School of Engineering and Science - Jacobs University

Siderophore production of Pseudomonas syringae and its implications on
the biological control of bacterial blight of soybean
by
Annette Wensing
A thesis submitted in partial fulfilment
of the requirements for the degree of
Doctor of Philosophy
Approved, Thesis Committee
Prof. Dr. Matthias Ullrich
International University Bremen
Prof. Dr. Ulrich Schwaneberg
International University Bremen
Prof. Dr. Georgi Muskhelishvili
International University Bremen
Dr. Beate Völksch
Friedrich-Schiller-University Jena
June 2006
School of Engineering and Science

Carpe noctem.

Acknowledgements
This project was supported by grants from Deutsche Forschungsgemeinschaft
and by IUB.
Prof. Dr. Matthias Ullrich gave me the possibility to work on this project and
supported my studies with guidance and advice.
Dr. Beate Völksch, Prof. Ulrich Schwaneberg and Prof. Georgi Muskhelishvili
agreed to take part in my thesis committee and were always available for
discussion of the project.
I would like to thank our external cooperation partners:
Dr. Beate Völksch (Jena, Germany) started the investigations on the antagonist
Pss22d and agreed on a cooperation project on the investigation of biocontrol
mechanisms. Discussions with her and her group members Petra Büttner and
Sascha D. Braun significantely stimulated this project.
Prof. Dr. Dominique Expert (Paris, France) supplied me with the
Dikeya chrysanthemi strain for achromobactin production and siderophore
cross-feeding experiments were performed in her lab. Prof. Dr. Jean-Marie
Meyer (Strasbourg, France) allowed me to visit his laboratory and taught me
how to purify and analyse siderophores. Prof. Dr. Herbert Budzikiewicz
(Cologne, Germany) agreed to perform NMR-analysis of purified Pss22d
siderophore.
I would not have been able to accomplish the presented thesis without the
assistance of Dr. Helge Weingart. His most valuable recommendations and the
many discussions with him formed the basis for the presented results.
All present and past members of the AG Ullrich, I have to thank for their help as
well as for the great working atmosphere. A special thanks to Yvonne Braun,
for a “hurricane proven” friendship.
I would like to thank Marcus Lindemann for his patience while explaining
fluorescence measurements to a biologist.
I am deeply grateful to my family. Without your support, patience and
motivation I would not have been able to finish my studies.

Manuscripts in preparation:
Wensing, A., P. Büttner, J. M. Meyer, B. Völksch, M. Ullrich and H. Weingart.
Siderophore production of the soybean pathogen Pseudomonas syringae pv.
syringae 1a/96 and its antagonist Pseudomonas syringae pv. syringae 22d/93.
Wensing, A., H. Weingart, D. Expert, H. Budzikiewicz, B. Völksch and M.
Ullrich.
Structure determination of an achromobactin-like siderophore produced by
plant-associated P. syringae.

Abbreviations
Ach
achromobactin-like siderophore
AHL
acetyl homoserine lactone
CAS
chrom azurol S
DAPG
2,4-diacetylphloroglucinol
DFOM
deferoxaminmesylate
HDTMA
hexadecyltrimethylammonium bromide
HPLC
high performance liquid chromatography
HR
hypersensitive response
ISR
induced systemic resistance
PGPR
plant growth promoting rhizobacteria
Psg
Pseudomonas syringae pv. glycinea
Pss
Pseudomonas syringae pv. syringae
Pvd
pyoverdin
ROS
reactive oxigene species
SAR
systemic aquired resistance
Sid
siderophore
TLC
thin layer chromatographie
Tris
2-amino-2-(hydroxymethyl)-1,3-propandiole
TTSS
type three secretion system
QS quorum sensing

Contents
1 Summary ....................................................................................................... 1
2 Introduction................................................................................................... 2
2.1 Biological control of plant disease ....................................................... 3
2.1.1 Advantages and limitations ............................................................ 3
2.1.2 Host, pathogen and antagonist – more than a “ménage à trois” 6
2.2 Iron and its implications for disease and disease control................ 11
2.2.1 The biology of iron......................................................................... 11
2.2.2 Iron in biological control of bacteria............................................ 12
2.3 Biological control of bacterial blight of soybean .............................. 13
2.4 Aim of this study .................................................................................. 18
3 Material ........................................................................................................ 19
3.1 Equipment............................................................................................. 19
3.2 Chemicals, antibiotics and enzymes .................................................. 19
3.3 Kits ........................................................................................................ 20
3.4 Media ..................................................................................................... 20
3.4.1 Complex medium for Escherichia coli......................................... 21
3.4.2 Complex medium for Pseudomonas syringae ............................ 21
3.4.3 Minimal media for Pseudomonas syringae ................................. 21
3.4.4 Siderophore detection medium .................................................... 23
3.5 Microorganisms.................................................................................... 24
3.6 Plasmids................................................................................................ 26
3.7 Oligonucleotides .................................................................................. 27
4 Methods ....................................................................................................... 28
4.1 Bacterial growth conditions ................................................................ 28
4.1.1 Escherichia coli ............................................................................. 28

Contents
4.1.2 Pseudomonas syringae................................................................. 28
4.1.3 Other bacteria ................................................................................ 29
4.1.4 Determination of cell density........................................................ 29
4.1.5 Storage of bacterial strains........................................................... 29
4.2 Molecular biology methods................................................................. 29
4.2.1 Plasmid DNA isolation................................................................... 29
4.2.1.1 Isolation of plasmid DNA by alkaline lysis ............................... 29
4.2.1.2 Plasmid DNA isolation by NucleoSpin plasmid kit .................. 30
4.2.2 Preparation of genomic DNA ........................................................ 30
4.2.3 DNA separation by gel electrophoresis ....................................... 31
4.2.4 Polymerase chain reaction (PCR) ................................................ 32
4.2.5 Cloning techniques........................................................................ 33
4.2.5.1 Digestion of plasmid DNA with endonucleases....................... 33
4.2.5.2 De-phosphorylation of digested DNA ....................................... 33
4.2.5.3 Converting overhanging sticky ends to blunt ends................. 34
4.2.5.4 Precipitation of DNA by ethanol ................................................ 34
4.2.5.5 Extraction of DNA fragments out of agarose gels ................... 34
4.2.5.6 QIAquick PCR and reaction purification kit.............................. 35
4.2.5.7 Estimation of DNA concentration.............................................. 35
4.2.5.8 Ligation of DNA........................................................................... 35
4.2.5.9 Ligation of PCR fragments by T/A cloning ............................... 36
4.2.5.10 Preparation of electrocompetent E. coli cells ........................ 36
4.2.5.11 Preparation of electrocompetent P. syringae cells................ 37
4.2.5.12 Electroporation of DNA ............................................................ 37
4.2.5.13 Conjugation by triparental mating........................................... 37
4.2.6 DNA-analysis by Southern blot technique .................................. 38
4.2.6.1 Generation of digoxigenin labelled probes .............................. 38

Contents
4.2.6.2 Alkaline transfer of DNA............................................................. 39
4.2.6.3 Hybridisation and detection....................................................... 39
4.2.7 DNA-sequencing............................................................................ 40
4.3 Analysis of bacterial growth in vitro................................................... 40
4.4 Analysis of bacterial growth in planta................................................ 40
4.4.1 Wound inoculation......................................................................... 40
4.4.2 Spray inoculation........................................................................... 41
4.5 Analysis of siderophore-production................................................... 41
4.5.1 Uptake of 59 Fe................................................................................. 41
4.5.2 Determination of siderophore concentration by quantitative
CAS-assay ...................................................................................... 42
4.5.3 Quantification of pyoverdin by fluorescence measurement...... 43
4.5.4 Purification of siderophores by XAD4 ......................................... 43
4.5.5 Isoelectric focussing of siderophores ......................................... 44
4.5.6 Gel-filtration ................................................................................... 44
4.5.7 Thin-layer chromatography .......................................................... 45
5 Results......................................................................................................... 46
5.1 Analysis of siderophores produced by Pss22d................................. 46
5.1.1 Construction of a pyoverdin-deficient mutant of Pss22d .......... 47
5.1.2 Southern blot analysis of Psg1a and Pss22d for the presence of
yersiniabactin biosynthetic genes ............................................... 51
5.1.3 Screening for an additional siderophore of Pss22d by random
mutagenesis................................................................................... 53
5.1.4 Construction of a marker exchange mutant of the
achromobactin-like siderophore in Pss22d................................. 57
5.1.5 In vitro comparison of Pss22d and its siderophore mutants..... 59
5.1.6 Purification of the achromobactin-like siderophore for structure
determination ................................................................................. 61
5.2. Comparison of siderophore production in Psg1a and Pss22d ....... 65

Contents
5.3 Influence of siderophore production on biocontrol activity and
epiphytic fitness of Pss22d ................................................................ 69
5.4 Distribution of the achromobactin–like siderophore synthesis
among plant associated P. syringae ................................................. 71
6 Discussion................................................................................................... 75
6.1 Identification of an achromobactin-like siderophore in P. syringae 75
6.2 Possible regulation of the achromobactin-like siderophore ............ 78
6.3 Influence of siderophore production on epiphytic fitness of Pss22d
.............................................................................................................. 80
6.4 Distribution of the achromobactin-like siderophore among
P. syringae pathovars......................................................................... 81
6.5 Outlook.................................................................................................. 82
Literature ........................................................................................................ 83

Summary
1 Summary
The use of naturally occurring microbial antagonists to suppress plant diseases
offers a favorable alternative to classical methods of plant protection. The
soybean epiphyte, Pseudomonas syringae pv. syringae strain 22d/93 (Pss22d),
exhibits a strong potential to control P. syringae pv. glycinea 1a/96 (Psg1a), the
causal agent of bacterial blight of soybean. Antagonism of Pss22d against
Psg1a has been proven under greenhouse and field conditions but the
underlying mechanism(s) remained unknown. In frame of this work it was
attempted to elucidate the influence of siderophore production on biocontrol. It
was verified that Pss22d and Psg1a both produce the typical pyoverdin-type
siderophore of P. syringae pathovars. In addition, the presence of a second
siderophore in Pss22d was demonstrated. A first characterization of this novel
achromobactin-like iron uptake system is presented. The distribution of this
second siderophore among different pathovars of P. syringae was investigated.
It could be shown that many but not all do produce it. Interestingly, Psg1a also
belongs to the strains tested positive for this siderophore. In consequence,
pathogen Psg and antagonist Pss22d produced the same set of siderophores.
Thus, a direct role of competition for iron in the examined biocontrol system
became unlikely. Comparison of the siderophore production in vitro showed
some interesting differences in the regulation of siderophore biosynthesis
between Pss22d and Psg1a. Finally, the impact of the two siderophores of
Pss22d on in planta performance of respective siderophore mutants was
investigated. As expected, the Pss22d siderophore mutants suppressed the
pathogen in a similar manner as the wild type. Different application techniques
were compared for an assessment of the impact of siderophores on epiphytical
fitness of Pss22d. While no differences in survival and growth of Pss22d wt and
its respective mutants were observed when wound inoculation technique was
used, the siderophore mutants performed slightly poorer than the wild type
when spray inoculation was applied. The phenotypes were quite variable and a
potential interference by alternative iron-uptake systems need to be considered.
This study presents novel information on siderophore production of plantassociated
bacteria as well as on the role of iron supply for epiphytic fitness
and biological control in the phyllosphere. Therefore, it can provide important
information for the development of new biocontrol strategies targeting foliar
plant diseases. Our results confirm the complexity of biological control systems
and the need for more general information on the interaction between epiphytic
microbes and plant-pathogen systems.
1

Introduction
2 Introduction
Like humans and animals, plants are affected by a broad range of pathogenic
microorganisms. Despite expensive pest control measure, infectious plant
diseases significantly interfere with crop production. It is estimated that they
diminish the attainable overall production by approximately 14% while another
6-12% of the actual harvest are lost due to post-harvest diseases (Agrios,
2005). These losses differ between crop varieties and climatic regions, but in
general their percentage is higher in developing countries as compared to the
industrialized world (Oerke et al., 1994). Worldwide, approximately 35 billion
US Dollars are spent on chemicals for plant protection per year (Agrios, 2005).
The high losses (equaling a value of more than 220 billion US Dollar) in spite of
this expenses have various reasons. Increased worldwide trading and traveling
brings about a fast distribution of foreign pathogens to new regions. For
example, the fire blight pathogen E. amylovora was supposed to be indigenous
to North America, but it has been spreading all over Europe by now (Eastgate,
2000). Monocultures grown over large areas favor epidemical spread of
pathogens, while the continued use of pesticides and fungicides to suppress
such outbreaks promotes the occurrence of resistant pathogens (Baker et al.,
1997; McManus et al., 2002). Resistance traits from plant pathogenic bacteria
can be transmitted to human pathogens, so the use of antibiotics in agriculture
is largely restricted (McManus et al., 2002; Teuber, 1999). Many other agrichemicals
have been proven to cause environmental damage, and
consequently have been prohibited. Growing public concern on side effects of
pesticides led to a revision of European commission directive 91/414/CEE
regulating safety requirements and accreditation of plant protection products.
The alteration of this directive in 2002 resulted in the direct withdrawal of 320
substances from the European market while at the same time the legal status
of another 150 products became questionable (European Commission press
release, 2002). As these 470 products equal 60% of all plant protection
products previously available, the need for alternatives becomes most obvious.
2

Introduction
2.1 Biological control of plant disease
A promising alternative approach to minimize infectious plant disease is the
application of antagonizing organisms with the ability to suppress pathogen
development. This concept is referred to as “biological control” and the
operative organism is called biocontrol agent (Wilson, 1997a).
2.1.1 Advantages and limitations
The targeted use of microbial antagonists offers several benefits. Mass
production of the active substance (i.e. fermentation of the control organism) is
low-priced compared to chemical synthesis of pesticides (Shoda, 2000). Since
biocontrol products can by applied by conventional techniques like spraying or
drenching, their ability to proliferate and establish stable populations reduces
application cost to a minimum (Montesinos, 2003). The impact of a biocontrol
agent on the on indigenous microbial communities or other organisms in the
ecosystem is less severe as compared to broad-spectrum pesticides (Emmert
& Handelsman, 1999). Another significant advantage of biological control
results from the flexibility of the control agent as living organism. The control
organism can interact with a pathogen in many different ways and it is able to
co-evolve with target and environment. This minimizes the risk of resistance
formation and contributes to the potency of disease control (Emmert &
Handelsman, 1999; Handelsman & Stabb, 1996). Biological control systems
can be classified into three major groups: Rhizospherical biocontrol, biological
control in the phyllosphere, and post harvest disease control. Post-harvest
disease control offers the unique possibility to keep environmental conditions
constant and adjust them in favor of the control organism (Janisiewicz &
Korsten, 2002). Disease control in the rhizosphere underlies more variable
conditions, yet root exudates provided by the plant stabilize nutrient supply and
increase microbial density by orders of magnitude. Biocontrol agents have to
cope with high microbial competition, but they can be assisted through direct
support by the host plant (Weller et al., 2002).
3

Introduction
In contrast to the rhizosphere, the phyllosphere represents a rather hostile
environment with low nutrient content, sudden changes in temperature and
humidity, and exposure to UV-radiation. These obstacles resulted in rather
pessimistic predictions for biological control in the phyllosphere, but several
control agents able to sustain these harsh conditions have been identified
(Braun-Kiewnick et al., 2000; Ji & Wilson, 2003; Stromberg et al., 2004;
Völksch & May, 2001b; Wilson, 1997b). The versatility of plant-associated
microorganisms provides a large pool of potential biocontrol agents. Many
screenings for disease suppressive strains have been conducted, yet the
number of registered patents is rather low (Fig.1) and even less products have
become commerciallized (Tab. 1; Agrios, 2005; Montesinos, 2003).
Despite the advantages listed above, the practical significance of biological
control in agriculture is negligible at present time. What is the reason for this?
The biggest advantages of biological control, the flexibility of the control agent
and its complex interactions with the environment, represent the biggest
drawbacks of the system as well. First of all, in many cases there is no
correlation between in vitro inhibition and in planta efficiency against the
pathogen. This complicates screening for a suitable control agent. Even thriving
100
93
Number of patents
80
60
40
20
0
64
11 9
5
Bacteria Fungi Yeast Nematode Virus
Biocontrol organism
Fig. 1. Patents on biocontrol agents.
Number of patents on biocontrol agents according to the
type of active organism. Source: Montesinos, 2003
4

Introduction
performance of a control agent during in planta assays under laboratory
conditions does not guarantee a successful application in greenhouse or in the
field (Montesinos et al., 2002; Shoda, 2000). The performance of a biocontrol
agent under changing conditions (climate, vicinity etc.) is often unpredictable
and for field applications of biocontrol products varying results are reported
(Thomashow, 1996). The outcome of a biological control depends on the
complex interaction of host plant, pathogen, control agent, and environment
and most of these relations are poorly understood. An increased knowledge on
these interactions is key towards reliable application of biological control (Duffy
et al., 2003; Handelsman & Stabb, 1996; Montesinos, 2003).
Tab. 1. Bacterial biological control products (USA).
Commercially available biocontrol products based on bacteria in 2003 (USA only).
Source of data: Agrios, 2005
Product name Control agent Crop Disease/Tagert Organism
Galltrol
Agrobacterium radiobacter Fruit/ornamental nurserey stock, Crown gall/ Agrobacterium tumafaciens
strain 84
grape, brambles
Nogall
Companion
Agrobacterium radiobacter
strain K1026
Bacillus subtilis str. GB03 and
other
Fruit/ornamental nurserey stock,
nut
Crown gall/ Agrobacterium tumafaciens
Many in greenhouse and nursery Pytium , Phytophthora , Fusarium ,
Rhizoctonia
HiStick N/T Bacillus subtilis str. MB1600 Legumes Fusarium , Rhizoctonia , Aspergillus
Kodiak Bacillus subtilis GB03 Cotton and Legumes Fusarium , Rhizoctonia , Alternaria ,
Aspergillus
Deny Burkholderia cepacia Cotton, Legumes, grain crops Pythium , Rhizoctonia , Fusarium , and
nematodes
Intercept Burkholderia cepacia Maize, vegetables, cotton Pythium , Rhizoctonia , Fusarium
BioJect Spot-Less Pseudomonas aureofaciens turf and other Dollar spot, anthracnose, Pythium , pink
snow mold
Bio-save 10LP, 110 Pseudomonas syringae Pome fruit, citrus, cherries,
potatoes
BlightBan A506
Pseudomonas fluorescens
A506
Pome and stone fruit, potatoes,
tomatoes, strawberries
Postharvest Botrytis , Mucor , Penicillium ,
Geotrichum
Frost damage, Erwinia amylovora ,
russeting bacteria
Dagger G Pseudomonas fluorescens Field crops, vegetables Rhizoctonia , Pythium
Cedemon Pseudomonas chloraphis Grain cereals Barley, oat leaf spots, Fusarium
5

Introduction
2.1.2 Host, pathogen and antagonist – more than a “ménage à trois”
The first step to understand complexity of biological control is the determination
of crucial features of the individual relationships; the virulence determinants of
the pathogen, defense mechanisms of the host plant, and mode of action of the
control agent. If these basics are known, the impact of environmental conditions
and competing organisms can be assessed.
The best characterized part of the biological control complex is the interaction
between plant and pathogen. Since the discovery of microbes as causal agents
of infectious plant disease in 1878, numerous plant diseases have been studied
for virulence determinants of the pathogens and defense mechanisms of host
plants (Burrill, 1878; Montesinos, 2000). The following principles have been
determined as common themes in plant disease: Prior to disease development,
most pathogens undergo an epiphytic growth phase. The pathogen attaches to
the plant surface and proliferates in this environment until it finds an entry site,
for example wounds or stomata where the pathogen can overcome structural
defense barriers provided by cuticula, cell wall etc. (Agrios, 2005; Montesinos
et al., 2002). The next step during disease formation would be the induction of
virulence determinants. This genetic switch to the pathogenic life style is tightly
regulated. Virulence factors of a pathogen could be perceived by the host and
lead to defense induction, thus they are only expressed under disease-favoring
conditions after the pathogen has reached a certain threshold population size.
Quorum sensing is considered an important regulation mechanism for many
virulence factors (Lugtenberg et al., 2002; Montesinos, 2000; Staskawicz et al.,
2001). Most pathogen attacks do not result in disease formation. In case the
host plant recognizes the pathogen, it starts an immediate defense reaction, the
so-called “hypersensitive response” (HR). HR is a localized reaction of the
infected tissue. The affected areas undergo programmed cell death consisting
of cellular electrolyte leakage and “oxidative burst” i.e. the rapid formation of
reactive oxygen species (ROS). Apart from the direct damage to the pathogen,
6

