Expression Cloning of noggin, a New Dorsalizing Factor Localized ...

Cell, Vol. 70, 829-840. September 4, 1992, Copyright 0 1992 by Cell Press 

Expression Cloning of noggin, 

a New Dorsalizing Factor Localized 

to the Spemann Organizer in Xenopus Embryos 

William C. Smith and Richard M. Harland 

Department of Molecular and Cell Biology 

Division of Biochemistry and Molecular Biology 

University of California, Berkeley 

Berkeley, California 94720 

Summary 

We have cloned a cDNA encoding a novel polypeptide 

capable of inducing dorsal development in Xenopus 

embryos. RNA transcripts from this clone rescue normal 

development when injected into ventralized embryos 

and result in excessive head development at 

high doses. Therefore, we have named the cDNA noggin. 

noggin cDNA contains a single reading frame encoding 

a 26 kd protein with a hydrophobic aminoterminal 

sequence, suggesting that it is secreted. In 

Northern blot analysis this cDNA hybridizes to two 

mRNAs that are expressed both maternally and zygotically. 

Although noggin transcript is not localized in the 

oocyte and cleavage stage embryo, zygotic transcripts 

are initially restricted to the presumptive dorsal mesoderm 

and reach their highest levels at the gastrula 

stage in the dorsal lip of the blastopore (Spemann organizer). 

In the neurula, noggin is transcribed in the 

notochord and prechordal mesoderm. The activity of 

exogenous noggin RNA in embryonic axis induction 

and the localized expression of endogenous noggin 

transcripts suggest that noggin plays a role in normal 

dorsal development. 

Introduction 

The development of the dorsal-ventral axis in vertebrates 

is thought to be controlled to a large extent by secreted 

inducing factors that are produced in a restricted part of the 

embryo and act at a distance. The initial event in dorsalventral 

patterning is a microtubule-directed rotation of the 

egg cortex (reviewed in Gerhart et al., 1989). The cortical 

rotation, which is completed before the first cleavage, 

modifies maternally deposited determinants of polarity 

(proteins or mRNAs) on the future dorsal side of the embryo. 

Irradiation of the vegetal hemisphere of the newly 

fertilized Xenopus embryo with ultraviolet (UV) light disrupts 

the microtubule array, and cortical rotation no longer 

occurs. The resulting embryo develops only ventral structures. 

A normal bodyaxiscan be restored tosuch UV-irradiated 

embryos in a number of ways. If UV-irradiated embryos 

are tipped during the first cell cycle, the force of 

gravity on the yolky vegetal hemisphere induces a cortical 

rotation, and such embryos develop normally (Scharf and 

Gerhart, 1980). If dorsal vegetal blastomeres are transplanted 

into the irradiated embryo, an axis is restored 

(Gimlich and Gerhart, 1984). The ability to restore an axis 

to a ventralized embryo can be exploited to isolate molecules 

that participate in axis formation during vertebrate 

development. We observed that injection of poly(A)i RNA 

from hyperdorsalized gastrula stage embryos into UVtreated 

embryos could, at least partially, rescue dorsal 

development (Smith and Harland, 1991). We devised an 

assay for the expression cloning of molecules with axisinducing 

activity, and this resulted in the isolation of Xwnt-8 

(Smith and Harland, 1991). 

The formation of a second body axis on the ventral side 

of normal embryos demonstrates an analogous inductive 

activity. Secondary axes can be produced both by physical 

manipulation of embryos and by the injection of any of 

three mRNAs into ventral blastomeres at the early cleavage 

stages. Members of the wnt family (McMahon and 

Moon, 1989; Christian et al., 1991; Sokol et al., 1991) induce 

complete secondary axes; activin induces only a partial 

axis (Thomsen et al., 1990); and goosecoid induces 

duplicated axes that are often complete (Cho et al., 1991). 

The induction of an axis in UV-ventralized embryos, or the 

formation of a secondary axis in normal embryos, combined 

with lineage tracing to distinguish between the primary 

axis and the induced secondary axis, provides a 

rigorous assay for molecules that induce a new axis; this 

test has been used to show that wnt molecules, especially 

writ-7 and Xwnt-8, can induce an axis de novo (Sokol et 

al., 1991; Smith and Harland, 1991). 

However, several properties of Xwnf-8 indicate that it is 

not likely to be the endogenous axis-inducing activity. Not 

only is it expressed after presumptive dorsal axial tissue 

has formed, but it is expressed on the ventral side of the 

embryo (Christian et al., 1991; Smith and Harland, 1991). 

Furthermore, Xwnr-8 can be selectively depleted from the 

dorsalizing RNA population, with no effect on the rescuing 

ability of the RNA (Smith and Harland, 1991). We concluded 

that Xwnt-8 was not the major axis-rescuing component 

in the initial dorsalizing RNA population, and we 

rescreened the library to identify additional dorsalizing activities. 

Here we report the cloning of a second dorsalizing RNA, 

which we have named noggin. noggin has an activity very 

similar to that of Xwnt8, but has no apparent sequence 

similarity to any previously identified protein. We show that 

injected noggin mRNA can promote formation of a vegetal 

dorsalizing center (the Nieuwkoop center, which induces 

dorsal mesoderm, but whose own cells populate the yolky 

endoderm). The presence of noggin mRNA is consistent 

with it having a role in normal dorsal development as part 

of the early-acting Nieuwkoop center. Zygotic expression 

of noggin occurs at the correct time and place for it to 

participate in the functions of the later acting Spemann 

organizer, which induces neural tissue and dorsalizes ventral 

mesoderm. 

Results 

Expression Cloning of noggin cDNA 

We previously described a cloning strategy for isolating 

cDNAs with dorsalizing activity in Xenopus embryos. RNA

from dorsalized gastrulae (treated with LiCl during blastula 

stages) was size fractionated and the active fraction used 

to construct a plasmid cDNA library. RNAs were synthesized 

from pools of plasmids and injected into ventralized 

embryos produced by UV treatment (Smith and Harland, 

1991). Pools of plasmid DNA that directed the synthesis 

of dorsalizing RNA were sib selected until single active 

clones were isolated. In the first screen we isolated Xwnf-8, 

which was surprising since Xwnt-8 is down-regulated by 

LiCl treatment. We therefore reexamined the initial pools 

of 10,000 clones to ask whether Xwnt-8 was the only dorsalizing 

activity present. 

