Chemical Analysis of Value Added Dairy Products and Their Quality ...

Dr. Rajan SharmaSenior Scientist & Director, Winter SchoolDr. (Mrs.) Bimlesh MannPrincipal Scientist & Co-Director, Winter SchoolCourse AdvisorsDr. (Mrs.) B.K. WadhwaDr. Darshan LalDr. Raman SethALL RIGHTS RESERVEDNo part of the lecture compendium may be reproduced or transmitted in any form or byany means, electronic or mechanical, including photocopy, recording, or any information,storage and retrieval system without the written permission of Director, NDRI, Karnal.

Committees for Organisation of Winter SchoolOrganizing CommitteeDr. (Mrs.) B.K. Wadhwa, Head & Principal ScientistDr. Darshan Lal, Principal ScientistDr. Raman Seth, Principal ScientistDr. (Mrs) Bimlesh Mann, Principal ScientistDr. Sumit Arora, Senior ScientistDr. Vivek Sharma, Senior ScientistDr. Rajesh Kumar, Senior ScientistDr. Rajan Sharma, Senior Scientist (Convener)Registration CommitteeDr. Raman Seth (Chairman)Dr. Rajesh Kumar (Convener)Dr. Sumit AroraSh. P.C. SinghSh. Ajit SinghTechnical ComiitteeDr. Darshan Lal (Chairman)Dr. (Mrs) Bimlesh Mann (Convener)Dr. Raman SethDr. Rajesh KumarDr. Rajan SharmaHospitality CommitteeDr. (Mrs.) B.K. Wadhwa (Chairman)Dr. Vivek Sharma (Convener)Dr. (Mrs.) Bimlesh MannSh. Rajeev SharmaPurchase CommitteeDr. (Mrs) Bimlesh Mann (Chairman)Dr. Rajan Sharma (Convener)Dr. Rajesh KumarDr. Vivek Sharma

THEORYContents1. Novel and Emerging Food Technologies for Defence Food Supplies 1A. S. Bawa2. An Overview of Designer Functional and Health Foods5A. K. Srivastava3. Prospects of Value Addition Through Functional Ingredients 10G. R. Patil4. Technological and Nutritional Aspects of Milk Phospholipids 17B. K. Wadhwa and Rajesh Kumar5.Methods of Cholesterol Removal to Develop Low –Cholesterol Dairy Products 22Darshan Lal and Vivek Sharma6. Fortification of Milk and Milk Products for Value Addition 29Sumit Arora7. Packaging of Value Added Foods and Their Storage Stability 36P. P. Gothwal8.Novel Technologies for Processing and Packaging ofHealth Foods and Beverages 40H. N. Mishra9. Glycomacropeptide – Biological Properties and its Application 49Rajan Sharma and Neelima Sharma10.11.New Approaches to Detect the Adulteration of Gheewith Animal Body Fats and Vegetable Oils/ Fats 54Vivek Sharma, Darshan Lal, Arun Kumar and Amit KumarColostrum Powder and its HealthBenefits 59Raman Seth and Anamika Das12. Cow Ghee Protects from Mammary Carcinogenesis: Mechanism 68Vinod K. Kansal, Rita Rani and Ekta Bhatia13.Lateral Flow Assay- Principle and its Application inAnalytical Food Science 72Rajan Sharma and Priyanka Singh Rao14. Separation Strategies for Bioactive Milk Proteins 77Rajesh Kumar15. SDS-PAGE – Principle and Applications 81Y. S. Rajput and Rajan SharmaWestern Blot: Theoretical Aspects 816. 5Y. S. Rajput and Rajan Sharma

17. Enzyme Linked Immunosorbent Assay - Theory 88Rajeev Kapila and Suman Kapila18.19.Experimental Determination of Thermal Stability ofProteins: A Theoretical Background 93Jai K. KaushikSpecies-Specific Identification of Milk and MilkProducts: A Molecular Approach 97Archana Verma20. Proteomic Techniques for Application in Food Science 100Ashok K. Mohanty21.Evaluation of Probiotic Attributes of Dairy StarterCultures Using Various Test Methods 106Rameshwar Singh22. Identification of Lactobacillus spp by PCR based MolecularMethodology 110Sachinandan De and Rupinder Kaur23.24.25.Antimicrobial Substances produced by LacticAcid Bacteria (LAB) 114Shilpa Vij, Subrota Hati and Minakshi DahiyaMicrobiological Risk Assessment: A NewConcept to Ensure Food Safety 117Naresh Kumar and Raghu H. V.Biopreservation of Dairy Products: Role of Bacteriocinsof Lactic Acid Bacteria 126R. K. Malik and Gurpreet Kaur26. Regulatory Aspects of Functional Foods 135Bimlesh mann , Rajesh Kumar and Prerna Saini27.28.29.30.31.Nanomaterials - Their Applications and SafetyAspects in Foods 142Bimlesh Mann , Rajesh Kumar and Prabhakar PadghamStrategies for Animals Studies to Assess theSafety Aspects and Bioavailability of Netraceuticals 145Ayyasamy Manimaran and Bimlesh MannRecent Advances in Synbiotic Dairy Foods andTheir Safety Evaluation 151Chand Ram, Manju and Santosh AnandPhysical Characterization of Dairy Foods withReference to Viscosity, Colour and Water Activity 160R. R. B. Singh and Prateek SharmaMalt Based Milk Foods as “Value AddedFunctional Dairy Products” 165Laxmana Naik, Rajan Sharma, Manju G. and Amit K. Barui

32.PRACTICALPreparation and Characterization of Gold Nanoparticles,Their Conjugation with Antibodies and Constructionof Lateral Flow Devices 170Priyanka Singh Rao, Swapnil Sonar, Y.S. Rajput and Rajan Sharma33. Use of Lateral Flow Technique for Detecting Melamine in Milk 173Raman Seth and Anamika Dass34.35.Rancimat (Accelerated and Automated) Method forEvaluation of Oxidative Stability of Fats and Oils 177Sumit AroraEstimation of Cholesterol Content in Ghee Using aCholesterol Estimation Kit 182Vivek Sharma and Darshan Lal36. Rapid Methods for Detection of Adulterants in Milk 184Rajan Sharma, Raman Seth and Amit K. Bauri37.38.39.Detection of Foreign Fats/Oils in Milk and GheeUsing Newer Approaches 189Darshan Lal, Vivek Sharma, Arun Kumar and Amit KumarDetermination of Total Polyphenolic Content in FruitEnriched Dairy Product 195Rajesh Kumar and Richa SinghSeparation and Identification of Low MolecularWeight Proteins Using Tricine SDS-PAGE 197Neelima Sharma, Rajan Sharma and Y. S. Rajput40. Identification of Proteins Through Western Blotting – Practical 200Neelima Sharma, Amit K.Barui and Y.S. Rajput41. Typing of Milk for A1 and A2 beta Casein 204Sachinandan De, C. M. Hari Kishore, Ayan Mukherjee and Rupinder Kaur42. Enzyme-Linked Immunosorbent Assay-Practical 206Suman Kapila and Rajeev Kapila43. Evaluation of Biological Activity of Milk Protein Ingredients 208Bimlesh Mann, Prerna Saini, Prabhakar Padghan, Anuradha Kumari44. Purification of Bioactive Proteins from Milk 212Neha Mishra, Rajesh Kumar and Jai K Kaushik45. Immunological Method to Detect Buffalo Milk in Cow Milk 214Archana Verma46. Conjugated Linoleic Acid and Its Estimation 217A. K. Tyagi, A. Hossain, A. Tyagi47.Importance and Estimation of Vitamins A & Ein Value Added Dairy Products 221Harjit Kaur

48.49.50.Use of Atomic Absorption Spectrophotometer for theEstimation of Minerals in Milk and Milk Products 225Veena ManiPesticides: Their Analysis in Milk Using HighPerformance Liquid Chromatography 230Chander Datt and Monica PuniyaEstimation of Microbial GOS by High PerformanceLiquid Chromatography 233Vikas Sangwan and Sudhir Kumar Tomar51. Estimation of Trehalose Production by Propionibacteria 236Poonam and Sudhir Kumar Tomar52.53.Spore Based Biosensor as A Quality Control Tool inDairy Industry 239Naresh Kumar, Raghu H. V. and AvinashDetection and Evaluation of Antimicrobial Activities ofBacteriocins and Bioactive Peptides Produced by LAB 248Shilpa Vij, Subrota Hati and Meenakshi Dahiy

Programme Schedule for Winter SchoolProgramme Schedule for Winter SchoolChemical Analysis of Value Added Dairy Products and Their Quality AssuranceJanuary 11-31, 201111 th January 2011(Tuesday)9.00 AM – 9.30 AM Registration of Participants9.30 AM -12.30 PMInauguration of Winter SchoolNovel and Emerging Food Technologies for Defence Food Supplies – Inagural Lectureby Dr. A.S.Bawa, Director, Defence Food Research Laboratory, Mysore12.30 PM -1.00 PM Visit to ATIC/Institute FilmLunch2.15 PM – 3.15 PM Achievements of Dairy Chemistry Division Dr. (Mrs.) B.K. Wadhwa3.15 PM – 4.30 PM Prospects of Value Addition Through functional Ingredients Dr. G.R. Patil12 th January 2011 (Wednesday)9.45 AM -10.45 AM11.00 AM – 12.00 PM12.00 PM – 1.00 PMLunch2.15 PM -5.00 PMMethod of Cholesterol Removal to Develop Low CholesterolDairy Products – TheoryFortifi cation of Milk and Milk Products for Value Addition –TheoryCow Ghee Protects from Mammary Carcinogenesis:Mechanism – TheoryEstimation of Cholesterol Content in Ghee Using aCholesterol Estimation Kit– PracticalDr. Darshan LalDr. Sumit AroraDr.V.K. KansalDr. Vivek Sharma13 th January 2011 (Thursday)9.45 AM -10.45 AMEvaluation of Probiotic Attributes of Dairy Starter Culturesusing Various Test Methods – TheoryDr. Rameshwar Singh11.00 AM – 12.00 PM Separation Strategies for Bioactive Milk Proteins – Theory Dr. Rajesh Kumar12.00 PM – 1.00 PMLunch2.15 PM – 3.15 PM3.15 PM – 5.00 PMNew Approaches to Detect the Adulteration of Milk Gheewith Animal Body Fats and Vegetable Oils/ Fats – TheoryQuality and Food Safety in Yoghurt Industry – Guest LectureDetection of Foreign Fats/Oils in Milk and Ghee Using NewerApproaches - PracticalDr. Vivek SharmaMr. Anuj Mehta(Danone India Ltd.)Dr. Darshan Lal14 th January 2011 (Friday)9.45 AM -10.45 AMTechnological and Nutritional Aspects of Milk Phospholipids -TheoryDr.(Mrs.) B.K. Wadhwa11.00 AM – 12.00 PM Colostrum Powder and its Health benefi t - Theory Dr. Raman Seth12.00 PM – 1.00 PMNovel Technologies for Processing and Packaging of HealthFoods and Beverages – Guest LectureDr. H.N. MisraIIT, Kharagpur

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceLunch2.15 PM – 5.00 PM Purifi cation of Bioactive Proteins from Milk – Practical Dr. Jai K. Kaushik15 th January 2011 (Saturday)9.45 AM -10.45 AM11.00 AM – 12.00 PM12.00 PM – 1.00 PMLunch2.15 PM – 3.15 PM3.15 PM – 5.15 PMNanomaterials - Their Applications and Safety Aspects inFood – TheoryRecent Advances in Synbiotic Dairy Foods and their SafetyEvaluation – TheoryDetermination of Total Polyphenolic Content in Fruit EnrichedDairy Product– Theory & Practicalcontd…. Determination of Total Polyphenolic Content in FruitEnriched Dairy Product – PracticalRancimat (Accelerated and Automated) Method forEvaluation of Oxidative Stability of Fats and Oils – Theory &PracticalDr. (Mrs.) Bimlesh MannDr. Chand RamDr. Rajesh KumarDr. Rajesh KumarDr. Sumit Arora16 th January 2011(Sunday)17 th January 2011 (Monday)9.45 AM -10.45 AM SDS-PAGE – Principle and Applications -Theory Dr. Y.S. Rajput11.00 AM – 1.00 PMLunchSeparation and Identifi cation of Low Molecular WeightProteins using SDS-PAGE – PracticalDr. Y.S. Rajput2.15 PM – 3.15 PM Western Blot: Theoretical Aspects – Theory Dr. Y.S. Rajput3.15 PM- 5.00 PM Identifi cation of Proteins through Western Blotting – Practical Dr. Y.S. Rajput18 th January 2011 (Tuesday)9.45 AM -10.45 AM11.00 AM – 1.00 PMLunch2.15 PM – 3.15 PM3.15 PM - 4.00 PMLateral Flow Assay- Principle and its Application in AnalyticalFood Science – TheoryPreparation and Characterization of Gold Nanoparticles, theirConjugation with Antibodies and Construction of Lateral FlowDevices – Practicalcontd…. Preparation and Characterization of GoldNanoparticles, their Conjugation with Antibodies andConstruction of Lateral Flow Devices - PracticalUse of Lateral Flow Technique for Detecting Melamine inMilk – PracticalDr. Rajan SharmaDr. Rajan SharmaDr. Rajan SharmaDr. Raman Seth4.00 PM – 5.00 PM Regulatory Aspects of Functional Foods Dr. Bimlesh Mann19 th January 2011 (Wednesday)9.45 AM -10.45 AM11.00 AM – 1.00 PMLunchImportance and Estimation of Vitamin A & E in Value AddedDairy Products – Theorycontd…. Importance and estimation of vitamin A & E in ValueAdded Dairy Products – PracticalDr. (Mrs.) Harjeet KaurDr. (Mrs.) Harjeet Kaur

Programme Schedule for Winter School2.15 PM – 3.30 PM3.30 PM – 5.00 PMEstimation of Microbial GOS by HPLC - Theory and PracticalEstimation of Trehalose Production by Propionibacteria –Theory and PracticalDr. S.K. TomarDr. S.K. Tomar20 th January 2011 (Thursday)9.45 AM -10.45 AM11.00 AM – 1.00 PMLunchMicrobiological Risk Assessment: A New Concept to EnsureFood Safety – TheorySpore Based Biosensor as A Quality Control Tool in DairyIndustry – PracticalDr. Naresh KumarDr. Naresh Kumar2.15 PM – 3.15 PM Enzyme Linked Immunossorbent Assay –Theory Dr. Rajeev Kapila3.15 PM – 5.00 PM Enzyme Linked Immunossorbent Assay – Practical Dr. Suman Kapila21 st January 2011 (Friday)9.45 AM -10.45 AM11.00 AM- 12.00 PMExperimental Determination of Thermal Stability of Proteins: ATheoretical BackgroundBiopreservation of Dairy Products: Role of Bacteriocins ofLactic Acid Bacteria – TheoryDr. Jai K KaushikDr. R.K. Malik11.00 AM- 1.00 PM Glycomacropeptide – Biological Properties and its Application Dr. Rajan SharmaLunch2.15 PM – 3.15 PM3.15 PM – 5.00 PMPesticides: Their Analysis in Milk Using High PerformanceLiquid Chromatography– TheoryContd…. Pesticides: Their Analysis in Milk Using HighPerformance Liquid Chromatography – PracticalDr. Chander DattDr. Chander Datt22 nd January 2011(Saturday)Exposure of Participants of Winter School to “Brain Storming Session on Promotion of Indigenous Dairy Products inInternational Market” being organized by Alumni Association, NDRI, Karnal23 rd January 2011 (Sunday)24 th January 2011(Monday)2.15 PM – 3.30 PMIdentifi cation of Lactobacillus spp by PCR based MolecularMethodology – Theory & PracticalDr. Sachinandan De3.30 PM – 5.00 PM Typing of Milk for A1 and A2 beta casein - Theory & Practical Dr. Sachinandan DeLunch2.15 PM – 3.15 PM3.15 PM- 5.00 PM9.45 AM -12.00 PM12.00 AM – 1.00 PMLunchUse of Atomic Absorption Spectrophotometer for theEstimation of Minerals in Milk and Milk Products – TheoryContd…. Use of Atomic Absorption Spectrophotometer for theEstimation of Minerals in Milk and Milk Products – Practical25th January 2011(Tuesday)Physical Characterization of Dairy Foods with Reference toViscosity, Colour and Water Activity – Theory & PracticalAllergen Mangement in Foods - Emerging TrendsDr. (Mrs.) Veena ManiDr. (Mrs.) Veena ManiDr. R.R. B. SinghRajesh Kumar Sharma(Cadbury India Ltd.)

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance2.15 PM – 3.15 PM3.15 PM- 5.00 PMCommon Statistical Techniques for Analytical Dairy and FoodScience – Theorycontd…. Common Statistical Techniques for Analytical Dairyand Food Science – PracticalDr. A.P. RuhilDr. A.P. Ruhil26 th January 2011(Wednesday) – Republic Day27 th January 2011 (Thursday)9.45 AM -10.45 AMStrategies for Animals Studies to Assess the Safety Aspectsand Bioavailability of Netraceuticals – TheoryDr. AyyasamyManimaran11.00 AM – 12.00 PM Rapid Methods for Detection of Adulterants in Milk – Practical Dr. Rajan Sharma12.00 PM – 1.00 PM Visit to Model Dairy Mr. G. MutrejaLunch2.15 PM – 3.15 PM3.15 PM- 5.00 PMImmunological Method to Detect Buffalo Milk in Cow Milk –PracticalSpecies-Specifi c Identifi cation of Milk and Milk Products: AMolecular Approach - TheoryDr. (Mrs.) ArchanaVermaDr. (Mrs.) Archna Verma28 th January 2011 (Friday)9.45 AM -10.45 AM11.00 AM – 12.00 PMPackaging of Value Added Foods and Their Storage Stability– Guest LectureFood Additives and Quality Issues – Guest LectureP.P. Gothwal (CFTRI,Regional Center,Lucknow)Ravinder Kumar(Danisco India Ltd.)12.00 PM – 1.00 PM Proteomic Techniques for Application in Food Science Dr. Ashok K. MohantyLunch2.15 PM – 3.15 PMEvaluation of Biological Activity of Milk Protein Ingredients –TheoryDr. (Mrs.) Bimlesh Mann3.15 PM – 5.00 PMcontd…. Evaluation of Biological Activity of Milk ProteinIngredients – PracticalDr. (Mrs.) Bimlesh Mann29 th January 2011 (Saturday)9.45 AM -10.45 AMAntimicrobial Substances Produced by Lactic Acid Bacteria(LAB) - TheoryDr. (Mrs.) Shilpa Vij11.00 AM – 1.00 PMDetection and Evaluation of Antimicrobial Activities ofBacteriocins and Bioactive Peptides Produced by LAB – Dr. (Mrs.) Shilpa VijTheory & PracticalLunch2.15 PM – 3.15 PM Conjugated Linoleic Acid and Its Estimation – Theory Dr. Amrish TyagiContd…. Conjugated Linoleic Acid and Its Estimation –3.15 PM- 5.00 PMPractical30 th January 2011 (Sunday)31 st January 2011(Monday)9.45 AM -10.45 AMCourse EvaluationDr. Amrish TyagiDr. (Mrs.) Bimlesh Mannand Dr. Rajan Sharma10.45 AM – 1.00 PMLunchInteraction with FacultyChaired by Head, DCDivision

Novel and Emerging Food Technologies for Defence Food SuppliesNovel and Emerging Food Technologiesfor Defence Food SuppliesDr. A. S. BawaDirectorDefence Food Research Laboratory, MysoreThe Defence Food Research Laboratory (DFRL) was established in December, 1961 under theaegis of Defence Research & Development Organisation (DRDO), Ministry of Defence to cater to thestrategic operational requirements of our Services and to provide logistical support to the Armedforces in the area of food supplies. Our troops often operate in far flung in hospitable treacherousterrains under inclement and hostile weather conditions. In such operational situations, not only arethey deprived of the fresh produce needed to sustain life processes even normal regime of cookingbecomes extremely cumbersome and difficult. The R & D efforts at DFRL are aimed at designing andengineering light weight convenient, pack rations for Army,Navy,Air force and other paramilitaryforces which do not require any elaborate cooking or preparation at the consumer’s end and remainshelf-stable under varying climate condition for periods ranging from 6 months to 1 year. Throughenormous and substantive contribution, DFRL has developed a wide verity of food products of Indiandietary matching the mainframe palate tastes of the country. Many of the DFRL foods, born out ofinnovative state of the art technology, lend themselves eminently suitable to industrial scale commercialexploitation by enterprising entrepreneurs of different genre. DFRL also has products which are exportworthy and amenable to working women. Owing to its singular dedicated contributions in processedfoods, DFRL can be reckoned as the leader in convenience food and packed ration developments inthis country. Indigenous ingenuity is the hallmark of most of the technologies developed at DFRL.Over the decades, the technological advancements have resulted in several innovative technologiesfor various applications. Among the dehydration techniques freeze-drying maintains the quality ofproducts which is quite close to that of fresh one. During freeze drying the thermal evaporation ofmoisture is through sublimation at low temperatures and under high vacuum. Hurdle technology helpsto preserve foods for a period of 2-4 months and is applicable to fruits, vegetables and their productsas well as meat and fish products and is sparingly used for cereal products preservation. Hurdletechnology is an intelligent combination of hurdles such as pH, temperature, water activity, redoxpotential, preservative etc. to ensure the microbial safety as well as sensory and nutritional acceptance.Membrane technology is used in the manufacture of clarified juices, for initial concentration throughultra filtration, nano-filtration and reverse osmosis processes.Thermal treatment is the most widely used technology for preservation of foods. Thus retortprocessing of foods has been the most promising technique for preservation of both vegetarian andnon-vegetarian foods in the ready-to-eat form. The temperatures in the range of 110 – 125ºC are usedfor low acid foods with the main objective of inactivating the undesirable micro-organisms to achievecommercial sterilization. High pressure technology is a novel non-thermal processing method of foodpreservation where the food is subjected to high hydrostatic pressures in the range of 100-600 Mpa atroom temperature. The Armed Forces are the biggest consumer of processed foods and approximately13 thousand tonnes of processed food is used annually. They have to subsist mainly on pack rationsduring operational situations. With the advancements in technological methods, Defence FoodResearch Laboratory (DFRL), Mysore, has contributed significantly to develop suitable technologiesfor preserving traditional Indian foods in light weight flexible packages so that pack rations couldbe designed based on such items to meet the nutritional requirements of the Defence personnel foroperational situations and this has also paved the way for providing variety of foods suiting to theirtaste. These efforts led to the development of convenience foods based on cereals, pulses, fruits andvegetables with a long shelf-life in flexible packs.1

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceFruit and vegetable technologiesThe Indian Army operates on hazardous terrain inclusive of Siachen Glacier and the sandy desertsof Rajasthan. Similarly, the Indian Navy is a blue water navy and the operations go deeper in theoceans to protect the maritime zones used for international shipping. The concept of fruit and vegetablestorage as such has undergone a change and the troops favors precut fruits and vegetables in packagedform on operational rations due to the logistic utility and convenience. Therefore, minimal processingof precut fruits and vegetables needs to be emphasized and the unit packages can be formulated as perthe ration scales and logistic requirements.The futuristic technologies encompass non-thermal processing i.e. high pressure processing andpulsed electric field applications. Eco-friendly and energy saving technologies are envisaged to occupytheir rightful place in the area of fruit and vegetable products. Use of biodegradable packaging forfresh and processed fruits and vegetables is a certainty and an absolute necessity. It is a common siteto notice heavy accumulation of wastage and spent packaging material even in partially inhabitatedareas including the high altitude locations. Use of biodegradable plastics and other materials of organicor inorganic origin need to be stressed upon to minimize the pollution hazards in the army locationsas well as the high seas of naval operations.Minimal processing of fruits and vegetablesSupply of fruits and vegetables in precut and packaged form is a challenging task as the precuttingoperations impose severe physiological stress on the commodity. Minimal processing of fruits andvegetables had been contemplated as a ‘bridge technology’, touching technologies concerned withpost harvest handling of fresh produce on one side and conventional process technologies on theother side. It is well accepted notion that minimally processed products can be defined as ‘lightlyprocessed’ products. This does not describe either the living or non living nature of the plant tissue. Inother words, it enlarges the horizons of minimally processed products giving scope for use of minutethermal treatments and also application of anti-metabolic substances. As such the emphasis is on‘fresh like’ sensory attributes of the products and any minimal process strategy shall keep the same asthe main objective.Microbiological aspectsMinimally processed fruits and vegetables encounter incidence of enhanced microbial attacks dueto the elimination of natural barriers of the plant tissue and enhanced accessibility to moisture andnutrition on the surface of the plant tissue. A number of contaminating microorganism includingspoilage organisms and pathogens were isolated from precut fruits and vegetables. The minimallyprocessed products were successfully subjected to field trials in different Naval commands and thefield trials on zero energy cooling devices were successfully completed in the forward locations ofdesert areas in Rajasthan. Freezing of fruits and vegetables in whole or precut form is a major problemduring peak winters in high altitude locations such as Ladakh sector. Antifreeze containers with therated capacities of 30 and 80 kg were field evaluated in Ladakh sector and the feed back was highlyencouraging for the induction of the same in Armed Forces. As such, the time is ripe for considerationof supply of precut fruits and vegetables to Armed Forces in packaged form and the strategies of thetransport and storage are encompassed to make the supply chain flexible enough to be accommodatedin the existing infrastructure prevailing in the areas of army deployment.Ultra high pressure processingThe search for newer methods of food processing aims at processing of food without resortingto thermal processing. The concept of high pressure processing had emerged from the depth of theoceans as the sea beds are devoid of the usual microorganisms that one can find at sea level. Only afew microorganisms can survive under high pressure conditions and the lethality grows manifoldfrom 500 MPa onwards. Ultra high pressure processing is an innovative technological conceptunder the category of non thermal processing with minimal or no heat treatment. It is a process2

Novel and Emerging Food Technologies for Defence Food Suppliesaimed at controlling growth of microbial populations and also inactivation of quality deterioratingenzymes. High pressure processing involves instantaneous and uniform transmission of the pressurethroughout the product independent on the product volume. Upon reaching the desired pressurelevel, the pressure can be maintained without further inputs of energy. Liquid foods such as fruitjuices can be subjected to high pressure processing holding the required pressure for specific durationand decompressing for further aseptic filling as per the standard procedures of aseptic packaging.Apart from these aspects, high pressure processing can also be used for pressure shift freezing, highpressure thawing, texture modifications and enhancement of nutritive value of foods. High pressuresresult in the physical confirmation of biological entities such as proteins, resulting in positive changesin the bio-accessibility of nutrients.Infrared processing of cereals and pulsesThe infrared processing is also known as ‘micronising processes and is widely used for cookingcereals, oil seeds, pulses and also for the processing of cocoa. Micronisation is used for the developmentof different types of consumer foods, animal feeds inclusive of pet foods and several brewed products.It is one of the most flexible and efficient means of processing for the development of value addedproducts.Infrared radiation has wavelengths between 0.7 and 500 µm. Radiation with wavelengthsjust below 0.7 µm consists visible light, whereas radiation with wavelengths just above 500 µm ismicrowave radiation. Infrared radiation with shorter wavelengths transmits more thermal energy tofoods in shallow-bed radiators designed for in-depth processing. Such radiators are equipped withglass-encapsulated heaters operating at about 3,000 kW. Microniser consists of a long flat moving beltof approximately 5 meters in length onto which cereals (wheat, ragi, barley, soy, etc.) are fed at oneend. Above the belt and along its length are suspended gas burners which emit infrared energy onthe grains which is carried through the machine by the belt. Infrared energy is absorbed by the moistgrains, causing expansion of starch gelatinization. Extent of gelatinization depends upon magnitudeof infrared heat and the time the material takes to travel from one end to the other. The expandedgrain upon processing is subjected to flaking, cooling and subsequent packaging. Infrared processingimproves starch accessibility for easy digestion and the same could be attributed to opening up ofcrystalline starch structurally. Conventional cooking methods also improve the accessibility of starchfor digestion but the process may result in nutrient losses besides being a long duration process.Micronization is highly reliable and consistent “Short Time High Temperature Process” usinghumidity, temperature and mechanical pressure to achieve high levels of starch gelatinization andelimination of anti nutritional factors, without any significant loss in nutrient value. Infrared energymakes the starch soft and turgid, causing it to swell, fracture and gelatinize. Immediate rolling /flaking or secondary processing enhance the digestibility and nutritional value. The nutritive value orprotein quality of a food / feed protein depends not only on its content of amino-acids but also theirbio-availability. The products as such could be made ready-to-eat or instantized to suit the logisticrequirement of defence forces.Retort processing technologyRetort processing of foods in rigid, semi rigid and flexible packaging systems is the most acceptableform of food preservation. It represents a unique combination of product, process and packagetechnologies with potential, functional, quality and economical benefits. The increasing consumerawareness and inhibition/dislike to accept other methods of food preservation such as use of chemicalpreservatives, irradiation etc. has offered a vast scope for retort processed foods.Although retort pouch processing of foods is similar to conventional canning, it has certain majoradvantages like (i) Consumes less energy for processing (ii) enhances the quality attributes and (iii)reduces the cost of transportation and storage.Retort processing is generally carried out for low acid foods with a pH more than 4.5 at a temperatureof 121.1ºC using moist heat. During heat treatment, undesirable spoilage as well as pathogenic3

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancemicroorganisms is inactivated / killed and thereby the food products become commercially sterile.Thermal destruction of microorganisms is measured and monitored by time-temperature history,lethality and Fo-value.Despite distinct advantages, retort pouch processing of foods till recent years did not becomepopular in India as compared to countries like Japan mainly because of the high cost of processingequipment and non-availability of indigenous multi layer flexible packaging materials.DFRL, Mysore has been a pioneer in developing the retort processing technology indigenouslyin the country. Over the past two decades, research and development work has been carried outin developing multilayer flexible packaging materials as well as designing a simple low cost retort(semi-automatic and automatic) amenable to Indian food industry. Due to continuous efforts, DFRLhas so far successfully transferred the retort pouch processing technology to 40 firms for commercialexploitation.Functional foodsFunctional food is a three way concept wherein the (i) agricultural or animal origin serves asraw material, (ii) specific ingredients components of the products exerting functionality and (iii)physiological effects with respect to human system. Hence the balanced view of the three factors,with specific ingredient action, imparts the needful strategic effect. Thus functional food is a recentstrategic application in the food field and a driving force for the product development in this century.The functional foods viz. antioxidant rich herbal tea, squash, baked foods, anti-ulcerative fruit spread,low calorie squash for diabetics, fibre rich ash gourd juice, etc. are some of the recent developmentsmade in the field.Appetisers are another class of functional foods which improve the appetite. The physiologicalmechanism in brief is stimulation of trignomial nerves to increase the secretion of digestive juices.On the other hand, the hormone leptin formed at hypothalmous in the brain for the appetite controlincreases at high altitude stay; thereby satiety setting is signaled and results in lack of appetite. DFRLhas developed several appetisers for high altitudes which have proved its efficacy for the cause.In conclusion, the food technologies from the ancient to the advanced technologies adopted in thepresent, along with the emerging, promising technologies as well as the present day requirement offunctional foods have been reviewed in brief. Based on the raw materials i.e., fruits, vegetables, cereals,nuts, medicinal but natural herbs as well as the food requirements of the Defence Forces along withthe logistic convenience of longer shelf life, ease of transportation, DFRL has developed more than100 processed foods with varied technologies adopted. Packed rations with ready-to-eat products,emergency rations with calorie dense products, logistic based foods with functionality, energy densefood bars, functional food bars for low intensity conflicts, convenient processing machine such asautomatic chapathi making machine, automatic coconut processing system, on-line continuousblancher for vegetables, soy paneer making plant, etc. are the important contributions of DFRL forDefence Forces, besides the need based techniques and quick test kits for meat and processed foodswhich are adopted by them.4

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceFunctional foods for infant and weaning purposeIndia is among the nations with higher incidence of child malnutrition and deficiency diseases.According to an estimate more than 50% of children are born with low birth weight resulting instunted growth. Lack of key nutrients and bio-protective components in infancy led to prevalence ofanaemia and infectious disease among children. Mother’s milk is considered as perfect food of naturebut in many incidences maternal nursing is not possible and new born has to feed with infant formula.Infant formula is the best example of designer foods. Normal infant formulas are manufacturedfrom cow’s milk, but this requires substantial alteration to parallel the composition of breast milk.These modifications include reduction in protein and minerals, an increase in carbohydrates and theaddition of vitamins and trace elements. In recent years, studies have indicated that infants may havean impaired ability of synthesizing taurine and carnitine, and a dietary source is therefore required.Carnitine is necessary for the transportation of long chain fatty acids into cell for the β-oxidation andenergy production. Fatty acid profile of different fat sources do not meet the complexity of maturebreast milk, therefore mixture of different fat sources is preferred. Most manufacturers use a mixtureof vegetable oils (Simmer, 2000). The fat source must also provide the essential fatty acids linoleic(C18:2, ω-6) and α-linolenic acid (C18:3, ω-3). A ratio of 5:1 of ω-6:ω-3, as occurs in breast milk, isbeing suggested. Short chain as well as medium chain fatty acids should also be present in sufficientquantities as they are easy to absorb and assimilate. However there is a need for more short-andlong-term studies before the optimum ratio and its effects on growth are evaluated. Linoleic acid andα-linolenic acid are the precursors of the very-long-chain (C20 - C22), polyunsaturated fatty acids(LCPUFA): Arachidonic and docosahexaenoic acid (DHA). LCPUFA are involved in the neural andvascular development of the fetus and neonates and are present in human milk.Nucleotides, a component of non-protein nitrogen in human milk, may be important for normalimmune function. Supplementation of infant formula with nucleotides seems to be beneficial inclinical trials, although further research is needed before routine nucleotide supplementation of infantformula can be considered. The success of commercially prepared infant formulas has stimulated thedevelopment of numerous formulations and several hundred varieties of proprietary infant formulasare now available throughout the world. In addition, special formulas for use in clinical situations orfor premature infants or for infants with special inborn errors of metabolism are available as specialdietary foods.The GI tract of infant is dominated by Bifidobacteria which provides health promoting andprotective properties such as activation of immune system, inhibition of pathogens by the secretion ofsubstances which are directly inhibitory towards several bacteria, lowering of pH by the production ofacids such as acetate and lactic acid, leading to an antibacterial environment, production of digestiveenzymes such as casein phosphatase and lysozyme and production of vitamins. For these reasons itseems desirable to also increase the numbers of Bifidobacteria in the intestinal flora of formula-fedinfants. Administration of prebiotic oligosaccharides and probiotic supplements appear to be the mosteffective way to increase the number of the Bifidobacteria in the intestine. Human milk oligosaccharidesare mainly responsible for Bifidogenic effects of breast milk. Several commercial formulations havebeen developed with the view of providing a predominance of Bifidobacteria in the intestinal floraformula-fed infants. However the inclusion of such unconventional ingredients in formulation ofinfant formula needs long-term investigations before being approved.Inadequate nutrition during first 2-3 years often leads to problems associated with malnutrition inseveral developing nations in the world. Complementary nutrition is must for the normal and healthygrowth of a child after the age of 6 months, owing to increased requirement of nutrition in additionto those provided by breast milk. Moreover the food preparations consumed as weaning foods donot contain adequate nutrients desired for children. Traditional infant-feeding practiced, in countrieslike India, is usually cereal based. For the preparation of such foods grains are often germinated,6

An Overview of Designer Functional and Health Foodsfermented, processed and cooked in various ways to improve digestibility, and mixed with oilseeds oranimal products to enhance their nutritional profile, however most of these complementary foods arereported to be less energy dense and less safer for children because of the higher proportion of antinutrients.Cereals in combination with milk solids are generally used for the preparation of weaningfoods. Milk-Cereal-millet based complementary foods appear to be unique in the sense that they candeliver multitude of nutrients to children and complement each other as well. The correct form ofincorporation, effective concentration and required technological inputs determine the effectivenessof the resulted complementary food. Such products could be an attractive option for mass childrenfeeding programmes.Specialized foods with plant bioactiveNutritional significance of plant molecules is well documented and increasing cases of cancers,coronary heart diseases, diabetes and many other chronic diseases, have been attributed to underconsumption of fruits and vegetables in our diet. But beyond these known nutrients i.e. vitamins,fibers, plants have clearly more to offer and scientists are scurrying to discover exactly which plantcomponents might fend off specific diseases. An ever-expanding array of previously unknown plantmolecules with hard to pronounce names are being uncovered. But there exact metabolic role and howthese can be utilized in designer food, need to be clarified.The number of identified physiologically has increased dramatically in the last decades andoverwhelming evidence from epidemiological, in vivo, in vitro and clinical trial indicate that plant richdiet can reduce the risk of certain chronic diseases (Hasler, 2000) Health professionals are graduallyrecognizing the role of phytochemicals in health improvement. The major mechanism associated withtherapeutic aspects of plant bioactive is their ability to act as antioxidants.There are certain other compounds present in plant foods, with significant health promoting effectinclude plant fatty acids, tocotrienols, phenolic derivatives and dietary fibers etc. Docosahexaenoicacid (DHA), which is one of the most important structural component of brain and retina, and de-novosynthesis of this compound, is very rare. The decline in DHA intake could have serious implications forpublic health, since low plasma, DHA concentrations have been correlated with increased incidence ofnumber of important chronic diseases such as depression, attention deficit disorders and Alzheimer’sdementia. Crypthecodinium cohmii strain of marine algae is used for the commercial production of DHArich oil. Spirulina, termed as wonder alga is one of riches source of omeg-3-fatty acids, quality proteinand many other therapeutic molecules.Plant polyphenols are secondary metabolites widely distributed in higher plants. Polyphenolshistorically have been considered as anti-nutrients by nutritionists, because some, eg. tannins havesuch adverse effects as decreasing the activities of digestive enzymes, energy, protein and amino acidavailabilities, mineral uptake and having other toxic effects. Recognition of the antioxidant activitiesof many polyphenols has realigned thinking toward the health benefits provided by many of thesecompounds. Phytoestrogens are a broad group of plant-derived compounds that are structuralmimics of endogenous 17 beta-estradiol. Two major phytoestrogens, which are of great importancefrom nutritional and health perspectives, include lignans (Flaxseed) and isoflavones (soy bean).These compounds either compete with or antagonize estrdiol action. Exact biochemical mechanisminvolving CYP3A monoxygenase activity in presence of phase I enzyme inducers such as dixamethane.Phytosterols are another important terpene subclass. Two sterol molecules that are synthesized byplants are β - sitosterol and its glycoside. In animals, these two molecules exhibit anti-inflammatory,anti-neoplastic, anti-pyretic and immune-modulating activity. In the body, phytosterols can competewith cholesterol in the intestine for uptake, and aid in the elimination of cholesterol from the body.Saturated phytosterols appear to be more effective than unsaturated ones in decreasing cholesterolconcentrations in the body. Certain designer foods like phytosterol containing yoghurt, β-glucan richdairy drink, DHA containing infant foods etc. have already reach to the stage of commercialization.7

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceMilk proteins and peptides based nutraceuticalsDietary proteins possess nutritional, functional and biological properties, and the technologicalprocesses used in food manufacture and processing often affect these properties. The role of proteinsas physiologically active components in the diet has been increasingly acknowledged in recent years.Such proteins or their precursors may occur naturally in raw food materials, exerting their physiologicalaction directly or upon enzymatic hydrolysis in vitro or in vivo. Several dietary proteins, can act as asource of biologically active peptides. These peptides inactive within remain the parent protein, andreleased during gastrointestinal digestion or food processing. Once liberated, the bioactive peptidesmay provide different functions in vitro or in vivo.Bioactive peptides have to be released from the parent protein by enzymatic hydrolysis. Thiscan be achieved by the use of isolated enzymes, as well by microbial fermentation. Biologicallyactive peptides are of particular interest for pharma industry because they have been shown to playdifferent physiological roles, including opioid like activity, antimicrobial, immunomodulatory andantihypertensive. Such peptides can be released during hydrolysis by digestive or microbial enzymes.Microbial enzymes from lactic acid bacteria have demonstrated to be able to liberate theses peptidesfrom milk proteins, in various fermented milk products.Upon oral administration bioactive peptides may affect the major body systems- namely thecardiovascular, digestive, immune and nervous systems. For this reason, the potential of certainpeptides sequences to reduce the risk of chronic diseases or boost natural immune protection hasaroused a lot of scientific interest over the past few years. These beneficial health effects may beattributed to known peptide sequences exhibiting, e.g., antimicrobial, antioxidative, antithrombotic,antihypertensive and immunomodulatory activities. Milk proteins are considered the most importantsource of bioactive peptides and an increasing number of bioactive peptides have been identified inmilk protein hydrolysates and fermented dairy products.Over the last few years a number of investigations have been carried out across the world toelucidate the bioactivity of milk proteins and derivatives. These components may be either serve asfunctional ingredients in development of functional foods or can be utilized by pharma industry asnutraceuticals. Most of the claimed physiological properties of milk proteins and derivatives havebeen carried out in in-vitro or animal models, these hypothesized properties remains to be proven inhumans. Whey proteins are becoming an important constituent in the recipe of wide range of functionaland health foods because of the unique amino acid composition and bioactivity. Whey proteins basedcommercially available food products include sports supplements, low fat dairy desserts, medicalfoods, infant formulations and geriatric foods. Antihypertensive bioactive peptides may be utilized indevelopment of mood drinks and also foods for cardiac patients.Other prospective designer foodsBeverages are another range of products that offer tremendous market potential for Indian foodindustry because of being nutritionally-rich. Similarly, minor cereals and millets based milk beveragesseem to be lucrative products for school feeding programmes. Liquid milk fortification with vitamins Aand/D is mandatory in several countries. However, the milk fortification usually impaired its sensoryand processing quality characteristics. Moreover, bio-availability of fortified nutrients is another majorconcern. Investigations carried out at NDRI suggest possibilities of fortification of liquid milk withcalcium and iron. Beverages and soups based on whey continue to receive a considerable amountof attention nowadays. These indicate the growing awareness among consumers and manufacturersalike for the enormous potential these offered for diversifying product profile. Other designer foodsinclude low calories/low fat variants, low sodium foods and fun foods etc.ConclusionConsumer interest in the relationship between diet and health has increased the demand forinformation on functional foods. Rapid advances in science and technology, increasing healthcare8

An Overview of Designer Functional and Health Foodscosts, changes in food laws affecting label and product claims, an aging population, and rising interestin attaining wellness through diet are among the factors fueling interest in functional foods. Crediblescientific research indicates many potential health benefits from milk components.ReferencesFinley, J.W. 2005. Proposed criteria for assessing the efficacy of cancer reduction by plant foods enriched in carotenoids,glucosinolates, polyphenols and selenocompounds. Annals of Botany, 95:1075-1096 pp.Hasler, C.M. 1998. Functional Foods: Their role in disease prevention and health promotion. Food Technology 52(11),63-70 ppHasler, C.M. 2000. The changing face of functional foods. Journal of American College of Nutrition 19 (5), 499S-506S pp.Hirayama, M. 2002. Novel physiological functions of oligosaccharides. Pure Appl. Chem. 74 (7) 1271-1279 ppShah, N. P. 2000. Probiotic Bacteria: Slective Enumeration and survival in dairy foods. J. Dairy Science, 88:894-907Simmer, K. 2000 a. Long-chain polyunsaturated fatty acid supplementation in preterm infants. Cochrane Database Syst.Rev., -HD-(2): CD 000375 2000.Wollowski, I. 2001. Protective role of probiotics and prebiotics in colon cancer. Am. J. Clin. Nutrition: 73 (Suppl):451S-5S9

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIntroduction:Prospects of Value Addition ThroughFunctional IngredientsG. R. PatilDairy Technology Division, NDRI, KarnalIn recent years, there has been a vast and rapidly growing body of scientific data showing thatdiet plays an important part in diseases. Diet is thought to contribute to six of the 10 leading causes ofdeath. Nutrients and nonnutritive food components have been associated with the prevention and/or treatment of chronic diseases such as cancer, coronary heart disease, diabetes, hypertension, andosteoporosis. Up to 70% of certain cancers may be attributed to diet. As the data supporting the roleof diet in health promotion and disease prevention continue to mount, it is likely that the quantity ofenhanced foods will expand substantially. There is an increasing demand by consumers for qualityof life, which is fueling the functional foods revolution. Functional foods are viewed as one optionavailable for seeking cost-effective health care and improved health status. Moreover, the large babyboomersegment of the population is aging and considerable health care budget in most country isfocused on treatment rather than prevention. Thus, the use of nutraceuticals in daily diets can be seenas means to reduce escalating health care costs that will contribute not only to a longer lifespan, butalso more importantly, to a longer health span. Development of functional food products will continueto grow throughout the 21 st century as consumer demand for healthful products grows.The exploding area of functional foods and probiotics shows considerable promise to expandthe industry into new arenas. Both convenience and better for you attitudes are selling. Consumersclearly believe in the concept of functional nutrition, or specific association between foods/nutrientsand health functions. They are interested in foods that boost the immure system, reduce the risk ofdisease and enhance health, which consumers self-prescribe for themselves and their families. Hence,there are clear opportunities to offer consumers dietary alternatives to medical solutions. Theseopportunities, however, will be highly consumer driven and success will ultimately be dependentupon defining your segment and knowing your target group.The markets of traditional dairy products are increasingly getting overcrowded and our futuresuccess will depend on our ability to provide innovative products, which consumers want and need.Whatever the innovation - products, processing method or packaging - it should meet the real consumerneed. We know today’s families want “grab-and-go” convenience. They are also concerned aboutnutrition and health. Different ages and demographics want different things. Therefore, investment atthis level is essential if we are to respond rapidly to customers who are increasingly demanding new anddifferent taste experiences from products that are also competitively priced. Thanks to advancementsin technology, researchers have shown that specific components of milk, as well as ingredients canbe readily added to dairy products, which contribute to health and wellness, and assist consumerswith feeling balanced and satisfied. There is a golden opportunity for dairy marketers to formulateinnovative products to meet consumers’ needs and to effectively market the product’s value. Newvariants of sweets can be developed. Dairy products containing health-promoting ingredients may bedeveloped and promoted. Host of ingredients with health benefits are available for value addition ofdairy products. Some of these issues are discussed hereunder.Functional ingredients for value additionFunctional nutrition is a broad topic, and covers many ingredient categories. The functionalcomponents used in formulation of these formulated foods are given in Table 1.10

Prospects of Value Addition Through Functional IngredientsTable 1: Examples of Functional Ingredients*Class/ Ingredients Source* Potential BenefitCarotenoidsBeta-carotene carrots, various fruits neutralizes free radicals which maydamage cells; bolsters cellularantioxidant defensesLutein, Zeaxanthinkale, collards, spinach, corn, eggs,citrusmay contribute to maintenance ofhealthy visionLycopenetomatoes and processed tomatoproductsmay contribute to maintenance ofprostate healthDietary (functional and total) FiberInsoluble fi ber wheat bran may contribute to maintenance of ahealthy digestive tractBeta glucan oat bran, rolled oats, oat fl our may reduce risk of coronary heartdisease (CHD)Soluble fi ber psyllium seed husk may reduce risk of CHDWhole grains cereal grains may reduce risk of CHD and cancer;may contribute to maintenance ofhealthy blood glucose levelsFatty AcidsMonounsaturated fatty acids(MUFAs)tree nutsmay reduce risk of CHDPolyunsaturated fatty acids (PUFAs)- Omega-3 fatty acids—ALAPUFAs - Omega-3 fatty acids—DHA/EPAPUFAs - Conjugated linoleic acid(CLA)walnuts, fl axsalmon, tuna, marine and other fi shoilsbeef and lamb; some cheesemay contribute to maintenance ofmental and visual functionmay reduce risk of CHD; maycontribute to maintenance of mentaland visual functionmay contribute to maintenance ofdesirable body composition andhealthy immune functionFlavonoidsAnthocyanidins berries, cherries, red grapes bolster cellular antioxidant defenses;may contribute to maintenance ofbrain functionFlavanols—Catechins, Epicatechins,Procyanidinstea, cocoa, chocolate, apples,grapesmay contribute to maintenance ofheart healthFlavanones citrus foods neutralize free radicals which maydamage cells; bolster cellularantioxidant defensesFlavonols onions, apples, tea, broccoli neutralize free radicals which maydamage cells; bolster cellularantioxidant defensesProanthocyanidinsIsothiocyanatesSulforaphanePhenolsCaffeic acid, Ferulic acidcranberries, cocoa, apples,strawberries, grapes, wine, peanuts,cinnamoncaulifl ower, broccoli, broccoli sprouts,cabbage, kale, horseradishapples, pears, citrus fruits, somevegetablesmay contribute to maintenance ofurinary tract health and heart healthmay enhance detoxifi cation ofundesirable compounds and bolstercellular antioxidant defensesmay bolster cellular antioxidantdefenses; may contribute tomaintenance of healthy vision andheart health11

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceClass/ Ingredients Source* Potential BenefitPlant Stanols/SterolsFree Stanols/Sterolscorn, soy, wheat, wood oils, fortifi ed may reduce risk of CHDfoods and beveragesStanol/Sterol estersfortifi ed table spreads, stanol ester may reduce risk of CHDdietary supplementsPolyolsSugar alcohols—xylitol, sorbitol,mannitol, lactitolInulin, Fructo-oligosaccharides(FOS), PolydextroseLactobacilli, Bifi dobacteria12some chewing gums and other foodapplicationsPrebiotic/Probioticswhole grains, onions, some fruits,garlic, honey, leeks, fortifi ed foodsand beveragesyogurt, other dairy and non-dairyapplicationsmay reduce risk of dental cariesmay improve gastrointestinal health;may improve calcium absorptionmay improve gastrointestinal healthand systemic immunityPhytoestrogensIsofl avones—Daidzein, Genistein soybeans and soy-based foods may contribute to maintenanceof bone health, healthy brain andimmune function; for women,maintenance of menopausal healthLignans fl ax, rye, some vegetables may contribute to maintenance ofheart health and healthy immunefunctionSoy ProteinSoy Protein soybeans and soy-based foods may reduce risk of CHDSulfi des/ThiolsDiallyl sulfi de, Allyl methyl trisulfi de garlic, onions, leeks, scallions may enhance detoxifi cation ofundesirable compounds; maycontribute to maintenance of hearthealth and healthy immune functionDithiolthiones cruciferous vegetables contribute to maintenance of healthyimmune functionSource: IIFC (2004)Examples are not an all-inclusive list.Several functional dairy products can be developed using either single or combination ofingredients given in the table targeting specific health benefits. Besides these functional ingredients,which are mostly obtained from plant source, there are other ingredients such as fat replacers, artificialsweeteners, micronutrients like vitamins and minerals, which can be used for value addition.3.0 What are the possibilities?Innovative milk beverages:Recently, a whole new generation of beverages containing milk and dairy ingredient are emerging.Thanks to new technologies, including processes and ingredients, such dairy based beverages not onlyoffer a wider range of flavour, texture and other sensory properties than are current present but alsoprovides new marketing opportunities for these products in the healthy/ neutraceutical/ bioactivefoods category foods today’s consumer’s want. Some of the ingredients highlighted above, along withother ingredients that are currently used or can be used for development of such beverages. Dairymanufacturers can develop a signature formula to appeal to specific market segments.Select European countries use whey as a base for nutritional, fruity dairy-based beverages. A refreshingbeverage made from fermented milk and whey and containing fruit juice, or a probiotic beverage fromwhey and fruit juice that is fortified with vitamins and calcium are being marketed in these countries.NDRI has also recently developed formulations from whey such as whey-jaljeera beverage, whey-baelbeverage, and whey –mango beverage, which are available for commercial exploitation.

Prospects of Value Addition Through Functional IngredientsProbiotic dairy products:“Probiotic, food products in generals and “probiotic “ organism in particular are in the center ofcurrent R & D activities all over the world. “Functional foods” segment that is registering a steadyand consistent growth at present, among processed food products, gathered the momentum primarilyfrom the scientific investigations based on “probiotic” food products. A probiotic is a mono-or mixedculture of live microorganisms which benefits man or animals by improving the properties of theindigenous microflora. Viable counts delivered to the gastrointestinal tract are key to the functionalityof probiotics. The consumption of probiotic culture positively affect the composition of this microfloraor extends a range of host benefits including.1. Pathogen interference, exclusion and antagonism.2. Immunostimulation and immunomodulation.3. Anticarcinogenic or antimutagenic activities.4. Alleviation of symptoms of lactose intolerance.5. Reductiion in serum cholesterols.6. Reduction in blood pressures.7. Decreased incidence & duration of diarrhoea.8. Prevention of vaginitis.9. Maintenance of mucosal integrity.Industrial interest in developing probiotics and probiotic functional foods is thriving, drivenlargely by the market potential for foods that target general health or well being. NDRI has madesome progress in this area by developing probiotic dahi, lassi and probiotic cheese. There is possibilityof developing other milk based fermented traditional dairy products such as probiotic shrikand andRabadi – a milk-cereal based fermented product.Fat-replacement in dairy products:High fat consumption has been linked to several chronic diseases including cardiovascular diseases,obesity and certain forms of cancer. Nutrition experts recommend a total fat intake of less than 30 percent of total daily calories. These dietary recommendations are one reason for the increasing demandfor lower fat food products of the world market has been flooded with the food products carrying thelabels “low fat”, ‘no fat’ or ‘reduced fat’. Fat mimics or fat substitutes are normally used to producelow-fat foods, fat mimics are substances that help replace the mouthfeel of fat but can not substitutefor fat on a gram for gram basis and can not be used for applications involving frying. Substanceswhose physical or thermal properties resemble fat are termed as fat substitutes and can replace fat ona gram-for gram basis and can also be used for frying applications.Categories of fat replacersFat mimicsFat replacersProtein based Carbohydrate based -Emulsifiers-Medium chain triacylglycerols.- whey protein conc. - Starches -Structural lipids.- Microparticulated protein - Maltodextrins -Acaloric synthetic compounds.- Polydextrose * fatty alcohol esters of alkylmalonic or malonic acid.* esterified propoxylated glycerols* trialkoxy tricarballylate* poly carboxylic acid.* Sucrose polyestersLow-fat cheese, processed cheese, cultured products, frozen desserts, butters and spreads havebeen successfully developed using commercially available fat mimics/replacers. Using similartechnique several low fat varieties of traditional dairy products can be developed. An attempt hasbeen made to develop low fat burfi at this institute.13

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceDairy products for providing satiety:There are a few dairy products currently in the marketplace, which claim to provide satiety. Thisis an opportunity dairy product manufacturers need to tap into, too. Satiety is the state of being fullor gratified to the point of satisfaction. Scientific studies indicate that satiety is dependant on not onlyhow much food you eat, but what type of food you eat as well. Satiety is being addressed on food labelswith synonymous terms such as “hearty” and “controls or reduces hunger.” Unabsorbed nutrients inthe ileum, which is the final section of the small intestine, inhibit gastric emptying, providing a senseof satiety. Fat, in particular, penetrates the ileum when a person has eaten too much for the body toprocess. When this happens the ileum triggers a “full” message to the brain. That full message is theresult of the secretion of cholecystokinin (CCK), a peptide hormone of the gastrointestinal systemresponsible for stimulating the digestion of fat and protein. It is secreted by the duodenum, the firstsegment of the small intestine, and causes the release of digestive enzymes and bile from the pancreasand gall bladder, respectively.A satiety ingredient concept is available to dairy foods manufacturers. A patented combination ofoat and palm oils has been formulated into a novel emulsion with the oat oil extract containing a largequantity of polar lipids that coat the palm oil droplets. This coating prevents digestion of the palm oilin the stomach until it reaches the ileum.Fiber ingredient suppliers, too, are touting some of their products for satiety value. For example,research shows consumers on diets supplemented with inulin and oligofructose report higher levelsof satiety, longer feelings of fullness and lower calorie intake, which can all assist with weight loss.Research also shows that foods high in fiber and protein slow digestion and extend the release of CCK.With knowledge of this relationship between fiber, protein and satiety, several convenient, nutritiousand delicious products can be created for obese people, which can help them feel full and thus preventunhealthful snacking between meals.A heart-healthy opportunityWith the functional food market abuzz about the heart-health benefits of plant sterols, dairy foodsformulators have excellent opportunity to develop variety of dairy products with heart healthy benefit.Plant sterols can help lower serum low-density lipoprotein (LDL)—or bad—cholesterol levels, whichare well recognized as impacting heart disease risk. Eating foods low in saturated fat and cholesteroland high in sterols can reduce LDL cholesterol by 20%. Plant sterols provide an effective, dietarymethod for countering elevated cholesterol, a crisis facing millions of Indians.Plant sterols are relatively easy to formulate into existing dairy applications, and sterols areavailable in different forms to aid in the ease of processing.Likewise, plant sterols can be used in virtually any dairy application. If included in the amountsspecified for health claim, plant sterols also enhance a finished dairy product’s nutritional profilewithout altering its flavor or texture. The qualified claim states that foods containing at least 0.4g perserving of plant sterols, eaten twice a day with meals for a daily total intake of at least 0.8g, as part ofa diet low in saturated fat and cholesterol, may reduce the risk of heart disease.Arjuna Ghee: Arjuna ghee, with functionalities like resistance against heart diseases and bloodpressure regulating properties was developed at this institute. The developed ghee was foundsensorily similar to the market ghee. It had overall acceptability score of 85.1 compared to the control(90.84). The Arjuna ghee was found to be 4 times more stable to oxidative deterioration as compared tocontrol ghee. This is due to the fact that Arjuna extract contains several antioxidants like polyphenols,terpenoids in addition to phytosterol, which are beneficial in case of Cardio-vascular Diseases (CVD),high blood pressure and to boost up our immune system.Dietetic dairy productsThe dairy industry has responded to the growing needs of health conscious consumers for lowcaloriefoods. Consequently, a large number of dairy products made with low-calorie and nonnutritive14

Prospects of Value Addition Through Functional Ingredientssweeteners have been witnessed in the market. Low calorie sweeteners have become sugar alternativesto replace sucrose in a wide variety of dairy products. Kumar (2000) developed a low calorie lassi byusing aspartame and reported that aspartame at a level of 0.08% was required to replace 15% of canesugar in lassi.The technology for the production of rasogolla, the most popular channa based Indian sweetmeat,was developed by Jayaprakash (2003) using sorbitol (40%) and aspartame (0.08%). Chetana, et al.(2004) developed gulabjamun, a popular khoa based sweet, using sorbitol. Burfi, another khoa basedsweet delicacy was developed by completely replacing sugar using acesulfame-K (Yarrakula, 2006),aspartame (Muralidhar, 2006), saccharin (Narendra, 2006), sucralose (Singh, 2006), and sucraloseand bulking agents (Prabha, 2006). Kalakand and flavored milk were developed using acesulfame-K(Yarrakula, 2006), aspartame (Muralidhar, 2006), saccharin (Narendra, 2006), and sucralose (Singh,2006). The Indian counterpart for ice cream, kulfi was developed by Pandit (2004) using sorbitol(5.5%), maltodextrin (4.26%) and aspartame (742 ppm).Dairy products fortified with dietary fiberMilk and most dairy products are devoid of dietary fiber. With the growing interest in dietary fiberand its health benefits, dairy industry has geared up for fortifying the dairy products with fiber.Yogurt is one of the dairy products whose sales continues to increase due to diversification inthe range of yogurt-like products including reduced fat content yogurts, yogurt shakes, drinkableyogurts, yogurt mousse, yogurt ice cream, etc. (Fiszman and Salvador, 1999).In India, there are few traditional dairy products that contain significant quantities of fiber e.g.,Gajar-pak (carrot halwa), Giya-ka-halwa (bottle gourd halwa), Doda-burfi, and Kaju-burfi. Traditionallymade cereals-based milk desserts like kheer and dalia-dessert are other dairy food sources of dietaryfiber in Indian diets (Patel and Arora, 2005). Recently, dahi (Chandrakant, 2002), lassi and other dairyproducts have been fortified with fruits and commercial dietary fibers to give the benefits of dietaryfiber. Kantha (2005) developed a low fat paneer using soy fiber and inulin and reported that milk with2.5% fat and 0.56% soy fiber or 1.8% fat and 4.5% inulin yielded a paneer similar to that prepared fromfull cream milk (6% fat) in respect to sensory quality. Amul has launched a new variety of isabgolenrichedice cream. Isabgol is the seed derived from Plantago ovata. Being a ‘true dietary fibre’, theisabgol husk is considered to be a natural laxative that aids easy bowel movement. Besides it is alsoknown to possess serum cholesterol reducing properties (Mann and Singh, 2005)Targeting a successful product launchIn order to launch the product successfully in the market it is necessary to look in to followingpoints:• Identifying where the gaps are in a specific market--what the new/unmet consumer needs are.• Developing product concepts and consumer value propositions to fill the gaps.• Prper ingredient selection, formulating prototypes and evaluating product concepts at an inhousepilot plant.Fundamentally the product needs to pass the taste test. If it does not taste good, it is not possibleto get that repeat buy from consumer. Any product that has been developed by hitting a bull’s eye ineach one of these areas (health and wellness, simplicity and taste) will certainly have a stronger chancefor a successful product launch.What are the prospects for functional foods in india?Population growth, rising incomes, increasing awareness on health, urbanization, lifestyle changes(“on-the-go” eating) and growing organized retailing are contributing to the potential for functionalfoods. Just as for processed foods in general, India will be the largest potential markets for functionalfoods with their GDP growth, demographics and burgeoning consumption.15

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceThanks to the growing acceptance of functional foods, India could hope to leverage the country’skey resources in this area to gain a foothold in the global market. Functional foods are among theNew Age drugs that are being developed to provide better health. Functional foods are gaining publicacceptance in many developed countries in recent times. Looking at the changing trends, the marketof functional foods has huge potential. These days, industries are showing interest in the functionalfoods area. Within few years this potential can turn into a healthy growing market.The ingredients used in health/functional foods are mainly plant-based products and most of thembeing predominantly herbal. Hence clues to these functional ingredients could be got from our ancientand traditional systems of medicine like Ayurveda, Siddha and Unani. The ‘Rasayan’ and ‘Vajikarna’therapeutics of Ayurveda are essentially nutraceuticals and therefore there is ample scope for India todevelop a range of health food products. And to succeed, these products have to be standardized andwith scientific validation to ensure safety and efficacy so as to instill confidence in the customers touse them not as an alternative medicine but as a well defined system of medicine. For this to happen,there has to be research carried out on these products. Thus India’s own traditional knowledge basegathered from Unani, Ayurveda and Siddha can help out in research work on nutraceuticals. And wecan take a lead on this from the western world.What are the key challenges for functional foods in india?In India, we have traditional products touted as functional but have little scientific validation.Regulations will thus have to evolve to weigh R&D, ensure validation and prevent exploitation ofconsumers. Companies will also have to be sincere and honest in their claims while marketing andcommunicating with consumers till appropriate regulations for scientific validation are evolved.Processors will need to provide an optimal merger between taste, convenience and health attributes.References:Chandrakant, P.N. (2002) Development of Technology for Fruit Dahi. M. Tech Thesis submitted to National DairyResearch Institute, Deemed University, Karnal.Chetana, R., Manohar, B. and Reddy S.R. (2004) Process optimization of Gulab Jamun, an Indian traditional sweet,using sugar substitutes. Eur. Food Res. Technol. 209:386 – 392Fiszman, S.M. and Salvador, A. (1999) Effect of gelatine on the texture of yoghurt and of acid-heat-induced milk gels.Z. Lebensm. Unters. Forsch. 208: 100 – 05.IIFC (2004) Background on functional foods. http://www.ific.org/nutrition/ functional/ upload/FuncFdsBackgrounder.pdfJayaprakash, K.T. (2003) Technological Studies on the Manufacture of Rasogulla Using Artificial Sweeteners. M. TechThesis submitted to National Dairy Research Institute, Deemed University, Karnal.Kantha, K.L. (2005) Enhancement of Sensory and Functional Properties of Low-fat Paneer Using Dietary Fibre. M. Tech.Thesis submitted to National Dairy Research Institute, Deemed University, Karnal.Kumar, M. (2000) Physico-chemical Characteristics of Low-Calorie Lassi and Flavoured Dairy Drink Using Fat Replacerand Artificial Sweetener. M. Tech Thesis submitted to National Dairy Research Institute, Deemed University,Karnal.Mann, R.S. and Singh, P.K. (2005) Specialty frozen products. In: lecture compendium of “Recent Developments inHealth Foods and Nutraceuticals” 18th Short Course organized by Centre of Advanced stuies in Dairy Technology,NDRI, Karnal, pp 127 – 132.Muralidhar, G.H. (2006) Determination of Aspartame and its Stability in Indigenous Dairy Products. M.Sc. Thesissubmitted to National Dairy Research Institute, Deemed University, Karnal.Narendra, K. (2006) Estimation and Stability of Saccharin in Indigenous Dairy Products. M.Sc. Thesis submitted toNational Dairy Research Institute, Deemed University, Karnal.Pandit, P. (2004) Technological Studies on manufacture of Kulfi using Artificial Sweeteners. M. Tech. Thesis submittedto National Dairy Research Institute, Deemed University, Karnal.Patel, A. A. and Arora, S.K. (2005) Fibre fortification of dairy products.Proceedings of the Seminar on Value AddedDairy Products held at NDRI, Karnal from Dec. 21 – 22, 2005.Prabha, S. (2006) Development of Technology for the Manufacture of Dietetic Burfi. Ph. D. Thesis submitted to NationalDairy Research Institute, Deemed University, Karnal.Singh, V.P. (2006) Analysis of Sucralose and its Stability in Indigenous Dairy Products. M.Sc. Thesis submitted toNational Dairy Research Institute, Deemed University, Karnal.Yarrakula, S. (2006) Analysis of Acesulfame-K and its Stability in Indigenous Dairy Products. M.Sc. Thesis submitted toNational Dairy Research Institute, Deemed University, Karnal.16

IntroductionTechnological and Nutritional Aspects of Milk PhospholipidsTechnological and NutritionalAspects of Milk PhospholipidsB. K. Wadhwa and Rajesh KumarDairy Chemistry Division, NDRI, KarnalMilk fat in the lactating cow is secreted as myriads of lipid droplets of size 0.1 to 15 µm. Thesemicro lipid droplets are encircled by a special membrane composed of lipid bilayer and proteins.This membrane has been designated the milk fat/ lipid globule membrane (MFGM). Milk fat globulemembrane is composed of proteins and lipids in a 1:1 weight ratio. Bovine MFGM is a potentialnutraceutical. The health beneficial factors are contributed by both protein and non protein componentsof bovine MFGM. Among the health-beneficial components of the MFGM are cholesterolemia-loweringfactor, inhibitors of cancer cell growth, vitamin binders, inhibitor of Helicobacter pylori, inhibitor of betaglucuronidaseof the intestinal Escherichia coli, xanthine oxidase as a bactericidal agent, butyrophilinas a possible suppressor of multiple sclerosis, and phospholipids as agents against colon cancer,gastrointestinal pathogens, Alzheimer’s disease, depression, and stress (Spitsberg, 2005).Sources of phospholipidsUntil recently commercially available phospholipids were predominantly made from vegetablelecithin, the by-products of vegetable oil refining. Phospholipids of animal origin were extracted fromegg yolk or from fish roe, but played less important role compared to the plant derived products,which mainly found applications as food additives.Bovine milk is a very new source for a commercialTable 1: Phospholipid profile (%)of different raw materialsSoya Egg Milk MarinePC 23 73 27 82PE 22 18 22 04PI 14 2 08 03PA 7 - - -PS Traces - 12 01SPM - 3 27 02Glycolipids 12 - 07 -Table 2: Fatty acid profile (%) of phospholipidsfrom different raw materialsSoya Egg Milk MarineSaturated 22 41 50 17Mono-unsaturated 12 35 35 21Poly-unsaturated 66 24 15 62production of phospholipids as milk fat globule membranephospholipids are very unique in terms of phospholipidcomposition and application profile (Schneider, 2007).Vegetable lecithin is a complex mixture of phospho- andglycolipids, some carbohydrates and optionally triglycerides.Most animal lecithin does not contain glycolipids, norcarbohydrates. Vegetable oilseeds are solvent extracted toobtain the oil. Traces of phospholipids are co-extracted andneed to be removed during the refining process in order toimprove the oil for clarity and stability reasons. This is doneby the addition of small amounts of water; the phospholipidsstart swelling which makes them insoluble in oil. Mechanicalseparation and drying of the so-called wetgums finally gives vegetable lecithin. Toproduce egg and/or milk phospholipidsthe process is much more sophisticated.Especially in the case of milk, it is a multistep approach to separate them from themilk fat globule membrane - predominantlymilk processing technology, followed bysome solvent based steps. Concentrated orisolated phospholipids are made by solvent-based extraction or fractionation processes from lecithin,often followed by chromatographic purification steps. The qualitative and quantitative profileof phospholipids varies with the type of raw materials used (Table 1). Milk phospholipids containsphingomyelin whereas soya phospholipids do not contain sphingomyelin (Schneider, 2007). Also, thefatty acid profile of phospholipids from different raw materials is variable (Table 2). Milk phospholipidsare richer in saturated and MUFA but poorer in PUFA in comparison to soya phospholipids.17

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceProperties of phospholipidsThe molecular structure of phospholipids is bipolar and amphiphilic, means it combines a lipophilicpart (the fatty acid tails linked to the glycerol backbone) and a hydrophilic part (the polar head group, aphosphoric acid ester mostly of an amino alcohol like choline, ethanolamine, etc.).Technological applicationsTheir bipolar structure makes phospholipids excellent natural emulsifiers, widely used in foods,cosmetics and also pharmaceutical applications. The application properties of the food additive lecithinrelates to a great extent to their phospholipid content and profile. The most prominent applicationsare for margarine, chocolate, baked products, instant powders, etc. The cosmetic industry appreciatestheir emulsifying, skin friendly and moisturising properties; pharmaceuticals use them as emulsifiersfor intravenous fat emulsions, but also for complex drug delivery systems (Iiposome).Liposomes are versatile delivery systems, originally for pharmaceutical uses, but also widely usedin cosmetics. Liposomes are tiny, artificial cell-like structures, surrounded by either one (unilamellar)or many phospholipid double layers. Inside the vesicular structure, or between the differentphos¬pholipid membranes, water compartments are entrapped, carrying and protecting water-solubleactives. But also lipophilic payloads can be entrapped and protected from the environment inside thelipophilic domains of the phospholipid double layers.Nutritiona1 profile of phospholipidsBesides their widely used technological properties, phospholipids have a very Interestingnutritiona1 profile. Lots of clinical studies have shown• Cholesterol reducing properties ( soya phosphatidylcholine - PC)• Improvement of cognitive performance - stress symptom (soya phosphatidylserlne - PS)• Liver tissue detoxification and regeneration ( soya PC).• Egg phospholipids are used to supplement infant formulae because of their content of longchain polyunsaturated fatty acids (docosahexaenoic and arachidonic acid DHA and ARA).Milk polar lipidsAnother biologically interesting lipid group in milk fat is the polar lipids, which are mainlylocated in the milk fat globule membrane (MFGM). It is a highly complex biological structure thatsurrounds the fat globulestabilizing it in the continuous aqueous phase of milk and preventing it fromenzymatic degradation by lipases (Spitsberg, 2005 ). The membrane consists of about 60% proteins and40% lipids that are mainly composed of triglycerides, cholesterol, phospholipids, and sphingolipids.The polar lipid content of raw milk is reported to range between 9.4 and 35.5 mg per 100 g of milk.The major phospholipid fractions are phosphatidylethanolamine and phosphatidylcholine followedby smaller amounts of phosphatidylserine and phosphatidylinositol. The major sphingolipidfraction is sphingomyelin with smaller portions of ceramides and gangliosides. In processing milkinto different dairy products, the polar lipids are preferentially enriched in the aqueous phases likeskimmed milk, buttermilk and butter serum.The polar lipids in milk are gaining increasing interest due to their nutritional and technologicalproperties. These compounds are secondary messengers involved in transmembrane signaltransduction and regulation, growth, proliferation, differentiation, and apoptosis of cells. They alsoplay a role in neuronal signaling and are linked to age - related diseases, blood coagulation, immunity,and inflammatory responses. In particular, sphingolipids and their derivatives are considered highlybioactive components possessing anticancer, cholesterol - lowering, and antibacterial activities.Thesepromising results from cell culture and animal - model studies warrant further confirmation andhuman clinical studies but suggest that sphingolipid - rich foods or supplements could be beneficial inthe prevention of breast and colon cancers and bowel - related diseases (Korhonen, 2010).18

Technological and Nutritional Aspects of Milk PhospholipidsProperties of milk phospholipidsMilk phospholipids are different from all other commercial lecithin and phospholipid products,both in phospholipid pattern and fatty acid profile (Tables 1 and 2). Both differences make them veryattractive for a variety of new and innovative applications.Technological applications of milk phospholipidsBecause of the relatively high degree of saturated (50%) or mono-unsaturated fatty acids(approximately 35%) milk phospholipids are quite stable against oxidation and are• Very Important for food applications• Very stable against hydrolytic break-down in aqueous environments.• Hence, the taste and flavour profile is not negatively affected by liberated free fatty acids (aswith soya phospholipids which are richer in PUFA).• Milk phospholipids are versatile ingredients for functional cosmetics. They are excellentemulsifiers, creating a very good and soft skin feel, avoid trans-epidermal water loss and allowpreparing efficient Iiposomal systems with good entrapment stability.Milk phospholipids nowhave a clear advantage over all other phospholipids used so far for liposome production.• They are relatively stable against oxidation• They have a phase transition temperature of approximately 28°C, ideal for a lot of cosmetic andfood applications.• (The phase transition temperature is the temperature at which the membrane undergoestransition from an organized fatty acid region (a kind of crystalline structure) to an unorganizedone (a kind of liquid structure).• At ambient temperature milk phospholipids liposome membranes are crystalline with excellententrapment characteristics . At higher temperature they tend to release their payload – a simpleapproach to protect sensitive ingredients and to release them at targeted conditions (Schneider,2007).Preparation of liposomes from milk fat globule membrane phospholipidsusing a microfluidizerThe isolation of MFGM material from buttermilk on a commercial scale has provided a newingredient rich in phospholipids and sphingolipids. An MFGM-derived phospholipid fraction wasused to produce liposomes via a high-pressure homogenizer (Microfluidizer). This technique does notrequire the use of solvents or detergents, and is suitable for use in the food industry. The liposomedispersion had an average hydrodynamic diameter of 95 nm, with a broad particle-size distribution.Increasing the number of passes through the Microfluidizer, increasing the pressure, or reducingthe phospholipid concentration all resulted in a smaller average liposome diameter. Changing thesevariables did not have a significant effect on the polydispersity of the dispersion. Electron microscopyshowed that the dispersions formed had a range of structures, including unilamellar, multilamellar,and multivesicular liposomes. The composition of the MFGM phospholipid material is different fromthat of the phospholipids usually used for liposome production in the pharmaceutical and cosmeticindustries. The MFGM-derived fraction comprises approximately 25% sphingomyelin, and the fattyacids are primarily saturated and monounsaturated These differences are likely to affect the propertiesof the liposomes produced from the phospholipid material, and it may be possible to exploit the uniquecomposition of the MFGM phospholipid fraction in the delivery of bioactive ingredients in functionalfoods ( Thompson and Singh, 2006).19

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceNutritional applicationsPhospholipidsThe consumption of the MFGM alone as a nutraceutical or as a dairy food, or the consumption offood products enriched by the MFGM has health benefits due to the presence of phospholipids in theMFGM. Phospholipids of bovine MFGM constitute almost 30% of the total MFGM lipids. The threemain MFGM phospholipids are sphingomyelin, phosphatidyl choline, and phosphatidyl ethanolaminecomprising (weight %) 19.2 to 23.0, 25.7 to 41.1, and 27.0 to 35.0% of total MFGM phospholipids,respectively. Currently, it is considered that phospholipids, including milk-derived, affect numerouscell functions including growth and development, molecular transport systems, absorption processes,memory, stress responses, development of Alzheimer’s disease, and myelination in the central nervoussystem . Phospholipids also affect the development of colon cancer as discussed above (Spitsberg,2005).Phospholipids and glycosphingolipidsPhospholipids and glycosphingolipids accounts to about 1% of total milk lipids. They havefunctional roles in a number of reactions, such as binding enzymes on the globule surface, cellcellinteractions, differentiation, proliferation, immune recognition. Gangliosides are one of thesecomponents found in milk. The small amount of gangliosides (very complex neuraminic acid derivativesof a glycosylatcd ceramide) in milk polar lipid fractions has triggered interest to incorporate milkphospholipid compounds into infant formula products. Gangliosides have been confirmed as havingimmune stimulating effects and can modulate the binding of microbial toxins in the intestinal tract( Haug, 2007).SphingomyelinSphingomyelin (N-acylsphingosine-l phosphocho line or ceramide phosphocholine) is a phospholipid preferentially located in the outer leaflet of the plasma membrane of most mammalian cells. Inbovine milk, phospholipids account for 0.2-1.0 g/l00 g of total lipids, where they are as sociated withthe milk fat globule membrane. Sphingomyelin represents about one third of total milk phospholipids,variation in content is influenced by season and the stage of lactation, Digestion products ofsphingomyelin and other sphingolipids, the ceramides(fatty acid amides of sphingosine), sphingosinesand sphingosine-phosphates are highly bioactive compounds that are associated with cell regulation.They arrest cell growth and induce differentiation and apoptosis mechanisms that are deregulatedin carcinogenesis. Ceramide and sphingosine are referred to as tumor sup¬pressor lipids. The majormetabo-lites, ceramide and sphingosine, pass from the lumen to intestinal cells where they are utilizedto resynthesize sphingomyelin and other sphingolipids, which than largely pass to the circulation.Because ceramide and sphingosine participate in major anti proliferative pathways of cell regulationthat suppress oncogenesis, they have been termed tumor suppressor lipids. Both sphingolipids andtheir active metabolites, ceramides and sphingosines, were determined as effective bactericidal agentson pathogens like Listeria monocytogenes. In addition, studies with experimental animals haveshown that feeding sphingolipids inhibits colon carcinogenesis, reduces serum LDL cholesterol andregulates immune system. A series of study showed that dietary milkderived sphingomylein (0.025to 0.1%) of diet inhibited chemically induced colon tumors development in mice, reduced aberrantcrypt foci (ACF) (ACF -early precursors of colon cancer) formation and suppressed the conversion ofbenign adenomas to malignant adenocarcinomas. Feeding the milk derived sphingolipids, ceramidemonohexoside (glucosyl) ceramide dihexoside (lactosyl) and the ganglioside to mice at 0.025 to 1.0g/100g diet has shown that there complex sphingolipids were hydrolysed to ceramide by colonicenzymes. Supplementation reduced proliferation particularly in the upper-half of the colonic cryptcells and reduced the number of ACF by 50-60 per cent. The reduction in the ACF formation is similarto that previously obtained with sphingomyelin. Another aspect confirmed in human clinical trialsis sphingomyelin cholesterol lowering activity by inhibiting intestinal absorption of food basedcholesterol (Sibel et al, 2006; Schneider, 2007; Chaudhary et al, 2008).20

Technological and Nutritional Aspects of Milk PhospholipidsConclusionMilk phospholipids are a new class of natural phospholipids now commercially available. Theyoffer a broad spectrum of both technological and nutritional properties which are unique to this kind ofpolar lipid extract and which are different from all other phospholipid products on the market. Theseare potent emulsifier, stable liposome forming compound, cholesterol lowering, improving cognitiveperformance, stress dampening effects, colon cancer preventive effects, additive for infant formulae.ReferencesChaudhry, I; Kathirvelan, C; Tyagi, A.K. (2008).Anticancer property of milk. Indian Dairyman, 60(5)37-53.Haug, A; Hestmark, A.T; Harstad, O.M. (2007).Bovine milk in human nutrition-a review.Lipids in health and disease.p1-26.Korhonen, H.J. (2010).Bioactive components in bovine milk. Chapter2 p.15-42.cited from book- Bioactive componentsin milk and dairy products Edt. By Young W.Park. Willey blackwell A John Wiley & Sons, Ltd., Publication.Schneider, M.(2007). Milk phospholipids - technological and nutritional aspects.Bulletin of the IDF 413/2007.p.35-39.Sibel Akal, Gönç and Gülfem Ünal (2006). Functional Properties of Bioactive Components of Milk Fat in Metabolism.Pakistan Journal of Nutrition 5 (3): 194-197.Spitsberg,V.L.(2005).Bovine MFGM as a potential nutraceutical. J. Dairy Sci. 88:2289-2294.Thompson, A.K and Singh, H.(2006). Preparation of Liposomes from Milk Fat Globule Membrane Phospholipids Usinga Microfluidizer. J.Dairy Sci. 89:410-419.21

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIntroduction:Methods of Cholesterol Removal to DevelopLow – Cholesterol Dairy ProductsDarshan Lal and Vivek SharmaDairy Chemistry Division, NDRI, KarnalThe importance of milk and milk products, in India, has been recognized since Vedic times.Milk is considered to be a complete food as it contains almost all essential nutrients required forhuman health and growth. Lipids, the most important constituent of milk, play significant role in thenutrition, flavour and physico-chemical properties of milk and milk products. They are also rich sourceof fat-soluble vitamins (A, D, E & K) and essential fatty acids, apart from having pleasant sensoryattributes. Milk fat is easily digestible than other oils and fats. It contains number of componentswhich show anticarcinogenic activity, e.g. sphingomyeline, conjugated linoleic acid, β-carotene etc.So one (especially vegetarians) cannot avoid it in one’s diet. But recent trend, in the society, is againstfat-rich dairy products due to the presence of saturated fat & cholesterol as these are known to increasethe incidence of coronary heart disease (CHD).CHD is one of the common causes of heart attack. Through a period of time, many researchers haveshown that dietary cholesterol, serum cholesterol and occurrence of coronary heart disease (CHD)have positive correlation. Milk fat contains about 0.25 to 0.40% cholesterol. Consumption of gheeand other fat-rich dairy products makes appreciable contribution to cholesterol intake. Furthermore,some cholesterol oxidation products (COPs) have been reported to be more harmful than cholesterolitself as they are cytotoxic, atherogenic, mutagenic and carcinogenic. Recent wave against cholesterolcontainingfoods has damaged the image and market growth of fat-rich dairy products. The educatedand urban society, in particular, is more conscious about the presence of cholesterol in their diet.This segment of the society is the major consumer of dairy and other food items manufactured by theorganized sector. In recent years, demand of cholesterol-free foods has increased tremendously. Thishas led to increase in market of margarine, vegetable fat filled dairy products, milk fat replaced dairyproducts, etc.Owing to the adverse affects of cholesterol on human health, various physical, chemical andbiological methods have been developed for reducing cholesterol in foods. These include blending ofmilk fat with vegetable oils, extraction with organic solvent, adsorption with activated charcoal andsaponin, vacuum distillation, molecular distillation, degradation of cholesterol by enzyme (cholesteroloxidase) and removal of cholesterol by supercritical carbon dioxide. Recently, β- cyclodextrin (a starchhydrolysed product) has been effectively used for cholesterol removal from milk, cream, cheese, lardand egg-yolk. Beta cyclodextrin is reported to be non-toxic, non-hygroscopic, chemically stable andedible.Cholesterol:Cholesterol is a waxy material found in all cells of the bodyand is a necessary part of cell membranes, some hormonesand other body components. In particular, it participates inthe formation of myelin sheaths in the brain and peripheralnerves, and modulates the absorption of dietary fats in theintestine. It also acts as a precursor in the biosynthesis ofbile acids, steroid hormones and vitamin D. The body makesall the cholesterol it needs; it is not necessary to get anycholesterol from the diet. A high level of cholesterol in theblood is a major risk factor for CHD and heart attack.22