Introduction
the following necrosis of the adjacent tissue cuts the pathogen off from its
nutrients. It thus is unable to spread and multiply and will finally die.
(Hutcheson, 2001; Klement, 1963). The localized response is followed by a
systemic defense reaction, which is mediated by the plant messenger
molecules salicylic acid (Baker et al., 1997). This reaction is referred to as
systemic acquired resistance (SAR; (Ross, 1962; van Loon et al., 1998a).
A pathogen that is recognized by the plant is called “incompatible” to the
respective host plant. The plant is non-susceptible. In case of a so-called
“compatible” pathogen host interaction, the pathogen suppresses or modifies
plant defense in such a way, that it is not attacked (Staskawicz et al., 2001).
It proliferates causing visible disease symptoms as it nourishes on plant
material. New inoculum is spread from the infested tissue and the disease cycle
continues (Fig.2).
Fig. 2. Life cycle of plant pathogens.
The simplified life cycle of plant pathogenic
microorganisms divides into two parts.
During the epiphytic phase (left half of the
cycle) the pathogen is distributed to new
locations were it colonizes plant surfaces.
Under favourable environmental conditions
and in the presence of suitable entry sites,
the pathogen invades the plant tissue. In
an incompatible system the pathogen is
recognized by the host and plant defence
is activated. During hypersensitive
response (HR) the pathogen is killed and
the respective plant tissue becomes
necrotic. The surviving plant enters a state
of enhanced disease resistance (SAR).
In a compatible system the pathogen
remains undetected or is able to
manipulate plant defence reactions. After
achieving a threshold density it enters into
the pathogenic phase (right half of the
cycle). By expression of virulence factors it
attacks surrounding tissue and further
proliferates on the nutrients gained from
the plant. The pathogen is distributed from
the infected tissue and again enters into
the epiphytic phase.
7

Introduction
The relationship between plants and epiphytic microorganism is understood to
a much lesser extent. One well-characterized feature is the correlation between
root exudates and the high number of microorganisms associated to the
rhizosphere. By this mechanism plants are able to recruit biocontrol agents,
according to the type of pathogen that threatens the plant (Weller et al., 2002).
An example for this is the frequently observed spontaneous decline of take-all
disease. Take-all disease of wheat is caused by the fungus
Gaeumannomyces graminis var. tritici which results (as the name implies) in
disastrous losses. The take-all decline is defined as the spontaneous decrease
in the incidence and severity of take-all that occurs with monoculture of wheat
or other susceptible host crops after one or more severe outbreaks of the
disease (Mazzola, 2002). It was observed many times in different locations all
over the world and has been correlated to 2,4-diacetylphloroglucinol (DAPG)-
producing bacteria (Keel et al., 1996). The relative abundance of DAPG
producers in the wheat rhizosphere increases significantly during take-all
disease, while it does not increase if the pathogen is absent. Furthermore, a
temporal break in monocultures of wheat by a non-susceptible crop leads to a
decrease in DAPG producer populations and a loss of take-all suppression by
the respective soil. This stresses the active part of the host plant in supporting
the biocontrol agent (Mazzola, 2002; Weller et al., 2002).
Rhizobacteria can actively support the growth of their host plants. The
respective group of bacteria is called plant growth-promoting rhizobacteria
(PGPR). They produce plant hormones that influence root morphogenesis and
result in the overproduction of root hairs and lateral roots. The subsequent
increase of ion uptake accompanied by enhanced solubilisation of this ions due
to microbial activity results in enhanced plant nourishment and subsequently in
better plant health and growth (Persello-Cartieaux et al., 2003; Schippers et al.,
1987). Screening of PGNRs for biological control abilities revealed an
interesting new mechanism of induced plant resistance. Some PGNRs induce a
plant defense reaction similar to SAR. This so-called induced systemic
8

Introduction
resistance (ISR) can be triggered by several determinants including
lipopolysaccharides, siderophores, or salicylic acid (van Loon et al., 1998a).
The signaling pathways of SAR and ISR are supposed to differ, as
simultaneous induction of both shows additive effects (Pieterse et al., 2001). All
these interactions take place in the rhizosphere. Phyllospheric interactions
between plants and epiphytes are investigated to a much lesser extent. One
such relationship that has been focused on is the so called “cross protection”.
Here, the biocontrol agent subsidizes for an incompatible pathogen. As it tries
to invade the plant as described above, it activates plant defense. The initiated
SAR-pathway leads to elimination of the target pathogen (Shoda, 2000). In the
direct interaction, biocontrol organisms rarely eradicate a pathogen completely,
but they reduce pathogen population density below the threshold necessary for
disease formation. Control organisms interfere with different steps of the
pathogen life cycle and different active principles have been described (Fig.3).
The most direct approach is toxin production by the control agent, like DAPG
(Keel et al., 1996). Production of antibiotics or inhibitory metabolites that are
active against competitors is a common way of microorganisms to enhance
their own ecological fitness. Indeed, the prototypes of most commercially
available antibiotics are of microbial origin. Many biocontrol agents have been
shown to act by antibiosis (Raaijmakers et al., 2002). For example, the
production of phenazine is a major determinant in the control of Fusarium wilt of
chickpea by Pseudomonas aeruginosa (Anjaiah et al., 1998). But what is the
advantage of the use of toxin-producing biocontrol organisms as compared to
direct toxin application? First of all, there is a big difference in the used dosage.
A biocontrol organism produces only minute amounts of the active compound
compared to direct application of toxins. Second, the active compound is
released only in a small microsite on the plant surface while direct application of
such substances leads to their distribution within the entire ecosystem. This
mode of action is believed to decrease the selection pressure for the
9

Introduction
developement of resistances in the pathogen since the pathogen is exposed to
the antibiotic only during a short period of its life cycle (Duffy et al., 2003).
Competition for limiting nutrient resources is a fundamental ecological principle.
In biocontrol systems, the pathogen and its antagonistic control agent have to
compete for nutrients and space. Overlapping ecological niches enable a
control agent to reduce pathogen density by starvation and block possible entry
sites by colonizing them (Janisiewicz & Korsten, 2002). Particularly, the
competition for iron has been emphasized on in this respect (Handelsman &
Stabb, 1996; Loper & Buyer, 1991; Thomashow, 1996).
Fig. 3. Interference of biological control with the pathogens disease cycle.
The scheme summarizes possible means of biocontrol agents to interfere with the disease
cycle. Activating measures are indicated by green, arrows while suppressive measures are
represented by red, blocked arrows.
10

Introduction
An impact of iron uptake systems on biocontrol was proven for many different
pathosystems including the control of Gaeumannomyces graminis var. tritici by
fluorescent strains of Pseudomonas or the control of Pythium-induced
damping-off of tomato by Pseudomonas aeruginosa 7NSK2 (Buysens et al.,
1996; Hamdan et al., 1991).
As a result of their effective iron uptake systems many screenings for new
biocontrol organisms are limited to the group of fluorescent Pseudomonads
(Haas et al., 2000; Haas & Defago, 2005). Another recently discovered
biocontrol mechanisms is quorum sensing silencing (Dong et al., 2004). Many
virulence determinants are regulated in a cell-density dependent manner. In
Gram-negative bacteria the quorum sensing signals are N-acyl homoserine
lactones (AHLs). The gram-positive bacterium, Bacillus thuringiensis, a
common biological control agent, produces an AHL-lactonase that breaks down
AHL and thus silences virulence gene expression of gram-negative pathogens
(Dong et al., 2004).
The interaction between pathogen and control agent is not unidirectional. Plant
pathogens have evolved their own defense mechanisms against antagonizing
microbes, thus newly identified antagonists should always be tested for their
efficiency against several different strains of the pathogen (Duffy et al., 2003).
2.2 Iron and its implications for disease and disease control
2.2.1 The biology of iron
Iron is the fourth most abundant element in the outer crust of earth. Despite
this, the low water solubility of Fe 3+ at neutral pH limits the availability of free
iron in most habitats (Loper & Buyer, 1991). The importance of iron as cofactor
for enzymes involved in electron-transfer makes it an essential nutrient for
microbial growth. In contrast, high internal iron concentrations are deleterious
for the cell as it catalyses the formation of active oxygen species such as
hydrogen peroxide (H 2 O 2 ) and the hydroxyl radical (˙OH) by the Fenton
reaction:
11

Introduction
Fe 2+ + H 2 O 2 → Fe 3+ + ˙OH
In consequence, microorganisms did not only evolve high affinity iron-uptake
systems, but also storage proteins for internal iron and both features are tightly
regulated by the iron status of the cell (Poole & McKay, 2003; Smith, 2004).
2.2.2 Iron in biological control of bacteria
In order to increase iron supply, bacteria produce siderophores - molecules of
low molecular weight that chelate and thus solubilize iron. Siderophores are
excreted to the surrounding and the ligand/iron complex is selectively
transported back into the cells. After intracellular release of iron, the
siderophore is recycled (Braun & Braun, 2002; Guerinot, 1994; Neilands, 1995;
Visca et al., 2002). Siderophore high affinity iron uptake systems are important
virulence factors in human and plant pathogenic bacteria (Finlay & Falkow,
1997). Different organisms vary in quality and quantity of the siderophores
produced, and an antagonist with a siderophore of high affinity might be able to
out-compete a rivaling pathogen (Haas & Defago, 2005). Some siderophores
can form complexes with metal ions other than iron. The siderophore pyochelin,
for example, can form complexes with Zn, Cu or Mo (Visca et al., 1992).
Although the binding constants of such complexes are significantly lower as
compared to the iron complex, this could make certain trace elements
unavailable for competitors. Some examples for iron-competition dependent
biocontrol were mentioned under 2.1.2. However, siderophores have been
associated with an additional control mechanism. They seem to interfere with a
number of plant defense-mediated biocontrol parameters. First of all,
siderophores can directly trigger plant defense response. Pyoverdin of
Pseudomonas fluorescence CHAO can induce SAR in tobacco and radish
reacts towards the pyoverdin of P. fluorescence WCS374 by expression of an
ISR (van Loon et al., 1998b). Secondly, siderophores such as pyochelin or
pseudomonin are derived from salicylic acid as their precursor (Mercado-
Blanco et al., 2001; Quadri et al., 1999). It has been proposed that this could
12

Introduction
interfere with salicylic acid-depending defense mechanisms. An induction of
plant defense can not be excluded in general, even though no role for
bacterially produced salicylic acid could be demonstrated in rhizobacterial
induction of systemic resistance in Arabidopsis (Ran et al., 2005). Finally, the
type of siderophores produced by a bacterium influence the damage caused by
oxidative burst. The ROS formation during oxidative burst favors occurrence of
the Fenton reaction, yet not only free iron interacts, but also iron-ligand
complexes. Structural features of the ligand as well as the ligand : iron ratio
varies the reaction characteristics of the radical formation (Engelmann et al.,
2003). For example, Dikeya chrysanthemi produces the high-affinity
siderophore chrysobactin. This catechol-type siderophore can form radicals
during oxidative burst (Hirai et al., 2005). In addition D. chrysanthemi produces
a low-affinity siderophore called achromobactin, which does not form radicals
(Expert, 1999). So, siderophores are supposed to be involved in induction as
well as in survival of plant defense reactions.
2.3 Biological control of bacterial blight of soybean
The plant-microbe interaction between soybean (Glycine max) and the bacterial
blight pathogen P. syringae pv. glycinea (Psg) has been used extensively as a
model system to investigate plant pathogen relationships. Virulence factors of
the pathogen have been elucidated and detailed studies on their regulation are
available (Bender, 1999; Smirnova & Ullrich, 2004; Weingart et al., 2004).
Furthermore, the defense response of soybean toward compatible and
incompatible strains of the pathogen has been studied and the impact of
pathogen signaling was examined (Cui et al., 2005; Zou et al., 2005). All this
luxuriant background information makes this pathosystem an especially
feasible model for investigation of biological control. Even the third player is
already known: The antagonist Pseudomonas syringae pv. syringae strain
22d/93 (Pss22d) has been identified as an efficient biocontrol agent against
Psg in vitro, in planta and - most importantly - under field conditions (May et al.,
13

Introduction
1997a; May et al., 1997b; Völksch et al., 1996; Völksch & May, 2001a). What is
lacking for our understanding of this biocontrol system is the determination of
the control principles involved. In the following, a review of the available
information is given.
Pseudomonas syringae is a plant associated bacterial species belonging to the
γ -subgroup of proteobacteria. It stains Gram-negative. Different strains can by
either saprophytic or plant-pathogenic and are divided into more than 50
different pathovars (pv.) according to their host range (Doudoroff & Palleroni,
1974). The pathogen Psg has been discovered in 1919 as a leaf spot pathogen
causing necrotic spots surrounded by chlorotic halos (Fig.4) that are developed
Fig. 4. Bacterial blight of soybean.
Typical symptoms of Pseudomonas syringae pv. glycinea infected soybean leafs: Leaf spots
surrounded by chlorotic halos that develop into lesions later on. The picture is taken from the
first publication describing this disease. The title page shown on the right. Source: Coerper,
1919)
14

Introduction
from initial water-soaked lesions (Coerper, 1919). Psg is a cold-weather
pathogen, i.e. the disease occurs only after periods of cold and humid weather,
and virulence determinates of Psg are regulated in a temperature-dependent
manner (Smirnova & Ullrich, 2004; Weingart et al., 2004). The best studied
virulence factor of Psg is the phytotoxin coronatine, responsible for chlorosis
formation in infected tissue. Coronatine is a structural analogue of the plant
signaling compound, methyl jasmonate. In host plant tissue, it is able to induce
a systemic resistance response that is targeted against insects. By this
meddling with plant signal pathways, Psg misleads defense response of the
host and suppresses the SAR-pathway that would correctly address the
bacterial pathogen (Bender et al., 1999; Cui et al., 2005).
The antagonist Pss22d belongs to the same species, but to a different
pathovar. It has been isolated as possible biocontrol agent in a screening for
soybean phyllosphere epiphytes (May et al., 1997a). During that study, 82
epiphytes isolated from healthy soybean plants were tested for their ability to
suppress different strains of Psg in agar diffusion assay (in vitro) and in a
laboratory in planta assay (Tab. 2). Due to its excellent performance Pss22d
was selected for further studies.
Tab. 2. Screening of soybean phyllosphere for antagonists against Psg.
Correlation between in vitro and in planta inhibition of Psg by 82 tested
soybean epiphytes. Source of data: May et al., 1997a
Isolates
Number of strains with
inhibitory activity
Number of
tested strains in vitro in planta
in vitro and
in planta
Pseudomonas spp. 11 6 4 3
Pantoea agglomerans
(formerly Erwinia herbicola )
27 13 9 4
Enterobacter/Erwinia 11 5 2 2
Xanthomonas spp. 8 2 1 0
other Gram-negative bacteria 11 1 2 0
Gram-positive bacteria 14 2 1 0
15

Introduction
Pss22d demonstrated a high epiphytic fitness. After artificial wound inoculation
of greenhouse-grown soybean plants it established a stable population that
stayed constant for several weeks whereas other saprophytes could not be reisolated
after more than three days post inoculation (May et al., 1997a; May et
al., 1997b).
In the follow-up field trials Pss22d showed a satisfactory epiphytic fitness. It
formed a population of about 10 6 colony forming units (cfu) per gram fresh
weight of plant material after spray inoculation. This population size was stable
over the entire vegetation period and made up 10-40 % of the total epiphytic
population. Simultaneous application of Pss22d and Psg1a lead to a significant
suppression of the pathogen. The population density of Psg was reduced by as
much as two orders of magnitude. When the antagonist was inoculated four
weeks prior to pathogen application, this inhibitory effect was even enhanced.
At the end of the growing season the pathogen population reached only 1/800
(ca. 10 4 cfu/g fresh weight) of the population size it reaches in absence of the
antagonist, i.e. ca. 10 7 cfu/g fresh weight (Völksch & May, 2001b).
As mentioned above, the molecular basis of this interesting control system is
undetermined until now. Nevertheless, there are the following hypotheses.
Pss22d belongs to the group of fluorescent pseudomonads. Although the active
principles determined for this group so far have been studied mostly in the
rhizosphere, they comprise a starting point for the assessment of similar
mechanisms in the phyllosphere. Consequently, antibiosis and siderophores
production come into focus of two separate studies. Toxin production by
Pss22d has already been demonstrated in vitro, yet it is necessary to
investigate the importance of antibiosis in planta (Völksch et al., 1996). This is
currently investigated by Sascha D. Braun at the University of Jena. The
general importance of siderophore production for biological control by
fluorescent pseudomonads gave rise to a first assessment of siderophore
production by Pss22d and Psg. CAS-agar is a general indicator medium for the
16

Introduction
production of siderophores (Schwyn & Neilands, 1987). Comparison of both
Pss22d and Psg1a on this medium shows remarkably different phenotype of
the strains (Fig.5A). The antagonist produces a much larger halo as compared
to the pathogen. The same tendency was observed in several low-iron liquid
media after quantification of siderophore activity in the supernatants (Fig.5B;
Büttner, 2003). This difference is especially interesting, as the various
pathovars of P. syringae are known to produce the same pyoverdin-type
siderophore and so far there has been no experimental prove for the presence
of other siderophores aside of this pyoverdin (Jülich et al., 2001). Siderophore
production of Pss22d and its influence on the biocontrol system was addressed
by the current thesis.
I) II)
DFOM-Equiv. [µM]
180
160
140
120
100
80
60
40
20
Pss22d/93
Psg1a/96
0
CAA KB Pipes 5b SM
Medium
Fig. 5A. Siderophore-production on
CAS-agar. Bacterial syspension of
I) Psg1a and II) Pss22d was applied to
CAS-agar plate and incubated at 28°C
for 48 h.
Fig. 5B. Siderophore-production in different
low-iron media after 48h of growth.
Siderophore production of Pss22d ( ) and
Psg1a ( ) was determined by CAS-assay and
normalized to OD 600nm =1. Source of data:
Büttner, 2003
17

Introduction
2.4 Aim of this study
The antagonism of P. syringae pv. syringae 22d/93 (Pss22d) against bacterial
blight of soybean caused by P. syringae pv. glycinea (Psg) has been
successfully demonstrated in vitro, in planta, and under field conditions (May et
al., 1997a; May et al., 1997b; Völksch et al., 1996; Völksch & May, 2001a). The
outstanding performance of Pss22d accompanied by the multiple background
information on the pathosystem sets this biological control apart from the large
number of screenings for new control agents. It offers a unique opportunity to
investigate active principle(s) of biological control in detail. First results implied
a potential involvement of siderophore production (Fig.5). It was the aim of this
study to investigate the influence of siderophore production on the biological
control system by methods of molecular biology. A primary step for this was the
determination of the siderophores produced by Pss22d. Mutational approaches
such as marker-exchange mutagenesis and transposon mutagenesis were
applied in order to identify the respective gene cluster responsible for
siderophore biosynthesis. Pss22d and its siderophore mutants were analysed
for their ability to grow under iron limited conditions in vitro. A detailed
quantification of siderophores during in vitro growth was performed for a better
comparison between siderophore production of Pss22d and Psg1a. The
in planta application of Pss22d and the generated siderophore mutants was
conducted to directly address the impact of siderophore production on
biological control ability and epiphytic fitness of Pss22d. Finally, the distribution
of a newly identified siderophore among different pathovars of P. syringae was
analysed.
18

Material and Methods
3 Material
3.1 Equipment
Tab. 3. Equipment used in these studies.
Equipment Name Company
Refrigerated Incubator shaker Innova 4230 New Brunswick Scientific
(Nürtingen)
beanch top centrifuges MiniSpin Eppendorf (Engelsdorf)
5415R
Eppendorf (Engelsdorf)
5810R
Eppendorf (Engelsdorf)
Centrifuge with rotors Avanti J20XP Beckman Coulter
with rotor JLA-81000
Speed-vacuum centrifuge Concentrator 5301 Eppendorf (Hamburg)
freeze drying aparatus Micro Modulyo Edwards
rotation evaporator Laborota 4000 Hydolph
2-D electrophoresis apparatus Multiphore II electrophorese unit with Pharmacia Biotech (Freiburg)
Power supply EPS 3500XL
Power supply Power Pack P200 Biometra
DNA electrophoresis chamber MINI SUB DNA CELL BioRad (München)
WIDE MINI SUB CELL
AGS (Heidelberg)
Gel documentation system Gel Jet Imager Intas (Göttingen)
UV cross linker CL-1000 UVP (Cambridge, England)
Hybrisization oven Shake'n Stack Hybaid, (Middlesex, England)
Phosphoimager FLA-3000 Raytest (Straubenhardt)
Electroporation apparatus GenePulser II BioRad (München)
Thermocycler MyCycler BioRad (München)
Thermomixer Eppendorf Thermomixer 5436 Eppendorf (Hamburg)
Spectrophotometer Ultrospec 2100pro Pharmacia Biotech (Freiburg)
Spectrofluorometer F-2500 Digilab (Krefeld)
HPLC system Sykam 2000 Sykam (Fürstenfeldbruck)
HPLC column
250x4 mm, Spherisorb, C18-reversed
phase column Sykam (Fürstenfeldbruck)
3.2 Chemicals, antibiotics and enzymes
Chemicals and antibiotics were purchased from BioRad (München), Biomol
(Hamburg), Roth (Karlsruhe), Serva (Heidelberg), Sigma (Deisenhofen),
Qiagen (Hilden), Applichem (Darmstadt), and Merck (Darmstadt). Enzymes
used in this study were purchased from Amersham-Pharmacia Biotech
(Freiburg), Roche (Mannheim), New England Biolabs (Schwalbach),
Stratagene (Heidelberg) and MBI fermentas (St. Leon-Rot).
19

