992). In the second step, we determined the genomic group of B. burgdorferi
sensu stricto (B31 strain) by hybridization of the PCR product to four genomic‐specific
oligonucleotide probes immobilized on a membrane, testing different conditions, in order to
optimize the method for further molecular studies.
MATERIALS AND METHODS
Ticks and bacterial strains. Ixodes ricinus ticks were collected from natural infested
cattle from some regions in North‐East of Romania. Immediately after collection, the ticks
were immersed in 70% ethanol and stored.
The genomic group of Borrelia burgdorferi sensu stricto ‐ B31 strain was used for testing
the specificity of PCR and RLB hybridization, in order to optimize the particular conditions for the
methods.
Preparation of DNA extracts from ticks. Ticks were processed as described Schouls et
al. (1999). Briefly, the ticks were taken from the 70% ethanol solution, air dried, and boiled for
20 min in 100 μl of 0.7 M ammonium hydroxide to free the DNA. After cooling, the vial with
the lysate was left open for 10 min at 90°C to evaporate the ammonia. The tick lysate either
was used directly for PCR or was stored at ‐20°C until use.
PCR amplification. The polymerase chain reaction (PCR) amplification was carried out
in a 25‐μl reaction volumes. For the amplification of Borrelia burgdorferi sensu lato DNA, each
88

Universitatea de Științe Agricole și Medicină Veterinară Iași
reaction mixture contained the primers 23SN2 and 5SCB (Table 1), and 5μl aliquots of the B.
burgdorferi s.s. DNA and tick extracts. To minimize nonspecific amplification a touchdown PCR
program was used: 3 min at 94°C, two cycles of 20 s at 94°C, 30 s at 67°C, and 30 s at 72°C, and
then two cycles with conditions identical to the previous cycles but with an annealing
temperature of 65°C. During subsequent two cycles sets the annealing temperature was
lowered by 2°C until it reached 57°C. Then, an additional 40 cycles each consisting of 20 s at
94°C, 30 s at 57°C, and 20 s at 72°C, followed the touchdown program, were performed. The
PCR was ended by an extra incubation for 7 min at 72°C.
Reverse Line Blot Hybridization. The reverse line blotting technique was performed
as described by Schouls et al. (1999). For species identification, Borrelia PCR product were
hybridized with probes for B. burgdorferi sensu lato, B. burgdorferi sensu stricto, B. afzelii, B.
garinii.
DNA sequencing. The PCR products from samples with positive signal in RLB assay
were used for DNA sequencing in order to confirm the genotype of Borrelia burgdorferi and
implicit for validation of methods.
RESULTS AND DISCUSSIONS
For determining the specificity of PCR were tested range of B. burgdorferi sensu
stricto (B 31 strain) DNA concentrations: two samples diluted in water, one pooled with tick
lysate. The last one samples was added in order to check the potential presence of tick
inhibitors for PCR amplification. In the PCR were included also three different samples with
tick lysates from Ixodes ricinus, which were not positive in previously PCRs.
89

Table 1
Oligonucleotide primers and probes used in PCR and hybridization assay
Lucrări Științifice – vol 53 seria Medicină Veterinară
Reference
Oligonucleotide sequence Target organism Target gene Nucleotid
position
Rijpkema
et al, 1995
243‐263
469‐444
23S‐5S spacer
23S‐5S spacer
Borrelia burgdorferi sensu lato
Borrelia burgdorferi sensu lato
5’biotin‐GAGAGTAGGTTATTGCCAGGG
ACCATAGACTCTTATTACTTTGACCA
Oligonucleo‐
tide name
Primer
5SCB
23SN2
Rijpkema
et al, 1995
453‐430
322‐299
322‐298
305‐278
23S‐5S spacer
23S‐5S spacer
23S‐5S spacer
23S‐5S spacer
Borrelia burgdorferi sensu lato
Borrelia burgdorferi sensu
stricto
B. garinii
B. afzelii
5’‐amino‐CTTTGACCATATTTTTATCTTCCA
5’‐amino‐AACACCAATATTTAAAAAACATAA
5’‐amino‐AACATGAACATCTAAAAACATAAA
5’‐amino‐AACATTTAAAAAATAAATTCAAGG
Probes
SL
SS
GA
AF
90

Universitatea de Științe Agricole și Medicină Veterinară Iași
From each PCR reactions, 5 μl were subjected to electrophoresis on ethidium
bromide‐stained 1% agarose gel and visualized under UV transillumination (fig. 1).
In all samples with B. burgdorferi DNA (B 31 strain non‐diluted, diluted in water) the
intergenic 23S‐5S spacer gene was amplified, obtaining a visible band of 226 bp (Fig. 1). No any
differences of PCR amplification for diluted sample were registered. Also, the sample with B.
burgdorferi DNA pooled with tick lysate was amplified in the PCR. This finding, emphasizes that
there were not tick inhibitors which could affect the amplification reactions in the PCR.
The three tick lysate samples were not amplified by PCR the B. burgdorferi intergenic
23S‐5S spacer gene.
1 2 3
226
bp
MW 4 5 6 7 8
Fig. 1. Amplificarea specifică (PCR) a spațiatorului intergenic 23S‐5S a rDNA (226 bp)
‐ Borrelia burgdorferi: 1,2,3‐tick lysate; MW‐molecular weight marker; 4‐B. burgdorferi DNA
non‐diluted; 5‐B. burgdorferi DNA diluted in water; 6‐B. burgdorferi pooled with tick lysate; 7‐
negative control (water)
Only the intergenic 23S‐5S amplicons were subjected to the RLB assay. For optimizing
the conditions for RLB assay, different oligonucleotidic probe concentrations were used,
ranging from 10 pmol to 800 pmol (Table 2). In the RLB hybridization, a negative control
(water), was included, too. Hybridization of PCR products to species‐specific probes was
revealed by chemiluminescence using Super‐Signal substrate (Pierce, Rockford, IL), and images
were documented with a FluorChem 8800 imaging system (Alpha Innotech, San Leandro, CA).
91

Lucrări Științifice – vol 53 seria Medicină Veterinară
Oligoprobe final concentrations tested in the RLB assay
Oligoprobes Final concentration
(c‐pmol)
References
B. burgdorferi SL (sensu lato) 100 Schouls et al., 1999
B. afzelii (AF) 800 Schouls et al., 1999
B. garinii (GA) 800 Schouls et al., 1999
B. burgdorferi SS1 (sensu stricto) 100 Schouls et al., 1999
B. burgdorferi SS2 (sensu stricto) 50 Schouls et al., 1999
B. burgdorferi SS3 (sensu stricto) 25 Schouls et al., 1999
B. burgdorferi SS4 (sensu stricto) 10 Schouls et al., 1999
OLIGONUCLEOTIDE PROBES
B. afzelii
B. garinii
B. burgdorferi SS4
B. burgdorferi SS3
B. burgdorferi SS2
B. burgdorferi SS1
B. burgdorferi SL
1 2 3 4 5 6
PCR Products
Table 2
Fig. 2. Reverse line blot hybridization assay analyses for the detection and identification of B.
burgdorferi. The oligonucleotide probes are attached to the membrane in the horizontal
direction. and the PCR samples applied perpendicularly in the vertical direction. The PCR
amplicons derived from: 1‐B. burgdorferi non‐diluted DNA; 2‐B. burgdorferi DNA diluted in
water; 3‐negative control (water); 4‐6B. burgdorferi pooled with tick lysate
92

Universitatea de Științe Agricole și Medicină Veterinară Iași
The PCR was shown to be species specific, and in RLB assay the anticipated genomic
group ‐B. burgdorferi sensu stricto was identified in all positive samples.
The optimal concentration of the B. burgdorferi SS oligoprobe was 10 pmol. No cross
hybridization with other genomic group were registered in RLB assay.
Three of the PCR amplicons which have shown positive hybridization in the RLB assay
were subjected to DNA sequence analysis, in order to confirm the genomic group, and to
validate the method. Sequences were determined in both directions (using the same primers
individually as for the PCR). Sequences were subjected to National Center for Biotechnology
Information (NCBI) BLAST analysis for the homology. NCBI BLAST analysis revealed 99%
homology with Borrelia burgdorferi (strain B31) sensu stricto internal transcribed spacer DNA
sequences available in Genbank (accession numbers: L30127.1 GI:508388) (fig. 3).
Therefore, results of the trials described in this study, confirmed the genomic group,
and validated the optimal conditions of the PCR‐based RLB hybridization method, for further
studies for molecular detection of tick‐borne pathogens in Romania.
RLB was originally developed for the identification of Streptococci serotypes
(Kaufhold et al., 1994). The assay has been used also for molecular identification of some
parasites such as equine small strongyle species (Traversa et al., 2007, Cernaska et al., 2009,
Ionita et al., 2010).
The first application of RLB for the detection and differentiation of pathogens in ticks
was developed for Borrelia spirochetes (Rijpkema, 1995), for simultaneously identify the
genomic groups of B. burgdorferi sensu lato in ticks collected in the field. The results showed
that 10 to 35% of the Ixodes ricinus ticks from The Netherlands were infected with B.
burgdorferi genospecies. Subsequently, RLB was combined with Ehrilichia spp. (Schouls et al.,
1999), confirming the previously findings; on the other hand, it showed, also a high rate of
infection with Ehrlichia species (45%), and coinfection with Ehrlichia and two genospecies of B.
burgdorferi
RLB was then successfully applied for the detection and differentiation of all known
Theileria and Babesia species (Gubbels et al., 1999), for the characterization of Babesia
divergens in humans (Centeno‐Lima et al., 2003), and novel Theileria and Babesia species were
discovered through the application of RLB (Nijhov et al, 2003). Furthermore, RLB was used for
detection and differentiation of many Babesia and Theileria spp. occurring in small ruminants
(Schnittger et al., 2004). PCR and RLB were used, also to detect and identify B. burgdorferi sensu
lato, Anaplasma and Ehrlichia species, and spotted fever group rickettsiae in ticks from
Southeastern Europe (Christova et al., 2003). Prevalence data for pathogens in ticks can be used
to assess the risk of tick‐borne diseases for public health.
In conclusion, RLB is a versatile diagnostic tool, which sensitively and simultaneously
detects and differentiates pathogens in ticks, blood or tissue. RLB combine PCR amplification
followed by a hybridization step, resulting in sensitivity up to 100 fold or higher than PCR only.
CONCLUSIONS
1. The optimal conditions of a PCR‐based RLB assay for molecular detection of Borrelia
burgdorferi – the agent of Lyme disease, one of the most important tick‐borne zoonotic disease,
were established.
2. Amplification and hybridization of the 23S‐5SrDNA intergenic spacer region provide an
accurate and rapid method of determining the presence of the genomic groups of B. burgdorferi
sensu lato.
93

Lucrări Științifice – vol 53 seria Medicină Veterinară
3. The PCR was shown to be species specific; in RLB assay the anticipated genomic
group ‐B. burgdorferi sensu stricto was identified in all positive samples. No cross hybridization
with other genomic group were registered in RLB assay.
4. The genomic group was confirmed by DNA sequencing; the optimal conditions for
the PCR‐based RLB hybridization method were validated for further studies for molecular
detection of tick‐borne pathogens in Romania.
ACKNOWLEDGEMENT
This work was supported by CNCSIS – UEFISCSU, project number PNII – IDEI code
729/2007, director Mariana Ionita, Lecturer, PhD, DVM.
REFERENCES
1. Baranton G, Postic D, Saint Girons I, Boerlin P, Piffaretti JC, Assous M, Grimont PA., 1992.
Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461
associated with Lyme borreliosis. Int J Syst Bacteriol.;42(3):378‐83.
2. Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, Davis JP., 1982. Lyme
disease‐a tick‐borne spirochetosis?. Science. 18;216(4552):1317‐9.
3. Canica M.M., Nato F., du Merle L., Mazie J.C., Baranton G., Postic D., 1993. Monoclonal
antibodies for identification of Borrelia afzelii sp. nov. associated with late cutaneous
manifestations of Lyme borreliosis. Scand J Infect Dis.;25(4):441‐8.
4. Centeno‐Lima S, do Rosário V, Parreira R, Maia AJ, Freudenthal AM, Nijhof AM, Jongejan
F., 2003. A fatal case of human babesiosis in Portugal: molecular and phylogenetic
analysis. Trop Med Int Health.;8(8):760‐4.
5. Cernaska, D., Paoletti, B., Kral’ova‐Hromadova, I., Iorio, R., Cudekova, P., Milillo, P.,
Traversa, D., 2009. Application of a reverse line blot hybridisation assay for the species‐
specific identification of cyathostomins (Nematoda, Strongylida) from benzimidazole‐
treated horses in the Slovak Republic. Vet. Parasitol. 160, 171–174.
6. Christova I, Van De Pol J, Yazar S, Velo E, Schouls L., 2003. Identification of Borrelia
burgdorferi sensu lato, Anaplasma and Ehrlichia species, and spotted fever group
Rickettsiae in ticks from Southeastern Europe. Eur J Clin Microbiol Infect Dis.;22(9):535‐42
7. Estrada‐Pena A., Jongejan F., 1999. Ticks feeding on humans: a review of records on
human‐biting Ixodoidea with special reference to pathogen transmission. Exp Appl
Acarol.;23(9):685‐715.
8. Estrada‐Pena A., 2009. Tick‐borne pathogens, transmission rates and climate change.
Front Biosci., 1;14:2674‐87
9. Gubbels JM, de Vos AP, van der Weide M, Viseras J, Schouls LM, de Vries E, Jongejan F.,
1999. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot
hybridization. J Clin Microbiol.; 37(6):1782‐9.
10. Ionita M, Howe DK, Lyons ET, Tolliver SC, Kaplan RM, Mitrea IL, Yeargan M., 2010. Use of a
reverse line blot assay to survey small strongyle (Strongylida: Cyathostominae)
populations in horses before and after treatment with ivermectin. Vet Parasitol.;168(3‐
4):332‐7
11. Jongejan F, Uilenberg G., 2004. The global importance of ticks. Parasitology. 2004;129
Suppl:S3‐14
94

Universitatea de Științe Agricole și Medicină Veterinară Iași
12. Kaufhold A., Podbielski A., Baumgarten G., Blokpoel M., Top J., Schouls L., 1994. Rapid
typing of group A streptococci by the use of DNA amplification and non‐radioactive allele‐
specific oligonucleotide probes. FEMS Microbiol letters; 119(1‐2):19‐25
13. Nijhof A.M., Penzhorn B.L., Lynen G., Mollel J.O., Morkel P., Bekker C.P., Jongejan F., 2003.
Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: tick‐borne parasites associated
with mortality in the black rhinoceros (Diceros bicornis). J. Clin Microbiol, 41(5):2249‐54
14. Parola P, Raoult D., 2001. Tick‐borne bacterial diseases emerging in Europe. Clin Microbiol
Infect.; 7(2):80‐3. Review.
15. Rijpkema S.G., Molenboer M.J., Schouls L.M., Jongejan F., Schellekens J.F., 1995.
Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi
sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic
spacer region between 5S and 23S rRNA genes. J. Clin Microbiol, 33(12):3091‐5
16. Schnittger L, Yin H, Qi B, Gubbels MJ, Beyer D, Niemann S, Jongejan F, Ahmed JS., 2004.
Simultaneous detection and differentiation of Theileria and Babesia parasites infecting
small ruminants by reverse line blotting. Parasitol Res.; 92(3):189‐96
17. Schouls L.M., Van De Pol I., Rijpkema S.G., Schot C.S., 1999. Detection and identification of
Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus
ticks. J Clin Microbiol., 37(7):2215‐22
18. Schwartz JJ, Gazumyan A, Schwartz I., 1992. rRNA gene organization in the Lyme disease
spirochete, Borrelia burgdorferi. J Bacteriol. ; 174(11):3757‐65.
19. Sparagano OA, Allsopp MT, Mank RA, Rijpkema SG, Figueroa JV, Jongejan F., 1999.
Molecular detection of pathogen DNA in ticks (Acari: Ixodidae): a review. Exp Appl Acarol.;
23(12):929‐60.
20. Steere AC., 1989., Lyme disease. N Engl J Med.; 321(9):586‐96.
21. Traversa, D., Iorio, R., Klei, T.R., Kharchenko, V.A., Gawor, J., Otranto, D., Sparagano, O.A.,
2007. New method for simultaneous species‐specific identification of equine strongyles
(Nematoda, Strongylida) by reverse line blot hybridization. J. Clin. Microbiol. 45, 2937–
2942.
95

PROPOFOL ANAESTHESIA IN DONKEYS IN COMBINATION
WITH CHLORAL HYDRATE
Ismail, S.F ; Abd Al‐Galil, A.S.A and Gehan, B.A.Youssef
Dept. of Surgery, Anaesthesiology and Radiology, Faculty of Veterinary Medicine
Benha University.Egypt
Abstract
The anesthesia characterized by bad quality induction with strong nervous manifestation after
chloral hydrate injection. Nearly all body reflexes disappeared after propofol infusion. .
Complete analgesia and sedation was achieved at 4 minutes after injection where the animals
showed no responses to any painful stimuli.
The heart rate in this group showed gradual increase while the respiratory rate and body
temperature were showed significant decrease.
The recovery of the animals characterized by both of the pedal and anal reflexes appeared at 39
minutes after propofol injection .Complete recovery of the animals occurred at 95 minutes with
tinny smooth recovery without any signs of nervous manifestation
INTRODUCTION
Propofol is an alkyl phenol derivatives ( 2, 6 di‐iso‐propyl‐phenol). Only slightly
soluble in water and commercially present as an aqueous emulsion containing propofol ( 10mg
/ ml ), glycerol (100mg/ml), soya bean oil ( 22.5 mg/ml), egg lecithin (12mg/ml) and sodium
hydroxide to adjust PH. (Branson and Gross, 1994).
Propofol is non barbiturate and relatively non cumulative intravenous anesthetic agent with
rapid onset and recovery. It produce smooth induction with possibility of maintenance by
intermittent injection ( Muir et al.,2007)
Its effects are similar to that of Sodium Pentothal. It provides no analgesia. Yet in some
studies, when patients receive propofol compared to inhalation agents for anesthesia, post‐
operative pain is less after propofol.
Propofol is a potent hypnotic currently formulated as oil in water emulsion. Propofol is a short
acting, rapidly metabolized intravenous agent characterized in man by virtual lack of any
cumulative effect and by rapid recovery after its administration in a bolus dose or by
continuous infusion (Branson and Gross, 1994)
Propofol is highly protein bound in vivo and is metabolized by conjugation in the liver. Its rate
of clearance exceeds hepatic blood flow, suggesting an extra‐hepatic site of elimination as well
as It has several mechanisms of action, (Vanlersberghe and Camu ,2008) both through
potentiation of GABA‐A receptor activity, thereby slowing the channel closing time, (
Krasowski, Hong , Hopfinger and Harrison ,2002) and also acting as a sodium channel blocker
(Haeseler and Leuwer ,2003)
( Haeseler , Karst , Foadi , Gudehus , Roeder , Hecker , Dengler and Leuwer, 2008)
Recent research has also suggested the endocannabinoid system may contribute significantly
to propofol's anesthetic action and to its unique properties.( Fowler, 2004)
Propofol is a short acting hypnotic unrelated to other general anesthetic agents. Propofol is
provided in sterile glass ampoule contains no preservatives; there fore the formulation will
support microbial growth and end toxin production (Arduino, Bland and Allister, 1991). Those
96

Lucrări Științifice – vol 53 seria Medicină Veterinară
authors added that, because of the microbial growth and the risk of infection and sepsis any
unused propofol should be discarded at the end of the anesthetic procedure.
Propofol is oil at room temperature and insoluble aqueous solution. The concentration of
propofol is 10% each 1ml containing l0 mg of the active principle. Hui‐Chn lin, Ram and Tom
(1997). Chloral hydrate presented as colorless translucent crystals and has penetrating odor. It
metabolized by liver into (tri‐chloro‐ethyl alcohol), which in a less potent hypnotic. Chloral
hydrate is a good hypnotic but a poor anesthetic and the amount needed to produce
anesthesia approach the minimal lethal dose (Reid , Nolan and Welsh (1993) . El‐Sayad
(2006), stated that the injection of chloral hydrate in donkeys followed by propofol infusion
lead to rapid induction of anesthesia. also added that chloral hydrate followed by propofol
induce long time anesthesia and smooth recovery.
MATERIALS AND METHODS
The present study was carried out on 20 donkeys. Collected from the suburban of
kalyobia governorates were used as experimental model .The animals were apparently healthy
and their ages and body weights were ranged from 3‐4 years and 120‐150 kg respectively.
These animals were collected to investigate the pilot efficacies of propofol alone as well as
propofol combination with other anesthetic drugs, according to their physiological,
hematological, and neuromuscular effects.
All animals were fasted for about 12 hours and freely given water before being
investigated. These investigations were classified into two main parts
Before each injection, the jugular vien was cannulated on disinfected clipped skin, the weight
of the animal was estimated and the dose of each anesthetic drug was calculated.
The clinical signs of the anesthetic regimen including: assessments of its analgesic effect,
duration of its action as well as the time of its recovery were recorded.
The effect of the regimen on the heart and respiratory rates as well as the body temperature
were also measured and tabulated. They were recorded before each injection (0.0 time) and
at 5, 10, 20, 30, 60, 120, 180 minutes after injection.
The anesthesia of each regimen was maintained for 30 minutes and the animals were
put under observation recording the physiological and the clinical changes until the animals
become in the sternal and then in the standing position.
A catheter was inserted in the other jugular vein for blood sampling. The blood samples were
obtained before injection of each regimen (0.0 time) and at 15, 30, 60 minutes and at 24 hours
for the estimation of blood picture, as well as for liver and kidney function tests.
The animals were injected slowly with 10% chloral hydrate solution in a dose of 5 mg/
50 kg body weight then the anesthesia was maintained by intravenous infusion of 0.2mg /
kg/minute propofol diluted in 5 % dextrose in a ratio of 1:4 respectively.
RESULTS
The anesthesia characterized by bad quality induction, all animals of this group
showed strong nervous manifestation after chloral hydrate injection (5 mg/ 50 kg body
weight) with tremors in the muscles of the limbs, head, neck and the back of the animals. The
animals let down on the ground 3 minutes after injection.
Nearly all body reflexes disappeared after propofol infusion. No anal or perennial reflexes by
using strong stimuli. The eye reflexes disappear but the eye pupil reflex persist for 4 minutes
97

Universitatea de Științe Agricole și Medicină Veterinară Iași
then disappeared. Complete analgesia and sedation was achieved at 4 minutes after injection
where the animals showed no responses to any painful stimuli.
The heart rate in this group showed gradual increase from the preanesthetic value up to 20
minutes (Peak) then returned to normal 2 hour after injection as shown in table (1)
The respiratory rate showed significant decrease 20 minutes after injection (without apnea)
then returned back 3 hour after injection as shown in table (1)
The body temperature showed significant decrease throughout the time of the anesthesia,
this decrease of the body temperature was evidenced by shivering of the animals especially
during the recumbancy period as shown in table (1)
The recovery of the animals of this group characterized by shivering of the animals, both of
the pedal and anal reflexes appeared at 39 minutes after propofol injection, long recumbancy
period, the animal raise its head but still recumbent and finally the animal became in the
standing position after several trails to stand, then complete recovery of the animals occurred
at 95 minutes with tinny smooth recovery without any signs of nervous manifestation.
Blood analysis:
Blood analysis of the animals given propofol/ chloral hydrate was shown in table 2and 3.
Haemogram:
The red blood cells (RBCs) in this group showed non significant changes (7.70 ±1.82) when
compared to the base line value (7.75 ±1.75) while the white blood cells (WBCs) showed
gradual decrease (7.87 ±0.90) when compared to the base line value (8.30 ±0.92), as shown in
table 8 and figure 36 and 37 respectively .
The hemoglobin (Hb) showed non significant changes (12.34 ±0.85) when compared to the
base line value (12.78 ±1.11) while the packed cell volume (PCV) showed gradual decrease
(44.67 ±2.08)when compared to the base line value (46.33±2.52), as shown in table (2) .
GPT showed gradual decrease (64.33 ±11.15) when compared to the base line value (69.00
±11.14) while GOT showed non significant changes (64.00 ±38.97) when compared to the base
line value (64.00 ±43.59), as shown in table (3)
The cholesterol showed sudden increase 15 minutes after injection then gradual decrease
(143.00 ±15.87) when compared to the base line value (148.67 ±15.53) and the total protein
showed gradual decrease (5.87 ±0.78) when compared to the base line value (6.03 ±0.80)
while the glucose level showed abrupt increase 15 minutes after injection then returned back
to gradual increase (99.67 ±2.89) when compared to the base line value (73.33 ±10.97), as
shown in table (3)
The creatinine showed gradual decrease (1.44 ±0.25) when compared to the base line value
(1.52 ±0.36) while the urea concentration showed increase (24.67 ±5.13) when compared to
the base line value (22.67 ±5.03), as shown in table (3)
The albumin showed non significant changes (2.64 ±0.36) when compared to the base line
(2.76 ±0.30) while the A/G showed gradual increase (0.91 ±0.10) when compared to the base
line (0.85 ±0.04), as shown in table (3)
98

Time
180
120
60
30
20
10
5
0
parameters
Heart rate
63 ±5.29 64.67 ±18.15 67 ±18.36 68 ±16.82 64.67 ±13.80 66.67 ±13.32 58.33 ±6.81 58.67 ±7.64
Respiratory
Lucrări Științifice – vol 53 seria Medicină Veterinară
18.67 ±2.08 14 ±2.65 13 ±2.65 12.67 ±2.52 14.67 ±1.15 15.67 ±1.53 15.67 ±2.08 16.33 ±0.58
Temperature
37.47 ±0.64 36.07 ±0.12 36.2 ±0.52 36.17 ±0.38 36.23 ±0.25 36.57 ±0.31 36.6 ±0.69 36.77 ±0.49
Table (1): Showing the changes in the heart , respiratory rate and body temperature
0 15
Time
24h
60
30
7.75 ±1.75 7.64 ±1.58 7.70 ±1.82 7.47 ±1.39 7.64 ±1.68
8.30 ±0.92 7.93 ±1.01 7.87 ±0.90 8.20 ±0.66 8.40 ±0.70
12.78 ±1.11 12.51 ±0.71 12.34 ±0.85 12.11 ±0.88 12.00 ±0.66
Parameters
RBCs
(million/cmm )
WBCs
(cell/cmm)
HB
(gm/dl)
PCV %
99
46.33 ±2.52 46.00 ±1.00 44.67 ±2.08 43.67 ±3.21 47.00 ±3.61
Table ( 2 ): Effect on blood picture samples ( RBCs, WBCs, Hb and PCV)

Universitatea de Științe Agricole și Medicină Veterinară Iași
Time
0 15 30 60
24h
Parameters
GPT
69.00 ±11.14 66.00 ±12.49 64.33 ±11.15 61.67 ±9.50 66.00
(u/L)
±13.89
GOT
148.67 ±15.53 154.33 ±14.36 143.00 ±15.87 147.67 ±16.04 128.33 ±11.85
(u/L)
Cholesterol
(mg/ dl) 64.00 ±43.59 62.33 ±35.28 64.00 ±38.97 63.00 ±40.71 59.00 ±36.39
1.52 ±0.36 1.48 ±0.33 1.44 ±0.25 1.25 ±0.16 1.39 ±0.02
6.03 ±0.80 5.85 ±0.75 5.78 ±0.78 5.81 ±0.86 5.90 ±0.79
73.33 ±10.97 101.67 ±11.02 99.67 ±2.89 86.33 ±12.70 94.33 ±10.26
22.67 ±5.03 24.67 ±3.79 24.67 ±5.13 25.67 ±5.13 23.67 ±4.16
2.76 ±0.30 2.66 ±0.40 2.64 ±0.36 2.76 ±0.33 2.59 ±0.38
Creatinin
(mg/ dl)
Total protein
(mg/dl)
Glucose
(mg/dl)
Urea
(mg/dl)
Albumin
(gm/dl)
A/G %
100
0.85 ±0.04 0.83 ±0.07 0.84 ±0.06 0.91 ±0.10 0.79 ±0.11
Table (3): effect on liver and kidney functions of animals given propofol / chloralhydrate

DISCUSSION
Universitatea de Științe Agricole și Medicină Veterinară Iași
In this group we avoid the adverse effect of high induction dose of propofol by
injection of chloral hydrate for induction of anesthesia, and then the maintenance of
anesthesia was done by propofol infusion at rate of 0.2 mg/kg/minute.
Chloral hydrate was relatively good hypnotic but poor analgesic as stated by Reid , et al.
(1993) and this showed agreement with our results .
The induction of anesthesia in this group after injection of chloral hydrate was rapid
with severe nervous manifestation as vigorous struggling, tremors and stiffness in head, neck
and limbs. These finding were agreed with that recorded by Silverman and Muir (1993) , Field
(1993) and El‐Sayad (2006).
In this group, the induction of anesthesia with chloral hydrate produced a bad quality
induction, so the use of sedative tranquilizer to improve the bad condition of the induction of
anesthesia as reported by (Silverman and Muir (1993).
The anesthesia was deep in all animals of that group and the duration of anesthesia
was longer than that of propofol alone. This result supported by Silverman and Muir (1993),
Field (1993) and El‐Sayad (2006).
The adverse effect of high induction dose of propofol was avoided by injection of chloral
hydrate, so the marked changes in cardio respiratory parameters were not observed, as the
heart rate showed non significant increase in this group. This finding was similar to that stated
by El‐Sayad (2006) in donkeys.
The respiratory rate in this group showed significant decrease at the first 20 minutes
then returned back by time to the base line level. This result showed agreement with Field
(1993) who added that the respiratory depression occurred in horses anesthetized with chloral
hydrate.
The body temperature in this group showed significant decrease and this decrease
was evidenced by shivering of all animals of this group, this similar to the finding of El‐Sayad
(2006) in donkeys.
In this group the recovery from combination of chloral hydrate and propofol was
prolonged than that of propofol alone and this showed agreement with the results of
Silverman and Muir (1993), Field (1993) and El‐Sayad (2006) in horses and donkeys
respectively.
Those authors added that the main disadvantage of chloral hydrate is that the dose required
for inducing general anesthesia causes prolonged recovery.
The duration of recovery in this group was 95 minutes. The animal take long
recumbancy time then begin to response to external stimuli, then raise the head but still
recumbent, then attend to stand and complete recovery at 95 minutes. No nervous signs
recorded. This was augmented by Silverman and Muir (1993), Field (1993) and El‐Sayad
(2006) in horses and donkeys respectively.
The use of chloral hydrate as induction drug with propofol infusion in donkeys
produce bad quality induction anesthesia, but the anesthesia was deep with prolonged
recovery. However the uses of chloral hydrate reduce the high induction dose of propofol, so
reduce the adverse effect and the high cost of using propofol.
101

REFERENCES
Lucrări Științifice – vol 53 seria Medicină Veterinară
Arduino M. J., Bland L. A. and McAllister S. K. (1991): Microbial growth and endotoxin production in the intravenous
anaesthetic of propofol .Intec Control Hosp Epidem, 12: 535‐539.
Branson K, R and M, E. Gross (1994): Propofol in veterinary medicine; J. Am .Vet. Med. Assoc,; 1292 ‐
1246. 204(12): 1888‐1890.
El‐Sayad, A. M. M. (2006): Using of propofol as a general anesthetic in equine in comparison with other
anesthetics. M.V.Sc.Thesis. Tanta univ. Kafr‐El‐ sheikh branch
Field, Sc. (1993): Cardiovascular and respiratory effects of propofol administration in hypovolemic dogs.
Am.J. Vet. Res.; 53: 2323 ‐2327.
Fowler, CJ.(2004): "Possible involvement of the endocannabinoid system in the actions of three
clinically used drugs." Trends Pharmacol. Sci. Feb;25(2):59‐61.
Haeseler G, Karst M, Foadi N, Gudehus S, Roeder A, Hecker H, Dengler R, Leuwer M.(2008): High‐
affinity blockade of voltage‐operated skeletal muscle and neuronal sodium channels by halogenated
propofol analogues. British Journal of Pharmacology. Sep;155(2):265‐75.
Hui‐Chu Lin.;Ram,BC, And Tom,TA. (1997): Anesthesia in sheep with propofol or with xylazine ‐ ketamine
followed by halofhane. Veterinary Surgery; 26: 247‐252.
Haeseler G, Leuwer M. (2003): High‐affinity block of voltage‐operated rat IIA neuronal sodium channels
by 2,6 di‐tert‐butylphenol, a propofol analogue. European Journal of Anaesthesiology.
Mar;20(3):220‐4.
Krasowski , Hong X., Hopfinger A.J, Harrison N.L. (2002): Analysis of a set of propofol analogues:
mapping binding sites for an anesthetic phenol on the GABA(A) receptor. Journal of Medicinal
Chemistry. Jul 18;45(15):3210‐21.
Muir W.W.,Hubell J.A., Bednarski R.M. and Sharda R.T. (2007): Hand Book of Veterinary Anesthesia: 4 th
Edn. Chap3. Mosby. An Affiliate of Elsevier Inc. Usa, PP: 140‐163. ISBN: (13‐978‐0‐323‐04678‐7), (10:
0‐323‐046789‐9). DOI. 987654321.URL.WWW.elsevier.com.
Reid, J.; Nolan AM. and Welsh, E. (1993): Propofol as induction agent in the goat: a pharmacokinetic
study. J. Vet. Pharmacol. Ther. 16 (4): 488‐493.
Silverman, K. and Muir, M. (1993): Complications associated with general anesthesia of the horses. Vet.
Clin. North Am; 3:45‐60.
Vanlersberghe C, Camu F. (2008): Propofol. Handbook of Experimental Pharmacology. ;(182):227‐52.
102