The 10 pools of 10,000 clones were analyzed by filter 

hybridization for the presence of Xwnt-8. The result is 

shown in Figure 1A. Xwnt-8 clones were present in the 

two active pools (8 and 9), as well as in five others. The 

retrospective analysis demonstrates that although Xwnr-8 

is less abundant in RNA from dorsalized gastrulae, it is 

still an abundant mRNA that is highly represented in the 

library. 

In the isolation of Xwnt-8 (Smith and Harland, 1991) 

pool 9 was selected for subsequent sib selections. The 

Xwnt-8 hybridization signal was weaker in pool 8 than in 

pool 9 and not much different from the inactive pools that 

contained Xwnf-8. To test whether pool 8 contained dorsalizing 

activities other than Xwnt-8, it was subdivided into 

12 pools of 1000 clones. Five of the pools had activity in 

the rescue assay and three of these did not contain Xwnt-8. 

The Xwnt-b-negative pool with the strongest dorsal axisrescuing 

activity, pool 8.12, was further sib selected until 

a single active clone was isolated (clone A3 from pool 

8.12.12.A). The activity of the pools (i.e., the degree of 

dorsal axis rescued) increased as progressively smaller 

pools of clones were assayed. At the second sib selection 

of the library (pools of 1000 clones), A3 hybridizing clones 

could account for the activity of all dorsalizing pools that 

A. Pool: 1 2 3 4 5 6 7 8 9 10 

Activity: - - - - - - - + _ + _ - 

Xwnt-6-b 

Figure 1. Detection of Xwnf-8 and noggin Clones in Sib Selection 

Pools 

Five microgram samples of library plasmid DNA from the first (A) and 

second (6) sib selections (10,000 and 1,006 clones per pool, respectively) 

were digested with EcoRl and EcoRV, separated on 1% agarose 

gels, and transferred to nylon membranes. The membranes were hybridized 

with an Xwnt-8 probe alone (A) or first with Xwnt-8 and then 

with noggin probes (6). The activities of the various pools in the dorsal 

axis rescue assay are indicated (plus or minus). 

did not contain Xwnt-8 (Figure 16). One pool of 1000 

clones (8.2) hybridized with the A3 probe but did not have 

activity in the assay (Figure 16). The reason for this is 

unknown, although it is possible that this particular A3 

hybridizing clone was not functional. In addition, at this 

stage in the sib selection the active pools only conferred 

partial rescue of dorsal development, and pools with dorsalizing 

RNAs could have been missed. 

Finally, preliminary results indicate that at least one additional 

dorsalizing activity may be present in our library. 

RNA transcribed from Ncol linearized library plasmid DNA 

(rather than Notl linearized) retained axis-rescuing activity. 

Ncol cleaves within the 5’ untranslated region of A3 and 

within the coding region of Xwnt-8 and yields truncated, 

nonfunctional transcripts. The completeness of Ncol 

cleavage of A3 and Xwnt-8 plasmids in the pool was confirmed 

by blotting (data not shown). 

noggin cDNA Encodes a Novel Polypeptide 

The 1834 nt sequence of the A3 clone is shown in Figure 

2A. The sequence contains a single long open reading 

frame encoding a 222 aa polypeptide with a predicted molecular 

size of 26 kd. At the amino terminus, a hydrophobic 

stretch of amino acids suggests that the polypeptide enters 

the secretory pathway (Figure 26). There is a single 

potential site for N-linked glycosylation (see the asterisk in 

Figure 2A). Extensive untranslated regions are located 

both 5’and 3’of the reading frame (594 and 573 bp, respectively). 

The 3’ untranslated region is particularly rich in 

repeated dA and dT nucleotides, and contains, in addition 

to a polyadenylation signal sequence located 24 bp upstream 

of the start of the poly(A) tail, a second potential 

polyadenylation sequence 147 bp further upstream (both 

are underlined in Figure 2A). 

In vitro translation of RNA synthesized from the A3 clone 

resulted in a protein product with the approximate molecular 

weight predicted by the open reading frame (data not 

shown). Comparison of the amino acid sequence of the 

predicted polypeptide to the National Center for Biotechnology 

Information BLAST network (nonredundant data 

base) did not identify any similar sequence. Clone A3 thus 

appears to encode a new type of protein that may be secreted 

and that has dorsal-inducing activity in Xenopus. 

noggin mRNA Can Rescue a Complete 

Dorsal-Ventral Axis 

The new sequence, and its putative protein product, were 

named noggin based upon the phenotype resulting from 

mRNA injection into ventralized embryos (see below). Injection 

of noggin RNA into a single blastomere of a 4-cell 

stage UV-ventralized embryo can restore the complete 

spectrum of dorsal structures. The degree of axis rescue 

was dependent upon the amount of RNA injected: the embryos 

that received low doses had only posterior dorsal 

structures, while embryos that received higher doses had 

excess dorsal-anterior tissue. RNA transcripts from two 

noggin plasmids were tested. The first (A3) contained the 

full cDNA. The second @NogginAY) had a deletion removing 

the first 513 nt of the 5’ untranslated region up to the 

EcoRl site (see Figure 2A). The results of injection of RNA

l 

noggin Rescues 

831 

Dorsal Development 

A 

-359:CGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCC~AGTTTCTTCTAGGA~AGATCGAGTCTCTGGTTA ‘a GATCGAGCTGAAAGTGAAGAATATTTAAGAGAG 

NC0 I 

-239:ffiGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCACC~GGACTGT~GT~GffiTGAGCGCATT~AGACAGACAG~GCTCTGCTG~CTTCCACTTGACTGCGATGAGA~~G 

-119:GAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCA L2AAim TCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGAGC 

EC0 RI 

41:ProLeuValA~pLe"I1eGluHlsProAspProIleTy~A~pP~~Ly~Gl"Ly~A~pL~"A~"Gl"Th~Le"Le~A~gTh~L~~~e~V~lGly~~~PheA~pP~~A~"Ph~~~~Al~T~~ 

121:CCACTGGTGGACCTTATTGAGCACCCQ$.XCQC ATCTATGATCCCRAGGAGRAGGATCTTRACGAGACCTTGCCTTTATGGCCACC 

Ban HI 

81:IleLeuProGl"GluArgLeuGlyValGlyValGluAspLeuGlyGluLeuAspLeuLeuLeuArgGlnLysProSerGlyAlaMetProAlaGluIleLysGlyLeuGluPheTyrGluGlyLeu 

241:ATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTT~GGAGTTGGATCTCCTTCTTAGGCAG~GCCCTCGGGGGC~TGCCAGCGGA~TC~GGGACT~AGTTTTACGAGGGGCTT 

‘r 

I I I I 

0 I IO 100 

Pg RNA 

Figure 3. Dorsal Axis Rescue of Ventraked Embryos by noggin and 

Xwnt-8 RNAs 

Xenopus embryos were ventralized by exposure to UV light approximately 

0.5 hr after fertilization. The embryos were then injected into 

one blastomere at the 4-cell stage with noggin RNA transcribed either 

from the full cDNA (A3) or from a plasmid containing a truncation in 

the 5’ untranslated region (nogginA5’). Other embryos were injected 

with Xwnt-8 RNA. The RNAs were injected at 1 to 100 pg in 10 nl of 

water. Control embryos were injected with water only. Embryos were 

grown until untreated embryosof the same age reached approximately 

stage 41. The degree of dorsoanterior development was scored according 

to the scale of Kao and Elinson (1988). The mean DAIS for 12 to 

34 embryos at each RNA dose are plotted. Bars indicate the standard 

errors of the mean. 

noggin-Injected Blastomeres Act as a 

Nieuwkoop Center 

noggin, Xwnt-8, and writ-7 mRNAs all have the ability to 

restore dorsal axial development when injected into ventralized 

embryos (Smith and Harfand, 1991; Sokol et al., 

1991; this study). We have shown previously that when 

Xwnf-8 mRNA is injected into one vegetal blastomere of 

UV-treated embryos at the 32cell stage, dorsal structures 

are rescued (Smith and Harland, 1991). The descendants 

of the injected vegetal cells do not fate map to the rescued 

dorsal tissues, but rather to the endoderm. This result is 

consistent with earlier blastomere transplantation experiments 

in which the strongest source of the axis-inducing 

activity was found to be localized in dorsal vegetal cells 

(Gimlich and Gerhart, 1984; Gimlich, 1986; Kageura, 1990). 

Xwnt-8 mRNAcould also rescue dorsal development when 

injected into marginal zone cells (in which case they did 

contribute progeny to rescued dorsal tissues), but not 

when injected into animal pole cells. 

The effect of varying the site of noggin mRNA injection 

was investigated in a similar manner, and the results were 

similar to those observed for Xwnt-8. UV-treated embryos 

at the 32-cell stage were injected with either 0.5 ng of 

p-galactosidase mRNA alone or 0.5 ng of f3-galactosidase 

mixed with 25 pg of nogginA5’ mRNA, as described previously 

(Smith and Harland, 1991). Injection of noggin 

mRNA into blastomeres of the vegetal pole (tier 4 blastomeres) 

gave the most strongly dorsoanteriorized embryos 

(Figure 5). Representative embryos, stained with X-gal to 

indicate the fates of the injected cells, are shown in Figure 

6. In both of the vegetally injected embryos the nuclear 

X-gal staining was found almost exclusively in the endoderm 

(the mRNA encodes a 6-galactosidase that translocates 

to the nucleus, allowing distinction from the diffuse 

background stain). One of the embryos shown was 

strongly hyperdorsalized (DAI = -7) as a result of the 

noggin mRNA injection and has a severely truncated tail 

and enlarged head structures. Embryos were also rescued 

by noggin mRNA injections into the marginal zone (blastomeres 

from tiers 2 and 3) (Figure 5). In these embryos 

6-galactosidase staining was observed primarily in the 

axial and head mesoderm (Figure 6). As was observed 

previously with Xwnt-8, injection of noggin mRNA into the 

animal pole (tier 1 blastomeres) had very little effect on 

axis formation (Figures 5 and 6). Likewise, 6-galactosidase 

mRNA alone was without effect (Figure 5). 

noggin mRNA Is Expressed Both Maternally 

and Zygotically 

In Northern blot analysis of RNA from Xenopus embryos, 

two noggin mRNA species of approximate sizes 1.8 and 

1.4 kb were observed (Figure 7). Figure 7A shows the 

results of probing blots containing approximately 2 ug of 

poly(A)’ RNA from the indicated stages with both noggin 

and c-src probes (c-src serves as a control for RNA loading; 

Hemmati-Brivanlou et al., 1991). A relatively low level 

of noggin mRNA was detected in oocytes. By stage 11 the 

level of noggin mRNA was significantly higher, reflecting 

zygotic transcription (as opposed to the maternally 

deposited transcripts seen in oocytes). noggin mRNA remained 

at the elevated level up to the latest stage examined 

(stage 45). 

Based on previous results we expect the level of primary 

dorsalizing RNA in our library to be elevated in LiCI-treated 

embryos relative to normal or UV-treated embryos (Smith 

and Harland, 1991). Figure 78 shows the relative amount 

of noggin mRNA in total RNA samples from stage 8 

through 10 embryos that were either untreated, UV treated 

30 min after fertilization, or treated with LiCl at the 32-cell 

stage. Lithium ion treatment resulted in a large increase 

in the amount of noggin mRNA expressed, relative to untreated 

embryos. UV treatment had the opposite effect. 

noggin mRNA expression was essentially undetectable in 

total RNA samples from these embryos. Thus, the abundance 

of noggin mRNA in manipulated embryos parallels 

the rescuing activity. 

A simple model would predict that cytoplasm rotation 

results in localization of dorsalizing RNA on the prospective 

dorsal side of the embryo. We therefore analyzed the 

distribution of noggin mRNA in oocytes and cleavage 

stage embryos. Since the amount of maternally deposited 

noggin RNA is too low for in situ hybridization to detect 

above background, we used an RNAase protection assay. 

Oocytes were dissected into animal and vegetal halves. 