Material and Methods
Tab. 4. Antibiotic substances used in these studies.
Antibiotic
Stock solution
concentration
End
concentration in
medium
Ampicillin (Amp r ) 50 mg/ml 50 mg/L
Chloramphenicol (Cm r ) 25 mg/ml 25 mg/L
Kanamycin (Km r ) 25 mg/ml 25 mg/L
Spectinomycin (Sp r ) 25 mg/ml 25 mg/L
3.3 Kits
Tab. 5. Kits used in these studies.
Kit
DIG DNA Labeling and Detection Kit
Taq core Kit
pGEM-Teasy Vector system I
NucleoSpin Plasmid
QIAquick Gel extraction kit
QIAquick PCR Purification kit
Manufacturer
Roche (Mannheim)
Qiagen (Hilden)
Promega (Mannheim)
Macherey-Nagel (Düren)
Qiagen (Hilden)
Qiagen (Hilden)
3.4 Media
All media were sterilized in an autoclave (30 min, 121°C, 1.3 bar). Some
components of the media were sterilized by filtration through a sterile filter of
0.2 µm pore size (Whatman). 1.5 % agar was added to a medium used for
bacterial growth on a plate.
20

Material and Methods
3.4.1 Complex medium for Escherichia coli
LB-medium
Lurea-Bertani-medium (Sambrook et al., 1989), pH 7.0
10 g Bacto-trypton
10 g NaCl
5 g Yeast extract
Adjust to 1 L with H 2 O
3.4.2 Complex medium for Pseudomonas syringae
KB-medium
King’B medium (King et al., 1954), pH 7.2
20 g Peptone
1.5 g K 2 HPO 4
1.5 g MgSO 4 x 7 H 2 O
10 ml glycerol
Adjust to 1 L with H 2 O
3.4.3 Minimal media for Pseudomonas syringae
MG-medium
Mannitol-Glutamate medium (Keane et al., 1970), pH 7.0
10 g Mannitol
2 g L-Glutamic acid
0.5 g KH 2 PO4
0.2 g NaCl
0.2 g MgSO 4 x 7 H 2 O
Adjust to 1 L with H 2 O
21

Material and Methods
Iron-free 5b medium
Iron free 5b-medium (Bütter, 2003)
buffer (ad 500 ml):
2.6 g KH 2 PO 4
5.5 g Na 2 HPO 4
2.5 g NH 4 Cl
1 g Na 2 SO 4
carbon source (ad 500 ml):
10 g Glucose
100 mg MgCl x 6 H 2 O
10 mg MnSO 4 x 4 H 2 O
Buffer solution and carbon source are autoclaved separately.
Iron-free Pipes medium
Iron free Pipes medium (Schwyn & Neilands, 1987), pH 7.0
buffer (ad 500 ml):
30.24 g Pipes
0.3 g KH 2 PO4
1 g NH 4 Cl
1 g Na 2 SO 4
carbon source (ad 500 ml):
10 g Glucose
100 mg MgCl x 6 H 2 O
10 mg MnSO 4 x 4 H 2 O
CAA medium
Casamino-acids medium (Cornelis, Anjaiah et al., 1992)
5 g Difco Bacto casaminoacids
0.9 g K 2 HPO 4 x 3 H 2 O
0.25 g MgSO 4 x 7 H 2 O
Adjust to 1 L with H 2 O
22

Material and Methods
Succinat medium without nitrogen source
Succinat medium without nitrogen source (Meyer et al., 2002), pH 7.0
4 g succinic acid
6 g K 2 HPO 4
3 g KH 2 PO 4
0.2 g MgSO 4 x 7H 2 O
This medium was used as incubation medium for the 59 Fe-uptake experiment.
As it does not contain a nitrogen source, the growth of bacteria during the
assay is inhibited.
3.4.4 Siderophore detection medium
CAS agar for siderophore detection
The chrome azurol S (CAS) agar medium used in this study was prepared
according to an enhanced protocol (Alexander & Zuberer, 1991).
Solution 1, CAS indicator:
Mix 10 ml of 1 mM FeCl 3 x 6H 2 O (in 10 mM HCl) with 50 ml of an aqueous
solution of CAS (1.21 mg/ml). The resulting dark blue mixture is slovely added
to 40 ml of an aqueous solution of hexadecyltrimethylammonium bromide
(HDTMA; concentration 1.82 mg/ml)
Solution 2, Pipes buffer:
30.24 g Pipes were dissolved in 750 ml of salt solution containing 0.3 g
KH 2 PO 4 , 0.5 g NaCl and 1 g NH 4 Cl. The pH was adjusted to 6.8 with
50 % KOH, 15 g Agar and the volume was filled to 800 ml with water.
23

Material and Methods
Solution3, carbon source:
2 g glucose, 2 g mannitol, 493 g MgSO 4 x 7 H 2 O, 11 mg CaCl 2 , 1.17 mg
MnSO 4 x 7 H 2 O, 1.4 mg H 3 BO 3 , 0.04 CuSO 4 x 5 H 2 O, 1.2 mg ZnSO 4 x 7 H 2 O
and 1 mg Na 2 MoO 4 x 2 H 2 O were dissolved in 70 ml of water.
Solution 4, casamino acids :
30 ml of 10 % (w/v) of casamino acids
Solutions 1-3 were autoclaved separately and solution 4 was filter sterilized. All
components were mixed after cooling down to 50°C. Subsequently the agar
plates were poored. The plates were kept in the dark prior to usage, as the
CAS-indicator is light sensitive.
The trace metal composition of solution 3 was used for complementation test of
Pipes-medium
3.5 Microorganisms
Tab. 6. Bacterial strains used in these studies.
Bacterial strain Relevant characteristics Reference or source
Escherichia coli :
DH5α
S17-1 λ-pir
supE 44 ∆lacU169 (φ80 lacZ
∆M15) hsdR 17 recA 1 endA 1
gyrA 96 thi -1 relA 1 Hanahan, 1983
λ-pir lysogen of E.coli S17-1 (thi
pro hsdR - hsdM + recA RP4 2 -
Tc::MU-Km::Tn7 (Tet R /Sm R ), host
strain for plasmid pCAM-Not Wilson, et al . 1995
24

Material and Methods
Tab. 6 continued. Bacterial strains used in these studies.
Bacterial strain Relevant characteristics Reference or source
Pantoea agglomerans 48b epiphyt, DFFE producer Völksch et al. , 1996
Dickeya chrysanthemi cbsE-1 tonB60
Xanthomonas campestris DSM 1050
cbsE-1 , tonB60 , Cbs – , TonB – ,
Spec R , Km R Enard and Expert 2000
Ach - , but contains homologue
siderophore synthethase
German Culture Collection (DSM)
Sinorhizobium meliloti DSM 6047 Produces rhizobactin German Culture Collection (DSM)
Pseudomonas syringae pv.
syringae 22d/93 (Pss22d) antagonist wild type; Pvd + , Ach + Völksch et al. , 1996
Pss22d∆Pvd
Pss22d∆Ach
Pss22d∆Sid
derivative of Pss22d; Pvd - , Ach + ,
Km r
derivative of Pss22d; Pvd + , Ach - ,
Km r
derivative of Pss22d∆Pvd; Pvd - ,
Ach - , Km r , Sp r
this study
this study
this study
glycinea 1a/96 pathogen wild type; Pvd+, Ach+ Völksch and May, 2002
glycinea PG4180 Bender et al. , 1993
aceris CFBP 2339
actinidiae MAFF 302091
aptata GSPB 1080
atrofaciens GSPB 1440
atropurporea MAFF 301309
berberis CFBP 1727
broussonetiae MAFF 810036
J-M Meyer, Strasbourg, France
David Guttman, Toronto, Canada
Helge Weingart / K. Rudolph
German Culture Collection (DSM)
B. Völksch , Jena
J-M Meyer, Strasbourg, France
David Guttman, Toronto, Canada
castaneae CFBP 4217
J-M Meyer, Strasbourg, France
coronafaciens DSM 50261
strains
tested for the
Helge Weingart, Bremen
daphniphylli CFBP 4219
achromobactin-like J-M Meyer, Strasbourg, France
siderophore
delfinii ICMP 529 Kawalleck et al. (1995)
mori MAFF 301020
David Guttman, Toronto, Canada
mosprunorum GSPB 1013 K. Rudolph, Göttingen
maculicola DC3000
papulans ICMP 4048
phaseolicola 1448A
Elina Roine, Helsinki, Finnland
John Lydon, Beltsville, USA
John W. Mansfield
pisi GSPB 1477 K. Rudolph, Göttingen
savastanoi GSBP 2259 K. Rudolph, Göttingen
tabaci GSPB 117 K. Rudolph, Göttingen
tomato 487
B. Völksch , Jena
25

Material and Methods
3.6 Plasmids
Tab. 7. Plasmids used in these studies.
Plasmid Relevant characteristics Reference/Source
pGEM-TEasy cloning vector for T/A cloning, Amp r Promega
pPVSA1
pPVSA2
1,4 kb PCR-product of pvsA (fragment1) in pGEM-T Easy,
primer combination pvsA_fwd1_Spe and pvsA_rev6_Kpn ,
template Pss22d, Amp r
1,6 kb PCR-product of pvsA (fragment2) pGEM-T Easy, primer
combination pvsA_fwd7_Kpn und pvsA_rev4_Bam , template
Pss22d, Amp r
This study
This study
pPVSA3 Spe I-Kpn I fragment of pPVSA1 in pPVSA2 This study
pPVSA4
pPVSA3 containing Km r -cassette (Kpn I-Fragment), suizidvector
for pvsA-mutagenesis in Pss22d
This study
pACS1
1.3 kb PCR fragment amplified by primer combination
Achr1_fwd and Achr2_Kpn I_rev. in pGEM-T Easy, Amp r
This study
pACS2
2 kb PCR fragment amplified by primer combination
Achr5_EcoRV_fwd and Achr6_rev in pGEM-T Easy, Amp r
This study
pACS3 pACS1 with Km r resistance cassette, Amp r , Km r This study
pACS4
pACS3 insert in pACS2, suizide vector for mutagenesis of acsgenes
in Pss22d, Amp r , Km r
This study
pBBR-MCS1 cloning vector, Cm r Kovach et al., 1994
pBBR-11-Sid 6 kb Ps tI-fragment of Pss22d∆Sid in pBBR-MCS1, Cm r , Sp r This study
pBBR-23-Sid 6 kb Ps tI-fragment of Pss22d∆Sid-23 in pBBR-MCS1, Cm r , Sp r This study
pMKm vector containing kanamycin cassette, Km r Murillo et al., 1994
pCAM-Not
Sp r Amp r , carries the mTn5 SS40 transposon
Wilson et al., 1995, H.
Weingart
26

Material and Methods
3.7 Oligonucleotides
The following oligonucleotides were used in this study:
Pyoverdin biosynthesis-mutation:
PvsA_rev6_Kpn:
TAAGGTACCACGTCGAGGCTGAGCGGATC
PvsA_fwd7_Kpn:
TTAGGTACCTCGAACTTGGCCTCGCGGCTG
pvsA_rev4_BamHI:
TTTGGATCCGGCAGACCGTGGCTGAG
pvsA_fwd1_Spe
AATACTAGTGGATCCTGATGCGACTGGCCTTCGATC
Achromobactin biosynthesis mutation:
Achr1_fwd :
AGCGAGGACTCACAGATGTTG
Achr2_KpnI_rev :
GGTACCCAATGCTGCTGAATGGCAAC
Achr5_EcoRV_fwd:
GATATCAACTATGTGCGTCTTGCGTC
Achr6_rev:
ACGAATGCCACCAGACAGG
Yersiniabactin-Southern probe
South-irp1-fwd:
AATACCGCTGATCTCGAC
South-irp1-rev:
ATTGTTGCTGCCAGTGTG
27

Material and Methods
PCR-Screening for achromobactin-like siderophore production:
iuc1-fwd:
TGCTGGACTGGTTCGATG
iuc1-rev:
GATCAGCAGGCAATAGG
iuc2-fwd:
AAATCGAGCAGACCCAGC
iuc2-rev:
TGTTGGTCATGCTCATCG
4 Methods
4.1 Bacterial growth conditions
4.1.1 Escherichia coli
E. coli cells were grown overnight at 37°C on LB agar plates containing the
appropriate antibiotics. Subsequently, E. coli cells were cultured overnight at
37°C by shaking at 250 rpm in LB medium containing the appropriate
antibiotics. 2 ml plastic reaction tubes and test tubes were used for growth of
small volumes of E. coli cultures (1-5 ml), and Erlenmeyer flasks were used for
growth of big volumes of E. coli cultures (50-500 ml).
4.1.2 Pseudomonas syringae
P. syringae cells were grown for 2-5 days at 28°C on MG agar plates
containing appropriate antibiotics. Subsequently, P. syringae cells were
inoculated in liquid media (KB, 5b or Pipes) and grown at 28°C by shaking at
280 rpm. Test tubes were used for growth of small volumes of P. syringae
cultures (5 ml) and Erlenmeyer flasks were used for growth of big volumes of
P. syringae cultures (20-250 ml).
28

Material and Methods
4.1.3 Other bacteria
Cells of D. chrysanthemi, X. campestris and S. meliloti were grown for 1-3 days
at 28°C on LB or KB agar plates. Liquid cultures (20-250 ml) of
D. chrysanthemi were grown in Erlenmeyer flask at 28°C by shaking at 280rpm.
4.1.4 Determination of cell density
Cell density of bacterial suspensions or liquid culture was determined by
photometric measurement. The optical density (OD) of the sample was
determined at λ = 600nm. Samples with an OD above 0.6 were diluted in the
appropriate medium. It is assumed that an OD 600nm of one correlates to a cell
density of 10 9 (Miller, 1992).
4.1.5 Storage of bacterial strains
Fresh grow bacterial colonies or lawns from agar plates were resuspended in
15% sterile glycerol solution and stored at -80°C.
4.2 Molecular biology methods
4.2.1 Plasmid DNA isolation
4.2.1.1 Isolation of plasmid DNA by alkaline lysis
Small amounts of plasmid DNA were isolated by the 1-2-3 protocol based on
alkaline lysis (Sambrook et al., 1989).1-1.5 ml of E. coli overnight culture was
harvested by centrifugation at 13,000 rpm for 2-5 min. The pellet was
resuspended in 150 µl of pre-cooled buffer P1 (100 µg/ml RNase A, 50 mM
Tris/HCl, 10 mM EDTA-Na at a pH of 8.0). Alternative, cells from an overnight
LB-plate were resuspended in 150 µl of pre-cooled buffer P1. Subsequently,
the cells were lysed upon addition of 150 µl of buffer P2 (200 mM NaOH,
1% SDS) for 5 min, and the lysate was neutralized by addition of 150 µl of precooled
3 M potassium acetate solution (pH 5.5). This fast neutralisation led to
the renaturation of small plasmid DNA. Larger molecules as proteins and
chromosomal DNA, and cellular debris stay denaturated. Following incubation
29

Material and Methods
on ice for 10 min and subsequent centrifugation at 13,000 rpm for 15 min, the
supernatant containing plasmid DNA was transferred into another plastic
reaction tube. DNA was precipitated by addition of 0.7 volume (300 µl) of 2-
propanol and subsequent centrifugation for 30 min. Then the DNA pellet was
washed by 400-500 µl of 70% ethanol solution. After centrifugation for 15 min,
the DNA pellet was dried in a speedvacuum centrifuge for 5 min, and dissolved
in 20 µl of deionised water.
4.2.1.2 Plasmid DNA isolation by NucleoSpin plasmid kit
For preparation of larger quantities of plasmid DNA, the NucleoSpin kit
provided by Macherey-Nagel (Düren) was applied according to the protocol
provided by the manufacturer. The NucleoSpin preparation is based on alkaline
lysis, too, but instead of precipitation the plasmid DNA is recovered by binding
to a silica-membrane. The application of chaotrophic salts in the buffer system
of the kit leads to a high purity of the obtained DNA, thus this method was
applied for DNA preparations used for subsequent cloning or sequencing.
4.2.2 Preparation of genomic DNA
Genomic DNA of P. syringae was isolated by chloroform phenol extraction. As
the pseudomonads produce large quantities of exopolysaccharides that
interfere with DNA extraction, a cethylhexatrimethylammoniumbromide (CTAB)
extraction of exopolysaccharides was applied (Ausubel et al., 1987).
1.5 ml of a over night culture of P. syringae were harvested by centrifugation.
Supernatant was discarded and the cell pellet was resuspended in 567 µl of
buffer P1 (4.2.1.1). 30 µl of a 10% SDS solution a 3µl of 20 mg/ml proteinase K
were added. The sample was mixed and incubated at 37°C for one hour. 100 µl
of 5M NaCl was added to the viscous lysate and mixed thoroughly. Then, 80µl
of a 65°C preheated CTAB/NaCl solution (10% CTAB in 0.7 M NaCl) was
added. The sample was mixed and incubated at 65°C for 10 minutes.
Afterwards, the CTAB/polysaccharide complexes were removed by chloroform-
30

Material and Methods
extraction. For this, 1 volume of chloroform/isoamyl alcohol (24:1; v/v) was
added to the sample, mixed and centrifuged for 10 min. in a microcentrifuge.
Subsequently, the upper phase was transferred to a fresh plastic reaction tube
and mixed with 1 volume of phenol/choroform/isoamyl alcohol (25:24:1; v/v).
After centrifugation, the upper phase was transferred to a fresh plastic reaction
tube, and mixed with 1 volume of chloroform/isoamyl alcohol (24:1; v/v) to
remove residues of phenol. After centrifugation, the upper phase was
transferred to a fresh plastic reaction tube and the genomic DNA was
precipitated by addition of 0.6 volumes of isopropanol. The precipitate was
harvested by 30 min centrifugation in a microcentrifuge and washed once with
70 % ethanol. The resulting DNA-pellet was dried and resuspended in 50-
300 µl of sterile water. DNA was stored at –20°C.
4.2.3 DNA separation by gel electrophoresis
DNA-fragments can be separated in an agarose gel matrix upon application of
an electric field. Migration of the DNA fragments depends on the electrical
charge of the fragment and its structural interactions with the polymer mesh of
the agarose gel. Therefore for linear DNA fragments the migration distance
correlates to the fragment size. Upon addition of ethidium bromide which is
intercalated into GC-pairs, DNA becomes fluorescent and can be visualized
under UV-light (Sambrook et al., 1989). Agarose gels were prepared in TAE
buffer (1x: 40 mM Tris-acetate, 1.3 mM EDTA-Na, 0.47 mM acetic acid). For
agarose gels that were subsequently blotted to a membrane an agarose
concentration of 0.8 % was used, while gels for standard applications
contained 1 % agarose. DNA samples were mixed with 1/6 volume of loading
buffer (6x: 0.25 % bromphenol blue, 0.25 % xylene cyanol, 40 % sucrose) and
separated at 80 V in TAE buffer. The size of DNA fragments was determined by
parallel loading to the gel of the 1-kb DNA ladder (GibcoBRL) or the gene ruler
(MBI fermentas). Both markers are suitable to estimate the size of DNA
fragments in a range from 500 bp to 12 kb. After electrophoresis, the gel was
31

Material and Methods
stained in ethidium bromide solution (10 µg/ml in TAE buffer) for 5-15 min.
Then the gel was analysed and documented under UV-light using the gel jet
imager system (INTAS).
4.2.4 Polymerase chain reaction (PCR)
Polymerase chain reaction (PCR) is a method used to amplify a specific DNA
sequence in vitro by repeated cycles of synthesis with specific primers and
thermostable Taq DNA polymerase (Saiki et al., 1988). Specific primers are
complementary to sequences that lie on opposite strands of the template DNA
and flank the segment of DNA that is to be amplified. The template DNA was
first denatured by heating in the presence of a large molar excess of each of
the two primers and dNTPs. The reaction mixture was then cooled to a
temperature that allows the primers to anneal to their target sequences, and
subsequently the annealed primers were extended with DNA polymerase.
Cycles of denaturation, annealing, and DNA synthesis were repeated several
times. Reaction mixture was prepared according to the supplier’s manual.
As the primers used in this study were designed from heterologues sequence
information, touch-down PCR was applied to enhance the yield of product.
A typical PCR thermoprofile was programmed as follows:
Initial denaturation 95°C 5 min 1x
Denaturation 95°C 1 min
Hybridisation 65-50° 30 sec. 10x
Polymerisation 65°C 1 min/kb
Denaturation 95°C 1 min
Hybridisation 55°C-45°C (-0.5°C/cycle) 30 sec. 25x
Polymerisation 65°C 1 min/kb
Final extension 65°C 5 min
32