Methods of Cholesterol Removal to Develop Low – Cholesterol Dairy ProductsStructure and properties of cholesterol:The term cholesterol was derived from the Greek words chole and stear, which mean “bile”and “hard fat,” respectively. The origin of the term is a reflection of the fact that the substance wasfirst identified as a hard & white solid in gallstones. Though discovered by Poulletier de la Salle in1769, cholesterol was not named until 1818, when Michel Chevreul rediscovered it and dubbed it ascholesterine, believing that the material was like a fat (Sabine, 1977). Cholesterol is a hydrophobic sterolconsisting of a four-ring structure (Figure A) with molecular weight 386.66 and molecular formula:C 27H 46O.Cholesterol is insoluble in water, sparingly soluble in cold alcohol or petroleum ether, and solublein hot alcohol and most other organic solvents. Cholesterol melts at 148.5ºC. It can be sublimed anddistilled under high vacuum. The polar hydroxyl group, which gives cholesterol a slightly hydrophilicnature, can be esterified to a fatty acid, producing cholesterol ester. Both cholesterol and cholesterolester are important structural components of cell membranes. Cholesterol is also a major determinantof membrane fluidity due to its hydrophobic and hydrophilic regions (Webb et al, 1987).Sources of cholesterol in body:In the body, cholesterol appears through endogenous synthesis and from the diet. Cholesterolsynthesis in the body is most active in the liver and intestine and averages 11 mg per kg body weightper day. This equals 770 mg for a 70 kg man on a low (less than 300 mg per day) cholesterol diet(McNamara, 1987). Normally, liver makes 80% of the total blood cholesterol and only 20% comes fromthe diet (Renner and Gurr, 1991; Allred, 1993). Cholesterol is not considered as an essential dietarynutrient because of its endogenous synthesis. On the other hand, Thomas and Holub (1994) reportedthat if less dietary cholesterol is consumed, the body compensates by making more cholesterol.Digestion, absorption and transportation of cholesterol in the blood:Digestion and absorption of cholesterol occurs in the small intestine (Grundy, 1983). Cholesterolester is broken down by a pancreatic cholesterol esterase into free cholesterol, which, absorbed into thecells lining of the intestine. The absorption of endogenous cholesterol (as bile acids) is more efficientthan dietary cholesterol absorption.Fat, including cholesterol, absorbed from the diet, is insoluble in the aqueous medium of theblood. To enable transport through blood system, the various fat components are incorporated intoparticles called lipoproteins (Grundy, 1983; Mahley and Innerarity, 1983). Lipoproteins consist of alipid core of triglyceride and cholesterol ester with a surface of mainly phospholipids, protein andsome free cholesterol. The four major lipoprotein fractions found in the blood are chylomicrons, verylowdensity lipoprotein (VLDL), low-density lipoprotein (LDL) and high-density lipoprotein (HDL).Chylomicrons are very rich in triglycerides (about 85%) but also contain absorbed cholesterol inthe free or esterified form. VLDL is also rich in triglyceride (about 50%) and contains a substantialportion of cholesterol mainly as cholesterol ester. VLDL transport about 15% of the total cholesterolfound in the blood.LDL is enriched in cholesterol and accounts for about 60% of the total blood cholesterol level. It isdeposited in artery walls, increasing the buildup of plaque and hence also known as bad cholesterol.HDL carries as much as 20% of the total blood cholesterol level. HDL is thought to be antiatherogenicsince it picks up cholesterol from peripheral tissues for delivery to the liver and excretion. Consequently,HDL is called good cholesterol. A better indicator of risk for CHD is the LDL/HDL cholesterol ratio(Thomas and Holub, 1994; Gurr, 1995).Synergistic effect of cholesterol with saturated fatty acids on plasma cholesterol level:Some saturated fatty acids are reported to affect total plasma cholesterol concentration. While,stearic acid has little effect on plasma cholesterol concentration, myristic and palmitic acids havebeen reported to have the greatest cholesterol raising potential (Hegsted et al., 1965). Some evidencesuggests that the effect of myristic and palmitic acids depends on the concomitant intake of dietary23

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancecholesterol (National Academy of Sciences, 1989). Such an interaction is clear in several experimentalmammals (Spady et al., 1993) and has also been found in some human studies (Fielding et al., 1995).The above reports suggesting an interaction between cholesterol and saturated fat intake; provide afurther reason to limit dietary cholesterol.Coronary heart disease and atherosclerosis:Coronary heart disease (CHD) is a condition in which the main coronary arteries which supplyblood to the heart are no longer able to supply sufficient blood and oxygen to the heart muscle. CHD,the common cause of heart attack, is one of the most frequent causes of death in the developed anddeveloping countries (AHA, 1989). The rates of mortality due to CHD throughout the world vary.For example, in one study among men aged 40-59 years, the annual incidence rate varied from 15 per100,000 in Japan to 198 per 100,000 in Finland (Lovegrove and Jackson, 2003). According to Chopra(1997), 2.5 million Indians become victims of heart disease every year, and Indian women are thefastest rising group of coronary patients in the world. He further observed that 33 per 1000 Indianshave a greater chance of requiring treatment and intervention for heart disease than either Europeanor Americans.Atherosclerosis is a silent, painless process and the main cause of CHD characterized by build upof cholesterol-rich fatty deposits on the inner lining of the coronary arteries, which decrease bloodflow to the heart muscle by narrowing the arteries substantially (Tabas, 2002). The atherosclerosisplaques usually develop at a point of minor injury in the arterial wall.Cholesterol in milk and milk products:Animal food products like milk and milk products, meat and meat products and eggs are themajor sources of cholesterol in our diet. Among these, chicken egg contains highest amount (about 215mg/egg) of cholesterol. Normally, most of the dieticians believe milk fat as a main source of dietarycholesterol and the main culprit for CHD disease. Cholesterol accounts for 0.25-0.45% of the totallipids in milk. Cholesterol concentrates in the milk fat globule membrane (MFGM). In milk, 80% of thecholesterol is associated with the milk fat globules and the remaining 20% is partitioned into the skimmilk phase where it is associated with fragments of cell membrane (Patton & Jensen, 1975). However,any event disrupting the membrane structure, e.g. churning of cream will result in the partial passingof cholesterol alongwith ruptured membrane material to the aqueous phase. Arul et. al., (1987) studiedthe distribution of cholesterol in various milk fat fractions viz., solid fraction (m. pt. 39ºC), semisolidfraction (m. pt. 21°C) and liquid fraction (m. pt. 12ºC) and reported that 80% of the total cholesterolcontent was present in the liquid fraction of the milk fat. 80-90% of the cholesterol is present in milk inthe free form, while 10-20% is esterified (Bindal and Jain, 1973; Wood and Bitman, 1986; Jensen, 1987;Schlimme & Kiel, 1989).Pantulu and Murthy (1982) observed 8-10 times higher content of cholesterol in whey than inwhole milk. Srinivasan (1984) reported the average cholesterol content of cow and buffalo milk as2.8 and 1.9 mg/g fat, respectively. However, Prasad and Pandita (1990) showed that buffalo milk (20mg%) contained more cholesterol than cow milk (15.5 mg%). Similarly, they found that dahi frombuffalo milk contained more cholesterol as compared to dahi from milk of different breed of cows. Ingeneral, dahi had lower cholesterol values than the fresh milk (Ismail and Ahmad, 1978; Prasad andPandita, 1990). Cholesterol in channa samples exhibited a highly significant variation, being minimumin buffalo, while such species variations were not observed in case of khoa calculated on dry weightbasis (Prasad and Pandita, 1990).Cheese was found to contain 52.3-76.6 (av. 69.3) mg of cholesterol/100 g of cheese and 198-298(av. 273) mg/100g fat in cheese (Fuke and Matsuoka, 1974). Tylkin et al., (1975) reported 9 timeshigher cholesterol/g fat in butter milk than butter. Aristova and Bekhova (1976) observed cholesterolcontent in unsalted butter as 244 mg/100 g. Vyshemirskii et al., (1977) reported that 80-90% cholesterolinitially present in cream passed into butter and 10-20% to butter milk. Masson and Martinez (1984)reported cholesterol content as 177–208 mg/100 g fat in butter. Bindal and Jain (1972) estimated free24

Methods of Cholesterol Removal to Develop Low – Cholesterol Dairy Productsand esterified cholesterol in Desi ghee, using TLC method and reported their contents as 0.288 and0.038% and 0.214 and 0.056% in cow and buffalo ghee, respectively. Prasad and Pandita (1987) observedcholesterol content of ghee prepared from milk of Haryana, Sahiwal and Sahiwal X Friesian cows andfrom Murrah buffaloes, to be 303, 310, 328 and 240 mg/100 g fat, respectively.Factors affecting level of cholesterol in milk and milk productsEffect of Species/Breeds:Bindal and Jain (1973) reported that cow ghee (0.31%) contained higher cholesterol than buffalo ghee(0.267%). Bernolak (1979) observed that cow milk, with 2.8% fat, contained 237 mg total sterols/100 g fat(92.8% cholesterol of total sterols). Prasad and Pandita (1987, 1990) also reported higher cholesterol contentin cow ghee compared to that in buffalo ghee. Singh and Gupta (1982) observed that goat ghee containhigher cholesterol (0.236 g/100 g fat) than cow (0.230 g/100 g fat) and buffalo (0.196 g/100 g fat) ghee.Effect of Season/Stage of lactation:Season has also been reported to affect the cholesterol content of milk fat. Treiger (1979) reportedthat total cholesterol content of cow milk fat ranged from 0.24-0.29 g/100 g fat in spring and 0.18-0.25g/100 g fat in summer season. Prasad and Pandita (1987, 1990) observed that cholesterol content ofghee was higher in winter than in summer (301 vs 291 mg/100g fat). Krzyzewski et al. (2003) alsoobserved a significantly lower (by about 16%) concentration of cholesterol in milk during winterseason. Ghee prepared from milk of old animals (Lal, 1982) and late lactation milk (Nigam, 1989) wasfound to contain highest level of cholesterol.Effect of Heat:Bector and Narayanan (1975) observed that when cow and buffalo ghee were heated at 225°C for 2h, respectively 26.1 and 27.3% of cholesterol was lost. Similarly, Rai and Narayanan (1984) also reported28.2 and 49% loss of cholesterol after 12 h of intermittent frying in aluminium and iron container.Methods of cholesterol removal from milk fat:Since dairy products contain significant amounts of cholesterol, a number of processes for removalof cholesterol have been developed to produce low-cholesterol dairy products. These include steamstripping, molecular distillation, solvent or super-critical extraction, reaction with cyclic anhydride,enzymatic method and treatments with adsorbents like saponin, activated charcoal and cyclodextrin.These are briefly discussed below.1. Steam strippingThis process is similar to that used in the deodorization of vegetable oils and removal ofunsaponifiable matter. To remove cholesterol by steam stripping, the fat is first deairated undervacuum after which it is heated with steam upto 232ºC and then subjected to steam at low pressurein cylindrical tall chamber. The anhydrous milk fat (AMF) passing over a series of plates is spreadin many thin layers, which increases the stripping efficiency. The steam rises and carries with it theevaporated cholesterol to be condensed and collected with other volatiles. This process can removeupto 93% of cholesterol though with 5% fat losses. The major disadvantage to the process is that itremoves flavouring compounds also (Schlimme & Kiel, 1989).2. Molecular distillationIn this process, AMF is molecularly distilled at temperature 190 and 210ºC at a vacuum of 10-4Torr. Fractions distilled at 190 and 210ºC represented 3.43 and 3.99 % of the initial mass and containedmore than 93% of the total cholesterol (Lanzani et al, 1994 and Sharma et al., 1999). Arul et al. (1988)fractionated AMF into four fractions at temperatures of 245 and 265ºC and pressure of 220 and 100 mmHg. Two low melting point fractions were blended together to yield a total of three fractions (liquid,intermediate and solid). About 78% of the total cholesterol was found in the liquid fraction while theremaining was found in the intermediate (18%) and solid (4%) fractions in the esterified form. But,because of the high heat used in the process, the quality of the end product is adversely affected.25

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance3. Solvent extraction:In this process butter oil is mixed with propane and ethanol in the mixing vessel. The low viscousmixture of butter fat, ethanol and propane is fed into the extraction column. A mixture of ethanol andwater, containing a small amount of propane is used as extractant. The extract, a solution of cholesteroland butter fat in a mixture of ethanol, water and some propane is withdrawn at the bottom of theextraction column, which is splitted into two phases. The upper phase consists of fat and cholesterol,which are subsequently separated, in a further processing step. Around 90 to 95% of the cholesterol isextracted in this counter-current procedure operated at 30ºC and 10 bar (Czech et al., 1993).4. Supercritical carbon dioxide extraction:Some studies have shown that supercritical carbon dioxide (SC-CO 2) can be used to fractionateAMF with evidence that cholesterol can be concentrated into selected fractions. Kaufmann et al., (1982)obtained two fractions of milk fat by SC-CO 2extraction at a pressure of 200 bars and temperature of80ºC. In this process, the liquid fractions were enriched in total cholesterol. However, Huber et al.(1996) observed that direct supercritical extraction of cholesterol from AMF is not feasible becauseof the low selectivity of cholesterol and poor solubility of AMF. Moreover, under these conditions,important milk flavours also get separated with the cholesterol. Therefore, they proposed anotherprocess for cholesterol removal from AMF, dissolved in SC-CO 2under high solubility conditions forAMF (40 MPa at 70ºC) to achieve rapid extraction. In this process, the dissolved AMF in SC-CO 2ispassed isobarically and isothermally through a high-pressure column, filled with a suitable adsorbent(e.g. silica gel) to eliminate cholesterol. Finally, the supercritical mixture is fractionated by eitherdescending or ascending temperature profile in separators connected in series. Karkare and Alkio(1993) found that over 99% of cholesterol from milk fat could be removed using an SC-CO 2extractionsystem equipped with a silica gel column.5. Reaction with cyclic anhydride:Gu et al. (1994) developed a method for cholesterol removal from milk fat based on the reactionbetween the hydroxyl group of cholesterol and a cyclic anhydride such as succinic anhydride. Theconversion of cholesterol into an acid derivative makes it possible to remove these from fats byextraction with aqueous alkali. Addition of acetic acid increases the rate of reaction and prevents thedistillation of cyclic anhydride from reaction mixture. They removed 50% cholesterol from animal fatsbut alongwith it α- tocopherol (50%), γ- and δ- lactones also get removed.6. Enzymatic method:McDonald et al. (1983) have described an enzymatic process using cholesterol reductase forconversion of cholesterol to biologically inactive, e.g., non-toxic, non-absorbable products likecoprosterol, which is either not or is only poorly adsorbed by the body. This approach, which istheoretically suitable for reducing the cholesterol content of milk fat, has been verified biologicallyat least in part, by the finding that a portion of the intestinal cholesterol is reduced to coprosterol byintestinal bacteria and subsequently eliminated.7. Adsorption methodsCholesterol can be removed by its adsorption on certain material. Adsorbents, which are used toremove cholesterol, are activated charcoal, saponins and β cyclodextrin.(A) Activated charcoalBindal et al., (1994) could remove half of the cholesterol present in milk fat through treatmentof liquid fat with activated charcoal. Another activated charcoal method claimed 95% of cholesterolremoval from AMF but many other compounds including yellow pigments were also removedsimultaneously (Sharma et al., 1999).(B) SaponinsSaponins are naturally occurring plant compounds that can be used to selectively bind tocholesterol and precipitate it out. 80% and 90% cholesterol reduction in cream and anhydrous milk26

Methods of Cholesterol Removal to Develop Low – Cholesterol Dairy Productsfat was obtained by using this method (Riccomini et al., 1990). Oh et al. (1998) found 70.5% of thecholesterol removal when milk was treated with 1.5% saponin at 45ºC for 30 min. Further, additionof 0.25% celite increased cholesterol removal to 72%. However, the methods using activated charcoalor saponins are relatively non-selective and remove flavour and nutritional components also whencholesterol is removed (Lee et al., 1999; Sharma et al., 1999).(C) β-cyclodextrinBeta cyclodextrin, one of the well known members of cyclodextrin family, is a cyclic oligosaccharideof seven glucose units joined ‘head to tail’ by α-1, 4 linkage and is produced by the action of enzymecyclodextrin glycosyl transferase (CGT) on hydrolyzed starch syrup. Beta cyclodextrin has torus likestructure. The central cavity is hydrophobic, giving the molecule its affinity for non-polar moleculessuch as cholesterol (Szejtli, 2004). The radius of the cavity can accommodate a cholesterol moleculealmost exactly, explaining the highly specific nature of β-cyclodextrin’s ability to form an inclusioncomplex with cholesterol (Hettinga, 1996).References:AHA (1989) Heart Facts. American Heart Association. Dallas, A. Heart. A.Ahn, J. and Kwak, H. S. (1999) Optimizing cholesterol removal in cream using beta-cyclodextrin and response surfacemethodology. J. Food Sci. 64(4): 629-632.Allred, J. B. (1993) Lowering serum cholesterol. Who benefits? J. Nutr. 123: 1453.Aristova, V. P. and Bekhova, E. K. (1976) Cholesterol in milk and milk products. Trudy, Vsesoyuznyi Nanchnoissledovatel’skiiInstitut Malochoi Promyshlennosti No. 42: 45 (cf. DSA 1977(39), 2748).Arul, J. A., Boudreau, A., Makhlouf, J., Tardif, R. and Grenier, B. (1988). Distribution of cholesterol in milk fat fractions.J. Dairy Res. 55: 361-371.Bector, B.S. and Narayanan, K.M. (1975) Comparative stability of unsaponifiable constituents of ghee during thermaloxidation. Indian J. Nutr. Dietetics. 12(6): 178-180.Bindal, M. P. and Jain, M. K. (1973) Studies on cholesterol content of cow and buffalo ghee. Indian J. Anim. Sci. 43(10):918-924.Bindal, M. P., Wadhwa, B. K., Lal, D., Rai, T. and Aggarwal, P. K. (1994) Removal of cholesterol from milk and milkproducts: Application of biotechnical processes. NDRI Annual Report. pp. 98-99.Czech, B., Peter, S. and Weidner E. (1993) Effective removal of cholesterol from butter fat. Scandinavian Dairy Information,7(4): 56-58.Fielding, C. J., Havel, R. J., Todd, K. M., Yeo, K. E., Schloetter, M.C., Weinberg, V. and Frost, P. H. (1995) Effects ofdietary cholesterol and fat saturation on plasma lipoproteins in an ethnically diverse population of healthy youngmen. J. Clin. Invest. 95: 611-618.Fuke, Y. and Matsuoka, H. (1974) Cholesterol content and identification of foreign fats in processed cheese. J. Jap Soc.Food Nutr. 27: 269.Grundy, S. M. (1983) Absorption and metabolism of dietary cholesterol. Annu. Rev. Nutr. 3: 71-96.Gu, Y. F., Chen, Y. and Hammond, E. G. (1994) Use of cyclic anhydrides to remove cholesterol and other hydroxycompounds from animal fats and oils. J. Am. Oil Chem. Soc. 71: 1205-1207.Gurr, M. I. (1995) Dietary lipids in health and disease. In Advanced Dairy Chemistry-2: Lipids, 2nd edn, (eds P. F. Fox),Chapman & Hall, New York, pp. 349-402.Hegsted, D.M., McGandy, R.B., Myers, M.L. and Stare, F.J. (1965) Quantitative effects of dietary fat on serum cholesterolin man. Am. J. Clin. Nutr. 17: 281-95.Hettinga, D. (1996) Butter. in Bailey’s industrial oil and fat products, Vol. 3, 5th edn, (eds Y. H. Hui), John Wiley & Sons,INC. New York, pp. 1-23.Huber, W., Molero, A., Pereyra, C. and Martinez de la Ossa E. (1996) Dynamic supercritical carbon dioxide extractionfor removal of cholesterol from anhydrous milk fat. Int. J. Food Sci. Tech. 31: 143-151.Ismail, A.A. and Ahmad, N.S. (1978) Cholesterol content in buffalo milk and its distribution in some dairy products.Egypt. J. Dairy Sci. 6: 92-95.Jensen, R. J. (1987) Cholesterol in human milk. in Human Lactation. 3. The effect of human milk on the recipient infant(eds A. S. Goldman, S. A. Atkinson and S. S. Hanson), Plenum Press, New York, pp. 151.Karkare, V. and Alkio, M. (1993) Removal of cholesterol during milk fat fractionation by supercritical carbon dioxide.Agric. Sci. Finland. 2(5): 387-393. (Cited in DSA, 56: 1522).Kaufmann, W. , Biernoth, G., Frede, E., Merk, W., Precht, D. and Timmens, W. (1982) Fractionation of butter fat byextraction with supercritical carbon dioxide. Milchwissenschaft. 37: 92-96.Krzyzewski, J., Strzakowska, N., Jozwik, A., Bagnicka, E. and Ryniewicz, Z. (2003) Effect of nutrition and season oncholesterol level in milk of Holstein-Friesian cows. Annals Anim. Sci. 3: 45-49.Lal, D. (1982) Effect of lactation number on the physicochemical status of milk lipids. Ph.D. Thesis, Kurukshetra Univ.,Kurukshetra.Lanzani, A., Bondioli, P. Mariai, C., Folegatti, L., Venturii, S., Fedeli, E. and Barreteau, P. (1994) A new short-pathdistillation system applied to the reduction of cholesterol in butter and lard. J. Am. Oil Chem. Soc. 71(6): 609-614.27

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceLee, D. K., Ahn, J. and Kwak, H. S. (1999) Cholesterol removal from homogenized milk with beta-cyclodextrin. J. DairySci. 82: 2327-2330.Lovegrove, J. and Jackson, K. (2003) Coronary heart disease. In Functional Dairy Products (eds Tina Mattila- Sandholmand Maria Saarela), CRC Press, Boca Raton, pp: 54-93.Masson, L and Martinez, M. (1984) Determination of cholesterol content in butter. International Dairy Federation Bulletinno 7: 165.McDonald, I. A., Bokkenheuser, V. D., McErnon, A. M., Mosbach, E. H. and Winter, J. (1983) Degradation of steroids inhuman gut. J. Lipid Res. 24: 675-700.McNamara, D. J. (1987) Diet and heart disease: The role of cholesterol and fat. J. Am. Oil Chem. Soc. 64: 1565-74.Mahley, R. W. and Innerarity, T. L. (1983) Lipoprotein receptors and cholesterol homeostasis. Biochim. Biophys. Acta,737: 197-222.Nigam, S. (1989) Studies on the physico-chemical status of milk lipids from cross breed cattle. Ph.D. Thesis, KurukshetraUniv., Kurukshetra.Oh, H. I., Chang, E. J. and Kwak, H. S. (1998) Conditions of the removal of cholesterol from milk by treatment withsaponin. Korean J. Dairy Sci. 20: 253-260.Pantulu, P. C. and Murthy, M. K. R. (1982) Lipid composition of skimmed milk and whey. Asian. J. Dairy Res. 1(1): 17-20.Patton, S. and Jensen, R.G. (1975). Lipid metabolism and membrane functions of the mammary gland. In Progress in thechemistry of fats and other lipids (eds R.T. Holman), Pergamon Press Oxford. pp. 163-277.Prasad, R. and Pandita, N. N. (1990) Cholesterol content of milk and its fractionation during processing. Indian J. DairySci. 43(2):190-193.Prasad, C.R., Subramanian, R. and Ramaprasad, C. (1992) Qualitative and comparative studies of cholesterol oxides incommercial and home-made Indian ghee. Food Chemistry. 45(1): 71-73.Prasad, R. and Pandita, N. N. (1987) Variations in the cholesterol content of dairy fat. Indian J. Dairy Sci. 40(1): 55-57.Rai, T. and Narayanan, K.M. (1986) Unsaponifiable constituents of ghee as affected by intermittent frying. Indian j.Anim. Sci. 56 (5): 610-611.Renner, E. and Gurr, M.I. (1991) Do we need cholesterol reduced dairy products? Dairy Industry International. 56: 34.Riccomini, M. A., Wick, C., Peterson, A, Jimenez-Flores, R. and Richardson, T. (1990) Cholesterol removal from creamand anhydrous milk fat using saponins. J. Dairy Sci. 73(1): 107.Sabine, J. R. (1977) Methods in cholesterol research. in Cholesterol, (eds J.R. Sabine) Marcel Dekker, Inc. New York andBasel. pp. 29-55.Schlimme, E. and Kiel, D. (1989) Removal of cholesterol from milk fat. European Dairy Magazine, 12-21.Seth, R. and Singh, A. (1994-95) Removal of cholesterol from milk using β-cyclodextrin and preparation of milk productsfrom such treated milk. NDRI Annual Report. pp. 95.Sharma, R., Nath, B. S. and Lal D. (1999) Approaches for cholesterol removal from milk fat: An overview. Indian J. Dairyand Biosciences. 10:138-146.Singh, I. and Gupta, M. P. (1982) Physico-chemical characteristics of ghee prepared from Goat milk. Asian J. Dairy Res.1: 201-205.Spady, D. K. Woollett, L. A. and Dietschy, J. M. (1993) Regulation of plasma LDL-cholesterol levels by dietary cholesteroland fatty acids. Annual. Rev. Nutr. 13: 355-381..28

IntroductionFortification of Milk and MilkProducts for Value AdditionSumit AroraDairy Chemistry Division, NDRI, KarnalFortification of Milk and Milk Products for Value AdditionFood fortification is thought to be a highly effective solution and among the most cost effectivepublic health interventions currently available. It may be defined as the addition of one or moreessential nutrients to food whether or not it is normally contained in the food, for the purpose ofpreventing /correcting a demonstrated deficiency of one / more nutrients in the population or specificpopulation groups (Codex Alimentarius Commission, 1994). It is practiced in those areas where theproblems of malnutrition are prevalent.According to FAO/WHO guidelines (1995) essential nutrients may be added (i) to replace lossesthat occur during manufacture, storage and handling of food (restoration). For example the removalof cream from milk takes almost all the natural vitamins A and D and therefore skimmed milk may befortified with the same vitamins at levels as fluid whole milk. (ii) To ensure nutritional equivalence inimitation or substitute foods. (iii) To compensate for naturally occurring variations in nutrient levels.For instance, milk and butter are subjected to seasonal variations in vitamins A & D contents. Somedairy products are fortified with the vitamins A & D in order to maintain constant vitamin levels. (iv)To provide levels higher that those normally found in a food. For example, margarine is fortified withvitamins A & D (in western countries) to render it nutritionally equivalent to butter, and (v) to providea balanced intake of micronutrient in special case (dietetic foods) for example infant formulas, specialfood for athletics, medical food etc.General criteria for fortification• The intake of nutrients is below the desirable level in the diet of significant number of people.• The vehicle used for fortification should be consumed in significant quantities by targetpopulation.• Addition of nutrient should not create an imbalance of essential nutrients.• The added nutrients should be stable under proper conditions of storage and use.• Biological availability of added nutrients should be high.• There should be reasonable insurance against excessive intake to a level of toxicity.(Food andNutrition Board, 1973)Milk and milk products as a suitable vehicle for fortificationMilk in its natural form is almost unique as a balanced source of man’s dietary need (Table 1). Thevarious steps in processing and storage have a measurable impact on some specific nutrients. Milkalso provides a convenient and useful vehicle for addition of certain nutrients to man’s diet and hasfollowing benefits:- Since milk is centrally processed so that the quality control can be effectively implemented.- Milk and milk products are widely consumed regularly in predictable amounts by people of allage groups.- Cost is affordable by target population.- The stability and bioavailability of the added micronutrients to the milk remains high.- Since milk is nearly a complete food and all nutrients exist in almost fully available form, thebioavailability of added nutrients remains high.- Addition of fortificants usually caused minimum change in colour, taste and appearance.29

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceNutrients generally added to milkLiquid milk fortification with vitamins A and/D is mandated in several countries. β-carotene isadded as a colour-enhancing agent to some milk products such as butter. Dried milk is often fortifiedwith vitamins A and D, calcium, and iron. Milk based infant formula and weaning foods are fortifiedwith a range of vitamins, minerals, and other nutrients such as polyunsaturated fatty acids. Powderedmilk used for complementary feeding in Chile is fortified with vitamin C, iron, copper and zinc.Fortification of milk & milk products with vitaminsUnder ambient conditions the water soluble vitamin C and vitamins of the B-complex groupsuch as thiamin, riboflavin, vitamin B6, niacin, pantothenic acid, folic acid, biotin and vitamin B12 arepowdered and thus relatively easy to work with when producing most dairy products. The fat solublevitamins which include vitamin A, D, E and K, however, exist either as an oil or as crystals, which maycause processing difficulties during the production of certain types of dairy products (Mortensen andGotfredson, 1996).One of the problem encountered with the vitamins, is their limited stability in presence of heat,humidity and oxygen. Among the water soluble vitamins, vitamin C, folic acid, vitamin B6 and vitaminB12 are the less stable. While in the case of fat soluble vitamins vitamin A, D and E are least stable.In order to improve the stability of these vitamins, a number of different coating technologieshave been developed. One of the most important methods to protect the fat soluble vitamins ismicroencapsulation, which results in a highly sophisticated powder, where the vitamin is kept protectedfrom degradation by the coating material used for the encapsulation. During microencapsulation, thefat soluble vitamins are brought from the form of oil or a crystal – which in some processes would bedifficult to handle – to the form of a free flowing powder much easier to handle and mix with otherdry ingredients (Mortensen and Gotfredson, 1996).When two or more vitamins are added to a food product at the same manufacturing stage, thisis commonly done in the form of premix or as blend. Premix is a homogenous mixture of desiredvitamins in a dry powder from, whereas a blend is the same for the fat soluble vitamins, but in an oilyform. A premix can consist of both water soluble and fat soluble vitamins and carotenoids, in whichcase the fat soluble vitamins have to be microencapsulated.Fortification of milk and milk products with iron, calcium and other mineralsSelection of an appropriate mineral fortificant (iron, calcium etc) is based on its organolepticconsiderations, bioavailability, cost and safety. The colour of iron compounds is often a critical factorwhen fortifying milk and milk products. The use of more soluble iron compounds often leads tothe development of off-colours and off-flavours due to reactions with other components of the foodmaterial. Infant cereals have been found to turn grey or green on addition of ferrous sulphate. Offflavourscan be the result of lipid oxidation catalysed by iron. The iron compounds themselves maycontribute to a metallic flavour. Some of these undesirable interactions with the food matrix can beavoided by coating the fortificant with hydrogenated oils or ethyl cellulose (Jackson and Lee, 1991).Bioavailability of iron compounds is normally stated relative to a ferrous sulphate standard. Thehighly water soluble iron compounds have superior bioavailability (Richardson, 1990). Bioavailabilityof the insoluble or very poorly soluble iron compounds can be improved by reducing particle size.Unfortunately this is accompanied by increased reactivity in deteriorative processes. The problemof low bioavailability of some of the less reactive forms of iron is often circumvented by the use ofabsorption enhancers like, ascorbic acid, sodium acid sulphate and orthophosphoric acid, added alongwith the fortificant.The other important mineral for the fortification of milk and milk products, which has been studied,is calcium. Several commercial calcium salts are available for calcium fortification, which includecarbonate, phosphate, citrate, lactate and gluconate. In general, organic acid salts of calcium are morebioavailable than inorganic salts (Labin-Godscher and Edelstein, 1996). The pH of the milk should be30

Fortification of Milk and Milk Products for Value Additiontaken care of during Ca fortification. Manufacturers of calcium fortified milk products should consideradding, magnesium, riboflavin and perhaps vitamin D as well, in amounts that would normally beobtained in a serving of vitamin D fortified milk (Weaver, 1998).Milk and milk products can also be fortified with a range of other mineral salts such as Mg, P,Zn, Cu and Mn. Prudent selection of mineral compounds is based largely on consideration of mineralreactivity and solubility of the salt. To overcome problems of flavour, texture and colour deteriorationdue to addition of minerals, some companies have engineered new fortificant preparations, whichgenerally involve the use of stabilisers and emulsifiers to maintain the mineral in solution (FAO,1995).Technology for fortification:1. Liquid milkThe technology of milk fortification is relatively simple and no additional equipments are neededor can be practiced with minor modifications in the existing plant. Mineral/vitamin fortification can bepracticed at several stages in the production. But liquid milk is usually fortified prior to pasteurizationor ultra-heat treatment. Homogenization is essential for oily preparations of vitamins. Usually twomethods of additions are practiced i.e. batch process for small operations and metered additions forcontinuous process. A metered injection of the vitamin preparation upstream to the homogenizer hasbeen the standard set up in continuous operation plants (Cornell University, 1994).Oily preparations are diluted with 10 parts of warm oil (45 – 50°C), usually butter oil andhomogenized with a suitable quantity of skim milk or it can be mixed with appropriate quantity of milkand cream and finally homogenized. In the case of water soluble or water dispersible micronutrients,a premix can be made by diluting the nutrients to 20 times their weight with milk at 45°C, followed bystirring and thorough mixing (USAID, 2001).A simple procedure for fortification of skim milk with vitamins A without using homogenizer wasdeveloped by Bector and Rani (1998). This process is basically a batch process and is suitable for smallplants of low capital cost.Many iron compounds have been assessed in the fortification of pasteurised whole milk. Thebest fortification procedure was judged to be the addition of ferric ammonium citrate followed bypasteurisation at 81 °C. In this way fortified milk containing 30 ppm iron was found to be acceptableafter 7 days storage. Levels of vitamin E, vitamin A and carotene were not affected by the presenceof iron. At pasteurisation temperatures below 79 °C off-flavours developed due to lipolytic rancidity(Edmondson et al, 1971). De-aeration of the milk prior to the addition of iron compounds was also foundto reduce flavour problems. In the production of iron fortified evaporated milk, ferric orthophosphatewas shown to be useful (FAO, 1995).Calcium fortificant preparations including stabilizers and emulsifiers have been used forfortification of milk and milk-based beverages. It maintains calcium in suspension so as to improvemouth feel and appearance of products (FAO, 1995). In Germany a milk-based fruit beverage has beenmarketed which is fortified with calcium, phosphorous as well as vitamins A, E, B and C.Dried milkHere particle size of the fortificant as well as density of the fortificant has to be taken care as largeand heavier size particles will lead to separation. In order to achieve stability of vitamins, the safest wayto fortify dried milk is to blend dry forms of premix with the dried milk powder, thereby protectingthe effect of microencapsulation. However, this requires an effective mixing system. If blends are used,they are added directly to milk, provided homogenization is done before spray drying. If vitamins areadded before spray drying, overage addition (Table 2) will be necessary in order to compensate thelosses (Mortensen and Gotfredsen, 1996).31

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIron fortification of powdered non-fat dry milk, ferrous sulphate at a level of 10 ppm was found tobe stable for a period of 12 months. Ferric ammonium citrate and ferric chloride at a level of 20 ppmiron in the reconstituted product gave acceptable results (FAO, 1995).Infant formulasThe mineral content of cow milk, from which many formulas are produced, is highly variable.Production methods have been adapted to control this source of variability. Operations have beenincluded which remove most of the minerals, but at the same time some vitamins and other componentsof the milk are lost: technologies used include ion exchange, ultra filtration, electrodialysis, reverseosmosis and gel filtration. Mineral compounds are then added at the required levels. There must becareful selection of mineral compounds added to the formulas, as cereal products are highly susceptibleto lipid oxidation during storage. The use of ferrous fumarate and ferrous succinate is recommendedfor fortification of infant cereals as they gave rise to no objectionable flavours/odours or colours onstorage. Ferrous sulphate coated with hydrogenated fats, mono- or di-glycerides and ethyl cellulosecaused discolouration on reconstitution with hot milk and hot water.Although some allowance is made for the natural vitamin content of the ingredients used, most ofthe vitamins are added to the formula. The Codex Alimentarius Commission (FAO/WHO, 1994) haspublished an advisory list of mineral salts and vitamin compounds which can be added to formulas.Predetermined excesses of vitamins have to be added to allow for processing and storage losses. UHTprocessing followed by aseptic packaging has been preferred to in-can sterilisation since less nutrientlosses occur in the former case. Losses have been noted particularly for vitamin C, thiamin, folic acidand vitamin B6.Iron absorption from formulas has been reported to be 5-10% compared to 50% for human milk.It has been suggested that bovine milk proteins or elevated calcium and phosphorus levels accountfor this difference. Zinc levels in formulas are also higher than in human milk to make up for reducedbioavailability.Ice-cream:The unit operations used in the manufacture of ice-cream is not highly destructive to vitamins.Vitamins are added in the dry form to the mix. Since whipping and consequent operation of the mixis carried out around freezing temperature, oxidative losses of vitamins are minimized. The greatestprocessing losses, which occur during manufacture of fortified ice-cream, are during pasteurization ofice cream mix. Calcium enriched ice-cream is also available in USA and is marketed under the nameof TruCal.Fermented milk products:In the production of yoghurt, the low pH renders it unsuitable as a carrier of vitamins suchas vitamin A. Water soluble vitamins are best used in a encapsulated form, protected for odourand flavour considerations. Some vitamin losses can occur through metabolism by microorganismsduring fermentation (O'Brien and Roberton, 1993). The sensory quality of iron fortified yoghurt wasacceptable to when tested by a consumer panel. No significant difference in the appearance, mouthfeel,flavour, or overall quality was observed between iron fortified and unfortified yoghurts (Hekman andMcMahon, 1997). In Germany, enrichment of cheese with iodine through the use of iodised salt hasbeen approved.Considerations while fortification of milk & milk products1. Bioavailability of commercial preparations: Bioavailability of different compounds facilitatesthe selection of the optimal compound. Bioavailability refers to the rate of absorption andutilization of a nutrient from a given matrix.2. Nutrient–nutrient reaction: Interaction among the nutrients and other food components isa key factor in nutrient addition. For example, Vitamin C will improve the absorption of iron32

Fortification of Milk and Milk Products for Value Addition(Kiran et al, 1977). On the other hand, the iron will accelerate vitamin degradation. Fortification ofcalcium in milk may interfere with absorption of iron or zinc (Weaver, 1998).3. Nutrient-matrix reaction: The added nutrient must not react with any component of the milk.For example, iron is a pro-oxidant and can accelerate the development of fat rancidity, destroysome of the vitamins and form coloured products.4. Shelf-life & packaging: Many of the fortified milk and milk products may have limited shelflife and thus may need different types of packaging which can be either oxygen impermeableor opaque to light. This is particularly true for the fortification of liquid milk with vitamin A asvitamin A fortified milk develops off flavour within 6 h when exposed to light, compared to 12 hfor control (Fellman et al, 1991). All the fortified products require proper labelling on the pack.5. Process considerations: The stability of all the vitamins is well known during various processingconditions and the same knowledge can be applied while processing the vitamin fortified milk.6. Cost factor: Cost may not be a crucial factor in the manufacture and marketing of fortified milkand milk products.7. Safety factor: There should be sufficient insurance against excessive intake of the fortificant.Unlike water soluble vitamins, fat soluble vitamins exhibited toxicity at higher concentrations.ConclusionFortification should not alter the organoleptic properties (taste, smell, colour, consistency) and shelflife (conditions related to storage, transport) of the product. Often there is a delicate balance betweenbioavailability and other properties of fortified food. Milk and milk products provide a convenient anduseful vehicle for fortification with micronutrients. The risks associated with fortification are minimalexcept if good manufacturing practices are not followed and only isolated incidents of this type haveever been reported. Improved understanding of interactions between food ingredients and health andingenuity of food technologists in food formulation and fabrication will contribute to the advances infood fortification.Table 1: Micronutrient content of cow milk vs recommended dietary allowances (RDA)Micronutrient Quantity /Litre RDAMenWomenVitamin A (IU) 1300 1000 800Vitamin D (IU) 42 5-10 5-10Vitamin E (IU) 1.5 10 8Vitamin K (μg) 41 45-80 45-65Vitamin B1(mg) 0.4 1.5 1.1Vitamin B2 (mg) 1.7 1.7 1.3Vitamin B6 (mg) 0.4 2 1.6Folic acid (μg) 62 200 180Niacin (mg) 1 19 15Vitamin B12 (mg) 3 2 2Vitamin C (mg) 15 60 60Iron (mg) 0.52 28 30Calcium (mg) 1300 400 400Copper (mg) 0.1 2.2 2.2Zinc (mg) 4 15.5 15.5(OMNI, 2001)33

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceTable 2: Micronutrient content of cow milk vs recommended overagesMicronutrient Quantity /Litre Recommended Overages (%)34Pasteurised UHT Dry Milk Milk DessertsVitamin A (IU) 1300 20 30 40 20Vitamin D (IU) 42 20 30 40 20Vitamin E (IU) 1.5 10 30 20 10Vitamin K (μg) 41 - - - -Vitamin B1(mg) 0.4 25 50 20 25Vitamin B2 (mg) 1.7 15 40 20 15Vitamin B6 (mg) 0.4 30 30 20-30 30Folic acid (μg) 62 20 40 40 20Niacin (mg) 1 15 20 20 15Vitamin B12 (mg) 3 15 30 40 20Vitamin C (mg) 15 30 100 50 30Iron (mg) 0.52 5 5 5 5Calcium (mg) 1300 5 5 5 5Copper (mg) 0.1 - - - -Zinc (mg) 4 - - - -Phosphorus (mg) 960 - - - -Iodine (ųg) 237 - - - -References(OMNI, 2001)Anderson, H. C. and Thomas, E. L. (1974) Fortification of fluid milk products with ascorbic acid. J Dairy Sci. 57:5.Bector, B.S. and Rani, S. (1998) A methodology to fortify low fat milk with vitamin A without using a homogenizer.Indian J. Dairy Sci. 51: 69-72.Bender, A. E. (1993) Food fortification. In. Encyclopedia on Food Science, Food Technology and Nutrition. Vol 3. p.1990-1993.Bullock, D. H., Singh, S. and Pearson, A. M. (1968) Stability of vitamin C in enriched commercial evaporated milk. J.Dairy Sci. 51: 921-923.Conochie, J. (1958) The stability of sodium ascorbate in evaporated milk. Australian J. Dairy Technol. 80-82.Cornell University: Dairy Science Facts (1999) Vitamin fortification of fluid milk. Department of Food Science, StockingHall, New York.Edmondson, L. F., Douglas, F. W. and Avants, J. K. (1971) Enrichment of pasteurized whole milk with iron. J. Dairy Sci.54: 1422-1426.Elliott, J. G. (1999) Application of antioxidant vitamins in foods and beverages. Food Technol. 53: 46-48.El-Sayed, M. M., Abd-Rabou, N. S., Sayed, A. F. and El-Samragy, Y. A. (1995) Iron fortification of processed Ras cheese.Egyptian J. Dairy Sci. 35: 289-298.FAO (1995) Micronutrient fortification of food: Technology and quality control. FAO Technical Consultation of FoodFortification: Technology and Quality Control. Rome, Italy, 20-23 November.Fellman, R.L., Dimick, P,S and Hollender, R. (1991) Photooxidative stability of vitamin A fortified 2% low fat milk andskim milk. J. Food Protection 54:113-116.Food and Nutrition Board (1973) General policies in regard to improvement of nutritive quality of foods: policystatement. National academy of Sciences Washington DC. p. 6.Food Fortification Roundtable. (1996) Food Technol. 86-94.Ford, J. E., Porter, J. W. G. and Thompson, S. Y. (1974) Influence of added ascorbic acid on the stability of folic acid andvitamin B12 in milk during UHT processing and subsequent storage. Proceedings 19 th Intr. Dairy Congress, 567-569.Goldscher, R. L. and Edelstein, S. (1996) Calcium citrate: A revised look at calcium fortification. Food Technol. 96-98.Graham, D. M. (1974) Alteration of nutritive value resulting from processing and fortification of milk and milk products.J. Dairy Sci. 57: 738-745.Head, M. K. and Hansen, A. P. (1979) Stability of L- ascorbic acid added to whole, chocolate, and low fat milks. J. dairySci. 62: 352-354.Hekmat, S and McMahon, D.J. (1997) Manufacture and quality of iron fortified yoghurt. J. Dairy Sci. 80: 3114-3122.

Fortification of Milk and Milk Products for Value AdditionHekmat, S. and McMahon, D. J. (1997) Manufacture and quality of iron fortified yoghurt. J. Dairy Sci. 80: 3114-3122.Hicks, T. Hansen, A. P. and Rushing, J. E. (1996) Procedures used by north Carolina dairies for Vitamins A and Dfortification of milk. J. Dairy Sci. 79: 329-333.Ilic, D. B. and Ashoor, S. H. (1988) Stability of vitamins A and C in fortified yoghurt. J. Dairy Sci. 71:1492-1498.Indyk, H., Littlejohn, V. and Woodland, D. C. (1996) Stability of Vit D3 during spray drying of milk. Food Chem. 57:283-286.Jackson, L. and Lee, K. (1991) Microencapsulated iron for food fortification. J. Food Sci. 56: 1047-1050.Johnson, L. E. (1994) Vitamin and mineral fortification in foods. Food Technol. 124.Kiran, R., Amma. M. K. P. and Sareen, K. N. (1977) Milk fortification with a system containing both iron and ascorbicacid. The Indian J. Nutr. Dietet. 14:260-266.Kiran, R., Kaur, I. P. and Vaneja, K. (19860 Studies on the acceptability and availability of fortificants present in milkand whey. J. Food Sci. 23: 110-111.Labin-Goldscher, R and Edelstein, S (1996) Calcium citrate: a-revised look at calcium fortification. Food Technol. 96-97.Lopez, G. B., Terre, J. M. Q., Lopez, B. G. and Terre, J. M. Q. (1996) Calcium enrichment of skim milk subjected to UHTtreatment. Almentaria 34: 79-82.McNamara, S. H. (1995) Food fortification in United States: a legal and regulatory perspective. Nutr. Reviews 53: 140-144.Mertz, W. (1997) Food fortification in United States. Nutr. Reviews 55: 44-49.Mortensen, B. L. and Gotfredsen, P. (1996) Fortification- nutritional improvement of dairy products. Danish Dairy FoodIndustry..worldwide 64-65.Newsome, R.L. (1997) Use of vitamins as additives in processed food. Food Technol. 163-168.Nordmark, B. (1999) A brief history of fortification. Food Technol.15-16.O’Brien, A. and Robertson. D. (1993) In. The technology of vitamins in Food. P. Berry Ottaway (Ed.) p-30.Olivares, m., Pizarro, F., Pineda, O., Name, J. J. Hertrampf, E. and Walter, T. (1997) Milk inhibits and ascorbic acidfavors ferrous bis-glycine chelate bioavilability in humans. American Society Nutr. Sci. 1407-1411.OMNI/Roche/USAID (2001) Fortification basics: Milk. http://www. roche.comRao, B. V. R. and Mathur, B. N. (1988) Stability of vitamins A, D and E in spray dried infant formula during storage.Indian J. Dairy Sci. 41:86-88.Richardson, D. P (1990) Food fortification. Proceedings of the Nutrition Society. 49: 39-50.Rosenthal, I., Rosen, B. and Bernstein, S. (1993) effects of milk fortification with ascorbic acid and iron. Milchwissenschaft48: 676-679.Saini, S. P. S., Jain, S. C. and Bains, G. S. (1987) Effect on iron fortification on flavour of buffalo milk. Indian J. Dairy Sci.40: 88-93.Sloan, A. E. and Stiedemann, M. K. Food Technol. 100-108.Subbulakshmi, G. and Nai(1996) Food fortification: from public health solution to contemporary demand. l, M. (1999)Food fortification in developing countries- current status and strategies. J. Food Sci. Technol. 36: 371-395.Sweeney, M. A. and Ashoor, S. H. (1989) Fortification of cottage cheese with vitamins A and C. J. Dairy Sci. 72: 587-590.Tateo, F., Bononi, M., Testolin, G., Ybarra, L. and Fumagalli, M. (1997) Experiments in the use of calcium and magnesiumlactates in milk enrichment. Industrie-Almentari 36: 614-617.Vahcic, N., Palic, A. and Ritz, M. (1992) Mathematical evaluation of relationship between copper, iron, ascorbic acidand redox potential of milk. Milchwissenschaft 47:228-230.Weaver, C.M. (1998) Calcium in food fortification strategies. Int. Dairy J. 8: 443-449.Ziegler, E. E. and Fomon, S. J. (1996) Strategies for the prevention of iron deficiency: iron in infant formulas and babyfoods. Nutr. Reviews. 54: 348-354.35

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIntroductionPackaging of Value Added Foodsand Their Storage StabilityP. P. GothwalCentral Food Technological Research Institute, Reseach Centre, LucknowIndia produces nearly 300 million MT of food products which comprise cereals, pulses, fruits,vegetables, mushrooms, algae, spices and plantation, meat, fish, poultry, milk and dairy basedproducts. It is estimated that nearly 30% of produce is lost due to poor handling, processing andpackaging. In the present scenario packaging has been identified as an integral part of processing inthe food industry. Packaging sector is an important global industry representing about 2% of GNP ofdeveloped countries. The value of packaging industry is expected about 345 Million Euros world widewith 50% for packaging of food materials. Scientific method of packaging and safe transportation offood materials plays a significant role in reducing the post harvest processing losses. Food, both in itsfresh and processed form needs appropriate packaging to facilitate storage, preservation, transportationand distribution. Packaged foods offer enormous export opportunities and foreign exchange earningsto the country. Research and development in the area of food packaging has resulted in building up adatabase on deteriorative characteristics and packaging needs of a large number and varieties of foodproducts stored under different environmental conditions. Accelerated testing conditions drasticallycut down the time required to identify suitable packaging materials to increase shelf life of processedfood products under various controlled conditions.Packaging is a coordinated system of preparing food for transportation, distribution, storage,retailing and end use. It is mean to ensure safe delivery of product to the ultimate consumer in soundcondition at minimum cost. Projected growth rate of demand and consumption for packaging in Indiais 10%. Value added processed food products comprising of fruits & vegetables based, cereal andpulses based, meat/fish/poultry based products, milk and dairy based products need specializedtypes of packages depending upon the type of preservation method used and extent of storage desired.All successful food processing industries continually develop and launch new value added productswith new attracting packaging. To ensure that these new value added products perform well in themarket, the food industries have to follow product development with food packaging procedures,which maximize their chances of success and reduce their risk of failure. Some food is made possibleby the introduction of new technology and new packaging technologies. New or latest technologiesunder active development or in the early stages of adoption as such can be expected to impact on thetype of value added products developed in the future.Different packaging materials:Packaging of fresh produce in consumer unit packs at the producing centers or terminal marketsprotects the produce against damage and excess moisture loss. The packaging materials used i) shouldhave sufficient permeability to oxygen, carbon dioxide and water vapor ii) should have desiredprotective physical properties, iii) should be transparent. The permeability requirement dependsupon rate of respiration of the produce, the package bulk density and temperature of storage. Foodpackaging can be categorized in to primary, secondary and tertiary types.• Primary packaging is the material that first envelopes the product and holds it. This usuallyis the smallest unit of distribution or use and is the package which is in direct contact with thecontents. Primary packaging is the main package that holds the food that is being processed.• The secondary packaging is outside the primary packaging, perhaps used to group primarypackages together. Secondary packaging combines the primary packages into one box being made.Corrugated fiber board is most commonly used to make secondary shipping cartons.36

Packaging of Value Added Foods and Their Storage Stability• Tertiary packaging is used for bulk handling, warehouse storage and transport shipping. Themost common form is a palletized unit load that packs tightly into containers. Tertiary packagingcombines all of the secondary packages into one pallet. Examples-• Form-Fill-Seal packaging• Bag-in-box• Dip-a- sauca packaging• Combi system of packaging• Boil in bag packs• Metals cans• Retort able pouches and traysPackaging material consumption pattern:With changing consumer preferences, the composition of substrate used in packaging industryhas also changed. The consumption pattern of various packaging material is shown below:Selection of packaging system for processed foods:• Drastic changes are seen in the system of foodsupply. The conventional means of harvesting Material India% Global%processing and handling are slowly replaced byPaper and paperboard 40 29improved systems, bringing in modernization. ItGlass 16 8is obvious that the produce in its natural or valueadded processed form should also be properlystored, so that it is available during non-seasonalperiod and in emergency.MetalPlasticOthers51524193905• The selection of package for a food product is to Source: Indian Institute of Packaging, New Delhiidentify the properties of the food, its sensitivityto environment, the length of life desired, the(2010 report)market condition, consumer needs and existing regulation. The technological need is to evaluatethe ‘product-package compatibility’. A product can be sensitive and susceptible to differentfactors like bio-chemical changes and microbial changes; physical and chemical (including toxicand traces elements), flavor loss, odor pick up, texture, moisture and gases.Packaging used for fresh produce:Corrugated Fiber Board boxes (CFB):These are most commonly used shipping container. Their major attributes are;• Low cost to strength and weight ratio• Smooth non abrasive surface that is minimum bruising damage• Good cushioning characteristics• Excellent printability• Easy to set up and collapsible for storage• Reusability and recycle• Easy handling and stack ability• Can be turned out quickly in to highly precise and accurate sizes; can be appropriately punchedfor ventilation and the most acceptable form in international markets.• Most of the perishables exported from India are packed in CFB cartons.• Plastic corrugated boxes: In recent years plastic corrugated boxes made of polypropylene (PP)and high density polyethylene (HDPE) are partly replacing CFB. Its advantage over CFB is lowweight to strength ration high degree of wet resistance and its reusability.37

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceModified atmosphere packaging:MAP is the method for extending the shelf life of perishables by altering the relative proportion ofatmospheric gases that surround the food. This is becoming increasingly popular technique to meetboth distribution and retailing needs of fruits and vegetables. Modified atmospheric conditions arecreated inside the packages by the commodities themselves by controlling respiration and selectingsuitable permeable films or by using carbon dioxide and ethylene absorbers (scavengers) withinthe package to prevent the build up of a particular gas. Compounds like hydrated lime, activatedcharcoal, and magnesium oxide are used to absorb carbon dioxide, iron powder for absorbing oxygenand potassium permanganate, squalene and phenyl methyl silicone for absorbing ethylene within thepackage. The modified atmosphere desirable for vegetables comprises reduced oxygen (2-3%) andincreased carbon dioxide levels (10%).Future scope of tinplate container:• As long as the tin metal exists in the earth’s crust, tinplate continues to be an ideal packagingmaterial for processed foods and beverages. There is a good scope in reducing the thicknessof tin coating if suitable lacquer is coated, which may help in reducing the cost of container.Recycling of tinplate container is another important aspect to be considered.Packages for specific processed food products:Bakery based processed food such as breads, buns, cakes, biscuits, pastries, etc. ensured by veryshort life. The goal of these products packaging is partial moisture control especially in breads, but themain purpose is to allow the product to be distributed safely and hygienically. Still cakes and pastriesare often packs in cardboard boxes. The packaging material recommended for bakery industry isof good quality waked papers, cellophane etc. There is a good scope in the development of goodpackaging material for bakery and confectionary products.Statutory marking, international packaging regulations:Standards and Regulatory issues are dealt with by multiple agencies: Most of the packaging relatedregulatory initiatives are concerned with the product quality, public health and hygiene, safety, Exportpromotion, transportation and consumer protection.BIS : All Agricultural productsDMI : Spices, walnuts, casings, fruits and vegetablesPFA : Pesticides residues, contaminantsEIC : Only export inspectionAPEDA: Only export standardsPPA : Issue of phytosanitary certificatesCodex : International standards on processed foodsAreas of research and development in food packaging:• Design and development of suitable packages based on processed food products characteristicsand performance properties of packaging materials, and finished package forms• Development of economical, flexible packages for processed food/agro based products• Development of indigenous aluminum containers for processed food/agro based productsfoods and beverages• Pre-packaging and bulk-packaging of fresh as well as processed produce• Safety evaluation of packaging components and plastic packaging materials for food contactapplicationsDevelopment of environment-friendly packaging materials today need• Utilization of agricultural waste materials and eco-friendly natural and synthetic materials• Development of bio-film from secretion of insects38

Packaging of Value Added Foods and Their Storage Stability• Design and fabrication of packaging machinery such as bio-plate making machine• Development of vacuum packaging equipment; volumetric machine for filling free-flowingsolid materials; continuous heat sealers for flexible films; and vibration testers with variableamplitude• Functional and economical (and suitable for marketing and distribution) package design fora variety of processed food products including traditional foods, infant foods, bakery andconfectionery products• Design of transport packages for fresh produce and processed foods, and development of costreductiontechniques in transport package design• Development of computer-aided package design techniques• Modeling and computer simulation of package performance• Standardization of process schedules for thermal processing of foods in cans, glass, tin-freesteel and aluminum containers, and retort able pouches based on heat penetration studies andsterilization value• Development of quality standards and government regulationWork carried out at CFTRI:• Technology packages for convenient and ready-to-eat foods• Economical and functional packages to contain edible oils and fats• Shelf-life prediction methods and generation of data on flexible packaging• Materials• Process modification and in-retort exhaust-cum-sterilization system for• Heat processing of food products in plastic containers• Transport package from traditional indigenous materials• Improvements in metal containers for processed food products and beverages• Migration aspects of plastic constituents into food simulants under use conditions• Development of rigid aluminum containers for packaging of processed foods and beverages• Development of bulk packages for storage and transportation of commercially important fruitand vegetables• Studies on the suitability of alternatives to tin plate containers for packing processed foodproductsTechnical services offered for:• Unit packages, transport packages, fresh-produce packages; packaging materials; computeraidedand graphic package designs; fabrication of canning and other packaging machinery• Sorption isotherm studies and shelf-life studies in controlled environments for inland and exportmarkets• Thermal processing of foods: Establishment of processes and evaluation of containers• Testing of packaging materials for their physico-chemical properties, safety and transportworthiness• Migration testing for food-grade quality of plastic packaging materials• Evaluation of finished packages for performance under simulated storage and distributionconditions• Routine quality control services39

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIntroductionNovel Technologies for Processing andPackaging of Health Foods and BeveragesH. N. MishraIndian Institute of Technology, KharagpurFood is basically energy – a form of solar energy - stored in plant and animal foods in chemicalforms. On consumption, this stored form gets converted to physiological energy. Processing and storageof food become imperative because availability of food is mostly seasonal, whereas its consumptiongoes on throughout the year unfettered by any types of seasonal bounds. Over the last five decades,India has made great strides in the production of food grains, milk, fruits and vegetables etc., andthere is semblance of self-sufficiency, albeit fragile in view of the burgeoning population. Even so,the net amount of the produce for consumption is further reduced due to insufficient storage andprocessing.Food processing industry is one of the largest manufacturing industries worldwide and possessesglobal strategic importance. With the advancement of science and technology, new food processingtechnologies are capturing the attention of many scientists in academia and industry. Consumersprefer high-quality foods with longer shelf life and, clearly, some of the new technologies can meetthese demands. Newer strategies have been devised to modify the existing food processing techniquesand the adoption of novel processing technologies.In industrialized countries the market for processed foods is changing. Consumers no longerrequire a shelf life of several months at ambient temperature for the majority of their foods. Changes infamily lifestyle, and increased ownership of freezers and microwave ovens, are reflected in demandsfor foods that are convenient to prepare, are suitable for frozen storage or have a moderate shelf life atambient temperature. There is also an increased demand by some consumers for foods that have fewerchanges during processing and thus either closely resemble the original material or have a healthyimage. New preservation technologies, such as high pressure processing and pulsed electric fieldsoffer advantages in meeting consumer demands of freshness, convenience and safety.Minimally processed foodsIn recent years the consumers have become more health conscious in their food choices but haveless time to prepare healthful meals. As a result the market demand for “minimally processed” or“lightly processed” foods has rapidly increased. Consumers increasingly demand foods which retaintheir natural flavor, colour and texture and contain fewer additives such as preservatives. In responseto these needs, one of the most important recent developments in the food industry has been thedevelopment of minimal processing technologies designed to limit the impact of processing onnutritional and sensory quality and to preserve food without the use of synthetic additives.Minimal processed foods have been defined as products that include all the operations whichadd some value to conventional food preservation processes like washing, selecting, peeling, slicing,chopping, coring and packaging that cause fewer possible changes in food quality and maintain theirquality attributes similar to those of fresh produce, but at the same time provide the food enoughuseful life to transport it from production site to the consumer. Minimal processed foods may bemeant for direct consumption or can be later transformed in to the final products by any conventionaltechniques.The demand for minimally processed, easily prepared and ready-to-eat ‘fresh’ food products,globalization of food trade, and distribution from centralized processing pose major challenges forfood safety and quality. Recent food-borne microbial outbreaks are driving a search for innovative40

Novel Technologies for Processing and Packaging of Health Foods and Beveragesways to inhibit microbial growth in the foods while maintaining quality, freshness, and safety. Oneoption is to use packaging to provide an increased margin of safety and quality. The next generationof food packaging may include materials with antimicrobial properties. These packaging technologiescould play a role in extending shelf-life of foods and reduce the risk from pathogens. Antimicrobialpolymers may find use in other food contact applications as wellTraditional thermal processing techniques can be both beneficial to foods in such areas aspreservation and flavor formation but detrimental in damaging other sensory and nutritionalproperties. Minimizing undesirable changes can be achieved in a number of ways, whether throughmore effective process control, the use of High Temperature Short Time (HTST) techniques such asaseptic processing, or newer technologies such as volume heating methods. The various approaches andthe range of technologies such as infrared heating, dielectric methods such as the use of microwaves,and ohmic heating is complemented by the following alternatives to thermal processing, ranging fromirradiation to high pressure processing and the use of pulsed electric fields.Ultrasound method (USM)Ultrasound is probably the most simple and most versatile method for the disruption of cellsand for the production of extracts. It is efficient safe and reliable. Ultrasound techniques have therelatively low cost and robust process. Ultrasound cavitation creates shear forces that break cell wallsmechanically and improves material transfer. This effect is being used in the extraction of liquidcompounds from solid cells. The compound to be dissolved into a solvent is enclosed in an insolublestructure. In order to extract it, the cell membrane must be destructed. For the purpose, ultrasound isfaster and more completed than maceration or stirring. The particle size reduction by the ultrasoniccavitation increases the surface area in contact between thesolid and liquid phase, significantly. The mechanical activityof this technique enhances the diffusion of the solvent intothe tissue; Ultrasound breaks the cell wall mechanically bythe cavitation shear forces at it facilitate the transfer from thecell into the solvent. This technique has potential advantagesover other techniques including freedom from radiationhazards, which may appear in some of the existing nondestructivemethods. The presence of the small gas bubblesin a sample can greatly attenuate ultrasound making signaldetection impossible. This can be solved by using reflectionFigure 1 Ultrasound set up for crystallization measurements rather than transmission measurement.Figure 1 shows an ultrasound set up for crystallization.In United States, ultrasound techniques are being used for processing of fresh juices like oranges,mango, grape fruit, plum, purees, sauces and dairy products. Oil extraction from oil seed, cell membranepermeabilization of fruits like grapes, plums and mango, extraction of lipids and proteins from plant seedssuch as soybean, extraction of phenolic compounds from vascular structures by disrupting plant tissuesetc are also achieved by this method. The most effective use is for microbial and enzyme inactivation. Thistechnique is used even in the emulsification, dispersing and homogenizing as well as to improve chemicalreactions and surface chemistry or to influence crystallization process.Oscillating Magnetic Fields (OMF)Inactivating microbes has the potential to pasteurize food with an improvement in the quality andshelf-life compared to conventional pasteurization processes. Strong static or oscillating magnetic fields(5-50 TesLa) have the potential to inactivate the vegetative microorganisms. The impulse duration is inbetween 10us and several milliseconds and the frequencies are maximally 500 MHz because above thisitems begin to warm up noticeably. The preservation of foods with oscillating magnetic field involvessealing of foods in a plastic bags and subjecting it into 1-100 pulses in can OMF at temperature of 0°C to50°C for a total exposure time ranging from 25 to 100 minutes and for this no special preparation of food41

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceis required. Magnetic field treatments are carried out at atmospheric pressure and at a temperaturethat stabilizes the food material. It does not have any influence on the organoleptic properties as thetemperature raises only 2-5°C.High pressure processing (HPP)In this food processing method the food is subjected to very high pressure (up to 8.4 kg/cm2) tokill bacteria present in the raw food. This technique can improve food safety by destroying the bacteriathat can cause food borne illness and spoilage and parasitesthat causes diseases. High pressure works like heat to killbacteria, but the food remains fresh and rich. In a typicalprocess, pre-packaged raw product is placed in a pressurechamber and subjected to very high pressures for specifictime (< 10 minutes). This process causes high changes in thecharacteristics of food. The foods can be kept for a longerperiod under better condition. Small molecules which arethe characteristics of flavouring and nutritional componentstypically remain unchanged by pressure. These pressureprocessed foods have better texture, nutrient retentionand colour compared to heat processed foods. Any foodwith sufficient moisture can be subjected to high pressureprocessing. This technique can be used to process both the Figure 2 : A typical high-pressure processingsystem for treating pre-packaged foodsliquid and solid foods expect for food materials containinglarge quality of air pockets.This technique was first time used by Royer (1895) to kill bacteria and subsequently in 1899 byHite to see its effect on milk, meat, fruits and vegetables. In Japan, in 1990 first commercial productslike fruit juices, jams, fruit topping and tenderized meats were introduced. HPP treatment consumesless energy e.g. energy required pressurization at 400 MPa is equivalent to heating the same materialat 300 °C. The main benefits of HPP in food processing include inactivation of microorganisms,structural modification of biopolymers and depression of freezing point of water. These could be usedadvantageously in several segments of food industry including sea food meat and meat industry.Since 1990 onwards, in Japan, HPP treatedjam prepared from strawberries, kiwifruit and apples are available withoutany application of heat treatment. HPPtreated orange juices, pickles, soybeanpaste, rice, seaweeds are available inJapanese markets. The key components ofa high-pressure system are the pressurevessel, pressurizing system, and ancillarycomponents (Figure 2).The processing by HPP is carried outusually in a low compressibility liquidsuch as water. The second principleis that of Lechatelier which states thatphenomenon of phase transition chemicalFigure 3: Schematic representation of microwave drying processchanges etc are accompanied by decreasein volume are favoured by pressure andvice versa. Pressure influences most biochemical reactions occurring in foods since they often involvea change in volume. Pressure may also inhabit the availability of energy by affecting energy producingenzymatic reactions.42

Novel Technologies for Processing and Packaging of Health Foods and BeveragesMicrowave processingThe increasing consumer demands for foods which offer more convenience in usage and timesavings in preparation made microwave over as an alternative for conventional thermal ovens. Themicrowave processing has been made use of for drying of fruit juices, pulps, apple segments andfinished drying of potato chips. Microwaves are endowed with some special characteristics such as, highpenetrating quality which results in the uniform heating of materials, selective absorption of radiationby liquid water and capacity for easy control. These impart some unique effects to the dehydratedmaterial such as improved quality and good texture. In the wider field of preservation, microwaveshave been used in drying, blanching and vacuum drying. Typical product areas where microwaveshave been used commercially include blanching of vegetables, where it is claimed that there is lessneed for mechanical handling with consequent better product. Also, microwaves in combination withhot air have been shown to be a positive route to drying of food stuffs, in selective product areas,where, other methods cannot be employed. Finally, microwave vacuum drying has found some outletsin producing fruit juices and meat extracts. By aim of using microwave processing in preservationin general and pasteurization or sterilization in particular is to deliver a more homogeneous heattreatment at a faster rate than conventional method of heating. Figure 3 is a schematic representationof a microwave drying system.Ohmic heatingThis technology has been around since early 1900s. Thefood processing researcher, however, began investigating thepotential of ohmic heating on food quality and cost and energysavings in 1980s. In this method an AC current is pass througha food sample which leads to generate internal energy in foods.As a result an inside out heating patterns is generated. Ohmicheating is some what similar to microwave heating but withFigure 4: Ohmic heating equipmentvery different frequencies. The advantage of this technique isthat it uniformly heats food with different densities such as chicken soup. The quality product withminimal structural nutritional and organoleptic changes can be produced. Potential application ofthis technique includes blanching, evaporation, dehydration, fermentation and extraction. It savessignificant time energy in hot air and freeze drying of foods and enhances extraction yields someprocessing operations. The parameters used during ohmic heating such as frequency of alternatingcurrent applied voltage and the temperature to which the sample was heated have a significant effecton it’s success. The electrical conductivity is also a significant factor. The ohmic heating is useful forvalue added processing, and it has great potential for use in wide variety of food processing operationsinvolving a heat and mass transfer. Ohmic heating equipment is shown in figure 4.Ohmic heating is currently used in Europe, Asia and North America to produce a variety of highquality low and high acid products containing particulates. Electrical resistance heating allows particlesand liquids to heat at the same rate and permits the rapid heating of mixtures of high solid fractions.The technique has been applied to a number of food processes, and has recently been developed intoa commercial process for the sterilization of food mixtures. Ohmic heating occurs, when an electriccurrent is passed through an electrically conducive product. Low frequency current from domesticsupply could be effectively used for ohmic heating. The ohmic heating has many advantages overconventional heating. Continuous processing is possible without any heat transfer surface. Liquid-solidmixture can be rapidly and evenly heated with minimal heat damage and residence time difference.Nutrient retention will also be more. This process can obtain fresher-tasting, high quality products withhigh microbiological safety. Maintenance cost is minimum due to absence of any moving parts. Theprocess is easy to control. Ambient temperature storage and distribution is possible when combinedwith an aseptic filling system.43

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceMembrane technologyWith the inception of new composite membranes and tubular system, reverse osmosis (RO) andultra filtration (UF) are being used extensively in food and dairy industries. RO is a single phaseconcentration process which uses a pressure gradient across a semi permeable membrane to squeezewater through membrane. RO process is extremely energy efficient compared to both evaporationand freeze concentration. Ultra filtration uses much lower pressure 1 to 10 bars and much more openmembranes, which pass salts, sugars and organics in the molecular range typically from 5,000 to1,00,000 depending on the membrane type. It is limited by osmotic pressures, since the sugars are notconcentrated.Both RO and UF have promising uses in fruit and vegetable juice industry as a unit operationfor concentration or aromarecovery and clarificationof juices respectively. Theprimary goal of UF infruit industry is to replacethe holding filtrationand decantation steps oftraditional process. Enzymetreatment is required toreduce viscosity of juice bypartially hydrolyzing. It isa clarification process toremove pectin, enzyme andother fibrous components,constituting the clear juice. For separationof molecules, semi permeable membraneis used at a temperature of 50 -55 °C (high)on 10-15 °C (low), depending on the type ofjuice and sensitivity. Tubular modules canbe used for viscous partially depectinizedjuice whereas where as pre filtration of juiceis necessary when this channel on boiled fibreUF system is used. Many case studies havedone on apple juice. UF system generates costsavings and manpower reduction, uses onlyelectrical energy to raise the pressure of juicefeed, operating costs are typically 5-10 timeslower than normal operations, process controlis simple, no cooling water equipment isneeded and products have better flavour.In nutshell, UF has become economicalviable alternative for clarification of juicein comparison to conventional method ofclarification. RO is a well established processfor concentration/pre concentration of rawand clear depectinized juice from fruits andvegetable. It consumes 10 times less energyfor renouncing water when compared withconventional evaporators.44Figure 5: A simplified general design of a pulsed electric field apparatus.Figure 6: Treatment chamber with different electrode geometriesand enhanced electric fields in the insulator channelFigure 7: Continuous PEF chamber with baffles

Novel Technologies for Processing and Packaging of Health Foods and BeveragesPulsed electric field (PEF)It was in US where in 1920s first attempt to treat milk with electro impulse was made. Further,experimentations followed in the 1960s primarily with in molecular biological research for incorporationof foreign gene materials into microorganisms. This technique involves application of pulse of highvoltage (typically 20-80 KV/cm) to foods placed between two electrodes. Only pumpable food productscan be treated. This is the more novel process. PEF imposes a strong electric field on a flowering fluidfor a very short time. Above critical field strength of about 15,000 V/cm, vegetable cells are killed.Generally higher field strength up to about 35,000 V/cm for disinfection like destruction of bacteria,fungi and other microbes. When exposed to high electric field pulses, cell membranes develop poreseither by enlargement of existing pores or by creation of new ones. The pores increase membranepermeability allowing loss of cell contents or inclusion of surrounding media either of which can causecell death. It has limited effect on pores and only appears to affect a few enzymes. Figure 5 shows asimplified design of pulsed electric field and figures 6 and 7 describe different electrode geometries inthe treatment chamber and Continuous PEF chamber with baffles respectively.PEF offers a five log reduction of most pathogens and is considered as a pasteurization processso products must be refrigerated. PEF also applies to fruit and vegetables cell well, concentration ofsewage sludge. It kills live cells and reduces their ability to retain water, greatly improves filtration.Extraction of sugars from beats and starches from potatoes can also be improved by PEF. The importantprocess variables of PEF include the electric field, temperature, pressure and time of exposure. PEFunits differ primarily in their fluid handling capacity: OSU-4, has 0.5-1.0 cm diameter tubing; OSU-5,has 1 cm diameter tubing; and OSU-6, has 1-1.2 cm diameter tubing.Food irradiationFood Irradiation is the new addition to the methods of food preservation. A great deal of workis being carried out at the utilization of ionizing radiation. The irradiation of foods does destroy themicroorganisms and enzymes. It may be desirable to inactivate some enzymes by other means, incomplementation to irradiation action. Irradiation does not leave any residue in foods like chemicaland hence is safe. The sterilization of food with ionizing radiation involves a major consideration,the food products and suitable radiation source, since the temperature remains 4-50C. It is also called“cold sterilization” technique. These techniques in controlling the ripening process of fruits and alsofor checking sprouting of roots, tubers and bulbs apart from general food preservation techniques.Modified atmosphere packaging (MAP) and controlled atmosphere storage(CAS)The main objective of modified atmosphere packaging (MAP) is to interrupt or slow downthe derivative processes and also to prevent the attack of pathogens until the food is consumed.Controlled atmosphere (CA) is the alteration of the natural gaseous environment and maintenance ofthis atmosphere at pre specified conditions throughout the storage time. Modified atmosphere (MA)is the initial alteration of the gaseous environment in the immediate vicinity of stored and packagedproduct. These are used for retail distribution and for consumer product packages. The CA and MAPextend the shelf life of the product. Lot of work has been carried out and further research is on.RTE health foodsIn our country processed food product are available in both organized and unorganized sectors.Developments in production technology, emergence of new products like ready-to-eat (RTE) mixes,enhancement of product shelf life and packaging are driving the shift from the non organized toorganized commercial business. Due to growing urbanization and changing food habits, thedemand has been rising at a good pace and there is enough latent market potential waiting to beexploited through developmental efforts. It is high time for the organized sector to take initiativein technology improvement, process modeling and automation, overall improvement in quality,investment in R&D to develop new products and enhance shelf life of existing products and further45

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceimprovement in packaging. The size of the industry might increase substantially if the productportfolio were to include at least one each of the daily staples; ready chapatti from the chapatti-subzistaple and precooked or concentrated dal from the dal–chawal combination. India is a vast countrywith different eating habits and yet North Indian cuisine is an acceptable restaurant fare and theubiquitous idli and dosa are available in every part of country. From dishes consumed throughoutthe country at different eating occasions of breakfast, lunch, tea time and dinner, it should be possibleto systematically examine similarities and come up with a short list of products that would find aplace in the menu of a major part of the country, which could then be developed as processed food.The Western concept of hamburger or a sandwich and its local equivalent chapatti-subzi takeawayscooked in perceived hygienic surrounding are a boon for the working women and can be nurtured intobig business. With the increasing dominance of large and technically more sophisticated companiesin food processing, attention also should be paid to small operations, which do not enjoy the sameeconomies of scale. To this end, an increase in the number of regionally centralized facilities offeringthe latest processing technique and advice should be encouraged. It would be necessary to develop theappropriate technology to produce an authentic product, with low cost or reusable packaging and anefficient distribution system to market them at an acceptable price. The prime aim will be to provideall consumers with increasing levels of convenience.Health / nutritional benefits of functional foodsDuring recent years importance of B-complex vitamins, beta-carotene and vitamin C has beenrealized in terms of their antioxidative and anticarcinogenic properties. Fruits and vegetables arethe rich sources of these vitamins. Fermented foods and beverages possess various nutritional andtherapeutic properties. Lactic acid bacteria play a major role in determining the positive health effectsof fermented milks and related products. The L. acidophilus and Bifidobacteria spp are known fortheir use in probiotic dairy foods. Cultured products sold with any claims of health benefits shouldmeet the criteria of suggested minimum number of more than 106 cfu / g at the expiry date. Otherhealth benefits of fermented milk products include prevention of gastrointestinal infections, reductionof serum cholesterol levels and anti -mutagenic activity. They are recommended for lactose intolerantindividuals and patients suffering from atherosclerosis.Health claimsHealth claims describe a relationship between a food, food component, or dietary supplementingredient, and reducing risk of a disease or health-related condition. There are three ways by whichFDA exercises its oversight in determining which health claims may be used on a label or in labeling fora food or dietary supplement: (i) the 1990 Nutrition Labeling and Education Act (NLEA), (ii) the 1997Food and Drug Administration Modernization Act (FDAMA) and (iii) the 2003 FDA Consumer HealthInformation for Better Nutrition Initiative. Such health claims must be qualified to assure accuracy andnon-misleading presentation to consumers. FDA authorizes these types of health claims based on anextensive review of the scientific literature, generally as a result of the submission of a health claimpetition, using the significant scientific agreement standard to determine that the nutrient/ diseaserelationship is well established.Nutrient content claimsNutrient content claims describe the level of a nutrient or dietary substance in the product, usingterms such as free, high, and low, or they compare the level of a nutrient in a food to that of anotherfood, using terms such as more, reduced etc. An accurate quantitative statement (e.g., 200 mg ofsodium) that does not “characterize” the nutrient level may be used to describe any amount of anutrient present.Structure/ function claimsStructure/ function claims describe the role of a nutrient or dietary ingredient intended to affectnormal structure or function in humans, for example, “calcium builds strong bones”. In addition, they46

Novel Technologies for Processing and Packaging of Health Foods and Beveragesmay characterize the means by which a nutrient or dietary ingredient acts to maintain such structure orfunction, for example, “fiber maintains bowel regularity,” or “antioxidants maintain cell integrity,” orthey may describe general well-being from consumption of a nutrient or dietary ingredient. Structure/function claims may also describe a benefit related to a nutrient deficiency disease (like vitamin C andscurvy), as long as the statement also tells how widespread such a disease is in the United States.Technology of formulation of health foodsThere are several methods of manufacturing functional foods, based either on the method used toproduce them or on their purpose. Functional foods may be processed by modification or they may befortified with different substances and the functionality of a product can be targeted to a special diseaseor just to improve overall well being. A particular food may be made more functional by increasing oradding a potential health promoting entity. Alternatively concentration of adverse components may bereduced or there may be a partial interchange between toxic and beneficial ingredients. Health drinksare formulated taking into account the nutritional requirements or recommended dietary allowancesfor the target group. It is not only essential to balance the energy protein and vitamin requirements,but also to make it palatable, sparkling and thirst quenching.Challenges in formulation of health foodsThere are many obstacles within food system that hinder the development processes of these specificfoods. There are considerable processing losses of vitamins, and information on vitamin contentsof processed foods is essential for assessing the adequacy of vitamin intakes. Problems associatedwith the iron fortification of fruit juices and drinks have been outlined as: accelerated loss of vitaminC, flavour and taste deterioration in the presence of thiamine, folic acid, vitamin A and vitamin C,levels of fortification beyond 2.7 mg per serving result in metallic off-flavors, decolourisation of somepigments.Fortification of beverages with calcium has become a popular practice. Insoluble Ca and Mg saltscause lightening of food colour, whereas soluble salts may interact with other food components such astannins to cause darkening. The prooxidant effect of many minerals has caused rancidity developmentin lipid containing beverages. In beverages with high protein content, the addition of Ca or Mg saltshave caused destabilization of the protein component. The use of soy lecithin to coat calcium ions foruse in the calcium fortification of soymilk prevented the Ca induced precipitation of soy proteins. Inthe production of yoghurt, the low pH conditions render it unsuitable as a carrier for vitamins suchas vitamin A.Health foods for control of cardiovascular disease (CVD) & diabetesFunctional foods that are marketed with claims to reduce heart disease focus primarily on the riskfactors of blood cholesterol, homocysteine and hypertension. This can be done by a reduced content offood components that are known to increase risk, saturated fat or sodium. More recently products havebeen designed that are enriched in components thought to reduce risk. The most common protectiveingredients include fibres, ώ-3 fatty acids, phytostanols, phytosterols and (antioxidant) vitamins.Replacement of saturated or trans fat in the diet by carbohydrates or other types of fat reduces the riskof coronary heart disease (CHD). High intakes of tea rich in catechins and other flavonoid polyphenolshave also been associated with a reduced risk of CHD. Many well-controlled trials have documentedthe efficacy of sterols and stanols for lowering low density lipoprotein (LDL) cholesterol. A highconsumption of soy protein has been associated with a low risk of cardio vascular disease (CVD) inecological studies. Besides soy protein, isoflavonones (phytoestrogens) such as genistein might beresponsible for the effects on CVD risk. Thus, any dietary pattern combining a high intake of naturalantioxidants, a low intake of saturated fatty acids, a high intake of oleic acid, a low intake of ώ-6 fattyacids and a high intake of ώ-3 fatty acids would logically produce a highly cardio protective effect.Diabetes mellitus is a heterogeneous metabolic syndrome with several different causes characterizedby chronic hyperglycaemia with partial or total lack of insulin secretion and a reduced sensitivity to47