No enrichment of noggin mRNA was seen in either hemisphere 

relative to total oocyte RNA (Figure 8). Four-cell 

stage embryos were dissected into dorsal and ventral

noggin Rescues Dorsal Development 

833 

Control 

UV/no injection 

Xwnt-8 

nogginAs’ 

1 

100 

Figure 4. Ve ntralized Embryos Injected with noggin and Xwnr-8 RNAs 

Figure shows i representative ventralized embryos injected with nogginA or Xwnf-8 R NAs. Xenopus embryos ventralized by UV irradiation before 

the first cleah rage were injected into one blastomere at the 4-cell stage with 1, 10, or 100 pg of either nogginA5’ or Xwnr-8 RNAs in a volume of IO 

nl. All embryr JS shown are the same age as the control embryos (approximately stage 41) which were not UV treated or injected. Also shown are 

noninjected I JV-treated embryos.

Cell 

634 

4 

4 

LacZ 

F 

+ noggin 

obtained with embryos that were tilted 90° immediately 

following fertilization and then marked with a vital dye on 

their uppermost side to indicate the future dorsal side 

(Peng, 1991). Older (32-cell stage) blastula embryos were 

also dissected into dorsal-ventral and animal-vegetal 

halves. No enrichment of noggin mRNA in any of the hemispheres 

was seen relative to the total embryo (data not 

shown). In addition, UV treatment did not alter the abundance 

of maternally deposited noggin RNA, indicating no 

preferential degradation in ventral tissues (Figure 8). Samples 

with known amounts of in vitro synthesized noggin 

mRNA were included in the RNAase protection assay (Figure 

8). From these and other data we estimate that there 

is approximately0.1 pg of noggin mRNA per blastula stage 

embryo and 1 pg per gastrula stage embryo. 

Figure 5. Dorsal Rescue of 32-Cell Embryos with noggin RNA 

Ventralized 32-cell stage embryos were coinjected with 25 pg of noggin 

and 0.5 ng of 6-galactosidase RNAs into a single blastomere in either 

the animal (tier l), marginal (tiers 2 and 3) or vegetal (tier 4) regions. 

Embryos were grown to about stage 25 and scored for dorsal axis 

rescue. 

halves, as well as animal and vegetal halves. noggin transcripts 

were found to be distributed evenly between dorsal 

and ventral hemispheres as well as animal and vegetal 

hemispheres (Figure 8). The same result (not shown) was 

In Situ Hybridization; Zygotic Expression of noggin 

in the Spemann Organizer 

The localization of noggin transcripts in developing embryos 

was examined in greater detail using whole-mount 

in situ hybridization (Harland, 1991). Whole fixed embryos 

were hybridized with digoxigenin-containing RNA probes. 

Hybridized RNA probe was then visualized with an alkaline 

phosphatase-conjugated anti-digoxigenin antibody. The 

specificity of hybridization seen with antisense noggin 

probes was tested both by hybridizing embryos with sense 

Figure 6. Lineage Tracing of noggin-Injected Blastomeres 

Ventralized embryos (32~cell stage) were coinjected with 25 pg of noggin and 0.5 ng of 5-galactosidase RNAs. The embryos were then stained with 

X-gal at about stage 25. Diffuse background staining can be seen in the endoderm. Specific staining from injected f3-galactosidase RNA can be 

seen as darker and more discrete points of staining. Arrows indicate cement glands. Arrowheads indicate staining of lineage tracer.

noggin Rescues 

835 


al 

5 Stage 

A. 8 9 11 12 13 14 20 35 

6. 

noggin 

c-src 

noggin 

c-src 

Control LiCl uv 

8 9 10 8 9 10 8 9 10 

Figure 7. Expression of noggin RNA in Development 

(A) A Northern blot of poly(A)’ RNA from embryos of the indicated 

stages hybridized with both noggin and c-src probes. The amount 

of c-src hybridization controls for RNA loading differences between 

samples. 

(B) A Northern blot of total RNA from late blastula and early gastrula 

(stage E-10) embryos hybridized with noggin and C-WC probes to assess 

the effects of UV (ventralization) and LiCl (dorsalization) treatment 

on noggin RNA expression. 

noggin probes and by using two nonoverlapping antisense 

probes (data not shown). Owing to both the low level of 

expression and background staining, noggin mRNA could 

not be detected unequivocally before the late blastula 

stage. The increased level of noggin mRNA that was detected 

by Northern blot following activation of zygotic transcription 

(Figure 7) was apparent in in situ hybridization at 

stage 9 as a patch of staining cells on the dorsal side of 

the embryo. Viewed from the vegetal pole (Figure 9A), this 

patch of cells was restricted to a sector of about 60°. A 

side view of the same embryo (Figure 96) shows that the 

staining cells were located within the marginal zone (i.e., 

between the animal and vegetal poles and within the presumptive 

dorsal mesoderm-forming region). As with other 

newly activated genes, transcripts are largely restricted to 

the nucleus at this stage (Smith and Harland, 1991; Frank 

and Harland, 1991). 

A side view of an early gastrula stage embryo (approximately 

stage 10.5) shows specific hybridization primarily 

noggin+ ‘ - 

EFla+ 

Figure 8. Distribution of Maternal noggin RNA in Oocytes and 4-Cell 

Stage Xenopus Embryos 

RNAase protection assay for noggin and EFlc in total RNA samples 

from dissected oocytes and 4-cell stage embryos. Also included in the 

assay is in vitro synthesized noggin RNA at the amounts indicated. 

c 

K 

in the involuting mesoderm at the dorsal lip (Figure 9C). 

A vegetal view of the same embryo (blastopore lip indicated 

with an arrowhead) shows that noggin mRNA is most 

abundant on the dorsal side, but expression extends at a 

lower level to the ventral side of the embryo. For reasons 

that we do not understand, this method of in situ hybridization 

does not detect transcripts in the most yolky endodermal 

region of embryos (Frank and Harland, 1992; M. E. 

Bolce and R. M. H., unpublished data); therefore, we cannot 

rule out expression in more vegetal regions than those 

seen in the figure. Treatments that are known to affect the 

size of the dorsal lip (LiCI treatment, UV irradiation) had a 

profound effect on the pattern of noggin in situ hybridization. 

Figures 9D, 9E, and 9F show vegetal pole views of 

three stage 10.5 embryos either untreated, LiCl treated at 

stage 6, or UV treated at stage 1, respectively. In LiCItreated 

embryos the staining is intense throughout the 

marginal zone. UV treatment reduced the hybridization 

signal to undetectable levels. This result is consistent with 

amounts of noggin mRNA seen by Northern blot analysis 

(see Figure 76). The UV-treated embryo also is a negative 

control for specificity of hybridization. 

