CHAPTER II MATERIALS AND METHODS 2.1 Chemicals and ...

2.1 Chemicals and materials
CHAPTER II
MATERIALS AND METHODS
The details of chemicals and reagents are shown in Appendix A.
2.2 Perylene derivatives
The perylene derivatives are synthesized by (i) the laboratory of Professor
Thomas Randy Lee at University of Houston and (ii) the laboratory of Professor Suk-
Wah Tam Chang at University of Arizona at Reno. The structures of perylene
derivatives are shown in Figure 2.1. TmPyP4 is a porphyrin derivative, a standard G-
quadruplex ligand that is well-studied for its G-quadruplex binding/formation and
telomerase inhibitors. These perylene derivatives were prepared as 5X stock in
difference solution (Table 2.1) before use.
2.3 Oligonucleotides
The oligonucleotides used in table 2.2 and 2.3 were commercially synthesized by
Bio Basic Inc. The FAM fluorescence spectra were measured using PhosphoImager.
The samples were excited at 488 nm and the fluorescence emission spectra were
collected in the wavelength range 520 nm.

N N
N N
H
H
N
N
N N
TmPyP 4
N
O
N
N
PM3
O
O
N
O O
N
Figure 2.1 Structures of perylene derivatives used in this study and TmPyP4.
Perylene Derivative
N
23
PIPER
Table 2.1 Solubility Profiles of Perylene Derivatives.
Solubility
PM 1 Water, Methanol
PM 2 Diluted acid, chloroform
PM 3 10 mM Tris-HCl pH 7
PIPER 1N HCl 10% H20
TmPyP Water
4
O
N
N
N N
O O
N
O
NN
OO
N
PM2
O
N
O
PM1
N
NH

Name
24
Table 2.2: Sequences of oligonucleotide and their specific assay.
2.4 Non-denaturing gel electrophoresis
Non-denaturing gel electrophoresis was employed to separate DNA samples in
their native states. In this study, various forms of DNA structures such as duplex,
single strand, and G-quadruplexes were separated from each other when they
migrated through polyacrylamide gel. To maintain the native forms of DNA sample,
the electrophoresis was run at 4 o C and electrophoresis buffer and gel were
supplemented with KCl.
Polyacrylamide gel was prepared by mixing 40% acrylamide/bis-
acrylamide (19:1) with 5X TBE buffer, 4M KCl, and the distilled water to the desired
percentage of gel and the final concentration of 50 mM KCl in the gel. For 80 ml gel,
the gel polymerization was started by adding 1000 µl of 10% ammonium persulfate
and 35 µl of TEMED (N, N, N' , N' -tetramethylethylenediamine) before pouring to
the gel mold.
Sequences Assay
VT-66 5’- GCCTGTCCCC GCCCCCCGGG GCGGGCCGGG
GGCGGGGTCC
CTTCCCGAGC CATGCGCCAC CTCCTT -3’
P16 5’- FAM-AAGGAGGTGGCGCATG -3’
DNA polymerase
stop assay
32G4 5’- FAM-AGTATAGGGG CGGGCCGGGG GCGGGGTTAG TA -3’ Duplex/Quadruplex
32C4 5’- TACTAACCCCGCCCCCGGCCCGCCCCTATACT -3’
competition assay