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancethe hormone in peripheral tissues. If monitored inadequately and associated with other lipid andprotein disorders, long term complications may develop in several organs and systems, resulting inboth high morbidity and mortality rates. Type 1 diabetes is the result of complete β-cell destruction.Type 2 diabetes is the primary result of either insulin resistance or deficiency in insulin secretion,and having a completely different clinical perspective and presentation is usually characterized bya mixture of the two. It has been suggested that for type 1 diabetes an early exposure to cows’ milkproteins may play a role in triggering the immune response that destroys pancreatic β-cells. In generala good nutritional diet that is low in fat and salt is important. For someone with type 1 diabetes,regular meal times and snacks and the right proportion of nutrients should be emphasized. Someonewith type 2 diabetes, where in most cases weight reduction is necessary, not only should considercalorie intake but also the component and type of food that is eaten.ConclusionImproving food technology not only improves health, but reduces poverty. When food productsare safe, nutritious, well marketed, and competitively priced thanks to efficient manufacturing, theyattract consumers. Rising consumer demand, in turn, expands a nation’s entrepreneurial base in foodproducts, creating jobs and raising family incomes. Larger family food budgets then contribute to afurther drop in malnutrition. New preservation technologies, such as high pressure processing andpulsed electric fields offer advantages in meeting consumer demands of freshness, convenience andsafety. There is no single process that will allow the high-quality production of every food productwhile ensuring safety; all of these processes, as well as thermal processing, have their own set oflimitations and advantages.ReferencesCánovas, B. G. V, Gongora-Nieto, M.M., Pothakamury, U. R. and Swanson, B. G. (1999). Preservation of foods with pulsedelectric fields. 1-9, 76-107, 108-155. Academic Press Ltd. London.Chandrasekhar, U. (2004) Soy proteins - an ideal functional food for growth promotion.Proc Nutr Soc Aust , Vol. 28. Asia Pac J Clin Nutr 2004; 13 (Suppl):S118.Gonçalo,E. B. (2003) Certificação de sistemas de qualidade na indústria de laticínios, Revista do Instituto de LaticiniosCândido Tostes 58 , (333): 9–14http://www.fao.org/ ag/ags/agsi/Nonthermal/nonthermal_1.htmIlbery, B. and Kneafsey, M. (2000). Producer constructions of quality in regional speciality food production: a casestudy from South West England. Journal of Rural Studies 16 2 (2000), pp. 217–230.Ruecroft, G. (2007) Power Ultrasound, Crystals and Particle Engineering, Paper presented in “Chemsource Symposium2007” during 27th & 28th June at RAI, Amsterdam.Zhang, M and Xu, Y. Y. (2003) Research developments of combination drying technology for fruits and vegetables athome and abroad, Journal of Wuxi University of Light Industry 22, (6): 103–106.48

Glycomacropeptide – Biological Properties and its ApplicationIntroductionGlycomacropeptide – BiologicalProperties and its ApplicationRajan Sharma and Neelima SharmaDairy Chemistry Division, NDRI, KarnalWhey proteins have been singled out as a super star ingredient for health promoting productsincluding ones formulated for weight loss, infant nutrition and immune support. The major wheyproteins are α-lactalbumin (α-la), β-lactoglobulin (β-lg), bovine serum albumin, immunoglobulinsand lactoferrin. In addition, sweet whey/rennet whey also contains glycomacropeptide (GMP) whichis a C-terminal hydrophilic glycopeptide released from κ-casein (κ-CN) by the action of chymosinduring cheese making. GMP lacks aromatic amino acids (phenylalanine, tyrosine, and tryptophan),and contains varying amounts of sugars which are made up of N-acetylneuraminic acid (sialic acid orNANA), galactose, and N-acetylgalactosamine.GMP found in sweet whey is an acidic glycopeptide. The bond sensitive to chymosin (rennin)hydrolysis occurs between the phenylalanine (Phe) residue at position 105 and the methionine (Met)residue at position 106. The hydrolytic products are para κ-CN (residue 1-105) and macropeptide(residue 106-169). Next to β-lg and α-la, GMP is the most abundant protein/peptide in wheyprotein isolate (WPI) and whey protein concentrate (WPC) produced from cheese whey with typicalconcentrations between 20-25% of the proteins (Thoma-Worringer et al., 2006). It is a heterogeneouspeptide of 64 amino acids formed by κ-CN (Delfour et al., 1964). It contains 47% (w/w) indispensableamino acids, but contains no histidine (His), tryptophan (Trp), tyrosine (Tyr), arginine (Arg), cysteine(Cys) or Phe (Laclair et al. 2009). There are four hydrophobic domains in GMP and most of them aremasked by the strong charge density of the glutamic acid (Glu) and asparatic acid (Asp) residuesover a wide range of neutral and basic pH, therefore the hydrophobic domains cannot interact. Onlythe N-terminal hydrophobic domain (amino acid 1-5) is not covered by the negative charge and isavailable for interaction (Kreub et al., 2009).GMP has received much attention in recent years because of its several biological properties.The various biological activities of GMP include its ability to bind cholera toxin and Escherichia colienterotoxins, inhibition of bacterial and viral adhesion, modulation of immune system responses,promotion of bifido-bacterial growth, suppression of gastric secretions and regulation of bloodcirculation etc. Further, GMP can find application in various food systems because of its functionalcharacteristics, mainly its high solubility and emulsifying properties.Chemical properties of GMPGMP is one of the various names given to the peptide formed by κ-CN rupture. This peptide is alsoknown as caseinomacropeptide (CMP) or casein-derived peptide (CDP). Usually GMP refers to theglycosylated form, due to its high carbohydrate content, and CMP to the peptide´s non-glycosylatedform. Its composition varies and depends particularly on the whey source and on the technology usedfor its isolation (Martín-Diana et al., 2006). The major chemical properties of GMP include:• Glycosylation;• Isoelectric point and UV absorption;• Molecular weight;• UV Characteristic1. Glycosylation: The glycosylated form represents 50 to 60% of total GMP and the carbohydratepart is composed of galactose, (Gal) N-acetylgalactosamine (GalNAc) and N-acetylneuraminic acid(NeuAc) (Thoma et al., 2006). The most predominant is NeuAc, known as sialic acid. GMP purified to49

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance90% is highly glycosylated with 7 to 8% sialic acid (Martín-Diana et al., 2003). Sialic acid present in theGMP gives the peptide anionic character and may react with other compounds like thiobarbituric acid(TBA) and ninhydrin to give chromophores which can be spectrophotometrically determined. Thisproperty can be utilized for the estimation of GMP as the sialic acid content and can be correlated withthe GMP concentration. In one approach Nakano and Ozimek (1999) determined the sialic acid contentfor the estimation of GMP in cheese whey by using TBA. The other approach for the determinationof sialic acid content in GMP has been given by the use of acidic ninhydrin by spectrophotometricmethod (Fukuda et al., 2004).2. Isoelectric point and UV absorption: The exact isoelectric point of GMP is still unclear. Usinganion exchange chromatography Nakano and Ozimek (2000) suggested that all sialylated GMP hadan apparent pI < 3.8. GMP is rich in branched-chain amino acids (valine and isoleucine) and it lacksaromatic amino acids, including phenylalanine, tryptophan and tyrosine (Oliva et al., 2002).3. Molecular weight: Several works have informed that the theoretical molecular weight of GMPis between 7 and 8 kDa. Some authors suggest that GMP has the ability of associating and dissociatingunder selected pH conditions. Kawasaki et al. (1993a) proposed that the monomer of k-casein GMP ofmolecular weight 9 kDa is obtained at pH ≤ 4 and the polymer of k-casein GMP of molecular weightbetween 45- 50 kDa is obtained at pH higher than 4. Later, Nakano and Ozimek (1998) also studiedthe influence of pH on GMP behaviour. Using chromatography in Sephacryl S-200 gel, the authorscollected fractions that were monitored for sialic acid. The results suggested that GMP is an aggregateof three monomers and the molecular weight was not affected by changes in pH. Farias et al. (2009)studied self assembly of 3-5% (w/w) GMP at pH 3-6.5 using DLS (Dynamic Light Scattering). Thehydrodynamic diameter increased when decreasing the pH from 6.5 to 3. GMP solution at a pH below4.5 shows time dependent self assembly at room temperature, which over time leads to gelation.Currently there is an overall consensus that the experimental molecular weight of GMP is higher thanthe theoretical weight.4. UV Characteristic: Because of the absence of aromatic amino acids, GMP has no absorptionat 280 nm. It is known that GMP is only detected in the range of 205-217 nm and differences in theabsorption at 210/280 nm are frequently used to characterize GMP (Oliva et al., 2002).Biological activities and nutritional propertiesBiological activity of bovine GMP has received much attention in recent years. The variousphysiological functions attributed to GMP include:• Binding of cholera toxin (CT);• Inhibition of bacterial and viral adhesion;• Suppression of gastric secretions;• Promotion of Bifidobacterial growth;• Modulation of immune system response;• Regulation of blood circulation through antihypertensive and antithrombotic activity;1. Binding of cholera toxin (CT): Kawasaki et al. (1992) showed that GMP is capable of bindingCT. Normal Chinese hamster ovary (CHO)-K1 cells are spherical but in the presence of CT, CHO-K1cells take on a spindle shape. As little as 20 ppm GMP is enough to cause considerable rounding ofCHO-K1 cells and 100 ppm GMP results in almost completely rounded CHO-K1 cells which indicatethat GMP has bound to CT. When the GMP was treated with sialidase, which hydrolyses the sialicacid, complete loss of CT inhibiting activity occurred. The peptide chain must also participate in thebinding as partial loss of CT inhibiting activity occurred after treatment with proteases. CT bindingactivity of purified GMP from bovine κ-CN was also detected by Oh et al. (2000) using ELISA. The CTbinding activity is rapidly lost by carbohydrase treatment.50

Glycomacropeptide – Biological Properties and its Application2. Inhibition of bacterial and viral adhesion: Many bacteria and viruses bind themselves totheir hosts as a part of the colonization process. Binding to the intestine or other mucosal surfaces isachieved by adhesins, capsular material on the bacterial cell surface or hair-like fimbriae or pili whichare specific for the various ceramide and ganglioside glycoconjugates which make up epithelial cellmembranes (Simon, 1996). Nakajima et al. (2005) studied the prevention of intestinal infection by GMP.The binding ability of GMP to intestinal pathogenic bacteria was evaluated by a binding assay withbiotinylated bacteria. GMP showed the ability to bind to Salmonella enteritidis and enterohemorrhagicE.coli O157:H7. This binding ability was decreased by a sialidase treatment and completely eliminatedby periodate oxidation indicating that sialic acid in GMP are involved in binding to the bacteria.Neeser et al. (1988a) investigated the mechanism by which milk components prevent dental caries.They evaluated the role of GMP in inhibiting adhesion of cariogenic bacteria (Streptococcus mutans,S. sanguis, S. sobrinus and Actinomyces viscosus) to oral surfaces. Haemagglutination by S. mutans, S.sanguis and A. viscosus is prevented by GMP with a disaccharide (Gal β1 → 3GalNAc - O – R).3. Suppression of gastric secretions: Guilloteau et al. (1994) while investing the effect of GMPon gastric secretion in preruminant calves found that intravenous injection of GMP had no inhibitionof gastric secretion. Beucher et al. (1994b) found that feeding GMP fraction, stimulated the intestinalhormone cholecystokinin which, in turn, regulates gastrointestinal functions. Yvon et al. (1994)demonstrated that GMP acts by triggering receptors on the intestinal mucosa.4. Promotion of bifidobacterial growth: Supplementation of milk with 2% GMP, either ofbovine, ovine or caprine origin increased the counts of Bifidobacterium lactis by 1.5 log cycles after 24h incubation at 37°C when compared with unsupplemented milk (Janer et al., 2004).5. Modulation of immune system response: Splenocyte (spleen lymphocyte) proliferation is astep in the inflammatory response. Inhibition of splenocyte proliferation can be used to demonstratesuppression of an immune response such as an allergic reaction. Research by Otani et al. (1992)demonstrated that casein inhibits mouse splenocyte proliferation induced by the mitogen Salmonellatyphimurium lipopolysaccharide (LPS). Inhibitory activity was due to κ-casein, which upon rennethydrolysis, results in inhibitory activity being found in the GMP fraction. Para- κ-casein had noinhibitory activity. Upon sialidase digestion, GMP lost its inhibitory activity, indicating that sialic acidis critical to the phenomenon (Otani and Monnai, 1993). Inhibitory activity was reduced after GMPdigestion with chymotrypsin but inhibitory activity increased after GMP digestion with trypsin orpronase so the peptide chain must also participate.6. Regulation of blood circulation through antihypertensive and antithrombotic activity:Bovine, ovine, and caprine GMP can inhibit platelet aggregation and, therefore, the formation ofthrombi, because the region 106–116 of κ-casein (casoplatelin) is analogous to the fragment 400–411of fibrinogen γ-chain (Jolles et al., 1986). Peptides with in vitro angiotensin I converting enzyme(ACE)-inhibitory activity were liberated from bovine, ovine and caprine GMP either by proteolysiswith trypsin or simulation of the GMP digestion under gastrointestinal conditions (Manso andLopez-Fandino, 2003). This suggests that intact GMP and its tryptic peptides may play a role in thephysiological regulation of blood pressure, although tryptic hydrolysates exhibited higher levels ofACE inhibitory activity than did intact GMP during subsequent digestion, which justifies their use asfood components.Along with the above mentioned physiological effects GMP has been found to be beneficial foroverall growth and development. GMP is rich in branched-chain amino acids and low in Met, whichmakes it a useful ingredient in diets for patients suffering from hepatic diseases (Abd El-Salam et al.,1996). Additionally, the fact that GMP has no Phe in its amino acid composition makes it suitable fornutrition in cases of phenylketonuria. Nevertheless, because of its high content of Thr, GMP can causehyperthreoninemia (Fanaro and Vigi, 2002; Rigo et al., 2001). GMP supplementation has also beenfound to increas zinc absorption (Kelleher et al., 2003). The sialic acid content of GMP is also interestingin terms of bioactivity. Large amounts of this carbohydrate are found in the brain and in the centralnervous system in the form of gangliosides and glycoproteins, which contribute to the functioning of51

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancecell membranes and membrane receptors and to normal brain development. An in vivo experimentwith laboratory animals has shown that the exogenous administration of sialic acid increased theproduction of ganglioside sialic acid in the brain, improving learning ability (Wang et al., 2001). Thiseffect could also be achieved with dietary GMP (Wang et al., 2004).Functional and technological properties/applications of GMPGMP can also be taken up as a functional ingredient in various speciality products like infantformulas, nutrition bars, medical foods (PKU), diet foods, oral care products and dietary supplementsbecause the development of innovative foods with an additional health benefit is a goal for the foodindustry.The characteristics of GMP not only permit medicinal and dietary applications, but also givethe molecule a great potential as a structural agent for food, since its glycosidic structure suggestsemulsifying and foaming properties (Kulozik and Guilmineau, 2003). GMP showed to be stable in thepH range of 1 to 10, with minimal solubility (88%) between pH 1-5 and maximum (98%) between pH5-10. The emulsifying activity was stronger at acid pH rather than alkaline. After letting the emulsionstand for 24 hours and heating a decrease in the emulsifying activity (22-60%) at pH below 4 (Chobertet al., 1989) was observed. Wong et al. (2006) determined the functionality, foaming capacity andemulsifying activity of GMP after conjugation to fatty acids. The authors observed that the foamingcapacity was lost, whereas the emulsifying activity enhanced. The addition of GMP to fermentedgoat milk favored gel formation in a more orderly and structured manner compared to the additionof whey protein concentrate (Martín-Diana et al., 2003). However, Veith and Reynolds (2004) verifiedin their work that the presence of GMP had a negative impact on gel strength and water retentioncapacity. On the other hand, Martín-Diana et al. (2005) studied GMP of cow, ewe and goat cheesewhey, concluding that GMP had an emulsifying activity, more stable to pH variation, compared towhey protein concentrate. This suggests the possibility to use GMP as an emulsifier in foods thatundergo great pH variation during processing, such as fermented dairy products. GMP obtainedfrom goat milk was modified with lactose through Maillard reaction under relative humidity 44% andtemperature of 40°C for periods of 0 to 11 days, thus obtaining different forms of lactosylated GMP.At these conditions, the most abundant form of lactosylated GMP was the Monolactosylated (55-60%),followed by the di-, tri- and tetralactosylated species. Solubility, heat stability and emulsifying capacityof native and modified GMP were investigated. Lactosylation enhanced emulsifying capacity but didnot improve the outstanding solubility and heat stability of native GMP (Moreno et al., 2002).ReferencesAbd El-Salam, M.H.; El-Shibini, S. and Buchheim, W. (1996). Characteristics and potential uses of the casein macropeptide.Int. Dairy J. 6:327–341.Beucher, S.; Levenez, F.; Yvon, M. and Corring, T. (1994b) Effect of caseinomacropeptide (CMP) on cholecystokinin(CCK) release in rat. Reproduction Nutrition Development. 34: 613-614.Chobert, J.; Touati, A.; Bertrandharb, C.; Dalgalarrondo, M. and Nicolas, M. (1989) Solubility and emulsifying propertiesof kappa-casein and its caseinomacropeptide. J. Food Biochem. 13:457-473.Eigel, W.N.; Butler, J.E.; Ernstrom, C.A.; Farrel, H.M.Jr.; Harwalkar, V.R.; Jennes, R. and Whitney, R.M. (1984)Nomenclature of proteins of cow’s milk: Fifth Revision. J. Dairy Sci. 67:1599-1631.Fanaro, S. and Vigi, V. (2002). Protein quality and quantity in infant formulas: A critical look. Minerva Pediatrica. 54:203–209.Farias, M.E.; Martinez, M.J. and Pilosof, A.M.R. (2010) Casein Glycomacropeptide pH-dependent self assembly andcold gelation. Int. Dairy J. 20:79-88.Fukuda, S.P.; Roig, S.M. and Prata, L.F. (2004) Correlation between acidic ninhydrin and HPLC methods to evaluatefraudulent addition of whey in milk. Le Lait. 84:502-512.Guilloteau, P.; Le Huerou-Luron, I.; Chayviaille, J.A.; Toullec, R.; Legeas, M.; Bernard, C.; Roger, L. and Mendy, F. (1994)Effect of caseinomacropeptide (CMP) on gastric secretion and plasma gut regulatory peptides in preruminantcalves. Reproduction Nutrition Development. 34:612-613.Janer, C.; Pelaez, C. and Requena, T. (2004) Caseinomacropeptide and whey protein concentrate enhance Bifidobacteriumlactis growth in milk. Food Chem. 86: 263-267.Jolles, P.; Levy-Toledano, S.; Fiat, A. M.; Soria, C.; Gillensen, D.; Thomaidis, A.; Dunn, F.W.; Caen, J.P. (1986). Analogybetween fibrinogen and casein: Effect of an undecapeptide isolated from k-casein on platelet function. EuropeanJ. Biochem. 158:379–382.52

Glycomacropeptide – Biological Properties and its ApplicationKawasaki, Y., Isoda, H., Tanimoto, M.; Dosako, S. Idota, T. and Ahiko, K. (1992) Inhibition by lactoferrin and kappacaseinglycomacropeptide of binding of cholera toxin to its receptor. Biosci. Biotech. Biochem. 56: 195-198.Kawasaki, Y.; Kawakami, H.; Tanimoto, M.; Dosako, S.; Tomizawa, A.; Kotake, M. and Nakajima, I. (1993a) pHindependent molecular weight changes of k-casein glycomacropeptide and its preparation by ultrafiltration.Milchwissenschaft. 48:191-195.Kelleher, S.L.; Chatterton, D.; Nielsen, K. and Lonnerdal, B. (2003) Glycomacropeptide and α-lactalbuminsupplementation of infant formula affects growth and nutritional status in infantis rhesus monkeys. Am. J. Clin.Nutr. 77:1261-1268.Kulozik, U. and Guilmineau, F. (2003) Food process engineering and dairy technology at the Technical University ofMunich. Int. J. Dairy Tech. 56:191-198.Manso, M. A. and Lopez-Fandino, R. (2003). Angiotensin I converting enzyme-inhibitory activity of bovine, ovine andcaprine k-casein macropeptides and their tryptic hydrolyzates. J. Food Protection. 66:1686–1692.Martin-Diana, A. B.; Frias J. and Fontecha J. (2005) Emulsifying properties of whey protein concentrate andaseinomacropeptide of cow, ewe and goat. Milchwissenschaft. 60:363-366.Martín-Diana, A.B.; Gomez-Guillén, M.C.; Montero, P. and Fontecha, J. (2006) Viscoelastic properties ofcaseinmacropeptide isolated from cow, ewe and goat cheese whey. J. Sci. Food Agric. 86:1340-1349.Martín-Diana, A.B.; Pelaez, C. and Requena, T. (2003) Rheological and structural properties of fermented goat’s milksupplemented with caseinomacropeptide and whey protein concentrate. J. Dairy Sci. 86:1535-1540.Moreno, F.J.; López-Fandiño, R. and Olano, A. (2002) Characterization and functional properties of lactosylcaseinomacropeptide conjugates. J. Agric. Food Chem. 50:5179-5184.Nakajima, K.; Tamura, N.; Kobayashi-Hattori, K.; Yoshida, T.; Hara-Kudo, Y.; Ikedo, M.; Sugita-Konishi, Y. and Hattori,M. (2005) Prevention of intestinal infection by Glycomacropeptide. Biosci. Biotechnol. Biochem. 69:2294-2301.Nakano, T. and Ozimek, L. (1998) Gel chromatography of glycomacropeptide (GMP) from sweet whey on SephacrylS-200 at different pH’s and on Sephadex G-75 in 6M guanidine hydrochloride. Milchwissenschaft. 53:629-632.Nakano, T. and Ozimek, L. (1999) Purification of glycomacropeptide from non-dialyzable fraction of sweet whey byanion exchange chromatography. J. Biotech. Tech. 13:739-742.Nakano, T. and Ozimek, L. (2000) Purification of glycomacropeptide from caseinate hydrolysate by gel chromatographyand treatment with acidic solution. J. Food Sci. 65:588-590.Neeser, J.R.; Chambaz, A.; Vedovo, S.D.; Prigent, M.J. and Guggenheim, B. (1988a) Specific and nonspecific inhibition ofadhesion of oral actinomyces and streptococci to erythrocytes and polystrene by caseinoglycopeptide derivatives.Infection and Immunity. 56:3201-3208.Oliva, Y., Escobar, A. and Ponce, P. (2002) Caseinomacropéptido bovino: una alternative para la salud. Rev. Salud Anim.24:73-81.Oh, S.; Worobo, R.D.; Kim, B.C.; Rheem, S. and Kim, S. (2000) Detection of cholera toxin binding activity of κ-caseinmacropeptide and optimization of its production by the response surface methodology. Biosci. Biotechnol. Biochem.64:516-522.Otani, H. and Monnai, M. (1993) Inhibition of proliferative responses of mouse spleen lymphocytes by bovine milkk-casein digests. Food and Agricultural Immunology. 5:219-229.Otani, H.; Monnai, M. and Hosono, A. (1992) Bovine κ-casein as inhibitor of the proliferation of mouse splenocytesinduced by lipopolysaccharide stimulation. Milchwissenschaft. 47:512-515.Rigo, J.; Boehm, G.; Georgi, G.; Jelinek, J.; Nyambugabo, K.; Sawatzki, G. and Studzinski, F. (2001). An infant formulafree of glycomacropeptide prevents hyperthreoninemia in formula-fed preterm infants. J. Pediatr. GastroenterolNutr. 32:127–130.Saito, T.; Yamaji, A. and Itoh, T. (1991) A new isolation method of caseinoglycopeptide from sweet cheese whey. J. DairySci. 74: 2831-2837.Simon, P.M. (1996) Pharmaceutical oligosaccharides. Drug Discovery Today. 1:522-528.Thomä-Worringer, C.; Sorensen, J. and López-Fandinõ, R. (2006) Health effects and technological features ofcaseinomacropeptide. Int. Dairy J. 16: 1324-1333.Tolkach, A. and Kulozik, U. (2005) Fractionation of whey proteins and caseinomacropeptide by means of enzymaticcrosslinking and membrane separation techniques. J. Food Eng. 67: 13-20.Tullio, L. T.; Karkle, E. N. L. and Candido, L.M.B. (2007) Review: Isolation and Purification of Milk WheyGlycomacropeptide. B. CEPPA. 25:121-132.Wang, B.; Brand-Miller, J.; McVeagh, P. and Petocz, P. (2001). Concentration and distribution of sialic acid in humanmilk and infant formulas. Am. J. Clin. Nutr. 74:510-515.Wang, B.; Staples, A.; Sun, Y.; Karim, M. and Brand-Miller, J. (2004). Effect of dietary sialic acid supplementation onsaliva content in piglets. Asia and Pacific J. Clin. Nutr. 13:75.Wong, P.Y.Y.; Nakamura, S. and Kitts, D.D. (2006) Functional and biological activities of casein glycomacropeptide asinfluenced by lipophilization with medium and long chain fatty acid. Food Chem. 97:310-317.Xu, Y.; Sleigh, R.; Hourigan, J. and Johnson, R. (2000) Separation of bovine immunoglobulin G and glycomacropeptidefrom dairy whey. Process Biochem. 36:393-399.Yvon, M.; Beucher, S.; Guilloteau, P.; Huerou-Luron, I.L. and Corring, T. (1994) Effects of caseinomacropeptide (CMP)on digestion regulation. Reprod. Nutr. Dev. 34:527-537.53

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance54New Approaches to Detect the Adulteration of Gheewith Animal Body Fats and Vegetable Oils/ FatsIntroductionVivek Sharma, Darshan Lal, Arun Kumar and Amit KumarDairy Chemistry Division, NDRI, KarnalGhee is the most widely used milk product in the Indian sub- continent. It is a valuable source offat-soluble vitamins and essential fatty acids, apart from having rich and pleasant sensory attributes.Due to its increased demand, cost and variable chemical composition, the unscrupulous people gettempted to adulterate it with cheaper foreign fats like vegetable oils ⁄ fats and animal body fats, etc.,which is an unethical practice. Earlier, ghee used to be adulterated with foreign oils and fats, andaccordingly several methods were developed for detection of adulteration in ghee. These methodswere based on differences in the nature and contents of major/minor components of ghee andadulterant fats/oils. Methods presently used for detecting foreign fats in milk fat are mainly based onthe physico-chemical constants, fatty acid profile, sterol analysis, and partial solidification behavior.However, all these methods fail when milk fat is adulterated with a mixture of body fats and vegetableoils. In addition to this, now a days tailored vegetable oils with R.M/ P.V and B.R close to that of milkfat are available to the unscrupulous people in the unspecified market for adulteration purposes. Tocounter this approach some new methods have been developed, though these methods are also notfool proof, but can be handy in the testing laboratories.MethodologyThere are two approaches for the detection of adulteration of milk fat. First approach is based onthe classical methods like B.R reading, R.M- value, P.V – value, Phytosterol acetate test, Gas – liquidchromatographic analysis. Second approach is based on some innovative and rapid methods likefurfural test for vanaspati, Opacity test, crystallization test, Number of carbons by GLC of triglycerides, color based test for vegetable oil detection, apparent solidification time test and complete liquificationtime test. In all the cases, tests are applied on the extracted fat, accept the modified Gerber test, whereaspecially designed dual purpose Gerber butyrometer is used and B.R reading of the fat is measured.Hence, the first step is to isolate the fat and then apply the test (Kumar et al, 2002). In this article thefollowing methods have been discussed.1. Detection of animal body fats and vegetable oils/fats by the Opacity TestMelt the sample of fat (5 gm) isolated by heat clarification method at 50 +1ºC in a test tube andmaintain for 3 min to equilibrate. Then transfer the test tube at 23 + 0.2ºC water bath and record theopacity time (Time taken by fat sample to acquire either O.D. at 570 nm between 0.14-0.16 or Klettreading using red filter between 58-62 after adjusting the instrument to 100% transmittance). Theopacity time of pure buffalo ghee is 14-15 min, cow ghee is 18-19 min and that of ghee from cotton tractarea is 11-12 min. The opacity time of buffalo ghee adulterated at 10% level with vanaspati is 10-11min, with pig body fat is 8-9 min, with buffalo body fat is 2-3 min, with cow body fat is 3-4 min andwith refined oils is 20-25 min (Singhal, 1980).2. Detection of vanaspati in gheeIsolate the fat from milk by heat clarification method. Take about 5 g of the melted fat in a testtube. Add 5 ml of concentrated HCl. Add 0.4 ml furfural solution (2% in alcohol) and shake the tubethoroughly for 2 min. Allow the mixture to separate. The development of pink or red colour in the acidlayer indicates presence of vanaspati. Confirm by adding 5 ml distilled water and shaking again. If thecolour in acid layer persists, vanaspati is present. If the colour disappears, it is absent [SP:18 (1987)].3. Detection of vegetable oils by B.R. ReadingClean the prisms of the Butyro-refractometer with petroleum ether. Allow the ether to evaporate

New Approaches to Detect the Adulteration of Ghee with Animal Body Fats and Vegetable Oils/ Fatsto dryness. Maintain temperature of the prisms at 40ºC by circulating water. Calibrate the B.R.apparatus by applying a drop of fluid of known B.R. and adjusting B.R. by moving the adjustmentscrew. Clean the prisms. Apply a drop of sample of clear fat obtained by any of the three methodsbetween the prisms. Wait for 2 min before taking the reading so that sample should attain the constanttemperature of about 40ºC.B.R. reading decreases and increases with the rise and fall of temperature, respectively. Normally,the temperature of observation should not deviate by more than 2ºC. A correction of 0.55 is added tothe observed B.R. reading for each degree above 40ºC or subtracted for each degree below 40ºC to getcorrected B.R. reading of the sample.If fat is isolated by the Gerber method, B.R. is depressed due to hydrolytic effect of H 2SO 4on thefat. Therefore, observed B.R. reading is corrected as follows:Corrected B.R. = 1.08 x observed B.R.B.R. reading of milk fat isolated by one of the above mentioned methods should be consistentwith the values given for ghee as per PFA requirement. Any deviation from the standard valueindicates adulteration of milk with vegetable oils. However, this method has limitation of detectionof adulteration with two oils i.e. coconut oil and palm oil whose values are close to that of milk fat(Arora et al, 1996).4. Detection of animal body fats and vegetable oils by crystallization testTake 0.8 ml of melted fat in a stoppered test tube (10 x 1.0 cm internal diameter). Add 2.5 ml ofsolvent mixture consisting of acetone and benzene (3.5:1.0). Mix the contents slowly. Place the testtube in a water bath maintained at 20ºC for 3 min to equilibrate the temperature. Then transfer thetube in another water bath maintained at 17 + 0.2ºC till the onset of crystallization. Note the time foroccurrence of crystallization. The crystallization time of pure buffalo ghee is 18-20 min and that ofcotton tract ghee is 10.5-12.5 min, whereas that of buffalo ghee adulterated at 10% level with pig bodyfat is 11.5-12.5 min, with cow body fat 4.5-5.5 min and buffalo body fat 3.0-4.0 min, and with vegetableoils is 26 to 36 min (Panda, 1996).5. Detection of adulteration of vegetable oils in ghee by iodine valueIodine value, which is a measure of extent of unsaturation of fat, can be determined by the Wij’smethod as described in SP:18 (Part XI)1981. This property is particularly useful for detection ofadulteration in ghee with vegetable oils, as these oils have higher iodine values than milk fat and bodyfats. It can be measured, as follows:Accurately 0.4 g of sample is weighed in a clean and dry iodine flask and is dissolved in 15 ml ofcarbon tetrachloride. Then 25 ml of the Wij’s reagent are added and the flask is stoppered. The contentsare then mixed and kept in dark for one hour. After one hour, 20 ml of 10 per cent potassium iodidesolution and about 150 ml of distilled water are added to the iodine flask and mixed. The contents aretitrated against 0.1 N sodium thiosulphate solution using starch solution as an indicator. A blank testis also carried out using the same quantities of the reagents. From this, the iodine value is calculatedas follows:Iodine Value = 12.69 (B – S) N / WWhere;B = Vol. (in ml) of standard sodium thiosulphate solution required for the blankS = Volume (in ml) of standard sodium thiosulphate solution required for the sampleN = Normality of the standard sodium thiosulphate solution, andW = Weight (in g) of the sample taken for the testThe iodine values for cow and buffalo pure ghee ranges between 30.12 to 40.26. Any deviationfrom these values indicates adulteration (Kumar, 2008).55

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance6. Detection of adulteration by apparent solidification time (AST) test.The apparent solidification time (AST) of the fat sample is defined as the time taken by the meltedfat sample to get solidified apparently at a particular temperature. The test can be carried out as:Take 3.0 gm of completely melted fat sample in a test tube (10 × 1.0 cm ID) and maintain at 60°C for5 min. Transfer the test tube in a refrigerated water bath maintained at 18 ± 0.2°C and simultaneouslystart the stop watch. Observe the test tube constantly till the apparent solidification of the fat sampletakes place which is confirmed by non- movement of fat sample on tilting the test tube. At this stagestop the stopwatch and record the time taken for the apparent solidification of the fat. Pure gheesample of both cow and buffalo shows AST in the range of 2 min 31 sec to 3 min 25 sec. Any deviationfrom these values gives an indication of adulteration of milk fat (Kumar, 2009)7. Detection of adulteration using dry fractionation technique coupled with ASTBy employing dry fractionation technique, the different fractions enriched with body fats orvegetable oils are obtained and subsequently used to estimate AST. The aim is to enrich the solidfraction with animal body fats and liquid fraction with vegetable oils. Vanaspati, if added, will also befractionated along with animal body fats.Take 100 gm of clarified melted fat and keep it in a BOD incubator maintained at 20 ± 0.1°C. Afterabout 1.50 to 1.75 h of incubation, approximately one third of the whole fat gets solidified. Separate thesolid fraction (S 20) from the remaining liquid portion by filtration inside a BOD incubator maintained at20 ± 0.1°C. Further fractionate the liquid portion thus obtained in another BOD incubator maintainedat 18 ± 0.1°C. for 2 hr so as to obtain another solid (S 18) and liquid (L 18) fraction by filtering inside aBOD incubator maintained at 18 ± 0.1°C. Analyze S 20, S 18and L 18fractions of ghee for AST as describedabove. S 20, S 18and L 18fractions of pure ghee of both cow and buffalo show AST values of 1 min 40sec to 2 min 50 sec; 2 min 30 sec to 3 min 40 sec and 2 min 50 sec to 3 min 50 sec, respectively. Anydeviation from these values gives an indication of adulteration (Kumar, 2003).8. Detection of adulteration by complete liquification time (CLT) testThe complete liquification time (CLT) test of the fat sample is defined as the time taken by thesolidified fat sample to get melted completely at a particular temperature. The test can be performed,as follows:Take 3.0 gm of completely melted fat sample in a test tube (10 × 1.2 cm) and maintain at 60°C for 5min. Keep the test tube containing fat sample in a refrigerator (6- 8ºC) for 45 min for solidification of themelted fat sample. Transfer the test tube in a water bath maintained at 44 ± 0.1ºC and simultaneouslystart the stop watch. Observe the test tube constantly till the fat sample is completely liquefied. Atthis stage stop the stopwatch and record the time taken for complete liquification of the fat. Pure gheesample of both cow and buffalo shows CLT in the range of 2 min 12 sec to 3 min 15 sec. Any deviationfrom these values gives an indication of adulteration of milk fat (Kumar, 2008).9. Detection of adulteration using solvent fractionation technique coupled with CLT and Iodine valueUsing solvent fractionation technique, the different fractions enriched with body fats or vegetableoils can be obtained and used subsequently to estimate CLT. Here also, the aim is to concentrateanimal body fats in to solid fraction and vegetable oils into liquid fraction. Vanaspati, if added, willalso be concentrated in solid fraction along with animal body fats.Take 30 gm of melted ghee sample in a 100 ml graduated glass tube, and then add 60 ml acetoneand mix well to dissolve the fat. After mixing, keep the sample at 40°C for equilibration for 5 min. Thensubject the sample in a refrigerated water bath to three temperatures/time combinations, viz., 16 ±0.1°C/25 min, 8 ± 0.1°C/25 min and 4 ± 0.1°C/60 min, successively, after filtration at each stage of time/temperature combination. After about 25 min at 16 ± 0.1°C, approximately one-fourth of the wholefat gets solidified. This first solid fraction (S 16) obtained at 16 ± 0.1°C is separated from the remainingliquid portion (L 16) of the whole fat by filtration through ordinary filter paper. The remaining liquidportion (L 16) thus obtained after filtration is further fractionated at 8 ± 0.1°C. in refrigerated water bath.56

New Approaches to Detect the Adulteration of Ghee with Animal Body Fats and Vegetable Oils/ FatsAfter about 25 min, it gets partitioned into two fractions, one solid (S 8) and one liquid (L 8), which canbe separated by filtration through ordinary filter paper. At last, L 8fraction is further fractionated at4 ± 0.1°C for 60 min and filtered to get two fractions, one solid (S 4) and one liquid (L 4). Finally at theend of fractionation, three solid fractions (S 16, S 8and S 4) and one liquid fraction (L 4) are obtained fromghee sample containing a mixture of adulterants. Solvent from liquid fraction is removed by usingrotary evaporator at about 40ºC, followed by nitrogen flushing to evaporate solvent completely fromthe liquid fraction. To get rid of entrapped acetone, respective solid fractions are heated to 110ºC forabout 2 hr in an oven.(a) Analysis of first fraction (S 16) for CLT at 46ºCAnalyse S 16fraction for CLT at 46 ± 0.1ºC (instead of 44± 0.1ºC used for CLT of whole fat) asdescribed above. CLT values of S 16fraction at 46ºC range between 4 min 5 sec to 9 min for both cowand buffalo pure ghee. Any deviation from these values gives an indication of adulteration of milk fat(Kumar, 2008).(b) Analysis of last fraction (L 4) for Iodine valueAnalyse L 4fraction for iodine value as described above. The iodine values for L 4fraction of purecow and buffalo ghee are found to vary between 37.85- 46. 48. Any deviation from these values givesan indication of adulteration of milk fat (Kumar, 2008).10. Detection of liquid paraffin in milk fatIsolate the fat from milk by heat clarification method as described above. Saponify 1 g of fat takenin a test tube with 5 ml of 0.5 N ethanolic KOH solutions by heating on direct flame, using wire gaugefor 5 min. Add about 5 ml of distilled water to the hot saponified solution. Appearance of turbidityindicates the presence of mineral oil (Kumar, 2005)11. Rapid color based test for detection of vegetable oilsOne ml of clear molten fat was dissolved with 1.5 ml of hexane in a tightly capped test tube. To thiswas added 1.0 ml of color developing reagent (distilled water, Sulphuric acid - Sp.gr.1.835 and Nitric acid- Sp. gr. 1.42 in the ratio of 20:6:14), shaken vigorously and kept undisturbed till it is separated into twolayers. The appearance of a distinct orange tinge in the upper layer indicates the presence of vegetableoils / fats including vanaspati (Sharma et al., 2007).12. Detection of adulteration of rice bran oil in gheeRice bran oil contains gamma oryzanol, which can be used as a marker for the detection of its additionto ghee. It can be done by thin layer chromatographic method as well as colorimetric method.a) Thin layer chromatographic methodA simple thin layer chromatographic method can be employed to detect the adulteration of gheewith rice bran oil, as follows:Gamma oryzanol is extracted from 10.0 gm of molten fat using 20.0 ml of a solvent systemconsisting of methanol: water (9:1). The contents are vortexed for 2 min and centrifuged at 2000 rpm. /10 min. The alcohol layer is drawn. Extraction protocol is repeated thrice and all the alcoholic extractsare combined and evaporated at 60 – 70°C in a rotary evaporator. The residue is finally dried. Thedried residue is redissolved in 0.5 ml of developing solvent (toluene: ethyl acetate: methanol 90:8:2;v/v) and 5-10 µl were applied on silica gel TLC plate and plates are developed in the developingsolvent. Properly developed plates are removed from the chamber and air dried followed by sprayingwith color developing reagent (50% sulfuric acid) and heating at 120°C/ 10 - 15 min. Presence of thegamma oryzanol band confirms the adulteration of rice bran oil in milk fat. Addition of rice bran oil inghee at 5% level is easily detected by this method. (Kumar, et al., 2008).b) Colorimetric methodTake 1ml of melted ghee sample in a dry test tube. Add 1.5 ml of hexane to dissolve the fat. Then,in sequence, add 0.5 ml of dilute (25%) hydrochloric acid and 0.5 ml of 5% sodium nitrite solution57

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceand mix, followed by the addition of 1 ml of 10% sodium hydroxide solution. Rice bran oil producesorange-red color while other vegetable oils produce no color. Hence, this method is specific for thedetection of rice bran oil in ghee. As low as 2% rice bran oil added in ghee, can be detected by thismethod.13. Detection of beef body fat and margarine in butterfat by differential scanning calorimetry:In this case melting and crystallization curves of different fats are studied by cooling fats from70°C to - 40°C ( Aktas and Kaya, 2001). Based on new endothermic peak, more than 10 percent goatbody fat in ghee could be detected qualitatively with the help of melting diagram and determinedquantitatively from crystallization diagram. The method, however, failed to detect coconut oil, cottontract ghee and other animal body fats.14. Temperature controlled attenuated total reflectance- mid- infrared (ATR-MIR) spectroscopy:This is a spectroscopic technique used for the rapid estimation of butter adulteration. Themethodology is typically based on the infra red spectroscopic technique ( Koca et al., 2010). Theseworkers collected the Fourier transform infrared spectra of the samples between 4000 and 650 cm -1 ona FTIR spectrophotometer. Here the temperature was controlled, which allowed the stabilization ofanalysis temperature at 65± 2°C. The data was analyzed by using statistical tool namely Multivariatedata analysis and calibration models were developed covering all possible adulteration ratios. In thiscase adulteration of butter with margarine @ 2.5% could be predicted.15. Tryacyl glycerol analysis by evaporative light scattering detection (ELSD):This method is an HPLC method where major and minor triglyceride species could be sparated in 33min using reverse phase C 18column, ELSD and mbile pahse ( Dichloromethane: Acetonitrile) in a gradientmode.16. Analysis of triglycerides by GLC:This method is based on the principle of specific distribution of fatty acid moieties on the glycerolbackbone. Tryglycerides of 28 - 54 carbons are identified and quantified. The data generated is analysedby using multi variant analysis. The detection limit varied according to the source of fat added andfound to be < 10% ( Gutierrez et al., 2009).References:Aktas.N and Kaya.M ( 2001) Detection of beef body fat and margarine in butter fat by differential scanning calorimetry.Journal of Thermal Analysis and calorimetry. 66. 795- 801.Arora, K.L.; Lal. D, Seth. R and Ram, J. (1996). Platform Test for detection of refined mustard oil adulteration in milk.Indian Journal of Dairy Sci., 49(10): 721-723.Gutierrez.R; Vega.S; Daiz. G; Sanchez.J; Coronado.M; Ramirez.A; Perez.J; Gonzalez.M and Schettino.B ( 2009) Detectionof non milk fat by gas chromatography and linear discriminate analysis. J. Dairy Sci. 92: 1846- 1855.ISI (1981). Handbook of Food Analysis. IS: SP:18, Part XI. Dairy Products. Bureau of Indian Standards, New Delhi.Koca.N; Kocaogulu-Vurma.N.A; Harper.W.J; Rodriguez-Saona. L.E ( 2010) Application of temperature controlledattenuated total reflectance – mid- infrared (ATR-MIR) spectroscopy for rapid estimation of dutter adulteration.Food Chemistry. 121: 778- 782.Kumar.A; Lal.D; Seth.R and Sharma.R (2002) Recent trends in detection of adulteration in milk fat – A Review. IndianJ Dairy Sci., 55 (6): 319 - 330.Kumar. A, Lal, D, Seth, R and Sharma. V (2005) Turbidity test for detection of liquid paraffin in ghee. Indian J DairySci., 58 (4): 298.Kumar. A; Sharma. V and Lal.D (2008) Development of a thin layer chromatography based method for the detection ofrice bran oil as an adulterant in ghee. Ind. Journal . Dairy Sci. 61,2: 113 – 115.Kumar. Amit; (2008) Detection of adulterants in ghee. Ph. D thesis submitted to NDRI, Karnal (Deemed University).Kumar. A; Ghai, D. L; Seth, R and Sharma, V (2009) Apparent solidification time test for detection of foreign oils andfats adulterated in clarified milk fat, as affected by season and storage. International J . Dairy Tech. 62: 33 –38.Lal, D.; Seth, R.; Arora, K.L. and Ram, J. (1998) Detection of vegetable oils in milk. Indian Dairyman., 50(7): 17-18.Panda, D.K. (1996). Detection of adulteration of foreign fats in milk fat. M.Sc. thesis, submitted to N.D.R.I. DeemedUniversity, Karnal.Sharma. V; Lal, D and Sharma. R. (2007) Color based platform test for the detection of vegetable oils/fats in ghee. Ind.Journal . Dairy Sci. 60,1: 16 – 18.Singhal, O.P. (1980). Adulteration & Methods for detection. Indian Dairyman, 32: 771-774.SP:18 (1987). Handbook of Food Analysis Part XI, Dairy Products. Bureau of Indian Standards, Manak Bhawan, NewDelhi.58

Colostrum Powder and its Health BenefitsIntroductionColostrum Powder and its Health BenefitsRaman Seth and Anamika DasDairy Chemistry Division, NDRI, KarnalSince the time immemorial, man has sought some alternative methods to enhance and improve theimmune system of human body in order to fight against diseases. Historically, Ayurvedic physicianshave used bovine colostrum for therapeutical application in Asia, particularly in India for thousands ofyears. Increased awareness of the diet - health relationship in many countries has stimulated a trend innutrition science whereby more attention is given to the health effects of individual foods. Colostrumis the first lacteal secretion from the mammary glands after parturition during the first 24-72 hours.Colostrum is a complex fluid rich in nutrients and is also characterized by its high level of bioactivecomponents e.g. immunoglobulins (Igs), particularly IgG1, growth factors, i.e. insulin like growthfactors-1, transforming growth factor β2 and growth hormone in addition to lactoferrin, lysozyme andlactoperoxidase. Because of its poor heat stability, colostrum is an under utilized product in the dairyindustry. Heat processing may affect the functionality of bioactive components present in colostrum.Knowledge concerning the influence of processing and isolation procedures on bioactive compoundsin colostrum based products is, however, limited. Due to less heat stability of colostrum, its additionin raw milk affects further processing. Colostrum addition to milk causes elevated protein and mineralcontent which might render milk unsuitable for certain dairy processing operations such as UHTor milk powder production. But, during the past three decades, there has been increased interest inhuman consumption of bovine colostrum or its supplemented products based on the prophylactic andimmuno-therapeutic benefits of absorbed immunoglobulin especially IgG Thus, colostrum has beenprocessed into products designed for pharmaceutical and nutraceutical purposes which provide theconsumer with an identified health benefit over basic nutritional value. Internationally, colostrumderivedproducts have become valuable niche products and are currently being sold into highlycompetitive markets with current focus on protein components because of their physiological effectsand hence their commercial value.Processes involved in drying of colostrum powderLow-heat pasteurizationThe high-heat pasteurization and drying processes used by many producers of colostrum powderscan denature the sensitive PRPs and IgG proteins in colostrum. Only low-heat flash pasteurizationand low-heat indirect drying can be used to preserve the efficacy and bioactivity of colostrum. Usingflash pasteurization (161ºF or 72ºC for 15 seconds) all potentially harmful pathogens are removed,while immunoglobulins and other biologically important proteins retain their bioactivity.Low-pressure processingSimilar to high-heat processing, high-pressure processing of colostrum will denature proteins andreduce the bioactivity of the finished product. So low pressure processing is applied to manufacturecolostrum powder.Indirect steam dryingColostrum is spray dried using indirect steam and with low pressure and temperatures (less than145°F or 63ºC) to produce a high quality powder while protecting the colostral proteins. Toxic nitrogenoxides components produced in direct fired dryers used by other manufacturers are not produced inindirect steam dryer.Freeze drying (lyophilization)Freeze-drying (lyophilization) has been one of the most useful methods for producing high qualitycolostrum powder from colostrum. However, lyophilization has high capital and process costs. Freeze-59

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancedrying works by freezing colostrum and then reducing the surrounding pressure and adding enoughheat to allow the frozen water in the material to sublime directly from the solid phase to the gasphase.Composition of colostrum powderOften colostrum powder is priced on the basis of IgG content. Standardized colostrum powdersare available having 10 and 40 percent IgG levels and from 45 to 80 percent minimum protein levels.Typical composition of colostrum powder is as depicted belowImmune factorsImmunoglobulinsImmunoglobulins (Igs) are a family of globular proteins with antimicrobial and other protectivebioactivities. They exist at different concentrationsin milk and colostrum. Qualitative and quantitativedifferences are dependent on species, and arefound in various isotypes, with immunologicalactivities that are dependent on the Ig class. TheIgs are the principal agents that protect the gutmucosa against pathogenic microorganisms. IgGChemical CompositionMoistureFatProteinLactoseAsh4-5%0.5-1.5%55-80%15-23%5-7%antibodies express multifunctional activities,IgG 14-55%including complement activation, bacterialPhysical propertiesopsonisation and agglutination, and act byColourCreamy, yellowbinding to specific sites on the surfaces of mostinfectious agents or products, either inactivatingAppearanceFree fl owing spray driedpowderthem or reducing infection. In bovine colostrumBulk Density0.4 – 0.5 g/ml (when packed)and milk, immunoglobulin G (IgG; subclassesIgG1 and IgG2) is the major immune component,Sediment(25 g)A Discalthough low levels of IgA and IgM are also Microbiological propertiespresent IgG1 constitutes approximately 80%of the total Ig content of bovine milk. IgG is amonomeric glycoprotein consisting of two heavy(long) polypeptide chain of 53 KDa and twolight (short) polypeptide chains of 23 KDa thatare linked by disulfide bonds. The polypeptidechains contain both constant (Fc) and variable(Fab) regions of amino acid sequence, withthe antigen-binding sites located in the FabN-terminal region.Standard Plate Count(1 g)Coliforms (1 g)Coagulase +ve S.aureus (1 g)Salmonella (25 g)Yeast and moulds (1 g)E. coli (1 g)Listeria Species (25 g)

Colostrum Powder and its Health Benefitslactoferrin (68%) and human transferrin (60%) another iron-binding protein predominantly present inserum. Lactoferrin has been shown to inhibit the growth of several microbes, including E.coli, Salmonellatyphimurium, Shigella dysenteria, Listeria monocytogenes ,Streptococcus mutans, Bacillus stearothermophilusand Bacillus subtilis. In a recent study it was shown that human and bovine lactoferrin and theirN-terminal peptides were germicidal against Giardia lamblia in vitro. It has been proposed that theantimicrobial effect of lactoferrin is based on its capacity to bind iron, which is essential for the growthof bacteria.. Lactoferrin exerts its antimicrobial activity by modifying bacterial cell membranes. Inaddition to its antibacterial activity, lactoferrin has antiviral effects against herpes simples virus type-l(HSV-1) human immunodeficiency virus-l (HIV-l) and human cytomegalovirus in vitro. Lactoferrinplays a role in iron uptake in the intestine. and the activation of phacocytes and immune responses.Receptors for lactoferrin are found on intestinal tissues, monocytes, macrophages, neutrophils,lymphocytes, platelets and on some bacteria .Studies have shown that lactoferrin can bind DNA andactivate transcription, which might explain the molecular basis of growth regulation.LysozymeLysozyme is a well-known antibacterial and lytic enzyme present in many mammalian bodyfluids, including colostrum. The concentration of lysozyme in colostrum and in normal milk is about0.14-0.7 and 0.07-0.6 mg/L, respectively. The natural substrate of the enzyme is the peptidoglycanlayer of the bacterial cell wall and its degradation results in lysis of the bacteria. Some recent resultssuggest that the antibacterial activity of lysozyme is not only due to its enzymatic activity, but also toits cationic and hydrophobic properties The presence of lactoferrin enhances the antibacterial activityof lysozyme against E.coli, which also supports the hypothesis that lactoferrin damages the outermembrane of Gram-negative bacteria.LactoperoxidaseLactoperoxidase is a major antibacterial enzyme in colostrum. Bovine colostrum and milk containabout 1l-45 mg/L and 13-30 mg/ L lactoperoxidase, respectively.It is a basic glycoprotein containinga heme-group with Fe 3+ and catalyzes the oxidation of thiocyanate (SCN - ) in the presence of hydrogenperoxide (H 2O 2), producing a toxic intermediary oxidation product. This product inhibits bacterialmetabolism via the oxidation of essential sulphydryl groups in proteins. The lactoperoxidase system isalso toxic to other Gram-positive and Gram negative bacteria such as Pseudomonas aeruginosa,Salmonellatyphimurium,Listeria monocytogenes, Streptococcus mutans, Staphylococcus aureus and psychrotrophicbacteria in milk. Lactoperoxidase system inactivates polio virus and human immunodeficiency virustype 1 in vitro. The single peptide chain (612 amino acids) includes 15 half-cystines and 4- 5 potentialN-glycosylation sites and the heme group is suggested to bind to the peptide chain via a disulphidelinkage. Bovine lactoperoxidase also contains a site with high affinity for calcium. The lactoperoxidaseis partly activated by forming a complex with lysozyme and this interaction appears to be quite specific.The lactoperoxidase system and lactoferrin have been shown to have an additive but not a synergistic,antibacterial effect against Streptococcus mutans.Proline-Rich Polypeptides (PRP)A hormone that regulates the thymus gland, stimulating an underactive immune system ordown-regulating an overactive immune system as seen in autoimmune disease(Multiple sclerosis,rheumatoid arthritis, lupus, scleroderma, chronic fatigue syndrome, allergies, etc.). PRP stimulatesimmature thymocytes to turn into functionally active T-cells. Studies revealed that the addition of PRPisolated from colostrum led to the inhibition of vesicular stomatitis virus (VSV) replication in residentperitoneal cells. Furthermore, PRP acts as an immuno regulator by changing surface markers andfunctions of cells .It is a mixture of peptides(polypeptide-clostrinin) derived from colostrum whichcould help to slow the progression of Alzheimer’s disease by reducing the build-up of beta amyloid, atoxic protein that accumulates in the brains of Alzheimer’s sufferers.61

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceGrowth factorsGrowth factors are so called because historically they have been identified by their ability tostimulate the growth of various cell lines in vitro but, in reality, the functions of these peptide basedmolecules are considerably more diverse.Concentration ranges in growth factors reported for bovine colostrum and milkEpidermal growth factorEGF is a 53–amino acid peptide produced bythe salivary glands and the Brunners glands of theConcentrationGrowth factors(ng/ml)duodenum in adults. In vitro experiments usingColostrum milkgastric juice from preterm infants indicate that milkborneEGF is not deactivated under typical gastricEpidermal growth factor 4 – 325 1- 150proteolytic conditions. In contrast, we showed Betacellulin < 5 < 5that adult gastric juice digests EGF to an EGF form Insulin like growth –I 100 - 2000 5-100that has only 25% of the biological activity of the Insulin like growth factor-II 150 – 600 5-100intact EGF molecule. Once EGF enters the small Transforming growth factor-β1 10 – 50 < 5intestine, it is susceptible to proteolytic digestion Transforming growth factor- β2 150 -1150 10-70under fasting conditions but is preserved inFibroblast growth factor NAb < 1the presence of ingested food proteins . TherePlatelet-derived growth factor NA NAis controversy over the physiologic function ofEGF in the gastrointestinal lumen under normal(nondamaged) conditions. EGF acts as a “luminal surveillance peptide” in the adult gut, readily availableto stimulate the repair process at sites of injury. The EGF in colostrum and milk may therefore play a rolein preventing bacterial translocation and stimulating gut growth in suckling neonates.Transforming growth factor αIn contrast with EGF, TGF- α is produced within the mucosa throughout the gastrointestinal tract.Systemic administration of TGF- α stimulates gastrointestinal growth and repair, inhibits acid secretion,stimulates mucosal restitution after injury, and Increases gastric mucin concentrations. Within thesmall intestine and colon, TGF- α expression occurs mainly in the upper (nonproliferative) zones,which suggests that its physiologic role may be to influence differentiation and cell migration ratherthan cell proliferation. TGF-a may therefore play a complementary role to that of TGF-β in controllingthe balance between Proliferation and differentiation in the intestinal epithelium. Up-regulation ofTGF-α expression has been shown to occur in the gastrointestinal mucosa at sites of injury as well asin the liver after partial hepatectomy, supporting a role for TGF-α in mucosal growth and repair. Otherfindings support the role of TGF- α in maintaining epithelial continuity but suggest that the relativeimportance of peptides such as this might vary from one region of the gut to another. Taken together,most studies suggest that the major physiologic role of TGF- α is to act as a mucosal-integrity peptide,maintaining normal epithelial function in the undamaged mucosa.Transforming growth factor βThis family of molecules is structurally distinct from TGF- α and, in most systems, actually inhibitsproliferation. There are 5 different isoforms of TGF- β and their major site of expression in the normalgastrointestinal tract is in the superficial zones, where they may inhibit proliferation once the cells haveleft the crypt region. TGF- β has many diverse functions; it is a potent chemoattractant for neutrophilsand stimulates epithelial cell migration at wound sites. It is therefore likely to be a key player instimulating restitution, the early phase of the repair process during which surviving cells from theedge of a wound migrate over the denuded area to reestablish epithelial continuity. TGF- β and TGF- β-like molecules are present in high concentrations in both bovine milk (1–2 mg/L) and colostrum (20–40 mg/L). These concentrations are sufficient to prevent indomethacin-induced gastric injury in rats,suggesting that the TGF- β in colostrum may be a key component in mediating its ability to maintaingastrointestinal integrity in suckling neonates.62

Colostrum Powder and its Health BenefitsPlatelet-derived growth factorPlatelet-derived growth factor (PDGF) is an acid-stable molecule that was originally identifiedfrom platelets but is also synthesized and secreted by macrophages. It consists of 2 disulfide linkedpolypeptides: chain A (14 kDa) and chain B (17 kDa). The dimer, therefore, exists in 3 isoforms (AA,AB, and BB) that bind to tyrosine kinase–type receptors. PDGF is a potent mitogen for fibroblastsand arterial smooth muscle cells and administration of exogenous PDGF has been shown to facilitateulcer healing when administered orally to animals. Although PDGF is present in bovine milk andcolostrum, most of the PDGF-like mitogenic activity in bovine milk is actually derived from bovinecolostral growth factor, which shares sequence homology with PDGF.Insulin-like growth factors (somatomedins) and their binding proteinsIGF-I and IGF-II promote cell proliferation and differentiation and are similar in structure toproinsulin and it is possible that they also exert insulin-like effects at high concentrations. Bovinecolostrum contains much higher concentrations of IGF-I whereas lowered concentrations is foundin mature bovine milk (10 mg/L). These growth factors are relatively stable to both heat and acidicconditions. They therefore survive the harsh conditions of both commercial milk processing andgastric acid to maintain their biological activity. IGF-I is known to promote protein accretion, ie, it isan anabolic agent (50) and is at least partly responsible for mediating the growth-promoting activity ofgrowth hormone (GH). IGF-II is present in bovine milk and colostrum at much lower concentrationsthan is IGF-I, but like IGF-I, it has anabolic activity and has been shown to reduce the catabolic statein starved animals. IGFs in bovine colostrum and milk are present in both free and bound forms. Theamount of free IGF varies during the perinatal period, with most of the IGF-I in bovine colostrumsbeing present in the free form (ie, not associated with its binding protein), whereas the reverse istrue in the antepartum period and in mature milk. It was initially thought that the main functionof IGFBPs was to act as carrier proteins, reducing the proteolytic digestion of IGF and limiting itsbiological activity because only the free forms of IGF are thought to have any major proliferativeactivity. Additional roles for IGFBPs have been suggested because it has been shown that differentIGFBPs have distinct patterns of distribution in different tissues and their concentrations are altered inresponse to hormonal or nutrient status.The detailed functions of IGFBPs are unclear, although it is probable that one of the roles ofsecreted or soluble IGFBP is to inhibit IGF-mediated proliferation or amino acid uptake by limitingthe availability of free IGF to bind to its receptors. Conversely, cell surface and cell matrix–associatedIGFBPs may potentiate the actions of IGF by increasing local concentrations of IGF-I and IGF-II nextto their receptors.Clinical applications of colostrumGut related infectionsShort-bowel syndromeSome patients have an insufficient length of bowel to digest and absorb food adequately, usuallyas a result of massive intestinal resection for vascular insufficiency or after repeated operations forinflammatory bowel disease. Current therapeutic options are unpleasant and associated with ahigh risk of morbidity or mortality, eg, long-term parenteral (intravenous) feeding and small-boweltransplantation. Strategies to optimize the function of residual bowel and ultimately wean patientsoff total parenteral nutrition would therefore be of great benefit. There is evidence that growth factorscould be instrumental in achieving this goal; e.g systemic administration of individual growth factorssuch as EGF have been shown to stimulate bowel growth in rats receiving total parenteral nutrition. Inaddition, oral administration of EGF helped restore glucose transport and phlorizin binding in rabbitintestines after jejunal resection, and colostrum supplementation of piglet feeding regimens resultedin a significant increase in intestinal proliferation. Colostrum supplementation may be of particularvalue in young children who have undergone intestinal resection because gut adaptation is morelikely during early childhood than it is in adulthood.63

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceNonsteroidal antiinflammatory drug–induced gut injuryNonsteroidal antiinflammatory drugs (NSAIDs) are widely prescribed and are effective in thetreatment of musculoskeletal injury and chronic arthritic conditions. Nevertheless,

Colostrum Powder and its Health Benefits(PAF), which is produced by intestinal flora and inflammatory cells during the development of NEC.The finding that human colostrum contains the enzyme PAF acetylhydrolase, which degrades PAF,might therefore be relevant in explaining why human milk feeds protect against the developmentof NEC. These areas are discussed further by others (91–93). Although the molecular mechanismsunderlying the development of NEC are unclear, there is no doubt that once it is established, it isassociated with a very high mortality rate. Current treatment consists of general supportive measuresconsisting of fluid-replacement and antibiotic therapy, although intestinal resection is often required.There is therefore a need for novel therapeutic approaches, e.g. the use of peptides to stimulate therepair process. Support for this idea comes from a recent case study in which a continuous infusion ofEGF resulted in a remarkable restorative effect on gut histology in a child with NEC.Infective diarrheaHyperimmune milk or colostrum preparations have been shown to be of benefit in the preventionand treatment of infection and to increase weight gain in both clinical and veterinary practice, eg,vaccination of cows with specific viruses or bacteria to produce hyperimmune milk has been shownto be beneficial in the prevention and treatment of enteropathic infections due to Escherichia coli androtavirus. The use of whole hyperimmune colostrum rather than specific antibodies purified from milkor other sources has the added value of potentially stimulating the repair process (due to the presenceof growth factors) as well as facilitating the eradication of the infection by mechanisms involvingnonspecific antibacterial factors in colostrum and milk.The ultimate antioxidantColostrum is rich in Glutathione, a powerful antioxidant which is often described as ‘the ultimateantioxidant’. Antioxidants play an important part in overall good health and the prevention of disease,by scavenging for free radicals which cause disease, muscle damage, and inflammation. It has beenshown that glutathione enhances athletic performance by increasing muscle strength, and increasingthe capacity to exercise before fatigue sets in. Oxidative stress in the form of training and exercisecontributes to muscle fatigue. Glutathione and its precursors present in colostrum, have been shownto increase the capacity of exercise prior to the onset of fatigue.Anti-inflammatoryInflammation is associated with strenuous exercise and anti-inflammatories are the most commonlyprescribed class of drug to athletes. Inflammation is typically centered in the joints and in the digestivetract. Inflammation is a protective response to an injury, invading foreign substance, or an internallyproduced substance (e.g. in auto-immune disorders like rheumatoid arthritis). Colostrum reduces theneed for damaging medication, and because it is a natural food, unlike NSAIDS, it has absolutely nonegative side-effects and has a multitude of benefits.Increased Brain FunctionPhospholipids, components of alpha lipid, help in increasing brain function and have beenassociated with improved memory. They have also shown to elevate moods and reduce the symptomsof depression.Viral illnessesAbout 75% of the antibodies in the body are produced by the GI component of the immune system.The ability of AIDS/HIV patients to fight infectious disease is severely compromised due to damage tothe gut from chronic inflammation and diarrhea. Recent studies report colostrum’s role in the reversalof this chronic problem stemming from opportunistic infections like Candida albicans, Cryptosporidia,rotavirus, Herpes simplex, Pathogenic Strains of E. Coli and intestinal flu infections. All gut pathogensare handled well by colostrum without side effects.Allergies and autoimmune diseasesPRP from colostrum can work as a regulatory substance of the thymus gland. It has beendemonstrated to improve or eliminate symptomatology of both allergies and autoimmune diseases65

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance(Multiple Sclerosis, rheumatoid arthritis, lupus, and myasthenia gravis). PRP inhibits the overproductionof lymphocytes and T-cells and reduces the major symptoms of allergies and autoimmune disease:pain, swelling and inflammation.Heart DiseaseColostrum PRP have a role in reversing heart disease very much like it does with allergiesand autoimmune diseases. Additionally, IgF-1 and GH in colostrum can lower LDL-cholesterolwhile increasing HDL-cholesterol concentrations. Colostrum growth factors promote the repairand regeneration of heart muscle and the regeneration of new blood vessels for collateral coronarycirculation.CancerThe cytokines like Interleukins 1, 6, 10, Interferon G and Lymphokines found in colostrum areinvolved in the treatment of cancer. Colostrum lactalbumin has been found to be able to cause theselective death (apoptosis) of cancer cells, leaving the surrounding non-cancerous tissues unaffected.Lactoferrin has similarly been reported to possess anti-cancer activity. The mix of immune and growthfactors in colostrum can inhibit the spread of cancer cells.DiabetesJuvenile diabetes (TypeI, insulin dependent) is thought to be brought about through an autoimmunemechanism, possibly initiated by an allergic reaction to the protein GAD found in cow’s milk.Colostrum contains several factors, which can offset this and other allergies. Human trials reportedthat IgF-1 stimulates glucose utilization, effectively treating acute hyperglycemia and lessening a TypeII diabetic dependence on insulin.Helps in weight lossIgF-1 is required by the body to metabolize fat for energy through the Krebs cycle. With aging, lessIgF-1 is produced in the body. Inadequate levels are associated with an increased incidence of TypeII diabetes and difficulty in losing weight despite a proper nutritional intake and adequate exercise.Colostrum provides a good source of IgF-1 as a complementary therapy for successful weight loss.Athletic stressExhaustive workouts and athletic competition can temporarily depress the immune system, decreasingthe number of T-lymphocytes and NK cells. Athletes are therefore, more prone to develop infections,including Chronic Fatigue Syndrome. Many of colostrum’s immune factors can help significantly reducethe number and severity of infections caused by both physical and emotional stress.Leaky Gut SyndromeOne of the major benefits of colostrum supplementation is enhanced gut efficiency due to themany immune enhancers that control clinical and subclinical GI infections. Colostral growth factorsalso play a role by keeping the intestinal mucosa sealed and impermeable to toxins. Healing leaky gutsyndrome reduces toxic load and helps in the reversal of many allergic and autoimmune conditions.For the healthy individual or athlete in training, colostrum supplementation enhances the efficiencyof amino acid and carbohydrate fuel uptake by the intestine. One of the reasons for the energy boostseen in most healthy individuals who use colostrum as a food supplement is this ability of colostrumto improve nutrient availability and the correction of subclinical leaky gut syndrome.Wound healingSeveral colostrum components stimulate wound-healing. Nucleotides, EGF, TGF and IGF-1stimulate skin growth, cellular growth and repair by direct action on DNA and RNA. These growthfactors facilitate the healing of tissues damaged by ulcers, trauma, burns, surgery or inflammatorydisease. The tissues affected beneficially by colostrums wound healing properties are skin, muscle,cartilage, bone and nerve cells. Powdered colostrum can be applied topically to gingivitis, sensitiveteeth, aphthous ulcers, cuts, abrasions and burns after they have been cleaned and disinfected.66

Colostrum Powder and its Health BenefitsConclusionThe world-wide trend towards the development of health-promoting foods offers interestingopportunities for applications which contain specific antibody ingredients derived from immunisedcows. It is anticipated that colostrums based preparations may have remarkable potential to contributeto human health care as part of health promoting diet and as an alternative or a supplement to themedical treatment of specified human diseases. Bovine colostrum virtually contain all compounds ofhuman cellular and humoral immune defence. They are ideal sources of these defence molecules forindustrial production because of their ready availability and safety as compared with blood derivedanalogues. The ongoing success of colostrums based products speaks for itself. However, the challengefor manufacturers still remains as how to process colostrums in a cost effective way.ReferencesBlum, J. W., and Hammon, H. 2000. Colostrum effects on the gastrointestinal tract, and on nutritional, endocrine andmetabolic parameters in neonatal calves. Livest. Prod. Sci., 66: 151.Chen, C.C., Tu, Y.Y., and Chang, H.M. 2000. Thermal stability of bovine milk immunoglobulin G(IgG) and the effect ofadded thermal protectants on the stability. J. Food Sci., 65: 188.Donovan, S. M. and Odle, J. 1994. Growth factors in milk as mediators of infant development. Ann. Rev of Nutr., 14:147.Elfstrand, L., Lindmark-Mansson, H., Paulsson, M., Nyberg, L. and Akesson, B. 2002. Immunoglobulins, growth factorsand growth hormone in bovine colostrum and the effects of processing. Int. Dairy J., 12: 879.Gapper, L., Copestake D., Otter, D., Indyk, H., 2007. Analysis of bovine immunoglobulin G in milk, colostrum anddietary supplements: a review Anal Bioanal Chem.,389:93.Godden, S. M., Smith, S., Feirtag, J. M., Green, L. R., Wells, S. J., and Fetrow, J. P. 2003. Effect of on-farm commercialbatch pasteurization of colostrum on colostrum and serum immunoglobulin concentrations in dairy calves. J. DairySci., 86: 1503.Korhonen, H., Marnila, P. and Gill, H. S. 2000. Bovine milk antibodies for health. Br J Nutr., 84: S135.Kurokowa, M., Lynch, K. and Podolsky, D. K. 1987. Effects of growth factors on an intestinal epithelial cell line:transforming growth factor beta inhibits proliferation and stimulates differentiation. Biochemical and BiophysicalResearch Communications 142:775-182.67

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceCow Ghee Protects from MammaryCarcinogenesis: MechanismVinod K. Kansal, Rita Rani and Ekta BhatiaAnimal Biochemistry Division, NDRI, KarnalDuring the past several years, epidemiological studies have indicated the influence of environmentand life-styles on the development of certain forms of cancer. About 35 % of all cancer mortality in US maybe attributable to dietary factors. The association between dietary fat and cancer has been consistentlysupported by experimental evidence. Limiting the intake of fats and oils reduces the risk of cancer. Thishas now been expanded to limit saturated fat intake through reduction of animal fat intake.Epidemiological associations between dietary fat intake and cancer in humans are highlycontroversial. Some of this controversy stems from the limited ability to accurately assess total energyand fat consumption, and the difficulty in assessing the effects of dietary fat independent of totalenergy or micronutrient intake and other environmental factors such as physical activity.A chorus of establishment voices, including the American Cancer Society, the National CancerInstitute and the Senate Committee on Nutrition and Human Needs, claim that animal fat is linked notonly with heart disease, but also with cancers of various types. However, when researchers from theUniversity of Maryland analyzed the data, they found that vegetable fat consumption was correlatedwith cancer, not the animal fat (Enig et al., 1978).The mechanisms supporting a relationship between dietary fat and cancer can be classified aseither direct or indirect. Potential direct mechanisms include: 1) peroxidation of double bond inPUFAs, leading to persistant oxidative stress and generation of reactive lipid peroxidation products(malondialdehyde, 4-hydroxyalkenals), which induce DNA damage; 2) conversion of essential fattyacids to eicosanoids (short lived hormone synthesized from n-6 unsaturated fatty acids); and 3)interaction between fatty acids with signal transduction pathways leading to altered gene expression.Potential indirect mechanisms include: 1) effect on membrane bound enzymes such as cytochromeP450 (CYP) that regulate xenobiotic and estrogen metabolism; 2) structural and functional changesin cell membranes that can alter the hormone activity and growth factor receptors; and 3) effects onimmune function.Dietary fat and breast cancerBreast cancer is the most commonly diagnosed cancer in women and is the leading cause of cancermortality in females in the world. There is strong positive correlation between fat intake and mortalityfrom breast cancer. It is likely that sex hormones especially estrogen, play a promotional role in breastcarcinogenesis, stimulating mitotic division of initiated cells and proliferation.An increased amount of both vegetable and animal fat accelerates mammary tumor growth.Different types of fat also have different effects on mammary tumorigenesis. Meta-analysis of 97reports that studied the effects of dietary fatty acids on mammary tumor incidence and found: 1) n-6polyunsaturated fatty acids have a strong tumor-enhancing effect; 2) saturated fats have weaker tumorenhancing effects; 3) n-3 polyunsaturated fatty acids have a small non-significant protective effect; 4)the effects of n-6 polyunsaturated fats are stronger than that of saturated fats even at low levels; and5) there is no effect of monounsaturated fats on mammary carcinogenesis (Fay et al., 1997). A high fatdiet rich in n-6 polyunsaturated fatty acid in animal models could enhance metastasis of human breastcancer cells (Rose et al., 1991).Dairy products and breast cancerThe major hypotheses suggesting an increased risk of breast cancer risk associated with theconsumption of dairy product include: 1) a high consumption of dairy products results high dietary68

Cow Ghee Protects from Mammary Carcinogenesis: Mechanismfat intake particularly saturated fat which in turn has been associated with breast cancer risk; 2) milkproduct may contain contaminants, such as pesticide that are potentially carcinogenic; and 3) milkmay contain growth factors, such insulin like growth factor 1 (IGF-1), which have been shown topromote breast cancer cell growth.The hypotheses suggesting inverse relation between dairy product consumption and breast cancerrisk have focused on the anticarcinogenic effects of vitamin D and calcium, conjugated linoleic acidand butyric acid. Dairy products have high calcium content and are also a major dietary source ofvitamin D in countries where milk and other dairy products are fortified, such as the United States.In breast cancer cell lines, vitamin D exerts antiproliferative effects by causing arrest in phase G0 /G1 of the cell cycle (Colston and Hansen, 2002). The cellular functions of vitamin D are closely linkedto calcium. Calcium is a pivotal regulator of a wide variety of cellular functions, including cellularproliferation and differentiation. Several investigations have shown that animals fed diet deficient incalcium and vitamin D develops mammary hyperplasia and hyperproliferation (Lipkin and Newmark,1999). Furthermore, animal studies have shown that supplementation with calcium and vitamin Dreduces the risk of mammary tumors in animals fed a high fat diet and prevents the development ofmammary tumors in animals induced with the carcinogen 7,12-dimethylbenz (a)anthracene (DMBA)(Mehta et al., 2000).A third potential mechanism to suggest that dairy products may reduce breast cancer risk involves CLA.Animal studies suggest that CLA confers protection against the development of mammary tumors (Ip et al.,1996). It is interesting to note that tumor formation was inhibited in animals fed CLA, regardless of the typeor amount of fat in their diets. Another compound found in dairy products, known to have protective effectagainst mammary carcinogenesis is butyric acid.Epidemiological studiesMost of the epidemiological studies showed no consistent pattern of increased or decreased breastcancer risk with a high consumption of dairy products (Moorman and Terry, 2004). Two of the cohortstudies and 10 of the case-control studies investigated the association between breast cancer and butterconsumption and no consistent pattern was observed with reported butter intake. In a cohort studyconducted in Finland (Knekt et al., 1996), an inverse association that was not statistically significantwas reported; whereas a slight positive association was reported in a cohort study in the Netherlands(Voorrips et al., 2002). In the case-control studies, odds ratios both > and < 1.0 were reported, butgenerally differences between cases and controls were not statistically significant. Persons with ahigh consumption of butter, cheese and other high-fat dairy products may also be more likely toconsume large amounts of meat or other high fat-foods that could also contribute to an increased riskof breast cancer. Further, milk fat is rarely used in isolation from other dietary items, and other milkcomponents (milk protein, calcium, lactic acid bacteria) also have anticarcinogenic properties; hence itis not possible to separate the effect of milk fat as such.Animal studiesThere are a few studies in which milk fat or butter was compared with vegetable oils or margarinesin animal models of carcinogenesis. The vegetable oils (soybean oil, sunflowers oil, corn oil, cotton oil)were reported to enhance DMBA induced mammary adenocarcinomas more than butter and somesaturated fats (coconut oil, tallow, lard) in rodents (Carroll and Khor, 1971; Yanagi et al., 1989; Copeand Reeve 1994). The milk fat was more effective when introduced in the diet at weaning (Klurfeld etal., 1983).The work done in this laboratory (Bhatia and Kansal, in press) showed that ghee (clarified butter fat)opposed to soybean oil attenuated the gastrointestinal and mammary carcinogenesis. Gastrointestinalcarcinogenesis was induced by DMH in weanling male rats fed diet containing at 10% level of soybeanoil or buffalo ghee or cow ghee. The incidence was considerably higher in animal on soybean oil(73.30%) than on cow ghee (55%) or buffalo ghee (40%). Tumor multiplicity and tumor volume wereless on ghee diets than on soybean oil, and cow ghee was more efficacious than buffalo ghee in reducing69

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancetumor volume. Increased accumulation of CLA and decreased lipid peroxidation (measured by thelevel of TARS) in liver and colorectal tissue on ghee opposed to soybean oil correlated with decreasedtumor incidence, tumor multiplicity and tumor volume on ghee diets. Similar dietary treatment wasgiven to weanling female rats and mammary carcinogenesis was induced by DMBA. Considerablenumber of animal died in all dietary groups due to acute DMBA toxicity and mortality incidence wasgreater on soybean oil than on ghee groups. Cow ghee opposed to soybean oil decreased the tumormultiplicity, tumor volume and non-neoplastic disorders.In recent studies (Rani and Kansal, 2010) we evaluated the mechanism of protective effect ofcow ghee versus soybean oil in DMBA induced mammary carcinogenesis rat model. Four groups offemale rats were fed for 44 weeks diet containing cow ghee or soybean oil. Mammary carcinogenesiswas induced with 7,12-dimethylbenz(a)anthracene (DMBA) given through oral intubation. The twogroups, which were not given DMBA but fed similarly, served as controls. The animals challengedwith DMBA developed tumors in both cow ghee fed and soybean oil fed rats. The tumor latencyperiod was greater on cow ghee (27 weeks) than on soybean oil diet (23 weeks). The tumor incidencewas considerably higher in animals on soybean oil (65.4%) than on cow ghee diet (26.6%). The tumorvolume and tumor weight were significantly less on cow ghee (1925 mm3, 1.67 g) than on soybeanoil diet (6285 mm3, 6.18 g). The progression of carcinogenesis was more rapid on soybean oil than oncow ghee diet. While no adenocarcinoma was observed in cow ghee group, 8% of tumors in soybeanoil group were adenocarcinoma.Cyclooxygenase-2 (COX-2) is a rate-limiting step in synthesis of prostaglandin E2, and theexcessive production of the latter promotes mammary carcinogenesis. The expression of COX-2 wasobserved in DMBA treated rats, but not in untreated rats. The expression of COX-2 was significantlygreater on soybean oil than on cow ghee diet in tumor tissue as well as in uninvolved tissue of tumorbearing animals (Rani and Kansal, 2010).The cyclin A and D up regulate cell proliferation and promote tumerogenesis in carcinogen treatedanimals. The expression of cyclin A in carcinogen treated rats was significantly greater in soybean oilfedrats than in cow ghee-fed rats, both in tumor bearing and no tumor bearing rats, and in tumortissue and in uninvolved tissue of tumor bearing rats. The expression of cyclin D was also significantlygreater on soybean oil diet than on cow ghee diet, both in control and carcinogen treated rats (Rani etal., 2010)The peroxisome proliferators activated receptor-γ (PPAR-γ) down regulates cell proliferation andup regulates apoptosis, and thus prevents tumorogenesis. The expression of PPAR-γ was significantlygreater on cow ghee diet than on soybean oil diet, both in control and carcinogen treated rats. Further,its expression was greater on cow ghee than on soybean oil both in tumor bearing and no tumor bearingrats of treated animals (Rani and Kansal, 2010).The Bax up regulates apoptosis and thus prevents progression of tumorogenesis. Its expressionwas decreased in tumor tissue and uninvolved tissue of tumor bearing rats. However, the dietarytreatment with cow ghee or soybean oil has no effect on expression of Bax (Rani et al., 2010)The expression of both bcl2 and PKC genes was not effected by dietary treatments with cow gheeor soybean oil in control as well as in no tumor bearing treated animals. However, their expressionwas significantly less on cow ghee than on soybean oil in tumor tissue as well as in uninvolved tissueof tumor bearing rats (Rani et al., 2010)Apoptotic signal decreased in tumor bearing animals. In uninvolved tissue of tumor bearinganimals the decrease was significantly more on soybean oil than on cow ghee, while in tumor tissuethe decline in apoptotic signal was similar on cow ghee and soybean oil. In control animals and notumor bearing animals, the apoptotic signal was not affected by dietary treatment with cow ghee orsoybean oil. Hence, cow ghee feeding decreases expression of genes involved in cell proliferation, andincreases apoptotic signal (Rani et al., 2010)Most of carcinogens in nature occur in inactive form, and these are activated by cytochrome70

