Identification of Salix L. entities by DNA barcoding Lucchin M.1 ...

Tercer Congreso Internacional de Salicáceas en Argentina Trabajo Técnico 

Identification of Salix L. entities by DNA barcoding 

Lucchin M. 1* , Marziali L. 1 , Todeschini M. 1 , Salmaso M. 1 , Nicolè S. 1 , Paiero P. 2 

1 Department of Environmental Agronomy and Crop Production, University of Padova, Italy, 

2 Department of Land and Agroforest Environmets, University of Padova, Italy 

* presenting author, margherita.lucchin@unipd.it 

Abstract 

Following the sequencing of a growing number of plant genomes and with the availability of more 

and more powerful computational tools, DNA sequences are becoming the major source of 

information in understanding the evolutionary and genetic relationship among plant species. The 

importance of a comparative sequence analysis is clearly evident in studies aimed at clarifying the 

taxonomic and phylogenetic relationships at interspecific level. Since 2003 several authors 

proposed and demonstrated that the nucleotide content of a single gene can be sufficient for the 

discrimination and the identification of animal species. The experimental reliability and the general 

applicability of this approach, known as “DNA barcoding”, has been first assessed using the 

mitochondrial gene CO1 encoding for the subunit I of the cytochrome oxydase .The term “DNA 

barcoding” refers to a DNA-sequence based identification system that may be constructed of 

several loci used together as complementary unit to define a specific haplotype. A species can 

thus be unequivocally identified on the basis of single nucleotide polymorphisms (SNPs) or 

insertions/deletions (In/Dels) in the most conserved regions of one or a few selected genes. A DNA 

barcoding approach based on mitochondrial genes is not feasible in plants because of their much 

slower rate of evolution compared to animals.. This research was aimed at developing molecular 

diagnostic tests able to screen the plant biodiversity and univocally identify species belonging to 

the Salix L. genus. For this purpose we assessed the level of sequence divergence (SNP and 

In/del polymorphisms) among 22 willow species in two chloroplast putative barcode loci to 

determine which of them maximize species identification when combined as a barcode. 

Willow species belonging to Humboldtiana and Salix subgenera were clustered apart, supporting 

species separation on the basis of bio-geographical and morphological traits, whereas species of 

subgenera Caprisalix and Chamaetia were unrecognizable on the basis of two chloroplast 

intergene spacers, this is probably due to their frequent hybrid origin. Nuclear barcode sequences, 

able to identify recombination events have to be evaluated. 

Keywords: willow species, DNA barcoding, taxonomic identification, phylogenetic relationships. 

Introduction 

The genus Salix is one of the largest in the world dendroflora showing a very wide geographical 

distribution. Willow species play an important role in the vegetation structure of many habitats and 

are commonly utilized for different purposes. In spite of this, uncertainty and doubts exist in the 

taxonomy of this genus because of large morphological polymorphism of species and common 

natural interspecific hybridization leading to the presence of several transitional cases (Skvortsov, 

1999). 

DNA barcoding is a diagnostic technique aimed to provide rapid, accurate and automatable 

species identification by using a short, standardized DNA region, i.e. the “DNA barcode”. It is 

based on the premise that a short standardized sequence can distinguish individuals of a species 

because genetic variation between species exceeds that within species (Hajibabaei et al., 2007) 

In animals, the standard sequence for differentiating species has been identified in the cox1 

mitochondrial gene (Herbert et al., 2003). In plants, chloroplast DNA is favoured because its larger 

variability, but a sequence able to identify all species as in the animal kingdom is not yet identified. 

In this paper, the trnH-psbA and trnL-trnF chloroplast intergenic regions have been tested to i) 

examine the phylogenetic relationships within Salix genus to understand the evolutionary pattern 

of willow species; ii) assess their ability to discriminate among species in the genus Salix, which


can be considered as a model in the search for a barcode sequence because of its complexity and 

diffusion. 