25
The samples were mixed with 6X non-denaturing loading dye buffer. Before
sample loading, the gel was pre-run at 350 votes for 30 min at 4 o C in 1X TBE buffer
supplemented with 50mM KCl. Each well was washed again and 10 µl of each
sample was loaded. After all samples were loaded, the gel was run at 350 votes at
4 o C until the dye front traveled about 10 cm from the wells. Then, the power supply
was shut off and the glass wash, ready for fluorescence detection.
2.5 Denaturing gel electrophoresis
Denaturing gel electrophoresis was employed to separate DNA by length. In this
study, we employed this technique to separate the DNA products from DNA
polymerase stop assay.
The gel mold was prepared as described. The denaturing gel was mixing 40%
acrylamide/bis-acrylamide (19:1), urea, 5X TBE buffer, and the water to the desired
percentage of gel and the final concentration of 8 M urea. For 80 ml gel, the gel
polymerization was started by adding 1ml of 10% ammonium persulfate and 35 µl of
TEMED before pouring to the gel mold. When polymerization was complete, the gel
plate was assembled to electrophoresis unit. The gel slots were washed and the gel
was pre-run at constant power 1800-2000 voltage for 1 hour. Once again, slots were
washed to eliminate the accumulated urea. Before sample loading, the sample in
formamide loading buffer were heated at 95 O C for 5 min and immediately placed on
ice, to denature any secondary structure. Samples were then loaded onto the gel and
electrophoresis in a 1X TBE running buffer at 1800 volts for 2 hours. The gel was
separated from the glass plates and transferred onto a plastic covered, ready to detect
fluorescence bands.

2.6 DNA polymerase stop assay
26
DNA polymerase stop assay is often employed to test whether a compound can
induce intramolecular G-quadruplex formation from any particular G-quadruplex
motif. The assay is based on the principle that DNA polymerase cannot traverse
through an intramolecular G-quadruplex structure; therefore, primer extension by
DNA polymerase will arrest when DNA polymerase encounters a stable G-
quadruplex on the DNA template. The 10 l G-quadruplex forming mixture,
consisting of the indicated concentration of test compound, a DNA template (VT-66,
100 nM), and a FAM-labeled primer (P16, 100 nM) in 10 mM Tris-HCl buffer (pH
7.4) containing 25 mM KCl, was first denatured by heating to 95 C for 5 min, then
slowly cooled to 37 C, and held at 37 C for 30 min. The primer extension reaction
was initiated by adding a 10 l reaction mixture consisting of 100 mM dNTPs, 3 mM
MgCl2,
and 1 unit of DNA polymerase I Klenow fragment (Fermentas). The reaction
was allowed to proceed at 37 C for 30 min before it was stopped by adding 4 l of
loading buffer (95% formamide, 10 mM EDTA, 0.1% xylene cyanol, 0.1%
bromphenol blue). The samples were separated by electrophoresis in a 12%
denaturing polyacrylamide gel and visualized with a phosphoimaging system
(Typhoon; Molecular Dynamics).
2.7 Duplex/quadruplex competition Assay
Many G-quadruplex ligands are not useful as telomerase inhibitor because they
induce acute cytotoxicity, which is believed to occur from non-specific binding to
double stranded DNA. To investigate the binding preference of our perylene
derivatives, we employed the duplex/quadruplex competition assay. If the compound

27
prefers binding to G-quadruplex, there will be less duplex. On the other hand, if the
compound prefers binding to duplex, there will be less G-quadruplex formation. In
this study, we observed the competition between duplex and quadruplex from the
fluorescent-labeled G-rich strand.
The 20-µl reaction mixture contained 2µM of fluorescent-labeled G-strand, 10
mM of Tris-HCl buffer pH 7.4 containing 100 mM KCl, and 0-32 µM of perylene
derivative. The reaction mixtures were heated at 95 O C for 10 min before incubated at
55 O C for 10 h. The incubation was terminated by rapidly cooling down to 4 O C. The
sample were added with 6X glycerol loading dye buffer and kept at 4 O C before
loading into non-denaturing gel. The 10 µl of each sample was loaded on 16% non-
denaturing polyacrylamide gel containing 50 mM KCl. The gel was run in 1X TBE
buffer supplemented with 50 mM KCl at 4 O C, 350 volts for 10 h. Gel was then
exposed to fluorescence spectrum by PhosphoImager.
2.8 Cell lines and culture conditions
The human lung carcinoma cell line A549 was obtained from American Type
Culture Collection (Rockville, MD). The A549 cells were grown in Roswell Park
Memorial Institute medium 1640 (RPMI 1640) with 10% fetal bovine serum (FBS)
and 1% antibiotics (50 units/ml penicillin, 50 µg/ml streptomycin). The A549 cells
were grown as monolayers at 37 2 and 95%
air.

