- Page 1 and 2: http://researchspace.auckland.ac.nz
- Page 3 and 4: Thesis Abstract Population structur
- Page 5 and 6: Dedication To my parents Bernadette
- Page 7 and 8: and Véronique Pérard with the hel
- Page 9 and 10: Un remerciement tout spécial revie
- Page 11 and 12: 2.3.5. Moorea community size estima
- Page 13 and 14: 5.3.3. DNA extraction and microsate
- Page 15 and 16: List of Tables CHAPTER 1 Table 1.1.
- Page 17 and 18: List of Figures CHAPTER 2 Figure 2.
- Page 19 and 20: Chapter One: General Introduction t
- Page 21 and 22: Chapter One: General Introduction O
- Page 23 and 24: Chapter One: General Introduction m
- Page 25 and 26: Chapter One: General Introduction a
- Page 27 and 28: Chapter One: General Introduction a
- Page 29 and 30: Chapter One: General Introduction p
- Page 31 and 32: Chapter One: General Introduction h
- Page 33 and 34: Chapter One: General Introduction d
- Page 35 and 36: Chapter One: General Introduction s
- Page 37 and 38: 1.6.2. Biopsy sampling Chapter One:
- Page 39 and 40: 1.6.3. Molecular markers Chapter On
- Page 41: 1.7. Thesis outline and collaborato
- Page 45 and 46: Chapter Two: Insular communities of
- Page 47 and 48: 2.2. Introduction Chapter Two: Insu
- Page 49 and 50: Chapter Two: Insular communities of
- Page 51 and 52: 2.3. Materials & Methods Chapter Tw
- Page 53 and 54: Chapter Two: Insular communities of
- Page 55 and 56: Chapter Two: Insular communities of
- Page 57 and 58: Chapter Two: Insular communities of
- Page 59 and 60: Chapter Two: Insular communities of
- Page 61 and 62: Chapter Two: Insular communities of
- Page 63 and 64: Chapter Two: Insular communities of
- Page 65 and 66: 2.4.6. Population differentiation C
- Page 67 and 68: Chapter Two: Insular communities of
- Page 69 and 70: Chapter Two: Insular communities of
- Page 71 and 72: Chapter Two: Insular communities of
- Page 73 and 74: Chapter Two: Insular communities of
- Page 75 and 76: 3.1. Abstract Chapter three: Worldw
- Page 77 and 78: are relatively abundant worldwide.
- Page 79 and 80: Chapter three: Worldwide mtDNA dive
- Page 81 and 82: Table 3.1 continued Code Type of sa
- Page 83 and 84: Chapter three: Worldwide mtDNA dive
- Page 85 and 86: Chapter three: Worldwide mtDNA dive
- Page 87 and 88: Chapter three: Worldwide mtDNA dive
- Page 89 and 90: Chapter three: Worldwide mtDNA dive
- Page 91 and 92: Chapter three: Worldwide mtDNA dive
- Page 93 and 94:
Chapter three: Worldwide mtDNA dive
- Page 95 and 96:
Chapter three: Worldwide mtDNA dive
- Page 97 and 98:
Chapter three: Worldwide mtDNA dive
- Page 99 and 100:
Chapter three: Worldwide mtDNA dive
- Page 101 and 102:
Chapter three: Worldwide mtDNA dive
- Page 103 and 104:
Chapter three: Worldwide mtDNA dive
- Page 105 and 106:
Chapter three: Worldwide mtDNA dive
- Page 107 and 108:
short-finned pilot whale (Figure 3.
- Page 109 and 110:
Chapter three: Worldwide mtDNA dive
- Page 111 and 112:
Chapter four: Kinship in long-finne
- Page 113 and 114:
4.2. Introduction Chapter four: Kin
- Page 115 and 116:
Chapter four: Kinship in long-finne
- Page 117 and 118:
Chapter four: Kinship in long-finne
- Page 119 and 120:
Chapter four: Kinship in long-finne
- Page 121 and 122:
Chapter four: Kinship in long-finne
- Page 123 and 124:
Chapter four: Kinship in long-finne
- Page 125 and 126:
Chapter four: Kinship in long-finne
- Page 127 and 128:
Chapter four: Kinship in long-finne
- Page 129 and 130:
Table 4.3. Statistical behaviour of
- Page 131 and 132:
Chapter four: Kinship in long-finne
- Page 133 and 134:
Chapter four: Kinship in long-finne
- Page 135 and 136:
Chapter four: Kinship in long-finne
- Page 137 and 138:
Chapter four: Kinship in long-finne
- Page 139 and 140:
Chapter five: Social dynamic of pil
- Page 141 and 142:
5.2. Introduction Chapter five: Soc
- Page 143 and 144:
Chapter five: Social dynamic of pil
- Page 145 and 146:
Chapter five: Social dynamic of pil