Cow Ghee Protects from Mammary Carcinogenesis: MechanismP450 activities present in liver. Several enzymes present in liver and the target tissue detoxify theactive carcinogen. The balance of these two activities determines the active carcinogen present in thebody at a given moment. Feeding cow ghee opposed to soybean oil decreased carcinogen activatingcytochrome P4501A1, CYP1A2, CYP1B1 and CYP2B1 activities in liver. Further, feeding cow gheeopposed to soybean oil also increased carcinogen-detoxifying activities, γ-glutamyltranspeptidase,uridinediphospho-glucuronosyl transferase and quinone reductase in liver and mammary glandtissue of control as well as DMBA treated rats (Rani and Kansal, 2011) .The present study shows that compared to vegetable oil, cow ghee confers protection againstmammary gland carcinogenesis. The mechanism involves modulation of xenobiotic metabolism andexpression genes involved in cell proliferation and apoptosis. Nutraceutical importance of cow gheeover vegetable oils in conferring protection against mammary cancer has been validated. This countersthe propaganda against dairy ghee and indiscriminate promotion of vegetable oil as health food.ReferencesBhatia, E. 2005. Effects of dairy Ghee versus soybean oil on 1,2-dimethylhydrazinedihydrochloride inducedgastrointestinal tract carcinogenesis and lipid peroxidation in rats. Ind. J. Med. Res (in press)Bhatia, E. and Kansal, V. K. (2010) Dairy Ghee opposed to soybean oil attenuates diet-induced hypercholesterolemia inrats. Milchwissenschaft (Germany), in pressCarroll, K.K. and Khor, H.T. 1971. Effects of level and type of dietary fat on incidence of mammary tumors induced infemale Sprague-Dawley rats by 7,12-dimethylbenz[a] anthracene. Lipids, 6: 415-420.Colston, K.W. and Hansen, C.M. 2002. Mechanisms implicated in the growth regulatory effects of vitamin D in breastcancer. Endocr. Relat. Cancer, 9: 45-49.Cope, R.B. and Reeve, V.E. 1994. Modification of 7,12-dimethylbenzanthra-cene (DMBA) / ultraviolet radiation (UVR)co-carcinogenesis, UVR carcinogenesis and immune suppression due to UVR and cis urocanic acid by dietary fats.Photochem. Photobiol., 59: 24S.Enig, M.G., Munn, R.J. and Keeney, M. 1978. Dietary fat and cancer trends - a critique. Fed. Proc., 37(9): 2215-2220Fay, M.P., Freedman, L.S., Clifford, C.K. and Midthune, D.N. 1997. Effect of different types and amounts of fat on thedevelopment of mammary tumors in rodents : A review. Cancer Res., 57: 3979-3988.Ip, C., Briggs, S.P., Haegele, A.D., Thompson, H.J., Storkson, J. and Scimeca, J.A. 1996. The efficacy of conjugatedlinoleic acid in mammary cancer prevention is independent of the level or type of fat in the diet. Carcinogenesis.,17: 1045-1050.Klurfeld, D.M., Weber, M.M. and Kritchevsky, D. 1983. Comparison of semi-purified and skim milk protein containingdiets on DMBA-induced breast cancer in rats. Kiel. Milchwirtschaft. Forschun., 35: 421-422.Knekt, P., Jarvinen, R., Seppanen, R., Pukkala, E. and Aromaa, A. 1996. Intake of dairy products and the risk of breastcancer. Br. J. Cancer, 73: 687-691.Lipkin, M. and Newmark, H.L. 1999. Vitamin D, calcium and prevention of breast cancer : A review. J. Am. Coll. Nutr.,18: 392S-397S.Mehta, R., Hawthorne, M., Uselding, L., Albinescu, D., Moriarty, R., Christov, K. and Mehta, R. 2000. Prevention ofN-methyl-N-nitrosourea-induced mammary carcinogenesis in rats by γ-hydroxy vitamin D5. J. Natl. Cancer Inst.,92(22): 1836-1840.Moorman, P.G. and Terry, P.D. 2004. Consumption of dairy products and the risk of breast cancer: A review of theliterature. Am. J. Clin. Nutr., 80: 5-14.Rani, R and Kansal, V. K. (2010) Dietary intervention of cow Ghee versus soybean oil on 7,12-dimethylbenz(a)anthracene induced mammary carcinogenesis and expression of cyclooxygenase-2and peroxisome proliferators activated receptor- γ in rats. Indan. Journal of Medical Research(in press)Rani, R., Kansal, V. K., Kaushal, D and De, D. (2010) Dietary intervention of cow Ghee and soybean oil on expressionof cell cycle and apoptosis related genes in normal and carcinogen treated rat mammary gland. Molecular BiologyReports (Netharlands) DOI: 10.1007/S11033-010-0435-1Rani, R and Kansal, V. K. (2010) Dietary intervention of cow Ghee versus soybean oil on 7,12-dimethylbenz(a)anthraceneinduced mammary carcinogenesis and expression of cyclooxygenase-2 and peroxisome proliferators activatedreceptor- γ in rats. Indan. Journal of Medical Research (in press)Rose, D.P., Connolly, J.M. and Meschter, C.L. 1991. Effect of dietary fat on human breast cancer growth and lungmetastasis in nude mice. J. Natl. Cancer Inst., 83: 1491-1495.Voorrips, L.E., Brants, H.A.M., Kardinaal, A.F.M., Hiddink, G.J., van den Brandt, P.A. and Goldbohm, R.A. 2002. Intakeof conjugated linoleic acid, fat, and other fatty acids in relation to postmenopausal breast cancer : The NetherlandsCohort Study on Diet and Cancer. Am. J. Clin. Nutr., 76: 873-882.Yanagi, S., Yamashita, M., Sakamoto, M., Kumazawa, K. and Imai, S. 1989. Comparative effects of butter, margarine,safflower oil and dextrin on mammary tumorigenesis in mice and rats. In: The Pharmacological Effects of Lipids.III. The role of Lipids in Cancer Research (J.J. Kabara, ed.). Lauricidin Inc., Galena, IL, pp.159-169.71

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIntroductionLateral Flow Assay- Principle and itsApplication in Analytical Food ScienceThe lateral flow assay (LFA), also calledthe immunochromatographic assay or the stripassay is a simple device intended to detectthe presence (or absence) of a target analytein sample (matrix). This technique is basedon an immunochromatographic procedurethat utilizes antigen–antibody properties andenables rapid detection of the analyte. It includesseveral benefits, such as a user-friendly format,rapid results, long-term stability over a widerange of weather conditions, and relativelylow manufacturing costs. These characteristicsrender it ideally suited for on site testing byuntrained personnel. The main application ofthis technology had been the human pregnancytest which came in picture in the 1970s. However,to fully develop the lateral flow test platform,Rajan Sharma and Priyanka Singh RaoDairy Chemistry Division, NDRI, KarnalFigure 1. Typical configuration of a lateral flowimmunoassay test stripa variety of other enabling technologies were also required. These include technologies as diverseas nitrocellulose membrane manufacturing, antibody generation, fluid dispensing and processingequipment, as well as the evolution of a bank of knowledge in development and manufacturingmethodologies. Many of these facilitative technologies had evolved throughout the early 1990s, thefirst lateral flow products were introduced to the market in the late 1980s. Since then, as of 2010, over200 companies worldwide are producing a range of testing formats. The world market for LF-basedtests (Rosen, 2009) is estimated at $2,270 million in 2005 and, with a compounded annual growth rate(CAGR) of 10%, it will reach $3,652 million in 2012. This estimate includes LF-based tests used inhuman and veterinary medicine, food and beverage manufacturing, pharmaceutical, medical biologicsand personal care product production, environmental remediation, and water utilities.Architecture and working of a lateral flow immunoassayFigure 1 shows the typical configuration of a LFA which is composed of a variety of materials,each serving one or more purposes. The parts overlap onto one another and are mounted on a backingcard using a pressure-sensitive adhesive. The assay consists of several zones, typically constitutedby segments made of different materials. When a test is run, sample is added to the proximal endof the strip, the sample pad. Here, the sample is treated to make it compatible with the rest of thetest. The treated sample migrates through this region to the conjugate pad, where a particulateconjugate has been immobilized. The particle can typically be colloidal gold, or a colored, fluorescent,or paramagnetic monodisperse latex particle. This particle has been conjugated to one of the specificbiological components of the assay, either antigen or antibody depending on the assay format. Thesample re-mobilizes the dried conjugate, and the analyte in the sample interacts with the conjugateas both migrate into the next section of the strip, which is the reaction matrix. This reaction matrixis a porous membrane, onto which the other specific biological component of the assay has beenimmobilized. These are typically proteins, either antibody or antigen, which have been laid down inbands in specific areas of the membrane where they serve to capture the analyte and the conjugate as72

Lateral Flow Assay- Principle and its Application in Analytical Food Sciencethey migrate by the capture lines. Excess reagents move past the capture lines and are entrapped inthe wick or absorbent pad. Results are interpreted on the reaction matrix as the presence or absence oflines of captured conjugate, read either by eye or using a reader.Lateral flow assay formatsThis test can be performed on two platforms, either direct (sandwich) or competitive (inhibition)and also can be used to accommodate qualitative, semi quantitative and in limited cases, fullyquantitative determination.Direct assay format: Direct assays (Figure 2) are typically used when testing for larger analyte withmultiple antigenic sites i.e. analyte presenting several epitopes. This system (equivalent to sandwichELISA) employs two different antibodies (polyclonal and monoclonal) that bound distinct epitopes ofthe analyte: a labelled polyclonal antibody is placed in a dehydrated state onto a glass-fiber membrane(conjugate pad) to serve as detector reagent and a monoclonal antibody specific to the analyte is sprayedat the test line of the nitrocellulose membrane to serve as capture reagent. An additional antibody specificto the detection antibody (species specific) could be used to produce a control signal at control line.Figure 2. Direct Lateral Flow AssayFigure 3. Competitive Lateral Flow AssayWhen a sample extract is applied to samplepad, the liquid migrates up by capillary force and the detector reagent is then released. Some of theanalyte bind to the detection antibody and some remain free in the solution. Subsequently, the mixturepasses through the capture zone (test line) and both unbound analyte and bound analyte bind to thecapture antibody. The response in the capture zone (test line) is directly proportional to the amount ofanalyte in the sample.Competitive assay: Competitive assay formats (Figure 2) are typically used when testing for smallmolecules with single antigenic determinants, which cannot bind to two antibodies simultaneously. Inthis format, an analyte-protein conjugate coated on the test zone of a nitrocellulose membrane capturesa labelled anti-analyte monoclonal antibody complex, allowing colour particle (e.g. colloidal gold) toconcentrate and form a visible line on the test zone. Another specific antibody coated on the controlline allows the capture of the excess antibody complex. One band colour will therefore be visible inthe control zone regardless of the presence of target analytes, confirming correct test development.Conversely, a negative sample will result to the formation of two band colours visible (test line andcontrol line)Materials and processes in lateral flow immunoassay development andconstructionA typical test strip consists of the following components:Membrane/Analytical Region: The purpose of the analytical region in a lateral flow immunoassayis to bind proteins at the test and control areas and to maintain their stability and activity over the73

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceshelf-life of the product. The membrane material is typically a hydrophobic nitrocellulose or celluloseacetate membrane onto which anti-target analyte antibodies are immobilised in a line across themembrane as a capture zone or test line. A control zone may also be present, containing antibodiesspecific for the conjugated antibodies. Nitrocellulose, while extremely functional, the only materialthat has been successfully and widely applied for LIFA because of it’s relatively low cost, true capillaryflow characteristics, high protein-binding capacity, relative ease of handling.Conjugate Pad or reagent pad: This contains antibodies specific to the target analyte conjugated tocoloured particles (usually colloidal gold particles, or latex microspheres). The role of the conjugate padin a lateral flow immunoassay is to accept the conjugate, hold it stable over its entire shelf life, and releaseit efficiently and reproducibly when the assay is run. The materials of choice are glass fibers, polyesters,or rayons.Sample Pad: Sample pad is an absorbent pad onto which the test sample is applied. One of themajor advantages of the lateral flow concept is that these assays can be run in a single step with manydifferent sample types in a variety of application areas. The role of the sample pad is to accept thesample, treat it such that it is compatible with the assay, and release the analyte with high efficiency.The materials used for the sample pad depend on the requirements of the application. Examples ofsuch materials are cellulose, glass fiber, rayon, and other filtration media.Wick or waste reservoir: The wick is the engine of the strip. It is designed to pull all of the fluidadded to the strip into this region and to hold it for the duration of the assay. It should not releasethis fluid back into the assay or false positives can occur. The material is typically a high-densitycellulose.Backing Materials: All components of the lateral flow assay are laminated to the backing materialto provide rigidity and easy handling of the strip. The backing material is coated with a pressuresensitiveadhesive to hold the various components in place. The backing materials are typicallypolystyrene or other plastic materials coated with a medium to high tack adhesive.Labels for Detection: The most commonly used particulate detector reagents in lateral flow systemsare colloidal gold and monodisperse latex. Latex particles coupled with a variety of detector reagents,such as colored dyes, fluorescent dyes, and magnetic or paramagnetic components, are availablecommercially.Applications of lateral flow assays in food quality assuranceIn the past 3–5 years, food safety issues and concerns for public health have led to more stringentlegislation in food safety requirements. Legislation has produced increased demand for pathogenand toxin tests in just about every segment of the food production industry – processed food, meats,poultry, beverages, and dairy; and by all major food producers worldwide. For monitoring residuecontaminants such as veterinary, pesticide and antibiotic residues, an analytical strategy has beenrecommended using two different methods. This strategy comprises: (i) screening with a first methodoptimized to prevent false negative results, with a high sample throughput (e.g. ELISA), an acceptablepercentage of false positive results and low cost, and (ii) confirmation with an independent secondmethod optimized to prevent false positive results. Confirmatory methods are generally separativetechniques coupled with various detectors such as HPLC and GC–MS. Chromatography methodsare sensitive and specific, but suffer from being time consuming, laborious and multi-complex. Inaddition, these technologies are unaffordable to the farmers and some laboratories in the developingcountries. Therefore there have been emergent needs for developing highly accurate, rapid and cheapanalytical tools. Lateral flow tests provide advantages in simplicity and rapidity when compared tothe conventional detection methods. LFT has also been confirmed to be a rapid and sensitive methodin the detection of food borne pathogens such as Salmonella, Listeria, Campylobacter, Clostridiumand Escheriachia coli. Apart form these pathogens, LFA also has been employed for the detection ofbacterial toxins and zoonotic viruses such as Avian Influenza (AIV). LFA have also been used for thedetection of potentially allergenic peanut and hazelnut in raw cookie dough and chocolate. The74

Lateral Flow Assay- Principle and its Application in Analytical Food ScienceTable :- applications of lateral flow assays in food analysisAnalyte Assay format Labels Sample Sensitivities ReferenceDetection of pathogen bacteria and related toxinsStaphylococcusaureusSandwich Colloidal gold Pork, Beef, FriedChickenEscherichia coli Sandwich Colloidal gold Milk Powder, Flour,Starch, EtcListeriamonocytogenes

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceTable summarizes the published reports on LFT applications in this field. A driver in the demandfor rapid and LF tests in food production is the adoption of Hazard Analysis and Critical ControlPoints (HAACP) regulations that prescribe test procedures throughout the manufacturing process.A number of manufacturers have come with LF type tests. No one company dominates the marketfor LF food tests. The leaders are Strategic Diagnostics, Inc. (Newark, DE), Neogen, Idexx Labs andBiocontrol Systems (Brownsville, CA). Other companies include Celsis International PLC (Chicago,IL), Medical Wire & Equipment Co. (Wiltshire, United Kingdom), Merck KgaA (Dermstadt, Germany),and M-Tech Diagnostics Ltd. (Cheshire, United Kingdom).ConclusionsA variety of analytical methods available for detecting pathogen organisms or hazardouschemicals related to food safety, human health and environment suffers from being time-consuming,too expensive and too complicated to use. Major advantages found on LFT are low-cost, speed,portable, do not require complicated equipment and technical expertise, which are criticalcomponents during testing in the field. Since its initial development in the 1980s, the technology ofLateral Flow Immunoassay has gained wide acceptance. The main reason for its popularity is thesimplicity of the test design. The lateral flow immunoassay devices are compact and easily portable.Most of them do not require external reagent for results. Results are quick and easy to interpret,usually without the help of an instrument. The technology is also powerful. Multiple analytes can betested simultaneously with a single device. It can also be easily combined with other technology toprovide a comprehensive analysis like simultaneous drug and alcohol determinations by the policeforce in a roadside testing situation. Manufacturing of the test is relatively easy and inexpensive.Advancement in the detection moieties, improvement in material components, availability of betterprocessing equipment, and increased attention to quality manufacturing all these factors contributeto increase in the reliability, accuracy, and applications of the technology. However, the continuingdemand for quantitative result and sensitivity has presented great challenge for assay developer.References1. Blaskoza M, Koet M, Rauch P, Amerogen AV (2009) Eur Food Res Technol 229:867–8742. Chenggang S, Suqing Z, Kun Z, Guobao H, Zhenyu Z (2008) J Environ Sci 20:1392–13973. Geertruida A, Posthuma T, Jakob K, Amerogen AV (2008) Anal Bioanal Chem 392:1215-12234. Huang S-H, Wei H-C, Lee Y-C (2007) Food Control 18:893–8975. Khreich N, Lamourette P, Boutal H, Deveilliers K, Creminon C, Vollad H (2008) Anal Biochem 377:182–1886. Kolosova AY, De Saeger S, Sibanda L, Verheijen R, Peteghem CV (2007) Anal Bioanal Chem 389:2103–21077. Martı´n-Herna´ndez, C.; Mun˜oz, M.; Daury, C.; Weymuth, H.; Kemmers-Voncken, A.E.M,; Corbato´n, T.; Toribio,T. and Bremer, M.G.E.G. (2009). Int Dairy J. 19:205–208.8. Molinelli A, Grossalber K, Krska R (2009) Anal Bioanal Chem 395:1309–13169. Ngom, B., Guo, Y. Wang, X and Bi, D. (2010) Anal. Bioanal. Chem. 397: 1113-1135.10. O’Farrell, B. (2009) Evolution in lateral flow-based systems. In: Lateral flow immunoassay. (Ed. R.C. Wong andH.Y. Tse). Springer, NY, USA.11. Ponti, J.S. (2009)Material platform for the assembly of lateral flow immunoassay test strips. In: Lateral flowimmunoassay. (Ed. R.C. Wong and H.Y. Tse). Springer, NY, USA.12. Q. Rao, Y.-H. Peggy Hsieh. (2007) Meat Science. 76: 489–49413. Röder M , Vieths S, Holzhauser T (2009) Anal Bioanal Chem 395:103–10914. Rosen, S. (2009) Market Trends in Lateral Flow Immunoassays. In: Lateral flow immunoassay. (Ed. R.C. Wong andH.Y. Tse). Springer, NY, USA.15. Seo K-H, Holt PS, Gast RK, Stone HD (2003) Int J Food Microbiol 87:139–14416. Smidova Z, Blazkova M, Fukal L, Rauch P (2009) Czech J Food Sci 27:S414–S41617. Tang D, Sauceda JC, Lin Z, Basova SOE, Goryacheva I, Biselli S, Lin J, Niessner R, Knopp D (2009) Biosens Bioelectron25:51418. Wang J, Chen WN, Hu KX, Li W (2006) Chinese J 35:439–44119. Wang XH, Liu T, Xu N, Zhang Y, Wang S (2007) Anal Bioanal Chem 389:903–91120. Wang S, Zhang C, Wang J, Zhang Y (2005) Anal Chim Acta 546:161–16621. Wang J, Yu F-Y (2008) Anal Chem 80:7029–703522. Xu Y, Huang Z-B, He QH, Deng SZ, Li LS, Li YP (2010) J Food Chem 119:834–83923. Xiulan S, Xiaolian Z, Jian T, Xiaohong G, Jun Z, Chu FS (2006) Food Control 17:256–26276

Separation Strategies for Bioactive Milk ProteinsSeparation Strategies for Bioactive Milk ProteinsIntroduction:Rajesh KumarDairy Chemistry Division, NDRI, KarnalOver the past three decades, the dairy industry globally has moved from being based solely oncommodity food production to earning a significant income from specialty proteins. The introductionof large scale membrane processing in the early 1970’s made it possible not only to reduce waste but toproduce new products such as lactose and whey protein concentrate. A logical extension of the latterproduct is whey protein isolate (WPI), produced by single-stage batch capture of proteins on anionexchange resins. WPI is a crude mixture of acidic whey proteins, containing mainly α-lactalbumin,β-lactoglobulin, bovine serum albumin and immunoglobulins. Two whey proteins not capturedduring WPI production by anion exchange chromatography because of their high isoelectric pointsare lactoferrin (LF) and lactoperoxidase (LP). These basic proteins are instead captured from whey orskim milk by cation exchange chromatography and sold as specialty ingredients.Although production of high-value whey proteins is a commercial reality, two aspects of dairyprocessing may not be optimal for their production. First, the proteins are subjected to a series ofprocessing steps prior to being extracted. It is a generally accepted principle of bioseparation processdesign that proteins should be separated from a source material as fast and in as few steps as possible toavoid loss of activity and yield. Currently, high-value dairy proteins are viewed as a by-product, withthe major income of the industry coming from commodity dairy foods such as milk powder, cheeseand butter. Economies of scale for production of commodity dairy products mean that centralizedprocessing is the industry norm.Separation technologies provide the basis for adding value to milk through the production of bioactivecomponents that provide the food industry with nutraceuticals to develop functional foods. The globalfunctional food and nutraceutical market is currently worth about US$50 billion and is growing at some8 – 10 % annually. This huge and rapidly growing market, driven by consumer demands for healthpromotingfoods, is creating an almost insatiable desire on the part of food manufacturers for new andnovel ingredients with which to formulate these foods. Dairy constituents, notably the proteins andpeptides, provide the food technologist with a rich selection of potential ingredients for functional foods.Dairy proteins and peptides are truly multi-functional components, providing desirable features suchas physical functional traits, nutritional qualities and an increasing array of substantiated bioactivities.Their promise is clear. The challenge for science and technology is to isolate these ingredients in a costeffectivemanner while maintaining their inherent bio functional traits.Protein bioseparation:Protein bioseparation refers to the recovery and purification of protein products from variousbiological feed streams is an important unit operation in the food pharmaceutical and biotechnologicalindustry. Protein bioseparation is at present more important than at any time before due tophenomenonal developments in recent years in the frontiers of separation technology.Novel separation techniques:Separation technologies used to produce protein ingredients derived from milk includescreening based on size differences: centrifugation based on density differences; membraneprocesses based on size differences, such as ultrafiltration, diafiltration, nanofiltration, and reverseosmosis; ion exchange based primarily on charge differences; and affinity chromatography based onspecific binding to a matrix. Owing to unique functional and biological properties of many of the wheyproteins, a number of pilot and industrial scale technological methods have been developed for theirisolation in a purified form. Improved separation technologies and emerging markets have resulted77

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancein fractionation of milk proteins into ingredients that are enriched in specific proteins, or peptides, orboth to fill those new opportunities. This is especially true for milk protein fractions that are in verylow concentrations in the native state that require further concentration. These ingredients may beespecially useful in the developing market of physiologically functional foods, or nutraceuticals.Separation technologies are available to prepare fractions that are enriched in the followingmilk components: alpha-CN, beta-CN, beta-LG, alpha-LA, casein phosphopeptides, lactoferrin,lactoperoxidase and immunoglobulins and other minor proteins with special functional properties.Many of these products are commercially available in limited quantities. Bioactive peptides derivedfrom food proteins are often intermediates and are isolated from a very complex peptidic hydrolysatesin which their concentration are very low. The preparation of such peptides generally requires timeconsuming steps. Accordingly commercial production of bioactive peptide from milk proteins hasbeen limited by lack of suitable large scale techniques. Until now membrane based separation tech. hasprovided best technique for enrichment of peptides.Chromatographic techniques:Chromatographic techniques have been widely used for the isolation of milk proteins, and highperformance methodology now forms the basis for several accurate methods of analysis. Differenttypes of separation chemistries are used for chromatographic separation of milk proteins. In its simplestform, a chromatographic separation system consists of a column filled with separation adsorbentbeads. Chromatography has been known since the turn of the century, but its primary use has beenin the analytical sector, where the excellent separation capability has been a valuable investigativetool. The industrial use of this technology has however, been fairly limited and mainly used for highvalue added products in the pharmaceutical industry. Low processing rates and difficulties in scalingup chromatographic separation from laboratory to production scales has hampered the broader useand acceptance of the technology. However, now with the advancement in chromatography basedseparation technology, it has greatly improved the profitability of dairy industry through the bestpossible utilization of raw material especially whey in a cost effective manner.Chromatographic systems:The chromatographic systems are in many ways similar to ion-exchange systems. The varietyin adsorbent types and the range of applications are however far beyond what is known for ionexchange, and this has created a need for more sophisticated systems such as membrane adsorberbased chromatography, stirred tank batch process and expanded bed chromatography.Ion-exchange ChromatographyIon-exchange chromatography is the most popular method for protein purification.The theory of it is to use the difference of charges on proteins at a given pH. The solid adsorbentsare charged, positive or negative. Then the charged protein will be adsorbed by the charged adsorbents.According to the difference of the interaction forces between the protein and adsorbent, differentprotein is bounded differently by the adsorbent. Then, when we use some other buffer to replacethe protein, they (the proteins) will be washed out of the adsorbents in different velocity: the less theinteraction between the adsorbent and the proteins, the faster they will be washed out. Then, proteinscan be separated according to the sequence of their elution. There are two kinds of ion exchangers:anion exchangers, which have positively charged matrix, and will adsorb the proteins with negativecharge; cation exchanger, which have negative charged matrix, and will adsorb the proteins withpositive charge. The most common anion exchangers are DEAE- ,TEAE- and QAE-, and the cationexchangers often being used are CM- , S-.Membrane Chromatography:In order to overcome the limitations of traditional beads column, synthetic microporous ormacroporous membranes have been used as chromatography media. This method is called membranechromatography. Membrane chromatography can overcome the limitations associated with packed78

Separation Strategies for Bioactive Milk Proteinsbeds based chromatography. In membrane chromatographic processes, the transport of solutes to theirbinding sites take place predominantly by convection and the pore diffusion is very small comparingwith the beads column, thereby the mass transfer resistance is tremendously reduced. The result ofthis advantage is to reduce process time including adsorption, washing, elution and regenerationtime, which save time and improve efficiency. Most importantly, fast process can avoid the inactivityof biomolecules. As we all know, all the biomolecules have activities. The faster is the process, the lesspossibility for the biomolecules lose activity. The id ea of membrane chromatography is especiallysuited for large scaleprocess since the column volume of membrane can be made from less than 0.1ml and larger than thousands of liters. Due to the macroporous structure of the membrane support,membrane chromatography has a lower pressure drop, higher flow rate and higher productivity.There are many advantages of using membrane chromatography over column chromatography. Therate of association between target proteins and functional groups in ion exchange membranes is veryrapid, unlike the slow rate of diffusion through packed columns. The fast convective flow combinedwith negligible pressure drop lim itations exhibited by the thin membranes mean that processingtimes are dramatically reduced compared with packed columns. A distinct advantage of pressuredriven ion exchange processes is that there are no heat-treatments, extremes of pH, or chemicalpretreatment that could compromise protein structure and functionality. Hence, development of ionexchange membranes would be most desirable in terms of purifying individual whey proteins for usein functional foods and pharmaceutical products (Goodall et al., 2008).Application of membrane chromatography for protein purificationUsually, the membranes used for membrane chromatography have functional ligands attached totheir inner pore surface as adsorbents. There are many types of adsorptive membranes including ionexchangemembranes, affinity membranes, reverse-phase membranes and hydrophobic interactionmembranes. All these membranes have been developed for the purification of proteins, enzymes, andantibodies from various sources.The stirred tank system:In the stirred tank system for protein fractionation, the liquid to be treated is slurried with thechromatographic adsorbent material, in this case an ion-exchange resin, - until adsorption has occurred.The deproteinised solution is then draining from the stirred tank. The adsorbent is then washed withwater, prior to desorption of the proteins using an acid, alkali and/ or mineral salt solution. Comparedto the column system, the disadvantage of the stirred tank system is the fact that all the target proteinsare not removed, due to the equilibrium conditions. This problem can be partly solved by refeeding thedeproteinised solu tion to the adsorbent material, before the next batch of whey is treated. The stirredtank system allows the use of larger adsorbent particles, since the contact time between adsorbent andliquid can be increased. This facilitatesthe removal of the process solu tion, and makes the process less sensitive to fat and suspendedsolids. Also less overall changes in pH are required during the complete adsorption / desorptioncycle, which reduces the risk of protein denaturation, improving the final p roduct quality.Expanded bed chromatography:In expanded bed chromatography, viscous and particu late-containing feeds that would foul atraditional packed column are accommodated by introducing the feed upward through a column packedwith media designed to be suspended and dispersed in the upward flow. The bed expansion createsan increased void space between adsorbent particles allowing passage of particulate contaminants inthe feed and preventing unacceptable pressure buildup within the column. Once the feed is loadedand the target product is bound to the adsorbent, a wash step is performed, also in expanded bedupward flow mode, to remove particulates and unbound contaminants. Elution of the target productis then performed via downward flow in traditional packed bed mode. Some studies relate elutionperformed with an expanded bed upward flow mode. This tends to increase the elution volume. Aclean-in-place procedure is normally required after elution to prepare the column for another loading79

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancestep. An expanded bed is essentially a cross between a packed bed, with stationary p articles and lowflu id dispersion, and a fluidized bed, with randomly mixing particles and high flu id dispersion.Process design variables for optimizing expanded bed chromatographic separations include chemicaland physical properties of the packing media and of the feed solutions. Chromatographic media withthe appropriate density, particle size distribution, and mechanical stability required for expanded bedoperation are commercially available with several different chemistries including anion and cationexchange. The chemical properties of the feed such as pH, ionic strength, and buffer type that affectselectivity and capacity of the process have essentially the same effect in expanded bed mode as theydo in traditional packed bed chromatography.High Gradient Magnetic Fishing (HGMS):Heeboll-Nielsen et al., (2004) described the process for separation of lactoferrin and lactoperoxidasefrom whey using superparamagnetic ion exchangers. HGMS is employed to simply remove productor contaminants from process or waste streams in mineral processing. The term HGMF covers theintegrated process from product adsorption to magnetic separation and finally recovery of the productin a clarified and partly purified form, in contrast to merely the collection of particles in HGMS. Theobjectives of the individual steps in HGMF are similar to those of any chromatographic purificationprocess, and the process generally consists of: (i) mixing of the feedstock with the superparamagneticadsorbents to bind the target protein; (ii) separation of the protein laden supports from the spentfeedstock supernatant using high gradient magnetic separation technology; (iii) washing of theadsorbents and elu tion of boundprotein from the adsorbents using multip le cycles of support capture and release and finally (iv)a procedure for cleaning and regeneration of the supports. In contrast to chromatography all steps areoperated in a batchwise manner, and each operation contains a step to capture the supports in highgradient magnetic field s. For such operation the HGMF system may be +designed with stirred reactortanks and closed recycled loops.Conclusion:Dairy manufacturing technology has expanded tremendously in recent years and the emphasison identifying, recovering, and/ or supplementing bioactive proteins and peptides as functionalingredients will remain at forefront of future. Ultimately these approaches will improve the quality offood products containing such constituents.References:Bajaj, R.K. and Sangwan, R.B. (2002) Health enhancing potential of whey proteins – a review. Indian J. Dairy Sci., 55(5):253-260.Bargemana,G., Koopsb, G.-H. , Houwinga , J. , Breebaartb, I. , van der Horsta, H.C. and Wessling, M. (2002). Thedevelopment of electro-membrane filtration for the isolation of bioactive peptid es: the effect of membrane selectionand operating parameters on the transport rate. Desalination. 149: 369–374.Clare, D.A. , Catignani, G.L. and Swaisgood, H.E. (2003) Biodefense properties of milk: The role of antimicrobial proteins and p eptid es. Current Pharmaceutical Design, 9: 1239- 1255.Expanded bed adsorption; princip les and methods, Amersham Pharmacia Biotech, (1997).Goodall, S., Grandison, A. S., Jauregi, P. J. and Price J. (2008). Selective separation of the major whey proteins u sing ionexchange membranes. J. Dairy Sci. 91: 1-10Hauffman, L.M. and Harper, W.J (1999). Maximizing the value of milk through separation technologies. J. Dairy Sci.,82(10): 2238-2244Heebøll-Nielsen,A., Justesen,S.F.L, Hobley,T.J. and Thomas, O.R.T. (2004). High Gradient Magnetic Fishing recovery ofbasic whey proteins using superparamagnetic cation-exchangers. J. Biotech. 113: 247-262.Korhonen, H. (1998) Colostrum immunoglobulins and the complement system- potential ingredients of functionalfoods. IDF bulletin, 336: 36-40.Nielsen, W.K., Morten, A.O. and Lihme, A. Expanding the fronteiers in separation technology in Scandinavian dairyInformation 2 / 02.Olander, M.A., Jakobsen, U.L., Hansen M.B. and Lihme, A. Fractionation of high value whey Proteins. in Scandinaviandairy Information 2 / 01.Roper, D.K. and Lightfoot, E.N. (1995) Separation of biomolecules using adsorptive membranes. J. of ChromatographyA 702: 380

SDS-PAGE – Principle and ApplicationsSDS-PAGE – Principle and ApplicationsY. S. Rajput 1 and Rajan Sharma 21Animal Biochemistry Division, 2 Dairy Chemistry Division, NDRI, KarnalIntroduction and PrincipleThe purpose of sodium dodecyl sulphate – polyacrylamide gel electrophoresis (SDS-PAGE) is toseparate proteins according to their size. SDS-PAGE is the most widely used method for analyzingprotein mixture qualitatively. It is particularly useful for monitoring protein purification and, becausethe method is based on the separation of proteins according to size, it can be used to determine therelative molecular mass of proteins. SDS (CH 3-(CH 2) 10-CH 2OSO 3-Na + ) is an anionic detergent and whenproteins are treated with SDS in presence of a reducing agent like β-mercaptoethanol or dithiothreitol,SDS binds to hydrophobic regions of protein molecule and provides net negative charge on proteinmolecule. The binding of SDS to per-unit-length of protein molecules is almost constant for largenumber of different proteins and this brings charge-to–mass ratio almost constant for most proteins.The electrophoretic movement of protein in acrylamide gel is determined by molecular weight ofproteins. Lower molecular weight proteins move faster than high molecular weight proteins. Themethod described by Laemmli (1970) is widely used. In this method, discontinuous buffer systemis employed. A continuous buffer system has only single separating gel and uses same buffer in thetanks and gel. In discontinuous buffer system, large pore gel (stacking gel) is layered over small poregel (separating or running gel). For preparation of stacking gel and separating gel, different buffers areused and also tank buffers are different from gel buffers. When electrophoresis is started, ions fromstacking gel (leading ion), ions from buffer tank (trailing ion) and proteins start moving into stackinggel. In stacking gel, protein moves between leading ion and trailing ion and this leads to concentrationof protein in a thin zone referred as stack. The protein molecules continue to move in the stack untilthey reach the separating gel.Formation of Polyacrylamide Gels: Crosslinked polyacrylamide gels are formed from thepolymerization of acrylamide monomer in the presence of smaller amounts of N,N’-methylene-bisacrylamide(normally referred to as “bis-acrylamide”) (Fig. 1). Note that bis-acrylamide is essentiallytwo acrylamide molecules linked by a methylene group and is used as a crosslinking agent.Acrylamide monomer is polymerized in a head-to-tail fashion into long chains, and occasionally a bisacrylamidemolecule is built into the growing chain, thus introducing a second site for chain extension.Proceeding in this way, a crosslinked matrix of fairly well-defined structure is formed (Figure 1). Thepolymerization of acrylamide is an example of free-radical catalysis, and is initiated by the addition ofammonium persulfate and the base N,N,N’,N’tetramethylenediamine (TEMED). TEMED catalyzes thedecomposition of the persulfate ion to give a free radical (i.e., a molecule with an unpaired electron):2-S 2O 8+ e - 2- -.------ → S 2O 8+ SO 4(1)If this free radical is represented as R . (where the dot represents an unpaired electron) and M as anacrylamide monomer molecule, then the polymerization can be represented as follows:R . + M → RM .RM . + M → RMM .RMM . + M → RMMM. and so forth (2)In this way, long chains of acrylamide are built up, being crosslinked by the introduction of theoccasional bis-acrylamide molecule into the growing chain. Oxygen “mops up” free radicals, andtherefore the gel mixture is normally degassed (the solutions are briefly placed under vacuum toremove loosely dissolved oxygen) prior to addition of the catalyst.Use of Stacking Gels: For both SDS-PAGE and native-PAGE, samples may be applied directly tothe top of the gel in which protein separation is to occur (the separating gel). However, in these cases,81

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancethe sharpness of the protein bands produced in the gel islimited by the size (volume) of the sample applied to the gel.Basically the separated bands will be as broad (or broader,owing to diffusion) as the sample band applied to the gel.For some work, this may be acceptable, but most workersrequire better resolution than this. This can be achieved bypolymerizing a short stacking gel on top of the separating gel.The purpose of this stacking gel is to concentrate the proteinsample into a sharp band before it enters the main separatinggel, thus giving sharper protein bands in the separating gel.This modification allows relatively large sample volumesto be applied to the gel without any loss of resolution. Thestacking gel has a very large pore size (4% acrylamide) whichFigure 1. Polymerization of acrylamideallows the proteins to move freely and concentrate, or stackunder the effect of the electric field. Sample concentration is produced by isotachophoresis of thesample in the stacking gel. The band-sharpening effect (isotachophoresis) relies on the fact that thenegatively charged glycinate ions (in the reservoir buffer) have a lower electrophoretic mobility thanthe protein-SDS complexes, which in turn, have lower mobility than the C1 - ions if they are in a regionof higher field strength. Field strength is inversely proportional to conductivity, which is proportionalto concentration. The result is that the three species of interest adjust their concentrations so that [C1 - ]> [protein-SDS] > [glycinate]. There are only a small quantity of protein--SDS complexes, so theyconcentrate in a very tight band between the glycinate and C1 - ion boundaries. Once the glycinatereaches the separating gel, it becomes more fully ionized in the higher pH environment and itsmobility increases. (The pH of the stacking gel is 6.8 and that of the separating gel is 8.8.) Thus, theinterface between glycinate and the C1 - ions leaves behind the protein-SDS complexes, which are leftto electrophorese at their own rates.Procedure: The below mentioned procedure is for the separation of proteins using glycine-SDS-PAGE. For the separation of low molecular weight proteins, Tricine-SDS-PAGE is used and procedureis mentioned in the compendium.Equipments and ChemicalsMini-vertical gel electrophoresis dual model with glass plates, spacer, comb and power-supply;orbital shaker; 1 ml glass syringe with 2”22G needle; acrylamide, N,N1 methylene bisacrylamide;ammonium persulfate; β-mercaptoethanol; sodium dodecyl sulfate; molecular weight markers;coomassie brilliant blue R-250; TEMED; tris; glycine; dithiothreitol.Stock SolutionsAcrylamide / Bisacrylamide (30%): 29.2 g acrylamide and 0.8 g bisacrylamide are dissolved indistilled water and total volume was made to 100 ml. The solution is filtered and filtered solution canbe stored at 4ºC in dark bottle up to 3 months.4x Running Gel Buffer (1.5 M Tris-HCl, pH 8.8): 18.15 g Tris is dissolved in about 80 ml distilledwater. pH is adjusted to 8.8 with 1 N HCl and total volume is made to 100 ml with distilled water.Prepared buffer can be stored up to 3 months at 4ºC in dark bottle.4x Stacking Gel Buffer (0.5M Tris-HCl, pH 6.8): 3.0 g Tris is dissolved in about 40 ml distilledwater. pH is adjusted to 6.8 with 1 N HCl and total volume is made to 50 ml with distilled water.Prepared buffer can be stored up to 3 months at 4ºC in dark bottle.10% SDS: 10 g sodium dodecyl (lauryl) sulfate is dissolved in distilled water and total volume ismade to 100 ml with distilled water. Prepared solution can be stored at room temperature.5 x Electrode Buffer (125 mM Tris, 960 mM Glycine, 0.5 % SDS, pH 8.3: 15 g Tris, 72 g glycine and 5g SDS are dissolved in distilled water and total volume is made to 1 litre with distilled water. The pHof buffer should be 8.3 ± 0.2. Stock electrode buffer is diluted five times with distilled water before use.82

SDS-PAGE – Principle and ApplicationsThe stock buffer can be stored at room temperature up to 1 month. The diluted stock buffer is 25 mMtris, 192 mM glycine, and 0.1% SDS.10% Ammonium Persulfate: 100 mg ammonium persulfate is dissolved in 1.0 ml distilled water.The solution is always prepared fresh.2 x Sample Buffer (0.125 M Tris, 4% SDS, 20% glycenol 0.2 M DTT, 0.02% bromophenol blue, pH6.8: 2 x sample buffer is prepared by mixing following solutions/chemical.4 x stacking gel buffer - 2.5 mlglycerol - 2.0 ml10% SDS - 4.0 mlBromophenol blue - 2.0 mgDithiothreitol (DTT) - 0.31 gDistilled water - 1.5 ml2 x sample buffer can be stored in small aliquots at - 200C up to 6 months. Instead of DTT, 1.0 mlof β-mercaptoethanol can be used but the volume of water is reduced to 0.5 ml.Overlay Buffer (0.375 M Tris, 0.1%, SDS, pH 8.8): Overlay buffer is prepared by mixing 25 mlrunning gel buffer, 1 ml 10% SDS and 74 ml distilled water. This buffer can be stored up to 3 monthsat 4ºC in the dark bottle.ProcedureGlass Sandwich: One notched glass plate is placed on a flat surface. One spacer (1.0 mm) each isthen placed along the each of two edges so that spacer aligns with the notch. Subsequently, rectangularglass-plate is placed over it. The sandwich is held firmly between thumb and fingers. Side-ways ofboth spacers were sealed with appropriate tape to overcome any possible gel-leak during gel platepreparation. There is always the possibility of leakage at the bottom of the plate. This is taken careby placing molted agar (1% in water) up to 5 mm height in trough of gel-casting unit. The plate instanding position is then quickly placed in casting unit and screws are finger tightened.Preparation of Running Gel: Running gel of desired concentration is prepared by mixingappropriate volumes of solutions as shown belowAcrylamide / bisacrylamide, running gelbuffer, SDS and distilled water are added toconical flask and degassed. Then ammoniumpersulfate and TEMED are added andcontents mixed gently. With the help of glasspipette, the running gel solution is deliveredto sandwich to a level about 3 cm below thetop of rectangular plate. Air should not betrapped while filling sandwich with runninggel solution. A small volume of water oroverlay-buffer (~ 200 µl) is layered over gelsolution with the help of glass syringe with 22G needle. This prevents exposure to oxygen.SolutionsFinal Gel Concentrations7.5% 10% 12.5% 15%Acrylamide / 5.0 ml 6.7 ml 8.3 ml 10.0 mlbisacrylamide (30%)4 x Running gel 5.0 ml 5.0 ml 5.0 ml 5.0 mlbuffer10% SDS 0.2 ml 0.2 ml 0.2 ml 0.2 mlDistilled water 9.7 ml 8.0 ml 6.4 ml 4.7 ml10% Ammonium 0.1 ml 0.1 ml 0.1 ml 0.1 mlpersulfateTEMED 6.7 µl 6.7 µl 6.7 µl 6.7 µlPreparation of Stacking Gel: Stacking gel of 4% concentration is prepared by mixing appropriatevolumes of solutions as shown belowThe preparation of stacking-gel solution is similar to preparation of running-gel solution. Afterremoval of water or overlay buffer, stacking-gel solution is layered over running gel. Appropriatecomb is inserted into the stacking gel to make wells for sample application. Comb is removed afterpolymerization of gel.83

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceSample Preparation: Protein samples (1 mg/ml) are SolutionsVolumecentrifuged (10,000 g, 5 min.) to remove any insoluble material Acrylamide / bisacrylamide (30%) 1.3 mland are mixed with equal volume of 2 X sample buffer. The4 x Stacking gel buffer 2.5 mlresultant solution is boiled for 3 to 5 min. Molecular weight10% SDS 0.1 mlmarkers are also prepared in a similar way.Distilled water6.1 mlElectrophoresis: Gel plates are then tightly attached10% Ammonium persulfate 50 µlto electrophoresis unit. Stock electrode buffer is five timesTEMED 10 µldiluted with cold water. Anode and cathode chambers arefilled with buffer. 5 to 20 µl of sample is applied to eachwell. Electrophoresis is carried out at constant voltage of 50V till sample crosses stacking gel. Whensample enters running gel, voltage is increased to 100V. Complete electrophoretic run takes around2.5 to 3.0 h. During electrophoresis, temperature is kept low by circulating water in electrophoreticassembly. After electrophoretic run, stacking gel is removed. Small cut on top left side in runninggel is made to remember the orientation of the gel.Staining of proteins in gel: The gel is placed in glass tray containing coomassie brilliant blue solution(0.25%) prepared in methanol : acetic acid : water (40:7:53) mixture. Glass tray is then placed on orbitalshaker for 4 h at room temperature. After staining for 4 h, the gel is transferred to the destaining solutionI (methanol, acetic acid and water mixture in ratio of (40:7:53) for 30 min. Subsequently gel is placedin destaining solution II (methanol, acetic acid and water mixture in ratio of 7:5:88) till bands becomevisible against light background. During staining and destaining, gel should float free in glass tray.Helpful-hints84• A particular concentration of acrylamide gel is used Per Cent Molecular weight of proteinsfor separating proteins of particular range of molecularweights. Whereas low acrylamide gel concentration isused for separating high molecular weight proteins,low molecular weight proteins are resolved in highgel concentration. Use following table in deciding gelconcentration in separating gel.gel7.510.012.515.0to be separated (KD)24 – 20514 – 20514 – 6614 – 45• Spacers can absorb heat and thus lowers the temperature of gel at edges. If the gel is hotter inthe middle than at the edges, the mobility of dye front at edges will be lower as compared tomobility in the middle. This can be avoided by (i) using cooled electrode buffer and (ii) notallowing buffer to warm up during run. Thus, during electrophoretic run either use coolingdevice or use low current.• If gel is not polymerized properly at edges, current can leak down the edges resulting in moremobility at edges. Air- bubbles at the bottom of glass plates can block current flow resultingabnormal dye front.• While placing comb in stacking gel, care should be taken not to allow air-trap. Air inhibitspolymerization and sample wells will be distorted.• All stock solutions required for gel preparation are stored at refrigerated temperature and theseshould be brought to room temperature. At low temperature, polymerization is inhibited. Oxygenalso inhibits polymerization of acrylamide and these solutions should be degassed before use.• Sometimes boiling of sample in sample buffer may lead to irreversible precipitation and suchsamples remain at the top of separating gel. For such samples one can try incubating sample insample buffer at 70ºC instead of 100ºC.Reference:Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T 4. Nature, 227L680-685.Walker, J.M. (2006) Electrophoretic techniques. In Principles and Techniques of Biochemistry and Molecular biology (K.Wilson & J. Walker Eds). Cambridge University Press, New York.

Western Blot: Theoretical AspectsWestern Blot: Theoretical AspectsY. S. Rajput 1 and Rajan Sharma 21Animal Biochemistry Division, 2 Dairy Chemistry Division, NDRI, KarnalWestern blotting is the transfer of proteins from the SDS-PAGE gel to a solid supporting membrane.For analysis based on antibody reactivity or nucleic acid hybridization, the separated molecules aremade free of electrohoretic matrix. This can be simply achieved by slicing the gel followed by elution inbuffer. But, this process is slow and resolution is also poor. An alternative efficient method is ‘blotting’technique in which molecules are separated on a slab gel and separated molecules are eluted throughthe broad face of the gel onto a membrane that binds the molecules as they emerge. Proteins andnucleic acids stay on the surface and can be detected.The membrane materials frequently employed in blotting are nitrocellulose, nylon andpolyvinylidene difluoride (PVDF). The choice of membrane depends on the type of analysis andcharacteristics of detection system. Nitrocellulose is the most widely used since it works well withboth protein and nucleic acids. Some nylons do not bind protein reliably. PVDF, is often used whenbound proteins are analysed for sequencing.The transfer of the proteins or nucleic acids from the gel to the membrane can be achieved bycapillary flow of buffer or by transverse’ electrophoresis. The use of capillary flow to transfer DNAfrom agarose gels to nitrocellulose membrane was first described by Southern (1975) and thus referredas Southern blotting. Using the same method for transfer of RNA is referred as Northern blotting.Western blot refers to transfer of protein from gel to membrane and this technique was described in1979-80 by many workers but the method described by Towbin et al. (1979) is most cited.Western blotting essentially comprises of three techniques which are applied in sequence. Thefirst one is referred as SDS-PAGE through which proteins are separated based on the molecular sizeof molecules in acrylamide gel. Sodium dodecyl sulphate (SDS) is an anionic detergent that denaturesproteins by wrapping around the polypeptide backbone. This results in net negative charge topolypeptide in proportion to its length. Laemmli system (Laemmli, 1970) employing discontinuousbuffer is most widely used electrophoretic system. The resolution in Laemmli’s method is excellentbecause treated peptides are concentrated in stacking gel before entering the separating gel. Thetechnique, which follows SDS-PAGE, is transfer of protein/from gel to membrane. There are twotypes of equipments for electrophoretic transfer of proteins: the semi-dry blotting apparatus and‘tank’ buffer apparatus. The third technique used in sequence is for identification of protein (antigen)by performing” antigen-antibody (first antibody) reactions on the membrane itself. Second antibodyenzyme conjugates were then allowed to interact with immobilized first antibody and, then usingappropriate substrate, protein bands are detected. Although, antigen-antibody interactions are widelyemployed in Western blot, other kind of interactions such as glycoprotein-lectin and biotin-avidinhave allowed research workers to employ this technique for other applications including carbohydratestaining of glycoprotein, protein sequencing etc.Semi-dry electrophoretic transferIn semi-dry electrophoretic transfer, a stack of wetted filter papers surrounding the gel and theblotting membrane is used as a buffer reservoir, instead of tank as in conventional electrophoretictransfer. The electrodes, consist of conductive plates made of graphite or stainless steel or a conductingpolymer. The size of the plates is at least the same size as that of gel to provide homogeneous electricfield. The main advantages with semi¬dry transfer are the ease of handling, the short time (30 min, to1 h) required for the transfer and low buffer consumption. Another important feature is that differentbuffers can be used at the anodic and cathodic sides to improve the transfer. The short electrodedistance gives a high voltage gradient despite low power. Cooling is not normally required since heatproduction is negligible. Transfer can be performed from several gels at a time, either by placing them85

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancebeside each other if the electrodes are large enough or by placing several transfer units on top of eachother. Because of the short electrode distance, voltage applied is most often 10-20V. On the other hand,because of large cross-sectional area, the current passing through the transfer sandwich is fairly high,in the range 0.1-1A.Tank-buffer electrophoretic transferIn tank-buffer electrophoretic transfer, transfer cassette is submerged in a ‘tank’ of buffer. Gel,membrane, filter paper, porous foam sheet are arranged in cassette as per instructions of manufacturer.The details have been provided in write-up for practicals.Blot membranesNumerous types of papers and membranes have been utilized for protein blotting. Nitrocellulosepaper (film of nitric acid esterified cellulose) has been the most frequently used membrane.The bindingof proteins to nitrocellulose is probably hydrophobic. For electrophoretic transfer of small proteins,membranes with 0.1or 0.2 µm pore size are selected. If membranes stick to low concentration gels aftertransfer, membranes with pore size of 0.45 µm are selected. A drawback with nitrocellulose membraneis, however, that they are very brittle when dry.The other membrane, which is in use, is polyvinylidene fluoride (PVDF). PVDF membrane is ateflon-type polymer composed of the basic repeating unit (- +δ CH 2- -δ CF 2-) nand has good mechanicalstrength. Proteins interact with the polymer non-covalently through dipolar and hydrophobicinteractions. PVDF is chemically compatible with the aqueous buffer systems. Since PVDF is resistant tomost organic solvents, it can withstand harsh chemical conditions in which nitrocellulose membranesdissolve or decompose. These membranes are expensive. Some PVDF membranes have additionalcomponents. Western consists of PVDF cast on a polyester web. The web does not interfere withelectroblotting or alter the characteristics of the PVDF. Immobilon-CD is PVDF membrane in whichsurface is chemically modified to have a cationic charge. Although hydrophobic and dipolar interactionswith the Immobilon-CD may contribute to protein binding, the primary binding interaction is ionic.The membranes with high internal surface area (>2000 cm 2 per cm 2 of frontal area) bind substantiallymore protein (400 µg BSA/cm 2 ) as compared to membrane with low internal surface area (~400 cm 2per cm 2 of frontal area) that binds to around 130 µg BSA/cm 2 . Low internal surface area membranesusually function better in immunodetection. They are comparatively easy to block and antibodies arebetter able to penetrate the more open pore structure. Membranes with high internal surface structureare more difficult to block effectively and less open pore structure often limits antibody accessibility.Besides immunodetection, PVDF membranes are used for amino acid sequencing, amino acid analysisand peptide mapping. For these applications, blocking is not required and there is no steric hindranceencountered by antibodies. Higher internal surface membranes and Immobilon-CD are suitable foramino acid sequencing and amino acid analysis. Peptide mapping is more effective on low internalsurface area membranes. PVDF membrane is compatible with protein staining and immune-chemicalprotocols.Positively charged nylon membranes arc mechanically strong and have a high binding capacity.A disadvantage is their high non-specific binding which results in a high background afterimmunodetection. Most general protein stains are anionic dyes and can not be used with nylonmembranes since they bind to these membranes.Transfer bufferA major concern in transferring proteins onto nitrocellulose membrane is the composition of thetransfer buffer. The original protocol of Towbin et al. (1979) uses a transfer buffer containing methanol,which was added to, counteract swelling of the gel. Methanol also decreases gel pore size, removes SDSfrom proteins. Methanol may precipitate the proteins within the gel, however, it increases the capacityand the affinity of nitrocellulose membrane for proteins. PVDF membrane is activated by placingit in 100% methanol for 1-2 sec. This allows the hydrophobic surface of PVDF to wet with aqueous86

Western Blot: Theoretical Aspectssolvent. Addition of 20% methanol to transfer buffer is recommended for low molecular weightproteins. Methanol is not required for transfer to charged nylon membranes. Methanol facilitates thedissociation of SDS-Protein complexes and increases the hydrophobic interaction between protein andmembrane. On the other hand, for high molecular weight proteins, methanol can decrease the elutionefficiency by denaturing the proteins or retarding the elution from the gel. In contrast to low molecularweight proteins, high molecular weight proteins do not require methanol for adequate binding to themembrane.The presence of SDS in transfer buffer increases the mobility of protein from gel to membrane. Thisis especially useful for transfer of protein after isoelectric focussing, when proteins have no net charge.However, SDS decreases the binding of the protein to both nitrocellulose and PVDF membrane. It issometimes necessary to add SDS (0.01-0.02%) to aid transfer of high molecular weight proteins. Transferbuffer generally used is 25 mM Tris, 192 mM glycine, pH 8.3 and 20% methanol. If membrane is tobe used for protein sequencing or amino acid, analysis, CAPS buffer (10 mM 3-(cyclohexylamino)-1¬propanesulfonic acid, 10% methanol, pH 11.0 is recommended. Application of protein blotting forcharacterization of antigens will require antigen specific antiserum. By simultaneously runningmolecular weight markers and proteins (extracted from biological materials) in SDS-PAGE andsubsequent detection after electrophoretic transfer provides information about molecular weight ofantigen. Antibodies should be specific otherwise cross-reaction is observed and interpretation is moredifficult. Affinity purified antibodies or monoclonalantibodies provide good result. Through thesereactions, one can detect presence or absence ofsuch antigens in related and unrelated biologicalmaterials. Now tools are available for ascertainingcarbohydrate moiety in proteins on membrane.These proteins can be oxidized by periodateresulting in generation of free aldehyde groups(Figure 1). The generated groups are reacted withbiocytin hydrazide leading to biotinylation ofglycoproteins. Using appropriate probe such asavidin-peroxidase and substrate, glycoproteinsare detected. Alternately lactins specific forcarbohydrate residues can be employed. In thisapproach antibody (against lectins) enzymeconjugates or lactin - enzyme conjugates canbe used for staining glycoproteins. Asn-linked oligosaccharides can be cleared from protein ontomembrane by hydrazinolysis. The released oligosaccharides can be characterized by using biochemicaltechniques. Proteins onto membrane can be hydrolyzed for determining amino acid composition.Peptide mapping and protein sequencing are other useful applications where proteins on membraneare the starting material for subsequent steps.References:Figure 1. Detection of Biotin Labeled Glycoproteins onWestern blotsKurien, B.T and ScoWeld, R. H. (2006) Western blotting. Methods: 38 (2006) 283–293.Towbin, H.; Stachelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels tonitrocellulose sheets: procedure and some applications. Proc. Nat. Acad. Sci. USA. 76: 4350-4354.87

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceEnzyme Linked Immunosorbent Assay - TheoryRajeev Kapila and Suman KapilaAnimal Biochemistry Division, NDRI, KarnalEnzyme immunoassay (EIA) and enzyme-linked immunosorbent assay (ELISA) have becomehousehold names for medical laboratories, manufacturers of in vitro diagnostic products, regulatorybodies, and external quality assessment and proficiency-testing organizations. Analytes such aspeptides, proteins, antibodies and hormones can be detected selectively and quantified in lowconcentrations by ELISA. ELISAs are rapid, sensitive, cost effective and can be performed in a highthroughputmanner. In contrast, techniques like immunofluorescence and RIA are tedious, timeconsuming, having short shelf-life of the reagents, requiring sophisticated expensive equipments andthe strict regulatory controls on the use of isotope. Though, this technique is relatively less sensitive ascompared to radio-immuno-assay (RIA) but efforts are continuing to increase its sensitivity.An ELISA is used in a vast variety of different types of assays (e.g. direct ELISA, indirect ELISA,sandwich ELISA, competitive ELISA). Nevertheless, all ELISA variants are based on the same principle,the binding of one assay component – antigen or specific antibody – to a solid surface and the selectiveinteraction between both assay components. Molecules not specifically interacting with the assaycomponent are washed away during the assay. For the detection of the interaction, the antibody orantigen is labeled or linked to an enzyme (direct ELISA). Alternatively, a secondary antibody conjugatecan be used (indirect ELISA). The assay is developed by adding an enzymatic substrate to produce ameasurable signal (colorimetric, fluorescent or luminescent). Such a substrate is called a chromogenicor luxogenic substrate. The strength of the signal indicates the quantity of analytes in the sample.A number of enzymes have been employed for ELISA, including alkaline phosphatase, horseradishperoxidase and β-galactosidase. These assays approach the sensitivity of Radioimmunoassay (RIA)and have the advantage of being safer and less costly.Direct ELISAThe direct ELISA uses the method of directly labeling the antibody itself. Microwell plates arecoated with a sample containing the target antigen, and the binding of labeled antibody is quantitatedby a colorimetric, chemiluminescent, or fluorescent end-point. This technique has advantages ofdirect detection, quick methodology since only one antibody is used. Cross-reactivity of secondaryantibody is eliminated. Major disadvantages of direct detection is reduced Immunoreactivity of theprimary antibody as the result of labeling. Labeling of every primary antibody is time-consuming andexpensive. No flexibility in choice of primary antibody label from one experiment to another. Littlesignal amplificationIndirect ELISAThe indirect ELISA utilizes an unlabeled primary antibody in conjunction with a labeled secondaryantibody. Since the labeled secondary antibody is directed against all antibodies of a given species(e.g. anti-mouse), it can be used with a wide variety of primary antibodies (e.g. all mouse monoclonalantibodies). Indirect detection method of ELISA is versatile, since many primary antibodies can bemade in one species and the same labeled secondary antibody can be used for detection. Moreover,wide variety of labeled secondary antibodies are available commercially. Immunoreactivity of theprimary antibody is not affected by labeling. Sensitivity is increased because each primary antibodycontains several epitopes that can be bound by the labeled secondary antibody, allowing for signalamplification. Cross-reactivity may occur with the secondary antibody, resulting in nonspecificsignal.88

Enzyme Linked Immunosorbent Assay - TheorySandwich ELISAThe sandwich ELISA measures the amount of antigen between two layers of antibodies. Theantigens to be measured must contain at least two antigenic sites, capable of binding to antibody,since at least two antibodies act in the sandwich. So sandwich assays are restricted to the quantitationof multivalent antigens such as proteins or polysaccharides. Sandwich ELISAs for quantitation ofantigens are especially valuable when the concentration of antigens is low and/or they are containedin high concentrations of contaminating protein.Competitive ELISAIn this unlabeled antibody is incubated in the presence of its antigen. These bound antibody/antigen complexes are then added to an antigen coated well. The plate is washed and unboundantibody is removed. The secondary antibody, specific to the primary antibody is added. This secondantibody is coupled to the enzyme. A substrate is added, and remaining enzymes elicit a chromogenicor fluorescent signal. For competitive ELISA, the higher the original antigen concentration, the weakerthe eventual signal.Selection of enzymes for labellingAntigen-antibody interaction is basis on which Elisa works and extent of interaction is measuredby measuring the activities of enzyme linked to antigen or antibody. In ELISA, a soluble substrate thatis converted to soluble coloured product is used. Absorbance of colour is read in ELISA plate reader,which can read samples in 96-well microtitre plates. Enzymes are selected on the basis of availability ofpurified enzyme at cheaper rate, turn over number and availability of cheaper chromogenic substrates.The most common enzymes used are horseradish peroxidase and alkaline phosphate.Applications in dairySince the advent of pasteurization, the dairy industry has been a leader in food safety andaggressively proactive in its commitment to ensure the safety of dairy products. Few areas of attentionare pathogens, toxins, adulterants and, more recently, allergens. Thanks to new technological advancesin convenient-to-use, rapid screening tests, these safety issues can now be addressed as part of a totaldairy quality control program.Detection of pathogensBacterial pathogen contamination of dairy products is usually monitored via agar plate countingtechniques, which generally take from one to five days—too long to be an effective pathogen screeningtool. One of the most popular immunoassay techniques for screening milk for pathogens and toxins isthe enzyme-linked immunosorbent assay (ELISA) method. Highly automated and sensitive bench-topinstruments based on immunoassay methods are now available and have significantly reduced thetime and labor required to obtain results. According to Vasavada (2001), the rapidity and sensitivityof immunoassay-based test kits and systems have come a long way in the past few years due todevelopment in immunoprecipitation devices, lateral flow devices and immunomagnetic separation(IMS) techniques. Immunoassay tests offer three important advantages: speed of analysis, sensitivityand high specificity for detecting the target pathogen.Detection of allergensAllergens are another area of food safety concern. Approximately 2 to 3% of adults and 5 to 8%of children are allergic to foods. Food allergies are caused by proteins that can trigger an immuneresponse in sensitized individuals. As the number of different ingredients used in formulatedfoods continues to grow, it is becoming more common for dairy processing plants to handle awider spectrum of ingredients than they did a few years ago. This has increased the likelihood ofcross-contamination of products with inappropriate ingredients—i.e., ingredients that can causeallergic reactions and are not indicated on product labels. Whether it’s peanuts, tree nuts, milk,eggs, wheat or soybeans, nearly every processed food has an identified allergen in it. Currently,89

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancethe most popular type of food allergen testing is based on sandwich enzyme-linked immunoassays(S-ELISAs). A target allergen protein is extracted from samples with a buffered salt solution. Theextracted protein is sampled and added to antibody-coated microwells, where it binds to theantibody during an incubation period. After a wash step, enzyme-labeled antibody (conjugate) isadded to the antibody wells and is allowed to attach to the bound allergen, forming an “antibodysandwich” around the allergen. After another wash step, substrate is added which reacts with theconjugate to produce blue color. The intensity of color is proportional to the amount of allergen.It is important to realize some of the limitations inherent in this type of testing. Because hightemperature may denature protein, test antibodies may not capture a sample’s allergenic component.This is especially true with egg products, which denature at a relatively low time and temperaturecombination. Since denatured protein may remain allergenic, it is recommended that products betested prior to baking or cooking. Another problem can occur when testing samples that have high oilcontent. Although low levels of protein may be present in edible oils, they may be difficult to extractwith standard extraction solutions and may not be detected by the test. Also, it is important to notethat using a test kit designed for testing the presence of peanut protein is not appropriate to use forscreening samples for almonds, pecans or other tree nuts. Care must be exercised when testing foregg allergens. Some test kits only test for egg white proteins; egg yolk proteins can also cause allergicreaction in people sensitized to egg yolk proteins.Detection of of Aflatoxin M1 (AFM1) in milk and milk productsKim et al (2000) examined the occurrence of aflatoin M1 in pasteurized milk and dairy productslike milk infant formula, milk powders and yoghurt. Recoveries of AFM1 from sample spiked at levelsbetween 5 and 500pg/ml were 88-106% for pasteurized milk and 84-94% for yoghurt by ELISA. Limitsof detection were 2pg/ml. The occurrence of Aflatoxin M1 (AFM1) contamination in Indian infantmilk products and liquid milk samples was investigated by competitive ELISA technique. The range ofcontamination of AFM1 was comparatively higher in infant milk products (65–1012 ng/l) than liquidmilk (28–164 ng/l). Almost 99% of the contaminated samples exceeded the European Communities/Codex Alimentarius recommended limits (50 ng/l), while 9% samples exceeded the prescribed limitof US regulations (500 ng/l). The extrapolation of AFM1 data to estimate the Aflatoxin B1 (AFB1)contamination in dairy cattle feedstuffs indicate that the contamination may range from 1.4 to 63.3 μg/kg with a mean of 18 μg/kg which is substantially higher than the directive of European Communitiesregulation (5 μg/kg).Detection of adulteration of goat, sheep and buffalo milk and cheeseAn indirect ELISA successfully developed for the detection of defined amounts of cows’ milk(1-50%) in sheeps’ milk and cheese. The assay used polyclonal antibodies raised in rabbits against bovinecaseins (BC). The antibodies were biotinylated and rendered cows’ milk specific by mixing them withlyophilized ovine and caprine caseins. Extravidin- peroixidase used to detect the biotinylated anti-BCantibodies bound to BC immobilized on 96-well plates. Subsequent enzymic conversion of substrategave clear absorbance differences when assaying mixtures of sheeps’milk and cheese containingvariable amounts of cows’ milk. The indirect competitive ELISA had a lower sensitivity when appliedto cheese, compared with milk. A sandwich ELISA was developed utilising the monoclonal antibodyin combination with a polyclonal goat anti-bovine IgG antibody. Once optimised, the ELISA wasfound to be highly specific. Detection limits in milk were 0.001% cows’ milk adulteration of sheepor buffalo milk, and 0.01% cows’ milk adulteration of goat milk. Detection limits in soft cheese were0.001% in goat cheese and 0.01% in sheep or buffalo cheese. The ELISA performance makes it suitablefor development as a kit for use in routine surveillance of milk and soft cheese.Detection of insecticide and pesticide in milkPolyclonal antibodies against an aldrin/dieldrin immunogen have been raised in rabbits and usedas the basis of an enzyme-linked immunosorbent assay (ELISA). This assay can detect dieldrin in milk90

Enzyme Linked Immunosorbent Assay - Theoryin the range 5 μg/ml to 1ng/ml reliably. This range differs in skimmed and semi-skimmed milk, andin cream, reflecting the differences in fat content between these samples (Ibrahim et al, 1993).Detection of melamineRecent food safety scares, such as the discovery of melamine in milk, have sharpened the globalawareness of the links between profit, the food chain and the global food supply. A cheap industrialchemical, melamine has been used to artificially increase the amount of protein content in dilutedmilk, thereby increasing the price forthe milk. The combination of melamineand a degradation product, cyanuricacid, results in crystals that can createblockages in the kidneys. In March2007, public awareness of melaminecontamination was heightened whenFigure: General principle of the competitive ELISA assay. Enzymeconjugatedmelamine competes with the melamine from thesample for binding to melamine antibody. This enzyme activity andabsorbance values decrease according to increasing amount of theunlabeled melamine from the unknown sample.the contaminant was found in pet foodingredients imported from China,causing the death of many animals.Following this scare, it was revealed thatmelamine-tainted fodder may have beenused to feed animals, including chickens, swine and catfish intended for human consumption. Asmelamine is still being found in eggs, fish and a variety of processed foods imported from China, thescrutiny of products for melamine is intense.ELISA, is a high-throughput technique for screening food for melamine. The general principle ofthese competitive ELISA assays is shown in Figure .Detection of histamine in cheeseAygun et al. (1999) used a competitive direct ELISA for determining histamine in cheese. Cheesewas homogenized with phosphate buffered saline, centrifuged and filtered and the supernatant wasdiluted with phosphate buffered saline. Detection limit and mean recoveries were 2 mg/kg and 93%.Quantification of immunoglobulins and cytokine in milk and colostrumA double sandwich enzyme-linked immunosorbent assay (ELISA) procedure for the quantificationof IgG in bovine milk was developed for detecting the concentration of IgG in various homogenizedHTST, UHT, evaporated and raw milk samples as well as skim milk powder. Using this procedure,homogenized, HTST pasteurized milk was found to contain from 65 to 79% of the IgG found in rawmilk. Skim milk powder also retained a major portion of IgG, while evaporated and UHT pasteurizedmilk were virtually devoid of IgG (Kummer et al., 1992)Colostrum contains factors that are protective for the neonate and may be a source ofimmunomodulary molecules that positively influence the immune status of the neonate. To confirmthat colostrum contains a variety of cytokines with immunomodulatory properties, a bovine cytokinespecific ELISA and five cytokines (IL-1β, IL-6, TNF-α, INF-γ or IL-1 receptor antagonist, IL-1ra) inthe whey samples from cows at different stages of lactation were monitored. The concentrationsof cytokines in colostrum were significantly higher concentrations than those in the mature milk.Colostrum contains high levels of cytokines that could be produced and secreted in the mammarygland and that may have an immunomodulatory activity and influence neonatal immunity (Hagiwaraet al., 2000)Detection of antibiotics in milkβ-Lactam antibiotics, particularly penicillins are widely used in medicine and veterinary medicine,this being the reason why residual amounts of penicillins may be found in foodstuffs of animal origin.Antibiotics contained in milk may adversely affect the health of human consumers (e.g., by inducing91

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceallergic reactions). Moreover, the presence in milk of antibiotics and other compounds suppressing thedevelopment of microorganisms disrupts technological processes of production of cheese (includingsoft cheese) and sour milk beverages by retarding or blocking lactic acid fermentation. Therefore,milk should be carefully controlled for the presence of residual amounts of penicillins, and suchcontrol requires reliable and readily available analytical methods. ELISAs are widely used abroadfor determining penicillin in milk (Usleber et al., 1994; Rohner, et al., 1995) including as commerciallyavailable kits (Sternesjo and Johnsson, 1998). Determination of penicillin G, ampicillin, and isoxazolylpenicillins (cloxacillin and dicloxacillin) in milk has been described, with detection limits in therange 10–30 ng/ml A modification of an ELISA in which a fluorescent probe replaces conventionalchromogens and capillaries are used for simultaneous determination of six penicillins in milk has beendescribed (Huth, 2002).ConclusionThe increase in food borne illnesses and specific types of pathogens is due to various consumer,manufacturing and regulatory trends that may set the stage for contamination or minimal screeningmethods. For example, there are changes in consumer consumption habits and preferences for minimallyprocessed convenience foods, as well as an increase in certain risk groups who are most vulnerable todiseases. Also adding to the problem are changes in food production, distribution and globalization ofsupply that expands the potential for imports tainted with pathogens or pesticide residues. Compoundingthe problem are new types of pathogens, as well as new strains of recognized pathogens, and both areappearing in food products where they have never before been identified. It is likely that technologiesbased on immunoassays and PCR methods will emerge as the two favorite types of rapid pathogenscreening tests for dairy products because of their enhanced specificity, sensitivity and efficiencycompared to other methods. PCR tests that measure pathogen DNA or RNA are more sensitive butalso are more expensive than immunoassay methods. To continue to deliver safe dairy products to thepublic, dairy processors will be increasingly dependent on new rapid, accurate, sensitive and specificscreening tests for pathogens, toxins, adulterants and allergens.References:Aygun,o.,Schneider,E.,Suhener,R. and Usleber, E. and Martlbauer, E. J. agril. & food Chem.,1999, 47(5):1961-1964.Hagiwara, K.i Kataoka, S. ,Yamanaka, H.. Kirisawa, R. and Iwai, H. Veterinary Immunology & Immunopathology,2000, 76(3-4):183-190Huth, S.P., Warholic, P.S., Devou, J.M., Chaney, L.K.,and Clark, G.H., J. AOAC Int., 2002, 85 (2): 355–364.Ibrahim,A.M.A., Hewedi, M.M. and Smith, C.J. Food and Agril Immunol, 1993 5 (3): 145 - 154Kim, E.K., Shon, D.A. Dyer, D., Park, J.W., Hwang, H.J. and Kim, Y.B.. Food additives and Contaminants, 2000, 17(1):59-64.Kummer, A., Kitts, D.D.,Li-Chan, E., Losso, J.N., Skura, B.J.and Nakai, S. Food and Agricultural Immunology, 1992, 4(2): 93 - 102Rastogi, S., Dwivedi, P. D., Khanna, S. K., Das, M. Food control, 2004 15(4)287-290Rohner, P., Schallibaum, M., and Nicolet, J., J. Food Prot., 1995, 48(1):59–62.Sternesjo, A. and Johnsson, G., J. Food Prot., 1998, 61 (7) :808–811.Usleber, E., Lorber, M., Straka, M., Terplan, G., and Martlbauer, E., Analyst, 1994, 119 (12): 2765–2768Vasavada, P.C. Food Safety, 2001; 7(3):29-3892

Experimental Determination of Thermal Stability of Proteins: A Theoretical BackgroundExperimental Determination of Thermal Stabilityof Proteins: A Theoretical BackgroundJai K. KaushikAnimal Biotechnology Centre, NDRI, KarnalOne of the most crucial aspects in protein science is the solution properties affecting the structure,stability and activity of proteins in solutions. Most of the enzymes and many structural proteins areglobular while some structural proteins are fibrous in structure. The stability of proteins originates fromtheir detailed three dimensional structures. The covalently linked amino acids in a linear fashion results inthe primary structure that folds into a unique 3-D structure, which is responsible for the specific functionand activity of a protein molecule. The 3-D structure of proteins is defined by weak intermolecularinteractions and therefore the native state of proteins is only marginally stable by ca 5-15 kcal/mol.The small free energy is the difference of large changes, which can be several hundreds of kcal/mol, inenthalpy and entropy over folding. Therefore, determining these large changes in enthalpy and entropyaccurately is the central problem in protein physical chemistry to evaluate the precise free energy (Gibbsenergy) of stabilization of proteins.With the great advancement in generation and production of recombinant proteins, there hasbeen a new interest in understanding the molecular basis of protein stability so that more rugged andstable proteins functional over a wide range of environmental conditions can be designed. Thereforeit is critically important to evaluate the stability of proteins precisely and accurately to compare andrelate the experimentally determined stability data to theoretically determined stability for a set ofmutant proteins to understand the role of molecular interactions. There are two standard methods todetermine the protein stability, viz. kinetic methods, which include chemical denaturant jump, pH jumpand temperature jump to determine the rate of folding and unfolding, and equilibrium methods whichinclude the solvent denaturation and thermal denaturation procedures. The easiest and the most widelyused method is the thermal denaturation of proteins and determining the equilibrium thermodynamicparameters linked with the process. The obtained thermodynamic parameters like enthalpy, heatcapacity and entropy evaluated at the midpoint of denaturation can be used to determine the stabilityprofile (Free Energy versus temperature) for a given protein.There are several techniques to monitor the denaturation of proteins under varying external agentslike increasing concentration of chemical denaturants or increasing temperature or changing the pH. Tomonitor the changes in thermodynamic parameters related to thermal denaturation, the most direct methodis the calorimetry, which measures the enthalpy of denaturation as a function of temperature. Calorimetrycan provide the precise enthalpy, entropy and heat capacity of denaturation. Figure 1 shows a typicalthermal denaturation and renaturation scans as a function of temperature measured by (A) calorimetryand (B) spectrophotometry. In acalorimetrically measured phasetransition (Native ↔ Denatured)profile of a protein the peak of theendotherm indicates the midpointof transition. The total area underthe curve provides a direct measureof enthalpy of transition, whereasthe differences in the baselines forFigure 1: Typical thermal denaturation profiles of a protein determined by (A)differential scanning calorimetry (DSC) measuring the excess heat capacityas a function of temperature, and (B) spectrophotometry measuring changein absorbance.pure native and pure denaturedspecies measured at the midpoint oftransition provide the heat capacity ofdenaturation.93

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceFor a two state transition N ↔ D, where N is the native state and D the denatured state, the ∆H(T)- the enthalpy of transition at a temperature (T) can be directly evaluated using equation 1:∆H(T) = ∆Hº + ∆C p(T – T m) (1)where, ∆Hº is the enthalpy of transition at T m; ∆C p- the heat capacity of transition; and Tm, themidpoint of transition. This is the most direct method of evaluating the thermodynamic parameterslike enthalpy, while the entropy can be evaluated using the relation:∆S(T) = ∆Sº + ∆C pln (T/T m) (2)where ∆Sº is the entropy at the midpoint of transition and can be derived using the relation:∆Sº = ∆Hº/T m(3)The Gibbs energy of protein folding (free energy of stabilization) therefore can be defined by theequation:∆G(T) = ∆H(T) – T ∆S(T) (4)Substituting the values of ∆H and ∆S from equations (1-3) in to (4) and rearranging we obtain:∆G(T) = ∆Hº (1 – T/T m) – ∆Cp (T m– T + T ln (T/T m)) (5)which is a modified form of Gibbs Helmholtz equation and can be used to determine the proteinstability at any given temperature.Similarly, using the indirect methods which can measure the change in conformation of the nativestate of protein, we can determine the thermodynamic parameters linked with a phase transition(N↔D). The change in conformation can be monitored by various spectroscopic methods; e.g. circulardichroism, spectrophotometry, fluorescence, IR, light scattering, hydrogen exchange or anythingwhich are sensitive enough to record the phase transitions in proteins; even viscometric or volumetricmethods which can measure the solution properties of proteins due to phase transitions can alsobe used. Figure 1B shows the typical change in tertiary interactions of RNase A over denaturationmeasured by change in absorbance in the aromatic region. For a two state reversible phase transitionundergoing equilibrium conditions, the equilibrium constant can be defined as follows:K = [Unfolded] / [Native] = α/ 1– α (6)orα = K / 1+K (7)where α is the fractional denatured state concentration and K is the equilibrium constant.Also we know,K = e –∆Gº/RT (8)Substituting the values of ∆Gº, the standard free energy, and K from equation (5) and (8),respectively, in to equation (7), we obtain:{–1/R[∆Hº (1/T – 1/Tm) – DCp (Tm/T – 1 + ln (T/Tm))]}eα(T) ={–1/R[∆Hº (1/T – 1/Tm) – ∆Cp (Tm/T – 1 + ln (T/Tm))]}(9)1 + eEquation (9) can be used to fit the experimental data to directly evaluate the thermodynamicparameters like ∆Hº, ∆C P, and Tm to evaluate the Gibbs energy of protein denaturation. The enthalpyof denaturation (∆Hº) is known as van’t Hoff enthalpy (∆H vH) distinct from the calorimetric enthalpy(∆Hcal) determined by DSC. For a two state reversible denaturation process for a single domain and/ormonomer protein the ratio of ∆H vHand ∆H calshould be equal to unity. The solid lines shown in Figure1B are the nonlinear least square fittings to the experimentally determined data points representedby solid and open symbols. It is important to use good quality of data to evaluate the free energy ofstabilization. Even small differences in the free energy of stabilization due to single amino acid changein proteins can be reliably evaluated by using any of the methods mentioned above. These methodsalso require that phase transition must be reversible and undergoing equilibrium conditions.94

Experimental Determination of Thermal Stability of Proteins: A Theoretical BackgroundApart from the above mentioned methods which depend upon the heat-denaturation, other isothermalmethods employing the chemical denaturant to induce the phase transition of protein conformation canalso be used to evaluate the Gibbs energy of protein folding. It has been known for years that proteinscan be unfolded in aqueous solutions by high concentrations of urea or guanidine hydrochloride.Denaturation with these chemicals is one of the primary ways of measuring the conformational stabilityof proteins and comparing the stabilities of mutant proteins. Figure 2 shows the typical denaturationreaction mediated by guanidine hydrochloride. It has been observed that the free energy of denaturation,∆Gº = – RT ln K, depends upon the denaturant concentration as follows:d(∆Gº)/d(GdnCl) = RTn/(GdnCl) ½(10)where (GdnCl) ½is the midpoint of transition and n the slope of the curve. Later linear extrapolationmethod (LEM) became popular as ∆Gº was found to vary linearly with denaturant concentration asfollows:∆Gº = ∆G(H 2O) – m[denaturant] (11)where ∆G(H 2O) is an estimate of the conformational stability of a protein that assumes that thelinear dependence continues to 0 M denaturant concentration, and m the slope of the line measuresthe dependence of ∆Gº on denaturant concentration. The values of K can be calculated from thecurve plotted in Figure 2A to calculate the ∆Gº as a function of denaturant concentration followed byestimation of ∆G(H 2O) using the LEM. However, an equation to directly fit the raw data can also bewritten by substituting the value of K and ∆Gº from equations 8 and 11, respectively, in to equation7 to give:e –(∆G(H2O) – m[denaturant] ) /RTα(T) = (12)1 + e –(∆G(H2O) – m[denaturant] ) /RTNonlinear least square fitting of the above equation to the raw data provide us the value of m and∆G(H 2O ).Figure 2A showsthe typical equilibriumdenaturation andrenaturation curves of aprotein as monitored bychange in fluorescence, itis clear that the process isin equilibrium and highlyreversible, while the Figure2B shows the increase in thestability of wild type (WT)due to engineering (MutantsNuG1 and NuG2).Figure 2. Typical equilibrium transition curves for protein unfolding and refoldinginduced by guanidine hydrochloride. (A) The open triangles and solid circles are theunfolding curves while the open squares represent the refolding equilibrium curves.Panel (B) shows the increase in the midpoint of transition [GdnHCl] ½due to proteinengineering (mutants NuG1 and NuG2) of the wild type protein (WT).All the above methods are based on equilibrium conditions; however, it is also possible to evaluatethe free energy of protein stability using the kinetic methods which can measure the rates of folding andunfolding, since equilibrium constant K is the ratio of rate of unfolding (k u) and rate of folding (k f):K = k u/ k f(13)K can be used to calculate ∆Gº and various other thermodynamic parameters using the sameprocedure mentioned above. The value of rate constants can be known by unfolding and refoldingreactions induced by jump studies using temperature, pH or denaturant concentrations (Figure 3). Fora two state process N↔D, all these methods should provide the same value of Gibbs energy of proteinfolding within the experimental errors and therefore any of the technique available at ones disposalcan be used reliably for analysis of protein stability.95