Asgastrulation proceeds, noggin mRNAstaining follows 

the involuting dorsal mesoderm and is highest in the presumptive 

notochord. By the late neurula stage (approximately 

18) noggin mRNA-expressing cells are clearest in 

the most dorsal mesoderm, primarily in the notochord, but 

also extend more anteriorly into the prechordal mesoderm 

(Figures 9G and 9H). The anterior tip of the notochord is 

indicated by an arrow. During tailbud stages, expression 

of noggin in the dorsal mesoderm declines, though expression 

in the notochord persists in the growing tailbud. Expression 

of noggin initiates at several new sites, which 

become progressively clearer as the tadpole matures. A 

discontinuous line of stained cells runs the length of the 

roof plate of the neural tube (Figures 9J and 91). Staining 

is also apparent in the head mesoderm, primarily in the 

mandibular and gill arches. We suspect that this expression 

corresponds to skeletogenic neural crest cells, since 

the same sites also express twist (Hopwood et al., 1989; 

R. M. H., unpublished data); furthermore, subsetsof these 

cells express homeobox genes that mark different anterior-posterior 

levels of the head neural crest; for example, 

En-2 in the mandibular arch is seen by antibody staining 

(Hemmati-Brivanlou et al., 1991) and in situ hybridization 

(R. M. H., unpublished data). Cells with stellate morphology 

stained for noggin mRNA in the tail fin. These stellate 

cells are also likely to be derived from the neural crest. 

None of these patterns were seen with the sense probe or 

with a number of other probes (e.g., Xwnt-8). 

Discussion 

noggin, a Novel Polypeptide with Dorsalizing 

Activity in Xenopus Embryos 

Dorsal structures can be rescued in ventralized embryos 

by injection of mRNA from dorsalized embryos. Using this 

assay we have isolated cDNAs that, when transcribed into 

mRNA and injected into the embryo, can rescue adorsally 

complete anterior-posterior axis. Previously, we isolated

Figure 9. noggin In Situ Hybridization 

Whole embryos were hybridized with antisense noggin RNA probes. Hybridization was visualized by an alkaline phosphatase chromogenic reaction. 

Arrowheads in (C) and (D) indicate dorsal lip of the blastopore. 

(A) Stage 9, vegetal pole view. Staining restricted to wedge on dorsal side of embryo. 

(6) Stage 9, side view. Staining exclusively in dorsal marginal zone. 

(C) Stage 10.5, side view. Hybridizing cells found in dorsal lip of the blastopore.


837 

Xwnt-8 (Smith and Harland, 1991); here we have described 

a novel gene that is equally effective in dorsal 

rescue. Members of the wnt family and noggin are the 

only two types of molecules known that have the ability to 

rescue complete dorsal development in ventralized embryos. 

Preliminary results indicate that at least one additional 

dorsalizing activity may be present in our library. 

However, the identities of any additional dorsalizing activities 

remain to be determined. Our preliminary experiments 

eliminated only the contributions from noggin and Xwnt-8 

to the dorsalizing RNA transcribed from the library and did 

not exclude possible activities from other members of the 

wnt family or from noggin-related clones (if they exist). 

Although the results from the screening of our library 

clearly indicate that axis-rescuing activity is not restricted 

to only one type of molecule, the time and location of noggin 

expression suggest that it participates in the normal 

process of axis formation at blastula and gastrula stages. 

In addition, as would be expected for a molecule that is 

involved in cell-cell signaling, the noggin sequence prediets 

a secreted polypeptide. In contrast to Xwnt-8, noggin 

mRNA is present both maternally and zygotically, and is 

present in tissues that are known to be sources of dorsalinducing 

factors. Although maternal noggin transcripts do 

not appear to be localized within the cleaving embryo, 

zygotic transcription is localized to the dorsal mesoderm. 

Zygotic transcripts are detected in the dorsal marginal 

zone; this tissue involutes as part of the dorsal lip of the 

blastopore and becomes the notochord and head mesoderm 

(prechordal plate). Thus, noggin is expressed in the 

Spemann organizer and its descendant cells. A spatially 

separate and later phase of noggin expression initiates 

after the pattern of the tadpole is established; in the swimming 

tadpole, noggin transcripts are found in the roof plate 

of the neural tube and in a variety of probable neural crest 

derivatives. 

(reviewed by Gerhart et al., 1989; Smith and Harland, 

1991). Thus, noggin mRNA is most effective at rescue 

when injected into vegetal blastomeres of the cleaving 

embryo, and lineage tracing confirms that injected vegetal 

blastomeres populate the endoderm of the rescued embryo. 

Because the injection can be shown to confer an 

early-acting rescue, these experiments do not address the 

possibility that noggin protein may also act later at the 

gastrula and neurula stages. 

The location of zygotic noggin expression suggests that 

it participates in activities of the Spemann organizer, 

namely, neural induction and dorsalization of ventral 

mesoderm. The development of the organizer is dependent 

upon zygotic transcription initiating after the midblastula 

transition. A number of other genes have recently 

been characterized that are specifically turned on in the 

organizer following the start of zygotic transcription, ineluding 

goosecoid (Blumberg et al., 1991; Cho et al., 

1991), Xlim-7 (Taira et al., 1992), and XFK/-/l (Dirksen and 

Jamrich, 1992; Ruiz i Altaba and Jessel, 1992). In contrast 

to these genes, which all encode nuclear transcription factors, 

noggin encodes a secreted protein and could potentially 

mediate the inductive activitiesof the Spemann organizer. 

The later localization in the notochord suggests that 

noggin could be involved in induction of the floor plate 

of the neural tube (Yamada et al., 1991). In the tadpole, 

expression in the neural roof plate and neural crest suggests 

yet other trophic or differentiating activities. Production 

of recombinant noggin protein will allow us to address 

the question of whether responsiveness to noggin persists 

to the gastrula (or later) stages, and if so, how these older 

tissues respond to noggin treatment. 

