View - ResearchSpace@Auckland - The University of Auckland

More documents

Recommendations

Info

Table 6.5. Mitochondrial DNA haplotypes in rough-toothed dolphins of the Society Archipelago..... 158 Table 6.6. List of the pairs of individuals showing a high-level of microsatellite relatedness. ........... 160 Table 6.7. Summary statistics of various tests to detect a bottleneck effect..................................... 161 CHAPTER 7 Table 7.1. Summary of genetic parameters for the four species investigated in this study. ............. 171 APPENDICES Table 8.1. Description of criteria used to assess the quality of dorsal fin images............................. 182 Table 8.2. Behavioural responses to biopsy sampling in three species of dolphins. ........................ 183 Table 8.3. Genotypes of four pilot whales from the mass stranding of Stewart Island 2003............. 187 xiv
List of Figures CHAPTER 2 Figure 2.1. Location and details of the study area in relationship to worldwide distribution of spinner dolphins. ............................................................................................................................................. 31 Figure 2.2. Discovery curves based on the cumulative number of new DMIs. ................................... 43 Figure 2.3. Inferred genealogical relationship among mtDNA haplotypes from spinner dolphins....... 47 CHAPTER 3 Figure 3.1. Lateral view of the short-finned pilot whale and long-finned pilot whale……………………60 Figure 3.2. Global distribution of Globicephala spp..................................................................... ……61 Figure 3.3. The origin and number of Japanese and Korean short-finned pilot whale products. ........ 67 Figure 3.4. Phylogenetic relationships among pilot whale haplotypes................................................ 75 Figure 3.5. Inferred genealogical relationships among long-finned pilot whale haplotypes.. .............. 79 Figure 3.6. Inferred genealogical relationships among short-finned pilot whale haplotypes.. ............. 84 CHAPTER 4 Figure 4.1. Alternative scenarios of the social system of long-finned pilot whales. ............................ 98 Figure 4.2. Distribution and size of the mass strandings around New Zealand................................ 109 Figure 4.3. Observed mean relatedness within mass strandings. .................................................... 113 CHAPTER 5 Figure 5.1. Aerial view of the mass stranding at the Old Sand Neck, Stewart Island. ...................... 122 Figure 5.2. Illustration and interpretation of the progression of a mass stranding. ........................... 126 Figure 5.3. Geographical location of the mass stranding at Stewart Island...................................... 128 Figure 5.4: Correlogram plots of the genetic correlation coefficient as a function of distance. .......... 135 Figure 5.5. Distribution frequency of pairwise relatedness (rML). ...................................................... 136 Figure 5.6. Spatial distribution of long-finned pilot whales on the beach of Stewart Island............... 141 CHAPTER 6 Figure 6.1. Discovery curve based on the cumulative number of new DMIs. ................................... 155 Figure 6.2. Inferred genealogical relationship among rough-toothed dolphin mtDNA haplotypes .... 159 APPENDICES Figure 8.1. Patterns of behavioural reactions to biopsy sampling for three species of dolphin......... 184 Figure 8.2. Parental connexions between four pilot whales from the Stewart Island 2003 stranding 188 xv
Page 1 and 2: http://researchspace.auckland.ac.nz
Page 3 and 4: Thesis Abstract Population structur
Page 5 and 6: Dedication To my parents Bernadette
Page 7 and 8: and Véronique Pérard with the hel
Page 9 and 10: Un remerciement tout spécial revie
Page 11 and 12: 2.3.5. Moorea community size estima
Page 13 and 14: 5.3.3. DNA extraction and microsate
Page 15: List of Tables CHAPTER 1 Table 1.1.
Page 19 and 20: Chapter One: General Introduction t
Page 21 and 22: Chapter One: General Introduction O
Page 23 and 24: Chapter One: General Introduction m
Page 25 and 26: Chapter One: General Introduction a
Page 27 and 28: Chapter One: General Introduction a
Page 29 and 30: Chapter One: General Introduction p
Page 31 and 32: Chapter One: General Introduction h
Page 33 and 34: Chapter One: General Introduction d
Page 35 and 36: Chapter One: General Introduction s
Page 37 and 38: 1.6.2. Biopsy sampling Chapter One:
Page 39 and 40: 1.6.3. Molecular markers Chapter On
Page 41 and 42: 1.7. Thesis outline and collaborato
Page 43 and 44: Chapter One: General Introduction D
Page 45 and 46: Chapter Two: Insular communities of
Page 47 and 48: 2.2. Introduction Chapter Two: Insu
Page 51 and 52: 2.3. Materials & Methods Chapter Tw
Page 65 and 66: 2.4.6. Population differentiation C
Page 67 and 68:
Chapter Two: Insular communities of
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
3.1. Abstract Chapter three: Worldw
Page 77 and 78:
are relatively abundant worldwide.
Page 79 and 80:
Chapter three: Worldwide mtDNA dive
Page 81 and 82:
Table 3.1 continued Code Type of sa
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Page 95 and 96:
Page 97 and 98:
Page 99 and 100:
Page 101 and 102:
Page 103 and 104:
Page 105 and 106:
Page 107 and 108:
short-finned pilot whale (Figure 3.
Page 109 and 110:
Page 111 and 112:
Chapter four: Kinship in long-finne
Page 113 and 114:
4.2. Introduction Chapter four: Kin
Page 115 and 116:
Page 117 and 118:
Page 119 and 120:
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Table 4.3. Statistical behaviour of
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
Chapter five: Social dynamic of pil
Page 141 and 142:
5.2. Introduction Chapter five: Soc
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
Page 149 and 150:
Page 151 and 152:
5.4.2. Microsatellite analyses Chap
Page 153 and 154:
Page 155 and 156:
Page 157 and 158:
5.5. Discussion Chapter five: Socia
Page 159 and 160:
Page 161 and 162:
Page 163 and 164:
6.1. Abstract Chapter Six: Populati
Page 165 and 166:
Chapter Six: Population structure o
Page 167 and 168:
Page 169 and 170:
Page 171 and 172:
Page 173 and 174:
Page 175 and 176:
Page 177 and 178:
Page 179 and 180:
Page 181 and 182:
Page 183 and 184:
Page 185 and 186:
Chapter Seven: General Discussion a
Page 187 and 188:
Page 189 and 190:
Page 191 and 192:
Page 193 and 194:
Page 195 and 196:
8. Appendices Biopsy sampling of ro
Page 197 and 198:
Appendices Appendix 2: Spinner dolp
Page 199 and 200:
Appendices Interestingly, proportio
Page 201 and 202:
Appendices Appendix 5: Case of pote
Page 203 and 204:
Appendices Figure 8.2: Parental con
Page 205 and 206:
Appendix 9 Genotype dataset for Cha
Page 207 and 208:
Baguette M (2004) The classical met
Page 209 and 210:
Barrett-Lennard LG (2000) Populatio
Page 211 and 212:
Caurant F, Amiard-Triquet C, Amiard
Page 213 and 214:
Dalebout ML, Van Helden A, Van Waer
Page 215 and 216:
Gannier A (2000) Distribution of ce
Page 217 and 218:
Hayano A, Amano M, Miyazaki N (2003
Page 219 and 220:
Karczmarski L, Würsig B, Gailey G,
Page 221 and 222:
Lockley RM, Russell R (1953) Bird-r
Page 223 and 224:
Möller LM, Beheregaray LB, Allen S
Page 225 and 226:
Palumbi SR, Grabowski G, Duda T, Ge
Page 227 and 228:
Queller DC, Goodnight KF (1989) Est
Page 229 and 230:
Shane S, Wells RS, Würsig B (1986)
Page 231 and 232:
Valsecchi E, Amos W (1996) Microsat
Page 233 and 234:
Whitehead H, Weilgart L (2000) The
Page 235 and 236:
APPENDIX 6 - DATA CHAPTER 2 Chapter
Page 237 and 238:
CCCCTATCAATTTTATCTCCATTATACTCTATGGT
Page 239 and 240:
CCCCTATCAATTTTATCTCCATTATACCCTATGGT
Page 241 and 242:
Spinner dolphin’s samples used in
Page 243 and 244:
96 Slo03FP41 08/11/2003 biopsy Huah
Page 245 and 246:
Spinner dolphin microsatellite geno
Page 247 and 248:
Slo03FP08 84 100 210 212 145 147 25
Page 249 and 250:
Slo04FP62 84 100 208 222 147 147 23
Page 251 and 252:
ATATTAGACCACGAGCTTTATCACCATGCCGCGTG
Page 253 and 254:
TATATATCCCCTAATAATTTTATTTCCATTATATC
Page 255 and 256:
Long-finned pilot whale's samples u
Page 257 and 258:
99 Glo130 08/01/2003 mass stranding
Page 259 and 260:
195 Glo237 29/11/2004 mass strandin
Page 261 and 262:
Long-finned pilot whales microsatel
Page 263 and 264:
Glo106 178 188 195 197 210 226 269
Page 265 and 266:
Glo176 182 188 197 199 232 232 271
Page 267 and 268:
Glo255 178 188 193 197 228 228 271
Page 269 and 270:
APPENDIX 9 - DATA CHAPTER 5 Long-fi
Page 271 and 272:
Glo150 male 180 188 195 195 210 226
Page 273 and 274:
169 169 186 192 148 148 147 151 190
Page 275 and 276:
169 177 186 196 140 148 153 155 190
Page 277 and 278:
APPENDIX 10 - DATA CHAPTER 6 Chapte
Page 279 and 280:
GCAGGGATCCCTCTTCTCGCACCGGGCCCATATCT
Page 281 and 282:
Rough-toothed dolphin's samples use
Page 283 and 284:
Rough-toothed dolphins microsatelli
Page 285:
Sbr04FP37 83 83 156 162 233 233 232
show all

View - ResearchSpace@Auckland - The University of Auckland

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?