2.9 Cytotoxicity test
28
Cell survival is determined by using the colorimetric Sulforhodamine B assay.
The assay relies on the ability of Sulforhodamine B to bind to protein components of
cells that have been fixed to tissue-culture plates by trichloroacetic acid (TCA).
Sulforhodamine B is bright-pink aminoxanthane dye with two sulfonic groups (Figure
2.2) that bind to basic amino-acid residues under mild acidic conditions, and
dissociate under basic conditions. As the binding of Sulforhodamine B is
stoichimetric, the amount of dye extracted from stained cells is directly proportional
to the cell mass (Vichai and Kirtikara, 2006).
Figure 2.2 Structure of Sulforhodamine B

2.9.1 Cell preparation
29
After removing medium, the cells were washed with sterilized phosphate-
buffered saline (PBS), and then trypsinised with 0.25% (wt/vol) trypsin in versene-
EDTA to evenly cover the cell-growth surface. When the cells were started to
dissociate, a sterilized plastic or glass pipette was used to disperse them from the
culture surface with culture medium containing FBS and mix to obtain a
homogeneous cell suspension. After transferring the cell suspension to a sterilized
tube, the cells were centrifuged at 3,000 rpm for 5 min. The cell concentration was
determined by counting in a hematocytometer chamber under a microscope, using a
1:1 mixture of cell suspension and 0.4% (wt. /vol.) trypan blue solution and calculates
by using the formulae below:
Number of cells (cells/µl) = N x Cv x Cd
2.9.2 Sulforhodamine B assay protocol
N = number of cells
Cv = correction factor of volume (10 4
)
Cd = correction factor of dilution (x 2)
The growth inhibition of A549 cells was determined using the Sulforhodamine B
(SRB) assay according to a published protocol (Vichai V & Kirtikara, 2006). Briefly,
after adjusted the cell concentration with growth medium to obtain seeding density at
4
1.0 x 10 cells/well, the cell suspensions were seeded in 96-well tissue-culture plates
which pre-added with a various concentration (0-16 µM) of the test sample. The cell
suspensions were occasionally mixed during plating to ensure an even distribution of
the cells. The cells were allowed to attach for 2-3 h at 37 C in a humidified incubator

30
with 5% CO2. The first plate, as no-growth control (day 0), was proceeded to fix the
cell monolayer, whereas the remaining plates were incubated at 37 C in a humidified
incubator with 5% CO2 for 72 h. At the end of each treatment, the cells were fixed by
gentle addition of 100 µl of cold 10% (wt /vol.) trichloroacetic acid (TCA) to each
well, followed by incubation at 4 C for 1 h. Plates were washed four times with
deionized water and removed excess water using paper towels. Then, the plates were
left air dry at room temperature (20-25 C). Cells were stained with 100 µl of SRB
solution (0.057% SRB wt/vol in 1% acetic acid) added to each well for 30 min at
room temperature, then quickly rinse the plates four times with 1%(vol /vol) acetic
acid to remove unbound dye and allowed them to dry at room temperature. Next,
bound dye was solubilized with 10 mM Tris base solution (pH 10.5). The optical
density (OD.) was read at 510 nm using fluorescence plate reader (Biotech K40). The
absorbance values of treated samples were calculated as the percentage of cell-growth
inhibition using the formula below:
% of control cell growth = mean OD sample – mean OD day 0
mean OD neg. control - mean OD day 0
% growth inhibition = 100 - % of control cell growth
x 100
For IC50 determination, a dose-response curve between the compound
concentration and percent growth inhibition was plotted. IC50 can be derived using
curve-fitting methods with statistical analysis.

