Protocol animals DNA extraction and PCR - CusMiBio
Protocol animals DNA extraction and PCR - CusMiBio
Protocol animals DNA extraction and PCR - CusMiBio
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
Genomic <strong>DNA</strong> <strong>extraction</strong> from animal tissues Obtain animal tissue ~10-‐20 mg from your sample. Transfer to an Eppendorf 1.5 mL tube labeled with an identification number. If you are working with more than one sample, be careful not to cross contaminate specimens. Add liquid nitrogen <strong>and</strong> grind the tissue for 1 minute with a pestle. Add 300 μl Extraction (NaCl 10mM; Tris-‐HCl 10mM pH 7,5; EDTA 10mM, pH 8.0) <strong>and</strong> 100 μl SDS 5%. Add 15 μl Proteinase K Grind the tissue with a pestel Incubate the tube in a water bath or heat block at 60°C for at least 30 minutes Prepare a new set of eppendorf tubes labelled with identification codes for the next step Centrifuge at 13.000 rpm (round per minute) for 15 min Transfer 150 μl supernatant to a new tube Add 150 μl ammonium acetate 5M <strong>and</strong> 300 μl isopropanol Mix inverting the eppendorf tubes (5X) Leave at room temperature for 10 minutes Centrifuge at 13.000 rpm for 5 minutes. Eliminate the supernatant. Careful! Make sure you don’t remove the pellet at the bottom of the tube. Wash pellet adding 500 μl ethanol 70% Centrifuge at 13.000 rpm for 5 minutes. Eliminate the supernatant. Dry the pellet for 10-‐15 minutes at 60 °C to evaporate remaining ethanol Resuspend in 50 μl TE + RNAse <strong>PCR</strong> <strong>Protocol</strong> <strong>PCR</strong> MIX (for each <strong>DNA</strong> sample from fish) Buffer 10x 2,5 Primer 1 (15pmol/ µl) 0,4 Primer 2 0,4 Primer 3 0,4 Primer 4 0,4 dNTP (10mM) 0,5 H 2 O 17,9 <strong>DNA</strong> extract 2 Taq 5U/ µl 0,5 Total 25 µl
<strong>PCR</strong> MIX (for each <strong>DNA</strong> sample from insects or mammals) Buffer 10x 2,5 Primer MIX * (12,5pmol/ µl each) 0,5 dNTP (10mM) 0,5 H 2 O 19 <strong>DNA</strong> extract 2 Taq 5U/ µl 0,5 Total 25 µl * Primer Mix ( 5,6,7,8,9,10,11 <strong>and</strong> 12): mix 15 µl of each primer (initial concentration of each primer: 100pmol/ µl). Final volume 120 µl (final concentration of each primer 12,5 pmoli/µl) <strong>PCR</strong> cycles: 94 °C 2MIN 94°C 30s 54°C 45s 72°C 45s 35 cycles 72°C 3min 4°C end Barcode Primer COI (fish) 1) 5’-‐TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC-‐3’ (forward primer -‐ VF2_t1) 2) 5’-‐TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC-‐3’ (forward primer-‐ FishF2_t1) 3) 5’-‐CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA3’ (reverse primer -‐ FishR2_t1) 4) 5’-‐CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA-‐3’ (reverse primer -‐FR1d_t1) Barcode Primer COI (insects <strong>and</strong> mammals) 5) 5’-‐GTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG-‐3’ (forward primer -‐ LepF1_t1) 6) 5’-‐TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG-‐3’ (forward primer -‐ VF1_t1) 7) 5’-‐TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG-‐3’ (forward primer -‐ VF1d_t1) 8) 5’-‐ TGTAAAACGACGGCCAGTTCTCAACCAACCAIAAIGAIATIGG-‐3’ (forward primer -‐ VF1i_t1) 9) 5’-‐CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA-‐3’ (reverse primer -‐ LepR1_t1) 10) 5’-‐CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA-‐3’ (reverse primer -‐ VR1d_t1) 11) 5’-‐CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA-‐3’ (reverse primer -‐ VR1_t1) 12) 5’-‐CAGGAAACAGCTATGACTAGACTTCTGGGTGICCIAAIAAICA-‐3’ (reverse primer -‐ VR1i_t1) Key to degenerate nucleotides (I.e. a primer whose sequence contains ATCCR will contain both ATCCA <strong>and</strong> ATCCG) 2
Change language