View - ResearchSpace@Auckland - The University of Auckland

More documents

Recommendations

Info

GENETIC AND DEMOGRAPHIC INVESTIGATION OF POPULATION STRUCTURE AND SOCIAL SYSTEM IN FOUR DELPHINID SPECIES Marc Oremus A thesis submitted in fulfilment of the requirements for the Degree of Doctor of Philosophy in Biological Sciences The University of Auckland 2008
Thesis Abstract Population structure, genetic diversity and social system were investigated in four species of dolphins, thought to present contrasting habitat preferences and social organisation: spinner dolphins, rough-toothed dolphins, long-finned and short-finned pilot whales. To overcome methodological limitations, I combined molecular markers (mitochondrial DNA, -or mtDNA-, and microsatellite loci) and observational data (photo-identification and mass strandings) where possible. Genetic samples were obtained from skin biopsies of free-ranging (n = 243) and stranded (n = 375) dolphins. As with many species of delphinids, spinner dolphins (Stenella longirostris) form communities in which social and reproductive boundaries are poorly understood. In French Polynesia, capture-recapture analyses based on photographs of distinctly marked individuals (DMIs) and microsatellite genotypes (12 loci) indicated a community of about 150 dolphins around Moorea that is relatively closed on a generational time scale. Distinct communities, likely to follow a similar demographic pattern, were observed around neighbouring islands (Tahiti, Raiatea, Huahine and Bora Bora), as indicated by photo-identification data and restricted gene flow (FST = 0.143, n = 154). Surprisingly high levels of insular mtDNA genetic diversity (average π = 1.44%, suggesting Nef ~ 100,000) contrasted with demographic characteristics of these communities. There was no evidence for a recent bottleneck effect, suggesting that this pattern is the result of metapopulation structure, based on numerous insular communities connected through male and female gene flow. Investigation of the worldwide mtDNA diversity and phylogeography of long-finned and short-finned pilot whale species revealed a complex evolutionary history (Globicephala melas, n = 434; and G. macrorhynchus, n = 134, including published and unpublished sequences). Strong genetic differentiation between long-finned pilot whales from the North Atlantic (G. m. melas) and Southern Hemisphere (G. m. edwardii) indicated severely restricted gene flow, although shared haplotypes suggested some recent contact between the two subspecies. Low genetic distances among haplotypes and a star-like phylogeny suggested a recent worldwide expansion for this species. Higher levels of diversity (although low compared to other cetaceans) were found in short-finned pilot whales, in particular among samples from around Japan. Phylogeographic studies suggested that Japanese samples originate from three distinct populations, one of which could be the ancestral population of the species. Overall, my results confirmed that worldwide mtDNA diversity is low in the two species, probably due to a recent worldwide population expansion and, potentially, to a matrilineal social structure. The molecular ecology of the mass strandings of long-finned pilot whales around New Zealand was investigated to test the hypothesis that individuals stranding together are part of an extended matrilineal group. Analyses of mtDNA sequences indicate that more than one haplotype was found in five of the seven mass strandings i
Page 1: http://researchspace.auckland.ac.nz
Page 5 and 6: Dedication To my parents Bernadette
Page 7 and 8: and Véronique Pérard with the hel
Page 9 and 10: Un remerciement tout spécial revie
Page 11 and 12: 2.3.5. Moorea community size estima
Page 13 and 14: 5.3.3. DNA extraction and microsate
Page 15 and 16: List of Tables CHAPTER 1 Table 1.1.
Page 17 and 18: List of Figures CHAPTER 2 Figure 2.
Page 19 and 20: Chapter One: General Introduction t
Page 21 and 22: Chapter One: General Introduction O
Page 23 and 24: Chapter One: General Introduction m
Page 25 and 26: Chapter One: General Introduction a
Page 27 and 28: Chapter One: General Introduction a
Page 29 and 30: Chapter One: General Introduction p
Page 31 and 32: Chapter One: General Introduction h
Page 33 and 34: Chapter One: General Introduction d
Page 35 and 36: Chapter One: General Introduction s
Page 37 and 38: 1.6.2. Biopsy sampling Chapter One:
Page 39 and 40: 1.6.3. Molecular markers Chapter On
Page 41 and 42: 1.7. Thesis outline and collaborato