GENOTYPING ESTROGEN RECEPTOR POLYMORPHISM IN PIGS,
USING THE PCR‐RFLP METHOD
Adina Maria MANEA, S. E. GEORGESCU, Steliana KEVORKIAN,
Sorina DINESCU, Marieta COSTACHE
University of Bucharest, Department of Biochemistry and Molecular Biology, Spl.
Independentei 91‐95, sector 5, Bucharest
Abstract
The efficiency of livestock production is highly influenced by reproductive success, especially in
multipara species. In the case of the pig, litter size is a basic economic factor. Estrogen is
intimately involved with pregnancy and its function is mediated through the estrogen receptor,
therefore, ER was chosen as a candidate gene to study litter size in pigs. The goal of our study was
to genotype the T1665C polymorphism in Landrace, Large White, Pietran and Mangalitza breeds
using the PCR‐RFLP method. Our results showed that, by using this technique, it is easy to identify
the homozygous (TT or CC), and heterozygous swine. The method presented above is reliable, fast
and cost‐effective, and can be successfully applied in the marker‐assisted selection of the pigs.
Keywords: swine, estrogen receptor gene, polymorphism, PCR‐RFLP.
INTRODUCTION
Reproductive traits are of primary interest in livestock because they play a major role in the
efficiency of production. Selection for increased number of offspring has been employed in
model species like mice (Nielsen, 1994), pigs (Ollivier and Bolet, 1981; Lamberson et al., 1991;
Bidanel et al., 1994) and sheep (Elsen et al., 1994) with only limited success because of the low
heritability and the sex‐limited nature of reproductive traits.
Steroid hormones and their receptors play an important role in reproductive processes
(O'Malley, 1990). Cells in target tissues have receptor proteins that specifically bind the
hormone during the initial stage in its action. Estrogen is intimately involved with pregnancy
and its function is mediated through the estrogen receptor (ER). Mutations in this protein have
been implicated in spontaneous abortion and in human breast cancer (Lehrer et al., 1990). It
has been recently shown that transgenic mice containing a nonfunctional ER gene have
considerable phenotypic changes in the reproductive system (Korach, 1994). Therefore, ER
was chosen as a candidate gene to study litter size in pigs.
The first association between the estrogen receptor gene and litter size was established by
Rothschild et al in 1996. He highlighted a restriction fragment length polymorphism (RFLP) in
the α‐estrogen receptor gene, T1665C, a polymorphism associated with reproductive traits,
mainly litter size. The results obtained by Rothschild et al were later confirmed by Short et al
(1997) and Chen et al (2000). In all three studies a positive association between allele B
(C1665C) and litter size was highlighted.
Our goal was to genotype this polymorphism in the Landrace, Large White, Pietran and
Mangalitza breeds using the PCR‐RFLP method.
MATERIALS AND METHODS
We used blood samples from 75 pigs of the Landrace, Large White, Pietran and Mangalitza
breeds, (S.C. Romsuintest Periş, S.C. Suinprod S.A. Roman), preserved in EDTA anticoagulant.
103

Lucrări Științifice – vol 53 seria Medicină Veterinară
The isolation of genomic DNA from fresh blood was performed with Wizard Genomic DNA
Extraction Kit (Promega).
The PCR was performed using a GeneAmp 9700 PCR System (AppliedBiosystems). The
reactions were carried out in 25‐μl final volume containing PCR Buffer, MgCl2, 800μM dNTP,
0.48 μM of each primer (F‐CCCTCTATGACCTGCTGCTG; R‐TCAGATTGTGGTGGGGAAGTC), 0.5
units of AmpliTaq Gold DNA Polymerase, diluted DNA and nuclease‐free water. PCRs were
performed in 0.2 ml tubes by 40 cycles with denaturation at 95ºC (30s), annealing at 59°C
(30s) and extension at 72°C (60s). The first denaturation step was of 10 minutes at 95ºC and
the last extension was of 10 minutes at 72°C.
PCR products were detected by electrophoresis in 2% agarose gel stained with ethidium
bromide and then digested with restriction endonuclease AvaI at 37°C for 3 hours. Restricted
products were analyzed by electrophoresis in 3.2% agarose gel stained with ethidium bromide.
For sequencing, we used the same conditions as in the case of PCR. The amplified fragments
were sequenced by ABI Prism 310 Genetic Analyzer, using the ABI Prism ® BigDye Terminator
Cycle Sequencing Reaction Kit after purification with the Wizard System Kit (Promega). The
sequences were processed using DNA Sequencing Analysis 5.1 Software (AppliedBiosytems)
and the nucleotide sequences were aligned with the BioEdit program (Hall, 1999) and refined
manually.
RESULTS AND DISCUSSIONS
For the identification of the T1665C SNP we used the PCR‐RFLP method. The set of primers
was designed to amplify only a 185bp fragment from the α estrogen receptor gene that
contains the T(1665)C SNP. This polymorphism creates a new recognition site for AvaI
restriction endonuclease (C(T/C)TG(A/G)→C↓(T/C)CG(A/G)). The 185pb contains another
restriction site for enzyme AvaI, at this site there is no other polymorphism and the enzyme
will be cut at this level regardless of the animal genotype. We consider this site as a digestion
control site.
The PCR conditions were selected in such a way that the two primers could amplify the DNA
from homozygote (TT or CC) and heterozygote animals.
Successful amplification and digestion with AvaI yielded one, two, three or four fragments of
47, 60, 78 and 107 bp depending on the homozygote and heterozygote animals analyzed. For
homozygoteTT pigs in the 1665 position we obtained two bands of 107 and 78bp and for
homozygoteCC pigs we obtain three bands of 47, 60 and 78bp. In the case of a heterozygote
animal, after the digestion with AvaI restriction endonuclease and electrophoresis, we obtain
four bands of 47, 60, 78 and 107pb.
In our study we identified homozygote (TT and CC) and heterozygote animals for the SNP
T1665C (Figure 1).
Figure 1: Electrophoresis pattern of α estrogen receptor gene fragment after digestion with
the AvaI enzyme. Lines 1, 3, 5, 6 – two fragments of 78 and 107pb, indicate homozygous TT
pigs; Line 2 – four fragments of 47, 60, 78 and 107pb indicate heterozygous pigs; Line 4 –
three fragments of 47, 60 and 78pb indicate homozygous CC pigs; Line 7 ‐ uncut PCR product;
Line 8 ‐ molecular size marker‐50bp (Promega).
104

Universitatea de Științe Agricole și Medicină Veterinară Iași
To confirm our results we sequenced the 185bp fragment from the α‐estrogen receptor gene.
Figures 2 and 3 illustrate the profiles of the homozygous TT and CC pig from the region that
contains the T1665C SNP.
Figure 2: The sequence of the region from the PCR product that contains the SNP T1665C
inside the recognition site for AvaI for a homozygousTT pig.
Figure 3: The sequence of the region from the PCR product that contains the SNP T1665C
inside the recognition site for AvaI for a homozygousCC pig.
The sequence alignment between a region of the α‐estrogen receptor gene and our PCR
products from the homozygous (TT and CC) pigs (figure 4) was done using BioEdit programme.
Figure 4: BioEdit fragment sequence alignment of a region of the estrogen receptor gene and
our PCR products from homozygous (TT and CC) pigs.
CONCLUSIONS
The major focus of this study was to genotype the T1665C polymorphism from α‐estrogen
receptor gene in the Landrace, Large White, Pietran and Mangalitza breeds using the PCR‐RFLP
method. This method could help breeders in their forward selection strategy especially in the
marker‐assisted selection.
Our results showed that, by using this technique, it is easy to identify the animals which have
the favorable allele for reproduction. The method presented above is reliable, fast and cost‐
effective, and can be successfully applied in the wide‐scale screening of different pig
populations.
105

REFERENCES
Lucrări Științifice – vol 53 seria Medicină Veterinară
Nielsen MK (1994) Selection experiments for reproductive rate in mice Proceedings of the 5th World
Congress on Genetic Applied to Livestock Production (Univ. of Guelph, Guelph, ON, Canada), 19:219‐
225.
Ollivier L and Bolet G (1981) La sélection sur la prolificité chez le porc: Résultats d'une expérience de
sélection sur dix générations. J. Rech. Porcine France 13:261‐268.
Lamberson WR, Johnson RK, Zimmerman DR and Long TE (1991) Direct responses to selection for
increased litter size, decreased age at puberty, or random selection following selection for ovulation
rate in swine. J. Anim. Sci. 69:3129‐3143.
Bidanel JP, Gruand J and Legault C (1994) An overview of 20 years of selection for litter size in pig using
“hyperprolific” scheme Proceedings of the 5th World Congress on Genetic Applied to Livestock
Production (Univ. of Guelph, Guelph, ON, Canada), Vol. 17, pp. 512‐515.
Elsen JM, Bodin L, Francois D, Poivey JP and Teyssier J (1994) Genetic improvement of litter size in sheep
Proceedings of the 5th World Congress on Genetic Applied to Livestock Production (Univ. of Guelph,
Guelph, ON, Canada), Vol. 19, pp. 237‐243.
O'Malley B (1990) The steroid receptor superfamily: more excitement predicted for the future. Mol.
Endocrinol,. 4, 363‐369.
Lehrer S, Sanchez M, Song HK, Dalton J, Levine F, Savoretti P, Thung SN. & Schachter B (1990) Oestrogen
receptor β‐region polymorphism and spontaneous abortion in women with breast cancer. Lancet
335, 622‐624.
Korach KS. (1994) Insights from the study of animals lacking functional estrogen receptor. Science 266,
1524‐1527.
Chen KF, Huang LS, Li N, Zhang Q, Luo M, Wu CX (2000) The genetic effect of estrogen receptor (ESR) on
litter size traits in pig. Yi Chuan Xue Bao 27:853–857.
Short TH, Rothschild MF, McLaren DG, Southwood OI, Devries AG, Van der Steen A, Tuggle CK, Helm J,
Vaske DA, Mileham AJ, Plastow GS (1997) Effect of the estrogen receptor locus on reproduction and
production traits in four commercial pig lines. Journal of Animal Science 75:3138–3142.
Rothschild MF, Jacobson C, Vaske D, Tuggle C, Wang L, Short TH, Eckardt G, Sasaki S, Vincent A, McLaren
D, Southwood O, Van der Steen H, Mileham S and Plastow G (1996) The estrogen receptor locus is
associated with a major gene influencing litter size in pigs. Proc. Natl. Acad. Sci. USA 93:201‐205
Hall TA. (1999) BioEdit: a user‐friendly biological sequence alignment editor and analysis program for
Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:95‐98.
106

COMPARATIVE TESTING OF SOME EXPERIMENTAL MODELS OF
OXYGEN INDUCED RETINOPATHY IN YOUNG RATS.
HISTOLOGICAL STUDY.
Miclăuş V 1 ., Anne Claudia Ştefănuț 2 , Adriana Mureşan 3 ,
C. Ober 1 , V. Rus 1
1 FACULTY OF VETERINARY MEDICINE CLUJ‐NAPOCA
2 CLINIC EMERGENCY HOSPITAL CLUJ‐NAPOCA
3 UNIVERSITY OF MEDICINE AND PHARMACY
”IULIU HAȚIEGANU” CLUJ‐NAPOCA, vmiclaus@usamvcluj.ro
Abstract: The influence of O2 concentration on the development and maturation of the retina was
tested on two groups of newborn rats, one group subjected to hyperoxia and the other to
variations of the concentration of O2 (hyperoxia/hypoxia). Results were assessed on histological
sections. The occurrence of retinal cytoarchitectural changes in both experimental groups was
observed, but with big differences between them. In case of group with hyperoxia, they appeared
only in some animals (22%) and had regional character, while in group with hyperoxia/hypoxia,
the procent was 100% and tended to generalize. These aspects demonstrate the negative effects
of inadequate concentration of O2 on retinal development, variable concentration being more
harmful than a constant hyperoxia.
INTRODUCTION
Keywords: rat; retinopathy; histology
The newborn rats have an immature visual system and the eyes are closed. After birth, the rat
visual system gradually matures, the eye opening can be done after 14 days. Stage of
development of retinal vascularization in newborn rat is comparable to that of an human
premature L4‐5 month of gestation (Gyllensten and Hellström, 1954) and the retina is
extremely immature at birth, comparable with that of a human fetus of 26 weeks . (Ricci,
1990). Retinal vascularization of newborn rats matures in the first two postnatal weeks
(Cairns, 1959). Postnatal maturation of the visual system in rats, make that it can be used as an
experimental model for diseases that can occur during the final period of retinal maturation.
Maturation of human primary visual system is normally realised on intrauterine life (Dorfman
et al. 2008). But in premature newborn, the final part of retinal development and maturation
takes place extrauterine (in incubator) in circumstances that are sometimes different from
those optimal, necessary to carry out this delicate process. In some cases, premature humans
receiving high levels of O2 in order to compensate an unstable pulmonary status. But
increased levels of oxygen, can cause severe vasoconstriction and vaso‐obliteration, followed
by an abnormal proliferation of retinal vessels when it returned to normoxia, with the
occurrence of oxygen‐induced retinopathy (OIR). Direct relationship between oxygen and OHR
was supported by several authors (Michaelson, 1948, Campbell 1951, Ashton et al., 1954).
Dorfman et al. (2008), confirmed the anterior studies that demonstrated increased
susceptibility of the retina to hypoxemia in the first week of life, saying that in addition to
vascular changes which may be reversible, cytoarchitectural irreversible retinal changes can
occur. As in human subjects, exposure of young rats to postnatal hyperoxia can cause
107

Lucrări Științifice – vol 53 seria Medicină Veterinară
apparition of OIR (Smith et al., 1994; Reynaud et al., 1994; Madan and Penn 2003, Hardy et al.,
2005). Some authors have argued that variation of oxygen concentration produces more
severe retinopathy than just exposure to hyperoxia (Pennet al., 1993, Penn et al. 1995).
Although there have been numerous investigations that have attempted to clarify the causes
for the appearance of OIR, there are still many questions related to the etiology of this severe
disease.
MATERIALS AND METHODS
Animals used in this study were white rats, Wistar race, female with newborns, with a birth
weight of about 10g. Experimental study was performed at the Department of Physiology from
University of Medicine and Pharmacy Cluj‐Napoca. Three groups were realised: a control
group and two experimental groups. The control group was composed from a female rat and
her newborn rats(7), which were placed in an incubator together with its mother, at 4 hours
after birth, in conditions of normoxia for 21 days. Conditions of incubation: temperature 23‐
24OC, cyclic exposure 12 day/12 darkness, using white artificial light 200 lux, feeding of
newborn rats being ensured through maternal lactation, ad libitum from the mother. The first
experimental group (hyperoxia group), consisting from a female rat and its 9 newborn rats,
were placed in an incubator in conditions of normoxia for 7 days, then 5 days of hyperoxia
(80%) and the last 9 days, in normoxia conditions again.The second experimental group
(hyperoxia/hypoxia group), formed from a female rat and its 7 newborn rats, were placed in
conditions of normoxia for 7 days, than then five days in alternating daily periods of hyperoxia
(80% for 22 , 5ore) with hypoxia (10% for 1hr), and for hygiene of the incubator and mother
feeding were used 0.5 hours.To achieve hyperoxia, a mobile oxygen concentrator adapted to
the incubator was used, and hypoxia was achieved by placing the incubator in baroroom.
Slaughter of the rats was performed on day 21, after a sedation with ketamine 6 mg/kgc (Oana
et al. 2006). The eye globes were enucleated for histopathological examinations. An
aproximatively 3 mm incision was made in the central area of the cornea (to facilitate
penetration of fixative), then eye globes were fixed in Stieve mixture for 24 hours. Then the
eye globes were sectioned at limbus, under microscopic control, carefully removing the
cornea, lens and vitreous. The pieces were then dehydrated with ethyl alcohol, clarified with
butyl alcohol (n‐butanol) and included in paraffin. Serial sections of 5μ thick were obtained,
then its were stained with Goldner’s trichrome method. Examination of stained sections was
made at an Olimpus BX41 microscope.
RESULTS AND DISSCUTIONS
Young rats from the control group, showed after 21 days from starting the experiment a
normally developed retina, with typical layout in layers and normal vascularization (Fig. 1). In
none of the animals from control group were not identified structural changes, suggesting that
maintenace the rats under normoxia conditions, ensure appropriate conditions for normal
development of the retina. In case of rats from experimental group with hyperoxia, retinal
structural changes were observed in two of the nine rats studied. Changes were present in the
photoreceptor cell layer and had regional character. Were also observed areas where, because
of proliferation of photoreceptor cells, extern nuclear layer presents regional thickening,
resulting in zonal retinal thickening, which appears protruding into the respective area (Fig. 2).
In other areas, groups of photoreceptor cells migrated into the internal nuclear layer (Fig. 3),
or toward the pigmented layer (Fig. 4) have been identified
108

Universitatea de Științe Agricole și Medicină Veterinară Iași
Another situation was observed in the second experimental group, the group with alternation
hyperoxia / hypoxia. In this group retinal structural changes in all animals studied were
identified.They are different regarding the extension from an animal to another, observing
from changes with regional character to the tendency to generalize. Folds more or less deep
were also observed, sometimes covering half of the thickness of the retina (Fig. 5). They are
formed through zonal separation of photoreceptor cells, from the pigmented layer. In other
areas, polymorphic rossetes both in shapes and sizes were observed. (Fig.6.). In some areas,
structural disorganisation is so important, so that structural components appear mixed, with
almost complete disappearance of the characteristic disposition on the layers (Fig.7). The vast
majority of structural changes are irreversible. It seems that, largely, these structural changes
are due to abnormal proliferation of blood vessels which appear large or very large in optical
fibers layer (Fig. 8). Smaller vessels are detached from these large vessels, which penetrate
deeper, where branched and appears to participate in structural disorganization, beginning
with the photoreceptor cell layer, which is partial detached from the pigmented layer.
Results obtained in this experiment reveal that prolonged exposure to hyperoxia caused the
apparition of regional structural changes, mild or moderate in intensity in some animals taken
in the experiment. Beauchamp et al. (2004) stated that continuous exposure to hyperoxia
favors vasoconstriction with obliteration and stop developing vessels towards the retinal
periphery in response to increased levels of O2. After returning to conditions of normoxia, an
exaggerated neovascularization is unleashed, as a result of inadequate blood flow, a hypoxic
one. (Moore, 1990, Patz and Payne, 1998). Comparing with hyperoxia, hyperoxia/hypoxia
alternation induced severe cytoarchitectural changes having tendency of generalization, that
seems to be largely determined by an excessive neovascularization. Somewhat similar results
were reported by Penn et al. (1993) who said first that variations of O2 concentration, produce
a more consistent retinopathy compared with constant concentrations (hyperoxia). In his
experimental model (40/80 O2 concentrations), he obtained retinopathy in 66% of animals
studied. By alternating exposure to O2, 50% one day, next day 10% in the first 14 days and
then normoxia until day 20, neovascularization was obtained in 100% of animals taken in study
(Penn et al. 1994, Berkowitz 1996). Similar results were obtained by Cummingham et al. (2000)
in their experimental model in which rats were exposed 14 days at alternating concentrations
of O2, followed by normoxia, with apparition of retinopathy in 100% of animals used in
experiments. Dorfman (2008) argued that vascular changes may be reversible, but
cytoarchitectural and functional retinal changes are irreversible.
The aspects observed, confirmed that an inadequate concentration of O2 can negatively
influence the development and maturation process of the retina.But these changes are
dependent on oxygen concentration and especially on its concentration variation, aspects
good highlighted in the two experimental models studied. In the group with hyperoxia,
structural changes occurred only in some animals in the study, but these had a regional
character and were not very severe. In case of model hyperoxia/hypoxia, retinal
cytoarchitectural changes occurred in 100% of animals studied, although there were
differences between them in terms of extention and severity of injuries. By comparing the
results obtained in two experimental models, the fact that changes in oxygen concentration is
more harmful than hyperoxia is confirmed.
109

Lucrări Științifice – vol 53 seria Medicină Veterinară
CONCLUSIONS
1. Results obtained in this experiment confirm that an inadequate O2 concentrations may
adversely influence the development and maturation process of newborn rats retina, with
appearance of cytoarchitectural changes, whose extension and severity are dependent on
oxygen concentration and especially its concentration variations.
2. In case of group exposed to constant hyperoxia, only in 22% of animals studied moderate
severity structural changes occurred, with regional character, affecting only a small part of
photoreceptor cells.
3. In case of group exposed to hyperoxia/hypoxia, in 100% of animals studied appeared
cytoarchitectural bilateral retinal changes, severe and in most cases with tendency of
generalization and irreversible trend, with some differences from one animal to another.
4. By comparing the results obtained in two experimental models, is confirmed the fact that
variation of oxygen concentration is more harmful than hyperoxia, causing severe and
irreversible cytoarchitectural abnormalities, with retinal functional failure.
Fig.1. Control group ‐ normal structure (Goldner’s Trichrome ob. 40X)
1
2
Fig. 2. Hyperoxia group (Goldner’s Trichrome ob. 40X )
1. Regional thickening of photoreceptor cells layer
2. Regional thickening of the retina
110

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 3. Hyperoxia group (Goldner’s Trichrome ob. 40X )
1. Group of photoreceptor cells migrated in internal nuclear layer
1
1
Fig. 4. Hyperoxia group (Goldner’s Trichrome ob. 40X)
1. Group of photoreceptor cells migrated toward pigmented layer
111

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig.5. Hyperoxia/hypoxia group ( Goldner’s Trichrome ob. 40X)
1. Deep folds, 2. Regional thinness of the internal nuclear layer
1
1
1
Fig. 6. Hyperoxia/hypoxia group (Goldner’s Trichrome ob. 40X)
1. Polymorph rossetes
2. Regional disasapearance of the rods and cones
3.
Fig. 7. Hyperoxia/hypoxia group (Goldner’s Trichrome ob. 40X )
1. Structural disorganization of the 1‐5 layers
2. Regional thinness of the internal nuclear layer
112
2
2
2

REFERENCES
Universitatea de Științe Agricole și Medicină Veterinară Iași
1
2
Fig. 8. Hyperoxia/hypoxia group (Goldner’s Trichrome ob. 40X)
1. Exaggerated angiogenesis
2. Polymorph rossetes
3. Regional disasapearance of the rods and cones
1. Ashton N, Ward B, Serpell G., Effect of oxygen on developing retinal vessels with particular
reference to the problem of retrolental fibroplasia. Br J Ophthalmol 1954; 38:397‐432.
2. Beauchamp MH, Sennlaub F, Speranza G, et al. Redox‐dependent effects of nitric oxide on
microvascular integrity in oxygen‐induced retinopathy. Free Radic Biol Med. 2004;37(11):1885–
1894.
3. Berkowitz BA. Adult and newborn rat inner retinal oxygenation during carbogen and 100%
oxygen breathing. Invest OphthalmolVis Sci. 1996;37:2089–2098.
4. Cairns J.E., Normal development of the hyaloid and retinal vessels in the rat”‐Brit. J.
Ophthal.1959 43, 385
5. Campbell K., Intensive oxygen therapy as a possible cause of retrolental fibroplasia; a
clinical approach. Med J Aust 1951;2:48‐50.
6. Cunningham S, McColm JR, Wade J, Sedowofia K, McIntosh N, Fleck B., A novel model of
retinopathy of prematurity simulating preterm oxygen variability in the rat. Invest Ophthalmol Vis
Sci 2000; 41:4275‐80.
7. Dorfman A, Dembinska O, Chemtob S, Lachapelle P., Early manifestations of postnatal
hyperoxia on the retinal structure and function of the neonatal rat. Invest Ophthalmol Vis Sci,
2008, 49:458–466
8. Gyllensten LJ, Hellstrom BE., Experimental approach to the pathogenesis of retrolental
fibroplasia. I. Changes of the eye induced by exposure of newborn mice to concentrated oxygen.
Acta Paediatr Suppl 1954; 43:131‐48.
9. Hardy P, Beauchamp M, Sennlaub F, et al. New insights into the retinal circulation:
inflammatory lipid mediators in ischemic retinopathy. Prostaglandins Leukot Essent Fatty Acids.
2005;72(5): 301–325.
10. Madan A, Penn JS. Animal models of oxygen‐induced retinopathy. Front Biosci 2003;
8:d1030‐43.
11. Michaelson I. The mode of development of the vascular system of the retina with some
observations on its significance for certain retinal disorders. Trans Ophthalmol Soc UK
1948;68:137–80.
113
3

Lucrări Științifice – vol 53 seria Medicină Veterinară
12. Moore, A. (1990) Retinopathy of prematurity Taylor, D eds. Pediatric Ophthalmology 365‐
375 Blackwell Scientific Boston.Patz A.The effect of oxygen on immature retinal vessels. Invest
Ophthalmol Vis Sci 1965; 6:4:988‐999.
13. Oana L., A. Timen, Fl. Beteg, Anesteziologie şi propedeutică chirurgicală veterinară, Ed.
Risoprint, 2006, Cluj‐Napoca.
14. Patz A, Payne, JW, Retinopathy of prematurity (retrolental fibroplasia) Tasman, W Jaegen,
EA eds. Duane’s Foundations of Clinical Ophthalmology , (1998) 1‐19 Lippincott Williams &
Wilkins Philadelphia.
15. Penn JS, Tolman BL, Lowery LA., Variable oxygen exposure causes preretinal
neovascularization in the newborn rat. Invest Ophthalmol Vis Sci 1993; 34:576‐85.
16. Penn JS, Tolman BL, Henry MM., Oxygen‐induced retinopathy in the rat: relationship of
retinal nonperfusion to subsequent neovascularization. Invest Ophthalmol Vis Sci 1994; 35:3429‐
35.
17. Penn JS, Henry MM, Tolman BL. Exposure to alternating hypoxia and hyperoxia causes
severe proliferative retinopathy in the newborn rat. Pediatr Res 1994; 36:724‐31. Erratum in:
Pediatr Res 1995; 37:353.
18. Reynaud X, Dorey CK., Extraretinal neovascularization induced by hypoxic episodes in the
neonatal rat. Invest Ophthalmol Vis Sci.1994;35(8):3169–3177.
19. Ricci B., Oxygen‐induced retinopathy in the rat model. Doc Ophthalmol. 1990;74(3):171–177.
20. Smith LE, Wesolowski E, McLellan A, Kostyk SK, D'Amato R, Sullivan R, D'Amore PA.,
Oxygen‐induced retinopathy in the mouse. Invest Ophthalmol Vis Sci 1994; 35:101‐11.
114

EXPRESSION OF THE VIMENTIN MARKER IN DOG MELANIC
CUTANEOUS TUMORS
Moussa Raouad.,C Catoi., B Sevastre., M Taulescu.,
P Bolfă., A Gal., ,F.A Tabaran., A.L Nagy.,C CUC.
Pathology Department, Faculty of Veterinary Medicine,
University of Agricultural Sciences and Veterinary Medicine, Cluj‐Napoca, Romania,
Email:raouadmoussa@yahoo.com.
Vimentin is an intermediate filament that is expressed by mesenchymal and neuroectodermal
cells in normal tissues.(4) Melanoma showed positive staining of intermediate filaments with
antibodies to vimentin, with cells containing large numbers of melanosomes being stained less
strongly in general. Vimentin is type of intermediate filaments can distinguish melanoma from
undifferentiated carcinoma, but not from lymphoma or sarcoma.(2)
Methods: We investigated the immunohistochemical expression Vimentin marker , in tumour
tissues of 4 dog cutaneous melanomas and 2 dog cutaneous melanocytomas as possible
evidence of marked cells by vimentin . In addition we investigated the relationship between
vimentin expression and macroscopic,microscopic aspect.
6 cases were positive (2 melanocytoma, 4 melanomas), , 6 cases were positive
(2melanocytoma,4melanoma). Percentag of marked cells by vimentin were between (65.18% –
97.40%).The high percentages of marked cells were in melanotic tumors no have connective
activity.
the high percentages were in melanotic tumors that localized in global eye and perineal region
and moderate in a buccal region. I did,nt find legation between percentage of vimentin and
tumor types (benign or malignant).
Conclusions: the high percentage of vimentin immunoreactivity is in perineal and global eye
region and in melanotic tumors no have connective.the moderate percentage is in buccal region
and melanic tumors have a connective activity, and nu exist legation between tumor type and
percentage of marked cells.
Key words: Immunohistochemistry, Vimentin, Melanic Tumors, Dog.
INTRODUCTION
Vimentin (57 kDa) is the most ubiquituos intermediate filament protein and the first to be
expressed during cell differentiation. All primitive cell types express vimentin but in most non‐
mesenchymal cells it is replaced by other intermediate filament proteins during
differentiation.(1‐3)
Vimentin is expressed in a wide variety of mesenchymal cell types fibroblasts, endothelial cells
etc., and in a number of other cell types derived from mesoderm, e.g., mesothelium and
ovarian granulosa cells. However, in non‐vascular smooth muscle cells, vimentin is often
replaced by desmin. In striated muscle, vimetin is also replaced by desmin. However, during
regeneration, vimentin is reexpressed. Cells of the lymfo‐haemopoietic system (lymphocytes,
macrophages etc.) also express vimentin, sometimes in scarce amounts. ( 3)
Vimentin is also found in mesoderm derived epithelia, e.g. kidney (Bowman capsule),
endometrium and ovary (surface epithelium), in myoepithelial cells (breast, salivary and sweat
glands), an in thyroid gland epithelium. In these cell types, as in mesothelial cells, vimentin is
coexpressed with cytokeratin. Furthermore, vimentin is detected in many cells from the neural
115

Lucrări Științifice – vol 53 seria Medicină Veterinară
crest. Particularly melanocytes express abundant vimentin. In glial cells vimentin is
coexpressed with glial filament acidic protein (GFAP). (3)
Vimentin is present in many different neoplasms but is particulary expressed in those
originated from mesenchymal cells Sarcomas e.g., fibrosarcoma, malignt fibrous histiocytoma,
angiosarcoma, and leio‐ and rhabdomyosarcoma, as well as lymphomas, malignant melanoma
and schwannoma.(5‐6‐7)
Melanoma showed positive staining of intermediate filaments with antibodies to vimentin,
with cells containing large numbers of melanosomes being stained less strongly in general.(4)
This type of intermediate filaments can distinguish melanoma from undifferentiated
carcinoma, but not from lymphoma or sarcoma.(4)
The aim of the present this paper is to use computerized image analysis to measure vimentin
antibody in a series of canine melanocytic tumors to assess density of marked cells by
vimentin, and to correlate percentage of marked cells by vimentin with macroscopic and
microscopic aspect.
MATERIALS AND METHODS
●The material of our investigation was constituted of cadavers from the discipline of
morphopathology and necropsy diagnostic, and also as samples sent from the surgery clinic
and private practitioners, for diagnostic purpose. From all cadavers and samples examined
between 2001– 2010, 6 cases were diagnosed with 4 dog cutaneous melanomas and 2
melanocytomas.
● The samples were formalin fixed, then tissue sections were stained with hematoxylin and
eosin for histology study.
●For Immunohistochemistry (IHC), tissue sections of test samples were stained for CD31
(monoclonal Mouse Anti‐Vimentin Clone Vim 3B4, Code‐Nr.m7020, Dako Denmark A/S) and
developed with the diaminobenzidine (DAB) chromogen.
●Percentage of marked cells was assessed randomly by choosing immunolabeled vessels on a
400x field (40x objective and 10x ocular) and using an automated image analysis system
(Olympus cell B). 300 cells per tumor were examined.
Images were captured by using a microscope (Olympus BX51) connected to a video camera
(Olympus DP25), stored in the digital memory, and shown on the monitor. Manual outlining of
pecentange of marked cells were then calculated based on image analysis.
RESULTS AND DISCUSSIONS
In the period 2001 – 2010 in the Pathology Department, were diagnosed 4 dog cutaneous
melanoma and 2 dog cutaneous melanocytoma histological and with vimentin
immunoreaction see to(Table 1)
116

Universitatea de Științe Agricole și Medicină Veterinară Iași
Table 1:Results of dog cutaneous melanotic tumors ( histological , CD31 immunoreaction)
Number 81958 81693 78773 81783 81084 75688
HISTOL Date 04 ‐02‐ 15‐9‐ 01.07. 03‐11‐ 15‐11‐ 25‐04‐
GY
2010 2009 2005 2009 2008 2001
Vimenti
n
Breed Irish
Setter
M/F… F 13
age years
Region Buccal
cavity
Diagnosti
c
Cells
microsco
pic type
Nr of
mitosis
Lymphoc
yte
infiltrate
Amelano
tic
melano
ma
Doberm
an
M 9
yeas
Mandibu
lar
Junctoin
al
dermal
amelano
tic
melano
ma
Metis Tickle Giant
schnauzer
‐
F 6 years F 7years M 9 years ‐
Cutaneous‐
sacral,
dermal
amelanotic
Melanocyto
ma
Eye
global
amelano
tic
melano
ma
Neck in
dorsal
face
Hyperplas
ia
melanocy
tes
(lentigo )
benign
Knee
Amelano
tic
melano
ma
Epithelio
Epithelio Spindle Epithelio
id type
Epithelio Spindle
id type cells id
id type type
3 14 3 7 No 4
intense intense reduced moderat
e
No reduced
Necrosis intense intense reduced reduced No reduced
Connecti
ve
activity
Clark's
Clasificati
on
Percenta
ge of
marked
cell
Yes Yes No No Yes Yes
4 4 4 4 ‐ 4
69.18% 64.012% 93,67% 97.40% 65.18% 77.54%
117