Materials and Methods 

Following a multi-locus DNA barcoding approach, two non-coding chloroplast regions were tested 

across 22 willow species, each represented by two-five plants of different origin (Table 1). All 

plants are maintained in our willow collection at the Experimental Farm of the University of Padova, 

Italy. DNA was isolated from young leaves as in Meneghetti et al. (2007). The final concentration 

of DNA was estimated by electrophoresis on 1% agarose/TAE gel and quantification was made by 

comparison with 1 Kb plus DNA ladder (Invitrogen) of known concentration. The trnH-psbA spacer 

was sequenced by using primer forward trnH CGCGCATGGTGGATTCACAATCC and reverse 

PsbA GTTATGCATGAACGTAATGCTC. To sequence trnL/trnF region the primers trnL 

GAGCACAGTGGTCAAGTTTA and trnF GGGGATAGAGGGACTTGAAC were utilized. PCR 

products were purified enzimatically by EXO-SAP (Amersham) procedure and then bi-directionally 

sequenced using ABI BigDye dye-terminators and cycle-sequencing protocols. Sequencing 

reactions were run on an ABI 3730xl DNA analyzer. Sequences were visualized by Sequencher 

3.0 (GeneCodes Corp). 

Before alignment, primer sequences were removed from both ends of sequences, so all 

sequences began and ended at homologous sites. 

Genetic divergence (d) among species sequences was calculated according to the Kimura-2parameter 

model (Kimura, 1980), as 

d = - ½ log e(w1) – ¼ log e(w2) 

Where w1= 1-2P-Q 

w2= 1-2Q 

with P and Q the frequency of transition and transversion respectively. 

Based on the multilocus pairwise nucleotide divergences, the Neighbor-joining analysis was 

performed by Mega 4.1 software (Kumar et al., 2008) and a bootstrap statistical analysis was 

conducted to measure stability of the obtained branches using 1,000 resampling replicates. 

Populus nigra sample was added as outgroup. In addition, the different haplotypes were identified 

based on two loci. 

Results 

Genetic relationships among Salix species were investigated by a multilocus DNA barcoding 

approach based on the sequence divergences of two chloroplast intergenic regions, trnH-psbA 

and the trnL/trnF. 

The total lengths of the trnH-PsbA and the trnL/trnF regions were confirmed using a comparative 

alignment with sequences obtained from GenBank. The final aligned matrix had a total length of 

635 characters, 284 and 351 sites for trnH-PsbA and trnL/trnF respectively. The phylogenetic 

analysis resulted in a well-resolved and well supported tree (Figure 1) and seven willow haplotypes 

were identified: 

- Haplotype 1: S. alba, S. fragilis and S. pentandra; 

- Haplotype 2: S. acmophylla; 

- Haplotype 3: S. humboldtiana; 

- Haplotype 4: S. brutia; 

- Haplotype 5: S. triandra; 

- Haplotype 6: S. eleagnos, S. breviserrata, S. retusa, S. purpurea, S. apenina, S. 

mielichoferi, S. foetida, S. waldsteniana, S. rosmarinifolia, S. caprea, S. appendiculata, 

S. canariensis, S. daphnoides and S. myrsinifolia; 

- Haplotype 7: S. atrocinerea. 

Two main groups can be recognized in the phylogenetic tree: species belonging to subgenus Salix 

clustered apart from the main group showing species of subgenera Vetrix and Chametia, so 

supporting species separation on the basis of bio-geographical and morphological traits. Within 

subgenus Salix, that botanists consider the least evolved and the most related to the genus 

Populus (Martini & Paiero, 1988), species of sections Amygdalinae and Humboldtianae resulted to


be well separated according to their different distribution. S. alba, S. fragilis and S. pentandra did 

not show any nucleotide polymorphism in the two loci analysed, thus confirming their strong 

relationships: according to Skvortsov (1999), the two sections Salix and Pentandrae of the 

subgenus Salix have close relationships, and S. pentandra to some extents resembles S. fragilis. 

In section Salix, white willow and crack willow are known to constitute the S. alba-S. fragilis 

complex together with their hybrids and introgressants (Barcaccia et al., 2003). 