Material and Methods
4.2.5 Cloning techniques
4.2.5.1 Digestion of plasmid DNA with endonucleases
Type II restriction endonucleases recognize a DNA region with a specific
palindromic sequence of 4-8 bp and cut it. Cleavage of DNA linearizes it,
generating either blunt or 3’- or 5’-overhanging sticky ends. For DNA restriction,
sample DNA was incubated in an appropriate restriction buffer with enzyme(s)
for 2-16 hours either at 30°C or 37°C according to the protocol provided by the
supplier. The amount of enzyme added to a reaction mixture and the duration
of digestion were determined according to the assumption that 1 U of enzyme
cleaves 1 µg of DNA for 1 h in 50 µl reaction volume. For subsequent cloning
procedures, the restriction enzyme was either inactivated by heating or by
purification of the reaction with the Quiaquick PCR-purification system
(Quiagen).
4.2.5.2 De-phosphorylation of digested DNA
In order to prevent self-ligation of vector DNA during cloning procedures, a
treatment with shrimp alkaline phosphatase (SAP) was applied. This removes
the phosphate groups from 5’-ends of linearized DNA. SAP can be added
directly to a digestion mix because the SAP buffer is usually compatible with
the buffers for restriction endonucleases. 1/10 volume of the SAP buffer were
added to a sample. The amount of SAP, which was added to the reaction,
equalled the amount of endonuclease that had been used to linearize the
vector DNA. The reaction mixture was incubated for 30 min at 37°C to
accomplish de-phosphorylation. Afterwards, SAP and restriction enzymes were
inactivated by heating at 65°C for 15 min. This step is important in order to
avoid de-phosphorylation putative insert DNA fragment in subsequent ligation
reactions. To remove salts, the reaction was purified by Quiaquick PCRpurification
system.
33

Material and Methods
4.2.5.3 Converting overhanging sticky ends to blunt ends
In order to remove overhanging ends from endonuclease treated DNAfragments
the samples were incubated with Klenow polymerase. After
inactivation of endonuclease, 1/20 volume of 0.5 mM dNTPs, 1/10 volume of
the appropriate 10x-buffer and 1-5 U of Klenow fragment were added to the
reaction mixture and the sample was incubated at 30°C for 20 minutes. The
reaction was stopped by heat inactivation at 75°C for 10 min. The reaction was
purified by Quiaquick PCR-purification system.
4.2.5.4 Precipitation of DNA by ethanol
One possible method to concentrate or purify DNA is a precipitation by salt and
cold ethanol. 1/9 Volume of 3 M sodium acetate (pH 5.8) and 2 volumes of precooled
absolute ethanol were added to the DNA solution. The mixture was
incubated for at least an hour in an ethanol/ice bath at -20°C or for half an hour
at –80°C. Then the sample was centrifuged at 13,000 rpm for 30 min at 4°C.
The supernatant was discarded, and the precipitated DNA was washed in 70%
ethanol solution followed by another centrifugation at 13,000 rpm for 15 min at
4°C. The resulting DNA pellet was dried in a speed-vacuum centrifuge and
dissolved in 10-20 µl of sterile water. DNA samples were stored at –20°C.
4.2.5.5 Extraction of DNA fragments out of agarose gels
For re-isolation of DNA fragments after separation by agarose gel
electrophoresis the QIAquick extraction Kit provided by Qiagen was used
according to the supplier’s protocol. This kit applies a silica matrix in
combination with a buffer system containing chaotrophic salts to selectively
bind DNA fragments out of the agarose – DNA Mixture. The DNA fragment of
appropriate size was cut from the ethidium bromide strained gel under
illumination with UV-light. To avoid formation of thymine dimmers, the exposure
to the UV light was reduced to a minimum. The resulting agarose slice was
mixed with 300 µl QG-buffer per 100 mg of gel. Then the gel piece was
34

Material and Methods
dissolved in the buffer by 10 min incubation at 50°C in a thermomixer. During
this incubation the sample was mixed every two minutes. After complete
disolvance of the agarose piece, column purification was performed in
accordance to the manual. The DNA was eluted in water and stored at –20°C.
4.2.5.6 QIAquick PCR and reaction purification kit
The QIAquick-kit (Qiagen, Hilden) was used to re-isolate DNA out of reaction
mixtures. 5 volumes of buffer PB were added to the reaction. After that the
mixture was loaded to a QIAquick spin column in a 2 ml collection tube by short
centrifugation. Then the column was washed with 0.75 ml of buffer PE and
placed into a 1.5 ml plastic reaction tube. To elute, 30 µl of sterile water was
added to the center of the column and incubated at room temperature for
1-3 minutes. The sample was shortly centrifuged (1 min, 13,000 rpm). DNA
samples were stored at –20°C.
4.2.5.7 Estimation of DNA concentration
Concentration of DNA samples was determined photometrically, as an
absorption of 1 at λ = 260nm correlates to approx. 50 µg DNA per ml solution
(Sambrook et al., 1989).
4.2.5.8 Ligation of DNA
T4 DNA ligase catalyses the formation of phosphodiester bonds at juxtaposed
5’-phosphate and 3’-hydroxyl ends in duplex DNA. The appropriate insertion of
a piece of insert into an opened vector by this reaction is most efficient, if a
relatively small amount of vector (20-100 ng) is mixed with an 3-8 fold excess of
insert DNA. To high concentration of vector facilitates self-ligation of vector
DNA while to low concentration of insert DNA minimizes ligation efficiency. The
ligation reaction contained 1 µl of 10x buffer and 1 µl of T4 DNA ligase. It was
incubated at 18°C for about 20 hours. Subsequently the ligated DNA was
transformed into E. coli DH5α. The ligation reaction was stored at –20°C.
35

Material and Methods
4.2.5.9 Ligation of PCR fragments by T/A cloning
One attribute of the Taq polymerase is the creation of a so-called A-overhang.
After finishing the polymerisation of the according PCR fragment, a terminal
adenine is attached to the fragment. The pGEM-T Easy cloning kit provided by
Promega uses this feature for an enhanced cloning of PCR fragments. The kit
provides linearized DNA of the pGEM-T Easy vector extended by a terminal
thymine. The combination of T- and A-overhang provide a sticky end that highly
increases ligation efficacy.
For pGEM-T Easy cloning the purified PCR fragment was mixed with 0.5 µl of
vector solution, 2µl of 5x rapid ligation buffer and 5 U of high concentrated T4
ligase in a 10 µl reaction mixture. The ligation was incubated at 18°C over night
and subsequently transformed into E. coli DH5α. Ligation reaction was stored
at –20°C.
4.2.5.10 Preparation of electrocompetent E. coli cells
Electrocompetent cells of E. coli DH5α were prepare according to the standard
protocol (Sambrook et al., 1989). A fresh over night culture of DH5α was
inoculates at a dilution of 1:100 and incubated at 37°C until exponential growth
phase was reached (OD 600nm = 0.5 - 0.8). The cells were incubated on ice for
30 min. and then harvested by centrifugation (600rpm; 4°C). Next, medium
residues and salts were removed from the cells by three subsequent washing
steps (two times ice cold water, one ice cold 10% glycerol). The resuspension
volume was reduced in each step and after the final washing step the cells
were resuspended in 1/500 volume of the initial culture volume. 40 µl aliquots
of electrocompetent cells were filled into 0.5 ml plastic reaction tubes and
directly shock frozen in liquid nitrogen. The cells were stored at –80°C.
36

Material and Methods
4.2.5.11 Preparation of electrocompetent P. syringae cells
One inoculation loop of P. syringae cells was scratched from an over night KB
agar plate. The cells were resuspended in 1ml of ice-cold water and kept on ice
for 15 to 30 minutes. Then the cells were pelleted by centrifugation and washed
with 1 ml of ice-cold water two times. Thereafter the cells were washed another
two times in 0.5 ml of ice cold 10% glycerol. After the final washing step, the
cell pellet was resuspended in 200 µl of 10% glycerol. The cells were not stored
but directly used for electroporation.
4.2.5.12 Electroporation of DNA
40 µl of electrocompetent cells (either E.coli or P. syringae) were mixed with
0.1-1 µg of plasmid DNA or 1-2 µl of ligation mixture, and exposed to electric
shock in a pre-chilled electroporation cuvette. The GenePulser-Apparatus
(BioRad) used for this experiment was set to 2.5 kV and 200 Ω. Directly after
the electric pulse, cells were resuspended in 1 ml of the appropriate medium
(LB medium for E. coli and KB medium for P. syringae) The cells were then
incubated for 60 min. by shaking at 280 rpm at the respective growth
temperature, and plated onto agar plates (LB medium or KB medium)
containing the appropriate antibiotic(s). The plates were incubated until single
colonies became visible.
4.2.5.13 Conjugation by triparental mating
The native mechanism of horizontal gene transfer by plasmid conjugation via
‘triparental mating’ was used to transfer broad-host range plasmids into P.
syringae. Donor plasmids with the mob function are mobilized and transferred
into the recipient P. syringae strain by the use of the helper strain E. coli HB101
(pRK2013) carrying the transfer function. Recipient P. syringae strains were
grown for 2 days on MG agar plates prior to the conjugation. Approximately one
inoculation loop of recipient bacteria was resuspended in 1 ml of sterile water.
Subsequently, 1/3 of an inoculation loop each of the donor and helper E. coli
37

Material and Methods
strains were scratched from an over night grown plate and resuspended in the
same volume. Then 2 µl of each bacterial suspension was mixed together. The
resulting 60µl of bacterial suspension was divided into three aliquots of 20 µl
and spotted onto an LB plate. The suspension was allowed to dry and the plate
was subsequently incubated over night at 28°C. Then the mating spots were
scraped off the plate and resuspended in 1 ml sterile water, each. This cell
suspension was diluted from 10 -1 to 10 -5 . 200-300 µl of each dilution step were
plated onto MG plates with the appropriate antibiotic(s) to select for
transconjugants. Subsequently, plates were incubated at 28° for 3-5 days until
single colonies of P. syringae became visible. The selected transconjugants of
P. syringae were restreaked twice on MG agar plates in order to eliminate
residual E. coli cells.
4.2.6 DNA-analysis by Southern blot technique
4.2.6.1 Generation of digoxigenin labelled probes
Digoxigenin labelling of DNA-probes for DNA-DNA hybridisation was performed
according to the manual of the “DIG DNA labelling and detection kit”. 15 µl of
sample DNA was incubated at 95°C for 10 min. and subsequently shock-cooled
in an ethanol/ice-bath. The denaturated sample DNA was the mixed with 2 µl
10x hexanucleotidemix, 2 µl of dNTP mixture (1 mM dATP/dCTP/dGTP;
0.65 mM dTTP and 0.35 mM DIG-dUTP) and 1 µl Klenow fragment. The
reaction mixture was incubated at 37°C over night. In order to remove residual
nucleotides, the labelled DNA probe was precipitated by addition of 1 µl 0.5 M
EDTA, 2.5 µl of 4M LiCl and 75 µl of pre-cooled EtOH (96%). The mixture was
incubated for 30min. at –80°C and subsequently centrifuged. The pelleted DNA
was washed with 1 ml of cold 70% EtOH and dried completely. The labelled
DNA was resuspended in 50 µl of water and stored at –20°C.
38

Material and Methods
4.2.6.2 Alkaline transfer of DNA
The DNA for Southern blot analysis was separated by gelelectrophoresis
(4.2.3) on a 0.8% agarose gel. After documentation of the gel, the DNA was
transferred to a positively charged nylon membrane (Hybond N + ) by capillary
transfer using 5x SSC/10 mM NaOH buffer. The transfer was performed over
night. After transfer the DNA was fixed to the membrane using a UVcrosslinker.
The dried membrane could be stored at room temperature until
hybridisation.
Composition of 20x SSC is 3 M NaCl and 0.3 M tri-sodium citrate.
4.2.6.3 Hybridisation and detection
Prior to hybridisation with the probe, the membrane was incubated with
hybridisation buffer (0.1% n-laurylsarcosin, 0.02% SDS and 1% blocking
reagent in 5x SSC) for 1 hour. In the meantime, the DNA-probe was
denaturated for 10 min. at 95°C and then shock-cooled in an ethanol/ice bath.
Then the probe was resuspended in 10 ml of pre-warmed hybridisation buffer.
Then the probe/buffer mixture was added to the membrane and hybridised for
12-16 hours at the respective temperature. After hybridisation the membrane
was washed two times under non-stringent conditions (5 min. room
temperature in 2x SSC, 0.1% SDS) and two times under stringent conditions
(15 min at hybridisation temperature in 0.1x SSC, 0.1% SDS). Thereafter the
membrane was equilibrated at room temperature for 1 min. in buffer 1 (100 mM
Tris/HCl at pH 7.5 with 150 mM NaCl). Then the membrane was incubated at
room temperature for 30 min. in the blocking buffer 2 (0.5% blocking reagent in
buffer 1). After a washing the membrane in buffer 1, the antibody solution (2 µl
of anti-digoxygenin-ap, fab-fragment by Roche, Mannheim, in 20 ml of buffer 1)
was added to the membrane and incubated at room temperature for 30 min..
Any excess of antibody was removed by two washing steps in buffer 1 (15 min.,
room temperature). Finally, the membrane was equilibrated for 1 min. in the
detection buffer (0.1 M Tris/HCL, 100 mM NaCl, and 50 mM MgCl 2 at an pH of
39

Material and Methods
9.5). For signal generation, the membrane was incubated with the ECFsubstrate
(Amersham Pharmacia) on a glass tray. The signal was detected on
a phosphoimager (FLA-3000, Raytest). The membrane was scanned at
excitation wavelength 475 nm and emission signals above 520 nm were
detected.
4.2.7 DNA-sequencing
DNA sequencing was performed at MWG Biotech (Ebersberg).
4.3 Analysis of bacterial growth in vitro
For growth curve analysis of P. syringae bacterial cultures were inoculated to
an OD 600nm of 0.05 to 0.1 with an exponentially growing pre-culture. The
cultures were incubated at 28°C by shaking at 280 rpm. For each strain 3
separate cultures were analysed in parallel.
4.4 Analysis of bacterial growth in planta
For in planta analysis, soybean plants of the cultivar “Maple Arrow” were grown
in light shelves (Conviron) at approx. 23°C with a light period of 16 hours.
Relative humidity was approx. 40%.
4.4.1 Wound inoculation
Bacterial inoculum was prepared by resuspending cells from a fresh KB-agar
plate in sterile water. OD 600nm of the suspension was adjusted to 0.01. For
inoculation of the antagonist Pss22d, this suspension was mixed 2:1 with sterile
water. For inoculation of the pathogen Psg1a, the suspension was diluted 1:2
with sterile water. For co-inoculation, 1 volume of pathogen suspension was
mixed with 2 volumes of antagonist suspension. Subsequently, leafs of 4-weekold
soybean plants were punched with a sterile needle (10 wounds per leaflet).
Each wound was inoculated with 5 µl of bacterial suspension. For
40

Material and Methods
determination of bacterial population 20 such wounds were analysed per timepoint.
Disks of 7 mm diameter surrounding the wound-site were punched from
the leaflet using a cork-borer. The disks were grinded down in 20 ml of sterile
NaCl (0.9%). A dilution serious of the resuspension was plated on KB-agar and
cell-forming units were counted after 48 hours of incubation.
4.4.2 Spray inoculation
For spray inoculation experiments, bacterial inoculum was prepared by
resuspending cells from a fresh KB-agar plate in sterile water. OD 600nm of the
suspension was adjusted to 0.01. 100 ml of this suspension were sprayed on
three 4 weak old soybean plants. For determination of bacterial population
fresh soybean leaflets were cut and grinded down in sterile 0.9% NaCl (10ml of
NaCl per gram fresh weight). A dilution serious of the resuspension was plated
on KB-agar and cell-forming units were counted after 48 hours of incubation.
4.5 Analysis of siderophore-production
4.5.1 Uptake of 59 Fe
59 Fe can be utilized to monitor the bacterial uptake of iron/siderophore
complexes (Meyer et al., 2002). In this experiment, bacterial cells from 40 h of
culture in CAA medium were harvested by centrifugation, washed once with
distilled water, and resuspended at an OD 600nm of 0.33 in an incubation medium
made of succinate medium with the nitrogen source omitted. Label mix
containing 59 Fe/siderophore complex consisted of 5 µl of the commercial 59 Fe 3+
solution (iron chloride in 0.1 M HCl, specific activity 110 to 925 MBq/mg of iron;
Amersham) was diluted first with 100 µl of water and then mixed with 10 µl of a
6.5-mg/ml siderophore solution. Alternatively, 5 µl of the 59 Fe 3+ solution were
mixed with 100 µl of siderophore-containing culture supernatants. The final
volume of the label mix was adjusted after 30 min of incubation at room
temperature to 1 ml with incubation medium. Bacterial suspension (1.8 ml) was
mixed at time zero with 0.2 ml of label mix. After 20 min of incubation under
41

Material and Methods
gentle shaking in a waterbath at 25°C, 1 ml of the bacterial suspension was
rapidly filtered through a Whatman nitrocellulose filter (0.45-µm pore size), and
the filter was washed twice with 2 ml of fresh incubation medium. Each filter
was then wrapped in aluminum foil, and counts were determined in a Gamma
4000 counter (Beckman). The radioactivity in the remaining 1 ml of bacterial
suspension was counted directly to determine the total amount of radioactivity
present in the assay. Control assays without bacteria were performed to verify
the complete solubility of labelled iron through siderophore complexation.
4.5.2 Determination of siderophore concentration by quantitative CASassay
Quantification of siderophore activity was performed according to the CASassay
(Schwyn & Neilands, 1987). This photometric assay quantifies a colour
change of a blue coloured iron complex to red/orange after removal of the iron
by a siderophore. The indicator solution was prepared as follows:
1.5 ml of 1 mM FeCl 3+ in 10 mM HCl was mixed with 7.5 ml of a 2 mM
chrome azurol S (CAS) solution and slowely added to 6 ml of a 10 mM
hexadecyltrimethylammonium bromide (HDTMA) solution. The resulting mixture
was subsequently added to 80 ml of a buffer solution (4.307 g piperazine in
80 ml of water, neutralized by addition of 6.25ml of conz. HCl). This indicator
mixture was stored in the dark. Directly before application, 4 mM sulfosalicylic
acid, a substance that enhances siderophore/iron complexe formation. For the
quantification assay, the indicator solution was diluted ½ by addition of the
sample or a dilution of the sample. The mixture was incubated for 1 hour and
the siderophore-dependent colour change was determined at λ=630nm using a
spectrophotometer (Ultrospec 2100pro, Pharmacia Biotech, Freiburg).
Deferoxaminmesylate (DFOM) was applied as a quantification standard. The
CAS reaction was linear to a concentration of 0-20 µM DFOM.
42

Material and Methods
4.5.3 Quantification of pyoverdin by fluorescence measurement
The presence of pyoverdin was estimated by fluorescence measurements
using the F-2500 spectrofluorometer (Digilab, Krefeld). Purified pyoverdin of
Pss (courtesy of Prof. J.M. Meyer, Strasbourg, France) was used as standard.
For comparison between standard and sample, the pyoverdin was dissolved in
Pipes-medium (1 mg/ml). The excitation and emission spectrum was analysed
and an excitation maximum at λ= 397 nm as well as a maximum of emission at
λ= 458 nm was determined. Thus these parameters were applied for the
quantification measurements. A dilution series of pyoverdin in Pipes medium
served as equilibration curve for quantification. The fluorescence of the sample
was linear to pyoverdin concentration in a range of 0.5-7 µg pyoverdin/ml.
Culture supernatants were diluted until the fluorescence of the sample was in
the linear range.
4.5.4 Purification of siderophores by XAD4
Siderophore-containing supernatant of 5b cultures were harvested after 48 h of
incubation. The pH of the supernatant was subsequently adjusted to pH = 6 for
pyoverdin purification and to pH = 3 for purification of achromobactin or the
achromobactin-like siderophore. 50 ml to 150 ml of XAD4-resin (Sigma) were
loaded to a column. The column was pre-washed with water (1 L) and then the
supernatant was applied by gravity flow. Subsequently, the column was
washed with water (2 times the supernatant volume). Finally, the siderophore
was eluted in 100% methanol, until no more siderophore activity could be
measured in the eluate. The eluate was brought to dryness in a rotation
evaporator and eluted in 5-10 ml volume of water. This sample was brought to
dryness using a freeze drying apparatus (Edwards).
For fast screening of siderophores, this purification method was downscaled.
2 ml of culture supernatant were harvested and applied on a Mobicon minicolumn
(Mobitech, Göttingen) containing 2 ml of XAD4-resin. Supernatant was
applied to the column twice in order to improve siderophore binding. The
43

Material and Methods
columns were washed twice with 5 ml of water and eluted with 500 µl of 100%
methanol. The eluate was brought to dryness using an Eppendorf
Concentrator.
4.5.5 Isoelectric focussing of siderophores
The method of Koedam et al. was adapted to perform isoelectric focussing of
siderophores (Koedam et al., 1994). The Multiphore II electrophorese unit
(Amersham) was used for IEF. Polyacrylamid gels consisted of 4 ml Readysolve
IEF mixture (Amersham), 4 ml of 25% glycerol, and 1 ml of ampholyte 3-
10 (Biorad). Water was added to a volume of 20 ml and 25 µl TEMED as well
as 50 µl of 10% ammoniompersulfate were added to start polymerisation. After
polymerisation, the gel was placed on the cooling plate of the Multiphore II
elecrophoresis unit. Per lane, 1µl of sample was applied. A three-step
electrophoresis with 15 min at 100 V, 15 min at 200 V, and 1 h at 450 V was
performed at 4°C. Immediately after electrophoresis, the siderophore bands
were visualized by CAS overlay. For this the CAS indicator solution (4.5.2) was
supplemented with 1% agarose and a 0.1-2 mm gel was cast. The indicator gel
was overlayed over the polyacrylamid gel and bubbles were carefully removed.
After short incubation (5-10 min) siderophore active bands became visible due
to the colour change of the CAS-indicator.
4.5.6 Gel-filtration
The Biorad Econo-system was used for gel-filtration. The column size used was
0.5 cm x 20 cm. Three different column-materials were tested (Fractogel TSK
HW 50s, Merck; Bio-Gel P-30, Biorad; and G25 Sephadex, Amersham). All
materials were equilibrated in water. XAD4-purified siderophore was
resuspended in 0.5-1 ml of water and applied to the columns. Mobile phase for
the separation was water at a flow speed of 1 ml/min. Fractions of 2 ml volume
were collected and subsequently tested for siderophore activity by CAS assay
(4.4.2)
44