Is noggin an Endogenous Inducer of 


noggin mRNA is present throughout dorsal development 

and is expressed in tissues that have been identified by 

The Role of Zygotic noggin Transcripts dissection assourcesof inducing activity (i.e., dorsal vege- 

Because noggin was isolated from dorsalized gastrula tal cells in the blastula, dorsal lip in the gastrula, and noto- 

RNA (from LiCI-treated embryos), and because these em- chord in the neurula). We have demonstrated that exogebryos 

contain increased amounts of noggin transcript rela- nous noggin mRNA has dorsalizing activity when injected 

tive to controls, it is not surprising that gastrula transcripts into cleavage stage embryos. Injected noggin mRNA can 

are dorsally localized. However, injection assays into blas- substitute for the formation of the Nieuwkoop center in a 

tula embryos revealed dorsalizing activity of exogenous ventralized embryo, but it is not clear if endogenousnoggin 

noggin via the Nieuwkoop center, the early-acting source transcript performs the same role in normal development. 

of dorsal signals that resides in the vegetal hemisphere The amount of maternal noggin mRNA is significantly 

(D) Stage 10.5, vegetal pole view. Staining is restricted primarily to the dorsal side of the embryo. Faint staining can also be seen extending around 

the lateral and ventral sides of the embryo. 

(E) Stage 10.5, LiCI-treated, vegetal pole view. Strong noggin hybridization encircles the embryo as a result of dorsalizing treatment (LiCI). 

(F) Stage 10.5, W-treated, vegetal pole view. Only background staining was detected in the ventralized embryo. The sharp circle is the outline of 

the blastocoel. 

(G) Stage 18, dorsal view. Detectable staining along dorsal midline in notochord and prechordal plate. The anterior end of the embryo is to the left. 

Arrow indicates the anterior limit of the notochord. 

(H) Stage 18, side view. Note the anterior extent of noggin expression (to the left). Staining cells extend beyond the anterior limit of the notochord 

into the presumptive head mesoderm. 

(I) stage 40, dorsal view. A line running along dorsal midline is stained as well as the mandibular and gill arches in the head, These appear as 

bilateral patches of stain anterior lo the eye (mandibular arch) and “fingers” of stain behind the eye. Staining in the lens and in the pharynx (between 

the eyes) is not specific. 

(J) Stage 40, side view. Broken line of staining dorsal cells extending along the anterior-posterior axis corresponds to the roof plate of neural tube. 

Staining can still be detected in the posterior tip of the notochord. The speckled appearance of the tailfin is due to stained stellate cells.

Cell 

838 

lower than the quantity needed for axis rescue of ventralized 

embryos by injection. However, translational or 

posttranslational control might normally enhance the activity 

of noggin protein on the dorsal side, so large amounts 

of transcript may need to be injected into ventralized embryos 

to overcome reduced activity. 

To test whether noggin is required for normal development, 

its expression or activity must be eliminated experimentally. 

We have demonstrated a correlation between 

ventralization of the embryo and elimination of zygotic noggin 

expression, but the amount of maternal mRNA is unaffected 

in ventralized embryos, and noggin mRNA is present 

in the ventral half of the cleaving embryo. Whether 

protein expression or activity is affected in ventral cells is 

not yet known. In principle, maternal noggin mRNA can be 

eliminated by oligonucleotide-mediated RNAase H digestion 

and the effects on development monitored (Kloc et al., 

1989). Our recent cloning of the mouse homolog of noggin 

(A. Huang, W. C. S., and R. M. H., unpublished data) will 

also facilitate genetic studies. 

Dorsal Mesodermal Patterning in Xenopus 

To date, mesoderm induction assays and axis-rescuing 

assays have identified different molecules. The mesoderm 

inducers include activin and fibroblast growth factor (FGF). 

Injection of FGF RNA has little effect on normal embryos 

(Kimelman and Maas, 1992) and activin mRNA injection 

produces only partial axes (Thomsen et al., 1990; Sokol et 

al., 1991). Although a concentration gradient of mesoderm 

inducer could in principle account for dorsal-ventral differences 

(Green and Smith, 1990), the discovery of distinct 

axis-rescuing (dorsalizing) molecules suggests a different 

mechanism for patterning the mesoderm. While molecules 

like Xwnt-8 have no inherent mesoderm-inducing 

activity (Christian et al., 1992) they sensitize cells to mesoderm 

inducers; thus, the combination of a ventral mesoderm 

inducer, FGF, with cells expressing Xwnf-8 results 

synergistically in differentiation of dorsal mesoderm (Christian 

et al., 1992). In preliminary experiments, we observed 

that animal caps exposed to noggin formed very little, or 

no, mesoderm on their own. However, when combined 

with a low level of activin, the animal caps differentiated 

a large amount of dorsal mesoderm (A. Knecht and 

W. C. S., unpublished data). Therefore, wnt mRNAs and 

noggin appear to have similar properties as dorsalizing 

factors that sensitize cells to mesoderm inducers. 

A requirement for the dorsalizing class of molecules in 

the embryo is also suggested by the observation that ventral 

animal cap tissue exposed to high concentrations of 

activin cannot form notochord or anterior neural tissues 

(Sokol and Melton, 1991; Bolce et al., 1992); in contrast, 

dorsally derived cells can respond to activin to form these 

structures. In the embryo the pattern of the mesoderm 

could be generated by a uniform distribution of mesoderm 

inducers in the marginal zone that is acted on by a local 

source of dorsalizing factor such as a wnt or noggin (reviewed 

by Kimelman et al., 1992). 

Experimental 

Procedures 

Production of Xenopus Embryos 

Xenopus embryos were prepared as described previously (Condie and 

Harland, 1967). Embryos were staged according to the table of Nieuwkoop 

and Faber (1967). Ventralized embryos were produced by UV 

irradiation with a Stratalinker (Stratagene), and dorsalized embryos 

were produced by treatment with LiCl (Smith and Harland, 1991). 

Isolation and Sequencing of noggin cDNA 

The construction of the size-selected plasmid cDNA library from stage 

11 LiCI-treated embryos has been described previously (Smith and 

Harland, 1991). In vitro RNA synthesis, injection assay for dorsal axis 

rescue, and sib selections were also done as described previously 

(Smith and Harland, 1991). A slightly different protocol was used in 

plating bacteria for preparation of template plasmid DNAs from the 

sib-selected pools. As before, agarose plate cultures were used to 

prepare plasmid DNAs from pools of 100,000 to 1,000 clones per pool. 

This was done in order to ensure that particular clones did not become 

greatly overrepresented, as would be more likely in liquid cultures. 