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceFigure 3: Temperature dependence of kinetic and thermodynamic parameters of Pyrrolidone carboxyl peptidase (a)Temperature dependence of ku and k fand relaxation (k r= k u+ k f) rate constants. Dashed line represents kr values, (b)Solid circles represent the unfolding Gibbs energies obtained from the equilibrium constant (K = k u/k f). The solid line is thestability curve fitted to the data points using equation 5, whereas the dashed line is that generated from the thermodynamicparameters obtained by DSC, mk(c) log of rates of folding (circles) and unfolding (squares) as a function of urea conc. k f=3600sec -1 and k u= 27 sec -1 were obtained by extrapolation to 0 M urea. In the inset, the dotted line shows the denaturationcurve simulated by using the kinetic parameters and crosses indicate the experimentally obtained equilibrium data.ReferenceHughues-Despointes, B. M. Scholtz, J. M. and Pace, C. N. (1999). Protein conformational stabilities can be determinedfrom hydrogen exchange rates. Nat. Struct. Biol. 6: 910-912.Kaushik, J. K. and Bhat, R. (1998). Thermal stability of proteins in aqueous polyol solutions. J. Phys. Chem. Sect. B. 102:7058-7066.Kaushik, J. K. and Bhat, R. (1999). A mechanistic analysis of the increase in the thermal stability of proteins in aqueouscarboxylic acid salt solutions. Protein Science. 8: 222-233.Kaushik, J. K., Ogasahara, K. and Yutani, K. (2002). The unusually slow relaxation kinetics of the folding-unfolding ofpyrrol.idone carboxyl peptidase from a hyperthermophile, Pyrococcus furiosus. J. Mol. Biol. 316: 989-1001.Kaushik, J. K. and Bhat, R. (2003). Why is trehalose an exceptional protein stabilizer?: An analysis of the thermal stability ofproteins in the presence of compatible osmolyte trehalose. J Biol Chem, 278: 26458-26465.Kaushik et al. (2006) Completely-buried, Non-ion-paired glutamic acid contributes favorably to the conformationalstability of pyrrolidone carboxylic peptidases from hyperthermophiles, Biochemistry. 45: 7100-7112.Nauli, S., Kuhlman, B. and Baker, D. (2001). Computer-based redesign of a protein folding pathway. Nat. Struct. Biol.8: 602-605.Pace, C. N. (1986). Determination and analysis of urea and guanidine hydrochloride denaturation curves. MethedEnzymol. 131: 266-280.Pace, C. N. and Shaw, K. L. (2000). Linear extrapolation method of analyzing solvent denaturation curves. Proteins:Struct. Funct. Genet. (Suppl). 4: 1-7.Santoro, M. M. and Bolen, D. W. (1988). Unfolding free energy changes determined by the linear extrapolation method.1. Unfolding of phenylmethanesulphonyl α-chymotrypsin using different denaturants. Biochemistry. 27: 8063-8068.Tanford, C. (1970). Protein denaturation. C. Theoretical models for the mechanism of denaturation. Adv. Protein Chem.24: 1-95.96

Species-Specific Identification of Milk and Milk Products: A Molecular ApproachIntroductionSpecies-Specific Identification of Milk andMilk Products: A Molecular ApproachArchana VermaDairy Cattle Breeding Division, NDRI, KarnalIntermixing of milk from different species of origin is a common practice depending on the demandof the consumer for liquid milk or the manufacturing of milk products. Different methods basedon protein analysis are currently used for milk species identification, including chromatographic,electrophoretic and immunological techniques. Among these, capillary electrophoresis, twodimensionalelectrophoresis, isoelectric focusing of milk caseins, HPLC, mass spectrometry and ELISAare widely reported. All techniques are based on strategies suited to evaluate the protein patternsoriginating from the major whey proteins or casein fraction. All these analytical methods are able todetect bovine milk proteins to the minimum level of 0.5–1 %. Still, the success of analytical tools thatrely on protein detection for species identification may be in some cases is affected by proteolysis ordenaturation of milk proteins as a result of heat treatment during processing.In the last years, full attention has been turning towards application of DNA-based approaches forthe authentication of food. Particularly, the polymerase chain reaction (PCR) is increasingly used for thespecific detection of the animal origin in milk and milk products. DNA from somatic milk cells, principallyrepresented by leucocytes persists in milk products and may be analysed for species identification.Several PCR-based techniques (DNA hybridization assay; restriction enzyme analysis, RFLP; singlestrandedconformation polymorphism analysis, SSCP; duplex polymerase chain reaction, duplex-PCR)have been reported to be performed to amplify nuclear genome obtained from milk and milk products.These methods currently represent valid complements to protein electrophoretic and immunochemicalanalyses. Their reliability and very low thresholds of detection make them promising as routine tools.The methods developed so far rely mostly on PCR-amplification of various regions of the mitochondrialgenome. Only 2 of them assure protection from false negative results, as the mix contains primers for allthe identified species in a single tube. Other published methods use primers for single species or applyrestriction analysis of the obtained PCR-product. On the basis of various studies demonstrating that DNAis not degraded after thermal and enzymatic processes, this has come up as a new strategy for the detectionof low amounts of interspecies milk. Present paper will focus on DNA based techniques.Basic methodologyDNA Extraction from whole blood /milk is isolated using standard protocol of lysis, proteinaseK digestion, phenol - chloroform extraction, ethanol-precipitation.Primers Designing of specific primer pairs for detection of cow and buffalo genomic/mitochondrialDNA is done taking care to avoid significant Tm differences between the primers, thereby preventingthe generation of unspecific products. Some of the primer pairs from literature have been tabulated:Table: Some of the Primer Pairs with respective Annealing Temperatures and PCR Products *S.NoForward Primer5’------------3’Reverse Primer5’--------------3’Ta°CPCR Product(bp)1 GGTAAATCTCGTGCCAGCCA TCCAGTATGCTTACCTTGTTACGAC 56 3002 GAACTCTGCTCGGAGACGAC AGCACCAATTATTAGGGGAAC 56 1343 CAATAACTCAACACAGAATTTGC CGTGATCTAATGGTAAGGAATA 52 3004 CCAACATGCGTATCCCGT AGCGGATGCATGATGAAATG 52 4445 CTAGAGGAGCCTGTTCTATAATCGATAA TGGTTTCATAATAACTTTCGCGCT 63 223Lo´ pez-Calleja, et al. (2004); .2. FELIGINI et al.(2005); 3-4: Kotowicz et al. (2007)l 5. D´ıaz et al., (2007)97

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceFigure 1: Comparison of Qualitative and Quantitative PCR based species Identification (Ballin et al., 2009)[Some workers used universal primer, cytochrome b (cytb; cytochrome b1 and cytochromeb2). to differentiate milk from animal species (cattle, buffalo, goat and sheep) each according to itsmitochondrial DNA (mtDNA). The PCR product was digested by restriction endonuclease andyielded a species-specific restriction profile. The assay was more rapid than conventional methodsand showed considerable sensitivity.]PCR amplification performed in a 50 L reaction mixture containing template DNA, 200 µM dNTPs,10 mM Tris-HCl, pH=8.3, 50 mM KCl, 1.5 mM MgCl 2, 100 nM primers, 1.5 U DNA polymerase withPCR conditions of initial denaturation step at 95 °C for 10 min followed by 35 cycles of 95 °C for 30 s,annealing temperatures indicated against each primer and 72 °C for 30 s; final extension step at 72 °Cfor 10 min. Agarose Gel Electrophoresis is carried out to check for the amplicons.Analysis is carried out based on nucleotide-nucleotide BLAST similarity search (http://www.ncbi.nlm.nih.gov/ BLAST) was conducted with the bovine and bubaline specific primer sequences.98

Species-Specific Identification of Milk and Milk Products: A Molecular ApproachConclusionModern molecular techniques based on DNA analysis have found good applicability in detectingadulteration and they represent valid complements to the methods relying on protein analysis for theidentification of animal species. DNA-based techniques have become effective and reliable also forcommercial dairy products. Possible applications in DNA analysis includes traditional and real timePCR. PCR amplified sequence can originate from either mitochondrial or genomic DNA, where bothsingle copy and repetitive sequences can be used. The choice of analytical technique and especially theDNA sequence has a large influence on the limit of detection. However, quantitative methods basedon genome/genome equivalents that rely on a fixed copy number and use of repetitive sequences isalso an option.ReferencesBallin N.Z., et al. (2009). Species determination – Can we detect and quantify meat adulteration? Meat Science. 83:165–174.El-Rady, A. et al., (2006). Identification of milk source by polymerase chain reaction-restriction fragment lengthpolymorphism analysis. Journal of Rapid Methods and Automation in Microbiology 14 (2) 146–155.Feligini M., et al. (2005). Detection of Adulteration in Mozzarella Cheese, Food Technol. Biotechnol. 43 (1) 91–95.Kotowicz M, et al. (2007). Application of a duplex-PCR for detection of cows’ milk in goats’ milk. Ann Agric EnvironMed 2007, 14, 215-218.Lo´ pez-Calleja I., et al. (2004). Rapid Detection of Cows’ Milk in Sheeps’ and Goats’ Milk by a Species-SpecificPolymerase Chain Reaction Technique. J. Dairy Sci. 87:2839–2845.L´opez-Calleja I., et al., (2007). Application of a polymerase chain reaction to detect adulteration of ovine cheeses withcaprine milk. Eur Food Res Technol. 225: 345–349.99

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceProteomic Techniques for Application in Food ScienceIntroduction100Ashok K. MohantyAnimal Biotchnology Centre, NDRI, KarnalIn recent years, a number of ‘‘omics’’ technologies (genomics, proteomics, metabolomics, andothers) have become available that hold promise for increasing the understanding of the complexitiesof pathogen behavior at the molecular level and for the development of improved pathogen detectionand typing systems. Genomics is the study of genes and their function, transcriptomics refers to globalanalyses of gene expression, and proteomics is the study of the complete set of proteins produced bya species and their modifications, expression, involvement in metabolic pathways, and interactions.Omics-based tools enable researchers to explore complex biological processes in a quantitative andintegrative manner via a systems biology approach. These methods of analysis are facilitating theidentification of genes that are responsible for survival and persistence in specific environments, andrevealing genes that are potential targets for interventions and that play a role in pathogenesis, stressresponses, and biofilm formation.Proteomics is the study of the proteome, the protein complement of the genome. Proteomics or, moreappropriately functional proteomics refers to the branch of discovery of science focusing on proteins.The term ‘proteome’ is used to describe the complete set of proteins that is expressed, and modifiedfollowing expression, by the entire genome in the lifetime of a cell. The term “proteomics” and “proteome”were coined by Marc Wilkins and colleagues in the early 1990s and mirror the terms “genomics” and“genome”, which describe the entire collection of genes in an organism. Today, proteomics is a scientificdiscipline that promises to bridge the gap between our understanding of genome sequence and cellularbehaviour. It can be viewed as more of a biological assay or tool for determining gene function.Initially the term was used to describe the study of the expressed proteins of a genome using twodimensional(2D) gel electrophoresis, and massspectrometry (MS) to separate and identify proteinsand sophisticated informatics approaches for deconvoluting and interrogating data. This approach isnow referred to as “expression” or “global profiling” proteomics. The scope of proteomics has nowbroadened to embrace the study of “protein-protein” interactions (protein complexes), referred to ascell-mapping proteomics (Blackstock and Weir, 1999).The many faces of proteomicsProteomic analysis (or analytical protein chemistry). The large-scale identification andcharacterization of proteins, including their posttranslational modifications, such as phosphorylationand glycosylation. Analysis is done with the aid of mass spectrometry or Edman degradation.Expression proteomics (or differential display proteomics). Two-dimensional gels are used forglobal profiling of expressed proteins in cell lysates and tissues. This conventional approach is beingchallenged by non-2D gel methods, such as liquid-based isoelectric focusing (IEF) or ion-exchangechromatography / reversed-phage high-performance liquid chromatography (RP-HPLC). Proteins aretypically identified by massspectrometry (MS). In many situations, these methods are complementedby DNA-based array methods.Cell-mapping proteomics (or cataloging of protein-protein interactions). Protein-protein interactionsand intracellular signaling are determined by identification of protein complexes (obtained by affinitypurification and protein identification by MS) or by direct DNA readout (e.g. yeast two-two hybrid,phage display, ribosome display, and RNA-peptide fusions).Proteomics vis-a vis GenomicsLarge-scale genome sequencing:One of the most biological achievements to emerge during the last 40 years has been the completion

Proteomic Techniques for Application in Food Scienceof draft DNA sequences of the human genome, published bythe International Human Genome Sequencing Consortium(a publicly) funded project and by Celera Genomics (acommercial effort). This has provided a blue print of theinformation needed to create a human being and revealedfor the first time the organization of a vertebrate’s DNA.The public project estimates that there are 31, 000 proteinencodinggenes, where as Celera finds ~26,000, with manymore still to be found (a current estimate suggests that thenumber of protein-encoding genes may be on the order of60,000).Interestingly, the number of coding genes in the humansequence is not dramatically different from the numbers Biological context of Genomics and Proteomicsreported for phylogenetically remote organisms: 6, 000 fora yeast cell, 13,000 for a fly, 18,000 for a worm, and 26,000 for a plant (Genomes Online Databasesat http://wit.integratedgenomics.com/GOLD). The number of genes reported for multicellularorganisms is not highly accurate because of limitations of existing abinitio gene prediction methods usedto identify genes. The existence of an open reading frame (ORF) in genomic data does not necessarilyimply the existence of functional gene. In human DNA, gene prediction by abinitio methods is difficultbecause of extensive alternative splicing, lower density exons, and high proportions of interspersedrepetitive sequences. Given the unreliability of abinitio gene prediction software, all genes will needto be experimentally identified and annotated. Hence, verification of a gene product by proteomicanalysis is an important first step in annotating the genome.Disparity between mRNA Profiling and protein profiling:There is no simple correlation between changes in mRNA expression levels (transcriptomics) andthose in protein levels (proteomics). The link between transcript levels and protein levels in a given cellor tissue is difficult. It is also understood that array-based gene expression monitoring or other geneexpression methods for measuring mRNA abundances, alone are insufficient for analyzing the cell’sprotein complement. There is a marked disparity between the relative expression levels of mRNAsand those of their corresponding proteins. Differing stability of mRNAs and different efficienciesin translation can affect the generation of new proteins. Once formed, proteins differ significantlyin stability and turnover rates. Many proteins involved in signal transduction, transcription factorregulation, and cell-cycle control are rapidly turned over as a means of regulating their activities.Also mRNA levels tell us nothing about the regulatory status of the corresponding proteins, whoseactivities and functions are subject to many endogenous posttranslational modifications and othermodifications by environmental agents. Therefore, the complication arises when considering thecomplementarity of genomics and proteomics. Despite the notion that one gene gives rise to oneprotein, the situation in eukaryotic cells is more likely six to eight proteins per gene. Thus, theremay be several hundred thousand human proteins after splice variants and essential posttranslationalmodifications are included. For example, 22 different forms of human α-1-antitrypsin have beenobserved in human plasma. Such biological complexities can be unraveled using proteomic studies tounderstand how cells modulate and integrate signals.Identification and analysis of proteinsFour key platform technologies are crucial to any proteomics strategy aimed at elucidating thefunction of an unknown gene.• Sample preparation & handling• Determination of partial amino acid sequence information• Protein identification and quantification• Cell mapping101

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceSEC: size exclusion chromatography; IEX: ion-exchange chromatography; RP-HPLC: reversed–phase high-performance liquid chromatography; HIC: hydrophobic interaction chromatography;2DE: two-dimensional gel electrophoresis; 1DE: one dimensional gel electrophoresis; FFE: free-flowelectrophoresis; CZE: capillary zone electrophoresis; FRET: fluorescence resonanace energy transferProtein separation strategies:One of the rate-limiting stepsin any proteomic analysis studyis obtaining, and then handling,sufficient quantities of target protein(s) from its original biological source.The classical method of quantitativeand qualitative expressionTechnology platforms for Proteomicsproteomics combines protein separation by high-resolution 2D gel electrophoresis with MS or MS/MSidentification of selected protein spots. Because, even the best 2D gels can routinely separate no morethan 1500 proteins, this technique is limited to the most abundant proteins if a crude protein mixture(whole-cell lysate) is used. 2D electrophoresis is limited by the amount of material that can be applied tothe first-dimension immobilized pH gradient gel (~150 ug to low milligram quantities). Hence 2D gelshave limited ‘scale up’ capability. For this reason, it is often desirable to “trace enrich” for a particularsubclass of proteins. Byanalyzing proteins in a cellularcompartment or organelle,it is possible to reduce thecomplexity and differencesin abundance of a subset ofproteins within a cell.Two-Dimesional SDS-PAGE: This separation methodhas become synonymouswith proteomics and remainsthe single best method forresolving highly complexprotein mixtures. TwodimensionalSDS-PAGE isactually a combination of two Proteomics strategies for the identification and analysis of proteinsdifferent types of separations.In the first, the proteins areresolved on the basis of isoelectric point by IEF. In the second, focused proteins are then are furtherresolved by electrophoresis on a polyacrylamide gel. Thus 2D-SDS-PAGE resolves proteins in the firstdimension by isoelectric point and in the second dimension by molecular weight. Dedicated 2D-SDS-PAGE systems are available that use immobilized pH gradient (IPG) strips and relatively foolproofhardware to facilitate the transfer of proteins from the IPG strip into the SDS-PAGE slab gel. The IPGstrip is based on the use of immobilized pH gradients, in which polycarboxylic acid ampholytes areimmobilized on supports to reproducibly create stable pH gradient. The use of narrow pH rangesfacilitates the separation of proteins with highly similar isoelectric points. Proteins separated by 2Dgels are visualized by conventional staining techniques, including silver, Coomassie, amido blackstains and fluorescent staining. Silver-staining and newer fluorescent dyes are the most sensitive.Cell mapping and identification of proteins in complexesOne way to observe interacting proteins involved in a given biological process is to specificallyenrich for these proteins. Typically, this requires knowledge of the activity of atleast one protein in102

Proteomic Techniques for Application in Food Sciencethe multiprotein complex. Under nondenaturing conditions, interacting proteins can be enriched fromcomplex protein mixtures (e.g., cell lysates) using methods such as:• Coimmunoprecipitation or “pull-down” techniques using antibodies directed against one of thecomponent proteins.• Coprecipitation using affinity-tagged recombinant proteins and antibodies directed against the“tag” epitope• Protein-affinity-interaction chromatography (e.g using recombinant glutathione S-transferase (GST)-fusion proteins and glutathione-affinity chromatography).• Isolation of intact multiprotein complexes (e.g., nuclear pore complex, ribosome complexes,spliceosomes).Determination of Partial Amino Acid SequenceUsually, the final step of most proteomic studies, independent of the purification methodemployed, utilizes either SDS-PAGE or 2D acrylamide gels to separate the proteins for identificationand characterization. Following electroblot and transfer to an inert membrane, such as polyvinylidinedifluoride (PVDF), intact proteins can be identified directly by amino- or carboxy-terminal aminoacid sequence analysis or indirectly from peptides generated by in-gel or on-membrane digestionof the protein with a protease usually trypsin. MS-based methods usually identify a protein, not byanalyzing it directly, but by analyzing the peptides derived from proteolytic digestion. Usually, asmall number of peptides yield sufficient information to permit protein identification (by peptide massfinger printing (PMF) and/or MS/MS of individual peptides. In contrast to peptides, the molecularmass of intact proteins is usually insufficient to allow database identification.MALDI-MS is used todetermine the accurate massof a group of peptides derivedfrom a protein by digestionwith a sequence-specificprotease, usually trypsin,thus generating a peptidemass map or peptide massfingerprint. Because trypsincleaves proteins at the aminoacids arginine and lysine, themasses of tryptic peptides canbe predicted theoretically forany entry in a protein sequenceCell mapping: affinity capturedatabase. Electrospray ionization and tandem mass spectrometry is used to sequence the isolatedpeptides from a peptide mixture.Differential display proteomicsA fundamental aspect of proteomic research is the determination of protein expression levelsbetween two different states of a biological system (e.g. relative quantification of protein levels), suchas that encountered between a normal and diseased cells or tissues. This is referred to as differentialdisplay or comparative proteomics. This can be done in two ways such as running and comparingsamples in 2D-SDS-PAGE or with LC-MS and Isotope tags.For differences in the protein-expression profiling, we compare 2D-gels from two differentsamples for differences in the occurrence or intensity of protein spots. This approach provides a usefulmeans of comparing proteomes. However, identification of protein is cumbersome and difficult bythis procedure. Application of peptide mass fingerprinting and LC-MS-MS analysis now makes itpossible to identify essentially any protein one can detect by staining the gel. Therefore, the critical103

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancetask in comparative proteomics with 2D gels is identifying the features that differ between the gels.The LC-MS approach to proteome comparisions is conceptually the opposite of the 2D gel approach.Whereas the 2D gel approach separates proteins and begins with an image comparision, the LC-MSapproach separates peptides and ends with data mining to assess differences between samples. Twoprotein samples are treated with reagents to “tag” them. The tags are chemically identical, exceptthat one contains heavy isotopes (e.g. 2 H, 15 N, 13 C, 18 O etc.) and the other contains light isotopes. Thesamples are digested and the peptides are analyzed by LC-MS-MS. Analysis of the MS-MS data allowsidentification of the protein present. Examination of the full-scan spectra corresponding to each MS-MS scan then allows measurement of the ratio of the light- and heavy- isotope tagged peptides. Thisratio corresponds to the ratio of that protein in the two samples. This approach provides a relativequantification of the level of a particular protein in two samples.Mapping protein modifications:Vast majority of all eukaryotic proteins are posttranslationally modified and more than 200posttranslational modifications (PTMs) of amino acids have been reported so far. Practically all PTMsare associated with either an increase or a decrease in molecular mass. The two major PTMs of proteinsare phosphorylation and glycosylation. Phosphorylation of proteins is a ubiquitous regulatorymechanism in both eukaryotes and prokaryotes. Intracellular phosphorylation is regulated by proteinkinases (dephosphorylation is regulated by protein phosphatases), which are activated in responseto extracellular signals and trigger cells to switch on or off many diverse processes such as metabolicpathways, kinase cascade activation, membrane transport, gene transcription, and motor mechanisms.Protein phosphorylation can be examined in several ways such as ‘phosphopeptide mapping of 32Plabelledproteins and peptides’, amino-terminal sequencing using Edman degradation procedure andMass spectrometry. While all the three methods are equally good, MS is an ideal tool in proteomicsstudies of PTM identification and characterization because of its high sensitivity.Application in food scienceMicroarray-based comparative genomics research, which takes advantage of informationavailable from whole genome sequences, is leading to an increased understanding of the evolutionand pathogenesis of food-borne pathogens and is providing critical information for the developmentof improved detection and genotyping methods.DNAmicroarray technology provides accuratemeasurements of gene expression for every gene in a genome and allows this expression to beanalyzed in response to specific environmental variables. Further, this technology can be utilizedto identify genes that are controlled by specific regulators by comparing gene expression in mutantand wild-type bacteria. However, the potential for the analysis of gene expression of pathogens infood environments has not yet been completely realized due to the substantial technical challengesassociated with accurately measuring bacterial gene expression in complex matrices. Genomotypinginvolves the comparison of whole genomes of bacteria using DNA microarrays and has been utilizedto identify potential genes associated with virulence, disease severity, and adaptation to differenthosts and ecological niches. Used as diagnostic tools, DNA microarrays offer the capability to detectand characterize a broad spectrum of pathogens simultaneously in a relatively short period of time.Various food grade bacteria with specific reference to lactic acid bacteria are used for productionof fermented foods. Different lactic acid bacteria produce different proteins in the system duringfermentation. Global analysis of proteome of useful lactic acid bacteria using proteomic approacheswill help to identify various proteins expressed in the system. Systematic analysis of the proteinsexpressed will give an idea about the importance of various proteins during fermentation. Differentialexpression proteomics in between various useful microorganisms will help us to identify usefulbiomolecules specific for a particular microorganism. This will help us to identify organism specificcellular markers for future application in food product development.Milk constitutes an important ingredient of food system. This is constituted of number of growth104

Proteomic Techniques for Application in Food Sciencepromoting proteins,enzymes and signalingmolecules. Global anddifferential expressionanalysis of proteinsin milk of variousanimal species willhelp us to identifyvarious new proteinsof health importance.Until now, most ofthe abundant proteinshave been studied inmilk. However, manylow abundant proteinswhich are secretedin milk are generallyignored and have notbeen studied in detail.Proteomic approaches will help to identify useful low abundant proteins, which can be studied furtherfor understanding their beneficial properties. Thus proteomic techniques are extremely useful fordiscovery of novel biomolecules for future applications in food science. Global genetic-based analysesprovide information regarding which genes an organism contains or which genes are expressed underspecific conditions; however, examining the posttranslational protein output of an organism allowsone to query the ultimate outcome of the organism’s genetic and regulatory activities. Techniquesthat fall within the category of either proteomics or protein arrays are used for global analysis ofcellular protein output under different conditions and potentially those relevant to food and foodprocessingenvironments. The integration of both genetic- and protein based approaches provides aglobal analysis of treatment- or environment-related changes at the molecular level, thus presentinga more comprehensive view of cellular activities. The development of high-throughput analysistechniques will make possible multi-omics approaches to understanding complete biological systems,a field known as systems (integrated) biology. Although omics technologies are becoming standardresearch tools that offer tremendous opportunities, there are also significant challenges. There is aneed to properly manage the large quantity of complex raw data generated by these technologies ina manner such that it can be adequately analyzed, scrutinized, and compared for the benefit of thescientific community. There are various omics standardization activities underway, which are criticalfor the integration and interpretation of data from different data sources. Lastly, there is a need tobridge the gap between knowledge of the genome, proteome, and metabolome, and results obtainedin relevant systems by studying the behavior of pathogens in foods and in the animal host, not onlyin model systems under laboratory conditions. The knowledge garnered from omics-based researchin the coming years will play an important role in understanding how pathogens survive food safetybarriers and interact with host species. Each new advance in our understanding will potentially giverise to improved and novel strategies for detection, identification, and control of food-borne pathogens,as well as for diagnosis and control of infections.105

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance106Evaluation of Probiotic Attributes of DairyStarter Cultures Using Various Test MethodsRameshwar SinghDairy Microbiology Division, NDRI, KarnalProbiotics – friendly bacteria with a host of benefits“Let food be the medicine and medicine be the food,” the age-old quote by Hippocrates, is certainlythe dogma of today. With the growing interest in self-care, recognition of the link between diet andhealth is becoming stronger day by day. As a result, the market for functional foods, or foods thatpromote health beyond providing basic nutrition, is flourishing. Within the functional foods is therapidly expanding arena of probiotics.Probiotics (according to the currently adopted definition by FAO/WHO) are: “Live microorganismswhich when administered in adequate amounts confer a health benefit on the host”. The term probioticsis derived from the Greek word ‘pro’ means ‘for’ and ‘bio’ means ‘life’. Lilly and Stillwell were thefirst one to introduce the term probiotics in the year 1965 to describe the growth promoting factorsproduced by the microorganisms. However over the years, the term probiotics has been linked toseveral definitions. As per the version of Parker, probiotics can be defined as those organisms andsubstances, which contribute to the intestinal microbial balance. Later, Fuller redefined probiotics asfoods containing live microorganisms, which actively enhance the health of consumers by improvingthe balance of microflora in the gut, when ingested live in sufficient numbers.Types of probioticsMany types of bacteria have been used as probiotics since time immemorial. Today food productscontaining probiotics are almost exclusively dairy products – fluid milk, dahi, soy yogurt, yogurt due tothe historical association of lactic acid bacteria with fermented milk. The most frequently used bacteriain these products include the Lactobacillus and Bifidobacterium species. Some Enterococcus species, yeastslike Saccharomyces species too find a place in the long list of probiotics. In particular lactobacilli aregenerally used as probiotics. This may have historical reasons since Metchnikoff proposed that thelactobacilli present in yoghurt would have a health promoting effect.Potential health benefits of probioticThe list of potential health promoting traits attributed in particular to LAB is quite impressive.Health benefit: proposed mechanism(s)1. Alleviation of lactose intolerance:Bacterial β-galactosidase acts on lactose2. Positive influence on intestinal flora:a. Lactobacilli influence activity of overgrowth flora, decreasing toxic metabolite productionb. Antibacterial characteristics3. Prevention of intestinal tract infections:a. Adjuvant effect increasing antibody productionb. Stimulation of the systemic or secretory immune responsec. Competitive exclusiond. Alteration of intestinal conditions to be less favorable for pathogenicity (pH, short chain fattyacids, bacteriocins)e. Alteration of toxin binding sitesf. Gut flora alterationg. Adherence to intestinal mucosa, preventing pathogen adherenceh. Competition for nutrients

Evaluation of Probiotic Attributes of Dairy Starter Cultures Using Various Test Methods4. Improvement of the immune system:a. Strengthening of non-specific defense against infectionb. Increased phagocytic activity of white blood cellsc. Increased serum IgA after attenuated Salmonella typhimurium challenged. Increase in IgA productione. Proliferation of intra-epithelial lymphocytesf. Adjuvant effect in antigen-specific immune responsesg. Regulation of the Th1/Th2 balance, induction of cytokines5. Reduction of inflammatory or allergic reactions:a. Restoration of the homeostasis of the immune systemb. Regulation of cytokine synthesisc. Prevention of antigen translocation into blood6. Anti-colon cancer effecta. Mutagen bindingb. Carcinogen deactivationc. Alteration of activity of colonic microbesd. Immune responsee. Influence on secondary bile salt concentration7. Blood lipids, heart disease :a. Assimilation of cholesterolb. Alteration of activity of bile salt hydrolase enzymec. Antioxidative effect8. Antihypertensive effect:a. Peptidase action on milk results in antihypertensive tripeptides (angiotensin convertingenzyme inhibitors)b. Cell wall components act as angiotensin converting enzyme inhibitors9. Urogenital infections:a. Adhesion to urinary and vaginal tract cellsb. Competitive exclusionc. Inhibitor production (H 2O 2, bio-surfactants)10. Infection caused by Helicobacter pylori:a. Competitive exclusionb. Lactic acid productionc. Decreased urease activity of H. pylori in humans after administration of a supernatant of aLactobacillus culture11. Regulation of gut motility (constipation)Characteristics expected of potential probiotic strains• Non toxic and non-pathogenic• Accurate taxonomic identification• Normal inhabitant of the targeted species• Capable of survival, proliferation and metabolic activity in the target site, which implies:• resistance to gastric acid and bile• ability to persist, albeit for short periods, in the gastrointestinal tract• adherence potential preferred• ability to compete with the resident flora• Production of antimicrobial substances• Antagonism towards pathogenic bacteria• Ability to modulate immune responses• Ability to exert at least one clinically documented health benefit107

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance• Genetically stable• Amenability of the strain and stability of the desired characteristics during processing, storageand delivery• Viability at high populations• Desirable organoleptic and technological properties when included in fermentationprocessesEvaluation of the probiotic attributes of lactic acid bacteria(1) Acid tolerance: The ability of lactic acid bacteria (LAB) to resist acidic conditions (Clark et al., 1997) istested. The LAB are grown in their respective broth overnight at their respective growth temperatures.The actively grown cells (8 log10 cfu ml-1) are harvested by centrifugation and resuspended in equalvolume of broth with pH adjusted to pH 4.0, pH 3.0, pH 2.0 with 1 M HCl and simultaneously in brothwith pH 7.0 as control. Survival is evaluated by determining the viable counts of the samples seriallydiluted in peptone water after 0, 30, 60 and 120 min in acidic conditions, which is subsequently platedon their respective agar and incubated at their respective temperature.(2) Bile tolerance : Tolerance for bile acids is tested according to the method of Gilliland et al. (1984).The LAB are grown in their respective broth overnight at their respective growth temperature. Theactively grown cells (8 log 10cfu/ ml) are harvested by centrifugation and resuspended in equal volumeof their broth supplemented with 0.5%, 1%, 2% w/v ox bile and without supplement as a control .Survival is evaluated by plate count on their respective agar, after 0, 1, 3 and 12h of incubation in brothcontaining bile salts reflecting the time spent by food in the small intestine and subsequently the plateswere incubated at their respective temperature.(3) Cell surface hydrophobicity : Ability of the organisms to adhere to hydrocarbons is a measureof their adherence to the epithelial cells in the gut i.e. cell surface hydrophobicity. Cell surfacehydrophobicity of LAB is determined according to the method described by Rosenberg et al., (1980)with slight modification using n-Hexadecane, n-Octane and Xylene. Cultures of the strains are grownin their respective broth overnight at their respective growth temperatures. The cells (8 log 10cfu ml -1 )are harvested in their early log phase by centrifugation at 12,000 x g for 5 min at 5ºC, washed twiceand resuspended in 5 ml phosphate urea magnesium (PUM) buffer (pH 6.5) and the cell suspensionis adjusted to an absorbance value (A 610) of approx. 0.8 - 1.0. Three ml of the bacterial suspension areput in contact with 1 ml of each of the hydrocarbons. The cells are pre-incubated at their respectivetemperature for 10 min and then vortexed for 120 s. The suspension is then kept undisturbed at theirrespective temperatures for 1h to allow phase separation and the hydrocarbon layer is allowed to risecompletely. After 1h, aqueous phase is removed carefully with a Pasteur pipette and the absorbance(A 610) is measured using Spectrophotometer . The decrease in the absorbance is taken as a measure ofthe cell surface hydrophobicity (%H) calculated with the given equation.Where, ODinitial and ODfinal are the absorbance (at 610nm) before and after extraction with thethree hydrocarbons.(4) Antibiotic susceptibility : Pattern of resistance/susceptibility to antibiotic of LAB is studied bydisc diffusion method. Various antibiotic discs of ampicillin, amoxycillin, bacitracin, chloramphenicol,ciprofloxacin, cotrimoxazole, erythromycin, gentamicin, kanamycin, nalidixic acid, penicillinG,rifampicin, streptomycin, tetracycline, and vancomycin are used. Mueller Hinton agar 2 (Himedia)plates are poured in petri plates and allowed to solidify. These are subsequently over laid with 4 ml ofMueller Hinton agar 2 soft agar tempered at 45ºC and seeded with 200 µL of active cultures. Petriplatesare allowed to stand at room temperature for 15 min and then the antibiotic discs are dispensed ontoagar using forceps under aseptic conditions. The agar plates are incubated at 37ºC aerobically for 24 h.Diameter (mm) of zone of inhibition is measured using antibiotic zone scale and results are expressed108

Evaluation of Probiotic Attributes of Dairy Starter Cultures Using Various Test Methodsin terms of resistance, moderate susceptibility or susceptibility by comparing with the interpretativezone diameters given by Performance Standards for Antimicrobial Disk Susceptibility tests (CLSI,2007) for disc diffusion antibiotic susceptibility test.(5) Antimicrobial activity : LAB are screened for their antibacterial activity and inhibitory spectraagainst a broad range of Gram-positive and Gram-negative strains by spot-on-lawn assay (Uhlmanet al., 1992). Active pure cultures of LAB are grown in broth for 16-18 h at 37ºC. Cell free culturesupernatants (CFCS) are prepared by centrifuging the broth at 10,000 rpm for 10 min at 4ºC. Theculture supernatants thus obtained are heat treated (90ºC, 5-7 min) to kill any live cell. Fresh culture ofindicator bacteria grown for 16-18 h are further inoculated for its active growth at optimum temperaturefor 3-4 h (absorbance at 660 nm = 0.01). Fifty microlitres of this culture is mixed with 7 ml of melted andtempered (45ºC) TGE soft agar and poured onto the previously surface dried TGE agar plates. The softagar is allowed to solidify and 5 μl of CFCS is directly spotted on the lawns of indicator organism. Theplates are kept undisturbed for 2 h and subsequently incubated at 37oC. After 24 h of incubation, a 5mm or more diameters (mm) of the growth inhibition zones are considered positive inhibition.(6) Cholesterol reduction test : For the ability of probiotic culture to reduce cholesterol present in themedia, 20 mL of respective broth (containing 3% oxgall and 1% lipid cholesterol rich) is inoculatedwith culture and incubate at respective temperature for 16 h. Uninoculated broth (control) is processedin the same way. Cells are removed by centrifugation at 8000 g for 5 min. 0.5 mL supernatant is placedinto a clean glass tube and 3 mL of 95% ethanol is added to each tube, followed by 2 mL of 50%potassium hydroxide and mixed. Tubes are placed in water bath at 60°C for 10 min. and cooled atroom temperature (20°C). After this, 5 mL of hexane is carefully added and mixed vigorously with avortex for 20s. A 3 mL H 2O is added and mixing is done with the vortex. Then the tubes are allowed tosettle at room temperature for 15 min or until complete phase separation (aqueous and organic phase).Next, 2.5 mL of the hexane layer (upper phase) is transferred into a clean tube and dried at 60°C undernitrogen gas flow. The residues formed are resuspended in 4 mL of o-phthalaldehyde reagent. Tubesare kept at room temperature for 10 min and then 2 mL of concentrated sulfuric acid is pipette slowlydown the inside of each tube. These tubes are mixed thoroughly. After standing at room temperaturefor an additional 10 min, absorbance is recorded at 550 nm (A550) against the reagent blank. Theresults are expressed as micrograms (μg) of cholesterol per milliliter.ReferencesClark, P.A., Cotton, L.N. and Martin, J.H. 1997. Selection of bifidobacteria for use as delivery adjuncts in cultured dairyfoods. II. Tolerance to stimulated pH of human stomachs. Cult. Dairy Prod. J., 28(4): 11-14.Gilliland, S.E., Staley, T.E. and Bush, L.J. 1984. Importance of bile tolerance of Lactobacillus acidophilus used as dietaryadjunct. J. Dairy Sci., 67: 3045-3051.Rosenberg, M., Gutnick, D. and Rosenberg, E. 1980. Adherence of bacteria to hydrocarbons: A simple method formeasuring cell-surface hydrophobicity. FEMS Microbiol. Lett., 9: 29-33.Performance Standards for Antimicrobial Disk Susceptibility tests, Clinical and Laboratory Standards Institute (CLSI),27(1), 2007.Uhlman, U., Schillinger, U., Rupnow, J.R. and Holzapfel, W.H. 1992. Identification and characterization of twobacteriocin-producing strains of Lactococcus lactis isolated from vegetables, Int. J. Food Microbiol., 16: 141-151.Spencer, J. and Spencer, A. 2001. Methods in Biotechnology: Food Microbiology protocols, 14: 174-181.109

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance110Identification of Lactobacillus spp byPCR based Molecular MethodologySachinandan De and Rupinder KaurAnimal Biotechnology Centre, NDRI, KarnalLactic Acid Bacteria (LAB) constitute an important class of organism widely distributed in natureand occurring naturally as indigenous microflora in raw milk. They play an important role in food andfeed fermentation. Lactobacillus forms the most numerous genus in the -heterogeneous group of LAB.Members of the genus Lactobacillus are also found in plants and in plant-derived materials, such assilage, grains and foods, but also in the gastrointestinal tract (GIT) of humans and animals (Stewart,1997). Lactobacillus species are used industrially for the production of yogurt, cheese, sauerkraut,pickles, beer, wine, cider, kimchi, chocolate and other fermented foods, as well as animal feeds, such assilage. The genus Lactobacillus currently consists of over 149 species and 29 subspecies and encompassesa wide variety of organisms (http://www.bacterio.cict.fr/l/lactobacillus.html). Members of the genusLactobacillus are Gram positive, non motile, non spore forming rods or cocci bacteria that producemainly lactic acid after carbohydrate fermentation (Kandler and Weiss 1986).Quality assurance programs associated with research, development, production and validationof the health or technological benefits of these bacteria require their relevant isolation, counting andidentification. The precise identification of these bacteria to the genus and species level is quite laborious.At present the identification of Lactobacilli largely depend on selective growth in microaerophilicMRS (deMan Rogosa - Sharpe) media and an array of biochemical tests like Gram staining, catalasetest, carbohydrate fermentation. These microbiological / culture based methods are time consumingand often give rise to ambiguous results. Polyphasic approaches combining biochemical, molecular,and morphological data are important for the accurate classification of lactic acid bacteria (Klein etal., 1998). Lactobacillus species may be difficult to identify by conventional biochemical methods,although simplified approaches are useful for presumptively assigning organisms to this genus.Many DNA based methods have been applied to the identification of Lactobacilli. The ribosomalRNA gene sequences (16 S rRNA and 23S rRNA) have been used by many workers for the identificationof LAB. This is possible because of the conserved nature of the 16S rRNA gene sequence and a vastrepertoire of online rRNA gene sequences reported by the scientific community against which the rRNAcould be compared. The 16S rRNA gene based classification has revealed considerable diversity in thisgenus (Vela et al. 2008). New Lactobacillus species are continually being described (www.bacterio.cict.fr), with 10 new species in 2007 and four in 2008. Some Lactobacillus species have been renamedover the years. These changes cause confusion and some previous identification of Lactobacilli mayyet be subject to change . Dubernet et al (2002) have developed a PCR assay using a genus specificprimer, targeted to the genes encoding the 16S rRNA. As we enter into the genomics era the rRNAbased microbial phylogeny is under critical scrutiny. Other useful genotypic studies using proteinencoding genes tuf gene (encoding elongation factor Tu, involved in protein biosynthesis, Chavagnatet al 2002), rpoB (RNA polymerase beta subunit) , gyr B (B subunit of DNA gyrase), hsp 65, ( heatshock protein 65) dnaJ (asoociated with DnaK chaperone machinery) , recA (encoding recombinase A),groEL (groEL, encoding a 60-kDa heat shock protein) pheS (phenylalanyl-tRNA synthase) have beenpublished recently. Being housekeeping genes from biosynthetic pathways, they retained the aminoacid structure more or less conserved without modifying the product of translation substantially bytolerating silent point mutations, which lead to a greater degree of variability at the nucleotide level.Characterisation and identification of lactobacilli from genus level tostrain levelFor decades, differentiation between genera has been based on phenotypic characters. Under alight microscope, lactobacilliare generally regularly shaped, non-motile, non-spore-forming, Gram-

Identification of Lactobacillus spp by PCR based Molecular Methodologypositive rods. However, cell morphology varies widely, from long, straight or slighty crescentshaped rods to coryneform coccobacilli. Numerous genera display such morphological features.However, we can separate by simple tests such as tests for the oxygen tolerance, presence of catalaseand growth on acidified MRS. Classical phenotypic tests for identification of lactobacilli are basedon physiological characteristics such as respiratory type, motility, growth temperature and growthin NaCl, and on biochemical characteristics such as homo/hetero-fermentative, production of lacticacid isomers, metabolism of carbohydrate substrates, coagulation of milk and presence of particularenzymes (e.g. arginine dihydrolase, antibiotic susceptibilities, and so on). Lactobacilli are typicallychemoorganotrophic and ferment carbohydrates, producing lactic acid as a major end product.Analysis at genus levelThe genus Lactobacillus is heterogeneous, with the G+C content of the DNA of its species varyingfrom 33 to 55% (Hammes and Vogel 1995). However, it is generally thought that G+C content shouldvary by no more than a 10% range within a well-defined genus (Vandamm et al., 1996). The nucleotidesequences of Lactobacillus 16S ribosomal DNA (rDNA) provide an accurate basis for identification. Thesequence obtained from an isolate can be compared with those of Lactobacillus species held in databases.Recently, Dubernet et al. (Dubernet et al., 2002) defined a genus-specific primer by analysing similaritiesbetween the nucleotide sequences of the spacer region between the 16S and 23S ribosomal RNA genesof Lactobacillus. The specificity of this genus-specific primer combined with a universal primer wastested against 23 strains of lactobacilli of varied origin (corresponding to 21 species) Escherichia coli, twoleuconoctocs species, Carnobacterium piscicola, Pediococcus pentosaceus, Bifidobacterium bifidum, Weissellaconfusa, Enterococcus faecalis, Staphylococcus aureus and Listeria monocytogenes. Positive amplificationwas only obtained with the lactobacilli strains.Analysis at species level Phenotypical micro methodsSeveral combinations of tests and ready-to-inoculate identification kits such as API 50 CH, LRAZym and API Zym enzymatic tests can be used for the rapid and theoretically reproducible phenotypicidentification of pure cultures. They have been used for the characterisation and identification oflactobacilli in milks [Medina et al., 2001], yoghurts and other fermented milks (Andrighetto et al., 1998)and in cheeses (Andrighetto et al., 1998, Tilsala and Alatossava 1997). However, the reliability of thesetests has been questioned, especially for API 50 CH, initially developed for the identification of medicalLactobacillus strains. In addition, the manufacturer’s database is not updated and some Lactobacillusspecies are missing. Andrighetto et al.(Andrighetto et al., 1998) used API 50 CH to analyse 25 strains ofthermophilic lactobacilli isolated from yoghurt and from semi-hard and hard cheeses (Lb. delbrueckiissp. lactis and ssp. bulgaricus, Lb. helveticus and Lb. acidophilus). For most of the strains, clear assignmentto a particular species or subspecies was not possible because ambiguous results were obtained for thesugar fermentation profile. Nigatu (Nigatu 2000) also reported a lack of agreement between the API50 CH grouping pattern of isolates and RAPD clusters. Tynkkynen et al. (Tynkkynen et al., 1999) usedAPI 50 CH for identifying strains of the Lb. casei group (Lb. rhamnosus, Lb. zeae and Lb. casei). The exactidentifications of these closely related species were not reliable; some were doubtful or unacceptableand some strains were misidentified with a good identification level. Furthermore, variability maybe observed within a single strain. For example, the Lb. rhamnosus GG strain has traditionally beendetected, counted and identified on the basis of cultures in selective anaerobic conditions on MRS orRogosa agar (37°C for 78 h), colony morphology (large, white, creamy and opaque), Gram stainingand cell morphology (Gram-positive and uniform rods in chains) and the carbohydrate fermentationprofile in the API 50 CHL test. However, it has been pointed out that the colony morphology and thecarbohydrate fermentation pattern of strain GG are not always typical, due to variation (Charteris etal 1997). This variation may result from the loss or gain of plasmids, leading to inconsistency in themetabolic traits of a strain, as most of the proteins involved in carbohydrate fermentation are plasmidencoded(Arhné et al., 1989).111

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceSequencingComparison of rRNA gene sequences is currently considered to be the most powerful and accuratemethod for determining the degree to which microorganisms are phylogenetically related (Woese1987). Advances in molecular biological techniques have made it possible to sequence long stretches ofrRNA genes. Initially, reverse transcriptase was used to generate DNA from rRNA, and this DNA wasthen sequenced. It is now possible to sequence 16S or 23S rDNA molecules by direct PCR sequencing,and this method has generated large sequence databases. Although the speciesspecific sequences arelocated in the first half of the 16S rRNA gene (V1-V3 region), identification is more accurate if the wholegene is sequenced (Stackebrandt and Goebel 1994). This requires the sequencing of about 1.5 kb ofDNA. Tannock et al. (Tannock et 1999) showed that comparison of the16S-23S spacer region sequencesof lactobacilli can be used in practical situations for strain identification. The spacer region sequencesis sequencing rapidly and accurately identifies Lactobacillus isolates obtained from gastrointestinal,yoghurt and silage samples. The 16S-23S spacer sequences of lactobacilli are small, only about 200 bpin length. These short sequences are easy to sequence on both strands and provide reliable informationforcomparative work. The spacer region method has the advantage of distinguishing between Lb.rhamnosus and Lb. casei strains . (Tannock et 1999) It can be used to distinguish Lb. plantarum, fromLb. paraplantarum, these two closely related species belonging to the Lb. plantarum group [12]. Chenet al. (Chen et al., 2000) analysed the 5S-23S rRNA intergenic spacer regions (ISRs) of the Lactobacillusgroup. This method was found to be an effective way of discriminating Lb. rhamnosus from Lb. casei/Lb. paracasei because spacer length polymorphism results in a 76/80 bp insertion with respect to the16S V2-V3 sequences.ConclusionIt is widely recognised that the identification of lactobacilli to species or strain level on the basisof physiological and biochemical criteria is very ambiguous and complicated. Numerous taxonomicchanges have been observed in the Lactobacillus genus as qualification of old species in new generaor description of new species. This leads to a problematic genus characterization by phenotypic testsand to an increasing use of classical culture-based molecular methods. New molecular techniques formicrobial community analysis that do not require isolation of the microorganisms are very promising.They provide a complementary picture of the population obtained using culture-based techniqueswhen applied to the analysis of milks and dairy products. However, these molecular approaches haveseveral limitations, including the design of adequate primers, and the possibility that DNA isolation,amplification and cloning might be biased by certain strains and sequences. There is also dependenceon the detection threshold and on the number of lactobacilli, unfortunately low in high quality rawmilks.Numerous techniques, culture- dependent or culture-independent, are based on the use of probesand primers. For these techniques the discrimination level depends on the existence or not of the probesand primers at the taxonomic level desired. To date we are very far from having specific primers andprobes for the 88 lactobacilli species, and regarding those which have been designed, their specificityand validity should be checked one by one with closed genera, species or strains. Another problemresults from the given list of 88 lactobacilli species since it is not an official list (it does not exist) andthus to bypass possible misidentification all probes and primers should be validated against the samereference strain at the beginning to ensure their common specificity. Moreover, all the techniquesmentioned in this review have not been applied to the lactobacilli using the same objectives.The genus primer designed by Dubernet et al. (2002), has been used for PCR and PCR-TGGE,but not for hybridisation, but it is clear that it could be used. The difficulty of choosing a techniquethat has good discrimination power depends not only on the techniques but also on the speciesor strains. Results also depend on the quality and exhaustivity of a database. Finally, only a fewlimited techniques can be applied with a high degree of confidence although they are dependent on112

Identification of Lactobacillus spp by PCR based Molecular Methodologydatabase robustness: sequencing to identify at genus and species level, and sequencing or pulsedfield gel electrophoresis to discriminate strains. In conclusion, analysis of lactobacilli in cheeses andother dairy products is very complicated and the use of different techniques, especially molecularbasedphenotypic or genomic techniques, is recommended.ReferenceHammes W.P., Vogel R.F., The genus Lactobacillus, in: Wood B.J.B., Holzapfel W.H. (Eds.), The lactic acid bacteria. Thegenera of lactic acid bacteria, Blackie Academic, London, UK, 1995, pp. 19–54.Vandamme P., Pot B., Gillis M., de Vos P., Kersters K., Swings J., Polyphasic taxonomy, a consensus approach tobacterial systematics, Microbiol. Rev. 60 (1996) 407–438.Dubernet S., Desmasures N., Guéguen M., A PCR-based method for identification of lactobacilli at genus level, FEMSMicrobiol. Lett. 214 (2002) 271Medina R., Katz M., Gonzalez S., Oliver G., Characterization of the lactic acid bacteria in ewe’s milk and cheese fromnorthwest Argentina, J. Food Prot. 64 (2001) 559–563Andrighetto C., De Dea P., Lombardi A., Neviani E., Rossetti L., Giraffa G., Molecular identification and cluster analysisof homofermentative thermophilic lactobacilli isolated from dairy products, Res. Microbiol. 149 (1998) 631–643Tilsala-Timisjarvi A., Alatossava T., Development of oligonucleotide primers from the 16S-23S rRNA intergenicsequences for identifying different dairy and probiotic lactic acid bacteria by PCR, Int. J. Food Microbiol. 35 (1997)49–56Nigatu A., Evaluation of numerical analyses of RAPD and API 50 CH patterns to differentiate Lactobacillus plantarum,Lact. fermentum, Lact. rhamnosus, Lact. sake, Lact. parabuchneri, Lact. gallinarum, Lact. casei, Weissella minor and relatedtaxa isolated from kocho and tef, J. Appl. Microbiol. 89 (2000) 969–978.Tynkkynen S., Satokari R., Saarela M., Mattila-Sandholm T., Saxelin M., Comparison of ribotyping, randomly amplifiedpolymorphic DNA analysis, and pulsed-field gel electrophoresis in typing of Lactobacillus rhamnosus and L. caseistrains, Appl. Environ. Microbiol. 65 (1999) 3908–3914Charteris W.P., Kelly P.M., Morelli L., Collins J.K., Selective detection, enumeration and identification of potentiallyprobiotic Lactobacillus and Bifidobacterium species in mixed bacterial populations, Int. J. Food Microbiol. 35 (1997)1–27Arhné S., Molin G., Stahl S., Plasmids in Lactobacillus strains isolated from meat and meat products, Syst. Appl. Microbiol.11 (1989) 320–325.Woese C.R., Bacterial evolution, Microbiol. Rev. 51 (1987) 221–271Stackebrandt E., Goebel B.M., Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA sequence analysisin the present species definition in bacteriology, Int. J. Syst. Bacteriol. 44 (1994) 846–849Tannock G.W., Tilsala-Timisjarvi A., Rodtong S., Ng J., Munro K., Alatossava T., Identification of Lactobacillus isolatesfrom the gastrointestinal tract, silage, and yoghurt by 16S-23S rRNA gene intergenic spacer region sequencecomparisons, Appl. Environ. Microbiol. 65 (1999) 4264–4267113

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIntroductionAntimicrobial Substances producedby Lactic Acid Bacteria (LAB)Shilpa Vij, Subrota Hati and Minakshi DahiyaDairy Microbiology Division, NDRI, KarnalLactic acid bacteria (LAB) are found in many nutrient rich environments and occur naturally in variousfood products such as dairy, meat products and vegetables. They have traditionally been used as naturalbiopreservatives of food and feed. Biopreservation refers to extended shelf life and enhanced safety offoods obtained by using the natural or added microflora and their antimicrobial products. Lactic acidbacteria have traditionally been used as natural biopreservatives in food and animal feed, sauerkraut andsilage. Their preserving effect relates mainly to the formation of organic acids and hydrogen peroxide,competition for nutrients and production of antimicrobial substances. Lactic acid bacteria are able toproduce antimicrobial compounds such as organic acids, hydrogen peroxides, bacteriocins etc. Antifungalcompounds such as proteinaceous compounds, phenyllactic acid, cyclic dipeptides and hydroxylatedfatty acids and Bacteriocin-like substances (BLIS) and other low and medium molecular weight masscompounds are also produced by LAB.Organic acidsOrganic acids occurring in foods are additives or end-products of carbohydrate metabolism of LAB.Lactic and acetic acids are the main products of the fermentation of carbohydrates by LAB. Acetic acidis the strongest inhibitor and has wide range of inhibiting activity against bacteria, yeast and molds.These acids generally recognised as safe agents for the preservation of foods (El-Ziney, 1998), diffusethrough the membrane of the target organisms because they are lipid soluble. After entering the cell,the acid gets dissociated. The release of protons in the cytoplasm leads to acidification and inhibitionof the cell growth.Hydrogen peroxide (H 2O 2)Most LAB have flavoprotein oxidases, enabling them to produce hydrogen peroxide (H 2O 2)in the presence of oxygen. Hydrogen peroxide accumulates in the environment since LAB do notproduce catalase. The antimicrobial effect of hydrogen peroxide attributes to a strong oxidizingeffect on the bacterial cell, and to the destruction of basic molecular structures of cellular proteins.The antimicrobial effect of hydrogen peroxide at non-inhibitory concentrations is potentiated bylactoperoxidase and thiocyanate present in milk and saliva (Condon, 1987). The lactoperoxidase–thiocyanate–peroxide system involves the reaction of hydrogen peroxide and thiocyanate throughcatalysed by lactoperoxidase. Hypothiocyanate (OSCN – ) and other intermediary products then inhibitother microorganisms. The structural damage and changes in bacterial membrane due to exposure toOSCN – . Occurs. It inhibits glucose transport and some enzyme activity due to oxidation of sulfahydralin the metabolic enzymes.SCN – + H 2O 2→ OSCN – +H 2OThe Gram –negative bacteria are rapidly killed whereas, the Gram-positive bacteria are inhibited.Lactoperoxidase and thiocyanate are present in milk, and when some LAB are grown in milk or milkproducts, the third needed component, hydrogen peroxide, is added.DiacetylDiacetyl (2, 3-butanedione), the characteristic aroma compound of butter, has antimicrobial effectsat low pH (Jay, 1982) and is produced by strains of some genera of LAB during citrate fermentation.However, the amounts of diacetyl needed to exert antimicrobial activity (close to 200 mM) dramaticallyalters both the taste and aroma of the product. It has antimicrobial activity against Bacillus sp.114

Antimicrobial Substances produced by Lactic Acid Bacteria (LAB)BacteriocinsBacteriocins are bacterial ribosomally synthesized peptides or proteins with antimicrobial activityand kill very closely related bacteria upon binding to the inner membrane or other cytosolic targets.Nowadays, the term bacteriocin is mostly used to describe the small, heat-stable cationic peptidessynthesized by Gram positive bacteria, namely lactic acid bacteria (LAB), which display a widerspectrum of inhibition. Based on their cationic and their hydrophobic nature, most of these peptidesact as membrane permeabilizers. Pore formation leads to the total or partial dissipation of the protonmotive force, ultimately causing cell death. Bacteriocin pore formation seems to be target mediated.Nisin and other lantibiotics use the cell wall precursor lipid II as a docking molecule. Thereby, twomodes of action, i.e. inhibition of cell wall biosynthesis and pore formation, are combined within onemolecule for potent antimicrobial activity.Class General Features Produced by LABI-lantibiotics: la-Linear, lb-Globularand lc-Multi componentII-Unmodifi ed peptides:lla-Pediocinlike, llb-Miscellaneous, llc-MulticomponentIII-Large Proteins: llla-Bacteriolytic,lllb-Non-lyticModifi ed, heat stable,

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceLactococcus sp. and Leuconostoc sp. (BD type cultures), Propionibacterium sp. Lactobacillus sp. as well asLactobacillus acidophilus and Bifidobacterium.Antifungal compounds of LABProteinaceous compounds: Ribosomally synthesized antimicrobial peptides generally have ahydrophobic and a hydrophilic end, a size of 20–50 amino acids, and cationic properties. Many LABproduce bacteriocins, antibacterial, ribosomally synthesized peptides or proteins. Antifungal activityof the compounds produced by LAB are well known. Lactococcus lactis subsp. lactis and Lactobacilluscasei produced proteinaceous compounds with antagonistic activity against several filamentous fungi.The anti-aflatoxigenic properties of LAB depend on adherence of fungal toxins to cells of LAB. Aproteinaceous compound from Lactobacillus coryniformis subsp. coryniformis strain Si3 as antifungaleffect against several moulds and yeasts. The peptide is small (approximately 3 kDa), heat stable,active in the pH range 3–6 and totally inactivated by proteinase K. Similar characteristics are foundamong the heat stable, unmodified bacteriocins of subclass II.Phenyllactic acid: Phenyllactic acid and 4-hydroxy-phenyllactic acid from L. plantarum 21B haveantifungal activity against several species of filamentous fungi (Lavermicocca et al. (2000). Phenyllacticacid has also been identified from culture supernatants of L. plantarum MiLAB 393, L. coryniformis strainSi3, and strains of Pediococcus pentosaceus and L. sakei. Phenyllactic acid is only active against yeastsand moulds. However, this metabolite certainly contributes to the overall antifungal effect in synergywith other compounds produced by LAB.Cyclic dipeptides and other low-molecular-mass inhibitory compounds: New types of antimicrobialcompounds from the culture filtrate of L. plantarum VTT E-78076 was found (Niku-Paavola et al. (1999). The active fraction include benzoic acid, 5-methyl-2,4-imidazolidinedione (methylhydantoine),tetrahydro-4-hydroxy-4-methyl-2H-pyran-2- one (mevalonolactone), and cyclo(glycyl-L-leucyl). Twocyclic dipeptides are cyclo (Phe-Pro) and cyclo (Phe-OH-Pro) in the supernatant of L. plantarum MiLAB393. The antimicrobial effect of several different cyclic dipeptides has been found that cyclo(Phe-Pro)and cyclo(Phe-OH-Pro) are also produced by strains of P. pentosaceus, L. sakei and L. coryniformis andthus might be common LAB metabolites.Phenolic compounds: This phenolic compound produced by P. acidilactici LAB 5 and showedvarying degrees of antifungal activity against a number of foods and plant pathogenic fungi.Hydroxy fatty acids: Some LAB can produce antimicrobial fatty acids that improve the sensoryquality of fermented products. Caproic acid isolated from Lb. sanfrancisco CB1 is a potent antifungalsubstance produced by this strain. This compound can act in synergy with other acids such as propionic,butyric and valeric acids. Among these fatty acids, the most active is shown to possess a 12-carbonatom chain length. Hydroxylated fatty acid compounds present a very broad inhibition spectrum andare efficient against moulds and yeasts. The minimum inhibitory concentration (MIC) of hydroxylatedfatty acids ranges between 10 and 100 µg/ml (Sjögren et al., 2003).Reference:Heng, N. C. K. and Tagg, J. R. (2006). What is in a name? Class distinction for bacteriocins. Nature Reviews Microbiology,4. doi:10.1038/nrmicro1273-c1. Correspondence (February 2006).El-Ziney, M. (1998). Antimicrobial activity of lactic acid bacteria metabolites: The role of lactic acid enterocin 5701 and reuterin.Ph.D. Thesis, University of Gent (pp. 3– 23).Sjögren, J., Magnusson, J., Broberg, A., Schnürer, J. and kenne, L. (2003). Antifungal 3 - hydroxyl fatty acids fromLactobacillus plantarum MiLAB14. Applied and Environmental Microbiology, 69, 7554–7557.Meisel, H. and Bocklmann W. (1999). Bioactive pepitdes encrypted in milk proteins; proteolytic activation and throphofuntionalproperties. Antonie van Leeuwenhoek, 76: 207-215.Magnusson, J., Ström, K., Roos, S., Sjögren, J. and Schnürer, J. (2003). Broad and complex antifungal activity amongenvironmental isolates of lactic acid bacteria. FEMS Microbiology Letters, 219, 129–135.Lavermicocca, P., Valerio, F. and Visconti, A. (2003). Antifungal activity of phenyllactic acid against molds isolatedfrom bakery products. Applied and Environmental Microbiology, 69, 634–640.Niku-Paavola, M. L., Laitila, A., Mattila-Sandholm, T. and Haikara, A. (1999). New types of antimicrobial compoundproduced by Lactobacillus plantarum. Journal of Applied Microbiology, 86, 29–35.Condon, S. (1987). Responses of lactic acid bacteria to oxygen. FEMS Microbiology Reviews, 46, 269–280.Jay, J.M. 1982. Antimicrobial properties of diacetyl. Applied and Environmental Microbiology, 44, 525– 532.116

Microbiological Risk Assessment: A New Concept to Ensure Food SafetyMicrobiological Risk Assessment: A NewConcept to Ensure Food SafetyNaresh Kumar and Raghu H. V.Dairy Microbiology Division, NDRI, KarnalThe significance of milk in human nutrition in now well established as it is considered as thebest, ideal and complete food for all age groups. Milk can also serve not only as a potential vehiclefor transmission of some pathogens but also allows these organisms to grow, multiply and producetoxins. A variety of pathogenic organisms may gain access in milk and milk products from differentsources and cause different types of food born illnesses which includes food infection, intoxicationand toxio-infection (Aneja et al., 2002). Recent development regarding Quality and safety managementsystems such as ISO and Hazard Analysis Critical Control Point (HACCP) has reduced such incidences.The safety of milk and milk products has been extensively reviewed by regulatory agencies in Indiaand internationally. A large number of risk assessments and risk profiles have been undertaken,examining the risks across the entire dairy supply chain and conducting in-depth evaluations ofspecific pathogen-product combinations. This risk assessment will summarize the major body ofrelevant work undertaken to date.Evolution of food safety systems: When it was accepted that people can contract disease from contaminatedfood, hygiene control laws were introduced and examples can be seen in old legal records.Table 1 gives an overview of the more important milestones in developing food safety systems. Inthe absence of knowledge about the causes of serious foodborne diseases and their etiology, use wasmade of the ‘prohibition’ principle. This means that it was prohibited to produce and/or to consumecertain type of food after it was realized that the foods could be a cause of high mortality. The principlewas used particularly to protect special groups of individuals within society, such as soldiers. Afterthe recognition at the end of the nineteenth century that microbial agents were often responsible forfoodborne illness, systems for controlling the safety of the food supply began to be introduced. First,use was made of microbiological testing of foods and this became widely accepted as a means ofassessing food safety during the early part of the twentieth century. Eventually, statutory microbiologicalrequirements relating to food safety were established in many parts of the world. Furtherprogress occurred when Esty and Meyer (1922) developed the concept of setting process performancecriteria for heat treatment of low-acid canned food products to reduce the risk of botulism. Later,many other foods processed in this way were controlled in the same manner. An outstanding exampleis the work of Enright et al. (1956, 1957) who established performance criteria for the pasteurization ofmilk that provided an appropriate level of protection against Coxiella burnetii, the causative agent ofQ fever. Studies for tuberculosis have been carried out earlier. The work is an early example of the useof risk assessment principles in deriving process criteria.The ability of different bacteria to multiply in foods is influenced by several key factors, includingpH, water activity and storage temperature. The effects of these factors, both singly and in combination,have been studied extensively in laboratory media and model food systems, and this has led to thedevelopment of mathematical models for predicting bacterial growth in commercial food products.Although not a food safety system on its own, predictive modelling is a valuable tool, which has helpedto make possible the introduction of QRA. The latter has been used for many years in other disciplinesand its use in food microbiology has been stimulated by the decision of the World Trade Organisation(WTO) to promote free trade in safe food (Anon, 1995). It has been emphasized, however, that controlof food safety in this context must be based on the application of sound scientific principles, and riskanalysis is seen as the basis for ensuring that the requirement is met.Setting public health goals – The concept of Appropriate Level of Protection (ALOP): Duringthe past decade, there has been increased interest and effort in developing tools to more effectively link117

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancethe requirements of food safety programs with their expected public health impact. This documentintroduces two such tools, the "Food Safety Objective" (FSO) and the “Performance Objective” (PO).These can be used to communicate food safetyrequirements to industry, trade partners, consumersand other countries. Good practices and HACCPremain essential food safety management systems toachieve FSOs or POs. Setting goals for public healthare the right and responsibility of governments.These goals may specify the maximum numberof harmful bacteria that may be present in a food.Where possible, the determination of this numbershould be based on scientific and societal factors.The level of risk can be expressed in a qualitativeway (e.g., high, medium or low risk), or whenSeverityModerateSeriousSevereDescriptionNot usually life threatening; nosequelae; normally short duration;symptoms are self-limiting; can besevere discomfortIncapacitating but not lifethreatening; sequelae infrequent;moderate durationLife threatening, or substantialsequelae, or long durationpossible, as the number of cases of foodborne disease per number of people per year. The ICMSFranking scheme categorizes hazards by the severity of the threat they pose to human health, takinginto consideration the: likely duration of illness; likelihood of death; and potential for ongoing adversehealth effects. The severity of adverse health effects caused by a hazard is ranked as moderate, seriousor severe according to the following definitions:Under the ICMSF ranking, severe hazards are further divided into those applying to the generalpopu-lation and those applying to specific sub-populations, that is, susceptible individuals (forexample, the very young and old, the immunocompromised, and pregnant women and their unbornchildren). This takes into account those situations where a hazard considered to be of moderate orserious to the general population may cause a severe illness in certain susceptible sub-populations.The estimates of the risk level have to be based on clinical information available (e.g., how many stoolsamples have been found to contain salmonellae) in combination with results from microbiologicalsurveys of foods, evaluations of the types of foods that are produced, how they are produced and howthey are stored, prepared and used. A few countries may use scientific techniques such as QuantitativeMicrobiological Risk Assessment (QMRA) to estimate the risk of illnesses using detailed knowledgeof the relationship between the number of microorganisms in foods and the occurrence of foodbornediseases. Whatever method is used to estimate the risk of foodborne illness, the next step is to decidewhether this risk can be tolerated or needs to be reduced. The level of risk a society is willing to acceptis referred to as the "Appropriate Level Of Protection" (ALOP). Importing countries with more strictrequirements for a particular hazard (e.g., harmful bacteria) may be asked to determine a value for theALOP according to the SPS agreement. When a country is willing to accept the current risk of illnesses,that level is the ALOP. However, most countries will wish to lower the incidence of foodborne diseaseand may set targets for future ALOPs. For instance, the current level of listeriosis could be 6 permillion people per year and a country may wish to reduce this to 3 per million people per year.A Food Safety Objective (FSO):When a government expresses public health goals relative to the incidence of disease, this does notprovide food processors, producers, handlers, retailers or trade partners with information about whatthey need to do to reach this lower level of illness. To be meaningful, the targets for food safety setby governments need to be translated into parameters that can be assessed by government’s agenciesand used by food producers to process foods. The concepts of food safety objectives (FSOs) and performenceobjectives (POs) have been proposed to serve this purpose. The position of these conceptsappearing in the food chain can be seen in Figure 1. An FSO is “The maximum frequency and/orconcentration of a hazard in a food at the time of consumption that provides or contributes to theap-propriate level of protection (ALOP)” It transforms a public health goal to a concentration and/or fre-quency (level) of a hazard in a food. The FSO sets a target for the food chain to reach, but doesnot specify how the target is to be achieved. Hence, the FSO gives flexibility to the food chain to use118

Microbiological Risk Assessment: A New Concept to Ensure Food Safetydif-ferent operations and processing techniques that best suit their situation, as long as the maximumhazard level specified at consumption is not exceeded.FSO and Product/pathogen/Pathway Analysis:The ICMSF has introduced a simple equation that summarises the fate of a hazard along the foodchain as follows:Ho - SR + SI = FSOWhere:FSO = Food Safety ObjectiveHo = Initial level of the hazardSR = the cumulative (total) decrease in levelSI = the cumulative (total) increase in level≤ = preferably less than, but at least equal toFSO, Ho, R, and I are expressed in log10 unitsI (increase) is determined by growth (G) as well as by recontamination (RC). Since the FSO is thelevel of a hazard at themoment of consumption,another term is neededto describe the levelat another point in thefood chain. The termPerformance Criterionhas been proposed bythe ICMSF, but thisterm is also used to describe the outcome of a processing step (for example a 6 decimal reduction of apathogen). For this reason the term Performance Standard is used in this document to reflect the levelof a hazard and Performance Criterion to describe the impact of a process on the level of a hazard.As a consequence of this, the following equation is proposed:Where:FSO = Food Safety ObjectivePS = Performance StandardHo = Initial level of the hazardSR = the cumulative (total) decrease of the hazardSIRC = the cumulative (total) recontamination with the hazardSI G = the cumulative (total) growth of the hazard≤ = preferably less than, but at least equal toNote that the PS of one point of the food chain may be the Ho of the following one.This equation is helpful to determine the effect of control measures necessary to meet a FSO. Itis im-portant to recognise that data used in PPP analyses that can be used to determine the variousvalues of Ho, R, IRC, IG and PS, may differ according to their source and use.A Performance Objective (PO): For some food hazards, the FSO is likely to be very low, sometimesreferred to as "absent in a serving of food at the time of consumption". For a processor that makesingredients or foods that require cooking prior to consumption, this level may be very difficult to useas a guideline in the factory. Therefore, it is often required to set a level that must be met at earliersteps in the food chain. This level is called a performance objective (PO). A PO may be obtained froman FSO, as will be explained below, but this is not necessarily always the case. Foods that need to be119

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancecooked before consumption may contain harmful bacteria that can contaminate other foods in a kitchen.Reducing the likelihood of cross-contamination from these products could be important in achievinga public health goal. The level of contamination that should not be exceeded in such a situation is aPO. For example, raw chicken may be contaminated with Salmonella. Although thorough cooking willmake the chicken safe (absence of Salmonella in a serving), the raw chicken may contaminate otherfoods during preparation of a meal. A PO of “no more than a specified percentage of raw chickencarcasses may contain Salmonella” may reduce the likelihood that Salmonella will contaminate otherfoods. In products, such as ready-to-eat foods, the POs can be calculated from the FSO by subtractingexpected bacterial contamination and/or growth between the two points.Process performance criteria for heat pasteurisation of milk: The work of Enright et al. (1957) ledto the development of process standards for controlling Cox. burnetii in milk. The heat treatments usedinitially for milk were designed to inactivate any tubercle bacilli present and these were considered tobe the most heat-resistant of the nonsporing pathogenic bacteria likely to occur in the product. Thetreatments were based on information from many studies on the heat-resistance of both human andbovine strains (Mycobacterium tuberculosis and Myc. bovis respectively). In the USA, the heating regimeadopted in 1924 for the conventional process was 142°F (61.1°C) - 145°F (62.8°C) for 30 min. In 1933 aheating regime was introduced for the High-Temperature, Short-Time (HTST) process: 161°F (71.7°C)for 15 s. In practice, Cox. burnetii appears to be slightly more heat-resistant than the tubercle bacilli and,following recognition that the organism, which causes Q fever in man, could be transmitted by rawmilk, it was necessary to check on the adequacy of existing pasteurisation processes for inactivatingthe organism. The work undertaken by Enright and colleagues (1956, 1957) fulfilled this requirementand, although no formal MRA was employed,elements of the MRA approach were implicit intheir studies. These aspects are discussed below.Meeting the FSO: Since the FSO is themaximum level of a hazard at the point ofconsumption, this level will frequently be verylow. Because of this, measuring this level isimpossible in most cases. Compliance with POsset at earlier steps in the food chain can sometimesbe checked by microbi-ological testing. However,in most cases, validation of control measures,verification of the results of monitoring criticalcontrol points, as well as auditing good practicesand HACCP systems, will provide the reliableevidence that POs and thus the FSO will be met.Microbiological criteria can be derived fromFSOs and POs, if such levels are available. If suchlevels are not stated, microbiological criteria canbe developing, if appropriate. The ICMSF (2002)has provided guidance on the establishment ofmicrobiological criteria.Risk assessment & HACCP: The relationbetween Risk assessment and Hazard analysis andcritical control point (HACCP) system has beenthe source of much confusion. HACCP is the foodsafety management tool applied in a production,processing, used to continuously control hazardsand thus, to reduce risks. Control measures areput into place at critical control points in theFigure 1. Model food chain indicating the position of afood safety objective and derived performance objectivesFigure 2. FSOs and POs are means of communicatingpublic health goals to be met by food processors by goodpractices and HACCP. Also, industry can set POs to ensurethat FSOs are met.120

Microbiological Risk Assessment: A New Concept to Ensure Food Safetyproduction process to prevent or eliminate a food safety hazard or reduce it to an acceptable level.Risk assessment, on the other hand, is scientific processes of compiling and analysing informationobjectively, systematically and transparently estimate risk. A HACCP study is done for a particularproduct on a particular process line, sold and used under a specific set of conditions.It is some times thought that Risk Assessment is a part of a HACCP study, may be because thefirst activity in HACCP is Called “Hazards Analysis”. In HACCP this includes identifying potentialhazards and determining which are significant, i.e. those that need to be controlled. In Risk Assessmentthe first activity is called”Hazard identification”. This is one of the reasons for confusion.Coxiella burnetii is a small, Gram-negative bacterium, originally classified as a rickettsia that cannotbe grown in axenic culture but can now be cultivated in vitro in various cell lines (Maurin and Raoult,1999). Q fever is characterised by fever, chills and muscle pain, with occasional long-term complications.It was first described by Derrick (1937). And is known to occur worldwide. The organism infectsmany wild and domestic animals, which often remain asymptomatic. Domestic animals, such ascattle, sheep and goats, are considered the main sources of infection for humans (Maurin and Raoult,1999) and, when shed in milk, Coxiella burnetii is often present in relatively high numbers.Contact with infected animals was known to result in transmission of Coxiella burnetii to man,with subsequent development of illness, and the likelihood of the organism contaminating raw milkwas recognised. Early on, there was a lack of epidemiological evidence for transmission via milk, butthis was suspected in several outbreaks and there was strong supporting evidence from a UK outbreakin 1967 (Brown et al. 1968). Thus, the hazard was the presence of Coxiella burnetii in milk intended forhuman consumption.To determine the significance of potential hazards, the HACCP study team assesses the probabilityof contamination, survival and growth of the pathogen in the food during and after processing, as wellas in the production environment. This part of the HACCP study is similar to the product pathogenpathway analysis that is used in risk assessment; however, the aim and output are different. In HACCP,it is done to introduce control measures at critical control point to prevent, eliminate or reduce hazards.In risk assessment, it is done to assess exposure. In HACCP, the input is product and population linespecific. After implementation of HACCP plan, a “residual” level of a hazard can remain and this isthe input for exposure assessment in risk assessment.A full risk assessment as defined by the Codex can be useful when acceptable level (or Food SafetyObjectives) have not been established, and when dealing with a production line that does not reducepathogens (i.e. when HACCP is not fully effective). The risk assessor may estimate the effectivenessof changes in control measures or the introduction of new control measures in terms of reduction ofestimated illnesses. The result of such a risk assessment might help the HACCP-team to determineCCPs or the critical limits at CCPs. This limited form of Risk Assessment could better be called SafetyAssessment, and can be used as a tool for product and process development.This approach is not normally taken in industrial settings. CCPs and critical limits are determinedon the basis of previous experience. Such experience includes both incidents that initiated correctiveactions and the safety record for the particular product and processing line. For new products, theexperiences with similar products, or challenge and storage tests, are used.Hazard analysis and critical control point (HACCP) technique is the foremost system for the controlof microbiological hazards in food. The first phase of both MRA and HACCP is the identification ofHazard. Consequently, there is potential confusion between the two concepts. However, HACCP isreally a risk management system, thus the role of MRA is to provide the information that HACCPsystem developers need to make more informed decisions on. In addition to enhancing the hazardidentification phase of HACCP, Risk Assessment can be used to help identify critical control points(CCPs), establish the critical limits, and determine the extent of hazard associated with a product duringperiods of CCP deviation (ICMSF, 1998).Microbiological Risk Profile: Risk analysis (RA) and its component parts (risk assessment, risk121

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancemanagement and risk communication) should be used as a tool in evaluating and controlling microbiologicalhazards. A risk-management based approach is required to develop recommendations toensure consumer protection and facilitate fair practices in the food trade. This structured approachmay employ microbiological risk assessment and may utilize a spectrum of risk communicationproducts including guidance documents, codes of hygiene practice, food safety objectives (FSO) andmicrobiological criteria (CCFH, 2004).Principle of Risk assessment described by Codex Alimentarius Commission: Protocol for Riskassessment originally developed to manage chemical hazards. Principle of microbiological Risk Assessmentas described by Codex Alimentarius and the FAO/WHO report on Risk management. Accordingto the principle the risk manager who selects the hazards (Figure 3), while the risk assessor describesthe behavior and other important characteristics of the selected hazards. Subsequently, the riskassessor determines the level of exposure to the hazard either by analyzing products or by describingthe complete route from the raw materials, transport, processing, and storage to consumption. Thisis called a Dynamic Flow Tree model, process risk Model, Pathogen –Product Pathway or Farm-toFork-Model. It allows to estimate the various levels of hazards in various situations/circumstancesand the probability that the population is exposed to them. Finally risk assessor combine the exposuredata with data on the dose response relationship and severity of the effects, in a final risk estimate theprobability and the severity of the illness due to a particular pathogen in a particular food, in a specificgroup of consumers.Some general guidelines used to manage pathogens in foods have been described by ICMSF (2002),indicating the respective roles of industry and government. A series of steps is described, including:a) analysis of epidemiological data which may give rise to concern for public health or a need forim-proved controls; b) risk evaluation by an expert panel or through quantitative risk assessment; c)es-tablishment of a FSO when necessary; d) assessing whether the FSO is technologically achievablethrough preliminary process and/or product formulation criteria; and e) if the FSO is achievable, establishmentof process/product requirements.An explicit description of an ALOP may be in terms of the probability of an adverse publichealth consequence or the incidence of disease (e.g. the number of cases per 100,000 populationsper year). Translation of an ALOP into a Food Safety Objective (FSO), expressed in terms of therequired level of hazard control in food, provides a measurable target for producers, manufacturersand control au-thorities. An FSO is defined as “the maximum frequency and/or concentrationof a microbiological hazard in a food at the time ofconsumption that provides an appropriate level ofprotection” (ICMSF, 2002). An alternative definitionof an FSO might be a limit to the prevalence andthe average concen-tration of a microbial hazardin food, at an appropriate step in the food chainat or near the point of consumption that providesthe appropriate level of protection (Havelaar et al.,2004). The assessment of risks to public health andsafety from microbiological hazards in milk andmilk products has been undertaken in the form ofa Microbiological Risk Profile. It provides a broadoverview of risks asso-ciated with consumption ofdairy products. The risk profile identifies key foodFigure. 3 Principle of Risk assessment described bysafety hazards and as-sesses where in the primaryproduction and processing supply chain theseCodex Alimentarius Commissionhazards might be introduced, increased, reducedor eliminated.The WTO/SPS agreement (WHO, 1997) describes the rules for the international trade in safe food122