Material and Methods
4.5.7 Thin-layer chromatography
Thin layer chromatography was performed on silica-based TLC plates
(Macherey-Nagel, Düren). Samples were applied as methanol solutions and
brought to dryness completely prior to separation. Separation was performed in
glass tanks with equilibrated gas phase. The respective mobile phase was
prepared freshly prior to TLC separation. After separation, substances were
detected by autofluorescence at an excitation wavelength of λ=365nm or
quenching of a fluorescence indicator within the silica matrix (excitation
λ=254nm). Alternatively, the TLC plate was scanned on the phosphoimager
(Fla-3000, Raytest) as described under 4.2.6.3. Detection of siderophore
activity was achieved by CAS overlay as described under 4.5.5.
45

Results
5 Results
5.1 Analysis of siderophores produced by Pss22d
Under iron-limiting conditions many pseudomonads produce a yellow-greenish,
fluorescent pigment, thus they are classified as “fluorescent pseudomonads”.
These pigments are peptide-type siderophores called pyoverdins. All
pyoverdins share the same dihydroxyquinoline chromophore responsible for
their fluorescence, with an amidically connected small dicarboxylic acid (or its
monoamide). The peptide chain bound to the chromophore carboxyl group
varies. It consists of 6-12 amino acids often including modified amino acids or
D-forms (Fuchs et al., 2001). Approximately 50 different pyoverdins have been
identified so far and the type of pyoverdin produced can vary even among
strains of the same species, for example 3 different pyoverdins have been
characterized for P. aeruginosa (de Chial et al., 2003). In contrast to their
otherwise prominent diversity, all pathovars of P. syringae tested so far produce
the same pyoverdin (Fig.6) (Bultreys et al., 2001; Bultreys et al., 2003; Bultreys
et al., 2004; Jülich et al., 2001). In order to validate that pathogen Psg1a and
antagonist Pss22d do produce this pyoverdin (Pvd Ps ), a
59 Fe-uptake
experiment was performed with the help of our collaboration partner
HO
L-Thr 1
HO
H
NH CO N
CO
OC
HN
HO COOH
D-OHAsp 1
OC L-Thr 2
OH
HN
COOH OH
L-Ser 2
L-Ser 1
D-OHAsp 2
A
OC
HN
HO
CO
NH
COOH
HO
HO
NH 2
CH
CH2
CH 2 L-Lys
CH 2
CH2
NH
H
N +
O
NH
NHCOCH 2 CH 2 CONH 2
1, L-Ser 1
2, Gly
B
HO
OC
HN
OC
HN
HO
OC
HN
O
HO
L-Thr 1
L-Thr 2
CO
CO
NH
NH
COOH
CO
HO
D-OHAsp
OH
H
N
COOH
D-OHAsp 1
L-Ser 2
CO
HO
HO
NH 2
CH
CH2
CH 2 L-Lys
CH2
CH 2
NH
H
N
O
+
NH
NHCOCH2CH2CONH2
Fig. 6. The siderophore pyoverdin of P. syringae.
The pyoverdin typical for P. syringae has a seven amino-acid side chain that can be linear (A) or
can form a ring between the second threonine and the terminal serine (B).
Modified after Bultreys et al., (2004)
46

Results
Prof. J. M. Meyer (Strasbourg, France). Pantoea agglomerans strain 48b
served as control. The cells of Psg1a and Pss22d could both incorporate
labeled iron in the presence of reference pyoverdin of the P. syringae type,
while none could utilize a 59 Fe – desferrioxamine E complex. In contrast, cells
of P. agglomerans 48b incorporated only the labeled desferrioxamine E and
not pyoverdin (Tab. 8). The uptake experiment indicated that both strains,
Psg1a and Pss22d, produce a pyoverdin typical for P. syringae.
5.1.1 Construction of a pyoverdin-deficient mutant of Pss22d
The phenotypic difference between Pss22d and Psg1a on CAS-agar could
either originate from quantitative differences in pyoverdin production or the
production of other siderophores aside of pyoverdin. To address this question,
a pyoverdin-negative mutant of Pss22d was constructed by marker exchange
mutagenesis. The biosynthesis of pyoverdines is not completely understood,
but several essential enzymes have been determined (Ravel & Cornelis, 2003).
As the pyoverdin chromophore is essential for a functional pyoverdin and as its
structure is highly conserved, the enzymes involved in chromophore formation
represent good targets to generate a biosynthesis mutant. In P. fluorescense,
the non-ribosomal peptide synthetase (NRPS) PvsA has been determined to
mediate the formation of the chromophore precursor. A homologue of the
respective pvsA gene in P. syringae pv. maculicola DC3000 (PsmDC3000) had
already been described (Mossialos et al., 2002).
Tab. 8. 59 Fe uptake experiment.
Plant associated bacteria where tested for their ability to incorporate different iron
siderophore complexes labelled by 59 Fe.
59
Fe incorporation mediated by
strain Desferrioxamine E P.syringae pyoverdin
Psg1a - +
Pss22d - +
P. agglomerans 48b + -
47

Results
The 13-kb open reading frame (ORF) of pvsA encodes for a multi-domain
enzyme consisting of four different modules (Fig.7).
A
module 1 module 2
(L-Glu)
module 3
(D-Tyr → L-Tyr)
module 4
(L-Dab)
B
C
4 3 2 1
PVSA
2 kb PCR
fragment 2
PCR
fragment 1
Fig. 7. Construction of a pvsA deletion mutant in Pss22d.
The NRPS PvsA is involved in the biosynthesis of the precursor of the pyoverdin chromophore
(A). It consists of four different modules and comprises the domains for activation of three
amino acids, L-glutamate, D-tyrosine and L-2, 4-diaminobutyric acid, while the function of
module 1 is undetermined up to now (B). The domains are abbreviated as follows: AL = acyl
CoA ligase, A = adenylation, T = 4´phosphopantheteine binding, E = epimerisation, and C =
condensation
For construction of the deletion mutant, fragments of the 13kb ORF pvsA were amplified by
PCR (C). The respective primer-binding sites are numbered 1-4. The first fragment is the
1,4kb amplificate of primer pvsA_fwd1_Spe (1) and pvsA_rev6_Kpn (2) and the second
fragment is the 1,6kb region amplified by the primers pvsA_fwd7_Kpn (3) and
pvsA_rev4_Bam (4). The fragments were subsequently fused to a Km r -cassette and brought
back into pvsA by double homologues recombination. In the recombinant mutant, a 1,7kb
fragment containing the adenylation and part of the termination domain of module 2 is
exchanged by the Km r -cassette. Modified after Mossialos (2003)
48

Results
While the function of module 1 is unclear, modules 2-4 are responsible for
activation and condensation of glutamate, tyrosine, and diaminobutyric acid,
respectively (Mossialos et al., 2002). It is well-known that the modular structure
of NRPS allows some genetical modifications. If one of the modules is deleted
completely the rest of the enzyme remains functional, producing a similar
peptide just missing the respective amino acid residue (Finking & Marahiel,
2004). Taking this into account, deletion of the complete adenylation domain
and part of the condensation domain of module 2 in the marker exchange
construct should block chromophore synthesis. We could identify a homologue
of pvsA in the genome sequence of PssB728a.
This strain is closely related to Pss22d and primers derived from the nucleotide
sequence of PssB728a were used to amplify a PCR product of Pss22d. A first
PCR fragment of 1.4 kb was amplified by primer pair pvsA_fwd1_Spe and
pvsA_rev6_Kpn. The amplificate was purified and subcloned in the T/A cloning
vector pGEM-T Easy (Promega) resulting in plasmid pPVSA1. The second
PCR fragment, 1.6 kb in size, was amplified by primers pvsA_fwd7_Kpn and
pvsA_rev4_Bam. It was purified and ligated into pGEM-T Easy, resulting in
plasmid pPVSA2. Subsequently, the SpeI/KpnI fragment of pPVSA 1 was
cleaved, purified and inserted into pPVSA2, resulting in plasmid pPVSA3.
Finally, a 1.7 kb KpnI fragment of plasmid pMKm, carrying the kanamycin
resistance cassette, was inserted into the unique KpnI site of pPVSA3. The
resulting plasmid, pPVSA4, carries the entire marker exchange cassette
consisting of the kanamycin cassette flanked by the two PCR fragments.
pPVSA4 was transferred into Pss22d by electroporation. As the pGEM-T Easy
vector backbone is not able to replicate in Pss22d, the plasmid acts as a
suicide plasmid. Consequently, the resistance against kanamycin is transferred
to Pss22d only if the plasmid recombines into the chromosome. If integration of
the resistance cassette occurs due to a single cross-over, the complete plasmid
integrates and the transformants carry the resistance of the plasmid backbone
(i.e. ampicillin), too.
49

Results
If integration is due to a homologues double cross over event, the plasmid
backbone is lost. Thus the Pss22d transformants were screened for kanamycin
resistance and the resulting candidates were than screened for a lack of
ampicillin resistance. Finally, integration of the marker exchange cassette by
double crossover was verified by Southern blot analysis (Fig.8). Plasmid
pPVSA4 (control) and genomic DNA of wild type (wt) Pss22d and of 5 possible
transformants were digested by ApaLI, separated by agarose gelelectrophoresis,
transferred to a membrane and then hybridized at 60°C. Three
separate blots were analyzed by hybridization with probes against the
pGEM-T Easy vector backbone, the kanamycin cassette, and pvsA PCR
fragment1. Transformant no. 5 showed the expected hybridization pattern for
double cross-over insertion: There is no signal for the vector backbone, but
there is a signal for the kanamycin cassette.
probe:
vector backbone kanamycin cassette
pvsA fragment 1
K M wt 1 2 3 4 5 K M wt 1 2 3 4 5 K M wt 1 2 3 4 5
8
5
4
3
2
1,6
size (kb)
Fig. 8. Verification of the Pss22d∆Pvd genotype by Southern blot analysis.
Five different transconjugants were tested for correct insertion of the marker-exchange cassette by
double-homologues recombination. Sample DNA was digested with ApaL1 and loaded as follows:
K= control plasmid pPVSA4; M= 1kb molecular weight standard; wt= Pss22d; 1-5 = Transformants
of Pss22d electroporated with pPVSA4 and screened for kanamycin resistance. Three separate
blots were analysed by hybridisation with probes against the pGEM-T Easy®-vector backbone, the
kanamycin cassette, and pvsA PCR fragment 1, respectively. The red boxes indicate the
hybridisation pattern of Pss22d wild type and the double cross-over mutant no. 5.
50

Results
The signal for PCR fragment 1 is shifted as compared to Pss22d wt. This shift
is due to the insertion of the resistance cassette and the loss of a chromosomal
ApaLI site within the deleted sequence. Transformant no. 5 was designated
Pss22d∆Pvd and further analyzed for its siderophore phenotype. As expected,
Pss22d∆pvsA was no longer fluorescent when grown on King’s B medium
indicating the deficiency of the strain to produce pyoverdin (Fig.9A). But
surprisingly, it still produced a halo on CAS-agar almost as large as the wild
type strain (Fig.9B). This halo clearly indicated that mutant Pss22d∆pvsA
produces a functional siderophore although the pyoverdin biosynthesis of this
strain disrupted successfully.
5.1.2 Southern blot analysis of Psg1a and Pss22d for the presence of
yersiniabactin biosynthetic genes
At the time of construction of Pss22d∆Pvd, the first genome sequence of a
P. syringae was completed, namely the sequence of PsmDC3000. With the
finished annotation of the genome project, the presence of a yersiniabactin
biosynthesis cluster in PsmDC3000 was reported (Buell et al., 2003).
Pss22d∆Pvd
Pss22d
A
B
Fig. 9. Siderophore production of Pss22d and Pss22d∆Pvd.
A: Fluorescence of pyoverdin on Kings B medium; B: Siderophore production
on CAS agar. Bacterial suspension was applied to the respective medium and
incubated at 28°C for 48h.
51

Results
Yersiniabactin is a siderophore first identified in Yersinia pestis but also
reported for a number of other bacteria like for example uropathogenic E. coli
(Schubert et al., 1998). BLAST analysis of the available sequence for
PssB728a did not show any possible candidates of yersiniabactin biosynthetic
genes. Since it was unclear whether Pss22d produces yersiniabactin, a
Southern blot analysis was performed. The NRPS encoded by the irp1 gene is
necessary for yersiniabactin synthesis, thus a probe was derived against the
irp1 homologue of DC3000 via PCR and used for hybridization of KpnI-digested
genomic DNA of Psg1a, Pss22d, PssB728a and PsmDC3000. Hybridization
temperature was 55°C. The only signal detected was that of the control,
PsmDC3000 (Fig.10). Although we can not completely exclude the presence of
a yersiniabactin biosynthetic gene cluster in Psg and Pss, for the tested strains
the presence of yersiniabactin biosynthetic genes is unlikely.
1
2 3 4
10 kb
Fig. 10. Screening for the yersiniabactin
biosynthesis gene irp1 by southern blot
analysis.
KpnI digested genomic DNA of Psg1a (1),
Pss22d (2), PssB728a (3) and
PsmDC3000 (4) was hybridised with a
probe against the yersiniabactin NRPS
irp1.
52

Results
5.1.3 Screening for an additional siderophore of Pss22d by random
mutagenesis
In order to identify biosynthetic genes responsible of the potential second
siderophore of Pss22d, a random mutagenesis was conducted. For this we
used a modified mini-Tn5 construct derived from pCAM140 (Wilson et al.,
1995). The plasmid pCAM-Not was constructed by Dr. Helge Weingart via
deletion of the gusA gene by NotI digest of pCAM140. Random mutagenesis
was performed by conjugating the plasmid pCAM-Not in both, Pss22d∆pvsA
and Pss22d wt. The random character of transposon insertion-loci was verified
by analysis of size distribution among the transposon-tagged fragments in
Pss22d∆pvsA tansconjugants, as follows. Genomic DNA of 17 Tn5 mutants of
Pss22d∆Pvd was digested with PstI (Fig.11A) and ClaI (Fig.11B) and
hybridized with a probe against Tn5 at 60°C. The resulting distribution pattern
did not show any redundancy of fragment sizes, thus it could be assumed that
the mutagenesis had resulted in random Tn5 insertion.
Size (kb)
A
B
Fig. 11. Distribution of mini-Tn5 insertions in Pss22d∆Pvd.
17 Tn5 mutants of Pss22d∆Pvd were analysed for their loci of transposon
insertion. Genomic DNA was digested with PstI (A) and ClaI (B) and examined by
Southern blot analysis for the size of the Tn5 insertion fragment. The probe was
derived against the BamHI fragment of the transposon.
53

Results
Next, a large number of transconjugants was screened on CAS agar for
siderophore-negative (Sid - ) phenotype (Fig.12). The colony size of the resulting
mutants on the indicator plates had a remarkable influence on the size of the
siderophore-derived halos. Therefore, all clones that did not produce a halo in
the first screening where re-streaked on a CAS agar plate. Out of 500 Tn5-
mutants of Pss22d∆Pvd, three siderophore-negative clones were obtained. In
contrast and as expected, screening of 1500 Tn5-mutants derived from Pss22d
wild type did not result in any siderophore-negative mutants.
The loci of transposon insertions in the siderophore-negative mutants were
subsequently identified by cloning. Genomic DNA of mutants Pss22d∆Sid,
Pss22d∆Sid-23 and Pss22d∆Sid-25 was treated with the following restrictases:
PstI, ClaI, XbaI, KpnI, SacI, SacII and SpeI. These digests were ligated into
plasmid pBBR-Mcs1 cleaved with the respective restrictase. In order to select
for ligation products containing the transposon, the ligation was transformed
into E. coli DH5α and transformants were screened for spectinomycin
resistance mediated by the mini-Tn5. Two plasmides were derived from this
experiment: pBBR-11-Sid and pBBR-23-Sid, containing a PstI insert of
Pss22d∆Sid and Pss22d∆Sid-23, respectively. Insert sizes of both plasmids
were approx. 6 kb. The plasmids were sent to MWG biotech for sequencing.
Fig. 12. Screening of Tn5-mutants for
siderophore-negative phenotype on CAS-agar.
Transposon mutants of Pss22d∆Pvd were picked on
CAS-agar plate and incubated for 48h.The white
arrow indicates a sid - clone.
54

Results
For both plasmids a 500 bp sequence starting from the pBBR T7 primer binding
site was obtained. The sequences were then used for BLAST analysis. Figure
13 summarizes the result obtained for pBBR-11-Sid. For pBBR-23-Sid, the
same sequence was obtained, indicating that the same PstI Fragment had
been subcloned.
i- mini-Tn5 -o
2,8 kb 1,3 kb
A
acr
acsF
acsD
acsC
acsA
acsE yhcA
acsB
cbrA-D
B
acr
acsF
acsD
acsC acsA
acsE yhcA acsB
cbrA-D
C
acsF
acr
acsD
acsC acsA
acsE yhcA acsB
cbrA-D
2 kb
Fig. 13. Location of mini-Tn5 insertion 11-Sid - in Pss22d∆Pvd.
BLAST analysis of the insert sequence obtained for pBBR-11-Sid - showed significant
similarities to the sequence of the achromobactin biosynthesis cluster in Dikeya chrysanthemi
(C) and the two genome sequences of PssB728a (A) and Psp1448A (B). The part of the insert
fragment that could be sequenced was located approx. 2.8 kb upstream of the transposon i-
end and it aligned with the iucAC-like siderophore synthetase acsD. This indicated, that the
transposon itself is inserted in the yhcA-permease. Comparison of the three clusters shows a
high similarity in sequence and organisation of the genes, yet the siderophore receptor acr is
arranged differently (indicated in red). ORF’s indicated in green could be part of the
achromobactin cluster as well.
55

Results
Nevertheless the site of transposon insertion varies a little, as restriction
analysis could demonstrate (data not shown). Blast analysis of the pBBR-11-
Sid 500bp sequence showed significant sequence similarity to genes of the
Dickeya chrysanthemi (formerly Erwinia chrysanthemi) achromobactin
biosynthesis cluster (GenBank accession number: F416740 and AF416739;
Franza, et. al. 2005). Best similarity was obtained for the acsD siderophore
synthetase from within this gene cluster. Calculation of the respective fragment
sizes indicated, that the localization of transposon insertion should be within the
gene yhcA encoding for a permease.
The insertion into yhcA was next confirmed by a PCR subcloning technique
(Daria Zhurina, personal communication). By the time this sequence
information was obtained, draft annotation of the genome sequence of
PssB728a became available at GenBank (www.ncbi.nlm.nih.gov/Taxonomy/
taxonomyhome.html, TxID: 205918).
In line with our results for Pss22d, the draft annotation indicated the presence
of a second siderophore biosynthetic gene cluster in PssB728a. This cluster
showed similar organization and high sequence identities to the achromobactin
biosynthetic gene cluster from D. chrysanthemi. As the genome sequence of
P. syringae pv. phaseolicola 1448A became available, we could identify a
similar siderophore biosynthesis cluster in this pathovar, too (Fig.13). There is
no homologue of this cluster in strain PsmDC3000.
Comparison of the biosynthesis cluster in the three positive strains allowed the
following observations:
1) All genes that have been assigned to be involved in achromobactin
biosynthesis are present in every strain (Fig.13; grey arrows, genes
labeled according to Franza, et. al. 2005).
2) The aminotransferase acsF is located differently in D. chrysanthemi as
compared to P. syringae (Fig.13). While it is located upstream of the
56

Results
siderophore receptor gene acr in D. chrysanthemi, it is downstream of
this ORF in the pseudomonads.
3) Certain additional genes could potentially be part of the siderophore
cluster (Fig.13 indicated in green). Following cbrD, there is a putative
methyltransferase gene, conserved in all three strains. In both
pseudomonads a putative regulator containing a sensory domain with
week similarity to chemotaxis/aerotaxis and a regulator containing a
GGDEF domain involved in cyclic-diGMP signaling are present directly
after the siderophore cluster. Additionally, in both P. syringae strains two
putative regulatory genes are located in front of the siderophore
receptor. The first is a homologue of the alternative sigma factor FecI,
involved in ferric citrate uptake. The second shows similarities to the
regulator FecR that interacts with FecI (Visca et al., 2002).
As Pss22d∆Sid is the best characterized of the three transposon mutants, this
derivation was used for further analysis.
5.1.4 Construction of a marker exchange mutant of the achromobactinlike
siderophore in Pss22d
In order to address the impact of the achromobactin-like siderophore on the
phenotype of Pss22d, a non-polar marker exchange mutant, deficient for the
biosynthesis of this siderophore was constructed. The achromobactin
biosynthesis cluster encodes for three copies of a siderophore synthetase,
namely AcsA, AcsC, and AscD. These synthetases are supposed to be
responsible for the amide bond formation connecting the achromobactin
precursor molecules (Fig.14). The first of the three corresponding genes is
acsD. In mutant Pss22d∆Ach, this ORF has been exchanged against a
kanamycin cassette (Fig.15). For the construction of this mutant, a 1.3-kb PCR
fragment was amplified by PCR using the primer combination Achr1_fwd and
Achr2_KpnI_rev. The PCR fragment was purified and ligated into the vector
pGemT-easy. The resulting plasmid pACS1 was selected for orientation of the
57