2.10 Reverse transcriptase-polymerase chain reaction (RT-PCR)
31
Reverse transcriptase-polymerase chain reaction (RT-PCR) is used to amplify
cDNA copies of RNA. RT-PCR generate large cDNA libraries from cellular mRNA.
RT-PCR can be adapted to identify mutations and polymorphisms in transcribed
sequences and to measure the strength of gene expression when the amounts of
available mRNA are limited and/or when the RNA of the interest is expressed at very
low levels.
Principle of RT-PCR is relative simple. The first step is enzymatic conversion of
RNA to a single-stranded cDNA template. An oligodeoxynucleotide primer is
hybridized to the mRNA and is then extended by an RNA-dependent DNA
polymerase to create a cDNA copy that can be amplified by PCR. Depending on the
purpose of the experiment, the primer for first-strand cDNA synthesis can be
specifically designed to hybridize to a particular target gene or it can bind generally to
all mRNAs. Amplification of the desired portion of cDNA can be achieved in PCRs
primed by forward and reverse oligonucleotide primers corresponding to specific
sequence in particular cDNAs. In this study, VEGF expression at the transcriptional
level was analyzed using RT-PCR. In brief, the A549 human lung cancer cells were
incubated with test sample for 24 h. Then, the total RNA was extracted using Trizol
reagent. The mRNAs were converted to cDNAs by reverse transcriptase. The
cDNAs of VEGF was amplified by PCR with specific primers shown in Table 2.3
PCR products were separated by agarose gel electrophoresis. The parallel
amplification of GAPDH cDNA was also conducted as a positive control and an
internal standard.

32
Table 2.3 Primer sequences for determining effect of perylene derivatives on VEGF
expression in A549 cells by RT-PCR
VEGF (F)
VEGF (R)
GAPDH (F)
GAPDH (R)
Name Primer Sequence Product Size (bp.)
5’- TGCATTGGAGCCTTGCCTTG -3’
5’- CGGCTCACCGCCTCGGCTTG -3’
5’- CCACAGTCCATGCCATCAC -3’
5’- CCACCACCCTGTTGCTGTA -3’
2.10.1 Treatment of A549 cells with a test sample
540, 410
A549 cells (2.0 x 10 5 cells) were incubated in 6-well tissue-culture plates
containing growth medium. Cells were allowed to attach for 24 h, and washed with
PBS, and then treated with each test compounds. The plate was incubated at 37 C in
a humidified incubator with 5% CO2
were extracted as described below.
2.10.2 RNA extraction
Total RNA was extracted using Trizol reagent (Invitrogen), according to the
manufacturer’s instruction. In Brief, the cell monolayers were directly lysed in a
culture dish by adding 1 ml of TRIzol Reagent to a 3.5 cm diameter dish, and passed
several times through a pipette. The cleared homogenate solutions were transferred to
a fresh tube. The homogenized cells were incubated for 5 min at 15 to 30°C to permit
the complete dissociation of nucleoprotein complexes and then added 0.2 ml of
chloroform per 1 ml of TRIzol Reagent. The tubes were vigorously shaken for 15
452
for 24 h. At the end of treatment, total RNA