Lucrări Științifice – vol 53 seria Medicină Veterinară
Figure (1): Amelanotic melanocma immunoreactivety with vimentin that stained a lot of cells
in high‐power Field, black arrow indicates to marked cells by vimentin and white arrow
indicate to fibroblast cell no marked by vimentin.(400x)
Figure (2) vimentin immunoreactivity with epithelioid melanoma that stained a moderate
percentage of cells Yellow arrows indicate to marked cells and white arrow indicate to cells no
marked(400x).
Figure(3): melanocytoma immunorecativity with vimentin that marked a spindle type cells,
arrow indicates to these cells. (400x)
118

Universitatea de Științe Agricole și Medicină Veterinară Iași
Figure (4) vimentin immunoreactivity with epithelioid melanoma cells, yellow arrow indicate
to marked cells while white arrow indicate to fibroblast no marked . (1000x).
●6 cases were positive (2melanocytoma,4melanoma)
●Percentag of marked cells by vimentin were between (65.18% – 97.40%).
●The high percentages of marked cells were in melanotic tumors no have connective
activity(fig1), but the moderate percentages were in melanotic tumors that have connective
activity (fig 2) .
●The high percentages were in melanotic tumors that localized in global eye and perineal
region (fig 1) But the moderate percentage were in melanotic tumors that localized in buccal
region.(fig 2)
●Vimentin did,nt stain fibroblast cells and this is inverse what he said (refer‐3): Vimentin is
expressed in a wide variety of mesenchymal cell types fibroblasts, endothelial cells etc.(3) fig‐
4.
●I did,nt find legation between percentage of vimentin and tumor types (benign or malignant).
CONCLUSIONS
1. In the interval 2001 – 2010 six dogs were diagnosed with cutaneous melanocytic
tumours.
2. The affected dogs were between 6 and 14 years old.
3. 6 cases were vimentin positive (2 melanocytoma , 4 melanoma ) .
4. The high percentage of vimentin immunoreactivity is in perineal and global eye region
and the moderate percentage is in buccal region.
5. The high percentage of vimentin immunoreactivity is in melanotic tumors no have
connective(2 cases) activity and the moderate percentage is in melanic tumor have
connective tissue(4 cases)
6. Vimentin doesn’t stain fibroblast
7. It isn’t exist legation between tumor type and percentage of marked cells by vimentin.
119

REFERENCES
Lucrări Științifice – vol 53 seria Medicină Veterinară
1‐ Azumi, N., Battifora, H. 1987‐ The distribution of vimentin and keratin in epithelial and nonepithelial
neoplasms. A comprehensive immunohistochemical study on formalin‐ and alcohol‐fixed tumors. Am J
Clin Pathol;88:286‐96.
2‐ Caselitz J, M Jänner, E Breitbart, K Weber, M Osborn., 1983 ‐ Malignant melanomas contain only the
vimentin type of intermediate filaments. Virchows Arch A Pathol Anat Histopathol 400: 43‐51.
3‐ Katsumoto T., Mitsushima A., Kurimura T. 1990 ‐ "The role of the vimentin intermediate filaments in
rat 3Y1 ):579‐84.
7‐ Ramaekers FCS, Vroom TM, Moesker O, et al. 1985 ‐ The use of antibodies to intermediate filament
proteins in the differential diagnosis of lymphoma versus metastatic carcinoma. Histochem J.;17:57.cells
elucidated by immunoelectron microscopy and computer‐graphic reconstruction". Biol Cell 68 (2): pp.
139–46.
4‐ koenig a, j. wojcieszyn, b. r. weeks, AND J. F. MODIANO.,2001‐ Expression of S100a, Vimentin, NSE,
and Melan A/MART‐1 in Seven Canine Melanoma Cell Lines and Twenty‐nine Retrospective Cases of
Canine Melanoma Vet Pathol 38:427–435
5‐ Lang SH, Hyde C, Reid IN, Hitchcock IS, Hart CA, Bryden AA, Villette JM, Stower MJ, Maitland NJ. . 2002
‐ Enhanced expression of vimentin in motile prostate cell lines and in poorly differentiated and
metastatic prostate carcinoma. Prostate Sep 1;52(4):253‐63.
6‐Niveditha SR, Bajaj P., 2003‐ Vimentin expression in breast carcinomas. Indian J Pathol Microbiol
Oct;46(4).
120

ON THE SHAPE OF THE ERYTHROCYTES FROM
SOME HERBIVORE MAMMALS
S.OANCEA 1 , G.PAVEL 1 , A.V.OANCEA 2
1 University of Agricultural Sciences and Veterinary Medicine, Iasi,
lioancea@univagro‐iasi.ro
2 “Al.I.Cuza”University, Iasi
The shape of a normal erythrocyte is a biconcave disc (discocyte) which represents an
equilibrium state. Red cells can easily undergo shape transformations in vitro under the
influence of certain agents and these changes are reversible by removal of causative
agents by the addition of antagonists. On the other hand, there are some mammals
which have elliptical erythrocytes as an adaptation to the environment and way of life.
In this work the analysis of the erythrocyte shape for some herbivore mammals is
presented. Our result shows that llama has only elliptical erythocytes, the cow and the
sheep have discocytes but goat has a percent of 7.3% and goat kid 17.5% as
elliptocytes. In addition the erythrocyte eccentricity has been computed and it is 0.87 for
llama, 0.73 for goat and 0.77 for goat kid.
Key words: mammal blood, RBCs, erythrocyte shape
INTRODUCTION
The shape of a normal erythrocyte is a biconcave disc (discocyte) which represents an
equilibrium state. Red cells can easily undergo shape transformations in vitro under the
influence of certain agents and these changes are reversible by removal of causative agents by
the addition of antagonists. The mechanism by which mature red blood cells change their
shape under physiological and pathological conditions has been the subject of considerable
interest. The dominating interpretation of shape changes is explained by differential increase
in surface area of the two leaflets of erythrocyte membrane.
Several groups have reported that drug‐induced shape changes of erythrocytes as
elliptocytes are accompanied by alterations in their flow properties [1]. These alterations in
the erythrocytes could be through direct modification of the cell geometry (surface to volume
ratio) or through associated alteration of the membrane skeleton. Thus an inter‐relationship
exists between the capacity of the cell for the shape change and the deformability of its
membrane [2]. Erythrocytes in clinical conditions are associated with altered morphology
leading to abnormal rheological behaviour, as observed in several hematological disorders.
The inability of the erythrocyte to shape alteration contributes to its early removal from the
circulation. Elliptocytes can be seen in hereditary disorders, such as hereditary elliptocytosis
[3], or in acquired disorders, such as iron defiency anemia, infectious anemias, thalassemia,
and in newborn babies. Hereditary elliptocytosis and its variants are congenital hemolytic
disorders in which erythrocytes are either elongated into a cigar or oval shape or are
poikilocytic and bizarrely shaped. Its transmission has usually been described as autosomal
dominant.
On the other hand, there are animals which have normal erythrocytes with a different
shape from discocytes. Therefore bird blood and fish blood contain elliptical erythrocytes [4].
121

Lucrări Științifice – vol 53 seria Medicină Veterinară
The elliptocytosis was detected a 5‐year‐old dog during the evaluation of lameness.
The dog's erythrocytes had reduced cellular deformability and erythrocyte membranes had
decreased mechanical stability. Analysis of erythrocyte membrane spectrin revealed an
increased amount of spectrin dimmers and DNA analysis detected a β‐spectrin mutation [5].
Other mammals have elliptocytes as an adaptation to the environment and way of
life. Therefore it is theorized that the size, shape and hemoglobin concentration of camelid
erythrocytes play a role in increasing the oxygen‐carrying capacity as well as the ability of
erythrocytes to exchange oxygen. Camelid erythrocytes have a lower MCV than most other
species, but a higher RBC count. PCV’s are similar to or slightly lower than other herbivores
and total hemoglobin concentration in llama blood is high as compared to cattle. This is due to
the combination of a higher concentration of hemoglobin in individual erythrocytes and the
higher total RBC counts. The high hemoglobin concentration increases the ability of the cell to
carry oxygen while the small size and flattened shape provide increased membrane surface for
oxygen exchange (higher surface/volume ratio). In addition, it appears that camelid
hemoglobin has characteristics that allow a higher saturation with hemoglobin at lower
atmospheric oxygen pressure (left shift in the oxygen dissociation curve). The elliptical shape
of the camelid erythrocytes also makes them much more resistant to changes in blood
osmolality. In this work the analysis of the erythrocyte shape for some herbivore mammals is
presented.
MATERIALS AND METHOD
Samples from peripheral mammal’s blood were operated using May‐Grüwald Giemsa
colorature. With the aid of the microscope we obtained the photos and using erythrocyte
planar images, we count the normal erythrocytes and the elliptocytes. After that the
eccentricity of these elliptocytes has been determined using the well known formula:
b
2
e = 1−
a
2
where a and b are the ellipse semiaxes.
Fig.1,2,3,4,5 shows the morphology of RBCs under normal conditions for blood of
some herbivore mammals. We can see that caw and sheep have normal discocytes, llama has
elliptocytes and goat and goat kid have erythrocytes of various shapes in their blood.
Fig.1 Erythrocytes from cow blood
122

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig.2 Erythrocytes from sheep blood
Fig.3 Erythrocytes from llama blood
Fig.4 Erythrocytes from goat blood
123

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig.5 Erythrocytes from goat kid blood
RESULTS AND DISCUSSION
Fig. 6 shows the percentage of normal erythrocytes, elliptocytes and other shape of RBCs from
some herbivore mammals.
%
120
100
80
60
40
20
0
cow sheep llama goat goat kid
discocytes
elliptocytes
other shape
Fig.6 The percentage of different shape of RBCs from herbivore mammals
0.95
0.9
0.85
0.8
0.75
0.7
0.65
0.6
llama
goat
goat kid
Fig.7 The eccentricity of elliptocytes from llama, goat and goat
kid Error bars are 95% confidence intervals and n=20
124

Universitatea de Științe Agricole și Medicină Veterinară Iași
Our results are in good accordance with the other authors for llama blood [6], as
figure 8 and 9 show.
1
0.95
0.9
0.85
0.8
0.75
0.7
0.65
0.6
0.55
0.5
Fig.8 Erythrocytes from llama blood (Azwai et al.)
llama-personal results
llama-literature
Fig.9 Comparison of the elliptocyte eccentricity from llama. Error bars are 95% confidence
intervals and n=20
Our results showed that the cow erythrocytes and sheep erythrocytes have discoidal
shape, for llama the RBC are elliptocytes and for goat and goat kid blood appear elliptocytes
and other different shapes. From aur samples resulted that goat blood has a percentage of
7,3% from cells as elliptocytes and 27% other shape, the rest of 65,7%being normal discocytes.
For goat kid we obtained a higher percentage for elliptocytes (17,5%) than for goat, the other
shapes being 11,3%, and discocytes71%.
From figure 7 we can see that the eccentricity of llama elliptocytes is 0.87 and it
higher than the other animals (0.73 for goat and 0.77 for goat kid). The mean elliptocyte
eccentricity for our samples is in accordance with the literature data (for these data we
obtained a main elliptocyte eccentricity 0.901)
125

CONCLUSION
Lucrări Științifice – vol 53 seria Medicină Veterinară
Llamoid erythrocytes are elliptical and the elliptocyte eccentricity is higher than those
in other domestic animals studied in this work. The unique morphological features of llama
erythrocytes play a vital role in their ability to transport oxygen to the tissue adequately on
environmental conditions of high altitude. The goats and goat kids have also elliptical
erythrocytes they being adapted to the special way of life by comparison with the other
mammals.
REFERENCES
1. Suwalskya M., Gonzáleza R., Fernando Villenab F., Aguilarc L.F., Sotomayor C.P, Bolognind S.,
Zatta P., (2009), Structural effects of tetrachloroauric acid on cell membranes and molecular
models, Coordination Chemistry Reviews 253, 1599–1606
2. Maeda N, Nakajima T., Izumida Y., Suzuki Y., Tateishi N., Seiyama A., Decreased deformability
of red cells refractory anemia and the abnormality of the membrane skeleton,(1994),
Biorheology, 31(4), 395‐405.
3. Debray F.G. , Ilunga S. , Brichard B. , Chantrain C. , Scheiff J.M., Vermylen C., (2005), Une
forme particulière d’anémie constitutionnelle chez un nourrisson de deux mois :
l’elliptocytose.A particular hereditary anemia in a two‐month‐old infant: elliptocytosis, Archives
de pédiatrie, 12, 163–167
4. Nash, G B., Egginton S., (1993), Comparative rheology of human and trout red blood cells, J.
Exp. Biol., 174 ,109 – 122.
5. Di Terlizzi R., Gallagher P.G. , Mohandas N., Steiner L.A., Dolce K. S. , Guo X. , Wilkerson M.J.,
Stockham S.L., (2008), Canine elliptocytosis due to a mutant β‐spectrin, Veterinary Clinical
Pathology, 38(1), 52 – 58
6. Azwai S.M., Abdouslam O.E., Al‐Bassam L.S., Al Dawek A.M., Al‐Izzi S.A.L., (2007),
Morphological characteristics of blood cells in clinically normal adult llamas (Lama glama),
Veterinarski Arhiv,77 (1), 69‐79
126

IDENTIFICATION OF PATHOLOGICAL STATES BASED ON RED
BLOOD CELL AGGREGATION
S.OANCEA 1 , S.PADUREANU 1 , A.V.OANCEA 2
1 University of Agricultural Sciences and Veterinary Medicine, Iasi,
lioancea@univagro‐iasi.ro
2 “Al.I.Cuza”University, Iasi
In the present study the aggregation properties of cow RBCs were investigated. For cow,
in physiological conditions, the aggregation is not present but in pathological cases a
hyper aggregation process can be seen. In order to appreciate the RBC aggregation the
Aggregate Shape Parameter has been computed using AUTOCAD soft
Key words: RBC aggregability, cow blood, AUTOCAD soft
INTRODUCTION
In human blood and for almost all mammals, RBCs are biconcave disks under normal
physiological conditions, whereas their mean size may differ between species. RBCs in static
human blood form large aggregates resembling a stack of coins but aggregation characteristics
of mammalian RBC exhibit a wide range among various species. More investigators are playing
a good deal of attention of research on blood viscosity to clinic, the aggregation of red blood
cell may be a more useful parameter of hemorheology from point of view of pathology and
diagnostic [1]. Comparative animal studies showed the wide variation of whole blood and
erythrocyte aggregation among different mammalian species [2]. Horse RBCs aggregation was
reported by many authors [3] and it is greater than for the other mammalian species. Popel et al.
data [4] showed that athletic species exhibit a consistently higher degree of red blood cell
aggregation than their sedentary counterparts. There are different methods to evaluate this
complex process of RBC aggregation [5], [6]. In [7] the fractal analysis was used to make a
quantitative evaluation of aggregability for horse blood by comparison with the human blood and
in [8] the same method was used for bovine blood from pathological point of view. Traditional
mechanical and mathematical methods also proved to be insufficient in describing the aggregation
process [9].
In this work the aggregation process of cow RBCs was investigated. In order to
appreciate the RBC aggregation the Aggregate Shape Parameter has been computed using
AUTOCAD soft.
MATERIALS AND METHOD
Samples from peripheral bovine blood were operated using May‐Grüwald Giemsa
colorature. With the aid of the microscope we obtained the photos. Using erythrocyte planar
images of the clusters, obtained with a Nikon microscope, the RBC Aggregate Shape Parameter
was computed using the formula [10]:
A
K = 4π (1)
2
P
127

Lucrări Științifice – vol 53 seria Medicină Veterinară
Here A is the projected area of the aggregate and P is its perimeter. These quantities
were computed by means of AUTOCAD 2007 soft.
RESULTS AND DISCUSSION
Fig.1 shows the morphology of RBCs under normal conditions for cow blood when the RBCs
are not aggregated and Fig. 2 shows aggregated erthrocytes.
Fig.1 Erythrocytes from cow blood
Fig.2 Aggregated erythrocytes from cow blood
Our measurements for 5 aggregates (from 5 photos) on the Aggregate Shape
Parameter are given in the table 1.
128

Universitatea de Științe Agricole și Medicină Veterinară Iași
Table 1 Aggregate Shape Parameter for cow blood
Nr A P K
1 149974.62 1978.21 0.4813
2 155554.0 2663.97 0.2753
3 159709.67 2471.86 0.3283
4 68678.54 1112.6 0.6968
5 193315.05 2815.65 0.3062
Mean 0.4176
Standard deviation 0.1751
Standard error 0.0783
Confidence interval 0.2174
The Aggregate Shape Parameter for cow blood in this pathological state is higher than
the other animals studied in the earlier work [11], as figure 3 shows.
Fig.3 Comparative aggregation for three mammals
Fig.3 The Aggregate Shape Parameter for some mammal’s blood. Error bars are 95% confidence
intervals and n=5
CONCLUSION
aggregation shape parameter
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
variants
horse
We can suppose that if we develop an easy method to measure the RBC aggregation
in pathological states for some mammals and we could perform standardization, we could
obtain a method to find the stage of the disease.
129
pig
cow

REFERENCES
Lucrări Științifice – vol 53 seria Medicină Veterinară
1. Rampling, M.W., Meiselman, H.J. Neu B., Baskurt O.K, (2004), Influence of cell‐specific factors
on red blood cell agregation, Biorheology, 41, 91‐112.
2. Kumavarel, M., Singh M., (1995), Sequential analysis of aggregation process of erytrocytes of
human, buffalo, cow, horse, goat and rabbit, Clinical Hemorheology, 15, 291 – 304.
3. Baskurt O.K., Farley R.A., Meiselman H.J., (1997), Erythrocyte aggregation tendency and
cellular properties in horse, human and rat: a comparative study, Am. J., Physiol., 273, H2604‐
H2612.
4. Popel A.S., Johnson P.C., Kameneva M.V., Wild M.A., (1994), Capacity for red blood cell
aggregation is higher in athletic mammalian species than in sedentary species, J. Appl.
Physiology, 77, 1790‐1794.
5. Marton Z., Kesmarky G., Vekasi J., Cser A., Russai R., Horvath B., Toth K., (2001), Red blood
cell aggregation measurements in whole blood and in fibrinogen solutions by different
methods, Clinical Hemorheology and Microcirculation, 24, 75‐83.
6. Rapa A., OANCEA S., (2006), Hemoreologie comparata, Editura TEHNOPRESS
7. Rapa A., OANCEA S., CREANGA D.,(2005), Fractal dimension in red blood cell, J.of Veterinary
and Animal Science, 29, 1247‐1253.
8. Oancea, S., (2007), A quantitative analysis of red blood cell aggregation from bovine blood,
Romanian Journal of Biophysics, 17(3), 205‐209.
9. Skalak R., ZHU C.,(1990), Rheological Aspects of Red Blood Cell Aggregation, Biorheology, 27,
309‐325.
10. Foresto P., D’Arrigo M., Carreras L., Cuezzo R.E., Valverde J., Rasia R., (2000), Evaluation of
red blood cell aggregation in diabetes by computarized image analysis, Medicina (Buenos
Aires), 60, 570‐572.
11. Oancea S., Oancea A.V., (2010), Erythrocyte aggregation for two species of mammals,
Romanian Journal of Biophysics, in print
130

STRUCTURAL MODIFICATIONS OF THE ORAL MUCOSA AND THE
DENTAL APPARATUS INDUCED BY
SOME DRUGS IN LABORATORY MICE
Abstract
OPREAN O.Z. 1 , GHEBAN DIANA 2 , FORNA NORINA CONSUELA 2 ,
ŞINDILAR E.V. 1 , GRĂMADĂ S. 1
1 Veterinary Medicine Faculty, Iaşi
2 Dental Medicine Faculty, Iaşi
e‐mail: ozoprean@uaiasi.ro
The authors aim to verify and study the information mentioned in speciality literature on induced side
effects, (in mammals) in the oral cavity, of 3 drugs: Phenytoin, Cyclosporin, Nifedipine.
The research was conducted on 36 white laboratory mice (subfamily Murinae) distributed in groups of
12 animals each for each product, and a control group of 5 animals, to which no action was taken.
The fundamental pathological process observed in histological examination, with no significant
differences in the groups, was fibrocellular hyperplasia.
No relevant tissue reaction differences were observed in animals injected with Azithromycin, well‐
known antitoxin for the three drugs tested.
Keywords: experiment, Phenytoin, Cyclosporin, Nifedipine, fibrocellular hyperplasia.
The research performed on experience animals suggest side effects of some drug
compounds, very often used in human pathology, consisting of important structural alterations of
the oral mucosa and of the dental apparatus. We intend to verify and deepen the information
available in the litterature concerining side effects induced to the oral cavity by the
overdose/prolonged utilisation of three chemical compounds: Phenytoin, Cyclosporin, Nifedipine
Phenytoin has as main therapeutic indications the treatment of major epileptic crises
(generalised lonicodonic crises) and of partial crises, especially jacksonian ones, but also in the
prophylaxy of epileptic crises secondary to neurosurgery. (1,5,9)
Cyclosporine (also known as Cyclosporine A) is a cyclic polypeptide, consisting of 11
aminoacids, well known as a strong immunosupressive agent, which in animals leads to a
prolongement of the survival of allogenic skin, heart, kidney, pancreas, bone marrow, intestin or
lung transplants, thus having therapeutical indications in transplant protection and in autoimmune
disease. (2,4,10)
Nifedipine is a slow calcium channels blocker; it has an inhibitor effect on calcium ions
flows, especially in myocardic cells and in the cells of the smooth muscle in the walls of coronary
artheries and peripheric blood vessels. It is recommended in the treatment of pectoral angina and
in the chronic treatment of the essential and secondary hypertension. (3,6,7,8)
Side effects of these three drugs, more serious in children, consist of dysfunctions of the
main internal organs, skin and blood.
1. MATERIAL AND METHOD
36 white laboratory mice were divided in groups of 12 (6+6) animals for each tested drug,
and marked cromatically according to Table 1.
131

Lucrări Științifice – vol 53 seria Medicină Veterinară
Table 1
Repartisation of experience animals in groups and experiment accomplishment
Group
Active substance
administered*
F1 F
F2 F + Azy
C1 C
C2 C + Azy
N1 N
N2 N + Azy
*F=Phenytoin; C = Cyclosporine A; N = Niphedipine; Azy = Azytromicine
For each of the drugs, we also formed one group in which the drug was administered in
association with Azytromicine, that has a well known role as a moderator (antitoxic) for the 3
tested drugs.
We also had a witness group, with 5 congenere animals that did not suffer any intervention.
Experimental animals were all 20 days old males weighing 30 g each, that had their
digestive flora supressed through two daily administrations per os of 0,1ml peniciline solution
40.000 UI/ml, preceeding the experiment.
The drugs were administered through gavage, Phenytoine and Niphedipine as aquous
solution 2mg/ml, Cyclosporine A solubilised in saline solution 2mg/ml.
Mice in Lot F1 were administered Phenytoine 20mg/kg/day, for 55 days, and Lot F2 were
added 10mg/kg/day Azytromicine.
Lot C1 received 10mg/kg/day Cyclosporine A, and Lot C2 10mg/kg/day Cyclosporine A and
10mg/kg/day Azytromicine.
Lot N1 was administered Niphedypine 150mg/kg/day, for 7 days and 250mg/kg/day, for 13
days.
Lot N2 received Niphedypine the same way as N1, associated to 10mg/kg/day Azytromicine.
�on o important �on otice that in Lot C1 one animal died, in apparent health, in day 10 of
the experiment.
All animals were euthanised at the end of the experiment, using T‐61 as euthanasia agent.
2. RESULTS AND DISCUSSIONS
Administration period Dose
(days) (mg/kg/day)
20
55
F 20
Azy 10
10
35
C 10
Azy 10
7 150
13 250
N 150
7
Azy 10
N 250
13
Azy 10
Interpretation of the different deviations from the morphological normal, induced by the 3
drugs previously described was done accordingl;y to the normal aspect of the oral mucosa noticed
in the mice in the witness group. Transverse sections through lateral walls of the oral cavity (cheek
area) seveals, on the internal side, the structure of the oral mucosa, covered with a keratinised
stratified pavimentous epithelium, resembling the one on the exterior side of the cheeks. The
anterior segment of the oral cavity is less developped and the muscular support of the area is
represented by isolated fascicles of scheletical muscle fibers. (Fig.1, Fig.2).
132

Universitatea de Științe Agricole și Medicină Veterinară Iași
The superficial epithelium of the oral mucosa on the internal side of the lips, cheeks and at
gingival level is a medium keratinised pavimentous epithelium, with a report cornous layer / Malpighi
layer of about 1/3 (Fig.3).
The profound area of the oral cavity, the submucosa is developped, consisting of fascicles of
non‐oriented colagen fibers (Fig.4).
Toward the pharyngian area, the musculosa is very well developped and reaches
sometimes the subepithelial space (Fig.5).
Lingual mucosa presents onits dorsal side several papiliform papillae, and the musculosa
obviously predominates in the structure of the tongue, being made of scheletic muscle fibers
(Fig.6, Fig.7, Fig.8).
The tooth is made of two macrostructural segments: the crown is the fragment projected in
the oral cavity and protected my an enamel layer; the root is the portion implanted in the dental
alveola and is protected by a cement layer.
2.1.Changes of the oral mucosa
In all 3 drugs studied we noticed reactive‐inflammatory hyperplasia, with subacute‐chronic
evolution.
Necropsic examination does not evidentiate relevant modifications, histopathological
examination evidentiate fibro‐cellular prolifferations in all structural segments of the oral mucosa.
Superficial epithelium suffers from a moderate hyperplasia of the Malpighi layer, the report
keratine/spinous layers becoming about 1/6 (Fig.9).
In some areas, the hyperplasia of the spinous layer is produced in a centripete direction, as
papillae that protrude in the lamina propria (Fig.10).
In some cases of mice injected with Cyclosporine and Niphedypine proliferation of the
submucosa and of the superficial epithelium is associated in the form of micropollipes that
proeminate on the surface of the oral mucosa (Fig.11).
One animal in Lot N1 has a hyperplasiated mucosa that sticks to the dental surface, as
papillae reaching the top of the dental crown (Fig.12, Fig.13).
The papillae of the mucosa are anchored to the surface through a wide base, on which the
report keratine/spinous layers is about 1/8 (Fig.14).
The oral submucosa is affected by the same fundamental pathological process. The
hyperplasia, initally vasculo‐conjunctive, becomes predominantly fibrous in time, towards the
pharyngian area of the oral cavity The local mesenchyme prolifferates as thick unoriented
colagenic fascicles (Fig.15, Fig.16).
In 2 cases we noticed tissular reactions with accute‐subacute evolution, due to local
irritations or oportunistic bacteria. In one case we described edematous peridontal infiltrations,
and subepithelial necrotic foci (Fig.17, Fig.18).
2.2. Alterations of the dental apparatus
Moderate hyperplastic tissular reactions also extend to the dental apparatus.
Dental alveolae show a fibrous hyperplasia finalised in a band of conjunctive tissue, dense
and well vascularised that separates the root from the bone support of the dental arcade (Fig.19).
The proximal segment of the root show areas of dentine vacuolisation, whereas in the distal
area of tooth anchoration shows a conjunctive hyperplasia and a disjunction of the root from the
bone structures (Fig.20, Fig.21).
Structural components of the tooth also show deviations from the morphological normal:
the dentine and the cement appear striated by void canalicles, while dental pulp is the place of a
lymphohistiocytic and later fibrous hyperplasia (Fig.22, Fig.23).
2.3. Alterations of the internal organs
One mouse of din Lot C1 died in apparent health in day 10 of the experiment. Histological
examination of tissular fragments prelevated from the main internal organs reveal changes dued
to acute‐subacute toxicosis.
133

Lucrări Științifice – vol 53 seria Medicină Veterinară
Low resolution microscopical examination of the lung evidentiates the ectasy and hematic
overload of small and medium blood vessels and tissular densifications lodged in interalveolar
interstitium (Fig.24).
Thickening of the interalveolar septum is accompanied by hyperplasia of the distal
airwaves, that present 3‐4 rows of cells (Fig.25).
The heart is the place of changes with two structural localisations: interstitial (vascular)
and parenchimatous.
Vascular, we notice periartheriolar edematous infiltrations that dissociate the blood vessels
from the cardiac muscle fibers and enter the vascular wall, dissectig the vascular adventice. The
leyocites in the parietal media are thick with inflated vacuolised nuclei; vascular endothelium
appears tumefected, and the nuclei of the endothelial cells are bigger and hyperchromatic,
proeminating in the vascular lumen (Fig.26).
The parenchyme is the place of intracellular deposits of calium ions, with typical aspects of
localised calcification: intracellular amorpheous surfaces, intensely haematoxylinic in HEA staining;
calcifications are focalised on oxyfile myocardic areas, specific to tissular devitalisation (Fig.27).
The liver is affected by circulatory disorders and dismethabolies pretty unspecific, but
which, in association, lead to a common toxic etiology: passive liver congestion and granulo‐lipidic
hepatosis.
Passive liver congestion is translated through the ectasy and overload of centrolobular venulae
and dilatation of sinusoidal capillaries through erythrocytes partially hemolised and conglomerates
(Fig.28).
Granulo‐lipidic hepatosis consists on one hand of the tumefaction of hepatocytes and the
trubled aspect of their cytoplasms, and on the other hand of the spongeous aspect and even the
apparition of well circumscribed intracitoplasmatic valuolae (Fig.29).
Cellular sufference is also suggested by the aspect of the nuclei of the hepatocytes:
raspberry aspect, corical hyperchromatosis, chromatine condensation in hyperchromatic blocks
(Fig.30, Fig.31).
The cortical of the kidneys show tumefaction and intumescence of the renoepitheliums that
leads to the anullation of the urinifer tubes, changes of granulas nephrosis; we also noticed the
hyperplasia of vascular areas of Malpighi corpuscles, that completely anullate glomerular cavities.
(Fig.32).
CHART I
Fig. 1. Transverse section in cheek area.
Mouse. HEA, x100
134
Fig. 2. Oral mucosa. Mouse. HEA, x400

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 3. Oral mucosa, Pavimentous
stratified keratinized epithelium. HEA, x400
Fig. 5. Oral cavity, pharingeal area.
Musculosa. HEA, x400
Fig. 7. Lingual mucosa, dorsal side.
Filiform papillae HEA, x400
CHART II
Fig. 9. Superficial epithelium.
Hyperplasia of the spinous layer. Ration
eratinised/spinous layers of 1/6. HEA, x400
135
Fig. 4. Oral cavity. Submucosa.
Musculosa. HEA, x400
Fig. 6. Lingual mucosa, ventral side.
HEA, x400
Fig. 8. Lingual musculosa. Rabdocytes.
HEA, x400
Fig. 10. Superficial epithelium. Centripete
papillar hyperplasia of the spinous layer.
HEA, x400

CHART III
Fig. 11. Hyperplasia of the submucosa
and of the spinous layer. HEA, x400
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 12. Periodontal hyperplasia of the
mucosa. Premolar. HEA, x40
Fig. 13. Periodontal pollipe. HEA, x100 Fig. 14. Base of the periodontal polipe.
Hyperplasia of the spinous layer. HEA, x400
Fig. 15. Colagenised vasculated
submucosa . HEA, x100
Fig. 16. Colagenised submucosa,
Pharyngeal area of the oral cavity. HEA, x400
136

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 17. Periodontal edematous
infiltrations. Col. HEA, x100
Fig. 19. Molar. Bifide root. Longitudinal
section. Colagenization of the dental alveola.
HEA, x100
Fig. 21. Molar. Bifide root, profound
area. Transverse section. Alveola decolation.
HEA, x100
Fig. 23. Premolar. Fibrous hyperplasia
of dental pulp. HEA, x400
137
Fig. 18. Subepithelial necrosis.
HEA, x400
Fig. 20. Molar. Bifide root. Transverse
section. Dentine vacuolisation. HEA, x100
Fig. 22. Premolar. Dental crown, Cement
canalisation. HEA, x400
Fig. 24. Lung. Tissular condensation with
septal hyperplasia HEA, x100

CHART IV
Fig. 25. Lung. Hyperplasia of bronchiolar
epithelium. HEA, x400
Fig. 27. Heart. Dystriphic calcification
area.
HEA, x400
Fig. 29. Liver. Granulo‐lipidic dystrophy.
HEA, x100
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 26. Heart. Artheriole. Leyocite
tumefaction and of the vascular endothelium.
HEA, x1000
138
Fig. 28. Liver. Passive congestion. HEA,
x100
Fig. 30. Liver. Hyperchromatic nuclei.
HEA, x1000