Results
Achr2_KpnI_rev binding site next to the SpeI recognition site of the vector. A
second PCR fragment of 2 kb was amplified by the primer pair
Achr5_EcoRV_fwd and Achr6_rev. The PCR product was purified and brought
into pGemT-easy, too. This plasmid was designated pACS2. The 1.7-kb PstI
fragment of pMKm was purified and blunt-ended by application of Klenow
fragment. Plasmid pACS1 was linearized by SpeI, blunt-ended and fused with
the kanamycin resistance cassette by ligation.
Fig. 14. Structure of the siderophore achromobactin.
The oxo-glutaric acid side chains of achromobactin can cyclize. The structure shown on the right
prevails under neutral conditions. The siderophore synthetases AcsA, AcsC and AcsD are
supposed to form the amide bonds present in achromobactin. Modified after Franza, et al.,
(2005).
The resulting plasmid carrying a 3 kb insert was designated pACS3. This
plasmid was linearized by the restrictase ScaI and afterwards treated with
EcoRI, resulting in a 3-kb fragment of the insert and parts of the vector
backbone. The 3-kb fragment was purified, blunt ended and ligated into the
EcoRV-opened plasmid pACS2. Correct orientation of the fragments to each
other, resulting in the kanamycin cassette being flanked by both PCR
fragmentes was verified by restriction digest with the restrictase PstI. As PCR
fragment 1 carries an internal recognition site for this enzyme in addition to a
single recognition site in the vector sequence, the fragment pattern of a plasmid
with insert in correct orientation could be unambiguously identified.
58

Results
Fig. 15. Construction of the marker exchange mutant Pss22d∆Ach.
acsD is the first of three genes encoding for a siderophore synthetase. In mutant Pss22d∆Ach,
this ORF has been exchanged by a kanamycin cassette. For construction of this mutant, a 1,3 kb
PCR fragment was amplified by the primers Achr1_fwd (1) and Achr2_KpnI_rev. A second PCR
fragment, 2 kb in size, was amplified by the primer pair Achr5_EcoRV_fwd (4) and Achr6_rev (4).
The PCR fragments were subsequently fused to a 1.7-kb fragment containing a kanamycin
resistance cassette and incorporated into the chromosome by double homologous recombination.
Dashed arrow indicate the flanking genes acr and acsA.
The resulting plasmid, carrying the complete marker exchange construct was
designated pACS4. This plasmid was transferred into Pss22d by
electroporation and the resulting tranformants were screened for kanamycin
resistance and absence of ampicillin resistance. The correct genotype of the
candidate transformantes was verified by PCR (data not show). The resulting
mutant was designated Pss22d∆Ach.
5.1.5 In vitro comparison of Pss22d and its siderophore mutants
The phenotype of the Pss22d and the single siderophore mutants was
compared on CAS agar (Fig.16).
A
B
C
D
Figure 16. Siderophore production on CAS-agar.
Bacterial suspensions of A: Pss22d; B: Pss22d∆Ach;
C: Pss22d∆Sid; and D: Pss22d∆Pvd were applied on
a CAS-agar plate and incubated at 28°C for 48h.
59

Results
Interestingly the mutant Pss22d∆Pvd shows an as large siderophore halo as
Pss22d wt, while the halo of Pss22d∆Ach is reduced.The siderophore negative
mutant Pss22d∆Sid, produced no halo as indicated previously. In order to
investigate this phenotypic difference between Pss22d∆Pvd and Pss22d∆Ach
in more detail, siderophore production of Pss22d and its siderophore mutants
was analysed during in vitro growth in iron free Pipes medium (Fig.17; Tab. 9).
The two single mutants Pss22d∆Pvd and Pss22d∆Ach grew similar. Compared
to the wild type, they grew a little bit slower, but the difference was only minor.
The double mutant and Pss22d∆Sid grew considerably slower than the wild
type, yet it reached the same OD 600 . The siderophore production during growth
in liquid was analyzed as well (Tab. 9).In contrast to their similar growth,
analysis of siderophore production showed a clear difference between both
single mutants. While Pss22d∆Ach did produce as much siderophore activity
and fluorescence as the wild type, mutant Pss22d∆Pvd produced a more than
5 times higher siderophore activity.
10
OD600
1
0,100
0,010
0 5 10 15 20 25 30 35 40 45
time (h)
1
2
3
4
Fig. 17. In vitro growth of
Pss22d and its respective
siderophore mutants.
Growth in Pipes medium
under iron-limiting conditions
was compared between
Pss22d wt (1), Pss22d∆Pvd
(2), Pss22d∆Ach (3), and
Pss22d∆Sid (4). Both single
mutants grew similar, only
slightly slower than the wild
type. The double mutant
Pss22d∆Sid, instead, shows
a significantelly slower
growth.
60

Results
Tab. 9. Siderophore Production of Pss22d and its mutants.
Siderophore production and fluorescence of Pss22d and the derived
siderophore mutants after 48h of growth in Pipes medium. Values are
normalized to OD 600 =1.
µM DFOM
equiv.
fluorescence
[Pvd ps ] in
µg/ml
Pss22d 16 +/- 0 30 +/- 6
P ss22d∆Pvd 107 +/- 0 1 +/- 0
P ss22d∆Ach 20 +/- 0 33 +/- 0
P ss22d∆Sid 0 1 +/- 0
5.1.6 Purification of the achromobactin-like siderophore for structure
determination
Analysis of the Pss22d∆Sid transposon insertion allowed the conclusion, that
Pss22d produces siderophore similar to achromobactin. Whether this
siderophore is identical to achromobactin (Fig.14) or just similar to it remained
to be determined by structural analysis. NMR analysis is currently been
performed in cooperation with the laboratory of Prof. Budzikiewicz, University of
Köln. This laboratory already determined the structure of authentic
achromobactin from D. chrysanthemi (Münzinger et al., 2000).
To obtain an NMR-suitable sample of the achromobactin-like siderophore of
Pss22d, this siderophore had to be extracted from the culture supernatant and
next had to be separated from other secondary metabolites, cell debris and
residual medium components. For this, column chromatographic methods like
gel-filtration or HPLC are applied frequently. For both methods a concentration
of the sample volume prior to applications was necessary. To do so, affinity
chromatography offered the advantage that a large sample volume could be
dealt with at one time without preceding concentration steps. XAD4-resin
(Sigma) had been successfully applied for affinity chromatography of pyoverdin
(Jülich et al., 2001), and we could successfully modify this method for a first
concentration of the achromobactin-like siderophore of strain Pss22d∆Pvd.
61

Results
XAD4-purification yielded in a yellow-brownish mixture of substances; thus it
had to be further cleaned. The following three gel-filtrations using different
materials (Fractogel TSK HW 50s, Merck; Bio-Gel P-30, Biorad; and G25
Sephadex, Amersham) were conducted, resulting in an almost colorless
sample. Interestingly, upon addition of iron the color of the sample changed to
yellow. This is remarkable, as the D. chrysanthemi achromobactin was named
so because the iron-siderophore complex did stay colorless (Münzinger et al.,
2000). Unfortunately, the sample obtained after gel-filtration still contained
interfering substances and the resulting siderophore concentration was rather
low. Thus it was not suitable for NMR (Prof. Budzikiewicz, cologne, personal
communication). Therefore other methods were tested. HPLC separation on a
C18-RP sherisorp column did result in separation of several substances, but no
siderophore activity could be determined after the HPLC run (data not shown).
Next, separation of the sample by thin layer chromatography (TLC) was
conducted. Compared to column chromatography, TLC allows a rather fast
optimization of separation conditions, as it circumvents collection and testing of
numerous fractions per separation step. Theoretical models on the separation
characteristics of mobile phase mixtures allow a targeted modification of
solvent mixtures (Nyiredy, 2004; Snyder, 1978). After successful optimization of
the separation strategy, preparative TLC can be utilized or the running
conditions can be transferred back to column chromatography. TLC separation
of XAD4-purified supernatant of Pss22d∆Pvd was performed on silica plates
(Macherey-Nagel) in combination with various mobile phases. Separation of the
sample was investigated by autofluorescence of the substances at an excitation
wavelength of λ=360nm or quenching of a fluorescence indicator within the
silica matrix (excitation λ=254nm). The position of the achromobactin-like
siderophore was determined by CAS-overlay. A first TLC-separation of
Pss22d∆Pvd XAD4-purification using an equivolurimetric mixture of
diethylether, n-butanole, acetic acid, and water resulted in the separation of
several fluorescent substances (Fig.18).
62

Results
Fig. 18. Seperation of the achromobactin-containing XAD4
purificationS by TLC.
XAD4 purified supernatant of Pss22d∆Pvd separated by TLC on silica
plate (mobile phase: Diethylether : n-butanole: acetic acid: water; ratio
1:1:1:1; v/v). Fluorescence of the sample was visualizes by UV 365nm .
Drawn line at the bottom indicates the start and the uppermost fluorescent
line represents the running front.
Separations of the Pss22d∆Pvd XAD4-purification were compared to that of the
Pss22d∆Sid and a control achromobactin sample purified from
D. chrysanthemi cbsE-1 tonB60 (Fig.19). In all three samples the majority of
fluorescent components migrated to more than half of the running front. The
CAS-overlay of the TLC plates showed a positive reaction for authentic
achromobactin and the Pss22d∆Pvd XAD4-purification (Fig19A).
In both samples the CAS-active substance had moved only slightly (retention
factor of 0.25). As expected this band was absent in the siderophore-deficient
strain. No fluorescent band could be associated to the CAS-active region on the
plate, indicating that neither the achromobactin-like siderophore nor authentic
achromobactin were visible at the wavelength tested.
A
B
←
1 2 3 1 2 3
Fig. 19. CAS overlay of TLC separated XAD4 purification.
XAD4 purified supernatant separated by TLC on silica plate with different
mobile phases: A) Diethylether : n-butanole: acetic acid: water; ratio 1:1:1:1;
(v/v). B) MTBE : Methanol: acetic acid : water; ratio 3:1:1:1 (v:v).
Samples: 1) Pss22d∆Pvd 2) Pss22d∆Sid 3) Achromobactin purified from
D. chrysanthemi cbsE-1 tonB60. The arrow indicates CAS-active band of
Pss22d∆Pvd, the less intensive signal below this band is due to long
incubation time of the overlay.
63

Results
After changing the mobile phase to methyl t-buthyl ether (MTBE), methanol,
acetic acid and water (3:1:1:1, v/v) the retention factor of the CAS-active
substance was increased to 0.45 (Fig.19B). Interestingly, the retention factor for
authentic achromobactin differs from that (0.35). The smearing of the CASactive
band of Pss22d∆Pvd (Fig.19B) was likely due to a relatively long
incubation of the overlay in order to visualize a second signal above the major
CAS-active band. This additional signal could be observed in both siderophorepositive
samples and may correspond to a second conformation of the
siderophore.
The original CAS-active band of Pss22d∆Pvd corresponds to the more
intensive spot indicated by the arrow (Fig.19B). Approximately the same
amount of XAD4-purification was applied for both strains and the intensity of
the different fluorescent bands did not differ significantly between both lanes. In
contrast, the siderophore activity detected for D. chrysanthemi cbsE-1 tonB60
was much lower as compared to Pss22d∆Pvd.
The modified separation conditions are currently applied on the next large-scale
purification. After this step, another TLC-separation using a different stationary
phase will be used for further purification. Macherey-Nagel offers a range of
differently modified silica plates with varying hydrophobicities of the matrices.
The affinity of the CAS-active substance to silica modified by addition of a diolor
an amino group was tested (Fig.20). The affinity of the CAS-active substance
towards the stationary phase was lower for the diol modification and higher for
the amino modified plate. Thus the diol modified plate could be optimized for
better focusing of the CAS-active band, while the amino-modified phase could
be used to separate other disturbing substances.
64

Results
silica diol am ino silica diol amino
Fig. 20. Comparison of different silica matrixes.
XAD4-purified supernatant separated by TLC with different stationary phases: Silica=normal Silica
60; diol= silica with an added diol group; amino= silica with an added amino group; left side shows
fluorescence scane with the phosphoimager while the right side shows the respective CAS-overlay.
Mobile phase was diethylether : n-butanole: acetic acid: water; ratio 1:1:1:1; v/v.
Samples from left to right: Pss22d∆Sid; Pss22d∆Pvd; D. chrysanthemi cbsE-1 tonB60
5.2. Comparison of siderophore production in Psg1a and Pss22d
BLAST analysis had demonstrated the presence of the achromobactin-like
gene cluster in two of the three sequenced P. syringae strains and in Pss22d,
but what about the pathogen Psg1a? To address this question, XAD4-
concentrated culture supernatants from Psg1a, Pss22d, Pss22d∆Pvd, and
Pss22d∆Sid were compared by isoelectric focussing (IEF). IEF is generally
applied to separate proteins or peptides on a polyacrylamid gel according to
their isoelectric point, but it has also been successfully applied to investigate
siderophore patterns among different bacteria (Fuchs et al., 2001). For this,
siderophore-containing samples were separated on a polyacryamidgel and
subsequently visualized by CAS-overlay. Figure 21 shows results of such an
experiment. Pvd Ps (courtesy of Prof. J.M. Meyer, Strasbourg, France) served as
control. Pss22d and Psg1a produced the same band patterns consisting of two
pyoverdin bands and an additional band corresponding to the achromobactinlike
siderophore. So, despite their phenotypic difference on CAS agar plate,
both strains showed the same siderophore pattern.
65

Results
P
P
A
Fig. 21. Isoelectic focusing and CAS-overlay detection of purified siderophores.
Lanes: A: reference pyoverdin of P. syringae; B: Psg1a; C: Pss22d; D: Pss22d∆Pvd;
E: Pss22d∆Sid; P= pyoverdin; A= achromobactin-like siderophore
Siderophore production of antagonist and pathogen were analysed in more detail
during growth in iron-free pipes medium (Fig.22). One aim of this analysis was to
distinguish between pyoverdin production and production of the achromobactinlike
siderophore. As demonstrated before, there is no fluorescence signal in
pyoverdin-negative Pss22d strains and the siderophore-negative mutant does
not show a reaction in the CAS-assay (Tab. 9). Thus comparison between CASmeasurement
and fluorescence determination was used to differentiate between
total siderophore production (= achromobactin-like siderophore plus pyoverdin)
and pyoverdin production.
In initial experiments, 250 ml of culture were incubated in a 1 L Erlenmeyer flask
(Fig.22A). The antagonist Pss22d reached stationary phase within 30 h at an
OD 600 of 2. Psg1a showed a slower growth and reached the stationary phase not
before 60 h, yet it reached the same OD 600 . In contrast to our expectations, the
siderophore activity produced by the antagonist Pss22d was significantly (about
10 times) lower than that of the pathogen Psg1a. While the activity of Psg1a was
in line with previous results (Fig.5B), siderophore production in Pss22d was
66

Results
A
B
Fig. 22. Comparison of growth, siderophore production and fluorescence of Pss22d and Psg1a.
Siderophore production and fluorescence of antagonist Pss22d and pathogen Psg1a were compared
during in vitro growth in iron-depleted Pipes medium. The strains were incubated either in 250 ml culture
volume in 1 L Erlenmeyer flasks (A) or in 250 ml culture volume in 2 L Erlenmeyer flasks (B).
67

Results
reduced in comparison to these prior experiments. As the production of
siderophores is known to be tightly regulated, we next analyzed potential
regulatory parameters in order to reconstitute the original phenotype. Indeed,
siderophore production of Pss22d could be increased by addition of the trace
elements Zn 2+ , Cu 2+ , and Ca 2+ . This supplementation did not influence
siderophore production in Psg1a, but the CAS activity in Pss22d supernatants
was increased to approx. 150 µM DFOM equiv. at OD 600 =1. As the first
measurements were performed in the lab of our cooperation partner Dr. Beate
Völksch in Jena, chemicals from other commercial suppliers had been used to
prepare the medium. Thus a slight variation in medium composition due to
variable trace element content has an impact on the quantity of siderophores
produced. To investigate this hypothesis, Pipes medium was prepared with
chemicals and water supplied by the laboratory in Jena. Doing so, the
siderophore activity produced by Pss22d could be slightly increased; under the
conditions approximately 200 µM DFOM equiv. an OD 600 =1 were produced by
Pss22d.
Finally, the influence of culture volume on siderophore production was
investigated. Again, the total siderophore activity produced by Psg1a did not
change, but the response of Pss22d to different ratios of culture vessel to culture
volume became obvious. 250 ml of culture volume were incubated, but this time
a 2 L Erlenmeyer flask as used instead of a 1 L-flask (Fig.22B). Under these
conditions, the original phenotype could be reconstituted. At the same time,
growth of Pss22d was delayed, indicating a possible stress response. The two
growth curves gave an interesting insight into regulation of siderophore
biosynthesis in Psg1a and Pss22d. Under conditions of lower oxygen supply
(250 ml culture in a 1 L-Erlenmeyer flask), Pss22d produced lower amounts of
siderophores but relatively high fluorescence. Under high oxygen conditions
(250 ml culture in 2 L-Erlenmeyer flask), Pss22d produced approximately the
same amount of fluorescence but more than 10 times the siderophore activity.
68

Results
This result indicated an up-regulation of the achromobactin-like siderophore
under high oxygen conditions. The situation in Psg1a differs from this
considerably. In Psg1a, the total amount of siderophore production was not
influenced by oxygen supply. However the amount of fluorescence differed:
Under low oxygen conditions, less fluorescence was produced than under high
oxygen conditions.
These results indicated a differential regulation of
siderophore production in Psg1a and Pss22.
5.3 Influence of siderophore production on biocontrol activity and epiphytic
fitness of Pss22d
In order to study the influence of siderophore production on the antagonism
between Pss22d and Psg1a, the siderophore mutants of Pss22d were tested for
their ability to suppress growth (and disease development) of Psg1a in planta.
Bacteria were applied by wound inoculation technique. After punching soybean
leaves with a sterile needle, 5 µl of bacterial suspension were applied to the fresh
wounds and allowed to dry in. The inoculations were assigned as follows
(Fig.23):
A B C D E F G H I
Fig. 23. Symptom development 14 days after wound inoculation.
After punching soybean leaves with a sterile needle, 5 µl of bacterial suspension were applied to the
fresh wounds and allowed to dry in. 14 days later the symptom development was assessed. Inoculations
were as follows: A-E single inoculations with A: Psg1a; B: Pss22d; C: Pss22d∆Pvd; D: Pss22d∆Ach;
E: Pss22d∆Sid; F-I Co-inoculation of Psg1a in combination with F: Pss22d; G: Pss22d∆Pvd;
H: Pss22d∆Ach; I: Pss22d∆Sid
69

Results
A-E represents single inoculations with A: Psg1a; B: Pss22d; C: Pss22d∆Pvd; D:
Pss22d∆Ach, and E: Pss22d∆Sid. F-I showed the results for co-inoculation
experiments of Psg1a in combination with F: Pss22d; G: Pss22d∆Pvd; H:
Pss22d∆Ach; I: Pss22d∆Sid. In the co-inoculation experiments, antagonist and
pathogen were mixed at a ratio of 2:1. Symptom development was investigated
14 days post inoculation (Fig.23). Only when a single inoculation of Psg1a was
applied, a clear formation of chlorosis could be observed (Fig.23A). Wounds
inoculated with the antagonistic strains alone symptom-free (Fig.23B-E). Wounds
co-inoculated with antagonist and pathogen showed mostly no symptoms, while
on some single wounds a strongly reduced symptom development could be
observed (for example Fig.23G, uppermost wound).
Determination of CFU per wound did not give any evidence for a different
performance of Pss22d wild type and its siderophore mutants. Therefore data
were grouped in Figure 24. In the co-inoculation experiments, pathogen
population size was reduced by one order of magnitude as compared to the
single inoculation of Psg1a. Since wound inoculation technique could potentially
interfere with the impact of siderophores due to a possible iron leakage from
wound exudates, the in planta epiphytical fitness of Pss22d and its siderophore
mutants was investigated in a spray inoculation experiment. Preliminary results
indicated a reduction of population size for the siderophore mutants as compared
to the wild type (Tab. 10). While both single mutants reached a cell density one
order of magnitude below the wild type, the double mutant was reduced by two
orders of magnitude. A repetition of this experiment showed a very similar
outcome for Pss22d∆Pvd; however, growth of Pss22d∆Sid was reduced only by
one order of magnitude and that of Pss22d∆Ach was not affected at all.
70