Microbiological Risk Assessment: A New Concept to Ensure Food Safetyand has introduced the term "appropriate level of protection" (ALOP) to express what is mentionedin the first bullet point above. This ALOP has also been called "acceptable level of risk". This term issimilar to the expression "tolerable level of risk" (TLR) preferred by the ICMSF, because it recognisesthat risks related to the consumption of food are seldom accepted, but at best tolerated. Also impliedis that for a number of food safety hazards, “zero risk” does not exists and/or too costly (financial,societal) to achieve.Risk Characterization in Dairy Products: The risk involved in consuming raw milk could not beestimated because of the absence of dose response data. The data for the prevalence of contaminatedmilk, the maximum level of contamination and the fact that milk would have been consumedregularly by the majority of the population were probably implicit factors in an assumption that therisks associated with inadequate heat treatment were high.The studies of Enright et al. (1956, 1957) led to the conclusion that heating at “143°F for 30 minwas wholly inadequate to eliminate viable Coxiella burnetii from whole, raw milk, while heating at145°F ensures elimination of these organisms with a high level of confidence” (Enright et al., 1957).This led to the adoption of the higher temperature for vat pasteurisation in the USA. The work onthe HTST process indicated that the recommended standard of 161°F for 15 s was sufficient for totalelimination.In preparing the Dairy Risk Profile, previous risk assessments conducted by other scientific agencieswere reviewed and evaluated in this document. There have been few assessments undertaken fordairy products, and typically they address specific pathogen: commodity pairs. This profile considersthe entire dairy supply chain, including the wide range of milk and milk products. Dairy productslikely to support the growth of pathogens and prone to contamination after pasteurization may becategorised as higher risk than other dairy products. Alternatively, dairy products that do not supportthe growth of pathogens, if correctly formulated, can be classified as low risk.The actual ranking of the dairy products is quite variable. Once a shelf-stable UHT product isopened, it may become contaminated and when subjected to temperature abuse it could become ahigh-risk food. In contrast, the low pH and low water activity of extra hard cheese means its will bevery robust and unlikely to support the growth of any pathogen that adventitiously contaminates thesurface. Dried milk powders and infant formulae are inherently stable products due to their low wateractivity, however these products may be prone to contamination, and upon reconstitution becomehigher risk, especially if improperly reconstituted and stored. Following criteria in food matrix maybe considered while characterizing the risk:• Intrinsic properties of the product (i. e. the impact of a , pH, salt concentration, and their effectwon the growth of contaminating microorganism)• Extent to which food is exposed to factory environment or handling after heat treatment• Hygiene and control during distribution and retail sale• Degree of reheating or cooking before consumption (many dairy products are RTE, so this israrely a factor).Attribution of Food-borne Illness to Dairy Products: While there is enhanced quantitativedata on the incidence of illness due to specific pathogens, there is often not the ability or capacity toidentify or distinguish specific food vehicles. The causative agent of an illness is usually determinedthrough epidemiological studies, but confirming the identity of a key ingredient or the original sourceof product contamination, or critical factors contributing to their occurrence is problematic. Thisinability to attribute cases of food-borne illness to causal vehicles is a major issue internationally, andis especially difficult where illness is linked to foods with multiple ingredients. Critical in this processis the capacity to link epidemiological data to animal and food monitoring data. The developmentof public health interventions requires accurate data defining the source from which humans areacquiring pathogens and how specific foods contribute to the total burden of food-borne illness.However, outbreak data represents only a small component of actual cases of food-borne illness, as123

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancemany outbreaks go unrecognized. People do not always seek medical attention for mild forms ofgastroenteritis, and not all food-borne illnesses require notification to health authorities.Dose response: There was no information on the dose response in humans, since challenge trialshad not been carried out and epidemiological data were lacking in this respect.Exposure assessment: Information relevant to this step in MRA was obtained by injecting guineapigs to determine the presence and titre of Coxiella burnetii in milk. The organism was found in33% of 376 samples of raw milk from California, USA. “The maximum number of Coxiella burnetiidemonstrated in the milk of an infected dairy cow was the number of organisms contained in 10,000infective guinea pig doses of Coxiella burnetii per millilitre” (Enright et al., 1957). Similar titres werefound in milk that had been frozen and thawed. However, the study did not involve testing of allbreeds of dairy cattle, and it is possible that even higher levels of shedding may have occurred in somebreeds that were not examined. Nevertheless, it was concluded that the maximum level of consumerexposure would be represented by the highest infective dose demonstrated in this study and thatthe pasteurisation process should bring about thermal inactivation of such a number (Enright et al.,1957).Risk Management Issues and Control Strategies for Dairy foods: The critical factors having themost significant impact on the safety of processed dairy products are as follows:• The quality of raw materials• Correct formulation• Effective processing• The prevention of recontamination of product• Maintenance of temperature control through the dairy supply chain.Risk ranking of pathogen:Product L. Monocytogenes EHEC Campylobacter S. Aureus TBEVDairy Normal SusceptiblePasteurized Milk Cheese Medium High low low low lowRaw milk cheese Medium High high medium medium lowWhile pathogenic microorganisms may contaminate raw milk supplies, pasteurization is a very effectiveCritical Control Point (CCP) in eliminating pathogens; good manufacturing practices must alsobe employed to ensure that post-pasteurization contamination does not occur. The effectiveness ofpasteurization is dependentupon the microbiologicalstatus of the incomingraw milk. Controlmeasures at the primaryproduction level involveminimizing the likelihoodof microbiologicalhazards contaminatingthe raw milk. This isachieved through theimplementation of afood safety programincorporating goodagricultural practices The relative risk from dairy products may also be expressed graphically as a(GAP). These measures arecontinuum:124

Microbiological Risk Assessment: A New Concept to Ensure Food Safetyeffective in reducing the microbial load of milk being sent for processing.However, should microbial contamination of raw milk occur, it is critical that milk is stored ata temperature that minimizes the opportunity for the bacteria to multiply. Temperature abuse of themilk may allow growth of pathogenic bacteria to the extent where the pasteurization process may noteliminate all pathogenic bacteria and/or toxins. The Aflatoxins can be formed and ingested by dairycattle during feeding, eventually contaminating the milk. Aflatoxin contamination of milk is morecommon where intensive supplementary feeding of dairy herds is conducted.Concluding Remarks: FSOs and POs are new concepts that have been introduced to further assistgovernment and industry in communicating and complying with public health goals. These tools areadditional to the existing programmes of GAPs, GHPs and HACCP which are the means by which thelevels of POs and FSOs will be met. Hence FSOs and POs build on, rather than replace, existing foodsafety practices and concepts.References:Aneja, R. P., B. N. Mathur, R. C. Chandan, A. K. Banerjee, 2002. Technology of Indian Milk Products. A Dairy IndiaPublication, Delhi.Brown G L, Colwell D C and Hooper, W L, ‘An outbreak of Q fever in Staffordshire. Journal of Hygiene, Cambridge 196866 649-655.Codex Committee on Food Hygiene (CCFH, CX/FH 04/5/6), 2004. Proposed draft process by which the committee onfood hygiene could undertake its work in microbiological risk assess-ment/risk management, Alinorm 04/27/13.Derrick E H, ‘”Q” fever, A new fever entity: Clinical features, diagnosis, and laboratory investi-gation. Med J Australia,1937 2 281-299Enright, J. B., Sadler, W. W. and Thomas, R. C. ‘Thermal inactivation of Coxiella burnetii and its relation to pasteurisationof milk’, Public Health Service Publication No. 517. United States Gov-ernment Printing Office, Washington, D C,1957Enright, J. B., Sadler, W. W. and Thomas, R. C. ‘Observations on the thermal inactivation of the organism of Q fever inmilk’, J Milk Food Technol, 1956 10 313-318.Havelaar, A. H., Nauta, M. J., Jansen, J. T., 2004. Fine-tuning food safety objectives and risk as-sessment. InternationalJournal of Food Microbiology 93, 11–29ICMSF, 1998, Principles for the establishment of microbiological food safety objectives and related control measures.Food Control 9, 379-384.ICMSF, 2002. Microorganisms in Foods 7. Microbiological testing in food safety management. Kluwer Academic /Plenum Publishers, New York, USA.Jansson, E., Moir, C., Richardson, K., 1999. Final Report Review of Food Safety Systems devel-oped by the NSW DairyCorporation. Food Science Australia Report.Maurin M and Raoult D, ‘Q Fever’. Clinical Microbiology Reviews, 1999 12 518-553.WHO, 1997. Food Safety and Globalization of Trade in Food, a challenge to the public health sector. WHO/FSF/FOS/97.8 Rev. 1, WHO, Geneva.Zottola, E.A., Smith, L.B., 1991. Pathogens in cheese. Food Microbiology 8, 171-182.125

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance126Biopreservation of Dairy Products: Role ofBacteriocins of Lactic Acid BacteriaR. K. Malik and Gurpreet KaurDairy Microbiology Division, NDRI, KarnalIn spite of modern advances in technology, the preservation of foods is still a debated issue, notonly for developing countries (where implementation of food preservation technologies are clearlyneeded) but also for the industrialized world. Amelioration of economic losses due to food spoilage,lowering the food processing costs and avoiding transmission of microbial pathogens through thefood chain while satisfying the growing consumers demands for foods that are ready to eat, freshtasting,nutrient and vitamin rich, and minimally-processed and preserved, are major challenges forthe food industry. The extent of microbiological problems in food safety was clearly reflected in theWHO food strategic planning meeting (WHO, 2002):• The emergence of new pathogens and pathogens not previously associated with foodconsumption is a major concern;• Microorganisms have the ability to adapt and change, and changing modes of food production,preservation and packaging have, therefore, resulted in altered food safety hazards.The consumers in the developed world often question the safety of the thousands of non-foodpreservatives and other additives that are incorporated in food. It has also encouraged them to voicetheir feelings against the use of these chemicals in foods and also to look for foods that are “natural”,“healthy” and not treated with harsh contaminants. At the same time they are also concerned aboutthe loss of nutritional value of the “harshly processed foods” and the possible health risks of foodpreserved with chemicals.The empirical use of microorganisms and/or their natural products for the preservation of foods(biopreservation) has been a common practice in the history of mankind (Ross et al., 2002). Foodfermentations have a great economic value and it has been accepted that these products contributein improving human health. Lactic Acid Bacteria (LAB) have contributed in the increased volume offermented foods world wide especially in foods containing probiotics or health promoting bacteria.Potential risk from psychrotrophic pathogenic and spoilage organismsUntil relatively recently it was assumed that refrigeration at or below 4 o C was sufficient to preventthe growth of infectious and toxigenic food borne organisms. However, this assumption has changedwith the reports that several food borne pathogens are psychotrophs e.g. Listeria monocytogenes,Yesinia enterocolitica, Aeromonas hydrophila, some enterotoxigenic E. coli and Clostridium botulinumB & E. Moreover, it has been often observed that during distribution and before consumption ofrefrigerated foods, some temperature abuse may occur which may permit conditions for the growthof several other pathogens that can grow at 5 and 12 o C. (Del Giudice, 1991; Snyder et al., 1991). Longstorage of refrigerated foods, even at low temperatures will allow the psychrotrophic and spoilagemicroorganisms to multiply and reach a high level even from a very low initial population.Safety concerns of the chemical preservativesThe consumers’ preference for the refrigerated foods that do not contain any preservative(s) isbased on their perception of these foods to be nutritious, healthy and closed to natural as opposed toharshly processed and chemically preserved foods. This is because the safety of some preservativesas well as some other additives has been questionable such as NO 2, sulphides, sodium diacetate, betapropiolactones and therapeutic antibiotics. Reports on possible health hazard from the consumptionof some preservatives and other additives currently being used such as nitrite and saccharine, andadditives previously used but currently not been permitted for use such as cyclomate and some dyeshave shaken the faith of consumers, thus prompting them to question the safety and wholesomeness

Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid Bacteriaof food they eat.Antimicrobial chemical preservatives inhibit or retard the growth of spoilage and pathogenicmicroorganisms and are used to enhance the safety and shelf life of foods. They produce theirantimicrobial effect by interfering with the structural and functional components of microorganisms.Their effectiveness is dependant on the type of chemical, the concentration of chemicals used, themicroorganism present, the type of microorganisms and their physiological state (vegetative cell orspore), the composition and pH of food, and the temperature and duration of storage. Moreover, inrecent years the chemicals used in food items have increased exponentially to several thousands. Theeffect of actual consumption of these chemicals in multiple products over substantial length of timeshould be an important consideration in judging their safety.Therefore, the basis of selection of antimicrobial biopreservatives to be used in foods should notonly be their effectiveness against both Gram positive and Gram negative pathogens and spoilageorganisms and other desired characteristics of preservatives but also their proven safety recordsand their acceptance by the health conscious consumers and health regulatory agencies. Among thecompounds that have generated considerable interest in the recent years are several antimicrobialmetabolites of lactic acid bacteria used to produce, or associated with, fermented foods.Lactic acid bacteriaLactic acid bacteria belong to a group of Gram-positive anaerobic bacteria that excrete lactic acidas their main fermentation product into the culture medium. LAB were among the first organisms tobe used in food manufacturing. Today LAB play crucial role in the manufacturing of fermented milkproducts, vegetables and meat, as well as in the processing of other products such as wine. Lactic acidbacteria which include the genera Lactococcus, Streptococcus, Lactobacillus, Pediococcus, Leuconostoc,and Carnobacterium (Nettles and Barefoot, 1993), play an essential role in food fermentations. The mostimportant contribution of these microorganisms to the product is to preserve the nutritive qualities ofFig.1 Production of various metabolites by a lactic culture including acid, H2O2, diacetyl and bacteriocinthe raw material through an extended shelf life and the inhibition of spoilage and pathogenic bacteria.This is due to competition for nutrients and the presence of inhibitors produced by the starter. TheLactic Acid Bacteria produce an array of antimicrobial substances (such as organic acids, diacetyl,acetoin, hydrogen peroxide, reuterin, reutericyclin, antifungal peptides, and bacteriocins (Holzapfel etal., 1995; El-Ziney et al., 2000; Holtzel et al., 2000; Magnusson and Schnürer, 2001).Bacteriocins of lactic acid bacteriaThere are several examples of the inhibition of spoilage and pathogenic bacteria by LAB. Extensiveinvestigations, over the last few decades, into the antagonistic behaviour of such strains have led tothe identification and characterization of numerous bacteriocins produced by LAB (Jack et al, 1995;127

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceNettles and Barefoot, 1993; Klaenhammer, 1993). Such investigations have led to the discovery of arange of different bacteriocin-producing strains, many of which have potential in food applications.Given the ease with which bacteriocin-producing strains can be isolated from food sources, it is clearthat many of these bacteriocins have been safely consumed for decades and thus it could be arguedthat reintroduction of such cultures should have negligible associated safety or toxicological problemswhen consumed (Kelly et al., 1996).Bacteriocin could be highly advantageous as even in small amount; these peptides are sufficient tokill or inhibit bacteria competing for the same ecological niche or the same nutrient food. Bacteriocinsproduced by bacteria can be defined as biologically active protein and protein complex (proteinaggregates), lipo-carbohydrate proteins, glycoproteins, etc displaying a bactericidal mode of actionexclusively towards Gram positive bacteria and particularly against closely related species. They form aheterogenous group with respect to producing bacterial species, molecular size, physical and chemicalproperties, stability, anti microbial spectrum and mode of action, etc. The bacteriocins produced byLAB are of particular interest to the food industry (Nettles and barefoot, 1993), since these bacteriahave generally been regarded as safe (GRAS status). Moreover, majority of bacteriocin producing LABare natural food isolates, they are ideally suited for food preservation. The production of bacteriocinsby LAB is not only advantageous to the bacteria themselves but could also be exploited by the foodindustry as a tool to control undesirable bacteria in a food grade and natural manner, which is likelyto be more acceptable to consumers.Bacteriocins are antimicrobial peptides or small proteins which inhibit, by a bactericidal orbacteriostatic mode of action, micro-organisms that are usually closely related to the producer strain(De Vuyst and Vandamme 1994; Schillinger and Holzapfel 1996). A bacteriocin producer protectsitself against its own antimicrobial compound by means of a system referred to as immunity, whichis expressed concomitantly with the antimicrobial peptide (Nes et al., 1996). The bacteriocin familyincludes a diverse group of proteins in terms of size, microbial targets, modes of action, and immunitymechanisms. The bacteriocins produced by LAB offer several desirable properties that make themsuitable for food preservation:Inhibitory spectrum of bacteriocins of lactic acid bacteriaIn the original definition of Jacob et al (1953), bacteriocins were characterized by predominate intraspecies killing activity. While this is true for most of the bacteriocins of LAB especially those producedby a large number of lactococci and lactobacilli, others have been found to exhibit a broad range ofinhibitory activity extending across numerous Gram positive bacteria. Thus Klaenhammer (1998)defined two types of bacteriocins of lactic acid bacteria; one type exhibiting a classical bacteriocinantibacterial spectrum affecting only closely related bacteria and the second type effective against awide range of Gram positive bacteria. Inhibition of Gram negative bacteria in their native state has notbeen reported for any of the purified and thoroughly characterized bacteriocins. Similarly, inhibitionof yeast and molds has not been observed.Classification of bacteriocins of lactic acid bacteriaMost LAB bacteriocins are small (< 6 kDa), cationic, heat-stable, amphiphilic, membranepermeabilizingpeptides that may be divided into three main groups: the modified bacteriocins, knownas lantibiotics (Class I), the heat-stable unmodified bacteriocins (Class II), and the larger heat-labilebacteriocins (Class III) as proposed by Klaenhammer (1993). A fourth group (Class IV) with complexbacteriocins carrying lipid or carbohydrate moieties is often included in bacteriocins classifications.Recently a fifth class of circular bacteriocins has been included in the classification scheme with lesseramount of modified amino acids (Table 2).128

Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid BacteriaTable 2. General classification of LAB Bacteriocins. a Category excluded from Nes’classification (Nes et al., 1996) but included in Garneau’s (Garneau et al., 2002)CLASSClass I. LantibioticsClass II. Nonlantibiotics—Unmodifi ed Bacteriocins.CHARACTERISTICS AND SUBCATEGORIESRibosomally synthesized peptides that undergo posttranslational modifi cations.Molecular weight 2– 5 kDa. Contain lanthionine and β-methyl lanthionine.Heat stable peptides formed exclusively by unmodifi ed amino acids.Ribosomally synthesized as inactive pre peptides to get activated byposttranslational cleavage of the N- terminal leader peptide. Molecular weight< 10 kDa.Class III. Nonlantibiotics—Large, Heat-labile proteins. Molecular weight >30 kDa.Heat-labile Bacteriocins.Class IVaComplex bacteriocins carrying lipid or carbohydrate moietiesClass V Circular BacteriocinsBacteriocins of LAB as potentialfood biopreservativesThe term “biopreservative” includes theantimicrobial compounds that are of plant,animal and microbial origin and have beenused in human food for long time, withoutany adverse effect on human health. Theyare used to enhance safety and extendshelf life of food and can thus be regardedas “biopreservatives”. Fermented foodsare good examples of biopreserved foodsin which the starter cultures are allowedto grow so that they can produce antimicrobial metabolites. In fermentation theraw materials are converted by desirableFig 2. Influence of different factors on the efficacy of in situ bacteriocinproduction for biopreservation. (Galvez et al., 2007)microorganisms such as bacteria, yeast and molds to products that have acceptable qualities of food.In controlled fermentation, the starter cultures are added to the raw material in large number andthen incubated under conditions to stimulate the growth and production of desirable products. Anexample of food produced by controlled fermentation is yoghurt in which Lactobacillus bulgaricusand Streptococcus thermophilus are added to achieve the fermentations. The lactic acid and othermetabolites produced by these desirable bacteria in ‘Sauerkraut’ and yoghurt prevent the growthof undesirable microorganisms present in the non sterile raw materials and make the products shelfstable. (Ray, 1992)Biopreservation by bacteriocins of LABThe small heat-stable bacteriocins of lactic acid bacteria have been recognized as perhaps themost promising entities for use in applications of food preservation for a number of reasons. Theyare widely distributed and established as food-grade bacteria and often have a suitable spectrumof bacterial targets, for example, strains of Listeria, Clostridium and other Gram-positive bacteriaincluding LAB. Furthermore, these Bacteriocins can endure harsh treatments, such as boiling, withoutloosing much of their activity.Bacteriocins produced by lactic acid bacteria have received particular attention in recent yearsdue to their potential application in the food industry as natural preservatives. This trend reflects theincreasing consumer awareness of the risks derived not only from food borne pathogens, but alsofrom the artificial chemical preservatives used to control them (Abee et al., 1994). Some bacteriocinshave well established their action as potential antimicrobial and also their possible applications in food129

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancepreservation systems. Nisin A already showed effective inhibitory activity on the Listeria monocytogenesgrowth in cheese up to eight weeks. Enterocin, when inoculated in ham, pig meat, meat chicken, andsausage, showed inhibitory capacity on the L. monocytogenes growth. Lactocin also had inhibitorycapacity on the same microorganism, when applied in ground meat (Vignolio et al., 1996; Davies, 1999;Aymerich et al., 2000). There are numerous applications of nisin as food preservative, including shelflifeextension of dairy products, canned foods, vacuum-packed meat and cold smoke salmon (Hurst,1981; Davies, 1999; Nilsson et al., 2000).Nisin presents almost all the desirable characters of a potential biopreservative like:1. It is non toxic2.3.4.5.130It is natural and safe (produced by Lactococcus lactis having GRAS status)Heat and storage stableIt can be degraded by digestive enzymes so pose no harmful side-effect to humanIt does not confer any undesirable taste and flavor to foods andIt show prominent antimicrobial spectrum against Gram-positive microorganisms (Kominsky, 1999;Fiorentini et al., 2001).The accumulation of studies carried out in recent years clearly indicate that the application ofbacteriocins in food preservation can offer several benefits, still the use of food grade bacteriocinsas biopreservative is in its infancy. Civilization has reaped the benefits of Bacteriocins unknowinglyfor 1000s of years, yet nisin is the only bacteriocin bio-preservative that has received acceptance incountries worldwide. Among the major bacteriocins apart from nisin, pediocin, acidocin, bavaracin,curavaticin, and sakacin, can be other alternatives though there is need to well characterize themwith respect to their use in food preservation along with safety issues associated with them. Nisinis the single bacteriocin commercially used as natural agent of food conservation (biopreservation)and considered safe by World Health Organization (WHO) and has received the denomination ofGenerally Recognized as Safe (GRAS) and also by Food and Drug Administration (FDA). Nisin isproduced by Lactococcus lactis subsp. lactis and is used in various countries (Abee et al., 1994).Dairy ProductsNisin is used in pasteurized, processed cheese products to prevent outgrowth of spores suchas those of Clostridium tyrobutyricum that may survive heat treatments as high as 85–105°C. Use ofnisin allows these products to be formulated with high moisture levels and low NaCl and phosphatecontents, and also allows them to be stored outside chill cabinets without risk of spoilage. The level ofnisin used depends on food composition, likely spore load, required shelf life and temperatures likelyto be encountered during storage. (Hirsch et al., 1951).Nisin is also used to extend the shelf life of dairy desserts which cannot be fully sterilized withoutdamaging appearance, taste or texture. Nisin can significantly increase the limited shelf life of suchpasteurized products.Nisin is added to milk in the Middle East where shelf-life problems occur owing to the warm climate,the necessity to transport milk over long distances and poor refrigeration facilities. It can double theshelf life at chilled, ambient and elevated temperatures and prevent outgrowth of thermophilic heatresistantspores that can survive pasteurization. It can also be used in canned evaporated milk.Canned foodsNisin may also be added to canned foods at levels of 100–200 IU g –1 to control thermophilic sporeformerssuch as Bacillus stearothermophilus and Clostridium thermosaccharolyticum which may survive andgrow in canned foods stored at high temperatures. It also allows a reduction in heat processing requiredwithout compromising food safety. It is used in canned potatoes, peas, mushrooms, soups, and cerealpuddings. It increased activity at acid pH levels makes it ideally suitable in low pH foods such as cannedtomatoes, to inhibit acid-tolerant spoilage flora such as B. macerans and C. pasteurianum. (Eckner, 1992).

Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid BacteriaMeatConcern about the toxicological safety of nitrite used in cured meat has led to investigation into theuse of nisin to allow a reduction in nitrite levels. However, uneconomically high levels are requiredto achieve good control of Clostridium botulinum, perhaps as a consequence of nisin binding to meatparticles, uneven distribution, poor solubility in meat systems, or possibly interference in activity bymeat phospholipids. (Nielson et al., 1990; Eckner, 1992).CerealsLittle research has been conducted on the use of bacteriocins in cereal or cereal related products.Delves- Broughton (1996) discussed the use of bacteriocins in cereal puddings. Another possibleuse could be foreseen in pasta. Pasta dough is susceptible to contamination and growth of S. aureus.Bacteriocins, with their activity against Gram positive microbes, may be able to inhibitgrowth of thispathogen in the dough. (Eckner, 1992).WineThe insensitivity of yeasts to nisin allows its use to control spoilage lactic acid bacteria in beer orwine. It can maintain its activity during fermentation without any effect on growth and fermentativeperformance of brewing yeast strains and with no deleterious effect on taste. It can therefore be usedto reduce pasteurization regimens and to increase shelf life of beers. It has similar applications in wineexcept for those that require a desirable malolactic fermentation. However, nisin-resistant bacterialstarter cultures such as resistant strains of Leuconostoc oenos, in conjunction with nisin, can be used toactually control the malolactic fermentation. Nisin may also be used to reduce the amount of sulphurdioxide used in winemaking to control bacterial spoilage. (Todorov et al., 2003).Pediocin-like bacteriocinsPediocin-like bacteriocins are members of the Class II bacteriocins, a group of bacteriocins inwhich there is considerable commercial interest. They are small, heat-resistant peptides that are notpost-translationally modified to the same extent as the Class I bacteriocins, apart from the cleavageof a leader sequence from a double glycine site upon export of the bacteriocin from the cell, and thepresence of disulphide bridges in some molecules. All of the pediocins share certain features,includinga seven amino acid conserved region in the N-terminal of the active peptide (-Tyr-Gly-Asn-Gly-Val-Xaa-Cys-). Perhaps the best-known is pediocin PA-1, which is produced by Pediococcus acidilactici. Acommercial formulation has been introduced under the trade name ALTA. Pediococci are importantin the fermentation of vegetables and meat for both acid production and flavour development. Thepediocin-like bacteriocins (which are also produced by genera other than the pediococci) are activeagainst other lactic acid bacteria but are particularly effective against Listeria monocytogenes, a foodbornepathogen of increasing concern to the food industry. Listeria may be found in raw milk,dairy products, vegetables and meat products and can grow under conditions such as refrigerationtemperatures (growth has been reported at temperatures as low as –1°C), high salt concentrations (upto 10%), low pH (pH 5.0), and high temperatures (44°C). Pediocin PA-1 has been observed to inhibitListeria in dairy products such as cottage cheese, ice cream, and reconstituted dry milk. It has alsobeen demonstrated as a biocontrol agent on meat systems. In situ production in dry fermented sausageinhibits L. monocytogenes throughout fermentation and drying, possibly owing to a combination of thereduction in pH and bacteriocin production. Pediococcus acidilactici is also used as a low-level inoculumin reduced-nitrite bacon to prevent the outgrowth of Clostridium botulinum spores and subsequenttoxin production.Potential uses for other bacteriocinsAs more and more bacteriocin producers are being isolated and characterized, usuallyfrom food environments, the potential for their use increases. Lactobacillus plantarum producesplantaricins S and T in the Spanish-style green olive fermentation. Many traditional Africanfoods are fermented by lactic acid bacteria before consumption. Naturally occurring bacteriocin-131

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceproducing strains in these products may have the potential to improve the quality and shelf lifeof other African fermented foods which are often plagued by problems such as inconsistentquality, hygienic risks and premature spoilage.Other bacteriocins which have been isolated from food environments include plantaricin F, fromchilled processed channel catfish; acidocin B, produced by Lactobacillus acidophilus with a narrowspectrum of activity which includes Clostridum sporogenes and a narrow range of other lactobacilli;and salivaricin B, produced by Lactobacillus salivarus with a very broad host range including Listeriamonocytogenes, Bacillus cereus, Brochothrix thermosphacta, Enterococcus faecalis and many lactobacilli,which may have a more widespread application. Another recently identified bacteriocin with abroad host range similar to that of nisin is lacticin 3147, produced by a strain of Lactococcus lactis.Since lacticin 3147 is also an effective inhibitor of many Gram-positive food pathogens and spoilagemicroorganisms, these starters may provide a very useful means of controlling the proliferation ofundesirable microorganisms during Cheddar cheese manufacture.Microgard (Wesman Foods Inc., USA) is commercially produced from grade A skim milkfermented by a strain of Propionibacterium shermanii, and has a wide antimicrobial spectrum includingsome Gram-negative bacteria, yeasts and fungi. This product is added to 30% of the cottage cheeseproduced in the USA as an inhibitor against psychrotrophic spoilage bacteria. It is added to a varietyof dairy products such as cottage cheese and yoghurt and a nondairy version is also available for use inmeat and bakery goods. The inhibitory activity almost certainly depends primarily on the presence ofpropionic acid, but there has also been a role proposed for a bacteriocin-like protein produced duringthe fermentation. This use of milk fermented by a bacteriocin producer as an ingredient in milk-basedfoods may be a useful approach for introducing bacteriocins into foods at little cost.Bacteriocins and hurdle technologyHurdle technology refers to the manipulation of multiple factors (intrinsic and extrinsic) designed toprevent bacterial contamination or control growth and survival in food. A combination of preservationmethods may work synergistically or at least provide greater protection than a single method alone,thus improving the safety and quality of a food. While in certain foods intrinsic properties such as highsalt may provide adequate protection, the conscious addition of an extra hurdle(s) can ensure safety.(Leistner, 2000)The concept of hurdle technology began to apply in the food industry in a rational way after theobservation that survival of microorganisms greatly decreased when they were confronted with multipleantimicrobial factors (Leistner, 1978; Leistner and Gorris, 1995; Leistner, 2000). Over 60 potentialhurdles have been described to improve food stability and/or quality (Leistner, 1999). The application ofbacteriocins as part of hurdle technology has received great attention in recent years (Chen and Hoover,2003; Ross et al., 2003; Deeganet al., 2006), since bacteriocinscan be used purposely incombination with selectedhurdles in order to increasemicrobial inactivation (Fig3). The combination ofhurdles to be applied willdepend greatly on the typeof food and its microbialcomposition. This must becarefully considered, sincedifferent hurdles usuallyhave different effects onthe members of a microbialcommunity.Fig 3. Application of bacteriocins as part of hurdle technology.132

Biopreservation of Dairy Products: Role of Bacteriocins of Lactic Acid BacteriaAntimicrobial packagingBio-active packaging is a further potential application in which bacteriocins can be incorporatedinto packaging destined to be in contact with food. This system combines the preservation function ofbacteriocins with conventional packaging materials, which protects the food from external contaminants.Spoilage of refrigerated foods usually begins with microbial growth on the surface, which reinforcesthe attractive use of bacteriocins being used in conjunction with packaging to improve food safety andimprove shelf-life (Collins-Thompson & Hwang, 2000). Bio-active packaging can be prepared by directlyimmobilizing bacteriocin to the food packaging, or by addition of a sachet containing the bacteriocininto the packaged food, which will be released during storage of the food product. Studies investigatingthe effectiveness of bio-active cellulose- based packaging inserts and a vacuum packaging pouch madewith polyethylene/polyamide to improve shelflife and safety aspects have proved promising. Whenconsidering bio-active packaging, the stability and the ability to retain activity while immobilised to thepackaging film is of vital importance.While many LAB bacteriocins possess significant antimicrobial qualities that could greatly enhancethe safety of a food, it may yet emerge that industrially they will be most frequently applied as a ‘finalhurdle’in a food system where another hurdle(s) already exists to eliminate pathogens and spoilersthat survive only in adventitious circumstances.Bacteriocin resistance among pathogens and food spoilage bacteriaAlthough the use of bacteriocins for preservation is a novel approach to eliminating or controllingpathogens in food, the development of highly tolerant or resistant strains remains the main concernand decreases the efficiency of bacteriocins as biopreservatives. Resistant food-borne pathogens areposing a global problem which is further facilitated by international trade of raw and processed foods.In foods with a long shelf life, even a small number of these resistant cells can multiply to very highnumber and thus may lead to food-borne outbreaks and food spoilage.Future prospectsA large number of bacteriocins from LAB have been characterized to date, and many differentstudies have indicated the potential usefulness of bacteriocins in food preservation. Bacteriocins are adiverse group of antimicrobial proteins/peptides, and, therefore, are expected to behave differently ondifferent target bacteria and under different environmental conditions. Since the efficacy of bacteriocinsin foods is dictated by environmental factors, there is a need to determine more precisely the mosteffective conditions for application of each particular bacteriocin. Bacteriocinogenic cells may also actas living factories in foods. The antimicrobial effects of bacteriocins and bacteriocinogenic culturesin food ecosystems must be understood in terms of microbial interactions. Among the food bornepathogens, knowledge of the characteristics of bacteriocin resistant variants and the conditions thatprevent their emergence will help in determining the optimal conditions for application of bacteriocinsin foods and minimize the incidence of resistance.ReferencesAbee T., Rombouts FM., Hugenholtz J., Guihard G., and Letellier L. 1994. Mode of action of nisin Z against Listeriamonocytogenes Scott A grown at high and low temperatures. Applied Environmental Microbiology, 60, 1962-1968.Aymerich T., Garriga M., Ylla J., Vallier J., Monfort JM., and Hugas M. 2000. Effect of sausage ingredients and additiveson the production of enterocin A and B by Enterococcus faecium CT492. Optimization of in vitro production andanti-listerial effect in dry fermented sausages. Journal of Applied Microbiology, 88, 686-694.Chen H., and Hoover DG. 2003. Bacteriocins and their food applications. Comprehensive Reviews in Food Science andFood Safety, 2, 82–100.Collins-Thompson D., and Hwang CA. 2000. Packaging with antimicrobial properties. In Robinson RK., Batt CA.,andPatel PD. (eds.), Encyclopedia of food microbiology,. Academic press, London, UK, Pp. 416–420.Davies EA. 1999. Effective use of nisin to control lactic acid bacterial spoilage in vacuum-packed bologna-type sausage.Journal of Food Protection, 9, 1004-1010.Deegan LH., Cotter PD., Hill C., and Ross P., 2006. Bacteriocins: biological tools for bio-preservation and shelf-lifeextension. International Dairy Journal, 16, 1058–1071.Del Giudice, VJ. 1991. We must need the 21st century standards, Natl. Provisioner, 204 (6), 12133

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceDelves-Broughton, J., Blackburn, P., Evans, RJ. and Hugenholtz, J. 1996. Applications of the bacteriocin, nisin. AntonieLeeuwenhock, 69: 193-202.DeVuyst L. and Vandamme E. 1994. Bacteriocins of Lactic acid bacteria: microbiology, genetics and application.Chapman & Hill Ltd., London, UK.Eckner KF. Bacteriocins and food applications. 1992. Dairy Food and Environment Sanitation,12 (4), 204-209El-Ziney MG., Debevere J., and Jakobsen M. 2000. Reuterin. 2000. In: Naidu AS. (ed.), Natural Food Antimicrobial Systems,CRC Press, London, Pp. 567–587.Fiorentini, AM., Ernani SS., Porto ACS., Jaciara ZM., and Franco BDGM. 2001. Influence of bacteriocins produced byLactococcus plantarum BN in the shelf-lie of refrigerated bovine meat. Brazilian Journal of Microbiology, 32, 42-46Gálvez A., Abriouel H., López ., and Ben Omar N. 2007. Bacteriocin-based strategies for food biopreservation, Int. J.Food Microbiol. 120, 51–70.Hirsch A., Grimstead E., Chapman HR., and Mattic ATR. 1951. A note on the inhibition of an anaerobic sporeformer inSwiss cheese by a nisin producing streptococcus, Journal of Dairy Science, 18, 205-206Holtzel A., Ganzle MG., Nicholso, G.J., Hammes W.P., and Jung G. 2000. The first low-molecular-weight antibiotic fromlactic acid bacteria: reutericyclin, a new tetramic acid. Angewandte Chemie, International Edition, 39, 2766–2768.Holzapfel WH., Geisen R., and Schillinger U. 1995. Biological preservation of foods with reference to protective cultures,bacteriocins and food-grade enzymes. International Journal of Food Microbiology, 24, 343–362.Hurst A. 1981. Nisin. Applied Microbiology, 27, 85-122.Jack RW., Tagg JR. and Ray B. 1995 Bacteriocins of Gram-Positive Bacteria. Microbiology Reviews, 59, 171-200.Jacob F., Lwaff A., Siminonvich A., and Wallman E. 1953. Definition de qualques terms relatifs à la lysogenie. Annalesde Institut Pasteur, 84, 222-224.Kelly WJ., Asmundson RV., and Huang CM. 1996. Isolation and characterization of bacteriocin-producing lactic acidbacteria from ready-to-eat food products. International Journal of Food Microbiology, 33, 209–218.Klaenhammer TR. 1993. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiology Reviews, 12,39–86.Klaenhammer TR.1998. Bacteriocins of lactic acid bacteria, Biochimie 70, 337–349.Kominsky GMR. 1999, Avaliação da sensibilidade de microrganismos selecionados a diferentes concentrações de nisinaem salsichas comuns e de frango. Higiene Alimentar, 13, 56-62.Leistner L. 1978. Hurdle effect and energy saving. 1978 In: Downey, WK. (ed.), Food Quality and Nutrition. AppliedScience Publishers, London, UK, Pp. 553–557.Leistner L. 1999. Combined methods for food preservation. 1999 In: Shafiur Rahman M. (ed.), Handbook of FoodPreservation. Marcel Dekker, New York, Pp. 457–485.Leistner L. 2000. Basic aspects of food preservation by hurdle technology. International Journal of Food Microbiology, 55,181–186.Leistner L., and Gorris LGM. 1995. Food preservation by hurdle technology. Trends in Food Science & Technology, 6,41–46.Magnusson J., and Schnürer J. 2001. Lactobacillus coryniformis subsp. coryniformis strain Si3 produces a broadspectrumproteinaceous antifungal compound. Applied and Environmental Microbiology, 67, 1–5.Nes IF., Bao Diep D., Havarstein LS., Brurberg MB., Eijsink V., Holo H. 1996. Biosynthesis of bacteriocins of lactic acidbacteria. Antonie van Leeuwenhoek 70, 113-128.Nettles CG., and Barefoot SF. 1993 Biochemical and genetic characteristics of bacteriocins of food-associated lactic acidbacteria. Journal of Food Protection, 56, 338-346.Nielsen JW., Dickson JS., and Crouse JD. 1990. use of bacteriocin product by Pediococcus acidilactici to inhibit Listeriamonocytogenes associated with fresh meat, Applied and Environmental Microbiology, 56, 2142-2145Nilsson L., Chen Y., Chikindas ML., Huss HH., Gran L., and Monteville TJ. 2000.Carbon dioxide and nisin actsynergistically on Listeria monocytogenes. Applied and Environmental Microbiology, 66, 769-774.Ray B., and Daeschel MA. 1992. Food Biopreservatives of Microbial Origin. CRC Press, Boca Raton, FL.Ross AIV., Griffiths MW., Mittal G.S., and Deeth HC. 2003. Combining on thermal technologies to control foodbornemicroorganisms. International Journal of Food Microbiology, 89, 125–138.Schillinger, U. and Holzapfel, W.H. 1996. Guidelines for manuscripts on bacteriocins of lactic acid bacteria. Int. J. FoodMicrobiol., 33: 3–5.Snyder, op., and Poland, DM. 1991. America’s safe food-Part II, Dairy Food Environment Sanit., 11, 14Todorov S., Vaz-Velho M., and Dicks LMT. 2003. Isolation and partial characterization of bacteriocins produced by fourlactic acid bacteria isolated from traditional South African Beer. Electronic Journal of Environmental and AgriculturalFood Chemistry, 2(4), 1-6.Vignolio G., Fadda S., Kairuz MN., Ruizholgado AA., and Oliver G. 1996. Control of Listeria monocytogenes in groundbeef by lactocin 705, a bacteriocin produced by lactobacillus casei CRL 705. International Journal of Food Microbiology,29, 3997-4002.WHO. 2002. Food safety strategic planning meeting: report of a WHO strategic planning meeting, WHO headquarters,Geneva, Switzerland.134

Regulatory Aspects of Functional FoodsIntroduction:Regulatory Aspects of Functional FoodsBimlesh mann , Rajesh Kumar and Prerna SainiDairy Chemistry Division, NDRI, KarnalThe term “Functional Foods” was first introduced in Japan in the mid-1980s and refers to processedfoods containing ingredients that aid specific body functions, in addition to being nutritious. Currently,there is no universally accepted term for functional foods. A variety of terms have appeared worldwidesuch as nutraceuticals, medifoods, vita foods and the more traditional dietary supplements andfortified foods. However, the term Functional foods have become the predominant one even thoughseveral organizations have attempted to differentiate this emerging food category. Consumer interest inthe relationship between diet and health has increased substantially. There is much greater recognitiontoday that people can help themselves and their families to reduce the risk of illness and disease andto maintain their state of health and well being through a healthy lifestyle, including the diet. Ongoingsupport for the important role of foods such as fruits and vegetables and wholegrain cereals in diseaseprevention and the latest research on dietary antioxidants and combinations of protective substancesin plants has helped to provide the impetus for further developments in the functional food market.Current research suggests that functional foods can make a positive contribution to addressing thosechallenges. Behind functional food research and development, the key drivers are the food industry,consumers and governments. The growth of the functional foods sector not only represents significantbenefits to the health sector but also offers opportunities for processing and manufacturing companies.Manufacturers and their search for added-value, higher margin products provided key impetusfor the growth of functional products. However, the potential for financial gain resulted in manyunsupported claims for functional ingredients by commercial enterprises whose interests lie more inprofit rather than sound science. As a result, the functional foods field has been tarnished and suffers acredibility gap. Many academic, scientific and regulatory organizations are actively working on waysto establish the scientific basis to support claims for functional components or the foods containingthem. Any regulatory framework will need to protect consumers from false and misleading claimsand to satisfy the needs of industry for innovation in product development, marketing and promotion.For functional foods to deliver their potential public health benefits, consumers must have a clearunderstanding of, and a strong confidence level in, the scientific criteria that are used to documenthealth effects and claims. As interest in this category of foods has grown, new products have appearedand interest has turned to the development of standards and guidelines for the development andpromotion of such foods.Existing national and international regulatory systems governing theproduction and distribution of functional foods:WHO (1991) published a seminal report “Guidelines for the Assessment of Herbal Medicines”which set out “to define basic criteria for the evaluation of quality, safety and efficacy” of all herbal(including mushrooms) medicines. “As a general rule in this assessment, traditional experience meansthat long-term use as well as the medical, historical and ethnological background of those productsshall be taken into account.” Depending on each country’s situation, “the definition of long-term usemay vary, but would be at least several decades … Prolonged and apparently uneventful use of asubstance usually offers testimony of its safety”. The Guidelines call for various assessments of quality,efficacy and the intended use, and reference should be made to pharmacopoeia monographs wherethey exist. If none exist, then the manufacturer should be required to produce a similar statement.Procedures should all correspond to Good Manufacturing Practices and include stability testing of thefinal product as packaged. With regard to safety “A guiding principle should be that if the product hasbeen traditionally used without demonstrated harm, no specific restrictive regulatory action shouldbe undertaken unless new evidence demands a revised risk-benefit assessment” (Alkerele, 1992).135

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIt is recommended that consumer product information should include a quantitative list of activeingredients, dosage, dosage form, indications, mode of administration, duration of use, any majoradverse effects, contraindications, warnings, etc. (Wasser et al., 2000a). In this article the preliminaryrecommendations by FAO about regulation of functional foods followed by an overview of thefunctional foods regulatory systems of Europe, USA, Canada, Australia, Japan , other Asian countriesand guidelines of Codex Alimentarius as well as food safety act 2006 (India) are presented.Some preliminary recommendations:Some recommendations have previously been made by FAO (FAO, 2004).1. Functional foods should be clearly defined:An international definition for functional foods should be adopted: Functional foods should be “afood similar in appearance to a conventional food (beverage, food matrix), consumed as part of theusual diet which contains biologically active components with demonstrated physiological benefitsand offers the potential of reducing the risk of chronic disease beyond basic nutritional functions”;• An international database from dietary active compounds should be encouraged:• The basic principles for the addition of dietary active compounds in foods could be based on theprinciples for the addition of essentials nutrients to foods as stated by the Codex AlimentariusCommission:2. Health claims vs structure/functions claims vs nutrition claims should be clearly defined• Nutrition Claims could be referred to what the product contains;• Health Claims: could be related to what the food or food components does or do. The CodexAlimentarius guidelines for use of nutrition and health claims in foodlabelling should beencouraged.3. Health claims should require scientific validation and substantiation Substantiation of a claimshould be based on human data using rigorous scientific protocols:• There is a need to define guidelines for safety and efficacy assessment of functional foods.EUROPE :In December 2006, the regulation on the use of nutrition and health claims for foods was adoptedby the Council and Parliament of Europe.For the purposes of this regulation, the following definitions have been proposed:• “Claim”: any message or representation, which is not mandatory under Community or nationalLegislation, including pictorial, graphic or symbolic representation, in any form, which states,suggests or implies that a food has particular characteristics;• “Nutrition claim”: means any claim which states, suggests or implies that a food has particularbeneficial nutritional properties due to: a) the energy (calorific value) it (i) provides; (ii) providesat a reduced or increased rate; or (iii) does not provide; and/or b) the nutrients or other substancesit (i) contains; (ii) contains in reduced or increased proportions; or (iii) does not contain;• “Health claim”: means any claim that states, suggests or implies that a relationship existsbetween a food category, a food or one of its constituents and health;• “Reduction of disease risk claim”: means any health claim that states, suggests or implies thatthe consumption of a food category, a food or one of its constituents significantly reduces a riskfactor in the development of a human disease.• European Agencies: European Commission, European Food Safety Authority (EFSA), EuropeanFood Information Council (EUFIC) and International Life Sciences Institute (ILSI)• USA: Currently, Food and Drug Administration (FDA) has neither a definition nor a specificRegulatory rubric for foods being marked as “functional foods”, they are regulated under the136

Regulatory Aspects of Functional Foodssame regulatory framework as other conventional foods under the authority of the Federal FoodDrug and Cosmetic Act. There are three categories of claims that can be used on food:• Health Claims - Health claims describe a relationship between a food substance and a disease orhealth-related conditions. There are three sets of legislation by which FDA exercises its oversightin determining which health claims may be used on a label or in labeling for a food or dietarysupplement:• NLEA Authorized Health Claims – Under the provisions of the Nutrition Labeling and EducationAct (NLEA) of 1990, the Dietary Supplement Act of 1992, and the Dietary Supplement Healthand Education Act of 1994 (DSHEA), FDA may authorize a health claim for a food or dietarysupplement based on an extensive review of the scientific literature, generally as a result of thesubmission of a health claim petition, using the significant agreement standard to determine thenutrient/disease relationship is well established• Health Claims Based on Authoritative Statements – Under the 1997 Food and DrugAdministration Modernization Act (FDAMA), a health claim may be authorised for a foodbased on an authoritative statement of a scientific body of the U.S. government or the NationalAcademy of Sciences. FDA has prepared a guide on how a firm can make use of authoritativestatement-based health claims on food• Qualified Health Claims – FDA’s 2003 Consumer Health Information for Better NutritionInitiative provides for the use of qualified health claims when there is emerging evidence fora relationship between a food, food component, or dietary supplement and reduced risk of adisease or health-related condition.• Nutrient Content Claims - The Nutrition Labelling and Education Act of 1990 (NLEA) permitsthe use of label claims that characterize the level of a nutrient in a food (i.e., nutrient contentclaims) made in accordance with FDA’s authorizing regulations.• Structure/Function Claims - Structure/function claims have historically appeared on the labels ofconventional foods and dietary supplements as well as drugs. However, the Dietary SupplementHealth and Education Act of 1994 (DSHEA) established somespecial regulatory procedures forsuch claims for dietary supplement labels. Manufacturers of dietary supplements that makestructure/function claims on labels or in labelling must submit a notification to FDA no laterthan 30 days after marketing the dietary supplement that includes the text of the structure/function claim.• Agencies: The Food and Drug Administration (FDA), American Heart Association (AHA), TheInstitute of Medicine (IOM).CANADA:• In Canada, Health Canada regulates the functional foods and nutraceutical industry and theCanadian Food Inspection Agency enforces these regulations. Within Health Canada’s HealthProducts and Food Branch, the Food Directorates regulates functional foods, while the NaturalHealth Products Directorate regulates other natural health products including vitamins, minerals;herbal remedies; homeopathic medicines; traditional medicines such as traditional Chinesemedicines; probiotics, and other products like amino acids and essential fatty acids. Briefly, theterm “health claim”is not defined in Canada but currently, there are 3 types of nutrition claimsallowed:• Nutrient Content Claims- Nutrient content claims are the simplest label statement as theyidentify/quantify the amount of a nutrient contained in a food. In addition, comparativenutrient content claims (e.g. reduced, less, light) are allowed based on thestandardized referenceamount.• Biological Role/ Structure Function Claims – The second category of nutrition claims are referredto as biological role or structure/function claims. Biological role claims are for nutrients, not a137

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancefood containing the nutrient. These statements identify the generally recognized function of anutrient as an aid in maintaining the functions of the body necessary for the maintenance ofgood health, or for normal growth and development.• Risk Reduction Health Claims – Health Canada began to consider the possibility of risk reductionclaims for foods in 1999, by reviewing the ten U.S. approved health claims. In 2003, the Foodand Drug Regulations were amended to introduce the first series of authorized health claimsin Canada. In the meantime Health Canada developed a proposed regulatory framework forproduct-specific authorization of health claims In Canada, the most of nutraceuticals fall underthe Natural Health Products Regulations of the Food and Drugs Act which came into effect onJanuary 1, 2004. In addition, a compliance policy is in place to ensure the safety of Canadiansuntil all natural health products have undergone Health Canada’s approval process.• Agencies: Health Canada, the Canadian Food Inspection AgencyJAPAN:The Japanese Ministry of Health, Labour, and Welfare (MHLW) set up ‘Foods for Specified HealthUse’ (FOSHU) in 1991 as a regulatory system to approve the statements made on food labels concerningthe effect of the food on the human body. FOSHU refers to foods containing ingredient with functionsfor health and officially approved to claim its physiological effects on the human body. The regulatoryrange of FOSHU was broadened in 2001 to accept the forms of capsules and tablets in addition tothose of conventional foods. FOSHU increased the total to about 330 items in January 2003. In April2001, the MHLW enacted a new regulatory system, ‘Foods with Health Claims’, which consists of theexisting FOSHU system and the newly established ‘Foods with Nutrient Function Claims’ (FNFC).FNFC refers to all food that is labeled with the nutrient function claims specified by the MHLW.The labelling of functional foods should always be based on scientific evidence and be in harmonywith international standards. The nutrient–function claim was adopted in the guidelines for nutritionclaims by the Codex Alimentarius in 1997. The claims of the Japanese FNFC are equivalent to thenutrient function claims standardized by The Codex Alimentarius.• Agencies: Ministry of Health, Labour and WelfareOther asian countries:Recently, the Asian-Pacific Network for Food and Nutrition (ANFN) of the FAO regional office forAsia and the Pacific held its regional expert consultation on functional foods and their implications inthe daily diet and published a report on the development and status of Functional foods in differentasian countries including China, India, Bangladdesh, Indonesia, Nepal, Malaysia, Philippines,Thailand, Sri Lanka, and Vietnam (FAO, 2004). In Korea, the term “health/functional food” (HFF)refers to food supplements containing nutrients or other substances (in a concentrated form) that havea nutritional or physiological effect whose purpose is to supplement the normal diet. The KoreanHealth/Functional Food Act that came into effect in 2004 requires these products to be marketed inmeasured doses, such as in pills, tablets, capsules, and liquids.Codex Alimentarius: The Codex Alimentarius Commission (CAC) was created in 1961/62 byFood and Agriculture Organization of the United Nations (FAO) and the World Health Organization(WHO), to develop food standards, guidelines and related texts such as codes of practice under theJoint FAO/WHO Food Standards Programme. The main purpose of this Programme is to protectthe health of consumers, ensure fair practices in the food trade, and promote coordination of all foodstandards work undertaken by international governmental and non-governmental organizations.“Codex India” the National Codex Contact Point (NCCP) for India, is located at the DirectorateGeneral Of Health Services, Ministry of Health and Family Welfare (MOH&FW), Government ofIndia. It coordinates and promotes Codex activities in India in association with the National CodexCommittee and facilitates India’s input to the work of Codex through an established consultationprocess.The Codex Alimentarius has defined two types of nutrition claims- Nutrition content claim138

Regulatory Aspects of Functional Foodsand Nutrient comparative claim- and three types of health claims- nutrient function claims; enhancedfunction claims and reduction of disease risk (Codex Alimentarius Commission, 2004).• Nutrition Claims -Guidelines for the use of nutrition claims by the Codex Committee on FoodLabeling proposed that ‘nutrient claim means any representation which states, suggests orimplies that a food has particular nutritional properties including but not limited to the energyvalue and to the content of protein, fat and carbohydrate, as well as the content of vitaminsand minerals’. Nutrition Claims include two types: (i) Nutrient content claim that is a nutritionclaim that describes the level of a nutrient contained in a food and (ii) Nutrient comparativeclaim is a claim that compares the nutrient levels and/or energy value of two or more foods.• Health Claims - Guidelines for the use of nutrition claims by the Codex Committee in FoodLabelling proposed that “health claim means any representation which states, suggestsor implies that a relationship exits between a food or a constituent of that food and health”.Health claims include three types: (i) Nutrient Function Claim that is the claim that describesthe physiological role of the nutrient in growth, development, and the normal function of thebody’; (ii) Enhanced Function Claim concerns specific beneficial effects of the consumption offoods and their constituents in the context of the total diet and relate to a positive contributionto health or to improvement of a function or to modifying or preserving health and (iii) DiseaseRisk Reduction Claim relates to the consumption of a food or food constituent, in the contentof the total diet, to the reduced risk of developing a disease or a health-related condition. Riskreduction means significantly altering a major risk factor(s) for a disease or a health relatedcondition. Diseases have multiple factors and altering one of these risk factors may or may nothave a beneficial effect. The presentation of Risk Reduction Claims must ensure, for example, byuse of appropriate language and reference to other risk factors, that consumers do not interpretthem as prevention claims.’Food Safety and Standards Act, 2006 (India): Several Acts and orders prevailed in India tosafeguard food safety and the health of the consumer. They were introduced to complement andsupplement each other in achieving total food safety and quality. However due to variation in thespecifications/standards in different Acts/Orders, and administration by different Departments andMinistries, there were implementation problems and the lack of importance given to safety standardsover a period of time. The food industries were facing problems as different products were governedby different orders and ministries and the rules and regulations in the Country needed consolidation.The Food Safety and Standards Act 2006 was introduced to overcome these shortcomings and to givemore importance to safety standards. This Act consolidates the laws relating to food and establishesthe Food Safety and Standards Authority of India (FSSAII) for laying down science-based standardsfor articles of food and to regulate their manufacture, storage, distribution, sale and import, toensure availability of safe and wholesome food for human consumption. This Act provides for theestablishment of the FSSAII which is an autonomous body under the Ministry of Health and FamilyWelfare, Government of India. FSSAII’s work programs ensure the provision of appropriate scientific,technical and administrative support for scientific committees and scientific panels, ensuring that theFSSAII carries out its tasks in accordance with the requirements of its users, prepares statements ofrevenue and expenditure and executes the budget, while developing and maintaining contact withthe Central Government and ensuring a regular dialogue with its relevant committees. The FSSAIalso constitutes scientific panels and scientific committees to address various technical issues suchas food additives, pesticides and antibiotics, genetically modified foods, functional foods, biologicalhazards, contaminants, labeling and methods of sampling. The Scientific Committee is responsiblefor providing scientific opinions to FSSAI. Finally the FSSAI is also responsible for regulating andmonitoring the manufacture, processing, distribution, sale and import of food so as to ensure safeand wholesome food to consumers. The general principles to be followed by the Central Government,State Governments and FSSAI while implementing the provisions of this Act shall be guided by thefollowing seven principles:139

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance1. To endeavour to achieve appropriate levels of protection of human life and health and protectionof consumers’ interests including fair practices in all kinds of food;2. Carry out risk management based on risk assessment;3. Adopt risk management measures necessary to ensure appropriate levels of health protection;4. Measures adopted shall be proportionate and no more trade restrictions shall be imposed thanrequired;5. Measures adopted shall be revised within a reasonable period;6. In case of suspected risks of the public consuming contaminated food, the FSSAI shall takeappropriate steps to inform the general public of the risk to health; and7. If any lot of food fails to comply with food safety requirements it shall be presumed that thewhole consignment fails to comply with these requirements.Genetically modified foods, organic foods, functional foods, nutraceuticals and proprietory foodsare regulated by this Act. Packaged foods, labelling requirements and advertising requirements areadequately covered along with import regulations for food articles. There is a provision for the FSSAIto establish various Scientific Panels such as:• Food additives, flavours, processing aids, materials in contact with food;• Pesticides and antibiotic residues;• Genetically modified organisms and foods;• Functional foods, nutraceuticles and foods for special dietary purposes;• Biological hazards, other contaminants; and• Food labelling and methods of sampling and analysis.The Act has laid down certain broad principles for implementing the food safety, viz;1. To lay down food safety standards and to ensure fair trade practices while achieving anAppropriate Level of Protection (ALOP) of human life and health; for contaminants andhazards,2. To carry out risk analysis so as to ensure an appropriate level of protection to the consumers aswell to see that such measures are least trade restrictive and are in accordance with SPS and TBTmeasures of WTO;3. Wherever appropriate, food standards are to be specified on the basis of risk analysis;4. Risk assessment is to be based on the available toxicological evaluation (e.g. JECFA) and extensiveopen and transparent discussion with all stakeholders, and the underlying principle is to ensureprotection of consumers by preventing fraudulent, deceptive or unfair trade practices.The Act also prescribes general provisions for articles of food:• Food additives / processing aids are to be added only in accordance with provisions / regulationsunder the Act;• Foods are not to contain any contaminants such as toxic metals, toxins, pesticide residues,antibiotics and veterinary drugs, in excess of limits prescribed under the regulation;• Regulations will be made for the manufacture, distribution or trade of any novel foods, GM foods,irradiated foods, organic foods, foods for special dietary uses, functional foods, nutraceuticals,health supplements, proprietary foods etc.The onus of safety of food production, processing, import, distribution and sale lies with the foodbusiness operator. The Commissioner of Food Safety of the state will implement rules under this Act atstate level. The FSSAI and the State Food Authorities will maintain a system of control, involving riskcommunication, food safety surveillance and other monitoring activities covering all stages of foodbusiness. The FSSAI is empowered to recognise any agency to conduct food safety audits which are140

Regulatory Aspects of Functional Foodsa systematic and functionally independent examination of food safety measures based on food safetymanagement systems consisting of Good Manufacturing Practices, Good Hygienic Practices, HazardAnalysis and Critical Control Points or any other such measures specified by regulation. Food testinglaboratories are required to be accredited by any accreditation agency so that the analytical results arereliable and consistent. The FSSAI and State Food Safety Authorities are responsible for enforcementof this Act. Both shall monitor and verify that the relevant requirements of law are fulfilled by foodbusiness operators at all stages of food business. There is provision for food recall by the businessoperator if the food does not comply with the Act. The Food Safety Authority in the State (HealthMinistry) appoints a Commissioner of Food Safety, designated officers (district level) and food safetyofficers to implement the programmes under the provisions of this Act. The FSSIA will notify foodlaboratories and research institutions accredited by the National Accreditation Board for testing andcalibration laboratories. It may also recognise more referral food laboratories by this Act. This Act givesmore importance for ensuring a very safe food product to consumers by providing quicker disposal ofcases within the state. Punishments offered are very severe which would make the retailer/wholesalerbe more cautious in their dealings. The standards for quality and safety laid down in this Act areharmonised standards and applicable throughout the country, and all other standards/specificationsbecome null and void. This system provides for quicker corrective actions by the regulators as theproblems are localised and traceable.Conclusion/ Recommendatrions:Several approaches to the use of health claims on foods have been made around the world, andthe common theme is that any health claim will require scientific validation and substantiation. Thereis also broad consensus that any regulatory framework should protect the consumer, promote fairtrade and encourage innovation in the food industry. However, there is a clear need to have uniformunderstanding, terminology and description of types of nutrition and health claims.References:Food Safety and Standards Act , 2006 of India Ministry of Health and Family Welfare, New Delhi, Government of Indiahttp://www.mohfw.nic.in/pfa.htmFood Safety in India Ministry of Health and family Welfare, New Delhi, Government of India http://www.foodsafetyindia.nic.in/P. Roupas_ P. G. Williams (2007) Regulatory aspects of bioactive dairy ingredients . Food Science Australia Universityof Wollongong, http://ro.uow.edu.au/Report on Functional Foods Food Quality and Standards Service (AGNS) Food and Agriculture Organization of theUnited Nations (FAO) November, 2007141

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance142Nanomaterials - Their Applicationsand Safety Aspects in FoodsBimlesh Mann , Rajesh Kumar and Prabhakar PadghamDairy Chemistry Division, NDRI, KarnalNanomaterials which include nanoparticles, nano-emulsions and nano-capsules are nowbeing used in processed foods, food packaging and food contact materials. Because of their uniqueproperties, nanomaterials offer many new opportunities for the food industries, as potent colourings,flavourings, nutritional additives and antibacterial ingredients. Due to their very large surface area,thenanoparticles have better chemical reactivity, biological activity and catalytic behaviour as comparedto larger particles of the same chemical composition (Garnett and Kallinteri, 2006).The Chemical Selection Working Group of the U.S. Food and Drug Administration (FDA) definednanomaterials as “particles with dimensions less than micrometer scale [i.e. less then 1,000 nm]that exhibit unique properties not recognized in micron or larger sized particles” (U.S. FDA 2006).Australia’s Commonwealth Scientific and Industrial Research Organisation (CSIRO) food scientistshave also defined nanomaterials as measuring up to 1,000 nm (Sanguansri and Augustin, 2006). Inanother report on nanomaterials FDA chose not to offer a size-based definition at all (U.S. FDA, 2007).Nanomaterials also have far greater bioavailability than larger particles, resulting in greater uptakeinto individual cells, tissues and organs. Materials which measure less than 300 nm can be taken up byindividual cells (Garnett and Kallinteri, 2006), while nanomaterials which measure less than 70 nm caneven be taken up by cells’ nuclei, where they can cause major damage (Chen and Mikecz, 2005).Nanotechnology has potential applications in all aspects of food processing, food packaging andfood monitoring.These includes:• Developments of the methods for the production of foods such as soft drinks, ice cream,chocolate or chips to be marketed as ‘health’ foods by reducing fat, carbohydrate or caloriecontent or by increasing protein, fibre or vitamin content.• Production of stronger flavourings, colourings, and nutritional additives.• Development of foods capable of changing their colour, flavour or nutritional propertiesaccording to a person’s dietary needs, allergies or taste preferences.• Development of packaging materials to increase food shelf life and which can detect spoilage,bacteria, or the loss of food nutrient.One of the earliest commercial applications of nanotechnology within the food sector is in packaging(Roach, 2006). Between 400 and 500 nanopackaging products are estimated to be in commercial usenow. A key purpose of nano packaging is to deliver longer shelf life by improving the barrier functionsof food packaging to reduce gas and moisture exchange and UV light exposure (Sorrentino et al., 2007).Nano packaging can also be designed to release antimicrobials, antioxidants, enzymes, flavours andnutraceuticals to extend shelf-life (Cha and Chinnan, 2004; LaCoste et al., 2005). Packaging equippedwith nano sensors is designed to track either the internal or the external conditions of food products,pellets and containers throughout the supply chain. The use of nanomaterials to strengthen bioplastics(plant-based plastics) may enable bioplastics to be used instead of fossil-fuel based plastics for foodpackaging and carry bags (Sorrentino et al., 2007; Technical University of Denmark, 2007).Unfortunately, the greater chemical reactivity and bioavailability of nanomaterials may also resultin greater toxicity of nanoparticles compared to the same unit of mass of larger particles of the samechemical composition (Hoet et al., 2004; Oberdörster et al., 2005b).Other properties of nanomaterialsthat influence toxicity include: chemical composition, shape, surface structure, surface charge, catalyticbehaviour, extent of particle aggregation (clumping) or disaggregation, and the presence or absence ofother groups of chemicals attached to the nanomaterial (Brunner et al., 2006; Magrez et al., 2006; Sayeset al., 2006).The potential health risks associated with nanomaterials in foods has mainly focused on

Nanomaterials - Their Applications and Safety Aspects in Foodsmanufactured nanomaterial food or food packaging additives but ignored the nanoparticles createdduring processing. Thus nanoparticles are also present in many foods because of the technologyused to process the foods, rather than because they are food additives or ingredients. Although foodprocessing technologies that produce nanoparticles are not new, the rapidly expanding consumption ofhighly processed foods is most certainly increasing our exposure to nanoparticles in foods. Processingtechniques which produce nanoparticles, particles up to a few hundred nanometres in size, and nanoscaleemulsions are used in the manufacture of salad dressings,chocolate syrups, sweeteners, flavouredoils, and many other processed foods (Sanguansri and Augustin, 2006). The formation of nanoparticlesand nanoscale emulsions can result from food processing techniques such as high pressure valvehomogenisation, dry ball milling, dry jet milling and ultrasound emulsification. Although many foodmanufacturers may remain entirely unaware that their foods contain nanoparticles, it is likely thatthese processing techniques are used precisely because the textural changes and flow properties theyproduce are attractive to manufacturers.Recent research has found that many food products contain insoluble, inorganic nanoparticlesand microparticles that have no nutritional value, and which appear to have contaminated foodsunintentionally, for example as a result of the wear of food processing machines or throughenvironmental pollution. The health implications of food processing techniques that producenanoparticles and nanoscale emulsions also warrant the attention of food regulators. The potential forsuch foods to pose new health risks must be investigated in order to determine whether or not relatednew food safety standards are required. Just as a better understanding of the health risks of incidentalnanoparticles in air pollution have resulted in efforts to reduce air pollution, improved understandingof the health risks associated with incidental nanoparticle contaminants in foods may also warrantefforts to reduce incidental nanoparticles’ contamination of processed foods.The commercial manufacturing of food products, food packaging and food contact materials shouldbe after the introduction of nanotechnology specific regulation which protects the public workers andthe environment from their risks. Because of their potentially serious health risks, environmental risksand social implications, the following points have to be ascertained, before the commercial applicationsof these nanomaterials.• These manufactured food nanomaterials must be subject to new safety assessments as newsubstances, even where the properties of their larger scale counterparts are well-known.• The manufactured nanomaterials must be subject to rigorous nano-specific health andenvironmental impact assessment and demonstrated to be safe prior to approval for commercialuse in foods, food-packaging and food contact materials.• All particles up to 300nm in size must be considered to be ‘nanomaterials’ for the purposes ofhealth and environment assessment, given the early evidence that they pose similar health risksas particles less than 100nm in size which have to date been defined as ‘nano’.• The data related to safety assessments, and the methodologies used to obtain them, must beplaced in the public domain.• The nano ingredients must be clearly indicated on product labels to allow the public to make aninformed choice about product use.• The public, including all stakeholder groups affected, must be involved in all aspects of decisionmaking regarding nanotechnology in food. This includes in the development of regulatoryregimes, labeling systems, and prioritization of public funding for food and agriculturalresearch.References:Cha D, Chinnan M. 2004. Biopolymer-based antimicrobial packaging: A review. Critic RevFood Sci Nutrit 44:223-237.Chen M, von Mikecz A. 2005. Formation of nucleoplasmic protein aggregatesimpairs nuclear function in response toSiO 2nanoparticles. Experiment Cell Res 305:51-62.Friends of the Earth International. 2009. OUT OF THE LABORATORY AND ON TO OUR PLATES Nanotechnology inFood & Agriculture Amsterdam. Available at: http://www.foei.org143

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceGarnett M, Kallinteri P. 2006. Nanomedicines and nanotoxicology: some physiological principles. Occup Med 56:307-311. Gatti A. Undated. “Nanopathology : a new vision of the interaction environment-human life”. Available at:http://ec.europa.eu/research/qualityoflife/ ka4/pdf/report_nanopathology_en.pdf (accessed 11 September2007).Hoet P, Bruske-Holfeld I, Salata O. 2004. Nanoparticles – known and unknown health risks. J Nanobiotechnol 2:12.Hund-Rinke K, Simon M. 2006. Ecotoxic effect of photocatalytic active nanoparticles (TiO2) on algae and daphnids.Environ Sci Poll Res 13(4):225-232.Invest Australia. 2007. Nanotechnology: Australian Capability Report, Third Edition.Commonwealth of Australia, Canberra. Available at: http://www. investaustralia.gov.au/media/NANOREPORT07.pdf(accessed 17 January 2008).LaCoste A, Schaich K, Zumbrunnen D, Yam K. 2005. Advanced controlled release packaging through smart blending.Packag Technol Sci 18:77-87.Oberdörster G, Maynard A, Donaldson K, Castranova V, Fitzpatrick J, Ausman K, Carter J, Karn B, Kreyling W, Lai D,Olin S, Monteiro-Riviere N, Warheit D, Yang H. 2005b. Principles for characterising the potential human healtheffects from exposure to nanomaterials: elements of a screening strategy. Particle Fibre Toxicol 2:8Roach S. 2006. Most companies will have to wait years for nanotech’s benefits. Foodproductiondaily.com 21 August2006. Available at: http://www.foodproductiondaily.com/news/ng.asp?id=69974 (accessed 17 January 2008).Sanguansri P, Augustin M. 2006. Nanoscale materials development – a food industry perspective. Trends Food SciTechnol 17:547-556.Sayes C, Wahi R, Kurian P, Liu Y, West J, Ausman K, Warheit D, Colvin V. 2006. Correlating nanoscale titania structurewith toxicity: A cytotoxicity and inflammatory response study with human dermal fibroblasts and human lungepithelial cells. Toxicol Sci 92(1):174–185.Sorrentino A, Gorrasi G, Vittoria V. 2007. Potential perspectives of bio-nanocomposites for food packaging applications.Trends Food Sci Technol 18:84-95.Technical University of Denmark. 2007. Bioplastic developed into food packaging through nanotechnology. News 23March 2007. Available at: http://risoe-staged.risoe.dk/News_archives/News/2007/0322_bioplast.aspx (accessed17 January 2008).U.S. FDA. 2006. Nanoscale Materials [no specified CAS] Nomination and Review of Toxicological Literature. December8, 2006. Prepared by the Chemical Selection Working Group, U.S. Food & Drug Administration. Available at:http://ntp.niehs.nih.gov/ntp/htdocs/Chem_Background/ExSumPdf/Nanoscale_materials.pdf (accessed 15January 2008).U.S. FDA. 2007. Nanotechnology: A Report of the U.S. Food and Drug Administration Nanotechnology Task Force. July25, 2007. Available at: http://www.fda.gov/ nanotechnology/taskforce/report2007.html (accessed 15 January2008).144

Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of NetraceuticalsStrategies for Animals Studies to Assess the SafetyAspects and Bioavailability of NetraceuticalsAyyasamy Manimaran 1 and Bimlesh Mann 21Livestock Production Management and 2 Dairy Chemistry Division, NDRI, KarnalIntroductionThe word “nutraceutical” was first coined by DeFelice (2007) who defined it as “a substance that isa food or a part of food and provides medical and health benefits, including prevention and treatmentof disease.” Research and awareness about nutraceuticals has been increased in last few decadesand expected to continue to increase. Basic research using laboratory animals is critical to furtheringunderstanding of the impact of nutraceuticals on health promotion and disease management, apartfrom regulatory prerequisite for conducting further human clinical trials. A variety of laboratoryandsmall-animals are used for evaluation of functional food and nutraceutical efficacy/metabolicevaluation. These pre-clinical trials can be conducted utilizing either immune competent orimmunocompromised animals like nude mice which are not having cell mediated immune response.Although significant evidence exists that functional foods and nutraceuticals can play key roles indisease prevention and health promotion, as in decreasing the risk of certain chronic diseases, safetyconsiderations must not be ignored. Safety pharmacology studies for developing nutraceuticals arenecessary and compulsory to support human clinical trials of a given scope and duration as wellas marketing authorization for pharmaceuticals. The objective is to identify possible, undesirablepharmacodynamic effects of the nutraceuticals which are unrelated to the main pharmacologicalactivity, after therapeutic administration or overdose. Safety pharmacology and pharmacodynamicstudies includes the assessment of effects on cardiovascular, central nervous and respiratorysystems and should generally be conducted before human exposure. Safety pharmacology studiescan be performed as independent studies or can be incorporated as a part of toxicological studiesthus reducing the number of animals used in accordance with the 3R’s principles. Incorporation intotoxicological studies may offer the additional advantage that the effect of the nutraceuticals can beevaluated not only after a single administration but also after repeated administration for a givenperiod of time. However, one objection is that the dose levels involved can be much higher than thetherapeutic dose. In safety pharmacology studies, the low dose should be equal to or slightly higherthan the therapeutic dose. The purpose of toxicity testing of animals is to know the biological effectsof substances, so that precautions can be taken to protect humans, animals and the environment.Mice are the most widely used species accounting for more than 50% of animals use. Mice biology iswell known than any other laboratory animal and this is widely used by immunologist, oncologistand geneticist. Rats are second most widely used a laboratory animal species and they are generallypreferred over mice by toxicologist and pharmacologists due to convenient size and they do not havemany virally-induced tumors as mice. Rabbits have been widely used for antisera production, pyrogentesting and reproductive studies particularly for teratogenicity.Analysis of nutraceuticalsMilk and dairy products are important source for proteins, peptides and amino acids. Theyhave angiotension converting enzymes (ACE) inhibitory activities, antibacterial, antioxidant,immunomodulating, antithrombotic, absorption of minerals and anti-inflammatory activities. Thesehealth promoting effects make these compounds as nutraceuticals for prevention and treatment ofhypertension, diabetes and hepatitis etc. Their identification requires advanced analytical techniquesdue to complexity of these compounds. In general, analysis of milk compounds are carried out by liquidchromatography coupled to mass spectrometry (LC-MS) or capillary electrophoresis (CE) (Campanellaet al., 2009; Contreras et al., 2008; Meltretter et al., 2008; Simone et al., 2009) and immunosensors forparticular determination of lactoferrin and immunoglobulin G in milk (Campanella et al., 2009).145

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceFurther, an omics-rooted study of milk proteins has been carried out using advanced analyticaltechniques (HPLC-MS/MS, 2D-PAGE, MALDI-TOFMS) showing the great potential of this modernapproach (Casado et al., 2009). Polyacrylamide gel electrophoresis (PAGE), sodium dodecyl sulfatePAGE (SDS-PAGE) and 2D-PAGE have been employed to analyze proteins in milk, (Casado et al.,2009). However, these more classical techniques do not provide an identification of these biomoleculesas accurate as CE or HPLC coupled to mass spectrometry. Thus, mass spectrometry alone or coupledto HPLC has been used to characterize, identify and analyze proteins, peptides and amino acids inseveral sources including milk. Gas chromatography (GC) and HPLC are preferred analytical toolsfor analyzing bioactive compounds, probably due to their versatility, generalized availability, lowcostand simplicity. Other techniques such as CE, MS, Nuclear Magnetic Resonance (NMR) or FourierTransformed Infrared Spectroscopy (FTIR) have also given good results, although their use is not aswidespread as GC or HPLC.Table.1 Nutraceutical and analytical techniques employed for their analysisNutraceutical Source Possible health effect AnalyticaltechniquesPhytosterols andphytostanolsMilk andyoghurtReferenceDecrease cholesterol levels GC-MS Santos et al., 2007Milk lipids(triglycerides,diacylglycerides,saturated fatty acidsand PUFAs).MilkImmuno-suppressive, antiinflammatory, andantimicrobialproperties.HPLC-MS/MS,GC/LC.Casado et al., 2009GangliosidesDairyproducts(milk)Protect against entericpathogens, and prebioticfunctions.MALDI-TOFMS,HPTLC, HPLC-MSLacomba, et al., 2010;Mocchetti, 2005Milk proteins, peptides,Lactoferrin andimmunoglobulin G.Milk andderivedproductsAntihypertensive, antimicrobial,antiinfl ammatory andinmunostimulating activities.Important source of aminoacidsHPLC-MS/MS, 2D-PAGE,MALDI-TOFMS,Inmunosensors,CE (UV, MS),Lacomba, et al., 2010;Campanella et al., 2009;Contreras et al., 2008;Meltretter et al., 2008;Simone et al., 2009Pharmacological characterizationThe pharmacological characterization of a nutraceutical is simply the determination of its efficacyand safety. Since many nutraceuticals are considers as food items (Dietary Supplement Health andEducation Act, 1994), currently, many nutraceuticals (e.g., botanicals) do not require efficacy andsafety testing before marketing. However, Morrow et al. (2005) reported that there is a concern thatmany nutraceuticals have pharmacological activity that can endanger the public health and that certainnutraceuticals (e.g., botanicals) should be regulated similarly to prescription nutraceuticals. Therefore,future marketing of nutraceuticals may require more rigorous testing of safety and efficacy beforemarketing. In fact, the FDA (2007) developed a current good manufacturing practice requirement fordietary supplements that obligates manufacturers to evaluate the composition, identity, quality, andstrength of their marketed products. With future increased regulation of nutraceuticals on the horizon,pharmacological characterization of nutraceuticals will be useful.Drug development, testing and review processThe drug review process is roughly divided into preclinical and clinical testing. The preclinical testis primarily in vitro and animal studies, whereas clinical are human studies.Preclinical testing in animal model (one rodent, one non-rodent) is useful to evaluate acute andshort term toxicity. Doses will be at normal levels for short and long term or increasingly high levelsto induce toxicity. It is useful to determine lethal dose. Pre-clinical studies will be useful to assesshow drug/chemicals is absorbed, distributed, metabolized, and excreted in animals. Further, clinicalstudies will be conducted in human being in order to verify the mechanism and efficacy. It includes146

Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of Netraceuticalsthe following phases (FDA, 2002; Berkowitz, 2007).• Phase I: 20–80 human subjects, safety, pharmacokinetics• Phase II: 36–300 human subjects, efficacy• Phase III: 300–3,000 human subjects, efficacy, double-blind studies• Phase IV: post-marketing surveillancePreclinical testingPreclinical safety testing assesses the potential toxicity of a drug in in vitro and animal studies(FDA, 1985; Berkowitz, 2007). Preclinical testing involves pharmacological profile tests and it can befurther divided into the following (Berkowitz, 2007)1. Molecular: receptor binding, enzyme inhibition2. Cellular: cell cultures, isolated tissues3. Disease models: pain, seizuresSafety studies required by the FDA1. Pharmacology studies: determine ED502. Acute toxicity studies: determine LD503. Multi-dose toxicity studiesa. Subchronic toxicity: duration of one to three monthsb. Chronic toxicity: duration of six monthsc. Carcinogenicity: duration of two years4. Special toxicity studies: route of administration5. Reproduction studies: birth defects6. Mutagenicity studies: Ames test7. Pharmacokinetics studies: absorption, distribution, metabolism and excretion (ADME)Acute toxicityAcute toxicity tests are generally provide data on the relative toxicity likely to arise from a singleor fractionated doses up to 24 hrs for oral and dermal studies, while 4-hr exposure for inhalationstudies. Rats are preferred for oral and inhalation tests where as rabbits preferred for dermal tests.Young adults of 5 of each sex per dose level with minimum three dose levels were recommended.Animals should be monitored for 14 days for any clinical symptoms.Subacute study (repeated dose exposure)It is performed to obtain dose for subchronic studies typical protocol is to give 3-4 dosages, and10 animals for each sex per dose are often used. For non-rodents species, usually dogs (3-4 of each sexper dose).Subchronic toxicitySubchronic toxicity tests are employed one month to three months (90 days are common).Detailed clinical observations and pathology examinations should be conducted. Two species arerecommended (rodents and non-rodents). Young adult rodents’ (10-20 animals for each sex per dose)and non-rodents species, usually dogs (4 of each sex per dose) should be used for experimentation. Atleast 3 dose levels, in which high dose produce toxicity but not more than 10 per cent mortality, lowdose not produce toxicity and intermediate dose. The principal goal of this test is development of NoObservable Adverse Effects Level (NOAEL) and sometimes these protocols can be used for furtherlike chronic and developmental toxicity studies.147

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceChronic toxicityLong-term or chronic toxicity tests determine toxicity from exposure for a substantial portion of asubject’s life. They are similar to the subchronic tests except that they extend over a longer period oftime, which is depend upon intended period (short or long) of exposure to human and involve largergroups of animals. In rodents, chronic exposures are usually for 6 months to 2 yrs and in non rodents1 yr or more. It is useful to assess the cumulative toxicity of chemicals particularly carcinogencity.Dose selection for the chronic study is generally based on the results of a series of subchronic (90 day)toxicity studies. Result of weight gain, survival information, pharmacokinetic, metabolism data, andhistopathology from these experiments that are used for the dose selection. Highest dose employedshould be the maximum tolerated dose (MTD) which is defined as “the highest dose of the test agentduring the chronic study that can be predicted not to alter the animals’ normal longevity from effectsother than carcinogenicity”. Carcinogenicity tests are similar to chronic toxicity tests. Testing in tworodent species (mice and rats), 50 of each sex per dose level are preferred due to short life span. Theexposure period is at least 18 months for mice and 24-30 month for rats. They should be observed for18-24 months for mice and 24-30 month for rats.Developmental and reproductive toxicityDevelopmental toxicity testing detects the potential for substances to produce embryotoxicityand birth defects. Developmental toxicity is the study of adverse effects on the developing organismoccurring at any time during life span form before conception, during prenatal development orpostnatally until puperty. Teratology study involves from conception to birth. Reproductive toxicitytesting is intended to determine the effects of substances on gonadal function, conception, birth, andthe growth and development of the offspring. The oral route is preferred.Pharmacological studiesApart from safety and efficacy of nutraceuticals, the bioavailability studies are important.Bioavailability is the measurement of the rate and extent of the active ingredient that reaches thesystemic circulation. This can be determined by measuring the active ingredient of nutraceuticals orits metabolites from the blood. Active ingredient can be accurately quantitated pharmacokineticallyin the plasma (tmax, Cmax and AUC) or urine (rate of drug excretion) gives the most objectivedata on bioavailability. Pharmacokinetic studies are preferred over pharmacodynamic (deals aboutmechanism of action) studies. When both pharmacokinetic and pharmacodynamical studies are notpossible, then a clinical study can be used in human or suitable animals model with assumptionof therapeutic success occurred because there was enough bioavailability when the nutraceuticalswas administered. However, various factors such as diet, disease, or genetics, which can make itdifficult to understand the success or failure (Shargel, 1993; FDA, 2003). Whenever potentially activemetabolites found during human cell culture studies, these metabolites can be studied in laboratoryanimals to determine their safety and efficacy, which can help determine future in vitro or in vivohuman studies. Moreover, animal studies can be used to examine nutraceuticals-drug interactionswith regard to parent drug and its metabolites. Since several nutraceuticals (example, Grapefruitand St. John’s Wort) are inhibit or induce a cytochrome P 450which could affect subsequentlyadministrated drug concentrations.Assays for ACE-inhibitory and antihypertensive activityDetermination of the ACE inhibitory activity is the most common strategy followed in the selection ofantihypertensive peptides derived from milk proteins. In order to facilitate the characterisation of ACEinhibitory peptides, the establishment of a simple, sensitive and reliable in vitro ACE inhibition assaylike, spectrophotometric, fluorimetric, radiochemical, HPLC and capillary electrophoresis methodscan be used to measure ACE activity. This is usually expressed as the IC50, i.e. concentration neededto inhibit 50% of the enzyme activity. The spectrophotometric method of Cushman and Cheung (1971)is most commonly utilized. The in vivo effects are tested in spontaneously hypertensive rats (SHR),148