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 31. Liver. Nuclear hyperchromatosis.
Spongious cytoplasm. HEA, x1000
Fig. 32. Kidney. Hyperplasia of renal
glomerules. HEA, x400
3. CONCLUSIONS
The testing of secondary effects with oral localisation of the three drugs: Phenytoin,
Cyclosporin, Nifedipine , on white lab mice revealed the following conclusions:
1.Necropsic examination did not reveal macroscopical lesions.
2.The fundamental pathological process noticed histologically was the fibrocellular
hyperplasia, for all groups and at all levels of the oral cavity.
3. The access of the pathogen factor on the circulatory way leads to the hyperplasia of
profound and median structures of the oral mucosa, while the superficial keratinized layer stays
the same. The spinous layer of the epithelium thickens up to a ratio of 1/6. Lamina propria and the
submucosa are the place of a predominantly fibrous hyperplasia, finalised by the thickening of
affected areas and replacement of glandular tsructures through dense and well irrigated
connective tissue. Mucosal hyperplasia may lead to formation of pollipes adherrent to the lateral
surfaces of the tooth.
4.The dental apparatus is moderately affected by the same predominantly prolifferative
phenomena. The dental alveola is colagenised, leading, in profound areas of the dental root, to its
disjunction from the bone support of the region. The dentine and the cement are marked of fine
canallicles, while dental pulp suffers a hyperplasia (predominantly cellular, then fibrous).
5.We did not notice any relevant differences in the animals injected with Azytromicine.
6.In one case that was administered CyclosporinaneA (no Azytromicine) and died in
apparent halh in day 10 of the experiment, we noticed changes due to an acute‐subacute toxicosis,
and local circulatory disorders due to myocardic calcification.
7. In 2 of the cases we described edematous periodontal infiltrations and subepithelial
necrotic foci, due to local irritations or opportunistic bacteria.
BIBLIOGRAPHY
1. Balaji S (October 2004). "Medical therapy for sudden death". Pediatr. Clin. North Am. 51
(5): 1379–87;
2. Borel JF (2002). "History of the discovery of cyclosporin and of its early pharmacological
development". Wien. Klin. Wochenschr. 114 (12): 433–7. PMID 12422576;Cohn, J.N.,
Ziesche, S.M., Loss, L.E., Anderson, G.F., si V‐HeFT Study Group, Effect of felodipine on
short‐term exercise and neurohormone and long‐term mortality in heart failure: results
of V‐HeFT III (rezumat), Circulation, 1995, 92(supl.I), I143;
4. Dewick, P. (2001) Medicinal Natural Products. John Wiley & Sons, Ltd. 2nd ed.;
139

Lucrări Științifice – vol 53 seria Medicină Veterinară
5. Dreyfus, Jack (1998). A Remarkable Medicine Has Been Overlooked: Including an
Autobiography and the Clinical Section of the Broad Range of Use of Phenytoin.
Continuum International Publishing Group. ISBN 0‐8264‐1069‐3;
6. Furberg, C.D., Psaty, B.M., Mejer, J.V., Nifedipine. Dose‐related increase in mortality in
patients with coronary heart disease, Circulation, 1995, 92, 1326‐1331;
7. Lewis, B.S., Emmott, S.N., Smyllie, J., MacNeil, A.B., Lubsen, J., Left ventricular systolic
and dyastolic function, and exercise capacity six to eight weeks after acute myocardial
infarction, Am J Cardiol, 1993, 72, 149‐153;
8. Maisch, B., Brilla, C., si Kruse, T., Directions in antihypertensive treatment ‐ our future
from the past, Eur Heart J, 1995, 16(supl.C), 74‐83;
9. Man CB, Kwan P, Baum L, et al. (May 2007). "Association between HLA‐B*1502 allele
and antiepileptic drug‐induced cutaneous reactions in Han Chinese". Epilepsia 48 (5):
1015–8.;
10. Starzl TE, Klintmalm GB, Porter KA, Iwatsuki S, Schröter GP (1981). "Liver transplantation
with use of cyclosporin a and prednisone". N. Engl. J. Med. 305 (5): 266–9. PMID
7017414.
140

ISOLATION, CHARACTERIZATION, PHENOTYPIZATION AND
DIFFERENTIATION OF STEM CELLS FROM RAT PLACENTA
Emoke Pall 1 , Groza I. 1 , Cenariu M. 1 , Cristina Ilea 1 ,
Olga Soritau 2 , Ciprian T 2 ., Berce C 1 .
1.University of Agricultural Science and Veterinary
Medicine, Cluj‐Napoca, 3‐5 Calea Mănăştur, Cluj‐Napoca,
pallemoke@gmail.com
2.Oncology Institute Prof.Dr.Ioan Chiricuta, Cluj‐Napoca
Abstract: Mesenchymal stem cells have been successfully isolated from human, cat, dog, rabbit,
rat, chicken, sheep, goat and pig bone marrows thanks to their plastic adherence property. In
recent years, stem cell biology has sparked considerable interest worldwide in the scientific
world, and recent developments in stem cell research have opened new perspectives by using
them in regenerative therapy. In this study we successfully isolated, cultured and expanded rat
placenta‐derived mesenchymal stem cells using routine methods. After the initial 3 days of
primary culture, rat placental mesenchymal stem cells adhered to a plastic surface and presented
a small population of single cells with spindle shape. To investigate the mesenchymal mature we
differentiated the cells into the osteoblastic lineage and also the expression of certain surface
marker.
KEYWORDS: placenta, mesenchymal stem cells, culture expansion, differentiation
Stem cell research has become an important field of study for molecular, cellular, and
clinical biology as well as pharmaco‐toxicology. Indeed, stem cells have a strong proliferative
and unlimited self‐renewal potential and are multipotent (1,4,6,7)
The mesenchymal stem cells (MSC) are multipotent cells present in the bone marrow and
other tissue (3). The plasticity of these cells allows them to be used in cell therapy once they
have the potencial to replicate as undifferentiated cells and could be induced to differentiate
to mesenchymal lineages (bone, fat, cartilage, tendon, muscle, marrow stroma etc.) as
endodermal and ectodermal lineages, replacing tissues and organs whose function had been
harmed. All the species could be benefied using the cell therapy (2,5).
Rat mesenchymal stem cells from placenta offer significant promise as a multipotent source
for cell‐based therapies and could form the basis for the differentiation and cultivation of
tissue grafts to replace damaged tissue. Placental derived MSC therefore represent an
alternative and more easily obtainable and abundant source of MSC than bone marrow.
The aim of this study was to isolate and evaluate the differential potential of
mesenchymal stem cells from rats placentas. Our data demonstrate that we successfully
isolated, culture‐expanded mesenchymal stem cells from rat placentas.
MATERIALS AND METHODS
Biological material placentas were obtained after caesarean section from normal term
pregnancies (19‐21D) Pieces of placenta were excised and washed in PBS to remove excess
blood. Tissue was then incubated in trypsin EDTA. After enzymatic digestion, a cell strainer
was used to obtain a single cell suspension. The resulting cells were washed and centrifuged on
141

Lucrări Științifice – vol 53 seria Medicină Veterinară
PBS. Cells were then cultured in DMEM with 10% FCS, 1% antibiotics, 1%NEA (non essential
amino acid) After 48 hours, non‐adherent cells were removed and the remaining cells cultured
until almost confluent before passage. Media was changed every 3–4 days. After two or more
passages, the cells were analysed.
Osteogenic differentiation was induced by two different culture medium: basal
medium composed of DMEM (Gibco) supplimented with 10% FCS, 10 ‐7 dexamethasone, 10mM
β‐glicerophosphate, 1μg/ml insulin, 50μg/ml ascorbic acid, 10ng/ml BMP2, 2ng/ml TGFβ and
specific medium for osteoblasts PromoCell Osteoblast Growth Medium.
To identify differentiated cells was performed immunohistochemical analysis of cell
cultures at the end of the experiment. According to the immunohistochemical protocol, initial
patency was achieved by treating cells for their intracellular antigens with a solution 0.1%
TRITON X‐100 for 5 minutes and added lock patency 10% BSA solution. After 24 hours of
keeping in contact, at 4°C were performed three successive washes with PBS solution and
added primary antibodies: anti‐osteopontin (IgM) anti‐osteonectin (IgG2a).
RESULTS AND DISCUSSION
The cultures were observed daily by phase contrast invert microscopy to examine
adheretnt cell morphology. In the early days, individual adherent cells appeared in about 60%
of the wells, 40% of the wells having no adherent cells. After examining cultures have
identified two different types of cells, some were fibroblastic‐like and the others were round
with dark centers and transparent peripheries. After 4 days some fibroblastic cells
proliferated, giving rise to colonies of fibroblastic cells. At the end of day 8, generally 10‐12
fibroblastic colonies appeared. By the end of week 2 the number of floating cells increased
within the culture medium (Fig.1). Passages was made at a 80% confluence to avoid contact
inhibition. After each passages part of the cell suspension were frozen for future examination
so as to investigate multilineage differentiation, proliferation potential and the presence of
certain surface markers.
Figure 1 ‐ Microscopic analysis of cellular morphology 20x
142

Universitatea de Științe Agricole și Medicină Veterinară Iași
In osteoinductive cultures, a few cells became detached and floated in the medium
during the culture period (Fig.2).
Figure 2 ‐ Cellular morphology after osteogenic induction and distinct cellular
colonies with osteogenic nodules
In some areas of the culture dish, nodule‐like structures of different sizes were
observed. In cultures treated with basal medium after 8 days were observed emergence of
cells with morphology similar to that of adipocytes namely cell cytoplasm filled with lipid
droplets (Fig.3).
Figure 3 ‐ Apparition of adipocytes in culture 40x
Differentiation was further demonstrated by immunohistochemical staining for
osteopontine and osteocalcin. After 21 days induction period, the level of osteocalcin and
osteopontine slightly increased (Fig.4). This marker did not express in the undifferentiated
mesenchymal stem cells, but has been produced in the cells after the third week of induction.
143

Lucrări Științifice – vol 53 seria Medicină Veterinară
Figure 4 ‐ Immunohistochemical assay of osteopontin and
osteocalcin in cultures differentiated on osteogenic line 20x
After several passages the cells did not lose multipotential differentiation potential,
fibroblastic morphology was maintained during the subculture period.
CONCLUSIONS
In the present investigation, pure fibroblastic cells with multilineage differentiation
capability were isolated from rat placenta. The isolation on placental cells is far more difficult
than of other species due to the unwanted growth of non‐mesenchymal cells in both primary
and passaged cultures. Certain features of the cells having been isolated via our approach
convinced us that they were mesenchymal stem cells. The most important properties of these
cells were their multilineage mesenchymal differentiation in culture medium and their ability
to maintain this potential un to passage 8.
BIBLIOGRAPHY
1. Mark F. P., Alastair M. M., Stephen C. B., Rama K. Jaiswal, Robin D., Joseph D. M., Mark A. M., Donald
W. S., Stewart C., Daniel R. M., 1999, Multilineage Potential of Adult Human Mesenchymal Stem
Cells, Science,Vol. 284. no. 5411, pp. 143 – 147;
2. Mauro K., Massimo F., Giovanni P., Giuseppe A., 2007, Mesenchymal stem cells: from biology to
clinical use, Blood Transfus, 5(3): 120–129.
3. Ppokratis Pountos, Peter V.Giannoudis, Biology of mesenchymal stem cells, Injury,Int.J.CareInjured
(2005) 36S,S8—S12
4. Sarah Snykers, Tamara Vanhaecke, Vera Rogiers, 2006, Isolation of Rat Bone Marrow Stem Cells,
Cytochrome P450 Protocols, Second Edition, Methods in Molecular Biology
5. Shengkun Sun, Zikuan G, Xuren X., Bing L., Xioaodan L., Pei‐Hsien Tang, Ning Mao, 2003, Isolation of
mouse marrow mesenchymal progenitor by a novel and reliable method, Stem Cells, 21:527‐535
6. Yumi F., Hideaki N., Daisuke S., Imiko Hirose, Toshio K., Kohichiro T., 2004, Human Placenta‐Derived
Cells Have Mesenchymal Stem/Progenitor Cell Potential, Volume 22 Issue 5, Pages 649 – 658;
7. Zongning M., Jun J., Lei C., Jianzhong Z., Wei H., Jidong Z., Hanguang Q., Xueguang Z., 2006,
Isolation of mesenchymal stem cells from human placenta : Comparison with human bone marrow
mesenchymal stem cells ‐ Cell biology international, vol. 30, n o 9, pp. 681‐687;
144

LUTEIN PREVENTS HIGH GLUCOSE INDUCED OXIDATIVE
STRESS IN HUMAN RPE CELLS
Dumitrița RUGINA, Adela PINTEA, Andrea BUNEA, Raluca POP, Sanda ANDREI
University of Agricultural Sciences and Veterinary Medicine Cluj‐Napoca, Department of
Chemistry and Biochemistry, Mănăstur 3‐5 Cluj‐Napoca, 400372, Romania
E‐mail: apintea@usamvcluj.ro
Abstract
Human retina accumulates two dietary carotenoids: lutein and zeaxanthin. The
carotenoid pigments in retina act as screening pigments, by absorbing the damaging blue light,
but it is supposed that they can also contribute to the antioxidant defence of retinal structures.
Lutein was identified in several anatomic structures of the retina, including the retinal
pigmented epithelium (RPE). The aim of this study was to investigate the effect of lutein on the
oxidative status of RPE cultured cells in oxidative stress conditions induced by high glucose
concentration in culture medium.
D407 RPE cells were cultivated in DMEM medium with 10 % FCS. The cells viability was
estimated by the MTT assay and the cytotoxicity by LDH leakage assay. The generation of
intracellular reactive oxygen species (ROS) was determined by using a fluorescent probe – DCF‐
DA, TBAR’s by a fluorimetric method and reduced glutathione by an enzymatic assay.
Antioxidant enzymes: glutathione peroxidase (GPx). Superoxide dismutase (SOD) and catalase
activities were determined using commercial kits
High glucose concentration induced modification of oxidative stress markers: changes
in antioxidant enzymes activity, increased lipid peroxidation and intracellular ROS generation.
Lutein did not show any cytotoxic effect on RPE cells up to 10 μM in culture medium and
protect them against induced oxidation. Lutein protects RPE cells by quenching the intracellular
ROS generation, by reducing the lipid peroxidation and by enhancing the activity of superoxide
dismutase and glutathione peroxidase. Addition of lutein did not significantly influenced
reduced glutathione concentration and catalase activity. Increased concentration of lutein in
RPE cells can contribute to antioxidant defence in oxidative stress conditions.
Keywords: Lutein, RPE cells, high glucose, oxidative stress
INTRODUCTION
The Retinal Pigment Epithelium (RPE) is a monolayer of cells representing the barrier
between the photoreceptors and the choriocapillaris. It provides oxygen and nutrients to the
photoreceptors but also remove their debris and metabolites. The loss of RPE cells is related to
several eye diseases, including age related macular degeneration (AMD). Retina and retinal
pigment epithelium (RPE) represent an ideal environment for the generation of reactive
oxygen species (ROS) and oxidative damages. There are three main sources of ROS generation
in the RPE: high metabolic rate and oxygen consumption, high level of irradiation,
phagocytosis of photoreceptors outer segments and the presence of photosensitizers
(lipofuscin) (Miceli et al., 1994; Beatty et al., 2000; Winkler et al., 1999; Lu et al., 2006; Qin et
al., 2007). The vision loss in AMD results from photoreceptor damages in the central retina,
145

Lucrări Științifice – vol 53 seria Medicină Veterinară
and it is accepted that degeneration of RPE is involved in first stages of AMD (Qin, 2007). It
was demonstrated that oxidative stress plays an important role in the pathology of AMD
(Kopitz et al., 2004; Qin, 2007; Coleman et al., 2008). Hyperglycemia which occurs in diabetes
reduces the level of antioxidants and determines an increase of reactive oxygen species which,
in turn produce oxidative damages in different tissues, including retina. RPE cells respond to
acute high glucose level in culture medium by modification of antioxidant and proteolitic
enzymes activity. Cultured RPE cells exposed to high glucose concentration showed elevated
level of glutathione peroxidase, cathepsin B and heat shock protein 27, while the activity of
Cu/Zn SOD was decreased compared to control (Yokoyama et al., 2006). High glucose
concentration also determined a reduction of permeability in RPE cultured cells (Villarroel et
al., 2009). Lutein and zeaxanthin are the only dietary carotenoids accumulating in the
anatomic structures of human retina, including the retinal pigmented epithelium (RPE)
(Khachik et al.,1997; Snodderly et al., 1984a). Xanthophylls act primarily as screening pigments
in the retina by absorbing the damaging blue light but they can also contribute to the
antioxidant defence of retinal structures (Beatty et al., 2000; Wrona et al., 2004; Krinsky and
Johnson, 2005). Serum carotenoids, including xanthophylls lutein and zeaxanthin, are inversely
associated with type II diabetes and impaired glucose metabolism (Coyne et al., 2005). In this
context it is important to know how retinal cells respond to acute exposure to high
concentrations of glucose, with or without addition of antioxidants.
The aim of this study was to investigate the effect of lutein on the oxidative status of
RPE cultured cells in oxidative stress induced by high glucose concentration in culture medium.
MATERIAL AND METHODS
Cell culture and treatment. Human adult retinal pigment epithelial cells line D407 were
maintained in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine
serum, 1 mM sodium pyruvate, 100 U/ml penicillin, 100 μg/ml streptomycin, and 2.5 μg/ml
amphotericin B, at 37◦C, 5% CO2, and 95% relative humidity. The cells were seeded in 25 cm 3
flask at a concentration of 6 x 10 5 . After reaching 90% confluence, growth medium was
removed and replaced with medium containing 10 μM xanthophylls during 24 hours.
Exposure of cells to high glucose concentration. During the first experiment cells were
cultivated in increasing concentration of glucose in medium: 25 mM (control cells), 40 mM, 50
mM, 70 mM and 100 mM. After 24 h treatment with carotenoids, the culture medium was
removed, the cells were washed and with PBS and specifically lysed for each enzyme
determination.
Viability assay. MTT assay was used to asses the cell viability (Mossman, 1983). This method
uses the property of viable cells to reduce MTT reagent into a coloured formazan which is
detected by reading the absorbance at 550 nm. Cell viability was expressed as a percentage of
control (cells incubated in normal medium only).
Antioxidant enzymes activity. Glutathione peroxidase (GPx), superoxide dismutase (SOD) and
catalase (Cat) activities were determined using commercial kits provided by Cayman Chemical
Company, Michigan, USA. The enzymes activity was expressed as IU/mg protein and the
protein were determined with bicinchoninic acid assay (Sigma, St. Louis, USA).
Glutathione assay. The GSH assay was performed using an optimized enzymatic recycling
method with glutathione reductase (Cayman Chemical Company, Michigan, USA). Standard
curve was made with GSSG standard, having the equivalent GSH concentration between 0‐16
μM. Results are expressed as μmoles GSH/mg protein in cell pellet.
Intracellular reactive species assay. The determination of intracellular reactive oxygen species
146

Universitatea de Științe Agricole și Medicină Veterinară Iași
(ROS) is based on the oxidation of 2’,7’‐dichlorodihydrofluorescein (DCHF) by intracellular
peroxides, forming the fluorescent compound 2’,7’‐dichlorofluorescein (DCF) (Lebel et al.,
1992).
TBAR’S concentration was determined after the reaction with thiobarbituric acid by using a
calibration curve and a fluorimetric method. A micro plate reader HT BioTek Synergy (BioTek
Instruments, USA) was used for all photometric and fluorimetric assays.
Statistical analysis was done using One‐way analysis of variance ANOVA, Dunnett's Multiple
Comparison Test of Graph Pad Prism version 5.00. Significant differences are designated by
p

Lucrări Științifice – vol 53 seria Medicină Veterinară
LDH citotoxicity (% form control)
150
100
50
0
Control
ns ns
LUT
Fig. 2. Lactate dehidrogenase leakage in D407 cells culture medium.
Control; Control g – 50 μM glucose; LUT – Lutein 10 μM; LUT g – Lutein 10 μm + 50μM glucose
Activity GPx nmol/min/mg protein
50
40
30
20
10
0
Control
***
LUT
Control-g
**
LUT g
CAT nmoli/min/mg protein
(a) (b)
Fig. 3. Glutathione peroxidase (a) and catalase activity (b) in D407cells.
Control; Control g – 50 μM glucose; LUT – Lutein 10 μM; LUT g – Lutein 10 μm + 50μM glucose
Statistic: one‐way ANOVA analysis of variance, Tukey test, p

Universitatea de Științe Agricole și Medicină Veterinară Iași
In a previous study we demonstrated that cultured RPE cells are able to uptake lutein
and zeaxanthin in the range of 1‐10 μM (Pintea et al., 2007). Lutein at 10 μM concentration
did not affect the RPE cells viability in control or high glucose treated cells (data not shown)
and did not show any cytotoxic effect in both experimental conditions (Fig. 2). Cells treatment
with 50 mM glucose induced a small but not significant increase of GPx activity but a small
decrease of catalase activity. Treatment with lutein for 24 h resulted in a very significant
increase of GPx activity in both control and high glucose condition. Catalase activity was not
significantly changed by addition of glucose or glucose and lutein (Fig. 3). It is known that
catalase acts at high concentration of hydrogen peroxide while glutathione peroxidase acts at
lower level of peroxides. High glucose concentration induced a small but not statistically
significant decrease of SOD activity. The positive influence of lutein on SOD activity was more
evident in control cells that in high glucose treated cells (Fig. 4a). Lutein in culture medium
determined an inhibition of fluorescence in ROS assay, significant in the case of high glucose
treated cells, demonstrating the ability of carotenoids to neutralize the intracellular reactive
oxygen species (Fig. 4b). These results are correlated with a decrease of MDA concentration in
cells treated with lutein at high glucose concentration (Table 1). Reduced glutathione
concentration was lower in high glucose treated cells that in control cells but there were not
significant changes after addition of lutein, both in normal and high glucose samples (Table 4).
Similar results were obtained were xanthophylls (lutein, zeaxanthin and β‐cryptoxanthin) were
tested in oxidative stress induced by addition of hydrogen peroxide in culture medium (Pintea
et al, unpublished data).
SOD U/ mg protein
20
15
10
5
0
Control
*
LUT
Control g
ns
LUTg
DCF fluorescence
1400
1200
1000
800
600
400
200
0
Control
ns
LUT
Control-g
(a) (b)
Fig. 4. Superoxide dismutase activity (a) and ROS generation in D407 cells.
Control; Control g – 50 μM glucose; LUT – Lutein 10 μM; LUT g – Lutein 10 μm + 50μM glucose;
Statistic: one‐way ANOVA analysis of variance, Tukey test, p

Lucrări Științifice – vol 53 seria Medicină Veterinară
Diabetes is a chronic metabolic disorder manifested by a complex symptomatology.
Oxidative damages have been reported to be involved in the pathogenesis of diabetes and of
other neurodegenerative diseases. Hyperglycemia which occurs in diabetes reduces the level
of antioxidants and determines an increase of reactive oxygen species which, in turn produce
oxidative damages in different tissues, including retina. One of the complications of diabetes is
diabetic retinopathy, caused by inefficient control of blood glucose levels. Manifestations of
diabetic retinopathy occur when the retina is exposed to prolonged high glucose level.
Diabetic retinopathy affects virtually all subjects who suffer from type I diabetes by at least 20
years and 80% of those with type II diabetes for the same period. Most of the effects of high
glucose concentration are actually related to increased metabolism. Thus, there is an increase
in glycolysis, in pyruvate production, and in oxidative phosphorylation. Oxidative
phosphorylation is one of the physiological processes that generate reactive oxygen species.
Furthermore, reactive oxygen species are also produced outside mitochondria, in part by
sorbitol oxidation. It is also considered that oxidative degradation of proteins contributes to
damage of blood vessels, involved in the pathogenesis of diabetic microangiopathy (Yokoyama
et al., 2006). Several in vivo studies showed that progression of diabetic retinopathy is
inhibited by the use of antioxidants, by lowering the level of lipid peroxidation, of oxidatively
modified DNA, nitrotyrosine and other markers of oxidative stress (Martin‐Gallan, P., et al.,
2005, Kowluru, RE et al., 2008). However, zeaxanthin did not prevent the decrease in GSH
content in the retina of diabetic rats (Kowluru et al., 2008). Lutein treatment of healthy and
diabetic mice prevented the oxidative stress induced changes on the lipid peroxidation and
GPx activity in retina and hippocampus (Muriach et al., 2006). Lutein was recently reported to
prevent cortex lipid peroxidation in streptozotocin‐induced diabetic rats (Arnal et al., 2010).
Administration of high concentrations of glucose in the culture medium of RPE cells (33mm)
led to an increase of cathepsin‐B expression, glutathione peroxidase and heat shock protein
27. For Cu/ZnSOD the isoelectric point shifted toward acidic region in response to high glucose
concentration. Unlike for other enzymes, SOD activity was lower compared with control cells.
The authors concluded that RPE cells respond to acute pathologically high glucose by elevated
expression of antioxidant enzymes (GPX, Hsp27) and proteolytic enzymes (Yokoyama et al.,
2006). Cells respond differently to elevated glucose concentrations. Cultured human Schwann
cells exposed to high glucose showed an increase in superoxide dismutase and catalase
activity, but a decrease in reduced glutathione concentration (Askwith et al., 2009).
CONCLUSIONS
We examined the effect of high doses of glucose on the viability and oxidative status
of cultured retinal pigment epithelial cells and the effect of lutein addition on the antioxidant
status of cells cultivated in normal and high glucose medium.
Lutein did not show any cytotoxic effect on RPE cells up to 10 μM in culture medium
and protect them against induced oxidation. Lutein protects RPE cells by quenching the
intracellular ROS generation, by reducing the lipid peroxidation and by enhancing the activity
of superoxide dismutase and glutathione peroxidase. Addition of lutein did not significantly
influenced reduced glutathione concentration and catalase activity. Increased concentration of
lutein in RPE cells can contribute to antioxidant defence in oxidative stress conditions.
Acknowledgements
This work was supported by CNCSIS–UEFISCSU, PNII – IDEI code ID_854, 414/2007. We
gratefully acknowledge to Prof. Dr. Horst A. Diehl for providing the D407 RPE cells.
150

REFERENCES
Universitatea de Științe Agricole și Medicină Veterinară Iași
1. Arnal, E., Miranda, M., Barcia, J., Bosch‐Morell, F., Romero, F.J., Lutein and
docosahexaenoic acid prevent cortex lipid peroxidation in streptozotocin‐induced
diabetic rat cerebral cortex, Neuroscience, 2010, 166, 271‐278
2. Asckwith, T., Zeng, W., Eggo, MC, Stevens, MJ, Oxidative stress and dysregulation of
the taurine transporter in high‐glucose‐exposed human Schwann cells: implications
for pathogenesis of diabetic neuropathy, Am J Physiol Endocrinol Metab, 2009,
297(3), 620‐628
3. Beatty S., Koh H.H., Phil M., Henson D., Boulton M., The role of oxidative stress in
the pathogenesis of age‐related macular degeneration, Survey of Ophtalmology,
2000, 45, 115‐134
4. Coleman, H. R., Chan, C. C., Ferris, F. L., 3rd and Chew, E. Y., Age‐related macular
degeneration, 2008, Lancet, 372(9652): 1835‐1845
5. Khachik F., Bernstein P.S., Garland D.L., Identification of lutein and zeaxanthin
oxidation products in human and monkey retinas, Invest Ophthalmol Vis Sci., 1997,
38(9),1802‐1811.
6. Kopitz, J., Holz, F.G., Kaemmerer, E., Schutt, F., Lipids and lipid peroxidation products
in the pathogenesis of age‐related macular degeneration, Biochimie, 2004, 86, 825‐
831
7. Kowluru, R.A., Menon, B., Gierhart, D.L., Beneficial Effect of Zeaxanthin on Retinal
Metabolic Abnormalities in Diabetic Rats, Invest Ophthalmol Vis Sci., 2008, 49, 1645‐
1651
8. Krinsky, N.I., Johnson, E.J., Carotenoid actions and their relation to health and
disease, Molec. Asp. Medicine, 2005, 26, 459‐516
9. LeBel C.P., Ischiropoulos, H., Bondy, S.C., Evaluation of the probe 2',7'‐dichloro‐
fluorescin as an indicator of reactive oxygen species formation and oxidative stress,
Chem Res Toxicol, 1992, 5 (2), 227‐231
10. Lu L., Hacket S.F., Mincey, A., Lai H., Capochiaro P.A., Effects of different types of
oxidative stress in RPE cells, J. Cell Physiol., 2006, 206 (1), 119‐125
11. Martın‐Gallan, P., Carrascosa, A., Gussinye, M., Domınguez, C., Estimation of
lipoperoxidative damage and antioxidant status in diabetic children: relationship with
individual antioxidants, 2005, Free Radic. Res., 39, 933‐942
12. Miceli M.V., Liles M.R., Newsome, D.A., Evaluation of oxidative processes in human
pigment epithelial cells associated with retinal outer segment phagocytosis, Exp Cell
Res, 1994, 214 (1): 242‐249
13. Mosmann T., Rapid colorimetric assay for cellular growth and survival: application to
proliferation and cytotoxicity assays, J Immunol Methods, 1983, 65 (1‐2), 55‐63
14. Muriach, M., Bosch‐Morell, F., Alexander, G., Blomhoff, G., Barcia, J., Arnal, E.,
Almansa, I., Romero, F.J., Miranda, M., Lutein effect on retina and hippocampus of
diabetic mice, Free Radical Biology & Medicine, 2006, 41, 979‐984
15. Pintea Adela, Dumitrița Preda, Cornelia Braicu, Andrea Bunea, Carmen Socaciu, H.A.
Diehl, Lutein and Zeaxanthin uptake in cultured retinal pigmented epithelial cells,
Bulletin USAMV Cluj Napoca series MV, 2007, 64(1‐2), 238‐243
16. Qin, S., Oxidative damage of retinal pigment epithelial cells and age‐related macular
degeneration, Drug Dev Res, 2007, 68, 213‐225
17. Snodderly D.M., Brown P.K., Delori F.C., Auran J.D., The macular pigment. I.
Absorbance spectra, localization and discrimination from other yellow pigments in
151

Lucrări Științifice – vol 53 seria Medicină Veterinară
primate retinas. Invest. Ophtalmol. Vis. Sci., 1984a, 25, 660‐673
18. Villarroel, M., Garcia‐Ramirez, M., Corraliza, L., Hernandez, C., Simo, R., Effects of high
glucose concentration on the barrier function and the expression of tight junction
proteins in human retinal pigment epithelial cells, Exp. Eye Res., 2009, 89, 913‐920
19. Winkler, B.S., Boulton, M.E., Gottsch, J.D., Sternberg, P., Oxidative damage and age‐
related macular degeneration, Mol Vis, 1999, 5: 32
20. Wrona, M., Rozanowska, M., Sarna, T., Zeaxanthin in combination with ascorbic acid
or alpha‐tocopherol protects ARPE‐19 cells against photosensitized peroxidation of
lipids, Free Radic. Biol. Med., 2004, 36, 1094‐1101
21. Yokoyama, T., Yamane, K., Minamoto, A., Tsukamoto, H., Yamashita, H., Izumi, S.,
Hoppe, G., Sears, J.E., Mishima, H.K., High glucose concentration induces elevated
expression of anti‐oxidant and proteolytic enzymes in cultured human retinal pigment
epithelial cells, Exp. Eye Res., 2006, 83, 602‐609
152

ALUMINIUM SULPHATE IMPACT ON FUNDAMENTAL
BIOMARKERS OF REPRODUCTIVE FUNCTIONALITY IN FEMALE
RATS (SUCKLING PERIOD EXPOSURE)
TRIF ALEXANDRA 1 , DUMITRESCU EUGENIA 1 , PETROVICI SNEJANA 1
Corresponding author: Alexandra Trif, Banat’s University of Agricultural Sciences and
Veterinary Medicine, Faculty of Veterinary Medicine, Calea Aradului, 119, 300645 Timisoara,
Romania, tel.0040256277076,
e‐mai:al_trif@yahoo.coml
Recent researches are emphasizing more and more obvious the perturbance of the
health of the reproductive process, the causes including substances with toxic
potential (industrial contaminants, pesticides, organic solvents, etc.) (3).
The studies in the field of reproductive toxicology are of opportunity because in
Romania there is primary and secondary aluminium industry, that represents a real
risk for the environment, animals and humans health (2).
The aim of the study was the evaluation of aluminium toxic impact on the femele
reproductive system integrity, functionality and performances biomarkers.
The objectives of the study were evaluation of the reproductive functionality
fundamental biomarkers (duration of sexual cycle and sexual cycle regularity) at
sexual maturity of female offspring exposed to aluminium sulphate only during
suckling period.
Key words: aluminium rats, sexual cycles.
MATERIAL AND METHODS
The study was carried out on 32 adult female rats (90 days) exposed to aluminium
sulphate during suckling period as follows: E1: 200 ppb Al (the exceptional admitted limit in
drinking water according to the Law 485/2002); E2: 400 ppb Al; E3: 1000 ppb Al (values
representing concentrations found out in water sources destinated for animals and,
sometimes, for people, in areas exposed to the risk of aluminium based industrial
contamination).
The exposure to aluminium sulphate was stopped from weaning until sexual
maturity. Control group received tap water.
The forages and water have been assured ad libitum.
Duration of sexual cycle and of sexual cycle stages regularity were appreciated by
examination of vaginal smear cytological characteristics (stained May‐Grunnwald‐Giemsa
method, examinated by optic microscope. X 20).
The results had been processed by ANOVA method and Student test.
All assays with animals were conduced in accordance with present laws regarding
animal welfare and ethics in animal experiments (5, 6, 7, 8, 9, 10).
153

Lucrări Științifice – vol 53 seria Medicină Veterinară
RESULTS AND DISSCUSIONS
The results are presented in table 1, 2, and figures 1, 2.
Mean sexual cycle duration (days)
Grou
p
X±Sx D.S. C.L. 95%
C 4.89±0.09 0.23 0.21
E1 5.61±0.12 0.32 0.21
E2 5.96±0.08 0.22 0.21
E3 6.14±0.12 0.31 0.21
Fig.1. Dynamics of sexual cycle duration (days)
Table 1.
In C group, sexual cycle was in physiological limits – 4‐5 days (4), but in exposed
groups, the duration was significantly (p

Universitatea de Științe Agricole și Medicină Veterinară Iași
in direct correlation with the exposure level E2/E1: +79.53%, p