Page 43 and 44: Chapter One: General Introduction D
Page 45 and 46: Chapter Two: Insular communities of
Page 47 and 48: 2.2. Introduction Chapter Two: Insu
Page 49 and 50: Chapter Two: Insular communities of
Page 51 and 52: 2.3. Materials & Methods Chapter Tw
Page 53 and 54:
Chapter Two: Insular communities of
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64:
Page 65 and 66:
2.4.6. Population differentiation C
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
3.1. Abstract Chapter three: Worldw
Page 77 and 78:
are relatively abundant worldwide.
Page 79 and 80:
Chapter three: Worldwide mtDNA dive
Page 81 and 82:
Table 3.1 continued Code Type of sa
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Page 95 and 96:
Page 97 and 98:
Page 99 and 100:
Page 101 and 102:
Page 103 and 104:
Page 105 and 106:
Page 107 and 108:
short-finned pilot whale (Figure 3.
Page 109 and 110:
Page 111 and 112:
Chapter four: Kinship in long-finne
Page 113 and 114:
4.2. Introduction Chapter four: Kin
Page 115 and 116:
Page 117 and 118:
Page 119 and 120:
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Table 4.3. Statistical behaviour of
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
Chapter five: Social dynamic of pil
Page 141 and 142:
5.2. Introduction Chapter five: Soc
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
Page 149 and 150:
Page 151 and 152:
5.4.2. Microsatellite analyses Chap
Page 153 and 154:
Page 155 and 156:
Page 157 and 158:
5.5. Discussion Chapter five: Socia
Page 159 and 160:
Page 161 and 162:
Page 163 and 164:
6.1. Abstract Chapter Six: Populati
Page 165 and 166:
Chapter Six: Population structure o
Page 167 and 168:
Page 169 and 170:
Page 171 and 172:
Page 173 and 174:
Page 175 and 176:
Page 177 and 178:
Page 179 and 180:
Page 181 and 182:
Page 183 and 184:
Page 185 and 186:
Chapter Seven: General Discussion a
Page 187 and 188:
Page 189 and 190:
Page 191 and 192:
Page 193 and 194:
Page 195 and 196:
8. Appendices Biopsy sampling of ro
Page 197 and 198:
Appendices Appendix 2: Spinner dolp
Page 199 and 200:
Appendices Interestingly, proportio
Page 201 and 202:
Appendices Appendix 5: Case of pote
Page 203 and 204:
Appendices Figure 8.2: Parental con
Page 205 and 206:
Appendix 9 Genotype dataset for Cha
Page 207 and 208:
Baguette M (2004) The classical met
Page 209 and 210:
Barrett-Lennard LG (2000) Populatio
Page 211 and 212:
Caurant F, Amiard-Triquet C, Amiard
Page 213 and 214:
Dalebout ML, Van Helden A, Van Waer
Page 215 and 216:
Gannier A (2000) Distribution of ce
Page 217 and 218:
Hayano A, Amano M, Miyazaki N (2003
Page 219 and 220:
Karczmarski L, Würsig B, Gailey G,
Page 221 and 222:
Lockley RM, Russell R (1953) Bird-r
Page 223 and 224:
Möller LM, Beheregaray LB, Allen S
Page 225 and 226:
Palumbi SR, Grabowski G, Duda T, Ge
Page 227 and 228:
Queller DC, Goodnight KF (1989) Est
Page 229 and 230:
Shane S, Wells RS, Würsig B (1986)
Page 231 and 232:
Valsecchi E, Amos W (1996) Microsat
Page 233 and 234:
Whitehead H, Weilgart L (2000) The
Page 235 and 236:
APPENDIX 6 - DATA CHAPTER 2 Chapter
Page 237 and 238:
CCCCTATCAATTTTATCTCCATTATACTCTATGGT
Page 239 and 240:
CCCCTATCAATTTTATCTCCATTATACCCTATGGT
Page 241 and 242:
Spinner dolphin’s samples used in
Page 243 and 244:
96 Slo03FP41 08/11/2003 biopsy Huah
Page 245 and 246:
Spinner dolphin microsatellite geno
Page 247 and 248:
Slo03FP08 84 100 210 212 145 147 25
Page 249 and 250:
Slo04FP62 84 100 208 222 147 147 23
Page 251 and 252:
ATATTAGACCACGAGCTTTATCACCATGCCGCGTG
Page 253 and 254:
TATATATCCCCTAATAATTTTATTTCCATTATATC
Page 255 and 256:
Long-finned pilot whale's samples u
Page 257 and 258:
99 Glo130 08/01/2003 mass stranding
Page 259 and 260:
195 Glo237 29/11/2004 mass strandin
Page 261 and 262:
Long-finned pilot whales microsatel
Page 263 and 264:
Glo106 178 188 195 197 210 226 269
Page 265 and 266:
Glo176 182 188 197 199 232 232 271
Page 267 and 268:
Glo255 178 188 193 197 228 228 271
Page 269 and 270:
APPENDIX 9 - DATA CHAPTER 5 Long-fi
Page 271 and 272:
Glo150 male 180 188 195 195 210 226
Page 273 and 274:
169 169 186 192 148 148 147 151 190
Page 275 and 276:
169 177 186 196 140 148 153 155 190
Page 277 and 278:
APPENDIX 10 - DATA CHAPTER 6 Chapte
Page 279 and 280:
GCAGGGATCCCTCTTCTCGCACCGGGCCCATATCT
Page 281 and 282:
Rough-toothed dolphin's samples use
Page 283 and 284:
Rough-toothed dolphins microsatelli
Page 285:
Sbr04FP37 83 83 156 162 233 233 232
show all

View - ResearchSpace@Auckland - The University of Auckland

Create successful ePaper yourself

Delete template?

Save as template?