Strategies for Animals Studies to Assess the Safety Aspects and Bioavailability of Netraceuticalswhich constitute an accepted model for human essential hypertension. In addition, in many in vivostudies it is also checked that antihypertensive peptides from milk proteins do not modify the arterialblood pressure of Wistar-Kyoto (WKY) rats that are the normotensive control of the SHR. The resultsof hypotensive effects caused by the short-term administration to SHR of milk protein hydrolysates,fermented products and isolated milk-derived peptides have been shown to lack of correlation betweenthe in vitro ACE inhibitory activity and the in vivo action. This poses doubts on the use of the in vitroACE inhibitory activity as the exclusive selection criteria for potential antihypertensive substances,as it does not take into consideration of the bioavailability of the peptides or other mechanism likeantioxidant effects. On other hand, long-term intake of milk products on blood pressure of SHR wasshown that dose dependent attenuation of the development of hypertension in SHR during 14 weeksof treatment with milk containing the potent ACE inhibitory peptides (Nakamura et al., 1995; Sipolaet al., 2002).Hypertension animal modelsRats are the most popular species in hypertension. The rat models of hypertension thusprovide ample opportunity not only to investigate the mechanisms involved in the pathogenesisof hypertension, but also to learn about the critical balance between stress and coping. Amongrats spontaneously hypertensive rat (SHR) is most widely used rat model, although it reflects onlya rare subtype of primary human hypertension, which is due to genetic inheritance. SHR strokeprone (SHR-SP) is a further developed sub-strain, with even higher levels of blood pressure,and a strong tendency to die from stroke. Other rat models of hypertension are Dahl (due togenetic inheritance like SHR), deoxycorticosterone acetate (DOCA)-salt, cause hypertension dueto hormonal alterations (Contreras et al., 2009).Type 2 diabetic animal modelsChemical induced diabetes model can be produced by administrating drugs like alloxan in rat(40-200 mg/kg, iv or ip), mice (50-200 mg/kg, iv or ip), rabbit (100-150 mg/kg, iv), dog (50-75 mg/kg, iv) can cause diabetes. Administration of streptozotocin to rat (35-65 mg/kg, iv or ip), mice (100-200 mg/kg, iv or ip), hamster (50 mg/kg, ip), dog (20-30 mg/kg, iv) can induce diabetus in theseanimals. Selective loss of pancreatic beta cells, residual insulin secretion and ketosis makes lessmortality. Comparatively cheaper, easier to make and maintenance of animals. Disadvantages are,direct cytotoxic action on the beta cells and insulin deficiency rather than consequence of insulinresistance, less stable and reversible. Further, toxic actions on other body organs are constraints inlong-term experiments. Though spontaneous type 2 diabetic models are resemble to human beingand minimum variability of results with minimum sample size, they are limited availability, costlyand required sophisticated maintenance. In dietary or nutrition induced type 2 diabetic models as aresult of overnutrition, toxicity of other vital organ can be avoid. However, long period is requiredto create diabetes and no frank hyperglycaemia develops upon simple dietary treatment. Surgical,transgenic and knock out models of diabetes animals are need cumbersome technical procedure andcostly procedure (Srinivasan and Ramarao, 2007).ConclusionExperiments using laboratory animals should be well designed, efficiently executed, correctlyanalyzed, clearly presented, and correctly interpreted if they are to be ethically acceptable. Laboratoryanimals are nearly always used as models or surrogates of humans or other species. Animals should beused only if the scientific objectives are valid (i.e. high probability of meeting the stated objectives andreasonable contributing to human or animal welfare, possibly in the long term), no other alternative,and the cost to the animals is not excessive. The reason for choosing their particular animal modeland the species, strain, source, and type of animal used should be clear. The “3Rs” rules (replacement,refinement and reduction) should be followed to humane use of animals. However, it is important torecognizing biological effects with sufficient numbers animals in experiments. The number of animalsto be used in an experiment depends on a variety of factors, including experiment objectives, degree149

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceof precision required, the expected difference between the effects of treatments and structure andmethods of analysis. Development and application of the biomarkers to clarify functionality andrisk are important to understand the fundamental molecular mechanism concerning health care anddisease prevention of nutraceuticals. Through use of advanced technologies to study the relationshipbetween nutrition intake and health associated with genes can be useful for better understanding ofnutraceuticals.ReferencesBerkowitz, B. A. 2007. Development and Regulation of Drugs. In Basic and Clinical Pharmacology. 10 th edition. Edited byKatzung, B. G. New York, NY: McGraw-Hill, pp. 64–73.Campanella, L., Martini, E., Pintore, M. and Tomassetti, M. (2009). Determination of lactoferrin and immunoglobulin Gin animal milks by new immunosensors. Sensors, 9: 2202-2221.Casado, B., Affolter, M. and Kussmann, M. (2009). OMICS-rooted studies of milk proteins, oligosaccharides and lipids,J. Proteomics, 73: 196-208.Contreras, M. del. M., Carro´n, R., Montero, M. J., Ramos, M. and Recio, I. (2009). Novel casein-derived peptides withantihypertensive activity. International Dairy Journal, 19: 566–573.Contreras, M. M., López-Expósito, I., Hernández-Ledesma, B., Ramos, M. and Recio, I. (2008). Application of massspectrometry to the characterization and quantification of food bioactive peptides. J. AOAC Int., 91 (4): 981-994.Cushman, D.W. and Cheung, H. S. (1971). Spectrophotometric assay and properties of the angiotensin-convertingenzyme of rabbit lung. Biochem.Pharmacol., 20: 1637–1648.DeFelice, S. 2007. The Foundation for Innovation in Medicine. http://www.fi mdefelice.org.Food and Drug Administration. (1985). Guidance for industry: Guideline for the format and content of the nonclinicalpharmacology/toxicology section of an application. http:// www.fda.gov/cder/guidance/old032fn.pdf.Food and Drug Administration. (2002). The FDA’s drug review process: Ensuring drugs are safe and effective. http://www.fda.gov/fdac/features/2002/402_drug.html.Food and Drug Administration. (2003). Guidance for industry. Bioavailability and bioequivalence for orally administereddrug products: General considerations. http://www.fda. gov/cder/guidance/5356fnl.pdf.Food and Drug Administration. (2007). Final rule promotes safe use of dietary supplements. http://www.fda.gov/consumer/updates/dietarysupps062207.html.Meltretter, J., Schmidt, A., Humeny, A., Becker, C.M. and Pischetsrieder, M. (2008). Analysis of the peptide profile ofmilk and its changes during thermal treatment and storage, J. Agric. Food Chem., 56: 2899-2906.Morrow, J., T. Edeki, M. El Mouelhi, R. Galinsky, R. Kovelesky, and C. Preuss. (2005). American Society for ClinicalPharmacology and Therapeutics position statement on dietary supplement safety and regulation. Clin. Pharmacol.Ther. 77:113–122.Nakamura, Y., Yamamoto, N., Sakai, K. and Takano, T. (1995). Antihypertensive effect of sour milk and peptidesisolated from it that are inhibitors to angiotensin I-converting enzyme. J. Dairy Sci., 78: 1253–1257.Shargel, L. and A. Yu. (1993). Bioavailability and Bioequivalence. In Applied Biopharmaceutics and Pharmacokinetics.3rd edition. Norwalk, CT: Appleton and Lange, pp. 193–223.Simone, C. D., Picariello, G., Mamone, G., Stiuso, P., Dicitore, A., Vanacore, D., Chianese, L., Addeo, F. and Ferranti, P.(2009). Characterisation and cytomodulatory properties of peptides from Mozzarella di Bufala Campana cheesewhey. J. Pept. Sci., 15: 251-258.Sipola, M., Finckenberg, P., Korpela, R., Vapaatalo, H., and Nurminen, M.-L. (2002). Effect of long-term intake of milkproducts on blood pressure in hypertensive rats. J. Dairy Res., 69: 103–111.Srinivasan K. and Ramarao P. (2007). Animal models in type 2 diabetes research: An overview Indian J Med Res 125:451-472.150

Recent Advances in Synbiotic Dairy Foods and Their Safety EvaluationIntroductionRecent Advances in Synbiotic DairyFoods and Their Safety EvaluationChand Ram, Manju and Santosh AnandDairy Microbiology Division, NDRI, KarnalThe human gut habitats >500 species of bacteria and their proper balance is pre requisite for wellbeing of humans and animals. It is established that beneficial microflora must be viable and shouldremain adhered to the inner surface of the epithelial cells to confer desired health benefits to the host.Various factors such as nutritional requirements, transit time, infections, availability of metabolizablesubstrates affect microbial ecology of large intestine. Dietary habits influence gut microflora e.g.bifidobacteria dominate breast fed infants which gradually decrease with advancement in age. Inaddition, food substrate form also plays vital role in determining composition of gut microflora forinstance, presence of N- acetyglucosamine, galactose, certain glycoproteins and fucose oligomersin human milk act as specific growth factors for bifidobacteria. Further, low protein and highlactoferrin content in human milk elevate growth of bifidobacteria and inhibit growth of undesirablemicroorganisms, respectively. Elie Metchnikoff (1907) hypothesized longevity of Bulgarian peasantsassociated with continuous consumption of fermented milks, the concept of probiotics as knowntoday. Imbalance of microbial ecology of gut can be restored by administration of probiotics. WorldHealth Organization (WHO) has advocated application of probiotics in the form of functional foodsfor treatment and/or prevention of various ailments. This decade has witnessed advancement in thefield of probiotics in the form of synbiotic dairy foods. Hence, it is worth to discuss safety issuesrelated to probiotic vis a vis synbiotic dairy foods.Functional foods and related concepts:Dairy foods have always been a choice of innovation to remain competitive in the market aswell as changes in the consumer preference. The primary role of these foods is to provide nutritionand satisfaction feeling to the consumer. However, in recent times apart from nutrition, the trend istowards consumption of functional foods with beneficial microbes to have a state of good health andreduce risk of disease. Dairy products have a distinct role in delivering the probiotics to the host, asthese products provide suitable environment for survival and growth.Functional food- Food that satisfactorily demonstrate beneficial effect on one or more targetfunctions in the host, beyond the adequate nutritional effects in a way that is relevant to either animproved state of health and well-being and/or reduction of risk of disease (European FunctionalFood Science programme, Diplock, 1999).Probiotics- Live microorganisms, which when administrated in adequate amount confer healthbenefits to the host (FAO/WHO,2002).Probiotic food- That contains viable probiotic microorganisms in adequate numbers incorporatedin a suitable matrix so that upon ingestion claimed health effect is obtained in the host beyond regularnutrition. Probiotics adhere to epithelial cell and colonise thereby, improve metabolism, immunityand gut physiology.Prebiotics- Non digestible food ingredients that beneficially affect the host by selectively stimulatingthe growth and/or activity of one or a limited number of bacteria in the colon. Synbiotics- A mixturesof pro and prebiotics that beneficially affect the host by improving the survival and implantation ofselected live microbial strains in the gastrointestinal tract.Probiotics:Lactic acid bacteria (LAB) including bifidobacteria, natural inhabitant of human gut have been inuse for preparation of various functional foods. The product can be called probiotic functional only if151

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancethe effective dose of live organisms present and its health benefit has been shown upon consumption.As per WHO recommendations food must contain 106 cfu/g or 108 cfu/day of viable microorganismsin-take for better probiotic efficacy. Health benefits can be ascribed to probiotics/synbiotics i.e.alleviation of lactose intolerance, improvement in Ca, Fe and Mg absorption, cardiovascular health,anticancer effect, cholesterol assimilation, modulation of immune function, constipation alleviation,prevention/ treatments of diarrhoea and infections, increase in nutrient bioavailability, regularisationof intestinal flow, production of vitamins etc. Some of commercially available probiotics foods inglobal market are enlisted in Table 1.Prerequisite of probiotic cultures:Probiotic cultures should be selected on the following criteria, irrespective of the intended host orsite of application:• Survival in GIT and exhibit health effects in the host.• Proliferation and colonization under the host environmental condition.• Survival in association with the host immune system and non inflammatory.• Immuno-stimulatory for the mucosal immune system.• Production of antimicrobial substances against food spoilage and pathogenic bacteria.• Non-pathogenic, non-toxic, non-allergic, non-mutagenic or anti-carcinogenic, even in immunecompromisedhosts.• Genetically stable, non-plasmid transfer and technologically suitable for process applications.• Potential for delivery of recombinant proteins and peptides.• Desirable metabolic activity and antibiotic resistance / sensitivity.New generation probiotics:Due to advancement in health and nutrition science, new cultures and novel probiotic productsare being introduced in market. These will require well established safety assessment procedures, e.g.in the European Novel Foods Directive and in the US Premarketing Approval Clearances are must.• Novel probiotic species: Majority of probiotics belong to the genera Lactobacillus, Bifidobacterium,Lactococcus, Leuconostoc, and Propionibacterium with GRAS status. However, other organisms suchas Oxalobacter formigenes, Enterococcus fecalis and Escherichia coli do not enjoy the same status andpossibly more strict safety assessments are necessary to give clearance to novel probiotics forincorporation into synbiotic products.• Genetically modified probiotics: Dairy food containing genetically modified (GM) probioticshave low consumer acceptance in many countries e.g. Europe. However, GM probiotics possespotential in clinical applications e.g. delivery of antigens for vaccines and thus are morereadily accepted. This would provide a safer method of vaccination than the use of attenuatedpathogens e.g. GM, Lactococcus lactis, produce IL-10 in the mouse intestine. This may providenew treatment strategies for inflammatory bowel disease, and similar applications may beuseful for other diseases. The safety of such organisms that produce very powerful bioactivesubstances is of major concern as excess production of these substances in a healthy individualmay be detrimental.• Non-viable probiotics: Generally probiotics are live microbes, however, non-viable probioticsmay also have beneficial health effects. These are likely to be in the market due to practical andeconomic advantages; longer shelf-life, transportation and storage, safety etc. These could beconsidered safe when used in extremely high-risk immune-suppressed patients.• Novel applications: The main application for probiotics is their use in foods, aiming at affectingthe composition or activity of the intestinal microflora or directly affecting the function ofthe intestine. However, the probiotic principle should be expected to work in any part of thebody that has a normal microflora. With the exception of the urogenital tract, extra-intestinal152

Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluationapplications of probiotics have received little attention. Such probiotic preparations wouldclearly need different safety requirements.• Animal probiotics: Probiotics application in animals requires more strict safety assessment andshould be safe to both. Because of probiotics application in farm animals, these may enter thefood chain. Intimate relationship between pet and its owner result spread of probiotic fromanimal to human is possible. Enterococci are commonly used in animal preparations and thismay be reason for some concern. The safety requirements for animals are different from thosefor humans. Few studies suggest that Lactococcus garvieae is associated with mastitis in cows andsepticaemia in fish as well as disease in humans. However, its true pathogenesis for humansremains to be determined.Challengages for use of probiotics in food systems:• Acid sensitivity is principal factors for poor viability of probiotic cultures particularlybifidobacteria in fermented dairy foods. However, microencapsulation technique can be used toimprove viability of acid sensitive cultures in food systems.• Oxygen sensitivity is of particular relevance to bifidobacteria as they are strict anaerobes. Toxiceffects of oxygen can be overcome; milk may be deaerated prior to fermentation. Alternatively,use of impermeable packaging may eliminate the toxic effects of oxygen during product storage.Addition of reducing agents such as cysteine or oxygen scavengers such as ascorbic acid andselection of oxygen tolerating strains may also improve the tolerance of probiotic cultures tooxygen sensitivity.• Processing parameters such as thermo tolerance is an important parameter when consideringmicrobial survival in food processes such as spray-drying. Within the genera most often employedas probiotics, certain strains and species are more heat tolerant than others e.g. “thermophilic”lactobacilli.Safety issues of probiotics for humans:• Probiotic cultures used for preparation of functional dairy foods should be safe even in immunecompromisedindividuals. Long history of LAB usage in preparation of fermented food providesthem generally regarded as safe (GRAS) status. WHO and LABIP outlined following parametersfor their safety (Table 2.).Table 1. Commercial probiotic foods in the global marketSN Commercial preparation Probiotic cultures1 Acidophilus milk Lactobacillus acidophilus2 Sweet acidophilus milk Lb. acidophilus3 Acidophilin Lb. acidophilus, Lc. lactis subsp. lactis, kefi r yeasts.4 Nu-Trish A/B Lb. acidophilus, Bifi dobacterium spp5 Diphilus milk Lb. acidophilus, B. bifi dum6 Biomild Lb. acidophilus, B. bifi dum7 Cultura ® or A/Bmilk Lb. acidophilus, B. bifi dum8 Bifi ghurt ® B. longum (CKL 1969) or B. longum (DSM2054)9 Acidophilus buttermilk Lb. acidophilus, Lactococcus lactis subsp. lactis, subsp.cremoris, subsp. lactis biovar. diacetylactis10 Acidophilus-yeastmilk Lb. acidophilus, Saccharomyces lactis11 Bifi dus milk B. bifi dum or longum12 Yakult Lb. casei Shirota13 Yakult Miru-Miru Lb. casei, B. bifi dum or B. bereve, Lb. acidophilus14 A-38 fermented milk Lb. acidophilus, mesophilic lactic cultures15 Onaka He GG, Str. thermophilus,Lb. delbrueckii subsp. bulgaricus,16 Gefi lus (Valio Ltd) Lactobacillus rhamnosus GG153

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance17 CHAMYTO Lb. johnsonii, Lb. helveticus18 Vitagen Lb. acidophilus19 Procult drink B. longum BB536, Str. thermophilus,Lb. delbrueckii subsp. bulgaricus20 Actimel Lactobacillus casei ImmunitasTM21 AKTfi t, Biola, BioAktiv, YOMO, LGG+, Lb. rhamnosus GGActif Yoplait 360º , Kaiku22 Gaio Lb. casei F1923 Verum Lb. rhamnosus LB2124 ProViva Lactobacillus plantarum 299vAdopted from Ozer and Kirmaci, 2009Guidelines for evaluation of probiotics (FAO/WHO, 2002):• Strain identification by phenotypic and genotypic methods (Section 3.1)•Genus, species, strain•Deposit strain in international culture collection• Functional characterization (Section 3.2)• In vitro tests• Animal studies• Safety assessment (Section 3.3)• In vitro and/or animal• Phase 1 human study• Double blind, randomized, placebo-controlled (DBPC) phase 2 human trial or other appropriatedesign with sample size and primary outcome appropriate to determine if strain/product isefficacious (Section 3.4)• Preferably second independent DBPC study to confirm results• Phase 3, effectiveness trial is appropriate to compare probiotics with standard treatment of aspecific condition• Labeling (Section 3.5)•Contents – genus, species, strain designation•Minimum numbers of viable bacteria at end of shelf-life•Proper storage conditions•Corporate contact details for consumer information.Table 2. Safety assessment scheme for probiotic culturesSN Attribute Safety issues for assessment1 Intrinsic strain properties Adhesion factors, antibiotic résistance, plasmid transfer, enzyme profi le2 Metabolic products Concentrations, safety, and other effects3 Toxicity Acute and sub acute effect of ingestion of large amounts of cultures4 Infective properties In vitro with cell lines ; in vivo with animal models5 Dose- response effects Oral administration in volunteers6 Clinical assessments Potential for side effects and disease-specifi c effects; nutritional studies7 Epidemiological studies Surveillance of large populations following introduction of new strains and productsPrebiotics:The prebiotic application is directed to support growth of LAB due to their proposed health promotingproperties. The latest definition results in an equalization of ‘prebiotic’ and ‘bifidogenic’ which includes154

Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluationin the definition the prebiotic index (i.e. absolute increase in fecal bifidobacteria concentration/g of dailyconsumed prebiotics. Some of the properties of food ingredient to be classified as prebiotic are listed inthe Table 3.Table 3. Desirable attributes of functional prebioticsDesirable attribute in prebioticActive at low dosage and lack of side effectsPersistence through the colonProtection against colon cancerEnhance the barrier effect against pathogensInhibit adhesion of pathogensTargeting at specifi c probioticsProperties of oligosaccharidesSelectively and effi ciently metabolised by ‘benefi cial’ bacteriabut not by gas producers, putrefactive organisms, etc.Controlled molecular weight distributionStimulate butyrate production in the colonStructural basis unknownPossess receptor sequenceSelectively metabolised by restricted species of Lactobacillusand/or Bifi dobacteriumTable 4: List of some selected prebioticsSN Recognized prebiotics Emergent prebiotics1 Fructo-oligosaccharides (FOS) Genti-oligosaccharides2 Galactooligosaccharides (GOS) Gluco-oligosaccharides3 Galacto-oligosaccharides (GOS)/ transgalactosylatedoligosaccharidesIsomalto-oligosaccharides (IMO)(GOS/TOS)4 Inulin Lactosucrose5 Isomalto-oligosaccharides Levans6 Lactulose Pectic-oligosaccharides7 Pyrodextrins Resistant starch8 Soy-oligosaccharides (SOS) Sugar alcohols9 Xylo-oligosaccharides (XOS)Synbiotics:Another promising approach to manage correct balance of gut microflora is the use of synbiotics.These also improve survival of bacteria during storage and passage of upper part of GIT, therebyenhancing their health effects in the large intestine. The combined effects of synbiotics can be additiveor even synergistic.Synbiotics foods with defined health benefits:All the commercial probiotics are highly selected to have useful properties such as resistanceto acid and bile and technological stability to freeze-drying and product preparation. However, totransfer health benefits to the host synbiotic approach holds promise such as immune stimulation,cancer prevention, anti-pathogen activity etc. It would be expected that synbiotic versions of probioticstrains made with targeted prebiotics would display better survival and colonisation in the gut. Itwould be highly desirable to develop targeted prebiotics at particular species of microorganisms.Infant formulae and weaning foods: Bifidogenic factors in milk stimulate the growth of bifidobacteriathat result health benefits to the infant, including a decreased susceptibility to microbial infections. Breastfed infants’ gut is dominated by bifidobacteria while of formula-fed with mixed microflora resemble thatof an adult. The supplementation of infant milk formula with non-digestible compounds would supportgrowth of bifidobacteria. Hence, it would be of great interest to produce prebiotics with high selectivitytowards growth of bifidobacteria that are present in the gut of breast-fed infants as the basis of novelinfant food formulations.155

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceFunctional foods for healthy ageing: Bifidobacterial population decreased markedly in the colonof elderly person (55–60 years of age) as compared with those of young adults. Species of Bifidobacteriumare reasonable target for prebiotic viz., B. infantis and B. breve are predominant in infants, whereasB. adolescentis and B. longum in adults. Decrease in bifidobacterial numbers results in reduction inresistance to gastrointestinal infections and thus elderly people suffer more with such ailments.Development of targeted prebiotic that promotes the probiotic strains able to inhibit gastrointestinalpathogens viz., E. coli, Salmonella sp. and Campylobacter jejuni.Development of targeted prebiotics:Targeted prebiotics for probiotic can be developed firstly by screening a wide range ofoligosaccharide for their prebiotic attributes which will provide information about their selectivitytowards particular species. Structural diversity and cost effective manufacture technology for complexoligosaccharides is most important. The second approach is enzymes expressed probiotics which canact as synthetic catalysts. These enzymes will produce a mixture of oligosaccharide, which inturnmay be more readily metabolised by the producing organism, resulting in higher selectivity. Novelβ-galacto-oligosaccharide mixtures have been synthesised from lactose using β-galactosidases from arange of prebiotics.Technologies for manufacturing prebioticsFirst generation prebiotics are either extracted from plants or manufactured from cheap, readilyavailable sources, generally by means of enzymatic hydrolysis or synthesis reactions.Second approach is enzyme hydrolysis of polysaccharide. Fungal inulinase is used to hydrolysechicory inulin to oligosaccharides with low monosaccharide contents. Fructo-oligosaccharides andxylo-oligosaccharides are both manufactured by hydrolysis of their parent polysaccharides. Fructooligosaccharidescan also manufactured by synthesis from sucrose. Consequently, FOS producedfrom inulin have reducing activity. The probiotic like Galactooligosaccharides, lactosucrose, isomaltooligosaccharides(IMO) and some fructooligosaccharides are manufactured by enzymic glycosyltransfer reactions from cheap sugars such as sucrose and lactose or from starch. All of the sucrosederivedFOS terminate in a non-reducing glucose residue. Ion-exchange chromatography can be usedto remove glucose and sucrose.Second generation prebiotics: If the full potential of enhanced prebiotics is to be realised, newtechnological innovations will be required. The challenge, as ever, for biotechnologists is to achieve themanufacturing technologies at economically viable costs. Two areas of development are being exploredin laboratories in Europe at the current time. Controlled polysaccharide hydrolysis: Polysaccharidehydrolysis is a commercial manufacturing approach for prebiotics. In this a more controlled partialhydrolysis carried out in order to achieve control over the molecular weight distribution of the products.Different IMO with average molecular weights up to 12,000 Da can be prepared by controlled partialhydrolysis of dextran and pectins by endo-dextranase in an enzyme membrane reactor by controllingresidence time and ratio of enzyme to substrate. The fractions displayed good prebiotic fermentationin vitro.Safety of pre & probiotics:Probiotics mainly belongs to genera of Lactobacillus or Bifidobacterium, have been in use to conferhealth effects as they enjoy status of Generally Regarded as Safe (GRAS) due to their long historyof safe use. Various in vitro tests are available to evaluate efficacy and safety of pro and prebiotics.However, most probiotics do not have a documented history of safe use hence, safety evaluation isquite necessary. Some of the issues of probiotics concerned to safety are as below:• Antibiotic resistance: Presence of antibiotic resistance encoding genes must be determinedin order to prevent transmission of drug resistance to undesirable organism. The antibioticresistance gene specially vancomycin resistance should not be unstable plasmid encoded inprobiotic organisms as this is one of the last antibiotics used as an effective tool against multidrug-156

Recent Advances in Synbiotic Dairy Foods and Their Safety Evaluationresistant staphylococci. It is recommended not to use any vancomycin-resistant Enterococci aseither human or animal probiotics.• Strain Identification: This is not possible that all strains genus would confer probiotic healthbenefits to the host. Proper identification of the organism is desirable by using internationallyaccepted molecular tools such as DNA-DNA hybridization, 16S rRNA, pulsed field gelelectrophoresis (PFGE) or randomly amplified polymorphic DNA (RAPD), newer system suchas terminal restriction fragment-length polymorphism (T-RFLP) etc to give proper designationso that it can be easily accessible by researcher. After identification the strain must be depositedin a collection centre so that it can be easily available for workers.• Metabolic activities: Certain probiotics are capable to convert food components or biologicalsecretions into secondary metabolites which could be potentially harmful to the host. Hence,these should be assessed for the following parameters:• Biogenic amines: These are produced during degradation of food proteins by certain LAB dueto deaminase activity, whish is considered as detrimental effects of probiotics. The candidateprobiotic can be evaluated for this activity decarboxylase broth using Bover-Cid and Holzapfel’smethod.• Bile salt deconjugation: Bile salts are water soluble end products of cholesterol metabolismin liver and assist in the lipid digestion. They are absorbed actively in the terminal ileum andare subsequently re-secreted, thereby form an enterohepatic cycle. During the microbial bileacid metabolism first step is deconjugation as these are less effective in solubilisation of dietarylipids. Further, too early and too much deconjugation, particularly in the upper small intestinemay disturb the lipid digestion and subsequent uptake of fat-soluble vitamins. Primary bileacids can subsequently be dehydroxylated to yield secondary bile acids. The latter are mosthydrophobic and toxic to hepatocytes and the gastric and intestinal mucosa, and have beensuggested to be cancer promoters and to be involved in the formation of gal stones. Consideringthe detrimental properties of secondary bile acids, no increase in 7α- dehydroxylase activity canbe accepted anywhere in the intestine. Potential probiotics and starters should not exhibit thisproperty.• D (-) lactic acid Production: Mammalian tissues lack D-lactate dehydrogenase (DLDH) enzymeto metabolize D(-)-lactic acid. Production of D(-)-lactic acid by probiotic bacteria, is also aconcern to use them in children, due to D(-)-lactic acidosis. Acidosis is a pathologic conditioncharacterized by neurological alterations.• Others-binding: The binding of probiotics to mucosal layer is one of the prime selectioncriteria as it is more important for immune modulation by competitive exclusion of pathogens.However, binding is also a first step for the pathogenesis. Probiotics adhere to the extracellularmatrix (ECM) proteins typically exposed in wound tissue. Pathogens often have affinity forthese proteins, which also serve as receptors for invading microbes. Many lactic acid bacteriahave been observed to be able to reduce bioavailability of certain toxins by absorption viz.,absorb environmental toxins; mycotoxins, heterocyclic amines etc. Although, absorbingthese compounds is desirable trait, it is important that such organisms do not be able bind totherapeutic compound or essential nutrients.• If the strain under evaluation belongs to a species with known hemolytic potential,determination of hemolytic activity is required• Assessment of lack of infectivity by a probiotic strain in immunocompromized consumers(add a measure of confidence in the safety of a probiotic)• Animal and human studies: Assessment of side-effects, epidemiological surveillance (postmarket)and degradation of mucines must be carried out.157

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceEvaluation of prebiotic:• Prebiotic characterisation: The component which is claimed to have prebiotic attribute(s) mustbe characterised for source, origin, purity, chemical structure, composition, concentration andamount required to be delivered to the host.• Functionality evaluation: Correlation of physiological effect and modulation of intestinalmicroflora should be substantiated based on studies tested in the target host with the finalproduct type alongwith time framework. A prebiotic can be a fiber but a fiber need not be aprebiotic.FAO has recommended the following guidelines for safety evaluation and substantiation ofprebiotic (Figure 1):• If the product has long history of safe usage then it should be considered as GRAS status andthus no need for further human and animal trials. If it is a new candidate, safe levels must bedetermined.• Levels of consumption for safe and minimum side effects must be established.• The product must be free from contaminants and impurities, characterisation of contaminantshould be done with toxicological studies.• The prebiotic must not alter the gut microbiota in a way detrimental to the host.Global regulatory status:The dietary supplement market for probiotics/synbiotic is gaining momentum at a very fast paceover the globe, hence, regulation of these products is must consumers safety.UNITED STATES: FDA controls the safety of foods of dietary supplements and probiotics thatare sold as components of conventionalfoods or as dietary supplements. The safetyof traditional LAB has been granted GRASstatus. However, new and less traditionalstrains of microbes have to be more carefullyassessed prior to distribution to consumerswith potentially compromised health. In theUS, Title 21 of the Code of Federal Regulations(21 CFR).EUROPEAN UNION: Probiotics/synbiotic dairy foods fall under EC NovelFoods Regulation (258/97) to ensure the freemovement of novel foods, while protectingthe interests of consumers, especially withrespect to safety, health and information.GERMANY: Occupational foundation ofchemical industry has established an expertgroup to assess the safety of microbiologyand biotechnology. This expert group hasalso assessed the safety of microbes andFigure1 Guidelines to evaluate and substantiate a product aspublished a list containing the classification of prebiotic (FAO Technical Meeting, 2007)bacteria used by different industries includingfood and feed industries (Berufsgenossenschaft der chemischen Industrie, 1998).JAPAN: Probiotics/ functional foods fall under the Food for Specified Health Uses (FOSHU)regulation. FOSHU regulations do not specifically define the safety aspects for probiotic microbes butfor functional foods in general and to get FOSHU status company has to get it from Ministry of Healthand Welfare.158

Recent Advances in Synbiotic Dairy Foods and Their Safety EvaluationInternational Dairy Federation(IDF): An expert action team has been constituted in collaborationwith European Food and Feed Culture Association to prepare a position document on properties ofdairy starters and probiotics to be used by the dairy industry..Conclusion and future perspectives:The current safety record of food starter cultures and probiotics appears to be excellent in developedcountries. Although, safety regulation related to functional/ probiotic / symbiotic foods yet to beformulated in India. The future development of probiotics/ synbiotics and also industrial dairy startersrequires stringent guidelines for safety assessment of such organisms. Hence, constant surveillance ofprobiotics/synbiotics is essential specially in clinical applications. Development of safety assessmenttools is extremely important for both premarket safety assessment and post-marketing surveillance ofhuman populations to guarantee safety of future products in humans and animals including immunecompromised.This will enable the future use of microbes and microbial fermentations for a wideningarea in food technology and in functional and clinical food areas.References:Diplock A. T. 1999. Scientific concepts of functional foods in Europe: Consensus Document. Br J Nutr, 81(Suppl 1),S1–S27.Granato D., Branco, G.F., Cruz, A. G., Faria, J.A.F. and Shah, N.P. 2010. Probiotic dairy products as functional foods.Comp. Rev. Food Sci. Safety.9:455-470Ozer, B.H. and Kirmaci, H.A. 2009. Functional milks and dairy beverages. Int. J. Dairy Tech. 63(1):1-15.Ross, R.P., Desmond, C., Fitzgerald, G.F. and Stanton, C. 2005. Overcoming the technological hurdles in the developmentof probiotic foods. J. Appl. Micro. 98:1410-1417.Suvarna, V.C. and Boby, V.U. 2005. Probiotics in human health: A current assessment. Curr. Sci. 88(11):1744-1748.159

Chemical Analysis of Value Added Dairy Products and Their Quality AssurancePhysical Characterization of Dairy Foods withReference to Viscosity, Colour and Water ActivityR. R. B. Singh and Prateek SharmaDairy Technology Division, NDRI, KarnalPhysical properties of foods are manifestations of its inherent compositional make up and structuralorganization of its molecules. While the intrinsic properties of the foods are largely determined byfactors controlled by the material itself, the extrinsic factors are influenced by external conditions. Thecomposition of foods could be determined by either genetically or technologically induced factors.The physical properties of milk components affect the functional properties of the processed foodsand are therefore of significant importance with regard to new product development or selectionof new processing technologies for designing a new product formulation or packaging condition.The principal physical properties of processed dairy foods could include rheology, color, and wateractivity.Viscosity:Texture and rheology are two important physical properties of foods. While texture refers to sensoryperception of the force-deformation relationship, rheology generally refers to response of foods asexemplified by flow properties to application of definite stress or strain. Therefore instrumental datacan be usefully related to sensory data for interpreting the consumer assessment of the sensory qualityof a product. Instrumental data can be alternatively also used for designing equipments, packagingrequirements, processing conditions and evaluation of the finished product quality.Instrumental methods measuring rheology can be classified as (i) empirical or (ii) fundamentalmethods based on the test conditions in relation to the applied force and the resulting deformation(or flow) coupled with the sample geometry. The empirical methods represent large-deformationdata (destructive tests) generated under specified test conditions and are highly product-specific. Thedata generated are useful when a comparison is to be made between different products tested underidentical test conditions. Therefore these data are relevant when effect of processing variables or storageconditions on the rheological properties is to be evaluated and are also appropriate for quality testscarried out routinely. On the other hand the fundamental methods are based on small deformations(non-destructive tests) and the data are generated in well defined (physical or engineering) unitsof mechanical properties viz., viscosity for fluids and various modulii for solids. The results areindependent of the test conditions and appropriate for engineering design considerations. However,rheological parameters measured using fundamental methods are relevant to pure engineeringmaterials rather than complex materials such as foods. Furthermore, while the fundamental rheologicalmeasurements are made in a compression, tension, torsion or shear mode, empirical methods makemeasurements in terms of penetration, extrusion, pressing etc.Liquid foods are often characterized in terms of viscosity. The rheological behavior of fluids maybe Newtonian, pseudoplastic, or Bingham, depending upon the manner in which shear stress varieswith shear rate and time (Fig. 1). While the Newtonian fluids exhibit a viscosity which does not varywith the shear rate, the viscosity of non-Newtonian foods is shear-dependent. Non-Newtonian foodsare hence classified as either shear-thinning type (decreasing viscosity with increasing shear rate) orshear-thickening (dilatant) type (viscosity increases with increasing shear rate), the former being mostcommon to fluid foods. For example, milk with 30% or more total solids is shear-thinning. Alternately,a series of measurements may be made on a non-Newtonian product using a range of shear rates andthe stress-shear rate relationship from the set of data generated expressed in terms of parameters of anappropriate mathematical expression, such as ‘consistency coefficient’ and ‘flow behaviour index’ inthe most frequently used ‘power law’ model.160

Physical Characterization of Dairy Foods with Reference to Viscosity, Colour and Water Activityη=K.γ n-1Where η=viscosity, γ= shear rate, K=consistency co-efficient and n=flow behaviour indexPseudoplastic fluids which exhibit shearthinning are the most common among the non-Newtonian fluids and include emulsions and manytypes of dispersions (Fig. 2). Dilatant fluids containhigher levels of deflocculated solids such as cornstarch in water. Plastic fluids behave as a solid whenstatic and flow only upon application of certainamount of force referred as yield value. Tomatoketch up is a good example of such fluids. Plasticfluids may display Newtonian, pseudoplastic ordilatant properties. Many high viscosity fluidsexhibit thixotrophic behaviour which impliesthat the viscosity drops even at constant shearrate as a result of structural breakdown of foodcomponents until a point when it attains a constantFig. 1. Typical time independent fluids curvesvalue. Subsequently upon quiescent storage ofsuch fluids, structure rebuilds and the viscosityis restored to a limited extent generally below theoriginal value. Rheopexy fluids which are rarelyencountered behave opposite to thixotrophya n dviscosity increases with time when it is shearedat constant rate. In many cases both rheopexya n dthixotrophy may occur in combination with any o fthe flow behaviours described above. Howevertimeis a critical factor when shear rate is constantand therefore while some fluids may take onlyf e wseconds for the viscosity to become constant,othermay take much longer time. Most pseudoplasticliquidfoods follow the power law but the value oft h eexponent, which reflects the extent of digression from Newtonian flow, has not been determined for manydairy and food components. These flow properties Fig 2. Rheogram of pseudoplastic fluidsof these fluid foods affect the mouthfeel andtherefore are very important in determining the acceptability of food.Colour:Colour is another important physical parameter that is important from the point of view ofcharacterizing the dairy products. This is also an indicator of chemical reactions that occur leading toformation of chemical compounds during processing or subsequent storage of the processed foods.These compounds are generally absent or are present in negligible quantities in the raw products andare formed when these are thermally processed. Therefore often the formation of these compoundsis linked to measurement of severity of heat treatment. Storage induced enzymatic or non-enzymaticchanges are also associated with formation of compounds that lead to change in the colour profile ofthe products. Color measurement techniques are used for recording desirable color changes in canningsalmon with higher oil content, defining translucency of the tissues and green pigment degradationafter blanching treatment of green peas, studying browning kinetics, or determining the influence ofparticle sizes in the final color of powders. Characterization of the color of ingredients can also help topredict the color of the final product—for example, control of raw strawberries for processing into jam.In red wine, the percentage of brown component and the relative loss of anthocyanin can be followedby reflectance measurement during storage.161

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceThe color of foods as perceived by the human eye is related to the factors such as the spectralcomposition of the source of light, the food properties, and the spectral sensitivity properties of the eye.Therefore instrumental measurement of colour of any food requires that at least two of these factors arestandardized. As such the human eye can give fairly good estimate of the colour properties of the foodhowever replacing it with instrumental sensor or photocell is known to give a more consistent andreproducible measure of this attribute. Early instrumental methods for color measurement were basedon transmission, or reflection, spectrophotometry. However modern system of color measurement isbased on CIE, Munsell, Hunter, and Lovibond systems. The important factors in these systems aresource of light, geometry of viewing, and background colour. Colour may be specified in terms ofthree characteristics of light: Hue, saturation and brightness. Hue represents dominant wave-length ina mixture of light waves and therefore relates to the dominant color as perceived by the eye. Saturationmeasures relative purity or the amount of white light whereas brightness refers to chromaticity of theintensity. Hue and saturation are together called chromaticity.In CIE system, spectral curves as illustrated in Fig. 3 indicate the response of observers eyes tovarious spectral light types in the visible portion of the spectrum. It demonstrates that any colourcan be matched by mixing different proportion of red, green, and blue. These primary combinationsare called tristimulus values of color. The definite colour of an object can be thus defined in terms ofchromacity coordinates x and y, and by the luminous transmittance or lightness. A chromacity diagramdefines different color points that define the standard colorof a food. The Munsell system (Fig. 4) describes all colorsby three attributes: hue (or type of color), lightness (relativeto the proportion of light emitted), and saturation or purity(associated with clear to dark perception). The hue scale hasten hues distributed on a circumference (scaled 1 to 10); thelightness ranges from black to white (0 to 10) and is distributedon a perpendicular line; the purity is of irregular lengthbeginning with 0 for the central gray to the limit of purityobtainable by available pigments in the Munsell book of color.The Hunter system is also a three-dimensional system usingparameters L*, a*, and b* in each dimension: L* is the lightness(nonlinear), a* is redness or greenness, and b* is yellownessor blueness. Combination of L*, a*, and b* can be convertedto a single color. The Lovibond system is generally used fordetermining the color of vegetable oils. It makes comparison Fig. 3 CIE color systemof visual light transmitted through a glass couvette usingcolor filters. The oil samples oils are generally expressed interms of red to yellow. The Lovibond index are also used tomeasure color in wines and juices. Modern instruments usesoftware to convert light transition spectra into CIE, Munsell,Hunter, and Lovibond color indices.Color can be measuredinstrumentally with Colorimeters are also frequently used tomeasure colour and can be broadly classified as tristimuluscolorimeters and spectrophotometers. The difference betweenspectrophotometers and colorimeters is that the formermeasures intensity of light through the completely visiblespectrum, and colorimeters are designed to measure onlysome parameters related to sensory colors. Colorimeters areparticularly suitable for quality control of foods, and giveresults correlated with visual measurements.Fig. 4. Munshell colour system162

Physical Characterization of Dairy Foods with Reference to Viscosity, Colour and Water ActivityWater activity:The water activity of food can be conveniently expressed as the equilibrium water vapour pressure(P W) over the food system divided by the vapour pressure of pure water (Pow) at the same temperatureand atmospheric pressure:The water activity is correlated to the moisture content of foods. This relationship is known as watersorpition isotherm. The water sorption isotherm for most of the food products is sigmoid in shape. Itcan be divided into segments representing the aw ranges in which the three principal types of waterbinding predominates. The region lying between aw value of 0 and 0.25 is believed to be dominatedby water bound by ionic groups such as NH3 associated withproteins and -COO- groups associated with proteins, pectinsand other polyuronic acids. The moisture in this region istightly bound (known as monolayer moisture), which isgenerally not available for either chemical or microbiologicalactivities. The region lying between aw values of 0.25 and 0.75appears to be related primarily to covalently bound water, suchas amide groups in proteins and -OH groups in proteins andcarbohydrate polymers such as pectins, starch, hemicelluloseand cellulose. In this region, water is bound sufficientlytightly that it is unavailable to most of the microorganisms butavailable for chemical activity. The region lying between awvalues of 0.75 and 1.0 is believed to represent water multilayerson protein and carbohydrate polymers, in addition to waterin which the vapour pressure is reduced by dissolved solutes,such as free amino-acids, sugars, and/or capillary attraction inthe microstructure.The water in this region is loosely boundand is available for chemical and microbial activities. The wateractivity of various dairy products is presented in Table 1.Table 1. Approximate a wlevelsof some dairy productsPRODUCT a Wat 25°CDried Milk Products 0.1-0.3Butter, Unsalted >0.99Salted 0.91-0.93Sweetened Condensed Milk 0.77-0.85Cheese, Hard 0.86-0.97Soft 0.96-0.98Fresh 0.98-0.99Cream >0.99Frozen Desserts 0.98-0.99Fermented Milk Products 0.97-0.99Milk And Whey 1Khoa 0.96Paneer >0.99Fried Paneer 0.97Information on water binding is helpful in determining the energy requirements and conditionsfor drying of specific materials; controlling the growth of microorganisms to minimize qualitydeterioration; ensure safety, and selecting the appropriate microflora in certain foods, e.g. ripeningcheese; for evaluation of water uptake, porosity, sorption/desorption enthalpies; estimation of specificsurface area, crystalline state of components (lactose), and facilitating control of several chemical,physical and quality attributes of stored foods in addition to ensuring microbial stability. Besidesdeterminant role played by aw in influencing the stability of quality parameters, aw has many otherpractical applications such as prediction of packaged product moisture gain/loss and prediction ofshelf-life of packed food.Measurement of water activity: Analytical instruments or methods for aw value determinationare many. The important ones are: Hair hygrometers, Isopiestic methods, Electronic hygrometersetc.Hair Hygrometry: Measurements is based on the magnitude of longitudinal change in length ofwater-sorbing fibre in the same container at equilibrium. This measurement is based on the principlethat the keratinaceous proteins in hair strands stretch under tension, when they absorb moisture. Ifthe hair strand is fixed at one end and attached to an indicating lever arm at the other end, the relativehumidity within an enclosure can be read directly. The hair hygrometer is a dial-type polyamidethread hygrometer. This type of hygrometer is relatively inexpensive. Its accuracy is comparable toothers (i.e. + 0.02 upto 0.01).163

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIsopiestic Methods: This method provides the measurement of equilibrium relative humidity ofany aqueous systems in a closed container at a specified temperature. This is based on a principlethat most food substances are consistently adjusting their moisture content through absorption ordesorption processes depending upon the moisture condition and temperature of the environmentuntil the food substances approach equilibrium. In other words, the equilibrium vapour pressure ofthe reference salt slush will be identical to the vapour pressure of the sample at equilibrium condition.In this method, multiple samples must be measured at different equilibrium conditions using differentsalt slushes in desiccators. Upon equilibrium the sorption isotherm is drawn and the aw is measuredagainst moisture content of the food.Electronic Hygrometers: This type of instrument features the use of calibrated aluminium oxideor lithium chloride humidity sensors. Recalibration or standardization of sensor response is by a set ofreference salt slushes. Water activity measurement is carried out by connecting the appropriate sensorto an airtight food sample container and equlibrated at a specified temperature. Since the sensoris sealed in a small container, it usually takes less than 2 hr for a sample to approach equilibriumconditions. These instruments provide a better and convenient means of a wmeasurement withadequate accuracy and precision. However, they are susceptible to contaminants such as SO 2, H 2S,Chlorine and oil vapours. Temporary contaminants include ammonia, acetic acid, alcohols, glycol,glycerols, etc. depending upon the sensor material used. Foods usually contain these contaminants,thereby reducing the useful life of the sensors.The instrument using principle of chilled mirror dew point measurement to calculate aw of a givenfood sample is one of the frequently used systems. When a sample is placed in the instrument, a stainlesssteel mirror within the chamber is repeatedly cooled and heated. The mirror temperature is controlled bya thermoelectric (Peltier) cooler. A fan placed in the instrument continually circulates air in the sensingchamber to hasten the equilibration process. The precise determination of the temperature at whichthe condensation first appears is done with a photoelectric cell. The photodetector senses the changein reflectance when condensation occurs on the mirror. The temperature at which the condensationoccurs is recorded with the help of a thermocouple attached to the mirror. Simultaneously, the sampletemperature is also measured. Both the temperature of sample and the mirror temperature are usedfor calculating the a w. The a wis calculated and compared with the previous measurement and theprocess terminates with a beep only when two consecutive readings does not differ by more than0.001. The instrument thus displays the temperature of sample and a w.References:Sogi D. S (2008). Fundamentals of rheology. In compendium of the short course on “Sensory and related techniques forevaluation of dairy products” under Centre of Advanced studies held at Karnal from June 17-July 07, 2008214-220,pp.66-71.Rao M. A (2005) Rheological properties of liquid foods. In: Engineering properties of foods (Ed M. A. Rao, A. K. Dattaand S. S. H. Rizvi) CRC Press, USA.Patil G. R. (2003) Water activity of foods in relation to packaging. In compendium of the short course on “Advancesin Packaging of Dairy and Food Products” under Centre of Advanced studies held at Karnal from February 13 –March 05, 2003, pp.66-71.Francis F J (2005) Color properties of foods. In: Engineering properties of foods (Ed M. A. Rao, A. K. Datta and S. S. H.Rizvi) CRC Press, USA.164

Malt Based Milk Foods as “Value Added Functional Dairy Products”Introduction:Malt Based Milk Foods as “Value AddedFunctional Dairy Products”Laxmana Naik, Rajan Sharma, Manju G. and Amit K. BaruiDariy Chemestry Division, NDRI, KarnalFood is a basic nutritional requirement, but as a result of substandard diet, approximately 925million people are suffering from undernutrition in different regions of the world. Consequently alarger population in the underdeveloped world fall prey to the protein deficiency On the other handbusy lifestyles fragmented eating habits, change in consumer perception towards physical appearance,dietary choices and more importantly demanding an ideal wholesome food that address many diet andhealth related issues. Thus there is a need for developing a value added nutritional food supplement.Much of scientific evidence has shown that there is a strong positive relationship between consumedfoods and human health, and that there is a beneficial correlation between the function of variousfood components to the treatment and prevention of specific illnesses. Therefore, consumer interesthas focused on a diet with the capability to promote good health and to extend a healthy life span, thisstrongly promoted in the functional foods development.What makes a Functional food and what is the best source?Functional foods may be defined as any food, in a natural or processed form, that contains, inaddition to its nutritional components, substances which favor the good health, physical capacity andmental wellbeing of an individual. (Vasconcelles, 2001). Most of the individual foods are deficient in oneor other type of constituents which are very essential to human health. To prepare a diet nutritionallycomplete it is essential to make a complement of two or more foods which synergistically makeup thedeficiency of each other. Milk is an ideal food but milk proteins are deficient in sulfur containing aminoacids like methionine and cystein. Cereals on the other hand are generally deficient in lysine, threonineand tryptophan. Thus in order to develop a balanced food cereal protein should be supplemented withmilk protein. Nutritional merits of milk are well acclaimed. The malted barley is rich source of readilydigestible carbohydrates, proteins and provides a carbohydrate splitting α-amylase enzyme whichhydrolyses the insoluble starch ingredients into readily soluble sugars like maltose, dextrose, glucoseetc. This is also a good source of soluble fiber like β-Glucans and other health-promoting components.Recently U.S. Food and Drug Administration finalized a rule that allows foods containing barley tocarry a claim that they may reduce the risk of coronary heart disease. Hence special supplement andenrichment is made by use of milk and malted barely. These major ingredients synergistically fulfillmost of the nutritional and technological requirements in making an ideal wholesome food.Malt based milk foods fall in the category of nutritional functional health foods, these are preparedby a mixture consisting of standardized milk or milk solids with the fluid separated from the mash ofground barley malt. Depending on the intended use these foods are prepared either in liquid form fordirect consumptions or in dried powdered form to be use as an ingredient for reconstitution and sometimes a base material for other food recipe.Historical background of Malted Milk:In 1878 William Horlick and James Horlick, brothers, established a Horlick Food plant in theoutskirts of Racine, Wisconsin USA. They began to manufacture a product known as Horlick’s Foodby enriching milk with malted barley, they under took a research on this product at the request ofsome physician who wanted to have an infant food combining milk and cereal, First successful maltedmilk food was developed in 1883 and the product commercially marketed in 1887. This productgained favorable attention from the medicinal professionals and public due to its nutritional value,convenience, digestibility and palatability.165

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceMyth about Malted Barley:Barley is one of the seven internationally grown cereal grains, currently ranking fourth in worldproduction (FAO 2006). Belongs to the genus Hordeum and the major cultivated barley species isHordeum vulgare. Malted barley means the product obtained from soaking or steeping the wholebarley kernel followed by germination and drying in a controlled environment.What makes barley so special; Barley is a rich source of both soluble and insoluble fiber and it isone of the dieter’s delight” component. However, researchers have identified β-glucan as the primarycomponent in barley that is responsible for lowering cholesterol. Based on scientific evidence, the Foodand Drug Administration (FDA) finalized a rule in 2006 allowing barley foods to carry a health claimspecific to soluble fiber and relating to both for reducing cardiovascular disease risk and modifyingglycemic responses for treatment and prevention of diabetes (Lazaridou and Biliaderis 2007).Qualifying products may use the following claim: “Soluble fiber from foods such as [name offood], as part of a diet low in saturated fat and cholesterol, may reduce the risk of heart disease. Aserving of [name of food] supplies [x] grams of the soluble fiber necessary per day to have this effect.”Specifically, a food made from eligible barley sources must contain at least 0.75 g of β-glucan (solublefiber) per serving (FDA 2006).Malt based milk food: DefinationDefined as “Malt based milk food means the product obtained by mixing whole milk, partlyskimmed milk or milk powder with the wort separately from a mash of ground barley malt, anyother malted cereal grain and wheat flour or any other cereal flour or malt extract with or withoutaddition of flavouring agents and spices, emulsifying agents, eggs, protein isolates, edible commonsalt, sodium or potassium bicarbonate, minerals and vitamins and without added sugar in such amanner as to secure complete hydrolysis of starchy material and prepared in a powder or granule orflake form by roller drying, spray drying, vacuum drying or by any other process. It may contain cocoapowder. It shall be free from dirt and other extraneous matter. It shall not contain any added starch(except starch natural to cocoa powder) and added non-milk fat. It shall not contain any preservativeor added colour. Malted milk food containing cocoa powder may contain added sugar” (PFA 1955).The requirements according to PFA 1955 and Bureau of Indian Standards (IS-1806-1975) itshall confirm the fallowing standards.Characteristics166Malted Milk Food withoutCocoa powderMalted Milk Food with CocoapowderMoisture, % by mass Not More Than 5.0 Not More Than 5.0Total Protein (Nx6.25), % by weight Not Less Than12.5 Not Less Than 11.25Fat, % by weight Not Less Than7.5 Not Less Than 6.0Total Ash, % , dry basis Not More Than 5.0 Not More Than 5.0Acid Insoluble ash, in Dilute HCl, % Not More Than 0.1 Not More Than 0.1Alcoholic Acidity, % H 2SO 4in 90% alcohol Not More Than 0.3 Not More Than 0.3Solubility, % by weight Not Less Than 85.0 Not Less Than 85.0Cocoa Powder, % dry basis N/A* Not Less Than 5.0Test for Starch Negative N/A*Bacterial Count, Per gram Not More Than 50000 Not More Than 50000Coliform Count, Per gram Not More Than 10 Not More Than 10Yeast and Mold Count, per gram Not More Than 100 Not More Than 100Salmonella and Shigella Absent in 25 gm Absent in 25 gmE. Coli Absent in 10.0 gm Absent in 10.0 gmVibrio cholera and V. paraheamolyticus Absent in 0.1 gm Absent in 0.1 gmFaecal streptococci and StaphylococcusAbsent in 0.1 gmAbsent in 0.1 gmaureas* N/A: Not applicable.

Malt Based Milk Foods as “Value Added Functional Dairy Products”Basic Ingredients of malted dairy foods:1.2.3.4.Malted Barley: Provide appropriate levels of α-amylase enzyme required to convert all the starchinto simple sugars and also imparts typical malty flavor to the finished product.Malt Extract: This is a concentrated extract from roasted malted barley with a solid ofapproximately 80 per cent, imparts desired level of colour and typical caramelized flavor.Milk and Milk solids: Enhance nutritional value of the product by providing high quality protein,vitamins, minerals and milk fat provides unique flavor.Wheat flour, wheat gluten, isolated soy protein, malto dextrin, vitamin premixes, salts and othermicro ingredients are supplemented to improve the nutritional requirement, provide optimumpH for better digestibility, enhancing flavor and for value addition.Method of Preparation:In the manufacturing of malt based milk food (Figure 1) mashing is the first step fallowed bymix preparation, pasteurization of mix and concentration of mix in first stage up to 50 per cent solidsthen this base material can be directly spray dried or further concentrated up to 80 per cent solids inmultiple effect evaporator then vacuum oven dried or either band dried (Dhillon, 2005).Figure 1: Flow chart for production of malt based milk food.167

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceQuality related Issues:Quality related issue either of physical, chemical or microbiological problems hampersmanufacturing and business performance and ultimately to the safety of consumer health. Hence itis very much essential to address at the root level. Critical to quality issue arises mainly due to 5 Mfactors; these are Man, Machine, Methods of preparation, Materials quality and Mother nature ofproducts. It is often overlooked fact that just about every food item we eat is biological in origin,consumer expect our food should to be fresh, wholesome, and not to contain any unnecessary addedadditives. In ordered to preserve food from microbes; processing at high temperature is essential butleads to loss of nutritional and volatile compounds, hence it is optimally processed so that nutritionalidentity is retained but many of these components are very heat sensitive, creates problem duringprocessing, major bottleneck are their bioactivity will diminishes and loss of volatile aroma compoundsbut fortification in final stage is possible. Encapsulation of sensitive ingredients helps in protectingfrom thermal shock.Functional ingredients and Health benefits of malted milk foods:Malted barley has received attention from health professionals hence barley is used as the maincereal grain for the development of functional foods, as it contains two classes of compounds of strongnutritional interest: β-glucans (dietary fiber) and tocols (antioxidant - vitamin E).Dietary fibers, such as β-glucans, are defined as the edible parts of plants and analogouscarbohydrates that are resistant to digestion and absorption in the human small intestine with completeor partial fermentation in the large intestine. Dietary fiber includes polysaccharides, oligosaccharides,lignin, and associated plant substances (AACC 2001). A diet rich in fiber has health benefits includinglowered energy density, prolonged satiety, and effects related to an increase in fecal bulk. Foodscontaining soluble dietary fiber have been shown to lower serum cholesterol levels, postprandialblood glucose, and insulin response (Jenkins et al., 2000).There are three mechanisms for barley’s hypocholesterolemic effects are: (1) reduced absorptionof dietary lipids including cholesterol; (2) reduced absorption of bile acids; and (3) production ofvolatile fatty acids in the large intestine that are reabsorbed, and act as inhibitors of β-hydroxy-βmethylglutaril coenzyme A (HMG-CoA) reductase in the liver (McIntosh and Oakenfull 1990).It is important for diabetics to know the glycemic potential of food carbohydrates. The glycemicindex (GI) is a powerful method for nutritional characterization of carbohydrates and has beenproposed to diabetic subjects as a tool for managing their diet. Epidemiological data indicates that adiet characterized by a low GI reduces insulin resistance and improves certain metabolic consequencesof insulin resistance. This suggests a potential role against both the development of non-insulindependentdiabetes mellitus (NIDDM) and cardiovascular diseases (Björck et al., 2000).Tocols (tocopherols and tocotrienols) are well recognized for their biological effects, includingantioxidant activity (Kamal-Eldin and Appelvist 1996) and reduction of serum LDL-cholesterol.While tocopherols, mainly α-tocopherol, are considered to have the greater biological activity,tocotrienols have been the focus of growing research interest as unique nutritional compounds fortheir hypocholesterolemic action. Among the four tocotrienol isomers, γ-tocotrienol and δ-tocotrienolseem to be more effective than α-tocotrienol. Tocotrienols are reported to be capable of reducingserum LDL-cholesterol in chickens, swine, and human subjects. They may act as inhibitors of theHMG-CoA reductase, a rate-limiting enzyme of cholesterol biosynthesis (Qureshi et al., 1991). Somestudies indicate that the antioxidant potential of tocotrienols is even greater than that of α-tocopherolin certain types of fatty cell membranes and in some brain cells. Moreover, recent studies suggestthat tocotrienols may affect the growth and/or proliferation of several types of human cancer cells(Nesaretnam et al., 1998).168

Malt Based Milk Foods as “Value Added Functional Dairy Products”Conclusion:There is no room for second thought to it that food is going to be a medicine, consumersdemanding that they need a food which can overcome all the health related risk. Opportunities beforethe technologist is that formulation and design of a product containing bioactive substances, but manyof these components are very heat sensitive, creates problem during processing, major bottleneckare their bioactivity will diminishes and loss of volatile aroma compounds. Some efforts are madelike; Probiotic malted milk made by encapsulation of probiotics and subsequent drying. At presentIndian malted milk industry growing at a rate of 8 to10 per cent, because of marketing strategy andadvertising, brand image, the health claims, variants, ease of convenience.References:1. AACC (American Association of Cereal Chemists). 2001. The definition of dietary fiber. AACC Report., 46:3,112-126.2. Baldwin, A.J., Baucke, A.G. and Sanderson, W. B. 1980. New Zealand J. Dairy Sci.Tec., 15: 286.3. Björck, I., Liljeberg, H. and Ostman, E. 2000. Low glycemic-index foods. British Journal. of Nutrition., 83:149-155.4. Dhillon, L.S. 2005. Manufacturing of malt based food products. Ind. Dairyman., 57:4, 59-66.5. FAO. 2006. World crop production. Published online at http://www.faostat.fao.org.6. FDA (U.S. Food and Drug Administratin). 2006. Food labeling: health claims; soluble dietary fiber from certainfoods and coronary heart disease. Fed. Reg. 71:29248–29250.7. Food Safety and Standards Regulations, 2010. Final Regulations Hand Book, 349-351.8. Jenkins, D.J.A., Axelsen, M., Kendall, C.W.C., Augustin, L.S.A, Vuksan, V. and Smith, U.2000. Dietary fibre, lentecarbohydrates and the insulin-resistant diseases. British Journal of Nutrition., 83:S1,157-163.9. Kamal-Eldin, K. and Appelqvist, L.A. 1996. The chemistry and antioxidant properties of tocopherols andtocotrienols. Lipids., 31:7, 671-701.10. Lazaridou and Biliaderis. 2007. Barley products to carry heart health claim. Food Navigator-USA. Published onlineat http://www.foodnavigator-usa.com.11. McIntosh, G.H. and Oakenfull, D. 1990. Possible health benefits from barley grain. Chemistry in Australia., 57: 294-296.12. Nesaretnam, K., Stephen, R. Dils, R and Dabre, P. 1998. Tocotrienols inhibit the growth of breast cancer cells,irrespective of estrogen status. Lipids., 33: 461-469.13. PFA. 1955. The Prevention of Food Adulteration Act & Rules Hand Book, as on 1.10.2004. 329-330.14. Qureshi, A.A., Qureshi, N. Wright, J.J. Shen, Z. Kramer, G. Gapor, A. Chong, Y.H. DeWitt, G. Ong, A. andPeterson, D.M. 1991. Lowering serum cholesterol in hypocholesterolemic humans by tocotrienols. The AmericanJournal of Clinical Nutrition., 53: 1021s-1026s.15. Rosemary, K. N and Walter, C.N. 2008. Text Book of: Barley for Food and Health: Science, Technology, and Products.John Wiley & Sons Inc. pub.16. Salooja, M. K and Balachandran, R. 1988. Physical properties of spray dried malted milk powder, Ind. J. of DairySci., 41:4, 456-461.17. The Hindu, 2010. U. N. Warns of food crisis. 15-09-2010, ISSN 0971-751X 133:220:9.18. Vasconcellos, J.A. 2001. Functional foods. Concepts and benefits. The World of Food Science.. www.worldfoodscience.org:80/vol.1_3/feature1-3b.html.169

Chemical Analysis of Value Added Dairy Products and Their Quality AssurancePreparation and Characterization of GoldNanoparticles, Their Conjugation with Antibodiesand Construction of Lateral Flow DevicesPriyanka Singh Rao 1 , Swapnil Sonar 2 , Y.S. Rajput 2 and Rajan Sharma 11Dairy Chemistry Division, 2 Animal Biochemistry Division, NDRI, KarnalLateral Flow Assays also known as Immunochromatographic assays are a simple device intendedto detect the presence (or absence) of a target analyte in sample (matrix). Traditionally designed assaysare composed of a variety of materials, each serving one or more purposes. Colloidal gold is the mostwidely used label today in commercial lateral flow immunoassays for many reasons. It is fairly easy andinexpensive to prepare in the laboratory. The color is intense, and no development process is neededfor visualization. A large body of protocols exist in the literature for its conjugation and application.Gold colloids are formed by the reduction of gold tetrachloric acid through a “nucleation” process.The size and shape of the colloids depend on the type and amount of reducer used. The label is verystable in liquid or dried form and is non-bleaching after staining on membranes. An accurate andreproducible lateral-flow assay requires the use of high-quality gold conjugates. Gold particles canbe produced that range in size from 5 to 100 nm in diameter. The most common size of colloidal goldparticle used is 40 nm. In addition, colloidal gold in unconjugated forms (which are ready for labeling)and conjugated forms (conjugated with biologicals) are now readily available from many commercialsources. In addition to the dry parts of a lateral-flow assay, there are also the biological components thatallow the visualization of the results. By virtue of their high levels of specificity and binding affinities,antibodies are the ideal choice of agent for detection. In Lateral Flow Assay an antibody molecule isconjugated to a colloidal gold particle. Antibodies can be polyclonal or monoclonal. Once the antibodyhas been conjugated, the quality of the gold conjugate must be assessed before incorporation into therapid-test assay. Usually, electron microscopy is employed as a quality-control measure. Conjugationof colloidal gold particles and antibodies depends on the availability and accessibility of three aminoacid residues—lysine, tryptophan, and cysteine. Once a high-quality antibody–gold conjugate isformed, it can be applied to the conjugate pad either by soaking or by spraying. The drying process thatfollows is essential. The lateral flow immunoassay devices are compact and easily portable. A test striptypically consists of a plastic backing holding together a sample pad for deposition of sample fluids,a conjugate pad pre treated with sample detection particles, a microporous membrane containingsample capturing reagents, and an absorbent pad at the distal end serving to collect excess fluids.A. Preparation of Gold Nano ParticleMaterial: All the chemicals required for the preparation for gold nanoparticles can be procuredfrom Sigma-Aldrich Ltd.Reagents:1. Stock gold chloride (tetrachloroauric acid trihydrate, Mol.Wt. 393.83; 200 mM) solution- 787.6mg of HAuCl 4.3H 2O is dissolved in Millipore water and volume is made up to 10 ml. The stocksolution is stored at room temperature.2. Working gold chloride solution (50 mM) - Stock gold chloride solution is diluted four times withMillipore water.3. Trisodium citrate dihydrate (38.8 mM; M.W. 294) - 114 mg of trisodium citrate dihydrate isdissolved in 10 ml Millipore water.Procedure:1. 1. Prepare aqua regia by mixing 3:1 concentrated HCl:HNO in a large beaker in a fume hood.3Be extremely careful when preparing and working with aqua regia. Wear goggles and gloves,170

Preparation and Characterization of Gold Nanoparticles, Their Conjugation with Antibodies and Construction of Lateral Flow Devicesand perform the experiment in a fume hood. Aqua regia should be freshly prepared andshould never be stored in a closed vessel. The capped aqua regia bottle may explode. Renderit safe by dilution and neutralization.2. Soak the 200 ml two-neck flask, magnetic stir bar, stopper and condenser in aqua regia for atleast 15 min. Rinse the glassware with copious amount of deionized water and then Milliporefilteredwater. Obtaining high-quality nanoparticles is the first important step towardsthe success of the experiment. Care should be taken to make sure that no contamination isintroduced during nanoparticle synthesis.3. Load 98 ml of Millipore water into the two-neck flask. Add 2 ml of 50 mM HAuCl solution so4that the final HAuCl 4concentration is 1 mM.4. Connect the condenser to one neck of the flask, and place the stopper in the other neck. Put theflask on the hot plate to reflux while stirring.5. When the solution begins to reflux, remove the stopper. Quickly add 10 ml of 38.8 mM sodiumcitrate, and replace the stopper. The color should change from pale yellow to deep red in 1min. Allow the system to reflux for another 20 min.6. Turn off heating and allow the system to cool to room temperature (23–25°C) under stirring.B. Characterization of gold nanoparticlesThe diameter of such prepared nanoparticles is ~13 nm. The extinction value of the 520 nm plasmonpeak is 3.8, and the nanoparticle concentration is ~13 nM. The colour should be burgundy red, andthe nanoparticle shape should be spherical under transmission electron microscopy (TEM). All goldsols display a single absorption peak in the visible range between 510 and 550 nm, and the absorptionmaximum shifts to a longer wavelength with increasing particle size. The relative uniformity of theparticles or the range of particles can be gauged by the width of the absorption spectra: the sharper theband, the more uniform the particles. The relative concentration of each batch of colloidal gold can bedetermined by absorbance at 520 nm. Various batches can be brought to the same relative concentrationby the addition of de-ionized water.C. Labelling of gold nanoparticles with antibodyReagentsi. NaOH (0.2 N)ii. Carbonate Buffer (5 mM)iii. Tris-HCl buffer (pH 8.2) containing 1% BSA and 0.1 sodium azideProcedure: Adjust the pH of Gold nanoparticle using 0.2 N NaOH to 8.5. 6 µl (20 µg) of affinitypurified antibody (against glycomacropeptide) is diluted to 160 µl with carbonate buffer and added tonanoparticles. The mixture is incubated overnight at 4ºC. Centrifuge the contents at 7,000 rpm at 15ºCfor 15 minutes. Suspend the pellet in carbonate buffer and again centrifuge at 7,000 rpm at 15ºC for15 minutes. Decant the supernatant anddissolve the pellet in Tris-HCl buffer.Store the antibody labelled nanoparticlesat 4°C till further use.D. Construction and workingof lateral flow stripMaterials: All the material requiredfor the construction of lateral flow strip,can be purchased from Milipore IndiaPvt. Ltd. Bangalore.Procedure: Lateral flow assays areSide view of test-strip construction171

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancecomposed of a variety of materials, each serving one or more purposes. The parts overlap onto oneanother and are mounted on a backing card using a pressure-sensitive adhesive. Each component of thetest, including membrane, backing substrate, and each of the pad materials, has a defined dimension. Onconjugation pad Gold nanoparticles are coated with antigen specific antibodies.Test line is also coatedwith the antigen specific antibody and Control line with species specific anti-antibody for the antibodyin the particulate conjugate.The sample is treated to make it compatible with the rest of the test. The treated sample migratesthrough this region to the conjugate pad, where a particulate conjugate has been immobilized. Thesample interacts with the conjugate as both migrate into the next section of the strip, which is themembrane. Excess reagents move past the capture lines and are entrapped in the wick or absorbentpad. The control line indicates that the test developed properly and test line indicates that the test ispositive.172

Use of Lateral Flow Technique for Detecting Melamine in MilkIntroductionUse of Lateral Flow Technique forDetecting Melamine in MilkRaman Seth and Anamika DassDairy Chemistry Division, NDRI, KarnalMonitoring of milk and milk product for quality and safety during entire food chain is of majorconcern to the food producers and to the consumers. In the present scenario, consumers always preferhigh quality and safe foods. Dairy industry always looks forward for innovative tests to access dairyproduct for their quality. Therefore a holistic approach for checking the quality of any food productis an essential requirement. The Indian dairy industry is passing through a phase of adulterationin milk and milk product. Poor quality raw milk is either neutralized or preserved with differentpreservatives. Recently the menace of melamine addition in milk powder in order to enhance its proteincontent has been reported in China which caused death of many infants. Nitrogenous compounds likeurea, ammonium salts can be detected by simple and rapid test but presence of melamine cannot bedetected by simple test. In recent years incidence of melamine addition in infant milk formula hasbeen reported in media especially in China.Melamine is a chemical used primarily for the production of melamine resins. Because of its highnitrogen level (66% by mass), melamine is illegally added to milk product especially to milk powderin order to compensate for protein content when estimated on the basis of total nitrogen. Ingestion ofmelamine at levels above the safe limit (2.5 ppm in the USA and 1 ppm in European Union for infantmilk powder) can induce renal failure and even death in infants. Melamine, a non protein nitrogensubstance when added to any food product increases the total nitrogen content. Adulteration of proteinrich foods with melamine increases the crude protein content .This reminds us the recent scandalin China where attempts were made to increase the nitrogen content in infant food with melaminewhich accumulates in the body on feeding melamine contaminated milk and caused toxicity problem,there by forming solid stone deposit within kidneys or bladder which ultimately damage kidneys.Infants fed regularly with milk containing melamine were more susceptible to urinary infections.Thousands of infants were affected and several died in China due to melamine contamination in milk.However, the existing analytical methods for estimation of melamine in milk such as low temperatureplasma probe combined with tandem mass spectroscopy (LTP/MS), liquid chromatography–massspectrometry (LC/MS), Electrospray ionization coupled with mass spectrometry (EESI-MS), Enzymelinked immunosorbent assay (ELISA) and High performance liquid chromatography (HPLC) methodsinvolves cumbersome steps along with expensive instrumentation thus making difficult to take decisionwhether to accept or reject the milk for further processing into milk products. Therefore there is anurgent need to develop a simple test for detection of melamine in milk to stop unscrupulous person toadulterate milk with such harmful chemicals. Development of simple and rapid test for detection ofmelamine in milk and food has become a challenge for researchers. Color indicator for the presence ofmelamine in milk using gold nanoparticles may find important application in detecting melamine. In2008 in China, reports appeared in media where attempts were made to increase the protein contentin infant milk food using melamine .Thousands of infants were affected and several died in China.Milk protein contributes 30% of total milk solids. At present in India, the payment of milk indairy industry is made on the basis of fat, and SNF. Milk supplier’s uses various adulterants suchas urea, ammonium salts, starch, sugar, skim milk powder, maltodextrin, etc to increase the totalsolids in milk. Chemical tests are available to detect such common adulterants. Melamine is one of therecent adulterant which is reported in China and is used as a source to enhance the protein content ininfant milk powder. Melamine contains high nitrogen level (66% by weight),easily available and is notmuch costlier. For such reasons melamine adulteration in milk is rampant. Melamine is commercially173

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceavailable as white powder, odourless and does not impart any undesirable sensory attributes whenadded to milk. So it becomes very difficult to detect its presence when organoleptic and platform testsare performed at the reception dock of milk plant.MelamineMelamine is an organic base and a trimer Properties of melamineof cyanamide, with a 1,3,5-triazine skeleton. 1 Other name Cyanurotriamide , cyanurotriamine,Like cyanamide, it contains 66% nitrogencyanuramideby mass and when mixed with resins, has 2 IUPAC Name 1,3,5 triazine 2,4,6 triaminefire retardant properties due to release of3 Molecular formula C3H6N6nitrogen gas when burned or charred.It hasseveral other industrial uses also.4 Molar mass 126.125 Density 1574 kg/ m3The chemical term melamine wascoined by combining the names of two 6 Melting point 3500Cgerman words Melam (a distillation 7 Solubility in water 3.240 g / L at 200 Cderivative of ammonium thiocyanate)and amine .Melamine when combined with formaldehyde produces melamine resin, a very durablethermosetting plastic used in formica, and melamine foam, a polymeric cleaning product. Melamineresin is used in the production of dry erase boards, fabrics, glues, kitchen housewares and flameretardants. Melamine is one of the major component in pigment yellow 150, a colorant in ink andplastic Melamine is also used in the fabrication of melamine poly-sulfonate as a superplasticizer formaking high-resistance concrete (www. Wikipedia. com).Sulfonated melamine formaldehyde (SMF)is a polymer used as cement admixture to reduce the water content in concrete while increasing thefluidity and the workability of the mix during its handling and pouring. It results in concrete witha lower porosity and a higher mechanical strength exhibiting an improved resistance to aggressiveenvironments and therefore has a longer durability. The use of melamine as a fertilizer for crops hadbeen envisaged during 1960 because of its high nitrogen content. To be effective as a fertilizer, it isessential that the plant nutrients should be made available in a manner that matches the needs ofthe growing crop. The nitrogen mineralization process for melamine is extremely slow, making thisproduct both economically and scientifically impractical for use as a fertilizer. Melamine derivativesof arsenical drugs are potentially important in the treatment of African trypanosomiasis. In 1958,melamine was used as a source of Non-Protein Nitrogen (NPN) for cattle.Melamine toxicityMelamine is described as being harmful if swallowed, inhaled or absorbed through the skin.Chronic exposure may cause cancer or reproductive damage. Melamine can also affect eye, skin andrespiratory system. However, the toxic dose is at par with common table salt with an LD50 of morethan 3 grams per kilogram of bodyweight. Melamine and cyanuric acid can also be absorbed intothe bloodstream, concentrate and interact in the urine-filled renal microtubules, then crystallize andform large numbers of round, yellow crystals, which in turn block and damage the renal cells that linethe tubes, causing kidneys failure. The European Union has set a standard for acceptable humanconsumption of melamine at 0.5 milligrams per kg of body weight, Canada has declared a limit of 0.35mg and the USFDA’s limit was put at 0.63 mg, but was later reduced to 0.063 mg/kg body weightdaily. The amount of melamine a person could withstand per day known as the "tolerable daily intake"(TDI), is 0.2 mg per kg of body mass without incurring a major health risk.Melamine is reported to have an oral LD50 of 3248 mg/kg body weight in rats, while in rabbits itwas reported to be more than 1000 mg/ kg body weight for rabbits . A melamine cyanurate commonlyused as an fire retardant could be more toxic than either melamine or cyanuric acid alone. For rats andmice, the reported LD50 for melamine cyanurate was 4.1 g/kg body weight and 3.5 g/kg body weightwhen compared to 6.0 g and 4.3 g/kg body weight for melamine and 7.7 g and 3.4 g/kg body weightfor cyanuric acid, respectively. .174

Use of Lateral Flow Technique for Detecting Melamine in MilkIngestion of melamine may lead to reproductive damage or bladder or kidney stones, which canlead to bladder cancer . Dogs when fed with 3% melamine in diet regularly for one year showedchanges in their urine i.e. reduced specific gravity, increased urine output, melamine crystalluria,protein occult blood (WHO Report 1999). Crystals were formed in the kidneys when melaminecombined with cyanuric acid was fed to dogs.In April 2007,the newspaper The New York Times reported that the addition of "melamine scrap"into fish and livestock feed gave the false appearance of a higher level of protein which became an"open secret" in many parts of China.In China, several companies were implicated in a scandal involving milk and infant formulawhich had been adulterated with melamine, leading to kidney stones and other renal failure especiallyamong young children. Melamine may have been added to milk to fool government with regard toprotein content test after water was added to fraudulently to dilute the milk. Because of melamine'shigh nitrogen content (66% by mass), it can cause the protein content of food to appear higher thanthe true value. About 20 percent of the dairy companies tested in China sell products tainted withmelamine (Guan et. al 2009).2.1.4 Methods for testing melamine in milkUntil 2007, melamine had not been routinely monitored in food, except in the context of plasticsafety or insecticide residue. This could be due to the previously assumed low toxicity of melamineand the relatively expensive method of detection. Different methods for the analysis of melamine infood and milk developed by (USFDA 2008 ,http://www.wikipedia.org/wiki/melamine) have beenmentioned in Table1Table1: different methods for the analysis of melamine in food and milk developed by(usfda 2008 ,http://www.Fsis.Usda.Gov )Method Application Limit of detection Analogues detectedGC / MS Various foods 2ppm Melamine,Ammeline AmmelideCyanuric AcidELISA Used for wheat gluten, moistpet food, dried pet food, milkand milk powder10 ppm for wheat gluten, 2 ppmfor moist pet food, 4 ppm fordried pet food, 2 ppm for milkand 10 ppm for milk powderMelamineHPLC/UV USFDA for meat 25 ppb Melamine / Cyanuric AcidHPLC/UV Used for wheat Gluten andrice protein100ppmMelamine, Ammeline, and CyanuricacidHPLC/UV Used for beverage 50 ppb MelamineHPLC/UV Used for cereal fl our 5 ppm for Melamine, Ammeline,Ammelide, 90ppm for CyanuricacidMelamineHPLC/UV Used for meat and pet food 10 ppb Melamine,Cyanuric acidDetection of melamine in milk using melamine stripMelamine strips procured from cusabiotech were used for detection of melamine in milk. Presenceof melamine in milk was detected with the appearance of one pink or purple band in the test regionwhile two pink or purple bands were observed in case of control milk. This test is very simple, rapidand could detect up to 100ppm melamine in milk .Fig 1 and 2 shows the pattern of pink bandsappearing on melamine strip when prepared milk filtrate were applied. Another advantage of thistest is that only 3-4 drops of sample is required and no instrument is required.175

Chemical Analysis of Value Added Dairy Products and Their Quality AssurancePreparation of sample for melamine stripSkim Milk Powder extraction protocol:1. Add 1ml of methanol: water mixture ( 60:40) to 1g skim milk powder sample and Vortex thetube vigorously.2. Sonicate for 1min and then shake for 1 min. Allow it to stand for 5 min.3. Transfer the supernatant to another tube, centrifuge at 10000 rpm for 5min.4. Filter the supernatant through Whatman filter paper No 1, the filtrate is ready for the assay.Liquid milk extraction protocol (1:2.5)1. Add 150μl of methanol : water mixture ( 60:40) to 100μl liquid milk sample.Vortex the tubevigorously.2. Sonicate for 1min and then shake for 1 min. Allow it to stand for 5 min3. Transfer the supernatant to another tube, centrifuge at 10000 rpm for 5min.4. Filter the supernatant through Whatman filter paper No 1, the filtrate is ready for the assay.Detection procedure for melamine in milk filtrate using strip.1. Bring the melamine test strip and samples to room temperature (25-30ºC).2. Add four drop the prepared sample to the sample area of the test strip.3. Observed the formation of pink band in assay area within 5 min.Fig 1. Photograph showing pattern of pink or purple bands on melamine strip in control milk andmelamine adulterated milk samples.Fig 2. Photograph showing different level of detection of melamine in milk using strip.176

Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and OilsRancimat (Accelerated and Automated) Method forEvaluation of Oxidative Stability of Fats and OilsIntroductionSumit AroraDairy Chemistry Division, NDRI, KarnalRancimat is a modern, computer controlled analytical instrument for the comfortable determinationof oxidative stability index to predict oxidation stability of oils and fats, and hence, their shelf life. It wasdeveloped by Hador and Zurcher in 1974 to replace the time consuming active oxygen method (AOM)and other such methods. Oxidative stability is an important criterion for evaluating the quality of oils, fatsand fatty acid methyl esters (biodiesel). Lipid oxidation in foodstuffs is one of the most important criticalfactors affecting major quality parameters such as colour, flavour, aroma and nutritive value, whichreduces their shelf life and influence its suitability for consumption. Therefore, it has great importancein food industry to predict the shelf life of foods especially fatty foods. Determining oxidative stability isa tedious and time-consuming process when performed at room temperature, thus it is necessary to useaccelerated methods to obtain the oxidative stability in a shorter time. For this reason, several acceleratedmethods have been developed such as Schaal oven test, Active Oxygen Method (AOM) and RancimatMethod. AOM and Schaal oven test are non-reproducible and time-consuming methods, however,Rancimat method is comparatively more popular because of its ease of handling and reproducibility ofresults. The unique temperature extrapolation allows an approximate estimation of the storage stabilityof a product, thus saving both time and money.Advantages:• Automated computer-controlled instrument, therefore, is easy to operate• Conversion of induction time to other temperatures i.e. extrapolation to predict the shelf life ofsamples• Excellent data security and reproducibility• Time and money saving• Evaluation can be done at two different temperatures simultaneously• Independent heating blocks having individual start of each positionPrinciple:Oil or fat sample is heated at higher temperature in a sealed reaction vessel. Stream of air is passedthrough the oil or fat sample which results in oxidation of lipid molecules. The volatile productsformed upon oxidation are transported through the stream of air to a second vessel containing distilledwater, whose conductivity increases with increase in content of oxidation products. A graph is plottedbetween conductivity and time which can be used to estimate the induction time or oxidative stabilityindex of oil or fat, thus predicting the shelf life of sample.StandardsThe Rancimat method is included in various national and internationals standards, such as:• AOCS Cd 12b-92 (Sampling and analysis of commercial fats and oils: Oil Stability Index)• ISO 6886 (Animal and vegetable fats and oils– Determination of oxidation stability by acceleratedoxidation test)• 2.4.28.2-93 (Fat stability test on Autoxidation. CDM, Japan)• Swiss Food Manual (Schweizerisches Lebensmittelbuch), section 7.5.4177

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceDetermination of Oxidation Stability:Prepare fat/oil sampleSwitch on 743 Rancimat as suggested by the manufacturerSelect methodStart heatingInsert and connect reaction vessels when temperature is reachedStart determinationDetermination finished when stop criteria* is reachedFigure 1: Flow diagram showing working of 743 RancimatResult displayClean vessels and accessories*Stop criteria may be induction time, conductivity or end point (point at which conductivity startsincreasing abruptly)RANCIMAT:A. Instrumentation:A. Heating blocks:The 743 Rancimat has two independent heating blocks that allow up to eight samples to beanalyzed at one or two temperatures. Up to four Rancimats can be connected to one computer, sothat the maximum number of samples that can be analyzed in parallel can be increased to 32. Eachmeasuring position can be started individually. As soon as the measurement has been completed themeasuring position is immediately ready for a new sample, which means that the instrument can beused to its full capacity.B. Reaction vessel:Weighing out the sample and assembling the reaction vessel are extremely simple and safe. Reactionvessel does not need to be expensively cleaned at the end of the measurement, thus reducing the analysiscosts.C. Measuring vessel:178Figure 2: Reaction Vessel Figure 3: Measuring Vessel Figure 4: Conductivity cell

Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and OilsEasy-to-clean polycarbonate beakers are used for the automatic conductivity measurement. Glassbeakers are available as an alternative.D. Cover with built-in conductivity cell:The conductivity cell is incorporated in the measuring vessel cover. When the cover is placed inposition the cell is immersed in the water. At the same time electrical contact is made to the electronicsin the instrument. The use of fragile glass conductivity electrodes with lengthy connecting cables wentout of fashion a long time ago. The new conductivity cell is also very easy to clean.e. Connections:In order to make operation as simple as possible, there are no controls at all on the instrument.All its functions are controlled from the computer. Apart from the power switch, the only featuresyou will find on the instrument are the RS-232 socket for connection to a computer and a socket forconnecting the Pt-100 temperature sensor.Figure 5: Connections Figure 6: Air inlet filter and molecular sieve Figure 7: GLP Setf. Air inlet filter and molecular sieve:The air used for the measurement is aspirated through a filter that prevents particles from enteringthe instrument. The molecular sieve removes water vapour from the aspirated air; as water contributesto the hydrolytic decomposition of the fat molecules, it could interfere with the measurement.g. Air supply line:The amount of air that passes through the sample is automatically controlled via the rotationrate of the built-in pump according to the method settings. A separate supply of compressed air isnot necessary.B. Validation with the glp set:The optionally available GLP Set facilitates the validation of 743 Rancimat. It contains a certifiedPt-100 temperature sensor with accessories that can be used for testing the temperature regulation ofthe heating block. A test plug for checking the conductivity measurement inputs is also supplied.C. Software functions:All functions of the 743 Rancimat are controlled by the Rancimat software, which excels by its userfriendliness.All the functions are clearly arranged in just a few windows, the operation is intuitive.D. Rancimat control:This is where the measuring parameters can be called up and edited. The instrument functions arecontrolled directly from here; the measurements are also started and shown in the live display field.The arrangement of this window corresponds to a view of the instrument from above. This means thatthe assignment of sample information and measuring position is perfectly clear. The timer functioncan be used to automatically switch on the heating blocks before the start of work, so that it is nolonger necessary to wait while they warm up.179

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceThe functions in a nutshell:• Individual start/stop for each position• Live display• Temperature display• Method definition• Instrument controls• Calculation formulas, automatic result transformation to other temperatures• Timer functionE. Results:At the end of each determination, the measured data is stored in a database and can be viewed bythe user in the results window. Sample information and results are shown in tabular form and can beexported in various formats. The measured curves can be shown individually or in groups. It is alsopossible to edit the automatic evaluation and recalculate the results. The temperature extrapolationfunction for estimating the storage stability is available in this section of the software. All the displayeddata can be sorted or filtered and display can be adapted to meet our requirements. Results can beobtained in the following forms:• Overview table• Curve display: individual or multiple plots• Re-evaluation: induction time, stability time and manual tangent method• Report printout• Temperature extrapolation (estimation of storage stability)• Database functions: filtering, sorting• Data exportF. Applications:Determination of oxidation stability of foods:Just like the pure substances, the oils and fats contained in foods are also subject to oxidation,which contributes to their spoilage. In such cases the Rancimat can be used to determine the oxidationstability of foods containing oils and fats. Meltable foods with a high fat content, such as ghee, butter,margarine, lard or tallow, can be analyzed directly without any further sample preparation. For liquidor semi-liquid foods, such as salad dressings or mayonnaise, it is better to split the emulsion andanalyze the separated fat phase. For solid, non-meltable foods it is also necessary to separate off the fatphase. In this case the fat is normally cold-extracted with petroleum ether and the isolated fat is thenanalyzed.Following food samples can be analysed: butter, margarine, ghee, vegetable oils, baby foods, icecream,cereals, chocolate, nuts and biscuits.G. Technical specifications:1. Heating blocks:Two aluminium heating blocks; electrically heated; can be set to different temperatures2. Number of samples:Eight samples (4 measuring positions per heating block)3. Temperature control and measurementTemperature range: 50 to 220°C, adjustable in 1ºC stepsTemperature correction: -9.9 to +9.9°C, adjustable in 0.1ºC180

Rancimat (Accelerated and Automated) Method for Evaluation of Oxidative Stability of Fats and OilsstepsReproducibility of set temperature : Typically better than ±0.2 °C*Temperature variation: Typically

Chemical Analysis of Value Added Dairy Products and Their Quality AssurancePrincipleEstimation of Cholesterol Content in GheeUsing a Cholesterol Estimation KitVivek Sharma and Darshan LalDairy Chemistry Division, NDRI, KarnalCholesterol is extracted in unsaponifiable matter as free cholesterol. The aliquot of unsaponifiablematter is made to react with the reagents of the cholesterol estimation kit and the color developedis measured at 505nm. The absorbance values in the sample and control are used to calculate thecholesterol content in a given sample of ghee.MaterialsGhee, Enzymatic Diagnostic kit, Methanol, Potassium hydroxide, Hexane, Teflon line screwcapped tubes.EquipmentWater bath, Spectrophotometer, Cuvettes.Protocol for cholesterol estimation in milk fat after saponification using enzymatic diagnostic kit:Milk fat (0.1-0.15 g) in test tube with teflon lined screw capAdd 5 ml 5% methanolic KOH and mixIncubate capped tubes in water bath for 90 °C/ 20 min with shaking every 5 min.Cool contents by tap waterAdd 1 ml distilled waterAdd 5 ml hexaneVortex the contents for 1 min182

Estimation of Cholesterol Content in Ghee Using a Cholesterol Estimation KitCentrifuge at 2000 rpm/ 2 minPipette out upper hexane layerTake 0.2 ml of aliquot in dry test tubeEvaporate solvent under nitrogen at 60-70°CAdd 10 µl of absolute ethanol to dissolve dried residueAdd 1.0 ml cholesterol reagent provided in kit and incubate at 37°C/10minCool to room temp (28 – 30°C).Calculation:Measure colour (pink) intensity at 505 nmWhere,0.02 is the concentration (mg) of cholesterol in 10 µl of standard solution provided in the kit.183

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance184Rapid Methods for Detection of Adulterants in MilkIntroductionRajan Sharma, Raman Seth and Amit K. BauriDairy Chemistry Division, NDRI, KarnalAddition of neutralizers and adulterants in milk has become a common feature for fulfilling the milkdemands of over populated country. Now for dairy industry it seems to be difficult to run the plantwithout neutralization of milk. For milk vendors and shop-keepers, adulteration of milk with water toincrease the quantity in order to supply milk in large number of house-holds also has become a commonpractice. The lack of timely action against the adulterators by the Public Health Departments and lack ofeasier and rapid methods for detection of adulteration further encouraged this menace. Common mani.e. consumers are not aware of the methods and chemicals used in the methods. Now in NDRI Karnal,the procedures for the detection of various adulterants and neutralizers have been simplified to be easilyadopted by the house-holds. The prepared reagents as well as a KIT for the detection of adulterants andneutralizers are available in the Dairy Chemistry Division of NDRI, Karnal.PreservativesA. Test for formaldehydeFormalin (40% water solution of formaldehyde) is generally used by Public Health Departments topreserve the milk samples for chemical analysis purpose. Formaldehyde is very poisonous chemical.Though, it can preserve the milk for very long time, it should never be added to milk meant forprocessing due to its poisonous property. Moreover, it affects the quality of the milk products. If milkkept at room temperature (25 to 35ºC) for longer time, did not sour, then that milk must be tested forformaldehyde by the following simple method:Method 1: Leach test1. Take about 5 ml of milk in a test tube.2. Add to it equal volume of Conc. HCl containing 1 ml of 10% ferric chloride solution to each 500ml of the acid.3. Keep the tube in boiling water bath for about 3-4 min.4. Observe the colour of the solution in the tube. The tube containing pure sample will turnsyellowish. The positive sample (i.e. containing HCHO) will turn violet to brown black.Method II: Chromotropic acid testReagent: Saturated solution of 1,8-dihydroxynaphthalene-3,6-disulphonic acid in about 72%sulphuric acid (about 500 mg/100 ml). Light straw-coloured solution should result.1. Take one ml of milk sample in a test tube. Add 1 ml of the Chromotropic acid reagent and mix well.2. Appearance of yellow colour confirms the presence of formalin in the sample, whereas; controlsample will remain colourless.B. Test for hydrogen peroxideHydrogen Peroxide is a preservative, but as per PFA rule it is not permitted to be added in milk.Hence if it is found, then milk is said to be adulterated.Method IReagent: Para-phenylenediamine solution (2%, Aq, w/v).Procedure:1. Add to about 5 ml of milk in a test tube, an equal volume of raw milk, followed by five drops ofa 2 % of para-phenylenediamine.