Lucrări Științifice – vol 53 seria Medicină Veterinară
N – physiological (as duration) stage
A‐ absent stage
Table 2. Sexual cycle stages (% of total sexual cycles)
Sexual cycle stage
C E1 E2 E3 Proestrus N X ± Sx 98± 0.44 96.14±0.51 92.86±0.63 92.00±0.44
S. D. 1.15 1.35 1.68 1.63
C.L: 0.76 0.76 0.76 0.76
A X ± Sx 0.00± 0.00 0.00±0.00 0.00±0.00 0.00±0.00
S. D. 0.00 0.00 0.00 0.00
C.L: 0.76 0.76 0.76 0.76
P X ± Sx 2.00± 0.44 3.86±0.01 7.14±0.26 8.00±0.49
S. D. 1.15 0.01 0.69 1.29
C.L: 0.76 0.76 0.76 0.76
Estrus N X ± Sx 100± 0.00 94.43±1.57 90.00±0.79 88.57±0.87
S. D. 0.00 4.16 2.08 2.30
C.L: 1.18 1.18 1.18 1.18
A X ± Sx 0.00± 0.00 5.57±0.13 10.00±0.44 11.43±0.37
S. D. 0.00 0.13 1.15 0.98
C.L 1.18 1.18 1.18 1.18
P X ± Sx 0.00± 0.00 0.00±0.00 0.00±0.00 0.00±0.00
S.D. 0.00 0.00 0.00 0.00
C.L 1.18 1.18 1.18 1.18
Diestrus I N X ± Sx 100± 0.00 96.00±0.53 89.43±1.11 86.57±0.53
S.D. 0.00 1.41 2.94 1.40
C.L: 0.89 0.89 0.89 0.89
A X ± Sx 0.00± 0.00 0.00±0.00 0.00±0.00 0.00±0.00
S.D. 0.00 0.00 0.00 0.00
C.L: 0.89 0.89 0.89 0.89
P X ± Sx 0.00± 0.00 4.00±0.49 10.57±0.37 13.43±0.48
S.D. 0.00 1.29 0.98 1.27
C.L: 0.89 0.89 0.89 0.89
Diestrus II N X ± Sx 100± 0.00 93.29±0.68 89.00±0.31 85.86±0.40
S.D. 0.00 1.80 0.82 1.07
C.L: 0.93 0.67 0.67 0.67
A X ± Sx 0.00± 0.00 0.00±0.00 0.00±0.00 0.00±0.00
S.D. 0.00 0.00 0.00 0.00
C.L: 0.93 0.67 0.67 0.67
P X ± Sx 0.00±0.00 6.71±0.42 11.00±0.53 14.14±0.40
S.D. 0.00 1.11 1.41 1.07
C.L: 0.93 0.67 0.67 0.67
P – prolonged stage
E1 – 200 ppb Al
E2 – 400 ppb Al
E3 – 1000 ppb Al
NB: 28 supervised sexual cycles /group (7 individuals/group x 4 supervised sexual cycles)
156

CONCLUSIONS
Universitatea de Științe Agricole și Medicină Veterinară Iași
Exposure to aluminium sulphate during suckling period determined in female rats at
sexual maturity:
� Significant increase of sexual cycle duration comparative to control group, over
the physiological limits, and in direct correlation to exposure level;
� Modification of sexual stages regularity:
o significant decrease of sexual cycles percentage with proestrus, estrus, diestrus I
and diestrus II in physiological limits as duration comparative to control group and
inversely correlated with the exposure level;
o appearance of sexual cycles with absent estrus, directly correlated with the
exposure level;
o appearance of sexual cycles with prolonged proestrus, diestrus I and II, directly,
significantly correlated with exposure level.
REFERENCES
1. Agarwal, S.K., Ayyash, L., Gourlet, C.S., Levy, L., Faber, K., Hughes, C.L.JR.
Evaluation of the developmental neuroendocrine and reproductive
toxicology of aluminium. Food Chem Toxicol. 1996, 34:1: 49‐53.
2. Drugă Mărioara Aluminiul. Potențialul poluant al industriei de prelucrare
primară şi secundară. Impactul asupra organismelor vii, Teză de
doctorat,2005, USAMVB Timişoara.
3. Gupta C. Ramesh., Veterinary Toxicology, 2007, Ed. Academic Press U.S.A.
4. Kei‐Ichiro Maeda., Satoshi Ohkura., Hiroko Tsukamura., Physiology of
Reproduction, Academic Press, Japan, 2000, pp. 145‐456;
5. ***Directiva 86/609 Din 24.11.1986 privind protecția animalelor utilizate în
scopuri experimentale și în alte scopuri științifice,
http://ec.europa.eu/food/fs/aw/aw_legislation/scientific/86‐609‐
eec_en.pdf;
6. ***Legea 205/26.05.2004 privind protecția animalelor, M. O. nr.
531/14.06.2004;
7. ***Legea 206/27.05.2004 privind buna conduită în cercetarea științifică,
dezvoltarea tehnologică și inovare, M. O. nr. 505/4.06.2004;
8. ***Legea 471/9.07.2002 privind aprobarea O.G. nr. 37/2002 pentru
protecția animalelor folosite în scopuri științifice sau în alte scopuri
experimentale, M. O. nr. 535/23.07.2002;
9. ***Legea 9/11.01.2008 pentru modificarea și completarea Legii nr.
205/2004 privind protecția animalelor, M. O. nr. 29/15.01.2008;
10. ***Ordin 143/400 pentru aprobarea instrucțiunilor privind adăpostirea și
îngrijirea animalelor folosite în scopuri științifice sau în alte scopuri
experimentale, M. O. nr. 697/24.09.2002;
157

IMPROVEMENT OF GLUCOSE CONCENTRATION, LIPOPROTEIN
PROFILE AND ANTIOXIDANT BIOMARKERS IN BLOOD OF
NATURALLY DIABETIC BITCHES ADMINISTERED INSULIN WITH
VITAMIN C OR VITAMIN E
Wael M. EL‐Deeb a , S.M. El ‐Bahr b
a (Corresponding author)
Department of clinical studies, College of Veterinary Medicine and animal Resources, King
Faisal University, Saudi Arabia, Al‐Ahsa, 31982
P.O. Box: 1757
e‐mail: drwaeleldeeb@yahoo.com
b
Department of Physiology, Biochemistry and Pharmacology, College of Veterinary Medicine
and animal Resources, King Faisal University, Saudi Arabia, Al‐Ahsa, 31982
Abstract
The present work aimed to determine if vitamin C or E has any advantage over insulin therapy
on glucose concentration, lipoprotein profile, antioxidant activity and lipid peroxidation in
naturally diabetic bitches. Therefore, forty bitches were divided into four groups (10 bitches in
each). The first and second groups were served as non diabetic and diabetic control group,
respectively. Dogs of group 2 were divided to 3 groups (10 animals each) and subjected to
different three treatment protocols namely group 3, 4 and 5 which treated with insulin, insulin
and ascorbic acid, and insulin and vitamin E, respectively. Values of blood glucose, serum total
cholesterol, low density lipoprotein cholesterol (LDL‐c) and high density lipoprotein cholesterol
(HDL‐c) were determined. In addition, the enzymatic activities of superoxide dismutase (SOD),
catalase (CAT) and glutathione peroxidase (GPX) and the values of malondialdehyde (MDA) were
measured in erythrocyte hemolysate as biomarkers of antioxidation. Results revealed that, in
diabetic bitches, the values of glucose, total cholesterol, LDL‐c and MDA were significantly
increased as compared to non diabetic bitches. SOD, CAT, and GPX activities and HDL‐c values of
diabetic bitches were significantly decreased as compared to normal bitches. In diabetic bitches,
supplementation of examined dose of vitamin C or vitamin E with insulin was effective in
inhibiting hyperglycaemia, hypercholesterolemia, oxidative stress and lipid peroxidation than
insulin alone. These effects were almost the same whatever the vitamin used.
Keywords: Diabetes mellitus, lipoproteins, oxidative stress, vitamin C, vitamin E, bitches
1. INTRODUCTION
Diabetes mellitus (DM) is the most common metabolic disease. It is more likely that
long‐term, uncontrolled DM with sustained high blood glucose levels is the cause of glucose
autooxidation with increased oxidative stress (So¨zmen et al., 2005). Overproduction of
reactive oxygen species (ROS) through the electron transport chain has been demonstrated in
DM. Lipid peroxidation is an important biological consequence of oxidative cellular damage in
patients with DM. Serum lipoperoxidation products such as malondialdehyde (MDA) reflects
oxidative stress.
158

Lucrări Științifice – vol 53 seria Medicină Veterinară
The increase in ROS causes nonspecific modification of nucleic acids, proteins, and
phospholipids leading to DNA, RNA, and protein damage and alterations in antioxidant
enzyme levels. All these events result in cellular and tissue damage. Tissue damage induced
by free radicals is thought to be an important factor in the pathogenesis of DM and its
complications (Annunziata et al., 2005). Experimentally, streptozotocin (STZ) induces DM,
probably through the generation of ROS, leading to islet cell destruction (Tavridou et al.,
1997). Living organisms possess antioxidant defense systems against ROS. These defense
systems include endogen antioxidants, which can be classified as enzymatic (SOD, GSH) and
nonenzymatic (vitamin E, vitamin C, uric acid, bilirubin) defense system. Once ROS formed, it
depletes antioxidant defense systems, rendering the affected cells and tissues more
susceptible to oxidative damage.
Dogs are becoming an important medical research model because it shares the same
environment as humans and develops many of similar chronic diseases (Kearns et al., 1999,
and Adams et al., 2000). Much of their biochemical and endocrine mechanisms are similar to
humans (Kararli, 1995, and Felsburg, 2002). DM is one of the most frequently diagnosed
endocrinopathies in cats and dogs. Type 1 diabetes mellitus (insulin dependent diabetes) is
most common in dogs (Expert Committee on the Diagnosis and Classification of Diabetes
Mellitus, 1997). At present, there are no internationally accepted criteria for the classification
of canine diabetes. No laboratory test is readily available to identify the underlying cause of
diabetes in dogs, and diagnosis is generally made late in the disease course. If the criteria
established for human diabetes are applied to dogs, at least 50% of diabetic dogs would be
classified as type 1, because this proportion has been shown to have antibodies against β‐cells
(Hoenig and Dawe, 1992; Davison et al., 2003).
The balance between oxidant and antioxidant species has been proposed to have an
important role in preventing diabetic complications. Dietary antioxidants play a major role in
the maintenance of the oxidative balance. Vitamin C, vitamin E, and other micronutrients
protect humans DM (Schwedhelm et al., 2003). Numerous studies have demonstrated that
antioxidant vitamins and supplements can help lower the markers indicative of oxidant stress
and lipid peroxidation in diabetic subjects and animals. A number of studies have reported
vitamin C, vitamin E and beta‐carotene deficiency in diabetic patients and experimental
animals (Penckofer, et al., 2002; Naziroglu and Butterworth 2005).
To our knowledge, up till now, the publications concerning the effect of insulin
combined with vitamin C or E in diabetic bitches are not available. Therefore, the present
study aimed to determine the effect of combined administration of insulin with vitamin C or
vitamin E on glucose concentration, lipoproteins profile and oxidative stress markers in
naturally diabetic bitches.
2. MATERIALS AND METHODS
2.1. Animals
A total of 40 bitches (5‐8 years old) were used in the present study. They were
maintained as performed by national guidelines and protocols, approved by the University
Animal Ethics Committee. They were divided into four groups. Bitches of the first group (10
animals) were non diabetic and served as a control non diabetic group (positive control;
group 1). Bitches of the second group (30 animals) were diagnosed as diabetic and served as
control diabetic group (negative control; group II). This group (group 2) was divided to 3
groups (10 animals each) and subjected to different three treatment protocols. For simple
presentation these groups were named group 3, 4 and 5. Bitches of the third group were
159

Universitatea de Științe Agricole și Medicină Veterinară Iași
treated with insulin in a dose rate of 0.5 unite/kg body weight twice daily. Bitches of the
fourth group were treated with insulin in a dose rate of 0.5 unite/kg body weight twice daily,
and ascorbic acid supplementation in a dose rate of 30 mg/kg body weight and once daily
(Morgan, 2008). Bitches of the fifth group were treated with insulin in a dose rate of 0.5
unit/kg body weight and vitamin E supplementation in a dose rate 800 IU once daily (Morgan,
2008). The insulin dose was stabilized over the time of the experiment. All experimental
groups were presented in Figure 1.
2.2. Sampling protocol
Fasting blood sample was collected one month post treatment from the cephalic vein
from all groups in fresh heparinized vials containing sodium fluoride for the estimation of
glucose. Some blood samples were used for preparation of serum for determination of total
cholesterol, LDL‐c and HDL‐c. In addition, the activities of super oxide dismutase (SOD),
Catalase (CAT), Glutathion peroxidase (Gpx) and Malondialdehyde (MDA) in erythrocyte
hemolysate were also determined.
From ethical point of view, samples were taken from 10 animals of the group II and
served as a diabetic control samples. Afterwards all group II as mentioned before were
treated by different examined drugs. This has been done to run the experiment without
depriving any dogs of treatment.
2.3. Preparation of hemolysate
After collecting blood samples in heparinized tubes, centrifugation was performed at
1000g for 15 min to remove the buffy coat. The packed cells obtained at the bottom were
washed thrice with phosphate buffer saline (0.9% NaCl in 0.01 M phosphate buffer, pH 7.4).
Erythrocytes were lysed with hypotonic phosphate buffer. The hemolysate was obtained after
removing the cell debris by centrifugation at 3000g for 15 min and used for determination of
super oxide dismutase (SOD), Catalase (CAT), Glutathion peroxidase (Gpx) and
Malondialdehyde (MDA).
2.4. Determination of glucose and lipoprotein profile
Blood glucose was estimated by the method of Dubowski as modified by Sasaki et al.,
(1972). Blood was treated with 10% trichloroacetic acid, mixed and centrifuged at 1000g for
10 min; the protein free supernatant was then treated with orthotoludine reagent and kept in
a boiling water bath for 10 min. The color developed was read using spectrophotometer at an
absorbance of 640 nm. Enzymatic method of spinreact kits was used for colorimetric
determination of serum total cholesterol (Zak et al., 1954) according to the manufacturer
instructions. Briefly, the spectrophotometer was adjusted to zero by distilled water.
Afterwards, in clean and dry separate test tubes, 10μl of serum and standard of cholesterol
were added to 1ml of their working solutions. However, the blank was prepared by adding 1
ml of the working solution in a separate tube. After mixing, the mixture was incubated for 5
minutes at 37 °C and the developed colour was measured colorimetrically against blank at
wave length of 505 nm. The value of cholesterol (mg/dl) were calculated by dividing the value
of the absorbance of the serum sample on that of the standard and the resultant value then
multiplied by 200 (Standard concentration). Detection limit was ranged from 0.6 to 600
mg/dl. However, the sensitivity was 1 mg/dl. Enzymatic method of spinreact kit was used also
for colorimetric determination of serum HDL‐c (Lopes‐Virella et al., 1977). Briefly, 1 ml of the
serum was added to 100 μl of the precipitating reagent. After mixing, the mixture allowed to
stand for 10 minutes at room temperature. After centrifugation (3000g/20 minutes), the
supernatant was collected and the cholesterol value was estimated as mentioned above.
160

Lucrări Științifice – vol 53 seria Medicină Veterinară
Detection limit was ranged from 1.57 to 275 mg/dl and the sensitivity was 1 mg/dl. VLDL‐c
was calculated by division of TAG/5 mg/dl while the LDL‐c was calculated as total cholesterol
– (HDL‐c + VLDL‐c) = mg/dl (Bauer, 1982).
2.5. Determination of Antioxidant enzymes
Activity of superoxide dismutase SOD (inhibition rate percent) was assayed in the RBC's
cell as described by Nishikimi et al. (1972) using commercial available kits (Bio‐diagnostic, Kit
number SD2520). The activity of catalase was assayed in the RBC's cell by the method of Aebi,
(1984) using commercial available kits (Bio‐diagnostic, Kit number CA2516). The activity of the
enzyme was expressed as units/mg of haemoglobin. Glutathione peroxidase (GPx)
(EC.1.l1.1.l9) was assayed by the method of Rotruck et al. (1973). The hemolysate were
prepared in Tris‐HCl buffer (pH 7.0, 0.4 M). The assay mixture contained EDTA, sodium azide
(10 mM), reduced glutathione (GSH 0.2 mM), and H2O2 (0.2 mM) and the appropriately
diluted enzyme preparation. A system devoid of enzyme served as the control. The activity
was determined by measuring the amount of GSH consumed after carrying out the reaction
for 10 minutes.
2.6. Determination of lipid peroxidation
Lipid peroxidation was assayed by the measurement of MDA levels on the base of
MDA reacted with thiobarbituric acid at 532 nm, according to Ohkawa et al. (1979) using
commercially supplied kits (Bio‐diagnostic, Kit number MD2529).
2.7. Statistical analysis
The obtained data of biochemical parameters were compared between groups within
different concentrations by using computer package of the statistical analysis system (SAS,
1997). All data are presented as means ± standard deviation (SD).
3. RESULTS
The data summarized in Table 1 showed the level of blood glucose, total cholesterol,
LDL‐c and HDL‐c in the control and experimental Bitches. Blood glucose level in insulin treated
bitches (Groups 3) was significantly increased than the normal value noted in the control
bitches whereas its concentration in insulin‐vitamin C and insulin‐vitamin E treated bitches
(Groups 4 and 5 respectively) were comparable to the control group. However, blood glucose
level in diabetic bitches (Group 2) was significantly (p < 0.01) higher than control and treated
groups. Administration of insulin, insulin with vitamin C and insulin with vitamin E to diabetic
bitches decreased blood glucose level significantly compared to the diabetic animals not
getting either compound. Administration of insulin with vitamins (C or E) was found to be
more effective in lowering blood glucose level than insulin administered alone.
Serum total cholesterol values in insulin, insulin‐vitamin C and insulin‐vitamin E
(Groups 3, 4 and 5 respectively) treated bitches were significantly increased than the normal
values noted in the control bitches whereas its concentration in diabetic bitches (Group 2)
was significantly (p < 0.01) higher than control and treated groups. Administration of insulin,
insulin with vitamin C and insulin with vitamin E to diabetic bitches decreased the levels of
total cholesterol concentrations significantly compared to the diabetic animals not getting
either compound. Administration of insulin with vitamin C was found to be more effective in
lowering total cholesterol value followed by administration of insulin with vitamin E and
finally insulin administered alone.
161

Universitatea de Științe Agricole și Medicină Veterinară Iași
LDL‐c level in insulin treated bitches (Groups 3) was significantly increased than the
normal value noted in the control bitches whereas its concentration in insulin‐vitamin C and
insulin‐vitamin E treated bitches (Groups 4 and 5 respectively) were comparable to the
control group. However, LDL‐c level in diabetic bitches (Group 2) was significantly (p < 0.01)
higher than control and treated groups. Administration of insulin, insulin with vitamin C and
insulin with vitamin E to diabetic bitches decreased LDL‐c level significantly compared to the
diabetic animals not getting either compound. Administration of insulin with vitamins (C or E)
was found to be more effective in lowering LDL‐c level than insulin administered alone.
The concentration of serum HDL‐c in bitches treated with insulin (Groups 3) was
significantly (p < 0.01) lower than that of the control bitches whereas the concentration in
insulin‐vitamin C and insulin‐vitamin E treated bitches were comparable with the control
group. The concentration of serum HDL‐c in diabetic bitches (Group 2) was significantly (p <
0.01) lower than that of the control and treated groups. Administration of insulin, insulin with
vitamin C and insulin with vitamin E to diabetic bitches increased the levels of HDL‐c
concentrations significantly compared to the diabetic animals not getting either compound.
Administration of insulin with vitamins (C or E) was found to be more effective in elevating
HDL‐c level than insulin administered alone.
The data of Table 2 included the activities of SOD, CAT, Gpx and value of MDA in the
erythrocyte hemolysate of control and experimental Bitches. The activities of SOD, CAT and
Gpx in bitches treated with insulin, insulin with vitamin C and insulin with vitamin E (Groups 3,
4 and 5 respectively) were lower than the control bitches. The activities of SOD, CAT and Gpx
in the hemolysate were lowered significantly (p < 0.01) in diabetic bitches (Group 2)
compared to the control (Group 1). Administration of insulin, insulin with vitamin C and
insulin‐vitamin E simultaneously elevated the activities of these enzymes in the erythrocyte
hemolysate of the diabetic bitches. However, insulin administered either with vitamin C or
vitamin E was found to be more effective in elevating the values of examined enzymes than
that of insulin administered alone.
The value of MDA in insulin treated bitches (Groups 3) was significantly increased than
the normal value noted in the control bitches whereas its concentration in insulin‐vitamin C
and insulin‐vitamin E treated bitches (Groups 4 and 5 respectively) were comparable to the
control group. However, MDA value in diabetic bitches (Group 2) was significantly (p < 0.01)
higher than control and treated groups. Administration of insulin, insulin with vitamin C and
insulin with vitamin E to diabetic bitches decreased MDA value significantly compared to the
diabetic animals not getting either compound. Administration of insulin with vitamins (C or E)
was found to be more effective in lowering MDA value than insulin administered alone.
4. DISCUSSION AND CONCLUSION
Several features appear in DM including an increase in lipid peroxidation (Naziroglu
and Sqimsek 2004; Gumieniczek, 2005), alteration of the glutathione redox state, a decrease
in the content of individual natural antioxidants, and finally a reduction in the antioxidant
enzyme activities. These changes suggest an oxidative stress caused by hyperglycemia
(Chaudhry et al., 2007). Many defense mechanisms are involved in against oxidative stress.
Among these mechanisms, antioxidants such as ascorbic acid (vitamin C) and a‐tocopherol
(vitamin E) play the role of a free‐radical scavenger (Karaoz et al., 2002; Naziroglu and
Sqimsek 2004; Tucker and Townsen 2005).
The present results showed that, administration of insulin, insulin with vitamin C and
insulin with vitamin E resulted in significant changes in the concentration of blood glucose,
162

Lucrări Științifice – vol 53 seria Medicină Veterinară
total cholesterol, LDL‐c, HDL‐c, SOD, CAT, Gpx and MDA. Literature information indicates that
natural diabetic dogs are hyperglycemic and have increased oxidative stress (Comazzi et al.,
2002). Observations in this study also correlate well with the previous research findings, in
that the blood glucose levels were elevated significantly in diabetic bitches (Comazzi et al.,
2002). There were marked fall in the blood glucose concentration of diabetic bitches
administered insulin alone or in combination with either vitamin C or E. The better
hypoglycaemic effect of insulin administered with vitamins than that of insulin alone perhaps
attributed to one of two possibilities. The first possibility is that, supplementation of vitamins
increased the antioxidant enzymes expressions and/or activities. Although pancreatic beta
cell loss in diabetes is probably due to an autoimmune response, ROS produced during
inflammation are considered as a predisposing factor, and increased mitochondrial ROS
production during hyperglycemia may be central to much of the pathology of diabetes
(Kowluru Renu et al., 2006; Nobuyo et al., 2006; Wagner et al., 2007). The second possibility is
that, supplementation of vitamins inactivates the circulating free radicals that quench nitrous
oxide before it reaches pancreatic beta cells, where induced their damage and/or death (Vina
et al., 2006).
The reported increased level of total cholesterol and HDL‐c in diabetic bitches comes in
agreement with previous studies (Betteridge, 1994; Naziroglu, et al., 2004). Studies have
shown that increased plasma triglyceride and cholesterol levels may be a risk factor for
vascular disease (Kamata and Yamashita 1999; Kamata et al 2001; Shahar et al., 2003). Also
oxidative modification of LDL is an important step in the development of atherosclerosis
(Felmeden et al., 2003). This oxidation is initiated and propagated by free radicals where
antioxidants become depleted (Young and Woodside, 2001; Kaviarasan et al., 2005).
In this study, vitamin C or E when supplemented with insulin significantly reduced lipid
profile in diabetic bitches compared to insulin treated diabetic bitches. This improvement in
lipid profile in the present study is supported by previous studies that vitamin C (Anderson et
al., 1999; Kurowska et al., 2000) prevents oxidation of LDL‐cholesterol; decreases total and
LDL‐cholesterol and triglyceride; and also raises HDL‐cholesterol level. The superiority of
administration of insulin with vitamins than insulin alone reflected the protective effect of
vitamins against atherogenic properties of insulin. This was underlined by the reported
increment of HDL‐c in the respective groups.
The possible explanation for the hypocholesterolaemic effect of vitamin C and vitamin
E is that they prevents LDL‐cholesterol from oxidative damage and aids in degradation of
cholesterol. Secondly, it has been suggested that these vitamins are needed by the enzyme in
the first step of bile acid synthesis (cholesterol 7α‐hydroxylase) by directing cholesterol
towards bile acid synthesis and reduces its level in serum (White et al., 1994). Kaviarasan et
al. (2005) reported that level of total cholesterol, triglyceride, lipid peroxidation and glucose
increased in hyperlipidemic patients with DM whereas there was decreased plasma
concentration of vitamin C, E and other antioxidants. Taking the above evidence together
suggest that vitamin C and E supplementation improves the lipid profile of diabetic bitches by
acting through cholesterol 7α‐hydroxylase to direct cholesterol into bile synthesis.
Furthermore, by scavenging free radicals it decreases oxidative damage to oxidized LDL‐
cholesterol.
The significant (p < 0.01 %) decrease in the activity of antioxidant enzymes, SOD, CAT
and Gpx in diabetic bitches (Table 2) are agree with the previous results in rats (Kedziora, et
al., 2000; Vessby, et al., 2002). The authors reported that, antioxidant capacity in plasma of
type –1 diabetic rats was shown to be lower than that of the normal animals, and they
returned this reduction to decreased activity of antioxidant enzymes.
163

Universitatea de Științe Agricole și Medicină Veterinară Iași
The present work demonstrated a potential and beneficial effect of combined
administration of insulin either with vitamin C or E in attenuating oxidative stress and
enhancing the body’s own antioxidant defenses in diabetic bitches with established oxidative
stress. As tabulated in the result section, most of the evaluated parameters exhibited a
significant restoration which was comparable to that of normal control. In the contrary, the
enzymatic antioxidants and cell damages as reflected on MDA value in erythrocyte
hemolysate remained significantly altered in the diabetic control bitches.
The antioxidant enzymes Gpx, CAT and SOD are known to be inhibited in diabetes
mellitus as a result of non‐enzymatic glycosylation and oxidation. The positive impact of
treatment of DM using vitamins (C and E) on these enzymes observed in the present study
could be explained by two possible mechanisms. First, the antioxidative effect of vitamins C
or E perhaps prevent further glycosylation and peroxidation of proteins by interacting with
free radicals minimizing their serious effects. Second, vitamin C or E may induce the protein
synthesis of these enzymes, which explains the observed elevated activity after treatment.
The present results come in accordance with the previous researches (Vina et al., 2006;
Borras et al., 2005; Pawlowska‐Goral et al., 2002; Vimal and Devaki 2004). The authors found
that polyphenolic substances such as estrogens, flavonoids and vitamins increased the
expression of SOD and GPX enzymes at the transcriptional level. In conclusion of this section,
treatment of diabetic bitches in this study with vitamins C or E with the main drug (insulin)
showed a significant restoration in the levels of SOD, CAT, and GPX activity.
Although several criteria are without doubt required to adequately describe a
biomarker, the entire basis of the biomarker is the measurement of compound that directly
reflects certain biological events related to pathogenesis of a disease or condition
(Lykkesfeldt, 2007). Thus the rational of MDA as a biomarker relies both that it is derived from
lipid peroxide, that changes in lipid oxidation levels reflects the changes in MDA
concentration.
The significant (p < 0.01 %) increased level of MDA in diabetic bitches (Table 2) in this
study reflected the increased lipid peroxidation due to diabetes. This principle was previously
observed by Rahimi et al. (2005) who approved the increases in lipid peroxidation were
usually accompanied diabetic patient. Numerous studies have demonstrated that antioxidant
vitamins and supplements can help in lowering the markers indicative of oxidant stress and
lipid peroxidation in diabetic subjects and animals (Naziroglu et al., 2005 and Penckofer, et al.,
2002).
In the present study, we observed that vitamin C or vitamin E supplementation to
diabetic bitches improved the lipid peroxidation process as compared with diabetic condition
as appeared in the significant (p < 0.01 %) reduction in the levels of MDA as oxidative damage
biomarker (Table 2). Also we observed the more obvious reduction of MDA levels in insulin
vitamins treated group than insulin group. These results could be explained by the previous
observation of Naziroglu et al., (2005) who found that, vitamin C is shown to be an important
antioxidant, to regenerate vitamin E through redox cycling, and to raise intracellular
glutathione levels. Thus vitamin C plays an important role in protein thiol group protection
against oxidation. It has been proposed that, Vitamin C recycles Vitamin E by a non‐enzymatic
reaction. Additional interactions have been also reported between vitamin C and vitamin E.
Vitamin C is associated with the recycling of an important cellular antioxidant, the glutathione
and functions with it as a redox couple (Winkler et al., 1994). Glutathione is also involved in
the recycling of Vitamin E by an enzymatic mechanism (McCay, 1985; Chan, 1993). Another
possibility is that, supplementation of vitamin (C and E) inactivates the circulating free radicals
164

Lucrări Științifice – vol 53 seria Medicină Veterinară
that quench NO before it reaches pancreatic beta cells, where induced their damage and/or
death (Vina et al., 2006).
The current study indicated that, administration of the examined dose of either
vitamin C or vitamin E with insulin were effective in inhibiting hyperglycaemia,
hypercholesterolemia, oxidative stress and lipid peroxidation than insulin alone. These effects
were almost the same whatever the vitamin used.
5. REFERENCES
5. Adams, B., Chan, A., Callahan, H., Siwak, C., Tapp, D., Ikeda‐Douglas, C., Atkinson, P., Head, E.,
Cotman, C.W., Milgram, N.W., 2000. Use of a delayed non‐matching to position task to
model age‐dependent cognitive decline in the dog. Behav. Brain. Res. 108, 47– 56.
6. Aebi, H., 1984. Methods Enzymol 105, 121‐126.
7. Anderson J W, Gowri M S and Turner J. 1999. Antioxidant supplementation effects on low‐
density lipoprotein oxidation for individuals with type 2 diabetes mellitus; J. Am. Coll. Nutr.
18, 451–461
8. Annunziata L, Domenico F, Pietro T. 2005. Glyco‐oxidation in diabetes and related diseases.
Clin Chim Acta; 2:236–50.
9. Bauer, J.D., 1982, Clinical laboratory methods 9 th ed, The C.V. Company II 1830, Westline
industrial, Missouri, Chap. 33.
10. Betteridge D. J. 1994. Diabetic dyslipidemia; Am. J. Med. (Suppl. 6A) 96, 255–315.
11. Borras C., Gambini J., Gomez‐Cabrera M. C., Sastre J., Pallardo F. V., Mann G. E., et al. 2005.
17ßoestradiol up‐regulates longevity‐related, antioxidant enzyme expression via the ERK1
and ERK2 [MAPK]/NFkB cascade. Aging Cell; 4:113‐8.
12. Chan A. C. 1993. Partners in defense, vitmian E and vitamin C. Can. J. Physiol. Pharmacol.
71:725‐731
13. Chaudhry J, Ghosh NN, Roy K, Chandra R. 2007. Antihyperglycemic effect of a
thiazolidinedione analogue and its role in ameliorating oxidative stress in alloxan‐induced
diabetic rats. Life Sci.; 80:1135‐42.
14. Comazzi, S., Paltrinieri, S., Spagnolo, V., Sartorelli, P. 2002. Some aspect of erythrocyte
metabolism in insulin‐ treated diabetic dogs. Research in veterinary Science, 72. 23‐27
15. Davison, L. J., Herrtage, M. E., Steiner, J. M., Williams, D. A. & Catchpole, B., 2003. Evidence
of anti‐insulin autoreactivity and pancreatic inflammation in newly diagnosed diabetic dogs.
J. Vet. Intern. Med. 17: 395 (abs.).
16. Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. 1997. Report of
the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes
Care 20: 1183–1197.
17. Felmeden D C, Spencer C G, Blann A D, Beevers D G and Lip G Y 2003 Low‐density
lipoprotein subfraction and cardiovascular risk in hypertension: Relationship to endothelial
dysfunction and effects of treatment; Hypertension 41, 528–533.
18. Felsburg, P., 2002. Overview of immune system development in the dog: comparison with
humans. Human Exp. Toxicol. 21, 487–492.
19. Gumieniczek A. 2005. Effects of pioglitazone on hyperglycemia‐induced alterations in
antioxidative system in tissues of alloxan‐treated diabetic animals. Exp Toxicol Pathol;
56:321‐6.
20. Hoenig, M. & Dawe, D., 1992. A qualitative assay for beta cell antibodies. Preliminary
results in dogs with diabetes mellitus. Vet. Immunol. Immunopathol. 32: 195–203.
21. Kamata K. and Yamashita K. 1999. Insulin resistance and impaired endotheliium‐dependent
renal vasodilation in fructose‐fed hypertensive rats; Res. Commun. Mol. Pathol. Pharmacol.
103,195–200
165

