CHAPTER II MATERIALS AND METHODS 2.1 Chemicals and ...

More documents

Recommendations

Info

2.10 Reverse transcriptase-polymerase chain reaction (RT-PCR) 31 Reverse transcriptase-polymerase chain reaction (RT-PCR) is used to amplify cDNA copies of RNA. RT-PCR generate large cDNA libraries from cellular mRNA. RT-PCR can be adapted to identify mutations and polymorphisms in transcribed sequences and to measure the strength of gene expression when the amounts of available mRNA are limited and/or when the RNA of the interest is expressed at very low levels. Principle of RT-PCR is relative simple. The first step is enzymatic conversion of RNA to a single-stranded cDNA template. An oligodeoxynucleotide primer is hybridized to the mRNA and is then extended by an RNA-dependent DNA polymerase to create a cDNA copy that can be amplified by PCR. Depending on the purpose of the experiment, the primer for first-strand cDNA synthesis can be specifically designed to hybridize to a particular target gene or it can bind generally to all mRNAs. Amplification of the desired portion of cDNA can be achieved in PCRs primed by forward and reverse oligonucleotide primers corresponding to specific sequence in particular cDNAs. In this study, VEGF expression at the transcriptional level was analyzed using RT-PCR. In brief, the A549 human lung cancer cells were incubated with test sample for 24 h. Then, the total RNA was extracted using Trizol reagent. The mRNAs were converted to cDNAs by reverse transcriptase. The cDNAs of VEGF was amplified by PCR with specific primers shown in Table 2.3 PCR products were separated by agarose gel electrophoresis. The parallel amplification of GAPDH cDNA was also conducted as a positive control and an internal standard.
32 Table 2.3 Primer sequences for determining effect of perylene derivatives on VEGF expression in A549 cells by RT-PCR VEGF (F) VEGF (R) GAPDH (F) GAPDH (R) Name Primer Sequence Product Size (bp.) 5’- TGCATTGGAGCCTTGCCTTG -3’ 5’- CGGCTCACCGCCTCGGCTTG -3’ 5’- CCACAGTCCATGCCATCAC -3’ 5’- CCACCACCCTGTTGCTGTA -3’ 2.10.1 Treatment of A549 cells with a test sample 540, 410 A549 cells (2.0 x 10 5 cells) were incubated in 6-well tissue-culture plates containing growth medium. Cells were allowed to attach for 24 h, and washed with PBS, and then treated with each test compounds. The plate was incubated at 37 C in a humidified incubator with 5% CO2 were extracted as described below. 2.10.2 RNA extraction Total RNA was extracted using Trizol reagent (Invitrogen), according to the manufacturer’s instruction. In Brief, the cell monolayers were directly lysed in a culture dish by adding 1 ml of TRIzol Reagent to a 3.5 cm diameter dish, and passed several times through a pipette. The cleared homogenate solutions were transferred to a fresh tube. The homogenized cells were incubated for 5 min at 15 to 30°C to permit the complete dissociation of nucleoprotein complexes and then added 0.2 ml of chloroform per 1 ml of TRIzol Reagent. The tubes were vigorously shaken for 15 452 for 24 h. At the end of treatment, total RNA
Page 1 and 2: 2.1 Chemicals and materials CHAPTER
Page 3 and 4: Name 24 Table 2.2: Sequences of oli
Page 5 and 6: 2.6 DNA polymerase stop assay 26 DN
Page 7 and 8: 2.9 Cytotoxicity test 28 Cell survi
Page 9: 30 with 5% CO2. The first plate, as
Page 13 and 14: 34 2.10.3 cDNA synthesis by reverse
Page 15 and 16: 36 2.11.1 Preparation of total cell
Page 17 and 18: 38 through polyacrylamide gel. Smal

CHAPTER II MATERIALS AND METHODS 2.1 Chemicals and ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?