33
seconds and incubated at 15 to 30°C for 2 to 3 min. After centrifugation at 12,000×g
for 15 min at 4°C, the mixture was separated into a lower red, phenol-chloroform
phase, an inter-phase, and a colorless upper aqueous phase. RNA remained
exclusively in the aqueous phase, which is about 60% of the volume of TRIzol
Reagent used for homogenization. The aqueous phase was transferred to a fresh tube.
The RNA was precipitated from the aqueous phase by mixing with isopropyl alcohol,
incubated at 15 to 30°C for 10 min and centrifuged at 12,000×g for 10 min at 4°C.
The RNA precipitate, often invisible before centrifugation, formed a gel-like pellet on
the side and bottom of the tube. After removing the supernatant, the RNA pellet was
washed once with 75% ethanol, mixed by vortexing and centrifuged at 7,500×g for 5
min at 4°C. At the end of the procedure, the RNA pellet was dried by air-dry or for 5-
10 min and then dissolved in DEPC-treated water. The quantity and quality of total
RNA were assessed by the ratio of A260 /A280.
The concentration of RNA was determined by UV-Visible spectrophotometer.
An OD of 1 at the wavelength of 260 nm corresponds to approximately 40 µg/ml for
RNA. The obtained RNA was diluted 50 times in DEPC-treated water before
measuring. The concentration of RNA was calculated by using the formula below:
Concentration of RNA (µg/ml) = OD260 x 40 x dilution factor
The quality of the RNA is essential to overall success of the analysis. OD260 is
frequently used to measure RNA concentration and OD280 is used to measure protein
concentration. For further analysis it is imperative that the RNA extracted should
have high purity, displaying ratio of OD260/OD280 values between 1.7 and 1.9.
Smaller ratio usually indicates contamination of protein or organic chemicals.

34
2.10.3 cDNA synthesis by reverse transcription
Total RNA prepared in step 2.10.2 was primed with oligo-(dT)18 primer to
synthesize first-stranded complementary DNA using AMV reverse transcriptase
(Fermentus), according to the manufacturer’s instructions. Briefly, The 20 µl reaction
mixture contained 1 µg of extracted RNA, 0.5 µg of oligo-(dT)18, 1 mM dNTPs, 20
unit of ribonuclease inhibitor, 200 units of reverse transcriptase, and adjusted volume
to 20 µl with DEPC-treated water. The reaction mixture were incubated at94 o C for 5
min, 42 o C for 1 h and then at 70 o
C for 10 min. The extracted RNA was converted to
cDNA in these processes.
2.10.4 PCR optimization
The PCR condition of interested genes (VEGF and GAPDH) was optimized to
yield the amplified products without any nonspecific byproduct. The annealing
temperature was varied within the range from 58using a fixed number of
PCR cycle at 30. Next, the optimum PCR cycle was analyzed by various of numbers
PCR cycle from 15 to 33 cycles that could give the proportional PCR product relative
to its original cDNA. The chosen PCR condition, the annealing temperature and the
number of PCR cycle, was confirmed by 2-fold dilution series of cDNA template: 1x,
0.5x, 0.25x, and 0.125x.
The procedures and optimized protocols are as follows: The 10 µl reaction
mixture contained 1.0 µg of cDNA, 1X buffer (10 mM Tris-HCl pH 9.0, 50 mM KCl
and, 2.0 mM MgCl2),
0.2 mM dNTPs, 2 units of Taq polymerase, and 0.2 µM of
primers. Each reaction mixture was then placed on a Mastercycler gradient thermal
cycler. The temperature profile was as follows: initial denaturation at 95 C for 5

35
min, followed by the amplification process, which are denaturation at 95 C for 30
sec, annealing at optimal temperature of each gene for 30 sec and extension at 72 C
for 40 sec, and the final extension step at 72 C for 5 min. The optimized conditions
resulted in the efficient amplification of DNA without non-specific amplified
products.
2.10.5 Agarose gel electrophoresis and analysis of PCR product
After amplification, 10 µl from each sample was electrophoretically separated
on a 2 % (wt/vol) agarose gel and stained with ethidium bromide (EtBr, Vivantis).
The DNA bands were visualized by UV illumination and documented by using a Bio-
Rad gel doc 1000 system. The intensity of band was quantified by Quantity One
Software (Bio-Rad). The standard 100-base pairs DNA ladder was used as molecular
weight marker. The results are expressed as the percentage of gene expression. The
expression was calculated by using the formulae below:
% Gene expression = Mean band intensity of interested gene x 100
2.11 Western blot analysis
Mean band intensity of GAPDH
The Western blot analysis is an analytical technique used to detect specific
proteins in a given sample of tissue homogenate or cell extract. It uses gel
electrophoresis to separate denatured proteins by the size of the polypeptides. The
proteins are then transferred to a membrane, where they are probed using an antibody
specific to the target protein.