Universitatea de Științe Agricole și Medicină Veterinară Iași
22. Kamata K., Kanie N, and Inose A. 2001. Mechanisms underlying attenuated conntractile
respoonse of aortic rings to noradrenaline in fructose‐fed mice; Eur. J. Pharmacol. 428,
241–249
23. Karaoz E, Gultekin F, Akdogan M, Oncu M, Gokcimen A. 2002. Protective role of melatonin
and a combination of vitamin C and vitamin E on lung toxicity induced by chlorpyrifos‐ethyl
in rats. Exp Toxicol Pathol.; 54:97‐108.
24. Kararli, T., 1995. Comparison of the gastrointestinal anatomy, physiology, and biochemistry
of humans and commonly used laboratory animals. Biopharm. Drug Dispos. 16, 351–380.
25. Kaviarasan K., Arjunan M. M., and Pugalendi K. V. 2005. Lipid profile, oxidant‐antioxidant
status and glycoprotein components in hyperlipidemic patients with/without diabetes; Clin.
Chim. Acta 362, 49–56.
26. Kearns, R., Hayek, M., Turek, J., Meydani, M., Burr, J., Greene, R., Marshall, C., Adams, S.,
Borgert, R., Reinhart, G., 1999. Effect of age, breed and dietary omega‐6 (n‐6) :omega‐3 (n‐
3) fatty acid ratio on immune function, eicosanoid production, and lipid peroxidation in
young and aged dogs. Vet. Immunol. Immunopathol. 69, 165–183.
27. Kedziora‐Kornatowska KZ, Luciak M, Paszkowski J. Lipid peroxidation and activities of
antioxidant enzymes in the diabetic kidney: Effect of treatment with angiotensin convertase
inhibitors. IUBMB Life 2000;49:303–30.
28. Kowluru Renu A, Kowluru Vibhuti, Xiong Ye, Ho Ye‐Shih. 2006. Overexpression of
mitochondrial superoxide dismutase in mice protects the retina from diabetes‐induced
oxidative stress. Free Radic Biol Med.; 41:1191‐6.
29. Kurowska E. M., Spence J. D., Jordan J., Wetmore S., Freeman D. J, Piche L A and Serratore
P. 2000. HDL‐cholesterol‐raising effect of orange juice in subjects with
hypercholesterolemia; Am. J. Clin. Nutr. 72, 1095–1100
30. Lopes‐Virella, M.F., Stone, P., Ellis, S., and Colwell, J.A., 1977. "Cholesterol determination in
high density lipoproteins separated by the three different methods, " Clin. Chem., 23(5), pp.
882‐884.
31. Lykkesfeldt, J., 2007. Malondialdehyde as biomarker of oxidative damage to lipids caused
by smoking. Clinica Chimica Acta 380, 50–58.
32. McCay P. B. 1985. Vitamin E: interactions with free radicals and ascorbate. Annu. Rev. Nutr.
5:323‐340, 27.
33. Morgan V. 2008. Handbook of Small Animal Practice. The 5th edition. SAUNDERS, Printed in
the United States of America.
34. Naziroglu M, Sqimsek M. 2004. Effects of hormone replacement therapy with oral vitamin
C and E on plasma thyroid hormone levels in postmenopausal women with type 2 diabetes.
Biomed Pharmacother.
35. Naziroglu M, Butterworth P., 2005. Protective effects of moderate exercise with dietary
vitamin C and E on blood antioxidative defense mechanism in rats with streptozotocin‐
induced diabetes. Can J Appl Physiol.30 (2):172–85.
36. Nishikimi, M., Appaji N., and Yogi. K. 1972. The occurrence of superoxide anion in the
reaction of reduced phenazine methosulfate and molecular oxygen. Biochem. Bioph. Res.
Commn. 46(2), 849‐854 .
37. Nobuyo, M., Frei Balz, Heinecke Jay W. Vitamin C fails to protect amino acids and lipids
from oxidation during acute inflammation. Free Radic Biol Med 2006;40:1494‐501.
38. Ohkawa,H. ;Ohishi,w. and Yagik, 1979. Annal;.Biochem. ;95,351
39. Pawlowska‐Goral K., Kusz E., Wardas M., Damek E. and Wardas P. 2002. The results of the
interference of nitrates and vitamin E in the metabolism in the connective tissue of rat’s
liver. Exp Toxicol Pathol.; 54:147‐50.
40. Penckofer, S., Schwertz, D., Florczak, K., 2002. Oxidative stress and cardiovascular disease in
type 2 diabetes: the role of antioxidants and prooxidants. J Cardiovasc Nurs .16(2):68–85.
41. Rahimi R., Nikfar S., Larijani B. and Abdollahi M. 2005. Dossier: Antioxidants in the
prevention of human diseases. A review on the role of antioxidants in the management of
diabetes and its complications. Biomedicine & Pharmacotherapy, 59, 365–373.
166

Lucrări Științifice – vol 53 seria Medicină Veterinară
42. Rotruck J. T., Pope A. L. and Ganther H. E. 1973. Selenium: Biochemical role as a component
of glutathione peroxidase. Science 179: 588‐590.
43. SAS, 1987. Statistical Analysis System, Users Guide: Statistics, SAS Institute Cary , North
Carolina.
44. Sasaki T,
Matsy S, Sonae A (1972) Effect of acetic acid concentration on the colour reaction in the o‐
toluidine boric acid method for blood glucose estimation. Rinshokagaku 1: 346‐353.
45. Schwedhelm E., Maas R., Troost R. and Boger R. H. 2003. Clinical pharmacokinetics of
antioxidants and their impact on systemic oxidative stress. Clin Pharmacokinet; 42:437–59.
46. Shahar E, Chambless L. E, Rosamond W. D., Boland L. L., Ballantyne C. M., McGovern P. G.
and Sharnett A. R. 2003. Atherosclerosis risk in community study, plasma lipid profi le and
incident ischaemic stroke: the atherosclerosis risk in communities (ARIC) study; Stroke 34,
623–631
47. So¨zmen EY, So¨zmen B, Delen Y. and Onat T. 2001. Catalase/superoxide dismutase (SOD)
and catalase/paraoxonase (PON) ratios may implicate poor glycemic control. Arch Med
Res;4:283–7.
48. Tavridou A, Unwin NC, Laker MF, White M, Alberti GK. 1997. Serum concentrations of
vitamin A and E in impaired glucose tolerance. Clin Chim Acta; 266:129–40.
49. Tucker J. M and Townsen D.M. 2005. Alpha‐tocopherol: roles in prevention and therapy of
human disease. Biomed Pharmacother; 59:380‐7.
50. Vessby, J., Basu, S., Mohsen, R., Berne, C. and Vessby B. (2002). Oxidative stress and
antioxidant status in type 1 diabetes mellitus. J. Internal Med. 251:69‐76.
51. Vimal V and Devaki T. 2004. Linear furanocoumarin protects rat myocardium against
lipidperoxidation and membrane damage during experimental myocardial injury. Biomed
Pharmacother; 58:393‐400.
52. Vina J, Borras C., Gomez‐Cabrera M. C. and Orr W. C. 2006. Role of reactive oxygenspecies
and (phyto)oestrogens in the modulation of adaptive response to stress. Free Radic Res;
40:111‐9.
53. Wagner James G, Jiang Qing, Harkema Jack R, Illek Beate, Patel Dhavalkumar D, Ames Bruce
N, et al. 2007. Ozone enhancement of lower airway allergic inflammation is prevented by g‐
tocopherol. Free Radic Biol Med.; 43:1176‐88.
54. Winkler, B. Stephen M., and Tonia S. 1994. The redox couple between glutathione and
ascorbic acid: A chemical and physiological perspective. Free Radical Biology and Medicine,
17, 333‐349.
55. White, A., Handler P., Smith E. L., Hill R L and Lehman I. R. 1994. Principles of biochemistry
7th edition (Tokyo: McGrawHill Kogakusha Ltd) pp 619–630
56. Young, I.S. and Woodside J.V. 2001. Antioxidants in health and disease; J. Clin. Pathol. 54,
176–186
57. Zak, B., Dickenman, R., Whitsee, E., Burnett, H., and Cherney, P., 1954. "Rapid estimation of
free and total cholesterol, " Am. J. Clin. Path., 24(1), pp. 1307‐1315.
167

Group 1 contained 10 non
diabetic bitches served as non
diabetic control
Universitatea de Științe Agricole și Medicină Veterinară Iași
A total of 40 bitches were used in the
experiment
Figure 1: Diagrammatic representation of experimental protocol
Group 3 (10 animal)
Treated with insulin
Group 4(10 animal)
Treated with insulin
and ascorbic acid
168
Group 2 contained 30 diabetic
bitches
Samples of 10 of each served as
diabetic control before treated with
Group 5
(10
animal)
Treated
with

Lucrări Științifice – vol 53 seria Medicină Veterinară
Table 1: lipid profile and blood glucose level in control, diabetic, diabetic treated bitches
Significant Difference at P

INVESTIGATION OF SELECTED BIOCHEMICAL INDICATORS OF
EXERTIONAL RHABDOMYOLYSIS IN ARABIAN HORSES: PRO‐
INFLAMMATORY CYTOKINES AND OXIDATIVE STRESS MARKERS
Wael M. EL‐Deeb a , Abd EL‐Aziz Almujalli b , S. M. El‐Bahr c
a (Corresponding author)
Department of clinical studies, College of Veterinary Medicine and animal Resources, King
Faisal University.
Saudi Arabia, AL‐Ahsa, 31982.
e‐mail: drwaeleldeeb@yahoo.com
b Department of clinical studies, College of Veterinary Medicine and animal Resources, King
Faisal University.
Saudi Arabia, AL‐Ahsa, 31982.
c Department of Physiology, Biochemistry and Pharmacology, College of Veterinary Medicine
and animal Resources, King Faisal University, Saudi Arabia, AL‐Ahsa, 31982.
Abstract
A total of 30 horses were divided into two groups, one served as a control whereas other was
exertional rhabdomyolysis (ER)‐diseased horses. After blood collection, the resulted sera were
used for estimation of the activities of creatin kinase (CK), aspartate transaminase (AST),
lactate dehydrogenase (LDH), lactic acid, total triacylglycerol, glucose, total protein, albumin,
globulin, urea, creatinine, Triiodothyronine (T3), calcium, sodium, potassium, phosphorus,
chloride, vitamin E, interleukin‐6 (IL‐6) and tumor necrosis‐α (TNF‐α). In addition, whole blood
was used for determination of selenium, reduced glutathione (G‐SH) and prostaglandin F2‐α
(PGF2α). The erythrocyte hemolysates were used for the determination of the activities of
super oxide dismutase (SOD), catalase (CAT), total antioxidant capacity (TAC), nitric oxide (NO)
and malondialdehyde (MDA). The present findings revealed a significant (p≤ 0.05) increase in
the values of CK, AST, LDH, glucose, lactate, TAG, urea, creatinine, phosphorus, MDA, TNF‐ α,
IL6 and PGF2‐ α in diseased horses when compared with the control. In addition, the values of
calcium, SOD, CAT, TAC, NO and GSH in diseased horses were significantly (p≤ 0.05) lower than
the control. The other examined parameters remained unchanged. In conclusion, the examined
pro‐inflammatory cytokines could be added to old biomarkers for the diagnosis of ER in
Arabian horses. In the future, efforts should be made to confirm this in other breed. If this
could be achieved, it would open up new perspectives in research fields dealing with ER not
only in animals, but also in humans.
1. INTRODUCTION
Key words: Rhabdomylosis, horse, IL6, oxidative stress, TNF‐α, PGF2‐ α.
Muscle disorders are a common cause of suboptimal performance or even disability
to perform. In comparison to human medicine, the etiology of muscle disorders in equine
medicine is less explored. Tying‐up or ER was previously known as Monday‐morning disease
(Zentek, 1991). Monday morning disease was associated with work horses that was given a
170

Lucrări Științifice – vol 53 seria Medicină Veterinară
day of rest after a week of hard work. When the horses were supposed to return to work on
the following Monday, they developed stiffness and pain in the hindquarter musculature, and
reluctance to move (Jones, 2003). Arabians horses are one of the affected breed (Valentine et
al., 2000; McKenzie et al., 2003).
The underlying cause of this metabolic disorder is not yet known but is thought to
involve carbohydrate metabolism (Valberg et al., 1997). Clinical signs of ER, including muscle
pain, cramping, stiffness, sweating, exercise intolerance, weakness, and reluctance to move
may be observed, with the hindquarters most frequently affected (Firshman et al., 2003). In
order to confirm a diagnosis of ER blood samples should be obtained to determine serum CK
and AST. Their elevation indicates muscle damage and confirms the diagnosis of the disease.
In addition, AST activity may be heightened in asymptomatic horses with chronic ER.
Exercise has been shown to induce tissue damage by oxidation of cellular
components, such as membrane lipids, proteins, carbohydrates and DNA (Clarkson and
Thompson, 2000). The main sources of reactive oxygen species (ROS) that are generated
during exercise are the mitochondria (respiratory chain), although activated phagocytes
(respiratory burst) and several enzymes such as oxidases perhaps contribute to an increased
ROS release (Leeuwenburgh and Heinecke, 2001). Living organisms possess antioxidant
defense systems against ROS. These defense systems include endogen antioxidants, which can
be classified as non enzymatic (vitamin E, vitamin C, uric acid) and enzymatic defense system.
The most important antioxidant enzymes are SOD and CAT (Fridovich, 1995). If the pro‐oxidant
burden overwhelms the endogenous antioxidant defenses of the organism, the arising
imbalance between pro‐ and antioxidants is resulted which defined as oxidative stress (Sies,
1991). Exercise‐induced oxidative stress is believed to contribute to accelerated muscle fatigue
and muscle fiber damage, leading to exercise intolerance and poor performance in different
animal species (Sen and Packer, 2000), as well as to a decreased immune defense of the
organism (Nieman, 1997). If the importance of antioxidant deficiencies for exercise‐induced
oxidative stress and exercise intolerance has been clearly established, thereby that
supplementation of antioxidants might improve performance, remains to be proven (Clarkson
and Thompson, 2000; Jenkins, 2000).
Electrolyte imbalances were believed to have an important role in causing ER in some
pleasure and racehorses. Studies by Harris and Snow (1991) in the United Kingdom have
focused on determining electrolyte balance in horses with tying‐up. Commercial diets were
found to be too low in salt (sodium chloride) and most horses needed an additional 1‐2 ounces
of salt to maintain proper balance. While some horses improved dramatically by adding
electrolytes in the form of table salt (sodium chloride), lite salt (potassium chloride), or Epsom
salt (magnesium chloride), other horses showed no improvement. Trace‐elements, such as
selenium (Se), zinc (Zn), copper (Cu) and manganese (Mn) play an important catalytic role for
the enzymatic activity of SOD (Maughan, 1999; Mates, 2000).
Strenuous exercise induced a transient endotoxemia and a pro‐inflammatory
condition in the horse that persists for approximately 2 h after exercise (Douglas et al., 2007).
IL‐6 is an important mediator of inflammation. The pleiotrophic cytokine IL‐6 is involved in
directing the innate immune response to acquired immunity (reviewed by Jones (2005), and
has been described as a regulatory cytokine in osteoarthritis (Goldring, 2000). It stimulates
production of metalloproteinase inhibitors (Shingu et al., 1993, 1995), but also potentiates the
catabolic effects of IL‐1 and TNF‐α on proteoglycan metabolism (Jikko et al., 1998; Flannery et
al., 2000). According to authors knowledge there is no data concerning the oxidant‐
antioxidant balance or pro‐inflammatory response in cases of ER in Arabian horses. Therefore,
171

Universitatea de Științe Agricole și Medicină Veterinară Iași
the present study aimed to investigate new biomarkers, oxidative stress markers and pro‐
inflammatory cytokines for diagnosis of ER in Arabian horses.
2. MATERIAL AND METHODS
2.1. Animals
A total of 30 horses (4‐6 years old) were used in the present study. They were divided
into two groups. Horses of the first group (10 horses) were clinically healthy and served as a
control group. Horses of the second group (20 horses) were ER‐ diseased horses. They were
selected on the basis of clinical examination and laboratory findings and they had a history of
over exercise after a period of rest and overfeeding of non‐structural carbohydrates (grains).
2.2. Sampling protocol
Blood samples were collected from the ear vein from all groups in fresh plain vial for
serum collection and heparinized vials for whole blood, serum and erythrocyte hemolysate
preparations. Sera were used for estimation of the activities CK, AST, LDH. In addition, lactic
acid, total triglycerides, glucose, total protein, albumin, globulin, urea and creatinine were also
determined. Sera samples were also used for the determination of T3, calcium, sodium,
potassium, phosphorus, chloride, vitamin E, IL‐6 and TNF‐α. However, whole blood was used
for the determination of selenium, G‐SH and PGF2‐α. The erythrocyte hemolysates were used
for the determination of the activities of SOD, CAT, TAC, NO and MDA.
2.3. Preparation of hemolysate
After collecting blood samples in heparinized tubes, centrifugation was performed at
1000g for 15 min to remove the buffy coat. The packed cells obtained at the bottom were
washed thrice with phosphate buffer saline (0.9% NaCl in 0.01 M phosphate buffer, pH 7.4).
Erythrocytes were lysed with hypotonic phosphate buffer. The hemolysate was obtained after
removing the cell debris by centrifugation at 3000g for 15 min.
2.4. Determination of selected biochemical parameters
Enzymatic methods of Bio‐diagnostic kits were used for colorimetric determination of
serum glucose concentration (Trinder, 1969), TAG (Young et al., 1972), total protein (Henry,
1984), albumin (Doumas et al., 1981), globulin (Coles, 1974), AST (EC 2.6.1.1; Reitman and
Frankel, 1957), urea (Tabacco et al., 1979) and creatinine (Henry, 1984) according to
manufacturing instructions. In addition, the activities of CK (Faulker and Meites 1982), LDH (EC
1.1.1.27; Wroblewski and Duean 1955), and value of Lactate (Donawick et al., 1975) were also
determined in the serum by using commercial available kits (Bio‐diagnostic kits).
Serum concentration of T3 hormone was determined using a solid phase competitive
chemiluminescence immuno‐assay system (Elecsys 2010, Roche, Diagnostic, Mannheim).
Concentrations were determined using kits, controls, mono‐clonal mouse antibodies and
reagent supplied by Roche, Diagnostic, 2005 .The intra – and inter assay coefficients of
variation (C.V. %) were 3.6 and 5.4%.`The minimum detectable levels of the assay were
0.195ng /ml.
2.5. Determination of electrolytes and vitamin E
Serum calcium was determined colorimetrically by using commercial the kit of Invitro
Scientific according to the method described by Moorehead and Briggs, (1974). Calcium reacts
with cresolphthalein complexone to form purple color complex in alkaline medium. The
intensity of the color measured photometrically between wavelength 540 and 600nm with the
maximum absorbance at 575 nm is directly proportional to calcium concentration in the
172

Lucrări Științifice – vol 53 seria Medicină Veterinară
specimen. The serum inorganic phosphate was determined according to the method cited in
Wootton, (1982). The substituted phenol was used as a reducing agent and pH was adjusted
by an acetate buffer. The color development was hastened by copper present in the buffer.
The blue color was stable at least for 30 minutes. Sodium, potassium, and chloride were
analyzed using the same commercial available test kits according to the methods described by
Friedman and Young (1997) and Tietz, (1995).
However, whole blood selenium was measured using the Unicam 939 AA
spectrometer and AAS hydride technique. Serum vitamin E was measured by HPLC (Kontron
Instruments, Rotkreuz, Switzerland) using acetate of alpha tocopherol as internal standard
(Paolisso et al., 1993). Chromatographic separation was performed using a reversed phase
silica gel column (Alltech, Templeuvre, France) and an isocratic elution with acetonitrile.
Detection was performed photometrically at 292nm.
2.6. Determination of oxidative stress markers and pro‐inflammatory mediators
Activity of SOD (inhibition rate percent) was assayed in erythrocyte hemolysate as
described by Nishikimi et al. (1972) using commercial available kits (Bio‐diagnostic, Kit number
SD2520). The activity of CAT was assayed in the erythrocyte by the method of Aebi, (1984)
using commercial available kits (Bio‐diagnostic, Kit number CA2516). The activity of the
enzyme was expressed as units/mg of hemoglobin. Whole blood GSH was determined
spectrophotometrically using the Bio‐diagnostic kit (GR2510). Intra‐ and inter‐assay CV were
1% and 3%, respectively. TAC was assayed in erythrocyte hemolysate as described by
koracevic et al. (2001) using commercial available kits (Bio‐diagnostic, Kit number TA2512). NO
was assayed in hemolysate as described by Montgomery and Dymock (1961) using commercial
available kits (Bio‐diagnostic, Kit number NO2532). Lipid peroxidation was assayed by the
measurement of MDA levels on the base of MDA reacted with thiobarbituric acid at 532 nm,
according to Ohkawa et al. (1979) using commercially supplied kits (Bio‐diagnostic, Kit number
MD2529).
Serum concentrations of TNF‐α were determined using an ELISA assay developed
with commercially available reagents, and an equine recombinant TNF‐α standard. Standard
ELISA plates (96 well, flat bottoms, Immulon 4HBX, Milford, MA) were coated with polyclonal
antibody recognizing equine TNF‐α (PETFNAI, Endogen, Thermo‐Fisher Scientific, Pittsburg,
PA). The antibody was diluted 1:333 in carbonate buffer at pH 9.6 and 100 μl of antibody was
added to each well. The microtiter plates were incubated overnight at 4ºC, after which the
antibody was removed and the wells were filled with 100 μl of blocking buffer (1% BSA in 1X
PBS). The plates were incubated for 1h at room temperature. Then the plates were washed
three times with PBS containing 0.05% Tween 20 (PBST). Afterwards, 100 μl of each sample or
standard was added to triplicate wells, and the plates were incubated at 37 ºC for 2h. The
plates were washed three times with PBST. Biotin labeled polyclonal antibody against TNF‐a
(PETNFABI, Endogen) was diluted 1:277 in PBST, and 100 μl was added to each well. The plates
were incubated at 37 ºC for 90 min, after which they were washed three times with PBST.
Next, 100 μl of avidin‐horseradish peroxidase conjugate, (Pharmingen, BD, Franklin Lake, NJ)
diluted 1:5000 in PBST containing 0.5% bovine serum albumin, (Sigma, St. Louis, MO) was
added to each well and incubated for 1h at room temperature. The plates were then washed
five times with PBST. Finally, 100 μl of substrate (2,20‐azino‐di‐(3‐ethylbenzthiazoline sulfonic
acid), Sigma A1888, ABTS) was added to each well. The plates were incubated for 30 min at
room temperature in the dark, and then read at 405 nm on an automated microplate reader
(Dynex MRX II, Dynex Technology, Inc., Chantilly, VA).
173

Universitatea de Științe Agricole și Medicină Veterinară Iași
Serum IL‐6 values were determined by using ELISA kits supplied by Abazyme, LLC, USA
(Catalog Number EL10023). This IL‐6 enzyme linked immunosorbent assay (ELISA) applies a
technique called a quantitative sandwich immunoassay. The microtiter plate provided in this
kit has been pre‐coated with a monoclonal antibody specific to IL‐6. Standards or samples are
then added to the appropriate microtiter plate wells with a biotin‐conjugated polyclonal
antibody preparation specific for IL‐6 and incubated. IL‐6 if present, will bind and become
immobilized by the antibody pre‐coated on the wells and then be “sandwiched” by biotin
conjugate. The microtiter plate wells are thoroughly washed to remove unbound IL‐6 and
other components of the sample. In order to quantitatively determine the amount of IL‐6
present in the sample, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each
microplate well and incubated. Avidin is a tetramer containing four identical subunits that
each has a high affinity‐binding site for biotin. The wells are thoroughly washed to remove all
unbound HRP‐conjugated Avidin and a TMB (3,3',5, 5' tetramethyl‐benzidine) substrate
solution is added to each well. The enzyme (HRP) and substrate are allowed to react over a
short incubation period. Only those wells that contain IL‐6, biotin‐conjugated antibody and
enzyme‐conjugated Avidin will exhibit a change in colour. The enzyme‐substrate reaction is
terminated by the addition of a sulphuric acid solution and the colour change is measured
spectrophotometrically at a wavelength of 450nm ± 2 nm. The concentration of IL‐6 in the
samples (pg/mL) is then determined by comparing the O.D. of the samples to the standard
curve. The minimum detectable level was 2pg/ml. Inter and intra assay coefficients were 5.8
and 6%, respectively and the recovery was 95%.
Blood was collected into sterile microcentrifuge tubes containing a solution of EDTA
and sodium meclofenamate (final concentration: 10 mM, Sigma, St. Louis, MO) for the
determination of prostaglandin concentrations. The samples were placed on ice for 10 min,
after which they were centrifuged at 1000g for 20 min at 4ºC. The plasma was then harvested
and stored frozen at –80 ºC until analysis. On the day, the assay was performed, 100 μl of
plasma was added to 900μl of methanol, vortexed for 30 seconds and then dried down by
evaporation. Concentrations of prostaglandins (13, 14‐dihydro‐15‐keto prostaglandin F2α)
were evaluated using the ACETM competitive enzyme immunoassay (Cayman Chemical, Ann
Arbor, MI).
2.8. Statistical analysis
The obtained data of the examined acute phase proteins were compared between
groups within different concentrations by using computer package of the statistical analysis
system (SAS, 1997). All data are presented as means ± standard error (S.E.) of the means.
3. RESULTS
3.1. Clinical signs
The observed clinical signs were in the form of pronounced sudden muscular
weakness and stiffness, depression, reluctant or unable to move, colic, anorexia, muscle
tremors and myoglobinuria. All clinical signs were recorded shortly after exercise. In addition,
rectal palpation of the diseased group revealed highly distended bladder in 14 horses.
3.2. Selected biochemical indicators in control and diseased horses
The data summarized in Table 1 included the activities of CK, AST and LDH. In
addition the table also contains the values of glucose, lactate, TAG, urea and creatinine in
control and diseased horses. The present findings (Table 1) revealed a significant (p≤ 0.05)
174

Lucrări Științifice – vol 53 seria Medicină Veterinară
decrease in the activities of CK, AST and LDH whereas the values of glucose, lactate, TAG, urea
and creatinine were significantly (p≤ 0.05) increase when compared with the control group.
Values of the other examined parameters (Table 1) remained unchanged significantly (p≤ 0.05)
in disease horses when compared with control group.
3.3. Electrolytes and vitamin E levels in control and diseased horses
The data of Table 3 included the values of calcium, sodium, potassium, phosphorus,
chloride, vitamin E and selenium in control and diseased horses. The value of calcium in
diseased horses (Groups 2) were significantly (p≤ 0.05) lower than the control horses. In the
contrary, the value of phosphorus in diseased horses (Groups 2) were significantly (p≤ 0.05)
higher than the control horses. Values of the other examined parameters (Table 3) remained
unchanged significantly (p≤ 0.05) in disease horses when compared with control group.
3.4. Oxidative stress markers and pro‐inflammatory mediators
The data of Table 2 included the activities of SOD and CAT in addition the table also
contains the values of GSH, TAC, NO, TNF‐ α, IL6 and PGF2‐ α and MDA in control and diseased
horses. The activities of SOD, CAT and TAC in diseased horses (Groups 2) were significantly (p≤
0.05) lower than the control horses. The values of MDA, TNF‐ α, IL6 and PGF2‐ α in diseased
horse were significantly (p≤ 0.05) higher than the control horses whereas the values of NO and
GSH were significantly (p≤ 0.05) lower in diseased horses when compared with the control
group.
Table 1: Selected biochemical indicators in control and diseased horses
Parameters Control Diseased
CK (IU L _1 ) 202.6 ± 9.9 25.450 ± 86.76 ٭
AST (IU L _1 ) 275.34 ± 6.6 30.990.0 ± 69.6٭
LDH (IU L _1 ) 501.45 ± 8.9 24.540.0 ± 58.6٭
Glucose (mmol L _1 ) 5.6 ± 1.2 9.5 ± 1.4٭
T3 (ng/dl) 0.26 ± 0.02 0.25 ± 0.03
Lactate (mmol L _1 ) 1.0 ± 0.12 8.8 ± 1.01٭
Total Protein (g/L) 66.8 ± 1.45 65.9 ± 1.66
Albumin (g/L) 28.88 ± 1.21 29.78 ± 0.56
Globulin (g/L) 34.45 ± 1.87 35.32 ± 1.98
TAG (mmol L _1 ) 1.0 ± 0.04 15.2 ± 0.56٭
Urea (mmol/l) 7.32 ± 0.52 11.54 ± 1.22٭
Creatinine (µmol/l) 118.43 ± 2.67 203.34 ± 6.45٭
*Means are significantly different at the level (p≤ 0.05).
175

Universitatea de Științe Agricole și Medicină Veterinară Iași
Table 2: Oxidative stress markers and pro‐inflammatory mediators in control and diseased
horses
Parameters Control Diseased
MDA (μmol/L) 1.0 ± 0.12 8.2 ± 0.12٭
CAT (U/mL) 1480.66 ± 543 612.32 ± 348.76٭
GSH (mg/dL) 2.8 ± 1.94 1.56 ± 0.22٭
TAC (mmol/l) 0.53 ± 0.39 0.23 ± 0.12٭
SOD (U/ml) 110 ± 6.26 66.23 ± 3.56٭
NO (µmol/L 1 ) 4.11 ± 0.66 3.12 ± 0.12٭
TNF‐α (pg/ml _1 ) 95.4 ± 15.22 310.6 ± 32.43٭
PGF2‐α (pg/ml _1 ) 22.54 ± 2.13 357.63 ± 9.59٭
IL6 (pg/ml _1 ) 1.4 ± 0.65 5.62 ± 2.32 ٭
*Means are significantly different at the level (p≤ 0.05).
Table 3: Electrolytes and vitamin E levels in control and diseased horses
Parameters Control
(n=10)
diseased
(n=20)
Calcium (mmol/L) 3.12 ± 0.23 2.13 ± 0.21٭
Sodium (mmol/L) 144.8 ± 7.23 143.8 ± 6.45
Phosphorus (mmol/L) 1.3 ± 0.11 1.9 ± 0.12٭
Potassium(mmol/l) 4.16 ± 0.12 4.2 ± 0.13
Chloride (mmol/L) 107.5 ± 8.21 106.68 ± 6.66
Selenium (μg/l) 109.6 ± 5.42 107.87 ± 7.91
Vitamin E (μmol/l) 6.77 ±1.32 6.67 ±1.52
*Means are significantly different at the level (p≤ 0.05).
4. DISCUSSION
In the current study, ER represented as when a conditioned horse is not worked and
kept on full feed high insoluble carbohydrates (such as grain), the horse will accumulate
carbohydrates in the muscles. If there is a sudden demand for work, the body cannot
adequately remove the rapidly accumulating lactic acid in the muscles. This in turn causes
vasospasms and ischemia which means essentially that the surrounding blood vessels "clamp
down" so that the lactic acid waste product cannot be removed. As a result, intracellular pH
drops; the disrupted, hard and crampy muscle was observed when a horse ties up. In addition,
ER is often seen following strenuous muscular exercise and is a response to intensive and
severe exercise. It is associated with damage to the muscle group predominantly involved in
the activity. The clinical signs observed in the present study are agree with previous
researches (Clarkson, 2002; Hamer, 1997; Knochel, 1990; 1993; Line and Rust, 1995;
Walsworth and Kessler, 2001)
The significant increase in serum CK, AST and LDH values suspected ER with respective
muscle damage (Valentine et al., 2001; Sjaastad et al., 2004). The present results come in
accordance with previous studies (Hosie et al., 1986; Whitwell et al., 1988; Brandt et al., 1997;
Palencia and Rivero, 2007; Votion et al., 2007). Phosphocreatine is relatively short‐lived power
source that is effective at generating ATP rapidly. It has a high‐energy phosphate group that is
donated to ADP to produce ATP. It is used at the beginning of exercise to maintain high ATP
levels during muscle contraction. Creatine kinase is the enzyme that catalyzes the conversion
of phosphocreatine and ADP to creatine and ATP. Phosphocreatine stores are depleted more
quickly in fast twitch muscle fibers since they have a higher rate of ATP utilization (Ivy et al.,
176

Lucrări Științifice – vol 53 seria Medicină Veterinară
1981). In the horse Phosphocreatine levels are decreased about 50 to 70% during high
intensity exercise (Valberg and Essen‐Gustavson, 1987).
Elevated AST levels are also an indicator of muscle damage associated with
recumbence (Skenderi et al., 2006; Valentine & Löhr, 2007). Elevated levels of AST are also
thought to be indicative of liver damage (Nyblom et al., 2004). In the cell, AST is involved in
formation of adenosine triphosphate (ATP; Pesch et al., 2006). The reported significant
increase in glucose, lactate and triglycerides levels in diseased horses than that of the control
perhaps attributed to increase the rate of glycogenolysis, glycolysis and lipogenesis,
respectively. Feeding high insoluble carbohydrates to horses during rest increased the rate of
glycogen storage. After rest period and when the animal exercised the animal get the energy
through mobilization of glucose from glycogen storage site (glycogenolysis) followed by
oxidation of the obtained glucose (glycolysis). In addition, gluconeogenesis may be activated.
These mechanisms were enough to supply energy. Moreover, the excess glucose perhaps was
used in synthesis of triacylglycerol (lipogenesis). This interpretation underlined by the
reported significant increase in triacylglycerol of diseased horse in the present study. The
reported increase in glucose, lactate and triacylglycerol was reported previously in horse
(Westermann et al., 2007). The significant increase in urea and creatinine level in diseased
horses (Table‐1) indicated renal damage. These findings disagree with those obtained by
Clarkson (2006) who reported that, the renal system may not be affected in diseased horse.
Electrolytes are body salts that maintain an electrical gradient across muscle cell
membranes. During exercise, muscles contract when nerves stimulate a change in the
electrical gradient and electrolytes move across the cell membrane. Muscle cells contain high
concentrations of the electrolytes potassium and phosphate and low concentrations of
sodium, chloride, and calcium (Radostits, et al., 2007). If the ion pumps (sodium/potassium,
calcium/magnesium and calcium/ATPase) in the membrane surrounding the muscle cell which
move substrates in and out of the cell are disrupted, the interior environment of the muscle
cells either cannot get rid of waste products of metabolism or has too much of a metabolic
substrate to be able to function or can't get enough of a metabolic substrate to be able to
function. Therefore, the muscle cell simply shuts down. When muscle cells shut down, they
don't do so in the relaxed position, they freeze up in the contracted position, which resulted in
rock‐hard muscles. Biochemically, it's not all that different from rigor mortis.
The reported hypocalcemia in the present study perhaps shared in generation of ER.
The hypocalcemia as a suggesting cause of ER was reported before (Assmann et al., 1933 and
Jacobson et al., 1991).
It was suggested that, similar to other species, a dietary vitamin E and selenium
deficiency might cause muscle damage in ER horses. Vitamin E and selenium act to protect
muscles from oxygen free radicals that can be generated with exercise. However, the present
study did not reported changes in vitamin E and selenium level between diseased and healthy
control horses. Therefore, either vitamin E or selenium deficiencies were avoided as a cause of
ER in the present work. Documented cases of a selenium‐responsive muscle disease were
reported in foals from several countries with low selenium soil content in the 1970s. The
association with muscle disease led to the recommendation that horses with ER should be
given a selenium and vitamin E supplement. Although selenium deficiency may not be the
primary cause for ER, many practitioners report a decrease in the severity of tying‐up when
horses receive vitamin E and selenium supplementation. This may be due to the fact that
horses generate more toxic free radicals with the ER syndrome and therefore have a greater
need for supplementation. Another possibility is enzymatic antioxidant activity might be
177

