Ambystoma - University of Kentucky Libraries

More documents

Recommendations

Info

41 Table 2.9 (continued) <strong>Ambystoma</strong> Contig ID RAT cDNA clone E-value MexCluster_4589_Contig1 gi|4135567| Normalized rat embryo, cDNA clone E-32 TigSingletonClusters_Contig220 E-09 TigCluster_4093_Contig1 gi|4228395| cDNA clone UI-R-A0-bc-h-02-0-UI E-104 MexSingletonClusters_nm_21_2_m7_t3_ gi|425471| nuclear factor kappa B p105 subunit E-22 TigCluster_8535_Contig1 E-11 MexSingletonClusters_v6_p1_j6_triplex5_1ld_ gi|430718| Sprague Dawley inducible nitric oxide E-13 TigSingletonClusters_Salamander_15_D22_ab1 E-41 MexCluster_3498_Contig1 gi|436934| Sprague Dawley protein kinase C rec. 0 TigCluster_6648_Contig1 0 MexSingletonClusters_BL279A_B12 gi|464196| phosphodiesterase I E-49 TigSingletonClusters_Salamander_25_P03_ab1 E-75 MexCluster_8708_Contig1 gi|466438| 40kDa ribosomal protein E-168 TigCluster_5877_Contig1 E-168 MexSingletonClusters_nm_14_a9_t3_ gi|493208| stress activated protein kinase alpha II E-51 TigSingletonClusters_Salamander_11_A13_ab1 gi|517393| tau microtubule-associated protein E-44 TigSingletonClusters_Salamander_12_J14_ab1 gi|55933| c-fos E-26 MexSingletonClusters_nm_21_2_l13_t3_ gi|56822| major synaptic vesicel protein p38 E-39 TigCluster_2065_Contig1 E-50 MexCluster_10965_Contig1 gi|56828| nuclear oncoprotein p53 E-75 TigCluster_5315_Contig1 E-66 MexCluster_4245_Contig1 gi|56909| pJunB gene E-50 TigSingletonClusters_G05_Ag2_p9_G8_M13R E-09 MexSingletonClusters_NT013D_C12 gi|56919| region fragment for protein kinase C E-33 41
42 Table 2.9 (continued) <strong>Ambystoma</strong> Contig ID RAT cDNA clone E-value TigSingletonClusters_Salamander_21_H19_ab1 E-24 MexCluster_9585_Contig1 gi|57007| ras-related mRNA rab3 E-61 TigCluster_4885_Contig1 E-63 TigSingletonClusters_Salamander_1_M03_ab1 gi|57238| silencer factor B E-13 MexSingletonClusters_NT008B_D05 gi|57341| transforming growth factor-beta 1 E-13 TigSingletonClusters_Salamander_24_I16_ab1 E-20 MexCluster_9533_Contig1 gi|57479| vimentin 0 TigCluster_5768_Contig1 0 MexSingletonClusters_BL283B_A11 gi|596053| immediate early gene transcription E-12 TigSingletonClusters_Salamander_13_J19_ab1 E-16 MexSingletonClusters_v6_p4_j2_triplex5_1ld_ gi|790632| macrophage inflammatory protein-1alpha E-22 TigCluster_2146_Contig1 gi|951175| limbic system-associated membrane prot. E-11 MexSingletonClusters_v11_p54_o4_t3_ gi|971274| neurodegeneration associated protein 1 E-09 TigSingletonClusters_Salamander_2_J12_ab1 E-11 42
Page 1 and 2: ABSTRACT OF DISSERTATION Jeramiah J
Page 3 and 4: ABSTRACT OF DISSERTATION AMBYSTOMA:
Page 5 and 6: RULES FOR THE USE OF DISSERTATIONS
Page 7 and 8: AMBYSTOMA: PERSPECTIVES ON ADAPTATI
Page 9 and 10: Materials and Methods..............
Page 11 and 12: LIST OF FIGURES Figure 2.1, Results
Page 13 and 14: LIST OF FILES File Name Size Supple
Page 15 and 16: under which the female phenotype is
Page 17 and 18: CHAPTER 2: From Biomedicine to Natu
Page 19 and 20: Materials and Methods cDNA library
Page 21 and 22: minimum 100 bp match length, and 85
Page 23 and 24: indeed, there were approximately tw
Page 25 and 26: Informatic searches for regeneratio
Page 27 and 28: To identify SNPs between species, i
Page 29 and 30: ESTs and to assess likelihood that
Page 31 and 32: Table 2.1: Tissues selected to make
Page 33 and 34: 26 Table 2.2 (continued) Locus ID F
Page 39 and 40: 32 Marker ID Primers a Table 2.3 (c
Page 41 and 42: 34 Table 2.6: Top 20 contigs with t
Page 43 and 44: Table 2.8: Functional annotation of
Page 45 and 46: 38 Table 2.9: Ambystoma contigs tha
Page 47: 40 TABLE 2.9 (continued) Ambystoma
Page 51 and 52: Table 2.10 (continued) A. mexicanum