However, for pools of 100 clones agarose plates with 100 colonies 

were first grown overnight. Replica plates with ten impressions from 

the original plates were then made, grown overnight, and used to 

prepare template DNA. Pools of ten were produced first by picking and 

growing small liquid cultures of the 100 individual colonies from the 

original plate of the active pool of 100 clones. These cultures were then 

pooled into ten pools of ten clones, while reserving some of each single 

clone for later expansion and assay. 

To test for the presence of Xwnf-8 or noggin sequences in library 

pools, 5 Kg of DNA from each pool was digested with EcoRl and 

EcoRV, which released the cDNA inserts from the plasmid vector. 

Blots made from the samples after electrophoresis on a 1% agarose 

gel were hybridized with Xwnt-8 and noggin probes. 

The nucleotide sequence of both strands of the isolated noggin 

cDNA clone was determined by the dideoxy termination method 

(Sanger et al., 1977) using modifiedT7 DNApolymerase(US Biochemical 

Company). Deletions were prepared in sequencing templates by 

both restriction enzyme and exonuclease Ill digestion (Henikoff, 1967). 

RNA Isolation and Analysis 

Total RNA was isolated from embryos and oocytes by a small-scale 

protocol described previously (Condie and Harland, 1967). Oocytes 

and blastula stage embryos were fixed in 96% ethanol plus 2% acetic 

acid prior to dissection. The dissected tissues were then rinsed twice 

in 100% ethanol before homogenization. 

Samples containing either the total RNA equivalent of 2.5 embryos 

or approximately 2 ug of poly(A)’ RNA were analyzed by Northern 

blotting as described previously (Smith and Harland, 1991; Condie and 

Harland, 1967). Random primed DNA probes were prepared from a 

1323 bp fragment of noggin cDNA from the EcoRl site at nucleotide 

-63 to an EcoRV site that lies in the vector immediately 3’ to the end 

of the cDNA. Other probes used in the present study (Xenopus c-sfc 

and EFla) have been described previously (Hemmati-Brivanlou et al., 

1991; Krieg et al., 1969). 

RNAase protection assays were done using a protocol detailed previously 

(Melton et al., 1964) with minor modifications (C. Kintner, Salk 

Institute, La Jolla, CA). A noggin cDNA exonuclease Ill deletion clone 

(clone 5.5, see Figure 2A) having a deletion from the S’end to nucleofide 

363 was used as a template for synthesizing RNA probes. The 

template DNA was linearized by EcoRl restriction enzyme digestion, 

and a 463 base antisense RNA incorporating =P was synthesized with 

T7 RNA polymerase. A 367 base antisense EFia RNA probe was used 

as a control for amount of RNA per sample (Krieg et al., 1969). Probes 

were gel purified prior to use. 

In Situ Hybridization 

The procedure described by Frank and Harland (1991) and detailed in 

Harland (1991) was used with minor modifications. After fixation and 

storage, the embryos were checked to ensure that the blastocoel and 

archenteron were punctured. Care was taken to puncture the residual


839 

blastocoel of neurulae and tadpoles as well as the archenteron. Embryos 

were rewashed at room temperature in 100% ethanol for 2 hr 

to remove residual lipid. After hybridization, staining was allowed to 

develop overnight and the embryos were then fixed in Bouin’s, which 

stabilizes the stain better than MEMFA. Newly stained embryos have 

a high background of pink stain but most of this washes out, leaving 

the specific stain. Following overnight fixation, the embryos were 

washed well with 70% ethanol, 70% ethanol buffered with phosphatebuffered 

saline, and methanol. Embryos were cleared in Murray’s mix 

and photographed with Kodak Ektar 25 film, using a Zeiss axioplan 

microscope (2.5 x or 5 x objective with 3 x 128 telescope to assist 

with focusing). 

Lineage Tracing 

Lineage tracing with mRNA that encodes nuclear-localized &galactosidase 

has been described previously (Smith and Harland, 1991). Ventralized 

embryos were coinjected at the 32-cell stage with 0.5 ng of 

j3-galactosidase and 25 pg of nogginA5’ mRNAs. Embryos were fixed 

and stained with X-gal at approximately stage 22. 

Acknowledgments 

We thank J. Gerhart, M. Dunaway, K. Anderson, and members of our 

lab fortheir critical reading of our manuscript. This work was supported 

by grants from the National Institutes of Health to R. M. H. and by a 

postdoctoral fellowship from the American Cancer Society to W. C. S. 

The costs of publication of this article were defrayed in part by 

the payment of page charges. This article must therefore be hereby 

marked “advertisement” in accordance with 18 USC Section 1734 

solely to indicate this fact. 

Received May 16, 1992; revised June 25, 1992 

Blumberg, B., Wright, C. V. E., De Robertis, E. M., and Cho, K. W. Y. 

(1991). Organizer-specific homeobox genes in Xenopus laevis embryos. 

Nature 253, 194-196. 

Bolce, M. E., Hemmati-Brivanlou, A., Kushner, P. D.. and Harland, 

R. M. (1992). Ventral ectoderm of Xenopusforms neural tissue, including 

hindbrain, in response to activin. Development 775. 681-688. 

Christian, J. L., McMahon, J. A., McMahon, A. P., and Moon, R. T. 

(1991). Xwnt-8, a Xenopus Writ-iAnt- related gene responsive to 

mesoderm inducing growth factors, may play a role in ventral mesodermal 

patterning during embryogenesis. Development 777, 1045-1055. 

Christian, J. L., Olson, D. J.. and Moon, R. T. (1992). Xwnt-8 modifies 

the character of mesoderm induced by bFGF in isolated Xenopus ectoderm. 

EMBO J. 77, 33-41. 

Cho, K. W. Y., Blumberg. B., Steinbeisser, H., and De Robertis, 

E. M. (1991). Molecular nature of Spemann’s organizer: the role of the 

Xenopus homeobox gene goosecoid. Cell 67, 111 l-l 120. 

Condie, B. G., and Harland, R. M. (1987). Posterior expression of a 

homeobox gene in early Xenopus embryos. Development 707, 93- 

105. 

Dirksen, M. L., and Jamrich, M. (1992). A novel, activininducible, 

blastopore lip-specific gene of Xenopus laevis contains a fork head 

DNA-binding domain. Genes Dev. 6, 599-608. 

Frank, D., and Harland, R. M. (1991). Transient expression of XMyoD 

in non-somitic mesoderm of Xenopus gastrulae. Development 773, 

1387-1393. 