Universitatea de Științe Agricole și Medicină Veterinară Iași
higher in horses and protect the non enzymatic system from depletion. This underlined by the
reported decrease in SOD and CAT of diseased horses (Nathalie et al., 2008).
The significant decrease of SOD, CAT, TAC, GSH and NO in diseased horse attributed
to the depletion of antioxidant system to counteract the oxidative stress and reactive oxygen
species. In the equine species, an exercise‐induced imbalance in favor of oxidants has been
described in several experimental studies (Mills et al., 1997; Art et al., 1999; Deaton et al.,
2002; Kirschvink et al., 2002) as well as in field investigations (Balogh et al., 2001; White et al.,
2001; Hargreaves et al., 2002; Marlin et al., 2002). The production of NO plays a vital role in
the regulation of physiologic processes, and both proinflammatory and anti‐inflammatory
effects have been described for this molecule. NO is a biologic gas produced by almost all
tissues. Recently it has been demonstrated that NO has an important role in muscle physiology
(Balon et al., 1994) and may influence both contractile function and muscle metabolism. A
physiologic role as a vasodilatory regulator in skeletal muscle has been established for NO, and
in that way it increases O2 and nutrient supply to the muscle.
The significant decrease in the above discussed antioxidant system was underlined
by the significant increase of MDA, TNF‐ α, IL6 and PGF2‐α in diseased horse indicated lipid
peroxidation resulted from ER. Pro‐inflammatory molecules (TNF‐ α, IL6) have been reported
to increase with strenuous exercise (Lee and Clarkson 2003). Furthermore, tissue damage and
repair processes may involve the expression of inflammatory cytokines (TNF‐ α, IL6). Cytokines
can act directly on target cells or they may stimulate the creation of secondary mediators such
as other cytokines, PGF2‐α or free oxygen radicals.
Since some exercise‐related pathologic conditions are considered inflammatory
processes (Lee and Clarkson, 2003), the present work designed to examine some pro‐
inflamatory cytokines and prostaglandin in ER cases. To the authors knowledge this is the first
study to demonstrate the use of pro‐inflammatory cytokines (IL‐6 and TNF‐ α) and PGF2‐α
concentrations as biomarkers of ER. Similar significant increases in TNF‐ α, IL6 and PGF2‐α in
horse of ER were reported in case of equine osteoarthritis (Ley et al., 2009), equine laminitis
(Stewart, 2009), strenuous exercise in equine (Donovan et al., 2007) and others (for details see
Art and Lekeux, 2005).
5. CONCLUSION
Interestingly, the examined pro‐inflammatory cytokines (TNF‐ α, IL6) and PGF2‐α
concentrations could be added to other traditional biomarkers (CK, AST and LDH) used for the
diagnosis of ER in Arabian horses. In the future, efforts should be made to confirm this in other
breed. If this could be achieved, it would yield a valuable tool to diagnose ER and would open
up new perspectives in research fields dealing with ER not only in animals, but also in humans.
6. Bibliography
1. Aebi, H. 1984. Catalase in vitro. Methods Enzymol. 105, 121‐126.
2. Art, T., Kirschvink, N., Smith, N., Lekeux, P., 1999. Indices of oxidative stress in blood and
pulmonary epithelium lining fluid in horses suffering from recurrent airway obstruction.
Equine Veterinary Journal 31, 397–401.
3. Assmann H, Bielenstein H, Hobs H. 1933. Beobachtungen und untersuchungen bei der
haffkrankheit. Dtsch Med Wochenschr 59, 122–6.
4. Balogh, N., Gaal, T., Ribiczeyne, S., Petri, A., 2001. Biochemical and antioxidant changes in
plasma and erythrocytes of pentathlon horses before and after exercise. Veterinary
Clinical Pathology 30, 214–218.
178

Lucrări Științifice – vol 53 seria Medicină Veterinară
5. Balon, T., Nadler, L., 1994. Nitric oxide release is present from incubated skeletal muscle
preparations. Journal Applied Physiology 77, 2519–2521.
6. Brandt, K., Hinrichs, U., Glitz, F., Landes, E., Schulze, C., Deegen, E., Pohlenz, J., Coenen,
M., 1997. Atypische myoglobinurie der weidepferde. Pferdeheilkunde 13, 27–34.
7. Clarkson, M., 2002. Exertional rhabdomyolysis: myths and madness. The American Journal
of Sports Medicine 4, 155‐156.
8. Clarkson, M., Thompson, S., 2000. Antioxidants: what role do they play in physical activity
and health? American Journal of Clinical Nutrition 72, 637S–646.
9. Clarkson, P., 2006. Case report of exertional rhabdomyolysis in a 12 year old boy.
Medicine and Science in Sports Exercise 38, 197–200.
10. Coles, H., 1974. Veterinary Clinical Pathology. W.B. Saunders Co., Philadelphia, London,
Toronto.
11. Deaton, M., Marlin, J., Roberts, A., Smith, N., Harris, A., Kelly, J., Schroter, C., 2002.
Antioxidant supplementation and pulmonary function at rest and exercise. Equine
Veterinary Journal 34, 58–65.
12. Donawick, J., Ramberg, F., Paul, R. Hiza, A., 1975. The diagnostic and prognostic value of
lactate determinations in horses with acute abdominal crisis. Journal of the South African
Veterinary Association 466, 127.
13. Donovan, D., Jackson, C., Colahan, P., Norton, N., and Hurley, D., 2007. Exercise‐induced
alterations in pro‐inflammatory cytokines and prostaglandin F2α in horses. Veterinary
Immunology and Immunopathology 118, 263‐269.
14. Douglas C. Christie A., Patrick T., Natalie N., and David J., 2007. Exercise‐induced
alterations in pro‐inflammatory cytokines and prostaglandin F2a in horses. Veterinary
Immunology and Immunopathology 118, 263–269.
15. Doumas, T., Bayson, D., Carter, J., Peters, T., Schaffer, R., 1981. Estimation of total serum
protein. Clinical Chemistry, 27, 1642‐1643.
16. Faulker, R. and Meites, S., 1982. Selected Method of clinical chemistry 9, 185.
17. Firshman, M., Valberg, S., Bender, J., Finno, C., 2003. Epidemiologic characteristics and
management of polysaccharide myopathy in Quarter Horses. American Journal of
Veterinary Research 64, 1319–1327.
18. Flannery, R., Little, C., Hughes, C., Curtis, C., Caterson, B., Jones, S., 2000. IL‐6 and its
soluble receptor augment aggrecanase‐mediated proteoglycan catabolism in articular
cartilage. Journal of Biology 19, 549‐553.
19. Fridovich, I., 1995. Superoxide radical and superoxide dismutase. Annual Review of
Biochemistry 64, 97–112.
20. Friedman, B. et al., 1980. Clinical chemistry, 26:1D.
21. Friedman, B., Young, D., 1997. Effects of Disease on Clinical Laboratory Tests, 3rd Edition,
AACC Press, Washington, D.C.
22. Goldring, B., 2000. Osteoarthritis and cartilage: the role of cytokines. Current
Rheumatology Reports 2, 459‐465.
23. Hamer, R., 1997. When exercise goes awry: exertional rhabdomyolysis. Southern Medical
Journal 90, 548‐551.
24. Hargreaves, J., Kronfeld, S., Waldron, N., Lopes, A., Gay, S., Saker, E., Cooper, L., Sklan, J.,
Harris, A., 2002. Antioxidant status and muscle cell leakage during endurance exercise.
Equine Veterinary Journal 34, 116–121.
179

Universitatea de Științe Agricole și Medicină Veterinară Iași
25. Harris, A., and Snow, H., 1991. Role of electrolyte imbalances in the pathophysiology of
the equine rhabdomyolysis syndrome. In: Equine Exercise Physiology 3 ed. SGB Persson, A
Lindholm and LB Jeffcott. ICEEP Publications, Davis CA, pp 435‐442.
26. Henry, B., 1984. Clinical Diagnosis and management, 17 th edition, Saunder Publisher.
Elecsys triiodothyronine (11731360122) and thyroxine (12017709122), Cobas, 2005,
Roche, Diagnostics, GmbH, D, 68298, Mannheim.
27. Hosie, D., Gould, W., Hunter, R., Low, C., Munro, R., Wilson, C., 1986. Acute myopathy in
horses at grass in east and south east Scotland. Veterinary Record 119, 444–449.
28. Ivy J.L., D.L. Costill, P.J. Van Handel, D.A. Essig, and R.W. Lower. 1981. Alteration in the
lactate threshold with changes in substrate availability. Int. J. Sports Med. 2, 139.
29. Jacobson H, Striker G, Klahr S., 1991. Biochemical alterations in advanced uremic failure.
In: Jacobson H, Striker G, Klahr S, editors. The principles and practice of nephrology.
Philadelphia (BC): Decker; p. 682–689.
30. Jenkins, R., 2000. Exercise and oxidative stress methodology: a critique. American Journal
of Clinical Nutrition 72, 670S–674.
31. Jikko, A., Wakisaka, T., Iwamoto, M. et al., 1998. Effects of interleukin‐6 on proliferation
and proteoglycan metabolism in articular chondrocyte cultures. Cell Biology International
22, 615–621.
32. Jones, S., 2005. Directing transition from innate to acquired immunity: defining a role for
IL‐6. Journal of immunology 175, 3463–3468
33. Jones, W., 2003. Nutritional Support for Rhabdomyolysis. Journal of Equine Veterinary
Science, 23, 325‐326.
34. Kirschvink, N., Art, T., de Moffarts, B., Smith, N., Marlin, D., Roberts, C., Lekeux, P., 2002.
Relationship between markers of blood oxidant status and physiological variables in
trained and heaves‐affected horses after exercise. Equine Veterinary Journal 34, 159–164.
35. Knochel, P., 1990. Catastrophic medical event with exhaustive exercise: white collar
rhabdomyolysis. Kidney International 38, 709‐719.
36. Lee, J., Clarkson, M., 2003. Plasma creatine kinase activity and glutathione after eccentric
exercise. Medicine & Science in Sports & Exercise 35, 930–936.
37. Leeuwenburgh, C., Heinecke, J.W., 2001. Oxidative stress and antioxidants in exercise.
Current Medicinal Chemistry 8, 829–838.
38. Ley, C., Ekman, S., Ronéus, B., Eloranta L., 2009. Interleukin‐6 and high mobility group box
protein‐1 in synovial membranes and osteochondral fragments in equine osteoarthritis
Research in Veterinary Science 86 , 490–497
39. Line, L. and Rust, S., 1995. Acute exertional rhabdomyolysis. American Family Physician
52, 502‐506.
40. Marlin, J., Fenn, K., Smith, N., Deaton, D., Roberts, A., Harris, A., Dunster, C., Kelly, J.,
2002. Changes in circulatory antioxidant status in horses during prolonged exercise.
Journal of Nutrition 132, 1622S–1627S.
41. Mates, M., 2000. Effects of antioxidant enzymes in the molecular control of reactive
oxygen species toxicology. Toxicology 153, 83–104.
42. Maughan, J., 1999. Role of micronutrients in sport and physical activity. British Medical
Bulletin 55, 683–690.
43. McKenzie, C., Valberg, J. Godden, S., Pagan, D., MacLeay, M., Geor, J., Carlson, P., 2003.
Effect of dietary starch, fat and bicarbonate content on exercise responses and serum
creatine kinase activity in equine recurrent exertional rhabdomyolysis. Journal of
Veterinary Internal Medicine 17, 693–701.
180

Lucrări Științifice – vol 53 seria Medicină Veterinară
44. Mills, C., Smith, C., Harris, C., Harris, P., 1997. Effect of allopurinol on the formation of
reactive oxygen species during intense exercise in the horse. Research in Veterinary
Science 62, 11–16.
45. Montgomery, C., and Dymock, J., 1961. The determination of nitrite in water. Analyst 86,
414–416.
46. Nathalie, K., Brieuc, M., Pierre, L., 2008. The oxidant/antioxidant equilibrium in horses.
The Veterinary Journal, 177, 178–191.
47. Nieman, C., 1997. Immune response to heavy exertion. Journal of Applied Physiology 82,
1385–1394.
48. Nishikimi, M., Appaji N., and Yogi. K., 1972. The occurrence of superoxide anion in the
reaction of reduced phenazine methosulfate and molecular oxygen. Biochemistry and
Biophysics Research Commnication 46, 849‐854
49. Nyblom H., Bergren, U., Balldin, J., Olsson, R., 2004 High AST/ALT ratio may indicate
advanced alcoholic liver disease rather than heavy drinking. Alcohol & Alcoholism 39,
336–339.
50. Ohkawa, H., Ohishi, W. and Yagi, k., 1979. Assay for lipid peroxides in animal tissues by
thiobarbituric acid reaction. Analytical Biochemistry. 95,351‐358.
51. Palencia, P., Rivero, L., 2007. Atypical myopathy in two grazing horses in northern Spain.
Veterinary Record 161, 346–348.
52. Paolisso G, D’Amore A, Giugliano D, Ceriello A, Varrichio M, Dı´Onofrio F. 1993.
Pharmacologic doses of vitamin E improve insulin action in healthy subjects and non‐
insulin‐dependent diabetic patients. American Journal of Clinical Nutrition 57, 650–6.
53. Pesch, S., Bermann, M. & Bostedt, H. 2006. Determination of some enzymes and macro‐
and microelements in stallion seminal plasma and their correlations to semen quality.
Theriogenology 66, 307‐313.
54. Radostits, M., Blood, C., Gay, C., 2007. Veterinary Medicine, A Textbook of disease of
cattle, sheep, pigs, goat and horses. 10th Ed., SAUNDERS, ELSEVIER, Edinburgh, London,
New York, Oxford, Philadelphia, St Louis, Sydney, Toronto.
55. Reitman, M., and Frankel, S., 1957. A colorimetric method for determination of serum
glutamic oxaloacetic and glutamic pyruvic transaminase. American Journal of Clinical
Pathology 28, 56.
56. SAS, 2001. Statistical analysis system. In: Users Guide: Statistics. SAS Institute.
57. Shingu, M., Nagai, Y., Isayama, T., Naono, T., Nobunaga, M., and Nagai Y., 1993. The
effects of cytokines on metalloproteinase inhibitors (TIMP) and collagenase production by
human chondrocytes and TIMP production by synovial cells and endothelial cells. Journal
of Clinical Experimental Immunology 94, 145–149.
58. Shingu, M., Miyauchi, S., Nagai, Y. et al., 1995. The role of IL‐4 and IL‐6 in IL‐1‐dependent
cartilage matrix degradation. British Journal of Rheumatology 34, 101–106.
59. Sies, H., 1991. Oxidative stress: introduction. In: Sies, H. (Ed.), Oxidative Stress: Oxidants
and Antioxidants. Academic Press, London, pp. XV–XXII.
60. Sjaastad, V., Hove, K., Sand, O., 2004. Physiology of Domestic Animals. Oslo, Scandinavian
Veterinary Press. 266‐267.
61. Skenderi, K., Kavouras, S., Anastasiou, C., Yiannakouris, N. & Matalas L., 2006. Exertional
Rhabdomyolysis during a 246‐km continuous running race. Medicine & Science in sports
and exercise 38, 1054‐1057.
62. Stewart J., Pettigrew A , Cochran A., and Belknap J., 2009. Indices of inflammation in the
lung and liver in the early stages of the black walnut extract model of equine laminitis.
Veterinary immunology and immunopathology 129, 254‐260.
181

Universitatea de Științe Agricole și Medicină Veterinară Iași
63. Tabacco, A., Meiathini, F., Moda, E., Tarli, P., 1979. Simplified enzymic / colorimetric
serum urea nitrogen determination. Clinical Chemistry 25, 336‐337.
64. Tietz, N., 1995. Clinical Guide to Laboratory Tests, 3 rd Edition, W.B. Saunders, Philadelphia,
PA).
65. Trinder, P., 1969. Determination of glucose in blood using glucose oxidase with alternative
oxygen acceptor. Analytical Clinical. Biochemistry 6, 24.
66. Valberg, S., and B. Essen‐Gustavsson. 1987. Metabolic response to racing determined in
pools of type I, IIA, and IIB fibers. In: Gillespie JR, Robinson, NE, eds. Equine Exercise
Physiology 2. p. 290. Davis, CA. ICEEP publications.
67. Valberg, J., MacLeay, M., Mickelsen, R., 1997. Exertional rhabdomyolysis and
polysaccharide storage myopathy in horses. Compendium on Continuous Education for
the Practical Veterinarian 19, 1077–1085.
68. Valentine, A., and Löhr, V., 2007. Myonecrosis in three horses with colic: evidence for
endotoxic injury. The veterinary Record 161, 786‐789.
69. Valentine, A., McDonough, P., Chang, F., Vonderchek, A., 2000. Polysaccharide storage
myopathy in Morgan, Arabian, and Standardbred related horses and Welsh‐cross ponies.
Veterinary Pathology 37, 193–196.
70. Valentine, A., Van Saun, J., Thompson, N., Hintz, F., 2001. Role of dietary carbohydrate
and fat in horses with equine polysaccharide storage myopathy. American Veterinary
Medical Association 219, 1537‐1544.
71. Votion, M., Linden, A., Saegerman, C., Engels, P., Erpicum, M., Thiry, E., Delguste, C.,
Rouxhet, S., Demoulin, V., Navet, R., Sluse, F., Serteyn, D., Van Galen, G., Amory, H., 2007.
History and clinical features of atypical myopathy in horses in Belgium (2000–2005).
Journal of Veterinary Internal Medicine 21, 1380–1391.
72. Walsworth, M., and Kessler, T., 2001. Diagnosing exertional rhabdomyolysis: a brief
review and report of two cases. Military Medicine 166, 275‐277.
73. Westermann, M., De Sain‐van der Velden, M., Van der Kolk, H., Berger, R. Wijnberg, D.,
Koeman, P., Wanders, A., Lenstra, A., Testerink, N. Vaandrager, B., Vianey‐Saban, C.,
Acquaviva‐Bourdain, C., Dorland L., 2007. Equine biochemical multiple acyl CoA
dehydrogenase deficiency (MADD) as a cause of rhabdomyolysis. Molecular Genetics and
Metabolism 91, 362–369.
74. White, A., Estrada, M., Walker, K., Wisnia, P., Filgueira, G., Valdes, F., Araneda, O., Behn,
C., Martinez, R., 2001. Role of exercise and ascorbate on plasma antioxidant capacity in
thoroughbred race horses. Comparative Biochemistry and Physiology. Part A: Molecular
and Integrative Physiology 128, 99–104.
75. Whitwell, E., Harris, P., Farrington, G., 1988. Atypical myoglobinuria: an acute myopathy in
grazing horses. Equine Veterinary Journal, 20, 357–363.
76. Wootton, P., 1982. Microanalysis in Medical Biochemistry 6 th Ed. Churchill, LTD. London
pp. 107.
77. Wroblewski, F., and Duean, S., 1955. Bestimmung der Aktivital der lactate dehydrogenase.
Proceedings of Society of Experimental Biology, 90, 210‐214.
78. Young, S., Thomas, W., Friedman, B., Pestaner, C., 1972. Effects of drugs on clinical
laboratory tests. Clinical Chemistry 18, 1041–1303.
79. Zentek, J., 1991. Myopathies in a riding horse stable. Tierarztl Prax.19, 167‐9.
182

THE PARS DISTALIS (ANTERIOR PITUITARY) IN ONE‐HUMPED
CAMEL (CAMELUS DROMEDARIUS ) : A MORPHOLOGICAL STUDY
IHAB EL_ZOGHBY 1* , AHME D KASSAB 2
1 Department of Histology and Cytology, 2 Department of Anatomy and
Embryology and, Faculty of Veterinary Medicine (Moshtohor), Benha University, Egypt;
*Corresponding author: 1
INTRODUCTION
E‐mail: ihabyara@yahoo.com
Abstract : Fourteen pars distalis of one‐humped camels (Camelus dromedarius) were studied
using light, scanning and transmission electron microscopes. Camels (9 males and 5 females)
ranged from three to five years of age were used in this study. The pars distalis were principally
composed of clusters of tightly‐packed cells in the form of anastmosing cords. The cells were
separated from each other by collagen fibers and sinusoids of various sizes. The pars distalis of
camels included the following cells: mammotrophs, somatotrophs, gonadotrophs,
corticotrophs, thyrotrophs and folliculo‐stellate cells. Somatotrophs were the most abundant
secretory cells and were readily identifiable by their large homogeneously dense secretory
granules. The gonadotrophs contain small secretory granules. Corticotrophs were angular in
outline and occasionally possessed finger‐like projections. Thyrotrophs were few in number
and contain small scattered secretory granules. The folliculo‐stellate cells were small and
contained no secretory granules.
The present study showed that the camel pars distalis has five secretory and one non‐secretory
cell types, which could be easily differentiated from each other by the number and size of their
secretory granules.
Key words: Pars distalis; Camel; Scanning; Transmission Electron Microscope.
It is well known that the mammalian pituitary gland consists of two structurally distinct
lobes, the adenohypophysis and the neurohypophysis. The adenohypophysis consists of the
pars distalis, pars intermedia and pars tuberalis (Hanstrom, 1966; Daniel and Prichard, 1975).
The pars distalis forms the main body of the pituitary gland and consists of several types
of endocrine cells that secrete at least six trophic hormones (Webb, 1982). The
histomorphology of the pars distalis has been studied in various domestic species (Delmann,
1971); in horse (Harrison and Sharyock, 1940; Webb, 1982); in bovine (Dawson, 1948;
Bassett, 1951; Cupps et al., 1954; Jubb and McEntee, 1955); in buffaloes (Roy, 1970; Das,
1979); in small ruminants (Trautmann and Fiebiger, 1957; Webb, 1981); in the goat (Singh,
1971; Khatra and Nanda, 1981; Gomez et al., 1989) and in the dog and cat (Das, 1971; Girod
and Lheritier, 1986). However, there are no available reports that describe the pars distalis in
the camel.
The secretory cells of pars distalis secret at least six hormones: growth hormone (GH),
prolactin, adrenocorticotrphic hormone (ACTH), thyroid‐stimulating hormone (TSH),
183

Lucrări Științifice – vol 53 seria Medicină Veterinară
luteinizing hormone (LH) and follicle‐stimulating hormone (FSH). Each hormone, with the
exception of LH and FSH, is produced by separate cell type (Moriarity, 1973; Nakane, 1975).
Each cell type appears to be similar in many mammalian species (Foster, 1971; Farquhar,
Skutelsky and Hopkins, 1975). Many of the different cell types can be identified by their
ultrastructural morphology; particularly by the size of their secretory granules (Webb, 1981).
But there are no studies that dealt with the identification of cell types in the pars distalis of
the dromedary camel (Camelus dromedarius)
The two objectives of this study were: firstly, to elucidate a detailed description of the
pars distalis in the hypophysis of dromedary camel (Camelus dromedarius) by Scanning
electron microscopy (SEM) and transmission electron microscopy (TEM). Secondly, to compare
the camel’s pars distalis cell types with pars distalis cells in other domestic animals.
MATERIALS AND METHODS
Nine adult male and five female camels (Camelus dromedarius) ranged from three to
five years of age were used in this study. Samples were obtained from Benha and Toukh
slaughterhouses in Egypt. Each pituitary gland was quickly removed from its fossa. The pars
distalis were isolated from each pituitary gland and was cut into 1 mm blocks.
For light microscopy, the tissues were fixed in 10% neutral buffered formalin solution
then dehydrated, cleared, embedded and cut at 4‐5 microns. The tissues stained with H&E and
Crossmon’s trichrome stain according to the methods described by Crossman (1937) and
Bancroft, Cook, Stirling, and Turner (1994).
The scanning electron microscopy study was made in Faculty of Agriculture, Alazhar
University, Egypt. The specimens were dehydrated in ascending grades of alcohols, isopentyl
acetate for 2‐3 days, critical point dried with carbon dioxide, mounted on aluminum holders
and coated with gold in a sputtering device. Finally, the structures were examined using a
JEOL JSM 5500 LV SEM.
The transmission electron microscopy was made in Almasa Military Veterinary Hospital
in Egypt. Small pieces of camel pars distalis were fixed in 2.5% gluteraldehyde solution with
0.1 M phosphate buffer (pH 7.4) for 24‐48 hours, post fixed in 2% osmic acid for 2 hours,
dehydrated in ascending grades of alcohols and immersed in propylene oxide. Finally, they
were embedded in Epoxy resin. The block was polymerized for 24 hours at 70 ○ C. semithin
sections (0.4 µm) were cut with glass knives on an ultramicrotome and stained with 0.3 %
toludine blue for light microscopy to determine the orientation of the specimen. The ultrathin
sections (70 nm) were cut, mounted on copper mesh grids (No. 200) and stained with
saturated solution of uranyl acetate dihydrate. Then, the sections were examined with SEO
Electron Microscope. The sizes of granules were determined using the SemAfore software.
RESULTS
The parenchymal cells of the pars distalis were appeared in clusters of tightly‐packed
cells. The cells were arranged in anastmosing cell cords of (Fig. 1) with variable thickness.
These cells were covered externally by connective tissue capsule (Fig. 2) and were separated
from each other by collagen fibers and sinusoids of various sizes which were lined with
endothelium (Fig. 3).
184

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 1. Photomicrograph of camel pars distalis illustrating cord like arrangement of cells (C) and
in between sinusoidal vessels (S). The acidophil (A) can be distinguished easily from basophil
(B). The pars distalis faces cavum hypophysis (H). H&E. X 200.
Fig. 2. Scanning electron micrograph of camel pars distalis showing connective tissue capsule
(arrows) that surrounding the parenchymal cells (C) and sinusoids (S).
Fig. 3. Photomicrograph of camel pars distalis stain with Crossman’s trichrome showing the
distribution of the collagen fiber (arrows) among the cell clusters (C) and blood sinusoids (S).
X400.
185

Lucrări Științifice – vol 53 seria Medicină Veterinară
There were blood vessels (Fig. 4) between the secretory cells of pars distalis. The wall
of the blood vessels was reinforced with a tough collagen fiber and fine scattered fibrils were
also observed (Fig. 5). The cells were a mixture of secretory with typical details of protein
secreting cells and non‐secretory cell types. The clusters were surrounded by a network of
capillaries. The pars distalis of camels included the following cells: mammotrophs,
somatotrophs, gonadotrophs, corticotrophs, thyrotrophs and folliculo‐stellate cells.
Fig. 4. Scanning electron micrograph showing a blood vessel (BV) in the camel pars distalis
containing blood cells (b) which adjacent to secretory cells (C).
Fig. 5. High magnification Scanning electron micrograph of large blood vessels. Collagen fibrils
(c) are randomly distributed along its longitudinal axis. Secretory granules (G) were seen
adjacent to the blood vessel and blood cells (b).
Mammotrophs and somatotrophs
The mammotrophs and somatotrophs were difficult to distinguish from each other
because of their similarity. Somatotrophs were the most abundant secretory cells and tended
to be found in groups within a cluster. They were readily identifiable because they contained
large homogeneously dense secretory granules. The granules were generally round to ovoid
and were scattered either throughout the cytoplasm or concentrated near that part of the
186

Universitatea de Științe Agricole și Medicină Veterinară Iași
peripheral cell membrane (Fig. 6 & 7). They were distributed throughout the gland, but with a
relatively higher concentration in the antero‐ventral area. Lower concentration of these cells
was founded in the dorso‐posterior area. The diameter of the cells varied and the sizes of the
secretory granules ranged from 400‐ 1100 nm (Fig. 8).
Fig. 6. Transmission electron micrograph of mammotrophs or somatotrophs from camel pars
distalis. Note the nucleus (N) and the dense secretory granules (G) are concentrated near the
peripheral cell membrane. A blood vessel (BV) was seen with blood cells (b). Scale bar: 5 µm.
Fig. 7. Scanning electron micrograph from camel pars distalis showing various shape and size
of secretory granules.
187

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 8. Transmission electron micrograph of secretory granules
in somatotrophs of camels pars distalis. Note the granules
are of high number, large size and density packed. Scale bar: 2 µm
Gonadotrophs
The shape of gonadotrophs varied from angular to ovoid and may be irregular in
shape (Fig. 9). Their size and secretory granule number were varied according their activity.
The secretory granules were smaller, rounder and their diameters were ranged between
about 250 to 850 nm in diameter. These cells were often larger than the somatotrophs and
mammotrophs. The cells had a variable number of mitochondria and attached with neighbor
cells by junctional complex. The number of secretory granules was quite variable between one
cell and another.
The secretory granules in gonadotrophs of camel's pars distalis were darker and
denser than those of the somatotrophs and mammotrophs (Fig. 10). The rough endoplasmic
reticulum was sparsely distributed. The cytoplasm contained many free ribosomes.
Fig. 9. Transmission electron micrograph of gonadotrophs from camel pars distalis containing
small scattered secretory granules (G). Junctional complexes (arrows) were seen between
cells. The nucleus (N) and mitochondria (M) are seen. Scale bar: 5 µm.
188

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 10. Transmission electron micrograph of secretory granules in gonadotrophs of camels
pars distalis. Note the granules are of few in number and small in size. Scale bar: 2 µm
Corticotrophs
Corticotrophs were few in number and variable in size. They were usually angular in
outline and occasionally possessed finger‐like projections (Fig. 11). The projections, which
extended between adjacent cells, contained few organelles other than secretory granules. The
corticotrophs contained variable numbers of secretory granules scattered throughout the
cytoplasm. The granules were usually round, with diameters ranging between 150 to 300 nm.
Fig. 11. Transmission electron micrograph of camel pars distalis containing corticotrophs (Co)
surrounded by somatotrophs (So) and gonadotrophs (Go). The corticotrophs has angular
189

Lucrări Științifice – vol 53 seria Medicină Veterinară
profile with small secretory granules. Sinusoid (S) is also seen. Scale bar: 5 µm
Thyrotrophs
The thyrotrophs were few in number. They were usually found between
gonadotrophs and somatotrophs. The shape of thyrotrophs was angular, ovoid or irregular in
outline. They contained variable numbers of small secretory granules and their sizes varied
from 100 to 250 nm (Fig. 12). The secretory granules were scattered throughout the
cytoplasm. The nucleus was round and eccentrically located.
Fig. 12. Transmission electron micrograph of thyrotrophs (Th) in the camel pars distalis. The
nucleus (N) is eccentric ovoid. Somatotrophs (So) and gonadotrophs (Go) are seen. Scale bar:
5 µm.
Folliculo‐stellate cells
The folliculo‐stellate cells were small cells contained no secretory granules (Fig. 13)
and were distributed between the secretory cells. They possessed long slender cytoplasmic
processes which extended between adjacent cells. The nucleus was elongated ovoid or pear
shape. The cytoplasm of the folliculo‐stellate cells was dense and frequently contained many
free ribosomes, little rough endoplasmic reticulum, small Golgi complexes and few
mitochondria. The cells were either found alone, giving them a stellate appearance, or in
groups. When in groups they commonly formed follicles with junctional complexes joining one
cell to another near the luminal surface. The follicles varied in size and were usually found in
the centre of cell clusters. No secretory cells were observed lining the follicles.
190

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 13. Transmission electron micrograph of folliculo‐stellate cells (F) in the camel pars
distalis. The nucleus (N) is elongated. Corticotrophs (Co), gonadotrophs (Go) and Junctional
complexes (arrows) are seen. Scale bar: 5 µm
DISCUSSION
The pars distalis of the camel was composed of glandular cells enclosed by connective
tissue and surrounded by a capillary network, like other mammals as in cattle (Gasse et al.
1986; Fumagalli and Zanini, 1985); in goat (Khatra,et al., 1981) and in small ruminants
(Trautmann and Fiebiger, 1957 and Dellmann, 1971). These observations also support similar
findings in dog and pig ( Das, 1971).
The result of the present study showed that the density of solitary fibrils surrounding the
inner surface of vessels seemed to change according to the size. They are denser in the large
vessel and are sparser in the small vessels or sinusoids. It may be related to the structural
strength of vessels. These finding is agreement with Nishimura et al 2004 in the goat. Also the
sinusoids are generally distributed between the cluster according to the endocrine function of
the gland which also with agreement with Murray et al. (1997) in human and Townsend et al.
(2004) in equine.
Mammotrophs and somatotrophs were the easiest secretory cells to identify. Their
secretory granules were lagre and secttered over their cytoplasm, similar to that described by
Parry, McMillen, Robinson & Thorburn (1979) in sheep.
Our result revealed that the mammotrophs and somatotrophs are the most abundant
secertory cells in the camels pars distalis. While Farquhar et al. (1975) in rat and Foster (1971)
in rabbits observed that mammotrophs only were the most abundant secretory cell type. Such
cells were readily identifiable due to they were the largest of any pars distalis cell type and
their secretory granules are very large.
The gonadotrophs varied from angular to ovoid and may be irregular in shape, similar to
that mentioned by Nakane (1975).The aforementioned author observed that the shape of
gonadotrophs were large round or angular. Moriarty (1976) found that there were three
distinct cell types which contained LH and/or FSH and that their shapes varied from angular or
stellate to large and ovoid. Moreover, as secretory activity was increased and a cell lost its
population of granules, it became more angular or satellite.
191

