Ambystoma - University of Kentucky Libraries

More documents

Recommendations

Info

39 Table 2.9 (continued) Ambystoma Contig ID RAT cDNA clone E-value TigSingletonClusters_Salamander_2_B24_ab1 gi|205508| myelin/oligodendrocyte glycoprotein E-26 TigCluster_5740_V2_p10_M20_TriplEx5ld_ gi|205531| metallothionein-2 and metallothionein 1 E-08 TigSingletonClusters_V2_p5_A2_TriplEx5ld_ gi|205537| microtubule-associated protein 1A E-59 MexCluster_1645_Contig1 gi|205633| Na, K-ATPase alpha-2 subunit E-149 TigSingletonClusters_Contig328 0 TigSingletonClusters_Contig45 gi|205683| smallest neurofilament protein (NF-L) E-63 MexSingletonClusters_NT016A_A09 gi|205693| nerve growth factor-induced (NGFI-A) E-95 TigSingletonClusters_I09_Ag2_p9_K24_M13R E-24 MexSingletonClusters_NT007A_E07 gi|205754| neuronal protein (NP25) E-64 TigCluster_7148_Contig1 E-57 MexCluster_9504_Contig1 gi|206161| peripheral-type benzodiazepine receptor E-73 MexSingletonClusters_BL016B_B02 gi|206166| protein kinase C type III E-36 TigCluster_981_Contig1 E-27 MexSingletonClusters_nm_19_k3_t3_ gi|206170| brain type II Ca2+/calmodulin-dependent E-117 MexSingletonClusters_v11_p42_j20_t3_049_ab1 gi|207138| norvegicus syntaxin B E-79 MexSingletonClusters_nm_14_h19_t3_ gi|207473| neural receptor protein-tyrosine kinase E-40 TigSingletonClusters_Contig336 E-34 TigSingletonClusters_E10_Ag2_p18_O19_M13 gi|2116627| SNAP-25A E-123 MexCluster_211_Contig1 gi|220713| calcineurin A alpha E-63 TigSingletonClusters_Salamander_7_K14_ab1 E-87 MexSingletonClusters_NT014A_G03 gi|220839| platelet-derived growth factor A chain E-21 TigSingletonClusters_Salamander_9_M15_ab1 E-56 TigSingletonClusters_Salamander_19_M06_ab1 gi|2501807| brain digoxin carrier protein E-55 MexSingletonClusters_Contig100 gi|2746069| MAP-kinase phosphatase (cpg21) E-108 39
40 TABLE 2.9 (continued) Ambystoma Contig ID RAT cDNA clone E-value TigSingletonClusters_Salamander_11_A16_ab1 E-70 MexCluster_8345_Contig1 gi|2832312| survival motor neuron (smn) E-40 TigCluster_8032_Contig1 E-49 MexCluster_3580_Contig1 gi|294567| heat shock protein 70 (HSP70) 0 TigCluster_8592_Contig2 E-161 TigSingletonClusters_Salamander_17_N08_ab1 gi|2961528| carboxyl-terminal PDZ E-10 MexSingletonClusters_BL286C_D09 gi|298325| sodium-dependent neurotransmitter tran. E-12 TigSingletonClusters_Contig95 E-22 MexSingletonClusters_Contig461 gi|2996031| brain finger protein (BFP) E-08 TigSingletonClusters_Salamander_11_O19_ab1 E-23 TigSingletonClusters_E16_Ag2_p8_O20_M13R gi|3135196| Ca2+/calmodulin-dependent E-33 MexSingletonClusters_Contig188 gi|3252500| CC chemokine receptor protein E-15 MexCluster_6961_Contig1 gi|3319323| suppressor of cytokine signaling-3 E-08 MexSingletonClusters_nm_14_p15_t3_ gi|349552| P-selectin E-16 TigCluster_218_Contig2 E-99 MexSingletonClusters_Contig506 gi|3707306| Normalized rat embryo, cDNA clone E-14 TigSingletonClusters_I16_Ag2_p5_N7_M13R gi|3711670| Normalized rat muscle, cDNA clone E-35 MexSingletonClusters_V1_p1_a10_Triplex5Ld gi|3727094| Normalized rat ovary, cDNA clone E-15 TigSingletonClusters_v2_p1_D20_triplex5ld E-16 MexSingletonClusters_NT005B_F02 gi|3811504| Normalized rat brain, cDNA clone E-35 TigSingletonClusters_Salamander_22_I04_ab1 E-34 TigSingletonClusters_Ag2_p34_N23_M13R gi|405556| adenylyl cyclase-activated serotonin E-17 TigSingletonClusters_Salamander_1_H02_ab1 gi|4103371| putative potassium channel TWIK E-22 40
Page 1 and 2: ABSTRACT OF DISSERTATION Jeramiah J
Page 3 and 4: ABSTRACT OF DISSERTATION AMBYSTOMA:
Page 5 and 6: RULES FOR THE USE OF DISSERTATIONS
Page 7 and 8: AMBYSTOMA: PERSPECTIVES ON ADAPTATI
Page 9 and 10: Materials and Methods..............
Page 11 and 12: LIST OF FIGURES Figure 2.1, Results
Page 13 and 14: LIST OF FILES File Name Size Supple
Page 15 and 16: under which the female phenotype is
Page 17 and 18: CHAPTER 2: From Biomedicine to Natu
Page 19 and 20: Materials and Methods cDNA library
Page 21 and 22: minimum 100 bp match length, and 85
Page 23 and 24: indeed, there were approximately tw
Page 25 and 26: Informatic searches for regeneratio
Page 27 and 28: To identify SNPs between species, i