Frank, D., and Harland, R. M. (1992). Localized expression of aXenopus 

POU gene depends on cell-autonomous transcriptional activation 

and induction-dependent inactivation. Development 7 75, 439-448. 

Gerhart, J. C., Danilchik, M., Doniach, T., Roberts, S., Browning, B., 

and Stewart, R. (1989). Cortical rotation of the Xenopus egg: consequences 

for the anteroposterior pattern of embryonic dorsal development. 

Development (Suppl.) 707, 37-51. 

Gimlich, R. L. (1986). Acquisition of developmental autonomy in the 

equatorial region of the XenopuS embryo. Dev. Biol. 775, 340-352. 

Gimlich, R. L., and Gerhart, J. C. (1984). Early cellular interactions 

promote embryonic axis formation in Xenopus laevis. Dev. Biol. 704, 

117-130. 

Green, J. B. A., and Smith, J. C. (1990). Graded changes in dose of 

aXenopus activin A homologue elicit stepwise transitions in embryonic 

cell fate. Nature 347, 391-394. 

Harland, R. M. (1991). In situ hybridization: an improved whole-mount 

method for Xenopus embryos. Meth. Cell Biol. 36, 685-695. 

Hemmati-Brivanlou, A., de la Terre, J. R., Holt, C., and Harland, R. M. 

(1991). Cephalic expression and molecular characterization of Xenopus 

En-2. Development 7 77, 715-724. 

Henikoff, S. (1987). Unidirectional digestion with exonuclease Ill in 

sequence analysis. Meth. Enzymol. 755, 156-165. 

Hopwood, N. D., Pluck,A., andGurdon, J. B. (1989).AXenopus mRNA 

related to Drosophila twist is expressed in response to induction in the 

mesoderm and the neural crest. Cell 59, 893-903. 

Kageura, H. (1990). Spatial distribution of the capacity to initiate a 

secondary embryo in the 32-cell embryo of Xenopus laevis. Dev. Biol. 

742, 432-438. 

Kao, K. R., and Elinson, R. P. (1988). The entire mesodermal mantle 

behaves as Spemann’s organizer in dorsoanterior enhanced Xenopus 

laevis embryos. Dev. Biol. 727, 64-77. 

Kimelman, D., and Maas, A. (1992). Induction of dorsal and ventral 

mesoderm by ectopically expressed Xenopus basic fibroblast growth 

factor. Development 774, 261-289. 

Kimelman, D., Christian, J., and Moon, R. T. (1992). Synergistic principles 

of development: overlapping patterning systems in Xenopus 

mesoderm induction. Development, in press. 

Kloc, M., Miller, M., Carrasco, A. E., Eastman, E., and Etkin, L. (1989). 

The maternal store of the xlgv7 mRNA in full-grown oocytes is not 

required for normal development in Xenopus. Development 707,899- 

907. 

Krieg. P. A., Varnum, S. M., Wormington, W. M., and Melton, D. A. 

(1989). The mRNA encoding elongation factor l-alpha (EF-1 alpha) is 

a major transcript at the midblastula transition in Xenopus. Dev. Biol. 

733, 93-100. 

Kyte, J., and Doolittle, R. F. (1982). A simple method for displaying the 

hydropathic character of a protein. J. Mol. Biol. 757, 105-132. 

McMahon, A. P., and Moon, R. T. (1989). Ectopic expression of the 

proto-oncogene in&l in Xenopus embryos leads to duplication of the 

embryonic axis. Cell 58, 1075-1084. 

Melton, D.A., Kreig, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K., and 

Green, M. R. (1984). Efficient in vitro synthesis of biologically active 

RNA and RNA hybridization probes from plasmids containing a bacteriophage 

SP6 promoter. Nucl. Acids Res. 72, 7035-7056. 

Nieuwkoop, P. D., and Faber, J. (1967). Normal Table of Xenopus 

laevis (Daudin) (Amsterdam: North Holland). 

Peng, H. B. (1991). Appendix A: solutions and protocols. Meth. Cell 

Biol. 36, 661. 

Ruiz i Altaba, A., and Jessel, T. (1992). Pintallavis, a gene expressed 

in the organizer region and midline cells of frog embryos: involvement 

in the development of the neural axis. Development, in press. 

Sanger, F., Nicklen, S., and Coulson, A. (1977). DNA sequencing with 

chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463- 

5467. 

Scharf, S. R., and Gerhart, J. C. (1980). Determination of the dorsalventral 

axis in eggs of Xenopus laevis: complete rescue of uv-impaired 

eggs by oblique orientation before first cleavage. Dev. Biol. 79, 181- 

198. 

Smith, W. C., and Harland, R. M. (1991). Injected Xwnt-8 RNA acts 

early in Xenopus embryos to promote formation of avegetal dorsalizing 

center. Cell 67, 753-765. 

Sokol, S., and Melton, D. A. (1991). Pre-existent pattern in Xenopus 

animal pole cells revealed by induction with activin. Nature 357, 409- 

411. 

Sokol, S., Christian, J. L., Moon, R. T., and Melton, D. A. (1991).

Cdl 

840 

Injected Wnt RNA induces a complete body axis in Xenopus embryos. 

Cell 67, 741-752. 

Taira, M., Jamrich, M., Good, P. J., and Dawid, I. B. (1992). The LIM 

domain-containing homeo box gene Xlim-1 is expressed specifically 

in the organizer region of Xenopus gastrula embryos. Genes Dev. 6, 

356-366. 

Thomsen, G., Woolf, T., Whitman, M., Sokol, S., Vaughan, J., Vale, 

W., and Melton, D. A. (1990). Activins are expressed early in Xenopus 

embryogenesis and can induce axial mesoderm and anterior structures. 

Cell 63, 485-493. 

Yamada, T., Placzek, M., Tanaka, H., Dodd, J., and Jessell, T. M. 

(1991). Control of cell pattern in thedeveloping nervoussystem: polarizing 

activity of the floor plate and notochord. Cell 64, 635-647. 

GenBank Accession Number 

The accession number for the sequence reported in this paper is 

M96607. 

Note Added 

in Proof 

In Figure 2A the numbering of the 5’ untranslated region should be 

adjusted to read -120, -240, etc.

Expression Cloning of noggin, a New Dorsalizing Factor Localized ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?