Our preliminary results confirm the potentials of DNA barcoding technique as a powerful tool to be 

exploited for the genetic identification of willow species allowing to overpass the taxonomic 

impediments due to life and phenological stages or dioecism. However, the two chloroplast loci 

here considered were not able to distinguish all willow species showing some criticisms and 

suggesting further loci will have to be investigated. The conventional barcoding approach is based 

on reproductive isolation causing the accumulation of molecular differences. Due to the common 

interspecific hybridization which led the evolution of Salix species, nuclear regions will have to be 

assessed. 

References 

Barcaccia G, Meneghetti S, Albertini E, Triest L, Lucchin M., 2003. Linkage mapping in tetraploid 

willows: segregation of molecular markers and estimation of linkage phases support an 

allotetraploid structure for Salix alba x Salix fragilis interspecific hybrids. Heredity, 90, 169-180. 

Brullo S, Spampinato G, 1993. A new species of Salix (Salicaceae) from Calabria (S Italy). 

Candollea 48 (1), 291-295. 

Hajibabaei M, Singer GAC, Herbert PDN, Hickey DA, 2007. DNA barcoding: how it complements 

taxonomy, molecular phylogenetics and population genetics. Trends Genet., 23, 167-172. 

Herbert PDN, Cywinska A, Ball SL, de Waard JR, 2003. Biological identification trough DNA 

barcodes. Proc. R. Soc. Lond B, 270, 313-321. 

Kimura M, 1980. A simple method for estimating evolutionary rates of base substitutions through 

comparative studies of nucleotide sequences. J. of Mol. Evol., 16 (2), 111-120. 

Kumar S, Dudley J, Nei M, Tamura K, 2008. MEGA: a biologist-centric software for evolutionary 

analysis of DNA and protein sequences. Brief. in Bioinformatics 9: 299-306. 

Martini F, Paiero P, 1988. I salici d’Italia. Ed. Lint, Trieste, Italy. 

Meneghetti S, Barcaccia G, Paiero P, Lucchin M, 2007. Genetic characterization of Salix alba L. 

and Salix fragilis L. by means of different PCR-derived marker systems. Pl. Biosystems, 141 (3), 

283-291. 

Skvortsov AK, 1999. Willows of Russia and adjacent countries. Taxonomical and geographical 

revision. University of Joensuu Publ. Joensuu, Finland. 

Table 1: List of the 22 analysed willow species. Taxonomy is according to Skvortsov (1999). 

(a) Classification of S. brutia is according to Brullo and Spampinato (1993). 

Species No. of plants Subgenus Section 

S. acmophylla 2 Salix Humboldtianae 

S. alba 5 Salix Salix 

S. apennina 2 Vetrix Nigricantes 

S. appendiculata 3 Vetrix Vetrix 

S. atrocinerea 3 Vetrix Vetrix 

S. breviserrata 2 Chamaetia Myrtosalix 

S. brutia (a) 3 Salix Amygdalinae 

S. canariensis 3 Vetrix Vetrix 

S. caprea 3 Vetrix Vetrix


S. daphnoides 2 Vetrix Daphnella 

S. eleagnos 2 Vetrix Canae 

S. foetida 2 Vetrix Arbuscella 

Salix fragilis 4 Salix Salix 

Salix humboldtiana 3 Salix Humboldtianae 

Salix mielichoferi 4 Vetrix Nigricantes 

Salix myrsinifolia 4 Vetrix Nigricantes 

Salix pentandra 2 Salix Pentandrae 

Salix purpurea 4 Caprisalix Helix 

Salix retusa 2 Chamaetia Retusae 

Salix rosmarinifolia 4 Vetrix Incubaceae 

Salix triandra 3 Salix Amygdalinae 

S. waldsteniana 2 Vetrix Arbuscella


Figure 1: Phylogenetic tree obtained by analysing trnH-PsbA and trnL/trnF combined loci. The 

numbers above the nodes represent bootstrap support after 1,000 replicates.

Identification of Salix L. entities by DNA barcoding Lucchin M.1 ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?