Results
1x10 8
1x10 7
1x10 6
1x10 5
1x10 4
1x10 3
1x10 2
Fig. 24. Development of bacterial population in planta after wound inoculation.
The formation of bacterial populations following wound inoculation was examined. The
inoculation that is shown in Fig. 23: A-E single inoculations A: Psg1a; B: Pss22d; C:
Pss22d∆Pvd; D: Pss22d∆Ach; E: Pss22d∆Sid
F-I Co-inoculation of Psg1a in combination with F: Pss22d; G: Pss22d∆Pvd; H:
Pss22d∆Ach; I: Pss22d∆Sid
Series “Psg1a in co-inoculation” represents the mean value of the Psg1a counts for
inoculation F-I. Likewise, the series “Pss22d and mutants in co-inoculation” represents the
values determined for the antagonists in samples F-I. The series “Pss22d and mutants”
comprises the mean value of antagonist cfu in single inoculations B-E.
As the standard derivation of these series indicates, there was no difference for in planta
growth of Pss22d wt and the respective siderophore mutants neither in single nor in coinoculation.
5.4 Distribution of the achromobactin–like siderophore synthesis among
plant associated P. syringae
It was demonstrated that the achromobactin-like siderophore is produced by
Pss22d, Psg1a, Psp1448A and PssB728a, but not by PsmDC3000. In order to
elucidate the importance of this siderophore for the bacteria – plant interaction
a screening among a diverse group of plant associated P. syringae was
performed. The method of colony-PCR was used for fast detection of the
respective biosynthesis genes. Two sets of primers were derived from the
nucleotide sequence of the siderophore synthetase genes acsD and acsC.
71

Results
Tab. 10. Development of population sizes after spray inoculation.
Pss22d wild type and its siderophore mutants were analysed for their
growth on soybean leafs after application by a single spray inoculation.
cfu/g fresh material
day 1 day 10
Pss22d 5 x 10 4 6.7 x 10 4
Pss22d∆Pvd 1.3 x 10 4 5.4 x 10 3
Pss22d∆Ach 8.9 x 10 4 4.6 x 10 3
Pss22d∆Sid 9.2 x 10 4 4 x 10 2
Primer binding sites were highly conserved in PssB728a, Psp1448A, and
D. chysanthemi. A 550 bp fragment of the ascC gene was amplified by the
primer pair iuc2_fwd and iuc2_rev (Fig.25). In case of a negative PCR result,
colony PCR was repeated two more times. In case of a negative result, a
second PCR using the Primer combination iuc1_fwd and iuc1_rev was
performed. The specificity of the applied PCR program was controlled by
X S D Pss 1 2 3 4 5 6 DC
Fig. 25. PCR screening for achromobactin biosynthesis genes.
Colony PCRs with the primer combination iuc2_fwd and iuc2_rev was performed on
different strains of P. syringae and control strains. Abbreviations are as follows:
X= X. campestris; S= S. meliloti; D= D. chrysanthemi; Pss= Pss22d; 1-6 different
pathovars of P.syringae. DC=PsmDC3000. While sample 1 and 4 show a clear
positive reaction, the PCR for reactions like in sample 2, 3, and 5 were repeated.
72

Results
colony PCR with cells of Sinorhizobium meliloti and Xanthomonas campestris.
Both strains are known to contain similar siderophore synthetases but not the
achromobactin biosynthetic gene cluster. While no PCR product was obtained
for S. meliloti, a PCR fragment significantly smaller than the expected product
was detected in X. campestris. A colony PCR of PsmDC3000 served as a
negative control for each PCR mix, while cells of Pss22d and D. chrysanthemi
serve as positive control. Figure 25 gives an example for a screening gel. In
addition, the production of the achromobactin-like siderophore was investigated
by IEF analysis, as already shown in Figure 21. Table 11 summarizes the
preliminary results of both screening methods. So far, the presence of the
achromobactin-like siderophore could be demonstrated for 19 different
pathovars of P. syringae, indicating that the biosynthesis of the achromobactinlike
siderophore is widespread among different pathovars of P. syringae.
73

Results
Tab. 11. Distribution of the achromobactin-like siderophore among different pathovars of
P. syringae.
P. syringae strains were analyzed for their ability to produce the acromobactin-like siderophore
(IEF analysis). Additionally the presence of the siderophore biosynthesis gene acsB was
determined by PCR with the primer pair iuc2_fwd and iuc2_rev.
pathovar
strain
Achromobactin-like PCR product PCR for
IEF-band product iuc2
syringae Pss22d + +
Pss22d∆Pvd + +
Pss22d∆Sid - +
Pss22d∆Ach - -
B728a + +
B301D + +
B241 + +
C72 + +
aceris CFBP 2339 + +
actinidiae MAFF 302091 + nd
aptata GSPB 1080 + +
atrofaciens GSPB 1440 + +
atropurporea MAFF 301309 + (-)
berberis CFBP 1727 + nd
broussonetiae MAFF810036 + nd
castaneae CFBP 4217 + nd
coronafaciens DSM 50261 - -
daphniphylli CFBP 4219 + nd
delfinii ICMP 529 + nd
glycinea Psg1a + +
PG4180 +
mori MAFF 301020 + +
mosprunorum GSPB 1013 + (-)
maculicola DC3000 - -
papulans ICMP 4048 + +
phaseolicola 1448A + +
pisi GSPB 1477 + nd
savastanoi GSPB 2259 + (-)
tabaci GSPB 117 + +
tomato 487 + (-)
74

Discussion
6 Discussion
Public awareness of problems with food safety is constantly increasing, as is
the customer demand for food that has been produced by an integrative and
sustainable agriculture. While this situation provides a good chance for
biological control to prove its commercial applicability, the biggest bottleneck of
the system, the high variability in efficiency, remains to be solved. For this
reason research on biological control can improve the practical application of
biocontrol by investigation of the underling microbial interactions rather than by
screening for other control agents. Lack of knowledge on parameters of
epiphytical life in the phyllosphere is slowing down the progress in
development of biocontrol products. Biological control of bacterial blight of
soybean by the antagonist Pss22d is a good model system to gain more
information on these parameters, as it provides a) a highly efficient biological
control system and b) significant amount of background information on the
pathosystem involved. Thus the active principles of biological control could be
directly interconnected to the complex plant-microbe interaction. In the frame of
this work it was attempted to elucidate the influence of siderophore production
on the above mentioned biocontrol system. The results of this study clearly
opposed the initial hypothesis, that competition for iron between pathogen and
control organism is an active principle of this biological control. Despite this, we
could identify a siderophore production system that had not been described in
plant-associated P. syringae before and address the importance of this
siderophore for epiphytical fitness of the antagonist could be addressed. The
production of this second, achromobactin-like siderophore is widely distributed
among the pathovars of P. syringae.
6.1 Identification of an achromobactin-like siderophore in P. syringae
Iron uptake is essential for most bacteria, thus it is not surprising that the
increasing number of genome sequences reveal more and more information on
75

Discussion
bacteria with redundandent siderophore systems. For example,
Pseudomonas aeroginosa produces pyoverdin and pyochelin, some strains of
P. fluorescense produce pyoverdin and pseudomonin, and D. chrysanthemi
produces chrysobactin and achromobactin (Cox & Adams, 1985; Franza &
Expert, 1991; Franza et al., 2005; Mercado-Blanco et al., 2001; Persmark et
al., 1989). While the production of pyoverdin by different pathovars of
P. syringae had been reported previously (Bultreys et al., 2001; Jülich et al.,
2001), we are the first to proof experimentally the production of an addtional
siderophore aside of pyoverdin. This study demonstrated that the biosynthesis
gene cluster of this siderophore showed high similarity towards the
achromobactin siderophore gene cluster of D. chrysanthemi (Fig.13). IEF
analysis of achromobactin and the second siderophore of Pss22d shows a
CAS-active band at the same migration (data not shown). TLC separation of
achromobactin and the second siderophore of Pss22d on silica plates using a
mobile phase of diethylether, n-butanole, acetic acid, water (1:1:1:1; v/v)
exhibited a similar CAS-active band (Fig.19A). More importantely, the
siderophore of Pss22d∆Pvd could enhance growth of a siderophore-deficient
D. chrysanthemi mutant under iron limiting conditions, while the growth
deficiency of a mutant defective in the achromobactin receptor was not
restored by feeding with Pss22d∆Pvd supernatant (D. Expert, personal
communication). All these results imply a close structural similarity between the
novel Pss22d siderophore with achromobactin from D. chrysanthemi. .
The genetic organization of the biosynthesis genes differs between P. syringae
and D. chrysanthemi. The gene acsF, encoding for a putative
aminotransferase, is located upstream of the achromobactin receptor gene in
D. chrysanthemi, while it follows downstream this receptor gene in P. syringae.
This divergent organization could be the result of a genomic reorganization,
however it could also indicate a different origin and therefore a different
substrate specificity of the two respective aminotransferases. In support of this,
the observed color change of the Pss22d∆Pvd siderophore upon iron addition
76

Discussion
may indicate a difference in the structures of the Pss22d siderophore and
achromobactin. However, we can not rule out the possibility, that the different
behavior of both siderophores could be an artifact due to different purification
procedures. The same might hold true for the different retention factors
obtained after TLC separation (Fig.19B). Eventually, only structure
determination of the Pss22d∆Pvd siderophore will show whether it is identical
to achromobactin or not.
Several siderophores structurally related to achromobactin are known. They
are referred to as citrate-type siderophores. Aerobactin produced by E. coli,
rhizobactin of S. meliloti, or vibrioferrin synthesized by Vibrio parahaemolyticus
are some examples for this group (Harris et al., 1979; Lynch et al., 2001;
Tanabe et al., 2003). However, similarities between the P. syringae
siderophore gene cluster and the achromobactin gene cluster of
D. chrysanthemi is much higher than to the other citrate-type siderophores.
Recently, another gene cluster with high similarities towards the achromobactin
biosynthesis genes has been reported in Sodalis glossinidiust (Darby et al.,
2005). This obligate symbiont of Tse-Tse flies carries the achromobactin
biosynthesis genes on a plasmid. The organization of the respective gene
cluster shows a similar organization as that in D. chrysanthemi the acsF
homologue located in front of acr (Darby et al., 2005). In S. glossinidiust the
complete biosynthesis region is flanked by several transposons. This implies a
genetic mobility of this region. Indeed, a transposon-mediated transfer of
siderophore biosynthesis gene clusters via so-called pathogenicity islands had
been observed before, namely for the distribution of aerobactin or
yersiniabactin (Carniel, 2001; Vokes et al., 1999). Achromobactin biosynthesis
could be transferred by such an “island”. However no obvious transposase
gene is located next to the respective biosynthesis genes in P. syringae. The
organization of the siderophore biosynthesis genes together with a putative
regulatory system next to the biosynthesis genes rather indicated that this
gene cluster is native to P. syringae.
77

Discussion
6.2 Possible regulation of the achromobactin-like siderophore
The close proximity of genes encoding for a FecR and a FecI homologue to the
siderophore gene cluster in P. syringae implies the possibility of regulatory
similarities between the Pss22d∆Pvd siderophore synthesis and ferric citrate
uptake. Ferric citrate is internalized by combination of an outer membrane
receptor (FecA) and an ATP-binding cassette transporter, ABC-transporter
(Ferguson et al., 2002). FecA is also the first component of a signalling
cascade, which is initiated at the cell surface (Fig.26). Binding of ferric citrate to
FecA induces a conformational change that results in an interaction of FecA
with the response regulator, FecR. Subsequently FecR converts FecI into an
active sigma factor that directs RNA polymerase to the P fec promoter and thus
initiates transcription of the fecABCDE transport genes. When iron supply is
sufficient, the Fe 2+ -loaded ferric uptake regulation repressor, (Fur), inhibits
transcription of the fecIR regulatory gene and the fecBCDE transport genes
(Braun & Killmann, 1999). P fur represents the promoters to which Fe 2+ -loaded
Fur repressor binds (Fig.26). A similar organisation is likely for the
achromobactin-like siderophore of Pss22d, with the expression of the
permease genes cbrABCD potentially being part of the feedback regulation
loop (Fig.26, indicated in brackets). Although the influence of Fur on
achromobactin biosynthesis genes had be demonstrated (Franza et al., 2005),
no evidence for a FecI/FecR homologue system involved in achromobactin
regulation is currently present for D. chrysanthemi (Franza et al., 2005).
The conserved GGDEF domain within a predicted gene produc encoded
downstream of the P. syringae biosynthetic gene cluster of the achromobactin–
like siderophore is coupled to a putative sensory domain with similarity to
chemotaxis / aerotaxis signaling domains. GGDEF domains are involved in
cyclic di-GMP signaling, a global regulatory system for bacteria that mediates
response to a wide range of stress signals such as pH-shift, osmotic shock, or
78

Discussion
(acr)
(cbrA-D)
Fig. 26. Model of transmembrane signalling for regulation of the ferric citrate uptake .
The FecA protein is the initial component in the signaling cascade, which starts at the cell surface.
Binding of ferric citrate to FecA induces a conformation such that FecA interacts with FecR, which in turn
converts FecI into an active sigma factor that directs RNA polymerase to the P fec promoter and initiates
transcription of the fecABCDE transport genes. When iron supply is sufficient, the Fe 2+ -loaded Fur
repressor inhibits transcription of the regulatory genes fecIR and of the fecABCDE transport genes. P fur
the promoters to which the Fe 2+ -loaded Fur repressor binds. aa, amino acids encoded. The brackets
indicate homologues from the achromobactin-like siderophore uptake system. Modified after Braun and
Killman, 1999
79

Discussion
stationary phase transition (Galperin, 2006; Romling & Amikam, 2006). It is
possible that this signaling pathway is involved in the differentiated regulation
of siderophore biosynthesis in Pss22d.
The obvious differences in siderophore production observed during growth of
Psg1a and Pss22d in vitro can not directly be associated to the wellinvestigated
iron-mediated regulation of siderophore biosynthesis like the Fur
signaling. Although iron availability did not differ between the two growth curve
experiments depicted in Fig.22, the oxygen saturation of the culture medium
must have varied between the two settings. Possible oxygen stress is the most
likely explanation for the reduced growth of Pss22d shown in Fig.22B. It is
interesting to note that Pss22d reacts to this stress by an up-regulation of
synthesis of the achromobactin-like siderophore. Achromobactin is supposed
to protect D. chrysanthemi against oxidative stress (Expert, 1999). It could be
possible that a similar protection mechanism occurs in Pss22d. However, the
pathogenic Psg1a demonstrated an opposite regulation pattern. Pyoverdin
production was up-regulated under high oxygen conditions. However, while the
growth rate of Pss22d was reduced under high oxygen conditions, Psg1a
growth was not effected. This result could indicate that in Psg1a other means
are effective to avoid oxygen stress like for example in increased production of
superoxid dismutase. Up to now there is no experimental prove for this
assumption.
6.3 Influence of siderophore production on epiphytic fitness of Pss22d
We could clearly rule out the hypothesis, that siderophore production directly
influences biological control of Psg1a by Pss22d via competition for iron.
However, it was also essential to investigate the influence of siderophore
production on the overall epiphytic fitness of the antagonist in planta. One of
the most basic requirements for a versatile biological control agent is its ability
to survive in the respective habitat. It can only suppress pathogen development
sufficiently if it is able to compete with other epiphytic microorganisms. The
80

Discussion
wound inoculation technique is not suitable to test the epiphytic fitness of
Pss22d, as the artificial wound gives rise to many plant born nutrients normally
not present at the plant surface. Thus, spray inoculation experiments were
performed (Tab. 10). A practical problem of spray inoculation experiments is a
relatively high variation. In addition, the performance of the Pss22d
siderophore mutants could be influenced by the composition of the epiphytical
community of the inoculated plant. This may not only have affected the total
amount of available iron but bacteria also possess a large number of
siderophore receptors for uptake of heterogenic, “foreign” siderophores
(Schubert et al., 1999). For example the PsmDC3000 genome contains at least
23 different TonB-dependent siderophore receptors (Cornelis & Matthijs,
2002). Heterologous iron uptake could have complemented the phenotype of
the Pss22d mutants, thus the experiment needs to be repeated several times
on different sets of plants in order to obtain results for different overall epiphytic
communities.
6.4 Distribution of the achromobactin-like siderophore among P. syringae
pathovars
Screening of different P. syringae strains for the production of the
achromobactin-like siderophore revealed that a high number of the tested
strains produced this siderophore. Thus it can be concluded, that despite the
high genetic variability of P. syringae pathovars, siderophore biosynthesis of
Pvd PS as well as the achromobactin-like siderophore is highly conserved
(Bultreys et al., 2003; Bultreys et al., 2004; Jülich et al., 2001), this study). This
uniformity may reflect a lack of competitiveness for iron uptake among plantassociated
bacteria. This hypothesis is supported by investigations on the
siderophore production of PssB728a. Loper and coworkers (1987) reported
that knock-out mutation of pyoverdin in PssB728a had no impact on growth
survival or pathogenicity of PssB728a on snap bean leafs. They concluded,
that siderophore production has no impact on the interaction between plant
81

Discussion
and bacterium (Loper et al., 1984; Loper & Lindow, 1987). What they did not
notice at that time was the presence of a second siderophore in these mutants.
Since the CAS-assay for siderophore detection was not used at the time of that
study, the “siderophore-negative” phenotype of PssB728a mutants was just
determined by lack of fluorescence. Thus the presence of a second
siderophore stayed unnoticed. In follow-up studies, reporter gene fusions to
iron-regulated promoters were constructed and applied for an evaluation of iron
availability on the plant surface (Loper & Lindow, 1994; Loper & Henkels,
1997). However, the promoter used for this reporter gene fusion was derived
from pyoverdin synthesis genes and therefore the fusions responded only to
severe conditions of iron limitation. Therefore, the results obtained by these
fusions were not suitable to evaluate the impact of a siderophore that is
already expressed at less restrictive conditions as it has been recently
demonstrated for achromobactin expression in D. chrysanthemi (Franza et al.,
2005). In consequence, the conserved distribution of Pvd PS and the
achromobactin-like siderophore found in the current study rather may be
attributed to an optimal suitability of this siderophores for plant-associated
bacteria.
6.5 Outlook
The results represented in this thesis demonstrated the presence of an
achromobactin-like siderophore in Pss22d, but so far we could not clarify
whether this siderophore is structurally identical to achromobactin or not.
Further purification methods need to be developed in order to obtain a
siderophore sample that can be analyzed by NMR. As we could exclude a
direct role of siderophore production as an active principle of biological control
between Psg1a and Pss22d, the molecular basis of this antagonism remains
unknown. The impact of antibiosis is currentely investigated by Sascha Braun,
Jena, but several other mechanisms, like for example a possible influence of
plant defense activation remain to be examined.
82

Literature
Literature
Agrios, G. N. (2005). Plant pathology, 5th edn. edn. New York: Elseviewer
Academic Press.
Alexander, D. B. & Zuberer, D. A. (1991). Use of chrome azurol S reagents to
evaluate siderophore production by rhizosphere bacteria. Biol Fertil Soil 12, 39-
45.
Anjaiah, V., Koedam, N., Nowakthompson, B., Loper, J. E., Hofte, M.,
Tambong, J. T. & Cornelis, P. (1998). Involvement of phenazines and
anthranilate in the antagonism of Pseudomonas aeruginosa PNA1 and Tn5
Derivatives toward Fusarium spp. and Pythium spp. Molecular Plant-Microbe
Interactions 11, 847-854.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,
Smith, J. A. & Struhl, K. (1987). Current protocols in molecular biology: John
Wiley and sons.
Baker, B., Zambryski, P., Staskawicz, B. J. & Dinesh-Kumar, S. P. (1997).
Signalling in plant-microbe interactions. Science 276, 726-733.
Bender, C. (1999). Chlorosis-inducing phytotoxins produced by Pseudomonas
syringae. European Journal of Plant Pathology 105, 1–12.
Bender, C. L., Alarcon-Chaidez, F. & Gross, D. C. (1999). Pseudomonas
syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide
and polyketide synthetases. Microbiology and molecular biology reviews 63,
266-292.
Braun, V. & Killmann, H. (1999). Bacterial solutions to the iron-supply
problem. Trends in Biochemical Science 24, 104-109.
Braun, V. & Braun, M. (2002). Iron transport and signaling in Escherichia coli.
FEBS Letters 529, 78-85.
Braun-Kiewnick, A., Jacobsen, B. J. & Sands, D. C. (2000). Biological
control of Pseudomonas syringae pv. syringae, the causal agent of basal
kernel blight of barley, by antagonistic Pantoea agglomerans. Phytopathology
90, 368-375.
Buell, C. R., Joardar, V., Lindeberg, M. & other authors (2003). The
complete genome sequence of the Arabidopsis and tomato pathogen
Pseudomonas syringae pv. tomato DC3000. Proceedings of the National
Academy of Sciences of the United States of America, 10181-10186.
Bultreys, A., Gheysen, I., Maraite, H. & de Hoffmann, E. (2001).
Characterization of fluorescent and nonfluorescent peptide siderophores
produced by Pseudomonas syringae strains and their potential use in strain
identification. Applied & Environmental Microbiology 67, 1718-1727.
83

