- Page 1: ABSTRACT OF DISSERTATION Jeramiah J
- Page 5 and 6: RULES FOR THE USE OF DISSERTATIONS
- Page 7 and 8: AMBYSTOMA: PERSPECTIVES ON ADAPTATI
- Page 9 and 10: Materials and Methods..............
- Page 11 and 12: LIST OF FIGURES Figure 2.1, Results
- Page 13 and 14: LIST OF FILES File Name Size Supple
- Page 15 and 16: under which the female phenotype is
- Page 17 and 18: CHAPTER 2: From Biomedicine to Natu
- Page 19 and 20: Materials and Methods cDNA library
- Page 21 and 22: minimum 100 bp match length, and 85
- Page 23 and 24: indeed, there were approximately tw
- Page 25 and 26: Informatic searches for regeneratio
- Page 27 and 28: To identify SNPs between species, i
- Page 29 and 30: ESTs and to assess likelihood that
- Page 31 and 32: Table 2.1: Tissues selected to make
- Page 33 and 34: 26 Table 2.2 (continued) Locus ID F
- Page 35 and 36: 28 Table 2.2 (continued) Locus ID F
- Page 37 and 38: 30 Table 2.2 (continued) Locus ID F
- Page 39 and 40: 32 Marker ID Primers a Table 2.3 (c
- Page 41 and 42: 34 Table 2.6: Top 20 contigs with t
- Page 43 and 44: Table 2.8: Functional annotation of
- Page 45 and 46: 38 Table 2.9: Ambystoma contigs tha
- Page 47 and 48: 40 TABLE 2.9 (continued) Ambystoma
- Page 49 and 50: 42 Table 2.9 (continued) Ambystoma
- Page 51 and 52: Table 2.10 (continued) A. mexicanum
- Page 53 and 54:
Figure 2.3: Results of BLASTN and T
- Page 55 and 56:
CHAPTER 3: A comprehensive EST Link
- Page 57 and 58:
Materials and Methods Study species
- Page 59 and 60:
additionally constrained to flank a
- Page 61 and 62:
linkage groups that consisted of on
- Page 63 and 64:
combined map length of LG1 and LG2
- Page 65 and 66:
needed to elucidate fully the effec
- Page 67 and 68:
and BLAST alignments can also be ob
- Page 69 and 70:
Table 3.2: Distribution of markers
- Page 71 and 72:
Figure 3.1: Statistical tests for M
- Page 73 and 74:
Figure 3.2 (continued) 66
- Page 75 and 76:
CHAPTER 4: Sal-Site: Integrating Ne
- Page 77 and 78:
elated databases. To create the AES
- Page 79 and 80:
as hyperlinks to separate marker fi
- Page 81 and 82:
Figure 4.1 - Schematic showing the
- Page 83 and 84:
CHAPTER 5: Evolution of Salamander
- Page 85 and 86:
metamorphic timing. These results s
- Page 87 and 88:
coding sequence for this EST was ob
- Page 89 and 90:
modes in WILD2, all individuals wer
- Page 91 and 92:
Genetic basis of discrete variation
- Page 93 and 94:
met alleles that increase or decrea
- Page 95 and 96:
Figure 5.1: Larval and adult phases
- Page 97 and 98:
CHAPTER 6: Gene Order Data from a M
- Page 99 and 100:
sequence alignments between transla
- Page 101 and 102:
Results Identification of putative
- Page 103 and 104:
N=309 for Ambystoma-human), and 2)
- Page 105 and 106:
identifiable between Ambystoma and
- Page 107 and 108:
and more variable rates of genome r
- Page 109 and 110:
Fissions derived within the mammali
- Page 111 and 112:
Table 6.2: Distribution of human/Am
- Page 113 and 114:
Figure 6.2: Frequency distributions
- Page 115 and 116:
Figure 6.5: Oxford plot of the posi
- Page 117 and 118:
Figure 6.7: Oxford plot of the posi
- Page 119 and 120:
Figure 6.10: Oxford plot of the pos
- Page 121 and 122:
evolution) that has evolved since t
- Page 123 and 124:
Sequence Alignment Similarity searc
- Page 125 and 126:
Software Requirements: MapToGenome
- Page 127 and 128:
substantial proportion of zebrafish
- Page 129 and 130:
segments within which linear order
- Page 131 and 132:
shows much stronger correspondence
- Page 133 and 134:
Figure 7.2: Oxford plots of alignme
- Page 135 and 136:
Figure 7.4: Plot of the λ values f
- Page 137 and 138:
Figure 7.6: Oxford plots of vertebr
- Page 139 and 140:
CHAPTER 8: Bird and Mammal Sex Chro
- Page 141 and 142:
(XCR) (Graves, 1995; Ross et al, 20
- Page 143 and 144:
uild 2.1 (http://www.ncbi.nih.gov/m
- Page 145 and 146:
identified between amniote sex chro
- Page 147 and 148:
evidence for ancestral linkage of X
- Page 149 and 150:
Figure 8.1: An abridged phylogeny o
- Page 151 and 152:
Figure 8.4: Oxford plot of the posi
- Page 153 and 154:
etween sex chromosomes, or by gene
- Page 155 and 156:
Rearing conditions At approximately
- Page 157 and 158:
AGGGCCTTCACATATTTTTCTGCAAAATAT). Th
- Page 159 and 160:
were females (respectively, Z A. me
- Page 161 and 162:
Localization of the major sex-deter
- Page 163 and 164:
and possibly other members of the t
- Page 165 and 166:
Table 9.1: Segregation of sex among
- Page 167 and 168:
Figure 9.3: Diagram of the crossing
- Page 169 and 170:
Other amphibians As genetic maps be
- Page 171 and 172:
REFERENCES Adrian, E. K. Jr. and B.
- Page 173 and 174:
Collins, J. P., J. L. Brunner, J. K
- Page 175 and 176:
Gardiner, D. M., M. A. Torok, L. M.
- Page 177 and 178:
Humphrey, R.R., 1957 Male homogamet
- Page 179 and 180:
Licht, L. E., L. A. Lowcock, 1991 G
- Page 181 and 182:
Ohno, S., 1967 Sex chromosomes and
- Page 183 and 184:
Sakata, N, Y. Tamori, M. Wakahara,
- Page 185 and 186:
Straus, N. A., 1971 Comparative DNA
- Page 187 and 188:
(superorder Afrotheria) reveals the
- Page 189:
Page, R. B., J. R. Monaghan, A. K.