Page 29 and 30: ESTs and to assess likelihood that
Page 31 and 32: Table 2.1: Tissues selected to make
Page 33 and 34: 26 Table 2.2 (continued) Locus ID F
Page 39 and 40: 32 Marker ID Primers a Table 2.3 (c
Page 41 and 42: 34 Table 2.6: Top 20 contigs with t
Page 43 and 44: Table 2.8: Functional annotation of
Page 45: 38 Table 2.9: Ambystoma contigs tha
Page 49 and 50: 42 Table 2.9 (continued) Ambystoma
Page 51 and 52: Table 2.10 (continued) A. mexicanum
Page 53 and 54: Figure 2.3: Results of BLASTN and T
Page 55 and 56: CHAPTER 3: A comprehensive EST Link
Page 57 and 58: Materials and Methods Study species
Page 59 and 60: additionally constrained to flank a
Page 61 and 62: linkage groups that consisted of on
Page 63 and 64: combined map length of LG1 and LG2
Page 65 and 66: needed to elucidate fully the effec
Page 67 and 68: and BLAST alignments can also be ob
Page 69 and 70: Table 3.2: Distribution of markers
Page 71 and 72: Figure 3.1: Statistical tests for M
Page 73 and 74: Figure 3.2 (continued) 66
Page 75 and 76: CHAPTER 4: Sal-Site: Integrating Ne
Page 77 and 78: elated databases. To create the AES
Page 79 and 80: as hyperlinks to separate marker fi
Page 81 and 82: Figure 4.1 - Schematic showing the
Page 83 and 84: CHAPTER 5: Evolution of Salamander
Page 85 and 86: metamorphic timing. These results s
Page 87 and 88: coding sequence for this EST was ob
Page 89 and 90: modes in WILD2, all individuals wer
Page 91 and 92: Genetic basis of discrete variation
Page 93 and 94: met alleles that increase or decrea
Page 95 and 96: Figure 5.1: Larval and adult phases
Page 97 and 98:
CHAPTER 6: Gene Order Data from a M
Page 99 and 100:
sequence alignments between transla
Page 101 and 102:
Results Identification of putative
Page 103 and 104:
N=309 for Ambystoma-human), and 2)
Page 105 and 106:
identifiable between Ambystoma and
Page 107 and 108:
and more variable rates of genome r
Page 109 and 110:
Fissions derived within the mammali
Page 111 and 112:
Table 6.2: Distribution of human/Am
Page 113 and 114:
Figure 6.2: Frequency distributions
Page 115 and 116:
Figure 6.5: Oxford plot of the posi
Page 117 and 118:
Page 119 and 120:
Figure 6.10: Oxford plot of the pos
Page 121 and 122:
evolution) that has evolved since t
Page 123 and 124:
Sequence Alignment Similarity searc
Page 125 and 126:
Software Requirements: MapToGenome
Page 127 and 128:
substantial proportion of zebrafish
Page 129 and 130:
segments within which linear order
Page 131 and 132:
shows much stronger correspondence
Page 133 and 134:
Figure 7.2: Oxford plots of alignme
Page 135 and 136:
Figure 7.4: Plot of the λ values f
Page 137 and 138:
Figure 7.6: Oxford plots of vertebr
Page 139 and 140:
CHAPTER 8: Bird and Mammal Sex Chro
Page 141 and 142:
(XCR) (Graves, 1995; Ross et al, 20
Page 143 and 144:
uild 2.1 (http://www.ncbi.nih.gov/m
Page 145 and 146:
identified between amniote sex chro
Page 147 and 148:
evidence for ancestral linkage of X
Page 149 and 150:
Figure 8.1: An abridged phylogeny o
Page 151 and 152:
Page 153 and 154:
etween sex chromosomes, or by gene
Page 155 and 156:
Rearing conditions At approximately
Page 157 and 158:
AGGGCCTTCACATATTTTTCTGCAAAATAT). Th
Page 159 and 160:
were females (respectively, Z A. me
Page 161 and 162:
Localization of the major sex-deter
Page 163 and 164:
and possibly other members of the t
Page 165 and 166:
Table 9.1: Segregation of sex among
Page 167 and 168:
Figure 9.3: Diagram of the crossing
Page 169 and 170:
Other amphibians As genetic maps be
Page 171 and 172:
REFERENCES Adrian, E. K. Jr. and B.
Page 173 and 174:
Collins, J. P., J. L. Brunner, J. K
Page 175 and 176:
Gardiner, D. M., M. A. Torok, L. M.
Page 177 and 178:
Humphrey, R.R., 1957 Male homogamet
Page 179 and 180:
Licht, L. E., L. A. Lowcock, 1991 G
Page 181 and 182:
Ohno, S., 1967 Sex chromosomes and
Page 183 and 184:
Sakata, N, Y. Tamori, M. Wakahara,
Page 185 and 186:
Straus, N. A., 1971 Comparative DNA
Page 187 and 188:
(superorder Afrotheria) reveals the
Page 189:
Page, R. B., J. R. Monaghan, A. K.
show all

Ambystoma - University of Kentucky Libraries

Create successful ePaper yourself

Delete template?

Save as template?