Ambystoma - University of Kentucky Libraries

More documents

Recommendations

Info

AMBYSTOMA: PERSPECTIVES ON ADAPTATION AND THE EVOLUTION OF VERTEBRATE GENOMES By Jeramiah James Smith . S. Randal Voss Director of Dissertation . Brian C. Rymond Director of Graduate Studies . August 25, 2007 iv
RULES FOR THE USE OF DISSERTATIONS Unpublished dissertations submitted for the Doctor's degree and deposited in the University of Kentucky Library are as a rule open for inspection, but are to be used only with due regard to the rights of the authors. Bibliographical references may be noted, but quotations or summaries of parts may be published only with the permission of the author, and with the usual scholarly acknowledgments. Extensive copying or publication of the dissertation in whole or in part also requires the consent of the Dean of the Graduate School of the University of Kentucky. A library that borrows this dissertation for use by its patrons is expected to secure the signature of each user. Name Date ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ v
Page 1 and 2: ABSTRACT OF DISSERTATION Jeramiah J
Page 3: ABSTRACT OF DISSERTATION AMBYSTOMA:
Page 7 and 8: AMBYSTOMA: PERSPECTIVES ON ADAPTATI
Page 9 and 10: Materials and Methods..............
Page 11 and 12: LIST OF FIGURES Figure 2.1, Results
Page 13 and 14: LIST OF FILES File Name Size Supple
Page 15 and 16: under which the female phenotype is
Page 17 and 18: CHAPTER 2: From Biomedicine to Natu
Page 19 and 20: Materials and Methods cDNA library
Page 21 and 22: minimum 100 bp match length, and 85
Page 23 and 24: indeed, there were approximately tw
Page 25 and 26: Informatic searches for regeneratio
Page 27 and 28: To identify SNPs between species, i
Page 29 and 30: ESTs and to assess likelihood that
Page 31 and 32: Table 2.1: Tissues selected to make
Page 33 and 34: 26 Table 2.2 (continued) Locus ID F
Page 39 and 40: 32 Marker ID Primers a Table 2.3 (c
Page 41 and 42: 34 Table 2.6: Top 20 contigs with t
Page 43 and 44: Table 2.8: Functional annotation of
Page 45 and 46: 38 Table 2.9: Ambystoma contigs tha
Page 47 and 48: 40 TABLE 2.9 (continued) Ambystoma
Page 49 and 50: 42 Table 2.9 (continued) Ambystoma
Page 51 and 52: Table 2.10 (continued) A. mexicanum
Page 53 and 54: Figure 2.3: Results of BLASTN and T
Page 55 and 56:
CHAPTER 3: A comprehensive EST Link
Page 57 and 58:
Materials and Methods Study species
Page 59 and 60:
additionally constrained to flank a
Page 61 and 62:
linkage groups that consisted of on
Page 63 and 64:
combined map length of LG1 and LG2
Page 65 and 66:
needed to elucidate fully the effec
Page 67 and 68:
and BLAST alignments can also be ob
Page 69 and 70:
Table 3.2: Distribution of markers
Page 71 and 72:
Figure 3.1: Statistical tests for M
Page 73 and 74:
Figure 3.2 (continued) 66
Page 75 and 76:
CHAPTER 4: Sal-Site: Integrating Ne
Page 77 and 78:
elated databases. To create the AES
Page 79 and 80:
as hyperlinks to separate marker fi
Page 81 and 82:
Figure 4.1 - Schematic showing the
Page 83 and 84:
CHAPTER 5: Evolution of Salamander
Page 85 and 86:
metamorphic timing. These results s
Page 87 and 88:
coding sequence for this EST was ob
Page 89 and 90:
modes in WILD2, all individuals wer
Page 91 and 92:
Genetic basis of discrete variation
Page 93 and 94:
met alleles that increase or decrea
Page 95 and 96:
Figure 5.1: Larval and adult phases
Page 97 and 98:
CHAPTER 6: Gene Order Data from a M
Page 99 and 100:
sequence alignments between transla
Page 101 and 102:
Results Identification of putative
Page 103 and 104:
N=309 for Ambystoma-human), and 2)
Page 105 and 106:
identifiable between Ambystoma and
Page 107 and 108:
and more variable rates of genome r
Page 109 and 110:
Fissions derived within the mammali
Page 111 and 112:
Table 6.2: Distribution of human/Am
Page 113 and 114:
Figure 6.2: Frequency distributions
Page 115 and 116:
Figure 6.5: Oxford plot of the posi
Page 117 and 118:
Page 119 and 120:
Figure 6.10: Oxford plot of the pos
Page 121 and 122:
evolution) that has evolved since t
Page 123 and 124:
Sequence Alignment Similarity searc
Page 125 and 126:
Software Requirements: MapToGenome
Page 127 and 128:
substantial proportion of zebrafish
Page 129 and 130:
segments within which linear order
Page 131 and 132:
shows much stronger correspondence
Page 133 and 134:
Figure 7.2: Oxford plots of alignme
Page 135 and 136:
Figure 7.4: Plot of the λ values f
Page 137 and 138:
Figure 7.6: Oxford plots of vertebr
Page 139 and 140:
CHAPTER 8: Bird and Mammal Sex Chro
Page 141 and 142:
(XCR) (Graves, 1995; Ross et al, 20
Page 143 and 144:
uild 2.1 (http://www.ncbi.nih.gov/m
Page 145 and 146:
identified between amniote sex chro
Page 147 and 148:
evidence for ancestral linkage of X
Page 149 and 150:
Figure 8.1: An abridged phylogeny o
Page 151 and 152:
Page 153 and 154:
etween sex chromosomes, or by gene
Page 155 and 156:
Rearing conditions At approximately
Page 157 and 158:
AGGGCCTTCACATATTTTTCTGCAAAATAT). Th
Page 159 and 160:
were females (respectively, Z A. me
Page 161 and 162:
Localization of the major sex-deter
Page 163 and 164:
and possibly other members of the t
Page 165 and 166:
Table 9.1: Segregation of sex among
Page 167 and 168:
Figure 9.3: Diagram of the crossing
Page 169 and 170:
Other amphibians As genetic maps be
Page 171 and 172:
REFERENCES Adrian, E. K. Jr. and B.
Page 173 and 174:
Collins, J. P., J. L. Brunner, J. K
Page 175 and 176:
Gardiner, D. M., M. A. Torok, L. M.
Page 177 and 178:
Humphrey, R.R., 1957 Male homogamet
Page 179 and 180:
Licht, L. E., L. A. Lowcock, 1991 G
Page 181 and 182:
Ohno, S., 1967 Sex chromosomes and
Page 183 and 184:
Sakata, N, Y. Tamori, M. Wakahara,
Page 185 and 186:
Straus, N. A., 1971 Comparative DNA
Page 187 and 188:
(superorder Afrotheria) reveals the
Page 189:
Page, R. B., J. R. Monaghan, A. K.
show all

Ambystoma - University of Kentucky Libraries

Create successful ePaper yourself

Delete template?

Save as template?