36
2.11.1 Preparation of total cell lysis protein
A549 cells (2.0 x 10 5 cells) were seeded in each 6 well plates, and exposed to a
test sample of various concentrations at 37 2 incubator for 24 h. The
cells were collected and the pellet was lysed with 200 µl of ice-cold lysis buffer (10
mM Tris-HCl pH 7.5, 1 mM MgCl2, 1 mM EGTA, 0.5% CHAPS, 10% vol/vol
-2-mercaptoethanol) and incubated on ice for 30 minutes. The
pellet was then centrifuged at 12,000 x g at 4 was
quantified for protein using a Bio-Rad Protein Assay (Bio-Rad).
2.11.2 Protein determination
The protein concentration of cell pellets was quantified by the Bio-Rad Protein
Assay (Bio-Rad). When Coomassie dye in the protein assay kit binds to proteins in
acidic medium, there is an immediate shift in absorption maximum occurs from 465
nm to 595 nm with a concomitant color change from brown to blue. Protein
concentrations are estimated by reference to absorbance obtained for a series of
standard protein dilutions, which are assayed alongside the unknown samples.
as follows:
The procedure of protein determination by Bio-Rad protein assay reagent is
1. Bovine serum albumin (BSA) standard solution in various concentrations
(187.5 – 500 µg/ml) was prepared from stock BSA (2,000 µg/ml).
2. Pipette each standard and sample into the appropriate microplate wells.
3. Add 250 µl of Bradford reagent to each well and mix.
4. Measure the absorbance at 620 nm with a microplate reader.

37
5. Subtract the average 620 nm reading for the blank replicate from the 620nm
reading of all other individual standard and sample replicates.
6. Prepare a standard curve (Figure 2.3) by plotting the average blank corrected
620 nm reading for each BSA standard vs. its concentration in µg/ml. Use
the standard curve to determine the protein concentration of each sample.
Figure 2.3 The standard curve of bovine serum albumin (BSA)
2.11.3 SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western
blotting
BSA BS B A concentration (µg/ml) (µg/ g/ g ml)
Proteins from each sample were separated by SDS-PAGE. Sodium dodecyl
sulfate (SDS) binds to each polypeptide evenly throughout the polypeptide chain and
makes the charge/mass ratio of all the polypeptides in the mixture close to each other;
therefore, the polypeptides can be separated according to their molecular weight

38
through polyacrylamide gel. Smaller proteins migrate faster through this mesh and
the proteins are thus separated according to size.
The cells were treated in the same manner as in the RT-PCR analysis. After
treatment, the cells were lysed in ice-cold lysis buffer (10 mM Tris-HCl, pH 7.5, 1
mM MgCl2, 1 mM EGTA, 0.5% CHAPS, 10% glycerol, and 5 mM mercaptoethanol).
The protein (30 µg) from the cell lysates was separated by 8% SDS-polyacrylamide
gel electrophoresis and was transferred onto a nitrocellulose membrane by
electroblotting. The membrane was probed with the indicated primary antibody.
Following incubation with enzyme-linked secondary antibody, signal was detected by
enhanced chemiluminescence (Thermo Scientific) and captured on Kodak X-ray film
(Figure 2.4).
Figure 2.4 The schematic of SDS-PAGE and Western blot.

2.12 Statistical analysis
39
All values are given as mean ± standard derivation (m ± SD) from triplicate
samples of three independent experiments. The analysis of variance (One-Way
ANOVA) with SPSS 14.0 software package was used to compare treated and control
group. Differences were considered statistically significant when p < 0.05 or p <
0.01.