- Page 147 and 148:
Chapter five: Social dynamic of pil
- Page 149 and 150:
Chapter five: Social dynamic of pil
- Page 151 and 152:
5.4.2. Microsatellite analyses Chap
- Page 153 and 154:
Chapter five: Social dynamic of pil
- Page 155 and 156:
Chapter five: Social dynamic of pil
- Page 157 and 158:
5.5. Discussion Chapter five: Socia
- Page 159 and 160:
Chapter five: Social dynamic of pil
- Page 161 and 162:
Chapter five: Social dynamic of pil
- Page 163 and 164:
6.1. Abstract Chapter Six: Populati
- Page 165 and 166:
Chapter Six: Population structure o
- Page 167 and 168:
Chapter Six: Population structure o
- Page 169 and 170:
Chapter Six: Population structure o
- Page 171 and 172:
Chapter Six: Population structure o
- Page 173 and 174:
Chapter Six: Population structure o
- Page 175 and 176:
Chapter Six: Population structure o
- Page 177 and 178:
Chapter Six: Population structure o
- Page 179 and 180:
Chapter Six: Population structure o
- Page 181 and 182:
Chapter Six: Population structure o
- Page 183 and 184:
Chapter Six: Population structure o
- Page 185 and 186:
Chapter Seven: General Discussion a
- Page 187 and 188:
Chapter Seven: General Discussion a
- Page 189 and 190:
Chapter Seven: General Discussion a
- Page 191 and 192:
Chapter Seven: General Discussion a
- Page 193 and 194:
Chapter Seven: General Discussion a
- Page 195 and 196:
8. Appendices Biopsy sampling of ro
- Page 197 and 198:
Appendices Appendix 2: Spinner dolp
- Page 199 and 200:
Appendices Interestingly, proportio
- Page 201 and 202:
Appendices Appendix 5: Case of pote
- Page 203 and 204:
Appendices Figure 8.2: Parental con
- Page 205 and 206:
Appendix 9 Genotype dataset for Cha
- Page 207 and 208:
Baguette M (2004) The classical met
- Page 209 and 210:
Barrett-Lennard LG (2000) Populatio
- Page 211 and 212:
Caurant F, Amiard-Triquet C, Amiard
- Page 213 and 214:
Dalebout ML, Van Helden A, Van Waer
- Page 215 and 216:
Gannier A (2000) Distribution of ce
- Page 217 and 218:
Hayano A, Amano M, Miyazaki N (2003
- Page 219 and 220:
Karczmarski L, Würsig B, Gailey G,
- Page 221 and 222:
Lockley RM, Russell R (1953) Bird-r
- Page 223 and 224:
Möller LM, Beheregaray LB, Allen S
- Page 225 and 226:
Palumbi SR, Grabowski G, Duda T, Ge
- Page 227 and 228:
Queller DC, Goodnight KF (1989) Est
- Page 229 and 230:
Shane S, Wells RS, Würsig B (1986)
- Page 231 and 232:
Valsecchi E, Amos W (1996) Microsat
- Page 233 and 234:
Whitehead H, Weilgart L (2000) The
- Page 235 and 236:
APPENDIX 6 - DATA CHAPTER 2 Chapter
- Page 237 and 238:
CCCCTATCAATTTTATCTCCATTATACTCTATGGT
- Page 239 and 240:
CCCCTATCAATTTTATCTCCATTATACCCTATGGT
- Page 241 and 242:
Spinner dolphin’s samples used in
- Page 243 and 244:
96 Slo03FP41 08/11/2003 biopsy Huah
- Page 245 and 246:
Spinner dolphin microsatellite geno
- Page 247 and 248:
Slo03FP08 84 100 210 212 145 147 25
- Page 249 and 250:
Slo04FP62 84 100 208 222 147 147 23
- Page 251 and 252:
ATATTAGACCACGAGCTTTATCACCATGCCGCGTG
- Page 253 and 254:
TATATATCCCCTAATAATTTTATTTCCATTATATC
- Page 255 and 256:
Long-finned pilot whale's samples u
- Page 257 and 258:
99 Glo130 08/01/2003 mass stranding
- Page 259 and 260:
195 Glo237 29/11/2004 mass strandin
- Page 261 and 262:
Long-finned pilot whales microsatel
- Page 263 and 264:
Glo106 178 188 195 197 210 226 269
- Page 265 and 266:
Glo176 182 188 197 199 232 232 271
- Page 267 and 268:
Glo255 178 188 193 197 228 228 271
- Page 269 and 270:
APPENDIX 9 - DATA CHAPTER 5 Long-fi
- Page 271 and 272:
Glo150 male 180 188 195 195 210 226
- Page 273 and 274:
169 169 186 192 148 148 147 151 190
- Page 275 and 276:
169 177 186 196 140 148 153 155 190
- Page 277 and 278:
APPENDIX 10 - DATA CHAPTER 6 Chapte
- Page 279 and 280:
GCAGGGATCCCTCTTCTCGCACCGGGCCCATATCT
- Page 281 and 282:
Rough-toothed dolphin's samples use
- Page 283 and 284:
Rough-toothed dolphins microsatelli
- Page 285:
Sbr04FP37 83 83 156 162 233 233 232