Page 53 and 54: Figure 2.3: Results of BLASTN and T
Page 55 and 56: CHAPTER 3: A comprehensive EST Link
Page 57 and 58: Materials and Methods Study species
Page 59 and 60: additionally constrained to flank a
Page 61 and 62: linkage groups that consisted of on
Page 63 and 64: combined map length of LG1 and LG2
Page 65 and 66: needed to elucidate fully the effec
Page 67 and 68: and BLAST alignments can also be ob
Page 69 and 70: Table 3.2: Distribution of markers
Page 71 and 72: Figure 3.1: Statistical tests for M
Page 73 and 74: Figure 3.2 (continued) 66
Page 75 and 76: CHAPTER 4: Sal-Site: Integrating Ne
Page 77 and 78: elated databases. To create the AES
Page 79 and 80: as hyperlinks to separate marker fi
Page 81 and 82: Figure 4.1 - Schematic showing the
Page 83 and 84: CHAPTER 5: Evolution of Salamander
Page 85 and 86: metamorphic timing. These results s
Page 87 and 88: coding sequence for this EST was ob
Page 89 and 90: modes in WILD2, all individuals wer
Page 91 and 92: Genetic basis of discrete variation
Page 93 and 94: met alleles that increase or decrea
Page 95 and 96: Figure 5.1: Larval and adult phases
Page 97 and 98: CHAPTER 6: Gene Order Data from a M
Page 99 and 100:
sequence alignments between transla
Page 101 and 102:
Results Identification of putative
Page 103 and 104:
N=309 for Ambystoma-human), and 2)
Page 105 and 106:
identifiable between Ambystoma and
Page 107 and 108:
and more variable rates of genome r
Page 109 and 110:
Fissions derived within the mammali
Page 111 and 112:
Table 6.2: Distribution of human/Am
Page 113 and 114:
Figure 6.2: Frequency distributions
Page 115 and 116:
Figure 6.5: Oxford plot of the posi
Page 117 and 118:
Page 119 and 120:
Figure 6.10: Oxford plot of the pos
Page 121 and 122:
evolution) that has evolved since t
Page 123 and 124:
Sequence Alignment Similarity searc
Page 125 and 126:
Software Requirements: MapToGenome
Page 127 and 128:
substantial proportion of zebrafish
Page 129 and 130:
segments within which linear order
Page 131 and 132:
shows much stronger correspondence
Page 133 and 134:
Figure 7.2: Oxford plots of alignme
Page 135 and 136:
Figure 7.4: Plot of the λ values f
Page 137 and 138:
Figure 7.6: Oxford plots of vertebr
Page 139 and 140:
CHAPTER 8: Bird and Mammal Sex Chro
Page 141 and 142:
(XCR) (Graves, 1995; Ross et al, 20
Page 143 and 144:
uild 2.1 (http://www.ncbi.nih.gov/m
Page 145 and 146:
identified between amniote sex chro
Page 147 and 148:
evidence for ancestral linkage of X
Page 149 and 150:
Figure 8.1: An abridged phylogeny o
Page 151 and 152:
Page 153 and 154:
etween sex chromosomes, or by gene
Page 155 and 156:
Rearing conditions At approximately
Page 157 and 158:
AGGGCCTTCACATATTTTTCTGCAAAATAT). Th
Page 159 and 160:
were females (respectively, Z A. me
Page 161 and 162:
Localization of the major sex-deter
Page 163 and 164:
and possibly other members of the t
Page 165 and 166:
Table 9.1: Segregation of sex among
Page 167 and 168:
Figure 9.3: Diagram of the crossing
Page 169 and 170:
Other amphibians As genetic maps be
Page 171 and 172:
REFERENCES Adrian, E. K. Jr. and B.
Page 173 and 174:
Collins, J. P., J. L. Brunner, J. K
Page 175 and 176:
Gardiner, D. M., M. A. Torok, L. M.
Page 177 and 178:
Humphrey, R.R., 1957 Male homogamet
Page 179 and 180:
Licht, L. E., L. A. Lowcock, 1991 G
Page 181 and 182:
Ohno, S., 1967 Sex chromosomes and
Page 183 and 184:
Sakata, N, Y. Tamori, M. Wakahara,
Page 185 and 186:
Straus, N. A., 1971 Comparative DNA
Page 187 and 188:
(superorder Afrotheria) reveals the
Page 189:
Page, R. B., J. R. Monaghan, A. K.
show all

Ambystoma - University of Kentucky Libraries

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?