Literature
Bultreys, A., Gheysen, I., Wathelet, B., Maraite, H. & de Hoffmann, E.
(2003). High-Performance Liquid Chromatography analyses of pyoverdin
siderophores differentiate among phytopathogenic fluorescent Pseudomonas
species. Applied & Environmental Microbiology 69, 1143-1153.
Bultreys, A., Gheysen, I., Wathelet, B., Schafer, M. & Budzikiewicz, H.
(2004). The pyoverdins of Pseudomonas syringae and Pseudomonas cichorii.
Zeitschrift für Naturforschung [C] 59, 613-618.
Burrill, T. J. (1878). Remarks made in a discussion. Trans Ill State Hortic Soc
11, 79-80.
Büttner, P. (2003). Siderophore des Pathogens der Sojabohne
Pseudomonas syringae pv. glycinea 1a/96 und seiner bakteriellen
Antagonisten Pseudomonas syringae pv. syringae 22d/93 und Pantoea
agglomerans 48b/90. Diploma Thesis, University of Jena.
Buysens, S., Huengens, K., Poppe, J. & Hofte, M. (1996). Involvement of
pyochelin and pyoverdin in suppression of Pythium-induced damping-off of
tomato by Pseudomonas aeruginosa 7NSK2. Applied & Environmental
Microbiology 62, 865-871.
Carniel, E. (2001). The Yersinia high-pathogenicity island: an iron-uptake
island. Microbes and Infections 3, 561-569.
Coerper, F. M. (1919). Bacterial blight of soybean. Journal of Agricultural
Research 18, 179-193.
Cornelis, P. & Matthijs, S. (2002). Diversity of siderophore-mediated iron
uptake systems in fluorescent pseudomonads: not only pyoverdines.
Environmental Microbiology 4, 787-798.
Cox, C. D. & Adams, P. (1985). Siderophore activity of pyoverdin for
Pseudomonas aeruginosa. Infection and Immunity 48, 130-138.
Cui, J., Bahrami, A. K., Pringle, E. G., Hernandez-Guzman, G., Bender, C.
L., Pierce, N. E. & Ausubel, F. M. (2005). Pseudomonas syringae
manipulates systemic plant defenses against pathogens and herbivores.
Proceedings of the National Academy of Sciences of the United States of
America 102, 1791-1806.
Darby, A. C., Lagnel, J., Mathew, C. Z., Bourtzis, K., Maudlin, I. & Welburn,
S. C. (2005). Extrachromosomal DNA of the symbiont Sodalis glossinidiust.
Journal of Bacteriology 187, 5003-5007.
de Chial, M., Ghysels, B., Beatson, S. A. & other authors (2003).
Identification of type II and type III pyoverdine receptors from Pseudomonas
aeruginosa. Microbiology 149, 821-831.
84

Literature
Dong, Y. H., Zhang, X. F., Xu, J. L. & Zhang, L. H. (2004). Insecticidal
Bacillus thuringiensis silences Erwinia carotovora virulence by a new form of
microbial antagonism, signal interference. Appl Environ Microbiol 70, 954-960.
Doudoroff, M. & Palleroni, N. J. (1974). Genus I. Pseudomonas Migula. In
Bergey's manual of determinative bacteriology, pp. 217-243. Edited by R. E.
Buchanan & N. E. Gibbons. Baltimore, Md.: Williams & Wilkins.
Duffy, B., Schouten, A. & Raaijmakers, J. M. (2003). Pathogen self-defense:
Mechanisms to counteract microbial antagonism. Annual Review of
Phytopathology 41, 501-538.
Eastgate, J. A. (2000). Erwinia amylovora : the molecular basis of fireblight
disease. Molecular Plant Pathology 1, 325-329.
Emmert, E. A. & Handelsman, J. (1999). Biocontrol of plant disease: a (gram-
) positive perspective. FEMS Microbiolgy Letters 171, 1-9.
Engelmann, M. D., Bobier, R. T., Hiatt, T. & Cheng, I. F. (2003). Variability of
the Fenton reaction characteristics of the EDTA, DTPA, and citrate complexes
of iron. Biometals 16, 519-527.
Expert, D. (1999). Withholding and exchanging iron: Interactions between
Erwinia spp. and their plant hosts. Annual Review of Phytopathology 37, 307-
334.
Ferguson, A. D., Chakraborty, R., Smith, B. S., Esser, L., van der Helm, D.
& Deisenhofer, J. (2002). Structural basis of gating by the outer membrane
transporter FecA. Science 295, 1715-1719.
Finking, R. & Marahiel, M. A. (2004). Biosynthesis of nonribosomal peptides.
Annual Review of Microbiology, 453-477.
Finlay, B. B. & Falkow, S. (1997). Common themes in microbial pathogenicity
revisited. Microbiology and molecular biology reviews 61, 136-169.
Franza, T. & Expert, D. (1991). The virulence-associated chrysobactin iron
uptake system of Erwinia chrysanthemi 3937 involves an operon encoding
transport and biosynthetic functions. Journal of Bacteriology 173, 6874-6881.
Franza, T., Mahe, B. & Expert, D. (2005). Erwinia chrysanthemi requires a
second iron transport route dependent of the siderophore achromobactin for
extracellular growth and plant infection. Molecular Microbiology 55, 261-275.
Fuchs, R., Schafer, M., Geoffroy, V. & Meyer, J. M. (2001). Siderotyping-a
powerful tool for the characterization of pyoverdines. Current Medicinal
Chemistry 1, 31-57.
85

Literature
Galperin, M. Y. (2006). Structural classification of bacterial response
regulators: diversity of output domains and domain combinations. Journal of
Bacteriology 188, 4169-4182.
Guerinot, M. L. (1994). Microbial iron transport. Annual Review of
Microbiology 48, 743-772.
Haas, D., Blumer, C. & Keel, C. (2000). Biocontrol ability of fluorescent
pseudomonads genetically dissected: importance of positive feedback
regulation. Current Opinion in Biotechnology 11, 290-297.
Haas, D. & Defago, G. (2005). Biological control of soil-borne pathogens by
fluorescent pseudomonads. Nature Reviews Microbiol 3, 307-319.
Hamdan, H., Weller, D. M. & Thomashow, L. S. (1991). Relative importance
of fluorescent siderophores and other factors in biological control of
Gaeumannomyces graminis var. tritici by Pseudomonas fluorescens 2-79 and
M4-80R. Applied & Environmental Microbiology 57, 3270-3277.
Handelsman, J. & Stabb, E. V. (1996). Biocontrol of Soilborne Plant
Pathogens. Plant Cell 8, 1855-1869.
Harris, W. R., Carrano, C. J. & Raymond, K. N. (1979). Coordination
chemistry of microbial iron transport compounds.16. Isolation, characterization,
and formation constants of ferric aerobactin. Journal of the American Chemical
Society 101, 2722-2727.
Hirai, T., Fukushima, K., Kumamoto, K. & Iwahashi, H. (2005). Effects of
some naturally occurring iron ion chelators on in vitro superoxide radical
formation. Biology of trace element research 108, 77-85.
Hutcheson, S. W. (2001). The molecular biology of hypersensitivity to plant
pathogenic bacteria. Journal of Plant Pathology 83, 151-172.
Janisiewicz, W. J. & Korsten, L. (2002). Biological control of postharvest
diseases of fruits. Annual Review of Phytopathology 40, 411-441.
Ji, P. & Wilson, M. (2003). Enhancement of population size of a biological
control agent and efficacy in control of bacterial speck of tomato through
salicylate and ammonium sulfate amendments. Applied & Environmental
Microbiology 69, 1290-1294.
Jülich, M., Taraz, K., Budzikiewicz, H., Geoffroy, V., Meyer, J. M. &
Gardan, L. (2001). The structure of the pyoverdin isolated from various
Pseudomonas syringae pathovars. Zeitschrift für Naturforschung [C] 56, 687-
694.
Keel, C., Weller, D. M., Natsch, A., Defago, G., Cook, R. J. & Thomashow,
L. S. (1996). Conservation of the 2,4-diacetylphloroglucinol biosynthesis locus
86

Literature
among fluorescent Pseudomonas strains from diverse geographic locations.
Applied & Environmental Microbiology 62, 552-563.
Klement, Z. (1963). Rapid detection of pathogenicity of phytopathogenic
pseudomonads. Nature 199, 299-300.
Koedam, N., Wittouck, E., Gaballa, A., Gillis, A., Hofte, M. & Cornelis, P.
(1994). Detection and differentiation of microbial siderophores by isoelectric
focusing and chrome azurol S overlay. Biometals 7, 287-291.
Loper, J. E., Orser, C. S. & Panopoulos, N. J. (1984). Genetic Analysis of
Fluorescent Pigment Production in Peudomonas syringae pv. syringae. J Gen
Microbiol 130, 1507-1515.
Loper, J. E. & Lindow, S. E. (1987). Lack of evidence for insitu fluorescent
pigment production by Pseudomonas syringae pv. syringae on bean leaf
surfaces. Phytopathology 77, 1449-1454.
Loper, J. E. & Buyer, J. S. (1991). Siderophores in microbial interactions on
plant surfaces. Mol Plant Microbe Interact 4, 5-13.
Loper, J. E. & Lindow, S. E. (1994). A Biological Sensor for Iron Available to
Bacteria in Their Habitats on Plant-Surfaces. Appl Environ Microb 60, 1934-
1941.
Loper, J. E. & Henkels, M. D. (1997). Availability of iron to Pseudomonas
fluorescens in rhizosphere and bulk soil evaluated with an ice nucleation
reporter gene. Appl Environ Microbiol 63, 99-105.
Lugtenberg, B. J. J., Chin-A-Woeng, T. F. C. & Bloemberg, G. V. (2002).
Microbe–plant interactions: principles and mechanisms. Antonie Van
Leeuwenhoek 81, 373–383.
Lynch, D., O'Brien, J., Welch, T., Clarke, P., Cuiv, P. O., Crosa, J. H. &
O'Connell, M. (2001). Genetic organization of the region encoding regulation,
biosynthesis, and transport of rhizobactin 1021, a siderophore produced by
Sinorhizobium meliloti. Journal of Bacteriology 183, 2576-2585.
May, R., Völksch, B. & Kampmann, G. (1997a). Antagonistic activities of
epiphytic bacteria from soybean leaves against Pseudomonas syringae pv.
glycinea in vitro and in planta. Microbial Ecology 34, 118-124.
May, R., Völksch, B., Kampmann, G. & Nüske, J. (1997b). Isolation and
characterization of Pseudomonas syringae strain with antagonistic activities
against Pseudomonas syringae pv. glycinea in vitro and in planta. In
Pseudomonas syringae pathovars and related pathogens, pp. 629-634. Edited
by K. Rudolph, T. J. Burr, J. W. MANSFIELD, D. Stead, A. Vivian & J. von
Kietzell: Kluwer Academic Publischer.
87

Literature
Mazzola, M. (2002). Mechanisms of natural soil suppressiveness to soilborne
diseases. Antonie Van Leeuwenhoek 81, 557-564.
McManus, P. S., Stockwell, V. O., Sundin, G. W. & Jones, A. L. (2002).
Antibiotic use in plant agriculture. Annual Review of Phytopathology 40, 443-
465.
Mercado-Blanco, J., van der Drift, K. M., Olsson, P. E., Thomas-Oates, J.
E., van Loon, L. C. & Bakker, P. A. (2001). Analysis of the pmsCEAB gene
cluster involved in biosynthesis of salicylic acid and the siderophore
pseudomonine in the biocontrol strain Pseudomonas fluorescens WCS374.
Journal of Bacteriology 183, 1909-1920.
Meyer, J. M., Geoffroy, V. A., Baida, N., Gardan, L., Izard, D., Lemanceau,
P., Achouak, W. & Palleroni, N. J. (2002). Siderophore typing, a powerful tool
for the identification of fluorescent and nonfluorescent pseudomonads. Applied
and Environmental Microbiology 68, 2745-2753.
Miller, J. H. (1992). A short course in bacterial genetics. A laboratory manual
and handbook for Escherichia coli and related bacteria. Cold Spring Harbour,
N. Y.: Cold Spring Harbour Laboratory.
Montesinos, E. (2000). Pathogenic plant–microbe interactions. What we know
and how we benefit. International Microbiology 3, 69-70.
Montesinos, E., Bonaterra, A., Badosa, E., France´ s, J., Alemany, J.,
Llorente, I. & Moragrega, C. (2002). Plant-microbe interactions and the new
biotechnological methods of plant disease control. Int Microbiol 5, 169–175.
Montesinos, E. (2003). Development, registration and commercialization of
microbial pesticides for plant protection. International Microbiology 6, 245-252.
Mossialos, D., Ochsner, U., Baysse, C. & other authors (2002).
Identification of new, conserved, non-ribosomal peptide synthetases from
fluorescent pseudomonads involved in the biosynthesis of the siderophore
pyoverdine. Molecular Microbiology 45, 1673-1685.
Münzinger, M., Budzikiewicz, H., Expert, D., Enard, C. & Meyer, J. M.
(2000). Achromobactin, a new citrate siderophore of Erwinia chrysanthemi.
Zeitschrift für Naturforschung [C] 55, 328-332.
Neilands, J. B. (1995). Siderophores: structure and function of microbial iron
transport compounds. Journal of Biological Chemistry 270, 26723-26726.
Nyiredy (2004). Separation strategiesof plant constituents - current status.
Journal of Chromatography B 812, 35-51.
Oerke, E. C., Dehne, H. W., Schönbeck, F. & Weber, A. (1994). Crop
production and crop protection: Estimated losses in major food and cash crops.
Amsterdam: Elseviewer.
88

Literature
Persello-Cartieaux, F., Nussaume, L. & Robaglia, C. (2003). Tales from the
underground: molecular plant-rhizobacteria interactions. Plant Cell and
Environment 26, 189-199.
Persmark, M., Expert, D. & Neilands, J. B. (1989). Isolation, characterization,
and synthesis of chrysobactin, a compound with siderophore activity from
Erwinia chrysanthemi. Journal of Biological Chemistry 264, 3187-3193.
Pieterse, C. M. J., van Pelt, J. A., van Wees, S. C. & other authors (2001).
Rhizobacteria-mediated induced systemic resistance: triggering, signalling and
expression. European Journal of Plant Pathology 107, 51-61.
Poole, K. & McKay, G. A. (2003). Iron acquisition and its control in
pseudomonas aeruginosa: many roads lead to rome. Frontiers in Bioscience 8,
661-686.
Quadri, L. E., Keating, T. A., Patel, H. M. & Walsh, C. T. (1999). Assembly of
the Pseudomonas aeruginosa nonribosomal peptide siderophore pyochelin: In
vitro reconstitution of aryl-4, 2-bisthiazoline synthetase activity from PchD,
PchE, and PchF. Biochemistry 38, 14941-14954.
Raaijmakers, J. M., Vlami, M. & de Souza, J. T. (2002). Antibiotic production
by bacterial biocontrol agents. Antonie Van Leeuwenhoek 81, 537-547.
Ran, L. X., van Loon, L. C. & Bakker, P. A. H. M. (2005). No role for
bacterially produced salicylic acid in rhizobacterial induction of systemic
resistance in Arabidopsis. Phytopathology 95, 1349-1355.
Ravel, J. & Cornelis, P. (2003). Genomics of pyoverdine-mediated iron uptake
in pseudomonads. Trends in Microbiology 11, 195-200.
Romling, U. & Amikam, D. (2006). Cyclic di-GMP as a second messenger.
Current Opinion in Microbiology 9, 218-228.
Ross, A. F. (1962). Systemic acquired resistance induced by localized virus
infections in plants. Virology 14, 340-358.
Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G.
T., Mullis, K. B. & Erlich, H. A. (1988). Primer-directed enzymatic
amplification of DNA with thermostable DNA polymerase. Science 239, 487-
491.
Sambrook, J., Fritsch, E. F. & Maniatis, T. E. (1989). Molecular cloning. A
laboratory manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory.
Schippers, B., Bakker, A. W. & Bakker, P. A. H. M. (1987). Interactions of
Deleterious and Beneficial Rhizosphere Microorganisms and the Effect of
Cropping Practices. Annual Review of Phytopathology 25, 339-358.
89

Literature
Schubert, S., Rakin, A., Karch, H., Carniel, E. & Heesemann, J. (1998).
Prevalence of the "high-pathogenicity island" of Yersinia species among
Escherichia coli strains that are pathogenic to humans. Infection and Immunity
66, 480-485.
Schubert, S., Fischer, D. & Heesemann, J. (1999). Ferric enterochelin
transport in Yersinia enterocolitica: molecular and evolutionary aspects. J
Bacteriol 181, 6387-6395.
Schwyn, B. & Neilands, J. B. (1987). Universal chemical assay for the
detection and determination of siderophores. Analytical Biochemistry 160, 47-
56.
Shoda, M. (2000). Bacterial control of plant diseases. Journal of Bioscience
and Bioengineering 89, 515-521.
Smirnova, A. V. & Ullrich, M. S. (2004). Topological and deletion analysis of
CorS, a Pseudomonas syringae sensor kinase. Microbiology 150, 2715-2726.
Smith, J. L. (2004). The physiological role of ferritin-like compounds in
bacteria. Critical Reviews in Microbiology, 30, 173-185.
Snyder, L. R. (1978). Classification of the solvent properties of common
liquids. Journal of chromatographic science 16, 223-234.
Staskawicz, B. J., Mudgett, M. B., Dangl, J. L. & Galan, J. E. (2001).
Common and contrasting themes of plant and animal diseases. Science 292,
2285-2289.
Stromberg, K. D., Kinkel, L. L. & Leonard, K. J. (2004). Quantifying the
effect of bacterial antagonists on the relationship between phyllosphere
population sizes of Xanthomonas translucens pv. translucens and subsequent
bacterial leaf streak severity on wheat seedlings. Biological Control 29, 58-65.
Tanabe, T., Funahashi, T., Nakao, H., Miyoshi, S., Shinoda, S. &
Yamamoto, S. (2003). Identification and characterization of genes required for
biosynthesis and transport of the siderophore vibrioferrin in Vibrio
parahaemolyticus. Journal of Bacteriology 185, 6938-6949.
Teuber, M. (1999). Spread of antibiotic resistance with food-borne pathogens.
Cell Mol Life Sci 56, 755-763.
Thomashow, L. S. (1996). Biological control of plant root pathogens. Current
Opinion in Biotechnology 7, 343-347.
van Loon, L. C., Bakker, P. A. H. M. & Pieterse, C. M. J. (1998a). Systemic
resistance induced by rhizosphere bacteria. Annual Review of Phytopathology
36, 453-483.
90

Literature
van Loon, L. C., Bakker, P. A. H. M. & Pieterse, C. M. J. (1998b). Systemic
resistance induced by rhizospheric bacteria. Annual Review of Phytopathology
36, 453-483.
Visca, P., Colotti, G., Serino, L., Verzili, D., Orsi, N. & Chiancone, E.
(1992). Metal regulation of siderophore synthesis in Pseudomonas aeruginosa
and functional effects of siderophore-metal complexes. Appl Environ Microbiol
58, 2886-2893.
Visca, P., Leoni, L., Wilson, M. J. & Lamont, I. L. (2002). Iron transport and
regulation, cell signalling and genomics: lessons from Escherichia coli and
Pseudomonas. Molecular Microbiology 45, 1177-1190.
Vokes, S. A., Reeves, S. A., Torres, A. G. & Payne, S. M. (1999). The
aerobactin iron transport system genes in Shigella flexneri are present within a
pathogenicity island. Molecular Microbiology 33, 63-73.
Völksch, B., Nüske, J. & May, R. (1996). Characterization of two epiphytic
bacteria from soybean leaves with antagonistic activities against Pseudomonas
syringae pv. glycinea. Journal of Basic Microbiology 36, 453-462.
Völksch, B. & May, R. (2001a). Biological Control of Pseudomonas syringae
pv. glycinea by Epiphytic Bacteria under Field Conditions. Microb Ecol 41, 132-
139.
Völksch, B. & May, R. (2001b). Biological control of Pseudomonas syringae
pv. glycinea by epiphytic bacteria under field conditions. Microbial Ecology 41,
132-139.
Weingart, H., Stubner, S., Schenk, A. & Ullrich, M. S. (2004). Impact of
temperature on in planta expression of genes involved in synthesis of the
Pseudomonas syringae phytotoxin coronatine. Molecular Plant-Microbe
Interactions 17, 1095-1102.
Weller, D. M., Raaijmakers, J. M., Gardener, B. B. M. & Thomashow, L. S.
(2002). Microbial populations responsible for specific soil suppressiveness to
plant pathogens. Annual Review of Phytopathology 40, 309-348.
Wilson, C. L. (1997a). Biological control and plant diseases - a new paradigm.
Journal of Industrial Microbiology & Biotechnology 19, 158-159.
Wilson, K. J., Sessitsch, A., Corbo, J. C., Giller, K. E., Akkermans, A. D. &
Jefferson, R. A. (1995). beta-Glucuronidase (GUS) transposons for ecological
and genetic studies of rhizobia and other gram-negative bacteria. Microbiology
141 ( Pt 7), 1691-1705.
Wilson, M. (1997b). Biocontrol of aerial plant diseases in agriculture and
horticulture: current approaches and future prospects. Journal of Industrial
Microbiology and Biotechnology 19, 188 - 191.
91

Literature
Zou, J., Rodriguez-Zas, S., Aldea, M., Li, M., Zhu, J., Gonzalez, D. O.,
Vodkin, L. O., DeLucia, E. & Clough, S. J. (2005). Expression profiling
soybean response to Pseudomonas syringae reveals new defense-related
genes and rapid HR-specific downregulation of photosynthesis. Molecular
Plant Microbe Interaction 18, 1161-1174.
92