Lucrări Științifice – vol 53 seria Medicină Veterinară
The present study showed that somatotrophs and gonadotrophs are completely different
by their size and secertory granules. On the other hand, Farquhar et al. (1975) recorded that
somatotrophs and gonadotrophs could not be differentiated and proved indistinguishable
from each other using morphological criterion of granule size.
Corticotrophs were also identified in this study. The cells exhibited all the characteristics
described by many authors following morphological and immunocytochemical studies in
several species (Siperstein & Allison, 1965; Foster, 1971; Moriarty, 1973; Farquhar et al.,
1975). The corticotrophs were not numerous, which is in agreement with the results of
Nakane, Setalo & Mazurkiewicz (1977), who found that the number of corticotrophs in rat
pituitary sections represented approximately 15% of the total secretory cell population.
The secretory granules of the thyrotrophs of the camel pars distalis are spherical,
numerous and distributed throughout the cytoplasm, in the way described by Shirasawa et al.
(1985) in the goat. The secretory granules show their characteristically small size, giving values
similar to those found by Shirasawa et al. (1985) especially in the female goat. These results
suggest that the size of the secretory granules in the camels tend to be larger than in other
species of mammals. The granule content is of a very variable density, which coincides to a
certain extent with the diversity which appears in other species. However Shirasawa et al.
(1985) observed them as being electrodense in the goat.
The folliculo‐stellate cells of the camel pars distalis that were described in this study
characterized by their shape, a granularity, relatively few mitochondria and poor development
of RER. On the other hand, Smith (1963) was the first to describe large stellate cells with
prominent cytoplasmic fibrillae in the guinea‐pig pituitary. Cells with similar ultrastructural
features have been described in the rabbit (Young, et al., 1965; Foster, 1971), in the rat
(Farquhar, 1971; Vila‐Porcile, 1972; Farquhar, Skutelsky & Hopkins, 1975) and in the deer
(Young & Chaplin, 1975).
Foster (1971) found the cells in the rabbit pituitary with numerous microfilaments and
microtubules. He speculated that the cells might be capable of movement and might be
concerned in the circulation of intracellular fluid. A phagocytic role has been disscused by
Young et al (1965) and Farquhar (1971).
The results for camel pars distalis demonstrate that specific identification techniques (e.g.
immunocytochemistry) are required to help identify or verify certain of the pars distalis cell
types.
REFERENCES
1. Bancroft, J. D.; Cook, H. C.; Stirling, R. W. and Turner, D. R. (1994): Manual of
histological techniques and their diagnostic application. 2nd. Churchill Livingston,
Edinburgh, London, Madrid, Melbourne, New York, and Tokyo.
2. Bassett, E. G. (1951): The anterior lobe of cattle pituitary. I. Quantitative cell type
variation in various normal and abnormal sexual conditions. J. Endocr. 7: 203‐214.
3. Crossman, G. (1937): A modification of Mallory connective tissue stain with a
discussion of the principals involved. Anat. Rec. 69: 33‐83.
4. Cupps, P. T.; Laben, R. C. and Mead, S. W. (1954): Histology of the pituitary, testis
and adrenal in relation to reproduction in the bull. Dairy Sci. 37: 1074‐1087.
5. Daniel, P.M. and Prichard, M.M.L. (1975) Studies of the hypothalamus and the
pituitary gland with special reference to the effects of transaction of the pituitary
stalk. Acta Endocrinologica, Suppl. 201.
6. Das, L. N. (1971): Quantitative and histochemical studies on age correlated changes
in canine and porcine hypophysis. Ph. D. Dissertation. Iowa University Library Ames.
192

Universitatea de Științe Agricole și Medicină Veterinară Iași
7. Das, L. N. (1979): Observation on subgross morphology of the hypophysis and
histomorphology of the neurohypophysis of Indian buffalo. Indian J. Anim. Sci. 49:
531‐ 542.
8. Dawson, A. B. (1948): The relationship of the pars tuberalis to the pars distalis in the
hypophysis of the rhesus monkey. Anat. Rec. 102: 103‐ 122.
9. Dellmann, H. D., (1971): Veterinary histology. Lea and Febiger, Philadlphia.
10. Dellmann H.D. and J. Eurell (1998) Textbook of Veterinary Histology 5 th Edition, pp
289‐291, Lippincott Williams and Wilkins, Philadelphia.
11. Farquhar, M. G. (1971): Processing of secretory products by cells of anterior pituitary
gland. Memoirs of the society for endocrinology. 19, 79‐122.
12. Farquhar, M. G.; Skutelsky, E. H.; and Hopkins, C. R. (1975): Structure and function of
the anterior pituitary and dispersed cells. In vitro studies. In ultrastucture in
bioological systems. Vol. 7 the anterior pituitary, pp83‐135. Eds A. Tixier‐ Vidal& M.G.
Farquhar. Academic Press, New York.
13. Foster, C. L. (1971): Relationship between ultrastructure and function in the
adenohypophysis of the rabbit. Mem. Soc. Endocr. 19, 125‐146.
14. Fumagalli, G. and Zanini, A. (1985): In cow anterior pituitary, growth hormone and
prolactin can be packed in separate granules of the same cell. J. cell Bio. 100: 2019‐
2024.
15. Gasse H. and Schwarz R.(1986): Chromophobe cells and their significance as
folliculostellate cells in the pars distalis adenohypophysis in cattle. Dtsch Tierarztl
Wochenschr. 7;93(5):224‐8.
16. Girod, C.; and Lheritier, M.; Trouillas, S.and Dubois, M. P. (1986): Cell types of the
pars distalis of the hedgehog (Erinaceus europaeus L.) adenohypophysis: cytological,
immunocytochemical and ultrastructural studies. 4 thyrotropic cells. Acta Anat. 127,
48‐52.
17. Gomez, M.A.; Navarro, J. A.; Gomez, S.; Camara, P.; Gomez, J. C. and Bernabe, A.
(1989): Cytological, immunocytochemical and ultrastructural study of the
adenohypophyseal pars distalis of the kid (Capra hircus): The TSH cell. Anat. Histol.
Embryol. 18: 305‐315.
18. Hanstrom, B. (1966): Gross anatomy of the hypophysis in mammals> in the pituitary
gland, Vol. 1 pp. 1‐57. Eds G. W. Harris & B.T. Donovan. Butterworth, London.
19. Harrison, B. and Sharyock, H. (1940): Cytogenesis in the pars distalis of the horse.
Anat. Rec. 78: 449‐471.
20. Jubb, K. V., and McEntee, K. (1955): Observations on the bovine pituitary gland. II.
Architecture and cytology with special reference to basophil cell function. Cornell Vet.
45: 593‐641.
21. Khatra, G.S. and Nanda, B. S. (1981): Age related changes in the histomorphology of
the adenohypophysis of the goat. Anat. Histol. Embryol. 10: 238‐245.
22. Moriarity, G. C. (1973): Adenohypophysis: utltrastructural cytochemistry (a review).
J. Histochem. Cytochem. 21:855‐894.
23. Moriarty, G. C. (1976): Immunocytochemistry of the pituitary glycoprotein hormones.
Journal of Histochemistry and Cytochemistry, 24, 846—863.
24. Murray, K.; De Lera, J. M.; Astudillo, A. and McNicol, A. M. (1997): Organization of
basement membrane components in the human adult and fetal pituitary gland and in
pituitary adenomas. Virchows Arch 431:329‐335.
193

Lucrări Științifice – vol 53 seria Medicină Veterinară
25. Nakane, P. F. (1975): Identification of anterior pituitary cells by immune‐electron
microscopy in: the anterior pituitary (A. Tixier‐ Vidal and M.G. FARQUHAR, eds.), PP.
45‐61. Academic Press, New York.
26. Nakane, P. K.; Setalo, G. and Mazurkiewicz, J. E. (1977): The origin of ACTH cells in
rat anterior pituitary. Ann. N. Y. Acad. Sci. 297: 201‐204.
27. Nishimura, S.; Tabata, S.; Nakamura, Y.; Okano, K. and Iwamoto, H. (2004): Three
dimension architecture and distribution of collagen components in the goat
hypophysis. Anat. Rec. I, 277: 275‐286.
28. Parry, D. M.; McMillen, I. C.; Robinson, J. S. and Thorburn, G. D. (1979):
immunocytochemical localization of prolactin and growth hormone in the prenatal
sheep pituitary. A morphological and quantitative study. Cell Tiss. Res. 197, 501‐514.
29. Roy, M. K. (1970): Histological and certain histochemical studies on the endocrine
glands of buffalo. M.V.Sc thesis Agra university library, Agra.
30. Shirasawa, N.; Kihara, H. and Yoshimura, F (1985): Fine structural and
immunohistochemical studies of goat’s adenohyopohysial cells. Cell tissue Res. 240,
315‐321.
31. Singh, Y. (1971): Morphogenesis of the pituitary gland in goat. Ph. D. Dissertation.
Haryana Agricultural University Library, Hissar.
32. Siperstein, E. R. and Allison, V. F. (1965): Fine structure of the cells responsible for
secretion of Adrenocorticotrophin in the adrenalectomized rat. Endocrinology, 76,
70‐79.
33. Smith, R. E. (1963): An electron microscopic study of the adenohypophysis of guinea
pig (abstract). Anat. Rec. 154: 352.
34. Townsend, J.; Sneddon, C. L. and Tortonese, D. J. (2004): Gonadotroph
heterogeneity, Density and Distribution, and Gonadotroph‐Lactotroph Association in
the Pars Distalis of the Male Equine Pituitary Gland. J. neuroendocrinology 16:432‐
440.
35. Trautmann, A. and Fiebiger, J. (1957): Fundamental of histology of domestic animals.
Translated and revised by Habel, R. E., and E. L. PIPERSTEIN, Cumstock publishing
associate, Ithaca.
36. Vila‐Porcile, E. (1972): Léraseau des cellules folliculo‐stellaires et nes follicules dé
I’adenohypophyse du rat (pars distalis). Z. Zellforsch. 129: 328‐369.
37. Webb, P. D. (1981): The pars distalis (anterior pituitary) sheep: an ultrastructural
study. J. devl. Physiol. 3: 319‐332.
38. Webb, P. D. (1982): Ultrastructural study of the development of the pars distalis
(anterior pituitary) in the foal. J. Reprod. Fert. Suppl. 32:583‐588.
39. Young, P. A., and Chaplin, R. E. (1975): Some observations on the ultrastructure of
the adenohypophysis of certain cervidae. J. Zoo. 175:493‐508.
40. Young P. A.; Foster, C. L. and Cameron, E. (1965): Some observations on the
ultrastructure of the rabbit. J. Endocrinology. 31: 279‐287.
194

LIGHT AND ELECTRON MICROSCOPE STUDIES OF THE ADRENAL
GLANDS OF THE EGYPTIAN GEESE
(ALOPOCHEN AEGYPTIACUS)
INTRODUCTION
Ihab M. EL‐Zoghby
Department of Histology and Cytology,
Faculty of Veterinary medicine (Moshtohor), Benha University, Egypt.
E‐mail: ihabyara@yahoo.com
ABSTRACT: Twenty mature and immature male and female Egyptian geese, ranged in age from
three to eighteen months, were used in this study. The adrenal glands of the Egyptian geese
were paired organs weighing approximately 200‐250 mg (7.5 mg/100 g body weight) and were
situated anterior to the kidneys on each side of the dorsal aorta and inferior vena cava. Each
adrenal gland was surrounded from outside by a connective tissue capsule. The interstitial
tissue was rich in blood vessels, collagen, and reticular fibers. The parenchyma cells of the
adrenal gland were arranged in cords especially at sub‐capsular zone (SCZ). Thin layers of
connective tissue separated these cords and there were two types of cells: acidophilic and
basophilic cells, which intermingle with each other and are separated by sinusoids. The
acidophilic cells were large, polyhedral to columnar in shape, with a highly vacuolated and
lightly stained acidophilic cytoplasm; while the cells of inner cords were large columnar and are
less vacuolated. Ultrastructurally, these cells could be classified into two types, according to
the amount of lipid droplets and mitochondria: cells that contained numerous lipid droplets
with few somewhat large globular mitochondria, and the other type were cells containing few
lipid droplets. Basophilic cells were bluish islets or scattered groups found in‐between the
acidophilic cells. According to the shape of the secretory granules, these cells could be
classified into two types: cells that contained homogenous, polymorphic electron dense
secretory granules, and cells that contained secretory granules of electron dense core
surrounded by hallow electron lucent coat. With the increasing the age of the geese, the
connective tissue capsule became thick and the interstitial tissue was increased. The
acidophilic cells of the inner zone were more vacuolated and less acidophilic and slightly
numerous in the peripheral, acidophilic cells than in those of the inner zones. The basophilic
cells appeared less vacuolated and were smaller.
Key words: Egyptian Geese, Adrenal gland, Light and Transmission Electron Microscope.
The role of the adrenal gland is more difficult to be evaluated in geese than in
mammals. The difficulties are partly related to the intermingling of the cortical and medullary
tissues. It is generally accepted that the cortex of the geese adrenal gland cannot be divided
into the three distinct zones (zona glomerulosa, zona fasciculata, and zona reticularis) as in its
mammalian counterparts (Gulmez, Kocamis, Liman and Kukner, 2004). The adrenal gland is
an indispensable endocrine organ; it is a complex organ concerned with the production of
multiple hormones and performs many kinds of physiological functions. The adrenal gland is
as important in birds as it is in mammals; and the removal of the adrenal gland in birds
eventually leads to death (Peng, Chen and Liang, 2005). Morphological studies of the adrenal
gland have been reported in pigeon
( Bhattacharyya, 1975), Canadian goose (Gulmez et al., 2004), and in Wanxi white geese
195

Lucrări Științifice – vol 53 seria Medicină Veterinară
(Wang, Zhu and Jin, 1999), in fowl (Siller, Teague and Mackenzie, 1975), in quail (Basha,
Vijayaragavan and Ramesh, 2004), in duck (Pearce, Cronshaw and Holmes, 1978) and in
African ostrich chicks (Li Tang, Peng, Wang, Luo, Cheng, Zhang, Sun, Liu, and Song, 2009).
However, little attention was paid especially to the morphology of the adrenal glands in
Egyptian geese, and the glands ultrastructure remains obscure.
The purpose of this study was to provide a concise account of general morphology,
the cellular and sub cellular structures of the adrenal glands in Egyptian geese, and to
compare them with those observations in other birds. This would hopefully contribute to the
understanding of the features of the adrenal gland in birds in general, and of adrenal glands of
Egyptian geese morphology, in particular.
MATERIALS AND METHODS
Twenty mature and immature male and female Egyptian geese were collected from
EL‐Qaliubiya Province in Egypt. Each sex was represented by ten birds that ranged in age from
three to eighteen months. The birds were anaesthetized using 10% urethane, (1 g/kg body
weight), and were sacrificed. The paired adrenal glands were carefull dissected and removed
from each sample and then cut into 1 mm blocks. Tissues for light microscopy were fixed in
10% neutral buffered formalin solution and Bouin’s solution for 72 h, then dehydrated,
cleared, and embedded in paraffin. Sections (5 ‐ 6 microns) were cut and stained with
haematoxylin and eosin and Crossman’s trichrome stain and Gomeri’s reticulin and Periodic
acid Schiff according to the methods given by (Crossman, 1937; Bancroft, Cook, Stirling, and
Turner 1994).
The transmission electron microscopy evaluation was conducted at Science collage of
Ain Shams University in Egypt. Small pieces of adrenal gland were fixed in 2.5% gluteraldehyde
solution with 0.1 M phosphate buffer (pH 7.4) for 24‐48 hours, post fixed in 2% osmic acid for
2 hours, dehydrated in ascending grades of alcohols and immersed in propylene oxide. Finally,
they were embedded in Epoxy resin. The block was polymerized for 24 hours at 70 ○ C. The
ultrathin sections (70 nm) were cut, mounted on copper mesh grids (No. 200) and stained with
saturated solution of uranyl acetate dihydrate and lead citrate as described by Chiu, Schmidt
and Prasad (1993). Then, the sections were examined with Jeol JEM 100S Transmission
electron microscope (70KV).
RESULTS
The adrenal glands of the adult Egyptian geese were paired organs weighing approxi‐
mately 200‐250 mg (7.5 mg/100 g body weight) and were situated anterior to the kidneys on
each side of the dorsal aorta and inferior vena cava. The glands measured approximately 7.5
mm in length and 5mm in width, and in transverse section, it appeared either triangular or
oval with a thickness ranging from 3.5 to 4.5 mm.
The adrenal gland was surrounded from outside by connective tissue capsule
(Fig. 1) that contained mainly collagen fibers (Fig. 2), reticular fibers, with very few elastic
elements, blood vessels and fibroblasts. Delicate septa were arising from the capsule and were
ramifying between parenchyma tissues form the interstitial tissue. The interstitial tissue was
rich in blood vessels, reticular fibers (Fig. 3) which surrounded both types of cells and
sinusoids. Groups of ganglionic cells are found both outside (Fig. 4) and inside the gland’s
parenchyma.
196

Universitatea de Științe Agricole și Medicină Veterinară Iași
The parenchyma cells of adrenal gland were arranged in cords especially at
subcapsular zone, two cells wide (Fig. 5), and the cells were orientated so that their
longitudinal axes were transverse to the cord and the nucleus in each cell was situated toward
the outer margin. Thin layers of connective tissue separated these cords and there were two
types of cells (Fig. 5): acidophilic and basophilic cells. These cells intermingled with each other
and were separated by sinusoids (Fig. 6).
The first type of cells, the acidophilic cells, was arranged in two‐ cells wide cords that
rested on PAS positive membrane (Fig. 7&7a). At peripheral (subcapsular) zone, these cells
were arranged in clumps forming loops directed opposite to the capsule. These cells were
large, polyhedral to columnar with highly vacuolated and lightly stained acidophilic cytoplasm.
The cells of inner cords were large columnar cells and are less vacuolated. The nuclei of
acidophilic cells were rounded, apically located and contained one or two prominent nucleoli.
Ultrastructurally, the acidophilic cells appeared columnar in shape, their cytoplasm contained
numerous globular mitochondria, and many ribosomes, lipid droplets (Fig. 8), and smooth and
rough endoplasmic reticulum and their nuclei were spherical, large contained prominent
nucleoli and coarse chromatin. These cells could be classified into two types, according to the
amount of lipid droplets and mitochondria, cells contained numerous lipid droplets (Fig. 8)
with few somewhat large globular mitochondria and the other type were cells containing few
lipid droplets (Fig. 9).
The second type of cells, the basophilic cells, were found in the form of islets that
appeared, with general stain, as bluish islets or scattered groups in between the acidophilic
cells (Fig. 10). They were polygonal or rounded in shape with basophilic cytoplasm and large
spherical centrally located nuclei that contained two or even three nucleoli. According to the
affinity of the cytoplasm to the stain, the basophilic cells could be differentiated into two
types: cells with deeply stained basophilic cytoplasmic granules, and cells with lightly stained
basophilic cytoplasmic granules (Fig. 10a). The blood sinusoids were found between the cell
cords and islets, and were numerous and wider in the center of the gland than in the
peripheral zone of the gland. The peripheral zone were formed mainly from the first type of
cells where, the inner zones formed of large amount of second type of cells and a few of first
type of cells.
TEM revealed that the cytoplasm of the basophilic cells contained rod shaped
mitochondria with tubular cristea, ribosomes, a few rough endoplasmic reticulum, lipid
droplets and secretory granules. According to the shape of the secretory granules, these cells
could be further classified into two types: cells that contained homogenous, polymorphic
electron dense secretory granules (Fig. 11), and cells that contained secretory granules of
electron dense core surrounded by hallow electron lucent coat (Figs. 12 &13).
With the increasing the age of the gees, the connective tissue capsule became
thicker, and the amount of the interstitial tissues increased (Fig. 14). The acidophilic cells of
the inner zone were more vacuolated and less acidophilic, and the vacuoles were slightly
numerous in the peripheral acidophilic cells than in those cells of the inner zones. The
basophilic cells appeared less vacuolated and smaller.
FIGURE LEGENDS
Fig. 1. Photomicrograph in geese adrenal gland of three months old female showing the
capsule(c), blood vessel (bv), parenchyma of the gland (p), acidophilic cells (a) and basophilic
cells (b) H&E. X 100.
Fig. 2. Photomicrograph in geese adrenal gland of seven months old female showing the
collagen fibers (cf), blood sinusoids (bs) and blood vessels (bv). Crossman’s trichrome stain. X
100.
197

Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 3. Photomicrograph in geese adrenal glands of seven months old female with Gomori’s
reticulin methods showing the distribution of the reticular fiber (rt) among the of the gland
parenchyma X400.
Fig. 4. Photomicrograph in geese adrenal glands of ten months old female showing the capsule
(c), parenchyma (p) and ganglionic cells (arrows). H&E. X 200.
Fig. 5. Photomicrograph in geese adrenal glands of ten months old female showing the two
cells width forming the cords also, blood sinusoid (bs), acidophilic cells (a) and basophilic cells
(b). H&E. X 600
Fig. 6. Transmission electron micrograph from eleven months male of geese adrenal gland
showing blood sinusoid (bs) and thin layer of connective tissue between the cells of the
glands. X2000.
Fig. 7. Photomicrograph in geese adrenal glands of seven months old male showing the septa
between the cell (s) and & Fig. 7a.showing the positive membrane (arrows) of the same age
and sex. PAS technique X 100 and 1000 respectively.
Fig. 8. Transmission electron micrograph from eleven months male of geese adrenal gland
showing the subcapsular columnar cells with the nucleus (s), cell membrane (cm),
mitochondria (m) and large number of fat droplet (f) in their cytoplasm. X4000.
Fig. 9. Transmission electron micrograph from eleven months male of geese adrenal gland
showing the other subcapsular columnar cells with low fat droplet (f) in their cytoplasm and
mitochondria (m). X3000.
Fig. 10. Photomicrograph in geese adrenal glands of twelve months old male showing the
distribution of basophilic cells (b) in inner zone of the gland between the acidophilic cells (a)
also blood sinusoids (bs). Fig. 10a. Showing the two types of basophilic, one deeply stain (d)
and other lightly stains (l) of the same age and sex. H&E. X100 and 600 respectively.
Fig. 11. Transmission electron micrograph in geese adrenal glands of twelve months old male
showing the basophilic cells containing nucleus (n), cell membrane (cm), mitochondria
(arrows) and secretory granules (sg). X1000.
Fig. 12. Transmission electron micrograph in geese adrenal glands of twelve months old male
showing the distribution of the two types cells of basophilic cells. Cells contained
homogenous, polymorphic electron dense secretory granules (1) and cells contained secretory
granules of electron dense core surrounded by hallow electron lucent coat (2). X3000.
198

Universitatea de Științe Agricole și Medicină Veterinară Iași
199

Lucrări Științifice – vol 53 seria Medicină Veterinară
200

Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 13. High magnification transmission electron micrograph in geese adrenal glands of
twelve months old male showing the difference of the secretory granules of basophilic cells,
homogenous, polymorphic electron dense secretory granules (1) and secretory granules of
electron dense core surrounded by hallow electron lucent coat (2)
Fig. 14. . Photomicrograph in geese adrenal of eighteen months old female showing the thick
capsule(c), blood vessel (bv), subcapsular zone (scz) containing acidophilic cells. H&E. X 1000.
DISCUSSION
The birds are quite different from the mammals in that their adrenal glands are distinctly
divided into an outer cortex, and a medulla that lies in the center of the gland, because of the
scattered chromaffin tissue pervaded with islands between the cortical cells (Luo, 1983; and
Li, Luan, Yue and Zh, 2003). For geese in this study, the parenchyma tissue was intermingled
with each other, which generally agrees with the description of avian adrenal gland provided
by Unsicker (1973), Aire, (1981) and Cronshaw, Holmes, Ely, and Redondo (1989) for mallard
duck.
The present study also revealed that the parenchyma of adrenal gland of Egyptian geese
consisted of two types of cells intermingled with each other. These cells are acidophilic and
basophilic cells. The former cells is largely found in the outer zone of the gland, while the
latter type is concentrated in the center of the gland. These results are in agreement with
Sinha and Ghosh (1961) in pigeon, Ghosh (1962) in avian, and with Vyas and Jacob (1976) in
Indian avian species.
In ostrich chicks, the interrenal tissues and the tissue of the medulla
intermingle with each other, which generally agrees with the description of other
avian species. Beesides, the adrenal glands of ostrich chicks appeared to show
larger amount of interrenal tissue (Li et al., 2009) than other avian species.
The peripheral zone of the adrenal gland is arranged in clumps forming loops reverse to
the capsule, which is lined by columnar cells which are highly vacuolated lightly acidophilic
while those of the inner cords were large and less vacuolated but more acidophilic. As
observed by T.E.M, there are two types of cells according to the amount of lipid droplets and
mitochondria, these finding are similar to those described by Gulmez, Kocamis, Liman and
Kukner (2004) in goose (Anser Anser); while in parakeet, quail, and myna adrenal it was that
the subcapsular zone cells in quail continued inside the gland as a double‐ layered central
201

Lucrări Științifice – vol 53 seria Medicină Veterinară
cords (Bhattcharyya and Ghosh, 1972). The central cords consisted of high columnar cells with
nuclei that were localized in adjacent layer of cells. In parakeets, they found that subcapsular
zone cells were vacuolated and their nuclei were localized adjacent to the basement
membrane. Also, the cytoplasm of internal zone cells consisted of columnar epithelium that
was dense and basophilic. In Wanxi white geese, the cell cords in SCZ were arranged tightly,
parallel to each other, and were perpendicular to the capsule, which consisted of high
columnar cells with a lightly stained cytoplasm and a central nucleus (Wang et al., 1999). The
arrangement of these cell cords is similar to those of the fascicular zone in mammalian adrenal
gland.The two types of cells, found in the center of the gland, could be differentiated
according to the affinity of their cytoplasm to the stain: cells with deeply stained basophilic
cytoplasmic granules, and cells with lightly stained basophilic granules. Hodges (1974) has
related the variation of the basophilia of medullary cells to the physiological activity of the
cells. In this respect, Telford and Bridgman (1990) showed that there are two cell populations
in the medulla of adrenal gland of mammals, about 80% of theswe cells synthesize
epinephrine and the remainder of the cells produce norepinephrine. In birds, the interrenal or
cortical tissue is of mesodermal origin and secretes the corticosteroid hormones, while the
chromaffin or medullary tissue is of ectodermal origin and secretes adrenaline and
noradrenaline (Assenmacher, 1972; and Mori and George,1978). Medullary cells in duck are
characterized by a large population of electron opaque neurosecretory granules. These cells
contain fewer mitochondria and cisternae of endoplasmic reticulum than the cortical cells
Cronshaw, Holmes and Loeb (1974). In Japanese quails, medullary cells have polyhedral shape
and centrally located nucleus. Close to the centrally located nucleus, a moderate number of
mitochondria, endoplasmic reticulum and well developed Golgi complex can be found.
Catecholamine‐containing secretory granules in both Epinephrine and Norepinephrine cells
are enveloped by a continuous membrane and granules of Epinephrine are much smaller in
size and more in number than that in Norepinephrine, in duck (Klingbeil, Holmes, Pearce,
and Cronshaw, 1979), in avian (Manna and Ghosh, 1979) and in quail Cigankova, Zibrin,
Boda, and Holovska, 2005).
The results of the present study for Adrenal glands of Egyptian geese demonstrated that
the uses of specific identification techniques (e.g. immunocytochemistry) are required to help
identify or verify certain of cell types.
REFERENCES
1. Aire, T. A. (1981): Morphometric study of the avian adrenal gland. J. Anat. 131, 19‐23
2. Assenmacher, I. (1972): The peripheral endocrine glands; in I Farner and King, Avian
biology, vol.3, pp. 184‐J 287 ,Academic Press, New York.
3. Bancroft, J. D.; Cook, H. C.; Stirling, R. W. and Turner, D. R. (1994): Manual of histological
techniques and their diagnostic application. 2nd. Churchill Livingston, Edinburgh, London,
Madrid, Melbourne, New York, and Tokyo.
4. Basha, S.H., Vijayaragavan, C., Ramesh, G., (2004): Light and electron microscopic studies
on the interrenal tissue of the adrenal gland in Japanese quail (Coturnix coturnix
japonica). Indian J. Anim. Sci. 74, 1021–1023.
5. Bhattacharyya, T.K., (1975): Fine structure of the interrenal cell in the quail and the
pigeon. Anat. Embryol. (Berl.) 146, 301–310.
6. Bhattacharyya, T.K., & Ghosh, A. (1972): Cellular modification of interrenal tissue induced
by corticoid therapy and stress in three avian species. Am. J. Anat, 133, 483‐494.
202

Universitatea de Științe Agricole și Medicină Veterinară Iași
7. Chiu, W.; Schmidt, M. F., and Prasad, B. V. V. (1993): Teaching electron diffraction and
imaging of macromolecules. Biophys. J., 64:1610‐1625.
8. Cigankova, V., Zibrin, M., Boda, K., Holovska, K., (2005): Effect of long‐term
experimental hypodynamy on the adrenal glands of Japanese quails: an ultrastructural
study. B. Vet. I. Pulawy 49, 449–453.
9. Cronshaw J, Holmes, W. N., Ely, J. A. and Redondo, J. L. (1989):Pre‐natal development of
the adrenal gland in the mallard duck (Anas platyrhynchos). Cell Tissue Res. 258(3):593‐
601.
10. Cronshaw, J., Holmes, W. N., Loeb, S. L., (1974): Fine structure of the adrenal gland in the
duck (Anas platyrhynchos). Anat. Rec. 180, 385–405.
11. Crossman, G. (1937): A modification of mallory connective tissue stain with discussion of
the principle involved. Anat. Rec. 69, 33‐38.
12. Ghosh, A. (1962): A comparative study of the histochemistry of the avian adrenals. In
Progress in comparative endocrinology. Gen. Comp. Endocrinol. Suppl. 1:75‐80.
13. Gulmez, N., Kocamis, H., Liman, N., Kukner, A., (2004): Interrenal cell zonation in the
adrenal gland of the goose (Anser anser). Growth Dev. Aging 68, 11–18.
14. Hodges, R. D. (1974): The histology of the fowl. (Endocrine chapter, pp 464:474). Academic
Press. London, New York, San Francisco.
15. Klingbeil, C.K., Holmes, W. N., Pearce, R. B., and Cronshaw, J. (1979): Functional
significance of interrenal cell zonation in the adrenal gland of the duck (Anas
platyrhynchos). Cell Tissue Res. 2; 201 (1):23‐36.
16. Li, D. X., Luan, W. M., Yue, Zh. P., (2003): Animal Histology and Embryology. Jilin Peo‐ ple’s
Press, Changchun, pp. 230–231 (in Chinese).
17. Li Tang, Peng,k., Wang, J. Luo, H., Cheng, J., Zhang, G., Sun, Y., Liu, H.and Song, H.
(2009): The morphological study on the adrenal gland of African ostrich chicks.
Tiss. And cell 41:231‐238.
18. Luo, K., (1983): Anatomy and Histology of Domestic Fowls. Fukien
Science Publishers Press, Foochow, pp. 187–189.
19. Manna, C. K, and Ghosh, A. (1979): Comparative cytomorphology of the avian
adrenocortical tissue. Z Mikrosk Anat Forsch. 93(1):104‐12.
20. Mori, J. G. and George, J. C. (1978): Seasonal histological changes in the gonads, thyroid
and adrenal of the Canada goose (Branta canadensis interior). Acta anat. 101: 304‐324.
21. Pearce, R. B., Cronshaw, J., Holmes, W. N., (1978): Evidence for the zonation of interrenal
tissue in the adrenal gland of the duck (Anas platyrhynchos). Cell Tissue Res. 192, 363–379.
22. Peng, K.M., Chen, Y.X., Liang, Z.S. (2005) Anatomy of the Domestic Animals and Fowls.
Higher Education Press, Beijing, pp. 286.
23. Siller, W. G., Teague, P. W. and Mackenzie, G. M. (1975): The adrenal cortico‐medullary
ratio in the fowl. Br Poult Sci. 16(4):335‐42.
24. Sinha, D. and Ghosh, A. (1961): Some aspects of adrenocortical cytochemistry in the
domestic pigeon. Endkrinologie 40: 270‐280.
25. Telford, R. I. and Bridgman, F. C. (1990): Introduction to functional histology. 1 st Ed. Harper
and Eow, Publishers, New York.
26. Unsicker, K. (1973): Fine structure and innervation of the avian adrenal gland. Non‐
cholinergic nerve fibers. Z. Zellforsch. 145, 557—575
27. Vyas, D. K., Jacob, D. (1976): Seasonal study of the adrenal gland of some Indian avian
species. Acta Anat (Basel). 95(4):518‐28.
28. Wang, J., Zhu, L.L., Jin, G.M., (1999): Study on adrenal glands of Wanxi white geese.
J.Anhui Agric. Techn. Teach. Coll. 13, 1–4.
203