Rapid Methods for Detection of Adulterants in Milk2. A blue colour is developed in the presence of hydrogen peroxide.Note: It is unlikely that the addition of less than 0.1% of H 2O 2to milk could be detected after 24 h,owing to the action of peroxidase and catalase which stimulate its conversion into water. If moe than0.2% H 2O 2is added, some will persist for considerable long time. Owing to the fact that larger amountof H 2O 2are known to destroy peroxidase, it is always advisable to add to the sample an equal volumeof raw unpreserved milk and to follow with a few drops of a 0.2% solution of para-phenylenediamine.Under these circumstances a blue colour will develop immediately if H 2O 2is added.Method IIA method using potassium iodide and starch was standardized for the detection of hydrogenperoxide in milk.Procedure: Take one ml milk sample in a test tube. Add one ml of potassium iodide-starchreagent (mix equal volumes of 20% potassium iodide solution and 1% starch solution) to the test tube.Appearance of blue colour indicates the presence of hydrogen peroxide in the milk sample whereascontrol samples remain colourless.C. Detection of NeutralizersAlkali in various forms like sodium carbonate, sodium bicarbonate, sodium hydroxide and limeare used to neutralize developed acidity in milk. Detection of such neutralizers can be made by thefollowing two tests.Method I. Rosalic Acid Test:Reagents: Ethanol (95%), Rosalic acid solution (1% in alcohol).Procedure:1. Take in test tube about 5 ml milk and mix with 5-ml ethanol followed by 2-3 drops of rosalicacid solution.2. Formation of rose red colouration indicates the presence of alkali as neutralizer. Pure milkproduces brownish or brownish yellow colour only.Rosalic acid is an organic dye, which is used as an indicator-changing colour at pH 7.0 to 8.0.Hence, milk made even faintly alkaline by addition of neutralizers can be detected due to formation ofrose red colour with rosalic acid solution.Method II. Ash alkalinity testNeutralization of milk whether with lime, soda, or caustic soda, invariably increases the ashcontent and the total alkalinity of the ash from a fixed quantity.Reagent: HCl (standard, 0.1 N), Phenolphthalein indicator.Procedure:1. Pipette 20 ml of milk into a porcelain basin and evaporate to dryness on boiling water bath.2. Remove the basin, cool to room temperature and ignite the residue by heating over Bunsenflame until gray-white ash is obtained.3. Cool the basin to room temperature. Add to the residue 10-ml of water and disperse the ash inwater by stirring with a glass rod.4. Titrate the ash dispersate by standard HCl using phenolphthalein indicator. If the volume of 0.1N HCl required to neutralize the ash dispersate exceeds 1.20 ml; the milk is suspected to containneutralizers.D. Detection of starch or cereal floursReagent: Iodine solution (1%), Dissolve 2.5 g potassium iodide in 100 ml water, add to it 1 g pureiodine crystal, shake well to give a clear solution.185

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceProcedure:1. Take about 3 ml of well-mixed milk sample in a test tube.2. Heat the milk to just boiling by holding the tube over flame, and thereafter cool to room time.3. Add 1-2 drops of 1% iodine solution.4. Observe the development of colour. Formation of blue-violet colour indicates presence of starchcereal flours.E. Detection of cane sugarSugar or cane-sugar, is generally added to milk in order to raise the lactometer reading of themilk which was diluted with water, so that by lactometer reading, the detection of added water isprevented. In suspected samples, sugar can be easily detected by following method:Reagent: Resorcinol, conc. HCl. (or prepare sucrose detecting reagent by dissolving 0.5 g ofresorcinol in about 40 ml of distilled water. Then add 35 ml of 12 N conc. HCl. Make up the volumeto 100 ml using distilled water.)Procedure:1. To about 5 ml of milk in a test tube, add 1 ml of conc. HCl and 0.1 g of resorcinol and mix.2. Place the tube in boiling water bath for 5 min.3. In the presence of cane sugar, red colour is produced.Note: The test can be simplified by taking 1 ml of suspected sample of milk is a test tube followed bythe addition 1 ml of sucrose detecting reagent. In the presence of cane sugar, red colour is produced.F. Detection of glucoseGlucose being a reducing sugar poses many problems in its detection. Moreover, it is easilyavailable in commercial form as concentrated syrup. These days adulteration of milk with glucose isincreasing. Now it has become possible to detect Glucose in milk by the following method:Reagents:1. Barfoed’s reagent: Dissolve 24 g cupric acetate in 450 ml boiling water and immediately add 25ml of 8.5% lactic acid to the hot solution. Shake to dissolve almost all precipitate, cool and dilutewith water to 500 ml. If necessary decant of filter to get a clear solution.2. Phosphomolybdic acid reagent: Take 35 g ammonium molybdate and 5 g sodium tungstate in alarge beaker; add 200 ml of 10% NaOH solution and 200 ml water. Boil vigorously (20-60 min)so as to remove nearly whole of ammonia. Cool, dilute with water to about 350 ml. Add 125 mlconc. H 3PO 4(85%) and dilute further to 500 ml.Procedure:1. Take 1 ml of milk sample in a test tube. Add 1 ml of modified Barefoed’s reagent.2. Heat the mixture for exact 3 min in a boiling water bath and then rapidly cool under tap water.3. Add one ml of phosphomolybdic acid reagent to the turbid solution and observe the colour.4. Immediate formation of deep blue colour indicates the presence of added glucose. In case ofpure milk only faint bluish colour is formed due to the dilution of Barefoed’s reagent.G. Detection of nitrates (pond water)Pond water is heavier than the tap water; some unscrupulous persons for adulteration in milkusually prefer it. However, it can be easily detected by the following method. This method actuallydetects nitrates present in the pond water. In the pond water nitrates may come from fertilizers usedin the fields.Reagent: Diphenylamine: Prepare 2% solution of diphenylamine in conc. sulfuric acid.186

Rapid Methods for Detection of Adulterants in MilkProcedure:Take 2 ml of milk in a test tube. Rinse the tube with the milk and drain the milk from the test tube.Add two-three drops of the reagent along the side of the test tube. Deep blue colour will be formed inpresence of nitrate.H. Detection of Urea in milkUrea is a natural constituent of milk and it forms a major part of the non-protein nitrogen ofmilk. Urea concentration in milk is variable within herd. Urea is one of the ingredients of syntheticmilk along with caustic soda, detergent, sugar and foreign fats. Adulteration of natural milk withsynthetic milk increases the level of urea to such an extent that on consumption of this adulteratedmilk causes toxicological hazards. Estimation of urea concentration in milk may serve as a tool forchecking the menace of adulteration of natural milk with synthetic milk. The average urea contentin milk of Karan Swiss, Karan Fries and Sahiwal cows was reported to be 28.57, 28.79 and 25.39mg/100 ml (range 20 to 35 mg/100 ml). In buffalo milk, the average urea content was found to be35.10 mg (range 25 to 40 mg/100 ml). The addition of urea to milk can be detected by using DMABmethod. This method is based on the principle that urea forms a yellow complex with p-dimethylaminobenzaldehyde (DMAB) in a low acidic solution at room temperature. The intensity of yellowcolour is measured at 425 nm. Here only qualitative method is describedUrea + DMABReagent:1.6% DMAB reagent: Dissolve 1.6 g DMAB in 100-ml ethyl alcohol and add 10-ml conc. HCl.Procedure:1. Take equal quantity of milk and equal quantity of 24% TCA in a glass stoppered test tube. Mixand filter it.2. Take 3 ml of filtrate in a test tube and add 3 ml of 1.6% DMAB reagent in ethyl alcohol and HCl.Note the colour obtained.3. The occurrence of distinct yellow colour indicates the presence of added urea in milk.Note: The control (milk sample containing no added urea) showed a slight yellow colour due tothe presence of natural urea in milk.I. MaltodextrinTo 5 ml milk sample in a test tube, 2 ml of dilute iodine solution (0.05 N) is added. Appearance ofchocolate red brown colour developed indicates the presence of maltodextrin.J. Sodium chlorideTake 5 ml of milk and 1 ml of silver nitrate solution (0.1 N). Mix well and add two drops of asolution of 10% potassium chromate. Yellow colour indicates the presence of added salt. Otherwise,red colour will appear.K. Ammonium saltsThe added ammonium salts e.g ammonium chloride, ammonium sulfate, ammonium nitrate andammonium dihydrogen orthophosphate can be detected in milk by two methods i.e Nessler’s reagentmethod and turmeric paper method.Method I: Nessler’s reagent methodReagent : Nessler’s reagent: Dissolve the following chemicals separately.a. 8.0 g of mercuric chloride in 150 ml distilled water.187

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceb. 60.0 g of sodium hydroxide in 150 ml distilled water.c. 16.0 g of potassium iodide in 150 ml distilled water.Add reagent a to reagent b and mix well. To this mixture, add reagent c, mix and dilute the contentsto 500 ml. Leave this solution undisturbed and decant the clear upper layer of the solution and storein a stoppered glass bottle.Procedure: Pipette 5 ml of suspected milk sample into a test tube and add 1 ml of Nessler’s reagent.Mix the contents of the tube thoroughly. Appearance of yellowish or grey colour confirms the presenceof added ammonium salts in milkMethod II. Turmeric paper methodThis method is based on the principle that ammonium salts on addition of strong alkali liberateammonia and the liberated ammonia turns turmeric paper to pinkish red.Reagents:• Turmeric paper: Dissolve 10 g of pure turmeric powder in 100 ml distilled water and dipWhatman filter paper Grade 1 strips into it for 2 min. Dry the paper at room temperature. Thedried filter paper is wetted with distilled water before use.• Sodium hydroxide solution: 10% (aq.)• Procedure: Pipette 5 ml of suspected milk sample in a test tube and add 1 ml of 10% sodiumhydroxide solution in such a manner that should not touch the rim of the test tube while adding.Mix the contents of the tube. Place a piece of wet turmeric paper on the rim of the test tubeand keep the test tube undisturbed. Observe the change in the colour of the turmeric paper.Appearance of pinkish red colour confirms the presence of ammonium salt in milk.L. Sulfate saltsPresence of sulfates in milk can be detected by using barium chloride.Reagents:a. Barium chloride (BaCl 2.2H 2O) solution: 5% (w/v, aq.)b. Trichloroacetic acid (TCA): 24% (w/v, aq.).Procedure: Take 10 ml of milk in a 50 ml stoppered test tube and add 10 ml of TCA solution. Filterthe coagulated milk through Whatman filter paper Grade 42. Take 5 ml of clear filtrate and add fewdrops of barium chloride solution. Formation of milky-white precipitates indicates the presence ofadded sulfates like ammonium sulfate, sodium sulfate, zinc sulfate and magnesium sulfate etc. tomilkM. Detection of refined oil in milkThis method is based on the principle that BR reading of milk fat is comparatively lower thanthat of most of the foreign fats/oils. Its adulteration with vegetable and/or animal body fats/oilssignificantly increases the BR reading/For taking BR reading of the milk fat the milk fat is isolated from the specially designed butyrometerwhich has both ends open. Milk fat after centrifugation is taken with the help of a capillary and BRreading is noted at 40°C. A correction factor is added to the observed BR reading. This is done toeliminate the inherent hydrolytic effect of H 2SO 4.Actual BR at 40°C = Observed BR at 40°C + (0.08X observed BR at 40°C)References:Manual in Dairy Chemistry, NDRI, Karnal.IS:1479 (Part II) – 1961 Methods of test for Dairy Industry-Part II Chemical analysis of milk.188

Detection of Foreign Fats/Oils in Milk and Ghee Using Newer ApproachesDetection of Foreign Fats/Oils in Milkand Ghee Using Newer ApproachesDarshan Lal, Vivek Sharma, Arun Kumar and Amit KumarDairy Chemistry Division, NDRI, KarnalIntroductionThe menace of adulteration in food products has reached an alarming stage in recent years. Eventhe milk (most sacred food) has not been spared. Milk fat, the costliest edible fat, increasingly catchesthe attention of the unscrupulous elements for an easy adulteration with far cheaper oils and fats ofvegetable and animal origin. Under the circumstances, the dairy industry is in dire need for somerapid and simple methods to check the menace of adulteration in milk and milk products. Earlier, gheeused to be adulterated with foreign oils and fats, and accordingly several methods were developed fordetection of adulteration in ghee. These methods were based on differences in the nature and contentsof major/minor components of ghee and adulterant fats/oils. Now days, a new trend of addition offoreign fats/oils directly into milk has been gaining momentum. Unfortunately, the tests, which areapplicable for detecting adulteration in ghee, cannot be directly applied to milk because milk is not asingle-phase emulsion. Rather, it is an oil-in-water type emulsion. Therefore, the fat phase of milk hasto be separated from its aqueous phase before applying any test for checking the adulteration of milkfat. Moreover, since no single test can detect all types of adulterants (oils and fats), therefore, oftenmore than one tests have to be employed to confirm the purity of milk fat.MethodologyThere are two approaches for the detection of adulteration of milk fat. First approach is basedon the classical methods like B.R reading, R.M value, P. value, Phytosterol acetate test, Gas – liquidchromatographic analysis. Second approach is based on some innovative and rapid methods like furfuraltest for vanaspati, Opacity test, crystallization test, color based test for vegetable oil detection, apparentsolidification time test and complete liquification time test. In all the cases, tests are applied on the extractedfat, except the modified Gerber test, where especially designed dual purpose Gerber butyrometer is usedand B.R reading of the isolated fat is measured. Hence, the first step is to isolate the fat and then apply thetest (Kumar et al, 2002).A) Detection of foreign oils and fats in milk:Keeping in view the need for a rapid test which can be applied to milk for detecting the adulterationright at the platform where the milk is to be either accepted or rejected, the approach suggested byLal et al (1998) involves the isolation of fat from milk followed by determination of B.R. reading of theisolated fat. This test is specifically useful for detection of vegetable oils in milk.Isolation of fat from milkIsolation of fat from milk can be done by any of the three methods:• Solvent extraction method• Heat clarification method• Modified Gerber method.Solvent extraction methodTake 100 ml of milk sample in a 500 ml flask. Add 15 ml of NH 4OH, and shake thoroughly. Add50 ml ethyl alcohol, 100 ml solvent ether and 100 ml petroleum ether and shake thoroughly after eachaddition. Allow to stand for half an hour. Decant the ethereal layer in another conical flask of 250 mlcapacity.Add about 50 g of anhydrous Na 2SO 4to remove the traces of moisture from the ethereal layer.Collect the ether extract and add 1 or 2 glass beads. Evaporate ether extract to dryness on boiling waterbath taking care to prevent bumping and then transfer in oven maintained at 102ºC.189

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceHeat clarification methodObtain about 50g of cream by separation using cream separator or by centrifuging the milk at 4000rpm for 10 min. Convert the cream into ghee by heat clarification.Modified gerber methodIsolate the fat from milk by Gerber method using specially designed dual purpose milk butyrometer,which is open at both ends. Close the stem side opening with a good quality acid resistant silicon cork.From the neck side, add 10 ml of 90% H 2SO 4, 10.75 ml milk and 1 ml amyl alcohol. Close the neck sidewith lock stopper; mix the contents and centrifuge for 5 min to get clear fat in the column. Removethe silicon cork and take out the fat from the stem of butyrometer with the help of a capillary tube ora syringe (Lal et al, 1998).B) Detection of foreign oils and fats in ghee:Available tests:1. Detection of animal body fats and vegetable oils/fats by the opacity testMelt the sample of fat (5 gm) isolated by heat clarification method at 50 +1 o C in a test tube andmaintain for 3 min to equilibrate. Then transfer the test tube at 23 + 0.2 o C water bath and record theopacity time (Time taken by fat sample to acquire either O.D. at 570 nm between 0.14-0.16 or Klettreading using red filter between 58-62 after adjusting the instrument to 100% transmittance). Theopacity time of pure buffalo ghee is 14-15 min, cow ghee is 18-19 min and that of ghee from cotton tractarea is 11-12 min. The opacity time of buffalo ghee adulterated at 10% level with vanaspati is 10-11min, with pig body fat is 8-9 min, with buffalo body fat is 2-3 min, with cow body fat is 3-4 min andwith refined oils is 20-25 min (Singhal, 1980).2. Detection of vanaspati in gheeIsolate the fat from milk by heat clarification method as described above. Take about 5 g of themelted fat in a test tube. Add 5 ml of concentrated HCl. Add 0.4 ml furfural solution (2% in alcohol)and shake the tube thoroughly for 2 min. Allow the mixture to separate. The development of pink orred colour in the acid layer indicates presence of vanaspati. Confirm by adding 5 ml distilled waterand shaking again. If the colour in acid layer persists, vanaspati is present. If the colour disappears, itis absent [SP:18 (1987)].3. Detection of vegetable oils byButyro-Refractometer (B.R.) ReadingClean the prisms of the Butyro-refractometer with petroleum ether. Allow the ether to evaporate todryness. Maintain temperature of the prisms at 40ºC by circulating water. Calibrate the B.R. apparatusby applying a drop of fluid of known B.R. and adjusting B.R. by moving the adjustment screw. Cleanthe prisms. Apply a drop of sample of clear fat obtained by any of the three methods between theprisms. Wait for 2 min before taking the reading so that sample should attain the constant temperatureof about 40ºC.B.R. reading decreases and increases with the rise and fall of temperature, respectively. Normally,the temperature of observation should not deviate by more than 2ºC. A correction of 0.55 is added tothe observed B.R. reading for each degree above 40ºC or subtracted for each degree below 40ºC to getcorrected B.R. reading of the sample.If fat is isolated by the Gerber method, B.R. is depressed due to hydrolytic effect of H 2SO 4on thefat. Therefore, observed B.R. reading is corrected as follows:Corrected B.R. = 1.08 x observed B.R.B.R. reading of milk fat isolated by any one of the above mentioned methods should be consistentwith the values given for ghee as per PFA requirement. Any deviation from the standard valueindicates adulteration of milk with vegetable oils. However, this method has limitation of detectionof adulteration with two oils i.e. coconut oil and palm oil whose values are close to that of milk fat(Arora et al, 1996).190

Detection of Foreign Fats/Oils in Milk and Ghee Using Newer Approaches4. Detection of animal body fats and vegetable oils by crystallization testIsolate the fat from milk by heat clarification method as described above. Take 0.8 ml of meltedfat in a stoppered test tube (10 x 1.0 cm internal diameter). Add 2.5 ml of solvent mixture consisting ofacetone and benzene (3.5:1.0). Mix the contents slowly. Place the test tube in a water bath maintained at20ºC for 3 min to equilibrate the temperature. Then transfer the tube in another water bath maintainedat 17 ± 0.2ºC till the onset of crystallization. Note the time for occurrence of crystallization. Thecrystallization time of pure buffalo ghee is 18-20 min and that of cotton tract ghee is 10.5-12.5 min,whereas that of buffalo ghee adulterated at 10% level with pig body fat is 11.5-12.5 min, with cow bodyfat 4.5-5.5 min and buffalo body fat 3.0-4.0 min, and with vegetable oils is 26 to 36 min (Panda, 1996).5. Detection of adulteration of vegetable oils in ghee by Iodine valueIodine value, which is a measure of extent of unsaturation of fat, can be determined by theWij’s method as described in SP:18 (Part XI)1981. This property is particularly useful for detection ofadulteration in ghee with vegetable oils, as these oils have higher iodine values than milk fat and bodyfats. It can be measured, as follows:Accurately 0.4 g of sample is weighed in a clean and dry iodine flask and is dissolved in 15 ml ofcarbon tetrachloride. Then 25 ml of the Wij’s reagent are added and the flask is stoppered. The contentsare then mixed and kept in dark for one hour. After one hour, 20 ml of 10 per cent potassium iodidesolution and about 150 ml of distilled water are added to the iodine flask and mixed. The contents aretitrated against 0.1 N sodium thiosulphate solution using starch solution as an indicator. A blank testis also carried out using the same quantities of the reagents. From this, the iodine value is calculatedas follows:Iodine Value = 12.69 (B – S) N / WWhere;B = Vol. (in ml) of standard sodium thiosulphate solution required for the blankS = Volume (in ml) of standard sodium thiosulphate solution required for the sampleN = Normality of the standard sodium thiosulphate solution, andW = Weight (in g) of the sample taken for the testThe iodine value for cow and buffalo pure ghee ranges between 30.12 to 40.26. Any deviation fromthese values indicates adulteration (Kumar, 2008).6. Detection of adulteration by apparent solidification time (AST) testThe apparent solidification time (AST) of the fat sample is defined as the time taken by the meltedfat sample to get solidified apparently at a particular temperature. The test can be carried out as:Take 3.0 gm of completely melted fat sample in a test tube (10 × 1.0 cm ID) and maintain at 60ºC for5 min. Transfer the test tube in a refrigerated water bath maintained at 18 ± 0.2ºC and simultaneouslystart the stop watch. Observe the test tube constantly till the apparent solidification of the fat sampletakes place which is confirmed by non- movement of fat sample on tilting the test tube. At this stage,stop the stopwatch and record the time taken for the apparent solidification of the fat. Pure gheesample of both cow and buffalo shows AST in the range of 2 min 31 sec to 3 min 25 sec. Any deviationfrom these values gives an indication of adulteration of milk fat (Kumar, 2009)7. Detection of adulteration using dry fractionation technique coupled with ASTBy employing dry fractionation technique, the different fractions enriched with body fats orvegetable oils are obtained and subsequently used to estimate AST. The aim is to enrich the solidfraction with animal body fats and liquid fraction with vegetable oils. Vanaspati, if added, will also befractionated along with animal body fats.Take 100 gm of clarified melted fat and keep it in a BOD incubator maintained at 20 ± 0.1ºC. Afterabout 1.50 to 1.75 h of incubation, approximately one third of the whole fat gets solidified. Separate thesolid fraction (S 20) from the remaining liquid portion by filtration inside a BOD incubator maintained at191

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance20 ± 0.1°C. Further fractionate the liquid portion thus obtained in another BOD incubator maintainedat 18 ± 0.1°C. for 2 hr so as to obtain another solid (S 18) and liquid (L 18) fraction by filtering inside aBOD incubator maintained at 18 ± 0.1°C. Analyze S 20, S 18and L 18fractions of ghee for AST as describedabove. S 20, S 18and L 18fractions of pure ghee of both cow and buffalo show AST values of 1 min 40sec to 2 min 50 sec; 2 min 30 sec to 3 min 40 sec and 2 min 50 sec to 3 min 50 sec, respectively. Anydeviation from these values gives an indication of adulteration (Kumar, 2003).8. Detection of adulteration by complete liquification time (CLT) testThe complete liquification time (CLT) test of the fat sample is defined as the time taken by thesolidified fat sample to get melted completely at a particular temperature. The test can be performed,as follows:Take 3.0 gm of completely melted fat sample in a test tube (10 × 1.2 cm) and maintain at 60°C for 5min. Keep the test tube containing fat sample in a refrigerator (6- 8ºC) for 45 min for solidification of themelted fat sample. Transfer the test tube in a water bath maintained at 44 ± 0.1ºC and simultaneouslystart the stop watch. Observe the test tube constantly till the fat sample is completely liquefied. Atthis stage stop the stopwatch and record the time taken for complete liquification of the fat. Pure gheesample of both cow and buffalo shows CLT in the range of 2 min 12 sec to 3 min 15 sec. Any deviationfrom these values gives an indication of adulteration of milk fat (Kumar, 2008).9. Detection of adulteration using solvent fractionation technique coupled with CLT and IodinevalueUsing solvent fractionation technique, the different fractions enriched with body fats or vegetableoils can be obtained and used subsequently to estimate CLT. Here also, the aim is to concentrateanimal body fats in to solid fraction and vegetable oils into liquid fraction. Vanaspati, if added, willalso be concentrated in solid fraction along with animal body fats.Take 30 gm of melted ghee sample in a 100 ml graduated glass tube, and then add 60 ml acetoneand mix well to dissolve the fat. After mixing, keep the sample at 40°C for equilibration for 5 min. Thensubject the sample in a refrigerated water bath to three temperatures/time combinations, viz., 16 ±0.1°C/25 min, 8 ± 0.1°C/25 min and 4 ± 0.1°C/60 min, successively, after filtration at each stage of time/temperature combination. After about 25 min at 16 ± 0.1°C, approximately one-fourth of the wholefat gets solidified. This first solid fraction (S 16) obtained at 16 ± 0.1°C is separated from the remainingliquid portion (L 16) of the whole fat by filtration through ordinary filter paper. The remaining liquidportion (L 16) thus obtained after filtration is further fractionated at 8 ± 0.1°C. in refrigerated water bath.After about 25 min, it gets partitioned into two fractions, one solid (S 8) and one liquid (L 8), which canbe separated by filtration through ordinary filter paper. At last, L 8fraction is further fractionated at4 ± 0.1°C for 60 min and filtered to get two fractions, one solid (S 4) and one liquid (L 4). Finally at theend of fractionation, three solid fractions (S 16, S 8and S 4) and one liquid fraction (L 4) are obtained fromghee sample containing a mixture of adulterants. Solvent from liquid fraction is removed by usingrotary evaporator at about 40ºC, followed by nitrogen flushing to evaporate solvent completely fromthe liquid fraction. To get rid of entrapped acetone, respective solid fractions are heated to 110ºC forabout 2 hr in an oven.(a) Analysis of first fraction (S 16) for CLT at 46ºCAnalyse S 16fraction for CLT at 46 ± 0.1 o C (instead of 44± 0.1 o C used for CLT of whole fat) asdescribed above. CLT values of S 16fraction at 46 o C range between 4 min 5 sec to 9 min for both cowand buffalo pure ghee. Any deviation from these values gives an indication of adulteration of milk fat(Kumar, 2008).192

Detection of Foreign Fats/Oils in Milk and Ghee Using Newer Approaches(b) Analysis of last fraction (L 4) for Iodine valueAnalyse L 4fraction for iodine value as described above. The iodine values for L 4fraction of purecow and buffalo ghee are found to vary between 37.85- 46. 48. Any deviation from these values givesan indication of adulteration of milk fat (Kumar, 2008).10. Detection of mineral oil in gheeIsolate the fat from milk by heat clarification method as described above. Take 1 g of fat in astandard joint test tube and add 5 ml of 0.5 N ethanolic KOH solution and reflux by heating inboiling water bath, using condenser for 10 min. or more till saponification process is complete.Add about 5 ml of distilled water to the hot saponified solution. Appearance of turbidity indicatesthe presence of mineral oil.11. Rapid color based test for detection of vegetable oilsOne ml of clear molten fat was dissolved with 1.5 ml of hexane in a tightly capped test tube. To thiswas added 1.0 ml of color developing reagent (distilled water, Sulphuric acid - Sp.gr.1.835 and Nitric acid- Sp. gr. 1.42 in the ratio of 20:6:14), shaken vigorously and kept undisturbed till it is separated into twolayers. The appearance of a distinct orange tinge in the upper layer indicates the presence of vegetableoils / fats including vanaspati (Sharma et al, 2007).12. Detection of adulteration of rice bran oil in gheeRice bran oil contains gamma oryzanol, which can be used as a marker for the detection ofits addition to ghee. It can be done by thin layer chromatographic method as well as colorimetricmethod.a) Thin layer chromatographic methodA simple thin layer chromatographic method can be employed to detect the adulteration of gheewith rice bran oil, as follows:Gamma oryzanol is extracted from 10.0 gm of molten fat using 20.0 ml of a solvent systemconsisting of methanol: water (9:1). The contents are vortexed for 2 min and centrifuged at 2000rpm. /10 min. The alcohol layer is drawn. Extraction protocol is repeated thrice and all the alcoholic extractsare combined and evaporated at 60 – 70 °C in a rotary evaporator. The residue is finally dried. Thedried residue is redissolved in 0.5 ml of developing solvent (toluene: ethyl acetate: methanol 90:8:2;v/v) and 5-10 µl were applied on silica gel TLC plate and plates are developed in the developingsolvent. Properly developed plates are removed from the chamber and air dried followed by sprayingwith color developing reagent (50% sulfuric acid) and heating at 120°C/ 10 -15min. Presence of thegamma oryzanol band confirms the adulteration of rice bran oil in milk fat. Addition of rice bran oil inghee at 5% level is easily detected by this method. (Kumar, et al, 2008).b) Colorimetric methodTake 1ml of melted ghee sample in a dry test tube. Add 1.5 ml of hexane to dissolve the fat. Then,in sequence, add 0.5 ml of dilute (25%) hydrochloric acid and 0.5 ml of 5% sodium nitrite solutionand mix, followed by the addition of 1 ml of 10% sodium hydroxide solution. Rice bran oil producesorange-red color while other vegetable oils produce no color. Hence, this method is specific for thedetection of rice bran oil in ghee. As low as 2% rice bran oil added in ghee, can be detected by thismethod.193

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceStandards of ghee under PFA rulesSr.No.Name of the State & U.T.BRReadingat 40ºCRMvalue(Min)% ofFFA (asOleicacid)(Max)% ofMoisture(Max)1.2.Bihar, Chandigarh, Delhi, Punjab, Haryana (Areas other than cottontract areas), West Bengal (Areas other than Bishnupur sub-division),Sikkim, Jharkhand.Manipur, Meghalaya, Mizoram, Arunachal Pradesh, Orissa,Uttaranchal, Nagaland, Tripura, Assam, Goa, Kerala, HimachalPradesh, U.P., J & K, Rajasthan (Areas other than Jodhpur Divn),Haryana (Cotton tract areas), Lakshadweep, Maharashtra(Areasother than cotton tract areas).40-43 28 3 0.540-43 26 3 0.53.4.Karnataka (Belgaum district), Madhya Pradesh (Areas other thancotton tract areas), Pondicherry, Chhatisgarh. 40-44 26 3 0.5Andhra Pradesh, Daman & Diu, Dadar & Nagar Haveli, Karnataka(Areas other than Belgaum distt.) 40-43 24 3 0.55. Andaman & Nicobar Island, Tamil Nadu. 41-44 24 3 0.56. Gujarat (areas other than cotton tract). 40-43.5 24 3 0.57.Gujarat (cotton tract areas), Madhya Pradesh (Cotton tract areas),Maharashtra (cotton tract areas), Rajasthan (Jodhpur sub division),West Bengal (Bishnupur sub division). 41.5-45 21 3.0 0.5Baudouin test shall be negativeBy cotton tract is meant the areas in the state where cotton seed is extensively fed to the cattle and so notified by theState Govt. concerned.Usually such cotton tract areas ghee has low RM value and high BR reading compared to other areasGhee may contain BHA not more than 0.02% as antioxidant.References:Singhal, O.P. (1980). Adulteration & Methods for detection. Indian Dairyman, 32: 771-774.Arora, K.L.; Lal. D, Seth. R and Ram, J. (1996). Platform Test for detection of refined mustard oil adulteration in milk.Indian J. Dairy Sci., 49(10): 721-723.Panda, D.K. (1996). Detection of adulteration of foreign fats in milk fat. M.Sc. thesis, submitted to N.D.R.I. DeemedUniversity, Karnal.Lal, D.; Seth, R.; Arora, K.L. and Ram, J. (1998) Detection of vegetable oils in milk. Indian Dairyman., 50(7): 17-18.Kumar.A; Lal.D; Seth.R and Sharma.R (2002) Recent trends in detection of adulteration in milk fat – A Review. IndianJ. Dairy Sci., 55 (6): 319 - 330.Sharma. V; Lal, D and Sharma. R. (2007) Color based platform test for the detection of vegetable oils/fats in ghee. IndianJ. Dairy Sci. 60,1: 16 – 18.Kumar. A; Sharma. V and Lal.D (2008) Development of a thin layer chromatography based method for the detection ofrice bran oil as an adulterant in ghee. Indian J. Dairy Sci. 61,2: 113 – 115.Kumar. A; Ghai, D. L; Seth, R and Sharma, V (2009) Apparent solidification time test for detection of foreign oils andfats adulterated in clarified milk fat, as affected by season and storage. International J . Dairy Tech. 62: 33 –38.Kumar. A; Lal, D.; Seth, R and Sharma, V (2010) Detection of milk fat adulteration with admixture of foreign oils andfats using a fractionation technique and the apparent solidification time test. International J . Dairy Tech. 63 (3): 457–462.Kumar. Amit; (2008) Detection of adulterants in ghee. Ph. D thesis submitted to NDRI, Karnal (Deemed University).ISI (1981). Handbook of Food Analysis. IS: SP:18, Part XI. Dairy Products. Bureau of Indian Standards, New Delhi.Lal, D.; Seth, R and Sharma, R; Kumar. A. (2005) Approaches for detection of adulteration in milk fat-An overview.Indian Dairyman 57(10): 31-43.194

Determination of Total Polyphenolic Content in Fruit Enriched Dairy ProductDetermination of Total Polyphenolic Contentin Fruit Enriched Dairy ProductIntroduction:Rajesh Kumar and Richa SinghDairy Chemistry Division, NDRI, KarnalPolyphenols are plant secondary metabolites commonly found in herbs and fruits, such as berries,apples, citrus fruit, cocoa, grapes, vegetables like onions, olives, tomatoes, broccoli, lettuce, soybeans,grains and cereals, green and black teas, coffee beans, propolis, and red and white wines. Many ofthese polyphenols are responsible for the attractive colour of leaves, fruits and flowers. Further,polyphenolics are classified as:- Simple phenols: Phenol acids are phenols that possess one carboxylicacid functionality such as the hydroxycinnamic and hydroxybenzoic acid; Flavonoids: Polyphenolpossessing at least two phenol subunits and Tannins: Polyphenol possessing three or more phenolsubunits. The quantification of polyphenol content in foods and beverages is critical for understandingthe potential health benefits of polyphenols.Principle: The polyphosphotungstates are colorless in the fully oxidized 6 + valance stateof the metal, and the analogous molybdenum compounds are yellow. They form mixedheteropolyphosphotungstates- molybdatesthey exist in acid solution as hydrated octahedral complexesof the metal oxides coordinated around a central phosphate sequence of reversible one or two electronreductions lead to blue species such as ( PMoW 11O 40) 4- . In principle, addition of an electron to aformally nonbonding orbital reduces nominal MoO 4+ units to “isostructural” MoO 3+ . Tungstate formsare considered to be less easily reduced but more susceptible to one electron transfer. Molybdates areconsidered to be reduced more easily to blue forms. Mixed complexes as in Folin-Ciocalteu reagentare intermediate. Blue products of phosphomolybdate reduction can have Mo 6+ to Mo 5+ ratios of 9.6 to0.6. The 4 e- reduced species is the most stable blue form and develops readily from mixture of Mo 6+and Mo 5+ .Folin: Mo(VI) (yellow) + e- (from AH) → Mo(V) (blue)Reagents:a) Folins Ciocalteu’s reagent: (0.2N): The Folin-Ciocalteu reagent (FCR) is a mixture ofphosphomolybdate and phosphotungstate used for the colorimetric assay of polyphenolsand polypolyphenols antioxidants. 2N Folin-Ciocalteu’s phenol reagent (SRL) is diluted withdistilled water in the ratio 1:10.b) Sodium carbonate solution: (7.5% (w/v)7.5 g of sodium carbonate is dissolved in distilled water and make-up the Volume to 100mlusing volumetric flask.c) Sample: Two gm of fruit fortified dahi sample was placed in 10ml volumetric flask anddiluted with distilled water and subjected to centrifugation at 4000g for 10 min at 4°C and thesupernatant was collected.d) Gallic acid stock solution (1mg/ml)1g of Gallic acid (Sigma) was dissolved in 10ml ethanol and made up the volume to 1000 mlwith distilled water using volumetric flask.Procedure:a. Take 400μl of appropriately diluted sample/gallic acid standard in a test tube.b. To it add 2000μl of diluted Folin-Ciocalteu’s reagent and mix with vortex mixer.195

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancec. After 3 minutes add 1600 μl of sodium carbonate solution and incubate under dark at roomtemperature for 30 min.d. For blank preparation take 400μl of distilled water instead of sample.e. Measure the absorbance of the samples against blank at 765nm using SPECORD-200 doublebeam spectrophotometer (Analytical zena).C. Standard curve preparation:Standard curve is prepared by using 10-100 μg/ml concentration of gallic acid solution.D. Results:Express the results in terms of μmol gallic acid equivalent (GAE) /g of fruit pulp.196

Separation and Identification of Low Molecular Weight Proteins Using Tricine SDS-PAGESeparation and Identification of Low MolecularWeight Proteins Using Tricine SDS-PAGENeelima Sharma 1 , Rajan Sharma 1 and Y. S. Rajput 21Dairy Chemistry Division, 2 Animal Biochemistry Division, NDRI, KarnalThe purpose of SDS-PAGE is to separate proteins according to their size. SDS-PAGE is the mostwidely used method for analyzing protein mixture quantitatively. It is particularly useful for monitoringprotein purification and, because the method is based on the separation of proteins according to size,it can be used to determine the relative molecular mass of proteins. SDS (CH 3-(CH 2) 10-CH 2OSO 3-Na + )is an anionic detergent and when proteins are treated with SDS in presence of a reducing agent likeβ-mercaptoethanol or dithiothreitol, SDS binds to hydrophobic regions of protein molecule andprovides net negative charge on protein molecule. The binding of SDS to per unit length of proteinmolecules is almost constant for large number of different proteins and this brings charge-to-massratio almost constant for most proteins. The electrophoretic movement of protein in acrylamide gel isdetermined by molecular weight of proteins. Lower molecular weight proteins move faster than highmolecular weight proteins.Glycine-SDS-PAGE (also known as Laemmli-SDS-PAGE) and Tricine-SDS-PAGE, based onglycine-Tris and Tricine-Tris buffer systems, respectively are the commonly used SDS electrophoretictechniques for separating proteins.Tricine-SDS-PAGE is commonly used to separate proteins in the mass range 1-100 kDa. It is thepreferred electrophoretic system for the resolution of proteins smaller than 30 kDa. Tricine, used as thetrailing ion, allows a resolution of small proteins at lower acrylamide concentrations than in glycine-SDS-PAGE systems. A superior resolution of proteins, especially in the range between 5 and 20 kDa,is achieved without the necessity to use urea. The omission of glycine and urea prevents disturbanceswhich might occur in the course of subsequent amino acid sequencing.Requirements(A) Reagents1. Acrylamide solution (49.5% T, 3%C)• Acrylamide: 48 g• N, N’- Methylene-bis-acrylamide : 1.5 g• Dissolved in distilled water to a final volume of 100 ml. Filter the solution and refrigerate(7-10°C). Gentle warming may be required for complete dissolution after refrigeration.• %T = Total acrylamide percentage of both monomers (acrylamide and the crosslinkerbisacrylamide)• %C = Percentage concentration of the crosslinker relative to total concentration2. Gel buffer (3X)• Tris: 36.34 g• SDS: 0.3 g• HCl• Dissolve in 60 ml water. Adjust the pH to 8.45 with concentrated HCl. Make up the finalvolume upto 100 ml with water. Store at 20 – 25°C.3. Cathode buffer (1X)• Tris: 12.11 g• Tricine: 17.92 g197

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance• SDS: 1 g• Dissolve in distilled water and make volume upto 1 L. The pH of the solution should be approx8.2. Do not correct the pH.4. Anode buffer• Tris 6.05 g• Dissolve in 50 ml. Adjust pH upto 8.9 with conc. HCl/ 1N HCl and then makeup volume upto 500 ml with dist water.5. Sample buffer (4x)• SDS (12%, w/v) : 12 ml of 20% SDS• Glycerol (30%, w/v) : 6 g• Mercaptoethanol (6%.v/v) : 1.2 ml• Coommassie blue G 250 (0.05%) : 0.01g• Tris/HCl (pH 7) (150 mM) : 3 ml of 1 M Tris-HCl• Make up the volume upto 20 ml.6. Marker (2.5µl/well)• Take 3.5µl marker and add 10µl sample buffer (1.33x). For 1.33x sample buffer, dilute 1ml of 4xsample buffer with 2 ml distilled water.7. Ammonium persulfate• Dissolve 100 mg of ammonium persulfate in 1 ml of distilled water immediately before use.8. Separating gel solution (16%)• Acrylamide solution : 5 ml• Gel buffer : 5 ml• Glycerol : 1.5 ml• Water : 3.5 ml• APS : 30 μl• TEMED : 10 μl• TEMED - N,N,N’,N’-Tetramethylethylenediamine.• APS – This is the last to be added in the solution.9. Stacking gel solution (4%)• Acrylamide solution : 1 ml• Gel buffer : 3 ml• Water : 8 ml• APS : 60 μl• TEMED : 10 μl10. Fixing solution• 10% TCA (Trichloroacetic acid)11. Staining solution (0.025% Coommassie brilliant blue g250 in 10% acetic acid)• Dissolve 25 mg of the dye in 100 ml of 10% acetic acid.12. Destaining solution• 10% Acetic acid. Destain the gel twice. Each incubation should last for 15-60 min. Then transferthe gel to distilled water.• (B) Mini vertical gel electrophoresis unit.198

Separation and Identification of Low Molecular Weight Proteins Using Tricine SDS-PAGEMethod1. Gel preparation• Prepare gel plates of the size 8 x 10 cm in casting stand for gel electrophoresis.• Prepare the separating gel (16.5%) was, pipette it down into each of the gel cassettes to a heightof 4 cm.• Overlay the gel mix with water or butanol to cuy oxygen action and to give a flat gel surface forflat sample bands.• After polymerization carefully remove water with the help of blotting paper.• Then overlay stacking gel solution over it.• Insert preparative comb into the stacking gel solution to make troughs and wells and keep thewhole system undisturbed (1 -2 hours) for the setting of gel.2. Sample preparation• Dissolve 3 mg sample in 500 µl of Tris buffer (150 mM, pH 7.0) - Solution A.• Take 3 x 15 µl of Solution A and 3 x 5 µl of 4x buffer and load 10 µl in each well. Each wellwould contain 45 µg of protein.• Then take 100 µl of the Solution A and mix with equal volume of Tris buffer (150 mM, pH7.0). Now again take 3 x 15 µl of this sol in 3 x 5µl of 4x buffer and load 10 µl in each well.Each well would contain 22.5 µg of protein.• Incubate samples and marker at 37°C for 15 min3. Electrophoresis• Place the gel sandwich after removing the comb in the mini vertical gel electrophoresis unit.• Clamp the sandwich in place.• Load 15 µl of protein samples and molecular weight markers to these wells.• Fill the lower buffer chamber with anode buffer. Check that the lower electrode is completelysubmerged.• Fill the upper buffer chamber with cathode buffer and also layer it over the applied samplescarefully. Place the safety lid on the unit.• Run the experiment at 10°C by keeping the whole assembly in the refrigerator.• Carried out electrophoresis at constant current of 20 mA till the sample crosses the stacking gel.Then the increase the current to 25 mA and maintain throughout the remainder of the run untilthe marker dye was within 1 cm of the anodic end of the gel.• Remove the gel carefully and then transfer it to the fixative solution. Keep it over an orbitalshaker for 60 min.• Stain the gel with staining solution for twice the length of time used for fixing again using orbitalshaker.• Transfer the gel to the destaining solution till bands become visible against light backgroundrenewing the solution every 30 min.ReferencesSchagger (2006 )Nature Protocol, 1 (1): 16-22.Shagger, H. and Jagow, G.V. (1987) Tricine-Sodium dodecyl sulfate-polyacrylamide gel electrophoresis for theseparation of proteins in the range from 1 to 100 kDa. 166:368-379.199

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIntroductionIdentification of Proteins ThroughWestern Blotting – PracticalNeelima Sharma 1 , Amit K.Barui 1 and Y.S. Rajput 21Dairy Chemistry Division, 2 Animal Biochemistry Division, NDRI, KarnalThe technique of Western blotting refers to identification of specific proteins, which arefirst separated on acrylamide gel using electrophoresis and then subsequently transferred tonitrocellulose membrane and identified. The identification of protein (antigen) is carried out byperforming antigen-antibody (first antibody) reactions on the membrane itself. Second antibodyenzymeconjugates were then allowed to interact with immobilized first antibody and then usingappropriate substrate, protein bands are detected. Although, antigen-antibody interactions arewidely employed in Western blot, other kind of interactions such as glycoprotein-lectin and biotinavidinhave allowed research workers to employ this technique for other applications includingcarbohydrate staining of glycoprotein, protein sequencing etc.During 1979-80, this technique was described simultaneously by many workers but the methoddescribed by Towbin et al. (1979) is most cited. The technique of Western blotting involves two distincttechniques viz. (i) SDS-PAGE and (ii) electrophoretic transfer of protein from gel to membrane andimmuno-detection of proteins.For Western blot, SDS-PAGE is carried out in mini-gel units. The separation of protein in minigelunit is similar to large-gel unit. In mini-gel units, volumes and separation times are considerablyreduced. The resolution in mini-gel is adequate for most routine applications.Electrophoretic transfer of proteins from gel to membraneMini-trans blot assembly (Bio-rad), power pack, orbital shaker, tris, glycine, methanol, nitrocellulosemembrane, Whatman No. 3 paper.Transfer buffer (25 mM tris, 192 mM glycine, 20% methanol, pH 8.3)-3.03 g tris and 14.4 g glycine are dissolved in distilled water. 200 ml methanol is then added.Volume is made up to 1 litre with distilled water. The pH of buffer will range from 8.1 to 8.4 dependingon quality of tris, glycine and methanol. Methanol should be analytical grade as metallic contaminantsin low grade methanol will plate on the electrode. The pH of buffer is not adjusted with acid or base.Procedure-• Membrane and gel are handled only after wearing gloves.• After completion of SDS-PAGE, spacer gel is removed. A small cut on top left side in runninggel is made to remember the orientation of gel.• The running gel is equilibrated with transfer buffer for 30 min. to remove salts and SDS. Transferbuffer is changed at least once during equilibration. Membrane of appropriate size is cut fromsheet. A small cut on top left side of membrane (glossy side facing worker) is made to rememberorientation of the membrane.• While the gel is equilibrating, nitrocellulose membrane is activated by placing it in transfer bufferat an angle of 450. Also, fiber pads and pre-cut filter papers (Whatman No. 3) are immersed intransfer buffer. Air bubbles trapped in fiber pads and filter papers are removed.• Gel holder cassete is opened and placed in glass vessel so that the gray panel is flat on thebottom of the vessel and clear panel rests at an angle against wall of the vessel.• Gel holder cassette is assembled in following sequence : gray panel (cathode), fiber pad,filter paper, gel, nitrocellulose membrane (glossy side facing the gel), filter paper, fiber pad,200

Identification of Proteins Through Western Blotting – Practicalclear panel (anode). For easy remembrance of orientation, cut portions of gel and membraneis aligned. This arrangement allows transfer of proteins on membrane where well positionremains the same as that in acrylamide gel. While assembling, care is taken not to allowtrapping of air-bubbles. This is achieved by assembling cassette under buffer and when eachlayer is added, all air pockets are removed by rolling clean test tube over the layer. Nearlyadhesive contact is essential between the membrane and gel otherwise swirled or missingtransfer patterns and overall high background will be observed.• Buffer tank is filled with transfer buffer (4ºC). Bio-freeze cooling unit containing ice is placed inbuffer tank.• Gel holder cassette is closed and placed in the buffer tank such that gray panel of the cassettefaces the gray cathode electrode panel. The whole of blotting assembly is then placed over themagnetic stirrer.• Electrophoretic transfer is carried out at constant voltage of 30 V overnight at 4ºC. The startingcurrent should be around 40 mA. At the end of transfer, the current should be 90 mA. In casefinal value of current is less than 90 mA, a constant voltage of 100 V is additionally applied for1 h.• After run, nitrocellulose membrane is stained with different reagents for visualization of proteinsor antigens. For ascertaining transfer of proteins from gel, the gel is also stained with coomassiebrilliant blue as described in earlier section.Detection of transferred protein on nitrocellulose membraneIn Western blot, molecular weight markers and protein (antigen) samples are loaded in separatelanes in SDS-PAGE. Whereas, methods used for staining of molecular weight markers are based onnon-specific reaction of dye with protein, antigenic proteins are detected employing antigen-antibodyinteraction. Therefore, after electrophoretic transfer, the membrane-portion containing molecularweight marker is cut from rest of membrane containing protein antigens. The molecular weightmarkers can be stained by Ponceau S or congo-red dye. The proteins (antigens) are stained usingprimary antibody and secondary antibody-enzyme conjugates.Visualization of molecular weight markers-Ponceau S Staining-Stock Ponceau S dye solution is prepared by dissolving 200 mg Ponceau S in 10 ml of 3%trichloroacetic acid. The stock dye solution can be stored at room temperature. The stock solution isdiluted ten fold with distilled water before use. The membrane is added slowly to vessel containingdiluted dye solution so that membrane absorbs dye uniformly. The membrane is then sub-merged for5 to 10 min with mild shaking. After staining, the membrane is then rinsed with water or PBS until aclear contrast between the bands (pink) and background (white) is observed. Staining of proteins withPonceau S is reversible.Congo-red Staining-Stock Congo-red solution is prepared by dissolving 1 g Congo-red in 100 ml distilled water. Thissolution is stable at room temperature. The working congo-red solution is prepared just before use bydiluting 1 ml of stock dye solution with 9 ml of 0.2 M acetate buffer, pH 3.5. The membrane is submergedin working congo-red solution for 5 min. at room temperature. The destaining is carried outby immersing the membrane in distilled water until brown bands become visible against light pinkbackground. During staining and destaining, mild shaking is employed.Visualization of Protein (Antigen)-Reagents-Primary antibodies directed against antigen and raised in rabbit, secondary antibody enzymeconjugates such as goat anti rabbit immunoglobulin-peroxidase goat, anti rabbit immunoglobulin-201

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancealkaline phosphatase, diamino benzedine, hydrogen peroxide, bovine serum albumin, nitro bluetetrazolium (NBT) bromochloroindolyl phosphate (BCIP), dimethyl formamide (DMF).Visualization of antigen using secondary antibody peroxidase conjugate-All steps are carried out at room temperature.• Membrane is washed with PBS (3x10 min.)• The membrane is treated with blocking solution (3% BSA prepared in PBS) for 1 h.• The membrane is treated with diluted rabbit antiserum for 1 h. The antiserum in rabbit is raisedagainst the antigen. The dilution is decided by antibody litre in immune serum and is carriedout in 1% BSA – PBS- (0.05%) Tween – 20. The membrane is washed with PBS -0.05% Tween 20(3x10 min.).• The membrane is treated with goat anti-rabbit immunoglobulin-peroxidase conjugate (1:1000diluted with 1% BSA – PBS – Tween 20) for 1 h. The dilution of conjugate is done as per instructionfrom manufacturer.• The membrane is washed with PBS (4 x 10 min.).• The membrane is immersed in enzyme substrate DAB - H O (6 mg diaminobenzidine in 10 ml2 2of 0.05 M Tris-HCl buffer, pH 7.6 containing 100 µl of 3% H 2O 2) till brown bands become visible.The membrane at that stage is washed with distilled water and air-dried.• Membrane strips containing molecular weight markers and proteins (antigens) are aligned andphotographed.Visualization of antigen using secondary antibody-alkaline phosphataseconjugateThe method is similar to the method described using secondary antibody-peroxidase conjugateexcept the followings.• Appropriately diluted secondary antibody-alkaline phosphatase conjugate is used instead ofantibody-peroxidase conjugate.• Instead of DAB-H O , the enzyme substrate used is BCIP-NBT. Stock solutions of nitroblue2 2tetrazolium (NBT) and bromochloro indolyl phosphate (BCIP) are prepared and stored at–200C. Stock NBT is prepared by dissolving 30 mg NBT in 1 ml of 70 per cent DMF. StockBCIP is prepared by dissolving 15 mg BCIP in 1 ml of DMF. The working substrate solutionis prepared by addition of 200 µl of stock NBT and 200 µl of stock BCIP to 20 ml of 100 mMTris-HCl, pH 9.5 containing 100 mM NaCl and 5 mM MgCl 2. When membrane is treated withenzyme substrate, light violet colour blots become visible against light background.Helpful-hints• The one major problem in Western blot is incomplete transfer of protein from gel to nitrocellulosemembrane. Transfer efficiency is improved by decreasing gel concentration which leads tomore porous gel. In more porous gel, the resolution of proteins is decreased. Gel containinglow molecular weight proteins should not be excessively washed after SDS-PAGE and beforetransfer to avoid removal of these proteins in washing.• Methanol in transfer improves binding of SDS-proteins to nitrocellulose membrane but it causesacrylamide gel pores to contract resulting in fixation of large molecular weight proteins withinthe gel matrix. In case of poor transfer of large molecular weight proteins, one can try transfer intransfer buffer containing reduced concentration of methanol.• Gel and membrane must make good contact. Thus excess moisture in the gel-membrane interfaceshould be removed by rolling test tube over membrane while gel holder cassette is assembled.• Poor transfer can occur if the protein is basic (ie pI > 9) as protein will have net positive chargeat the pH of transfer buffer (pH 8.5).202

Identification of Proteins Through Western Blotting – Practical• Lower concentration of methanol (< 15%) does not facilitate removal of SDS from the gel andproteins.• Nitrocellulose membrane is compatible with enzyme immuno assay. Blocking of free proteinbinding sites is easy and thus background problems are not observed. No activation of themembrane is required. However, some proteins (

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceTyping of Milk for A1 and A2 beta CaseinSachinandan De, C. M. Hari Kishore, Ayan Mukherjee and Rupinder KaurAnimal Biotechnology Centre, NDRI, KarnalMilk contains numerous components of nutritional and health benefit. Calcium is one example.Milk is also a significant source of dietary fat. An additional risk factor present in some bovine milkrelated to the beta casein has been discovered. Initially, three variants of beta casein were discoveredand denoted as A, B and C. It was later found that the A variant could be resolved into A1, A2 andA3 by gel electrophoresis. The beta casein variants now known are A1, A2, A3, B, C, D, E and F, withA1and A2 being present in the milk in the highest proportions. The debate about A1 and A2 milk typeshas been in the public arena for more than ten years. There have been lots of claims and counter claimsabout whether ‘ordinary milk’, which is a mixture of A1 and A2 milk, is linked to a range of diseaseconditions, and whether selecting for cows that produce only A2 milk can avoid these problems. Wehave successfully developed a method for typing DNA from cells available from the milk. We arealso in the process of detecting A1 A2 beta casein variants from the milk sample. This is an innovativeprocess for the isolation of DNA from milk and milk products. The DNA samples obtained fromthe milk and milk products were used for differentiation of A1 and A2 beta-casein by simple PCRtechnique.Cows’ milk b-casein contains 209 amino acids. The A1 and A2 variants differ only at position67, which is histidine in A1 or proline in A2 milk. (Another variant B b-casein also has histidine atpositive 67. It is less frequent than A1 or A2 in the milk of cows of European origin.) A bioactive sevenamino-acidpeptide, b-casomorphin-7 (BCM-7) can be released by digestion in the small intestine ofA1 b-casein with pepsin, leucine aminopeptidase and elastase but the alternative proline at position67 prevents a split at this site.Tyr60-Pro61-Phe62-Pro63-Gly64-Pro65-Ile66-His67b-casomorphin-7 (BCM-7)BCM-7 has opioid and cytomodulatory properties. Synthetic BCM-7 can inhibit responses oflymphocytes to stimulants in vitro (Elliott, 1992; Elliott et al, 1997). Elliott et al (1997) reported thatNOD mice fed A1 b-casein did not develop diabetes if they were also given naloxone (the morphineantagonist). The antibody response to ovalbumin was prevented in NOD mice if they were alsogiven injections of (synthetic) BCM-7; this prevention did not happen in Swiss mice. They suggestedthat appearance of diabetes in genetically susceptible NOD mice fed A1 bcasein— not those fed A2b-casein—might be due to release from A1 b-casein of the bioactive peptide, BCM-7 which had astrong inhibitory effect on immune function.Some 75% of the world’s 300 million strong dairy herd produces milk that contains the proteinbeta casein A1. There is a somewhat controversial claim, backed by 16 years of research, that thismilk, which is drunk by most people in the western world, could be a cause of diabetes, heart disease,autism and schizophrenia in people with immune deficiencies. It is also claimed that the protein betacasein A2 is benign in this respect. Cows in the well-known dairy breeds can produce either or bothof the beta casein proteins. They can be A1/A1, A1/A2, or A2/A2. Genotyping has shown that about80% of Indian (Bos indicus) cows produce only beta Casein A2. In Australia, A2 milk was launched(A2 Corporation) quietly into the world marketplace. A2’s backers believe it will help prevent diseaseand make them fortunes. A1 proponents argue that the evidence against ordinary milk has not beenproved and that they are the victims of a scare campaign. The New Zealand Medical Journal publisheda paper in 2003 entitled ‘The influence of consumption of A1 ß-casein on heart disease and Type204

Typing of Milk for A1 and A2 beta Casein1 diabetes’, (http://www.nzma.org.nz/journal/116-1168/295/) by Murray Laugesen, and Robert BElliott. We all know the well documented and proven benefits of drinking milk which is a mixtureof A1/A2. The general view is that there may be quite some way to go before the hypothesis can beproved by evidence of cause and effect.A PCR based method was developed to detect the A1 and A2 beta casein variant forms in cattleand buffalo milk. Buffalo milk is of A2 type so far the numbers of samples are tested in our laboratory.Different proportions of A1 and A2 alleles are found in Indian cattle milk. This A1 allele is representedin heterozygous A1A2 type as well as in A1A1 type. Some animals are homozygous for examplebovines that are A1A1 for Beta casein and those A2A2 for beta casein. In bovine, a mutation in theDNA sequence coding for the beta casein protein at nucleotide position 200 has resulted in thereplacement of a cytidine base with an adenine base. Thus, the triplet codon affected by this changecodes for histidine (CAT) rather than for proline (CCT) at amino acid position 67 of the protein. Thus,the histidine at position 67 results in the cow producing beta casein A1 type while the proline resultsin the cow producing beta casein A2 type. A high proportion of the common domestic cattle breeds,such as Holstein, express the beta casein A1type. It was estimated that in the late 1980s more than 70%of the Californian Dairy herd carried the A1 allele. If the hypothesis of undesirable role of A1 betacaseinis confirmed, consumers may wish to reduce or remove this allele from their diet. In this way,we systematically try to monitor the frequency of beta-casein alleles in bulls and indirectly in cows.205

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceEnzyme-Linked Immunosorbent Assay-PracticalSuman Kapila and Rajeev KapilaAnimal Biochemistery Division, NDRI, KarnalEnzyme-linked immunosorbent assay, commonly known as ELISA is a heterogeneous EIA basedon the same principle as the radioimmunoassay but depends on an enzyme rather than a radioactivelabel. An enzyme conjugated with an antibody reacts with a colorless substrate to generate a coloredreaction product. Such a substrate is called a chromogenic substrate. A number of enzymes are beingused for ELISA like alkaline phosphatase, horseradishperoxidase and β-galactosidase. The specificity,sensitivity and ease to perform these techniques have made these methods popular. A number ofvariations of ELISA have been developed.Indirect ELISACoat well with Addition of specific Addition of secondary Addition of substrateAg Ab Ab (Enzyme -conjugated) measure colorSandwich ELISACoat well with Addition of Ag Addition of secondary Addition of substrateAb Ab (Enzyme -conjugated) measure colorCompetitive ELISAIncubation of antibody Addition of Ag-Ab Addition of secondary Addition of substratewith the Ag mixture Ab(Enzyme -conjugated) measure color206

Enzyme-Linked Immunosorbent Assay-PracticalAssay for immunoglobulins in colostrums/milk/serum by sandwich ELISAReagents:Coating buffer: 50mM Carbonate-Bicabonate Buffer, pH 9.6Washing buffer : 0.05 percent Tween in PBS (PBS/T).Blocking solution : 1 percent BSA (fraction V) in PBS/T.Coating antibody : Sheep anti-Bovine IgGStandard : Bovine reference serumDetection antibody : Sheep anti-Bovine IgG HRP conjugateSubstrate : TMB/ H 2O 2(0.02%) substrateStop solution : H 2SO 4(2M)ProcedureCoating1. Dilute capture antibody at a ratio of 1:100 with coating buffer and add 100ul of diluted captureantibody to coat each well.2. Incubate for at least 1h at room temperature3. After incubation, aspirate the solution of each well and wash the wells three times with washingbuffer.Blocking1. Add 200ul of blocking solution to each well2. Incubate for at least 1h at room temperature.3. After incubation, aspirate the solution of each well and wash the wells three times with washingbuffer.Reacting Standards and SamplesFor preparation of sample, take 20ml of milk/colostrums, warm it and add 0.5ml of rennet solution(0.5%). After 10 minutes, filter the coagulated sample using Whatman 42. Take filtrate for quantificationof antibodies.1. Dilute the standards and samples in blocking solution at 1:2 serial dilutions2. Transfer 100ul of standard or sample to assigned wells.3. Incubate for at least 1h at room temperature.4. After incubation, aspirate the solution of each well and wash the wells five times with washingbuffer..Detection Antibody1. Dilute the detection antibody in blocking solution.2. Add 100ul per well and incubate for 1h at room temperature.3. After incubation, aspirate the solution of each well and wash the wells five times with washingbuffer.Colour reaction1. Add 150ul of substrate solution containing 50ul TMB and 100ul H O to each well. Mix well by2 2shaking slightly.2. After incubation for 10-15 minutes at room temperature add 50ul stop solution3. Using a microtiter plate reader, read the plate at 450nm.207

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceEvaluation of Biological Activity ofMilk Protein IngredientsBimlesh Mann, Prerna Saini, Prabhakar Padghan, Anuradha KumariDairy Chemistry Division, NDRI, KarnalWith the growing popularity of high protein dairy products among health conscious consumers,many dairy manufacturers are looking for ways to boost the protein level of foods such as yoghurt,dairy beverages and frozen desserts. Milk protein ingredients which include sodium caseinate, wheyprotein concentrate (WPC), whey protein isolates (WPI) and milk protein hydrolysates, not onlyimprove the nutritional profile of dairy foods, but also provide the functionality. From a nutritionalperspective, all the milk ingredients are complete, high quality protein with all the essential aminoacids required for the human nutrition. From functional perspective, WPC and WPI are highly solubleover a wide pH range and contribute emulsifying, water binding, thickening, foaming, gelling, andfilm forming properties to food and beverages system. While the milk protein hydrolysate are fullysoluble and less likely to gel at high concentration in the high protein beverages compared to intactmilk proteins. From the biofunctional point of view, milk proteins are the potential sources of bioactivepeptides with antimicrobial, ACE- inhibitory, cholesterol lowering, antioxidant, immunomodulatoryand opioid properties. These peptides are inactive within the protein sequence and require enzymaticproteolysis for their release. Bioactive peptides usually contain 3-20 amino acid residues per molecule.These milk derived bioactive peptides are considered as prominent ingredients for various healthpromoting functional foods targeted at heart, bone and digestive system health as well as improvingimmune defense, mood and stress control.1) Antioxidant activity:-Free radicals are generated through normal reactions within the body during respiration in aerobicorganisms, particularly vertebrates and humans. In addition to the physiological production ofoxidants and their secondary reactions, there are other sources for production of oxidants. Oxidationof fats and oils during processing and storage of food products worsen the quality of their lipid contentand nutritive values. Consumption of these potentially toxic products can give rise to several diseases.Under normal conditions, antioxidant defense systems can remove reactive species through enzymaticantioxidants like superoxide dismutase and glutathione peroxidase and non-enzymatic antioxidantssuch as proteins and peptides, antioxidant vitamins, trace elements, coenzymes and cofactors. Themilk derived bioactive peptides show antioxidant activity by sequestering free radicals, chelatingmetal and regulating the level of antioxidant enzymes in body.Principle:Based on the principle of interaction of antioxidant with chemically generated ABTS˙ (bluecoloured) oxidant by persulfate oxidation of 2, 2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid)(ABTS2-) indicated by decrease in absorbance at 734nm with concomitant decrease in blue colour ofthe oxidant.Sample preparation:5% solution of whey protein concentrate preheated at 65°C /30 min is hydrolyzed by using alcalaseat 65°C for 5 hrs by maintaining pH at 8.5. The hydrolysate is centrifuge at 10000 rpm/30 min andsupernatant is collected.208

Evaluation of Biological Activity of Milk Protein IngredientsReagents:a) Potassium persulphate solution (140 mM)b) ABTS [2, 2’-azinobis (3 ethyl benzothiazoline)-6-sulfonic acid] stock solutionDissolve 19.2 mg of ABTS in 5 ml of double distilled water; add 88 µl of 140 mM potassiumpersulphate and keep the solution in an amber colour bottle in dark for 12-16 hours.c) Phosphate buffer saline (pH 7.4)PBS was prepared by dissolving 8.0 g of NaCl, 0.2 g of KCl, 1.44 g of Na 2HPO 4and 0.24 g ofKH 2PO 4in 800 ml distilled water, adjusted pH to 7.4 with 1 N HCl and made the volume to 1 liter withdistilled water.d) ABTS working solutionDilute 1 ml of ABTS stock solution with phosphate buffer saline (approx 1:90) till it gives anabsorbance of 0.70±0.02 at 734 nm. The stock solution of ABTS is stable upto 2 days for analyticalpurpose.e) Trolox solution (5 mM)Dissolve 12.5 mg of Trolox [6-hydroxy. 2, 5, 7, 8 – tetramethyl chroman-2-carboxylic acid] in 10 mlof ethanol. Dilute with distilled water to varying concentrations (25 - 250µM).Procedure:• Pipette out 3 ml of ABTS working solution in 3 ml cuvette• Pipette out 3 ml of phosphate buffer saline in another cuvette• Insert the curette into the respective slots in the double beam spectrophotometer• Add 10 µl of appropriate diluted sample / Trolox to both reference and ABTS solution• Mix the contents for 10 seconds• Measure the decrease in the absorbance at 734nm over a period of 10 minutes at 10 sec interval.• Plot the standard curve with concentration (µM) of Trolox (X-axis) vs % inhibition (Y-axis)• Express the results as trolox equivalent antioxidant capacity (TEAC) values i.e. μM troloxequivalent / mg of protein using standard curve.2) Antihypertensive activity:-Angiotensin I converting enzyme (ACE; kinases II peptidyldipeptide hydrolase, EC 3.4.15.1) isimportant for blood pressure regulation. In the event where decreased blood volume or decreased bloodflow to the kidneys is sensed, renin acts on angiotensinogen to form angiotensin I. ACE then catalysesthe hydrolysis of the inactive prohormone angiotensin I (decapeptide) to angiotensin II (octapeptide).The result is an increase in blood pressure through vasoconstriction, via increased systemic resistanceand stimulated secretion of aldosterone resulting in increased sodium and water resorption in thekidneys. ACE also inactivates the vasodilating peptide bradykinin (nonapeptide) and endogenousopioid peptide Met-enkephalin. Biologically active peptides derived from milk proteins are having anaffinity to modulate blood pressure by inhibit ACE activity.Principle:The method is based on the liberation of hippuric acid from hippuryl-L-histidyl-L-leucine (HHL)catalyzed by ACE.Sample preparation:5% solution of whey protein concentrate preheated at 65°C /30 min is hydrolyzed by using alcalaseat 65°C for 5 hrs by maintaining pH at 8.5. The hydrolysate is centrifuge at 10000 rpm/30 min andsupernatant is collected.209

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceReagents:Hippuryl- histidyl-leucine (HHL) (5 mM)10.74 mg of HHL (Sigma, U.S.A) was dissolved in 5 mL of 0.1 M sodium borate buffer (pH 8.3) with0.3 M NaCl, pH 8.3Sodium Borate buffer (0.1 M, pH 8.3) containing 0.3 M NaClSodium tetra borate 3.81 g and NaCl 1.75 g were dissolved in 80 mL of distilled water, pH wasadjusted to 8.3 and finally volume was made to 100 mL with distilled water.Angiotensin converting enzyme (ACE)ACE from rabbit lung (Sigma, U.S.A) 1 unit was dissolved in 5 mL of distilled water and stored at-20ºC.Procedure:1. Add 20 μl of sample to 110 μl of substrate (in 5 mM HHL in 0.1 M borate buffer)2. Add 20 μl ACE (4 mU), mix and incubate the mixture at 37ºC for 30 min.3. Add 250 μl of 1M HCl to terminate the reaction4. Extract the hippuric acid formed with 1.5 ml ethyl acetate centrifuging at 3000 g for 10 min5. Dry one ml of upper organic layer by heating at 95ºC for 20min and redissolve in 1 ml of distilledwater6. Measure the absorbance at 228nm7. Prepare positive control with distilled water in place of sample8. Prepared blank with substrate and water (ACE volume is replaced by equal amount of water)9. Calculate% ACE =Express the results as peptide concentration required to inhibit 50 percent of the original ACEactivity (IC50).3) Caseinophosphopeptides as mineral binding peptides:-Caseinophosphopeptides(CPPs) are casein derived peptides contains phosphorus boundvia monoester linkages to seryl residues. They contain a common motif i.e. a sequence of threephosphoseryl groups followed by two glutamic acid residues Ser (p)- Ser (p)- Ser (p)- Glu- Glu.These peptides are highly negatively charged structures and soluble at pH 4.6. The highly anionicphosphorylated regions and the a.a. sequence around this hydrophilic region part play a significantrole in mineral binding and absorption in body. These peptides are able to bind macroelements suchas Ca, Mg and Fe along with trace elements such as Zn, Ba, Cr, Ni, Co and Se.Principle:CPPs are soluble at pH 4.6 and they are aggregated with divalent cation such as calcium at neutralpH and precipitated by using ethanol.Procedure:• Prepare 5 % casein suspension by mixing casein on a magnetic stirrer• Adjust the pH to 7 using 0.5 N NaOH.• Add enzyme tripsin at Enzyme: substrate ratio of 1:25• Hydrolysis is carried out by mixing the suspension using electric stirrer in water bath at 37ºCfor 4 hours• The pH of solution is kept constant at 7.0 by addition of 0.1N NaOH solution210

Evaluation of Biological Activity of Milk Protein Ingredients• After complete hydrolysis remove the mixture from water bath• Adjust the pH of casein hydrolysate to 4.6 using 2N HCl• Centrifuge at 3000 rpm for 10 min to remove the unhydrolyze protein.• Collect the supernatant and adjust pH to 7.0 using 2.0 N NaOH.• Add calcium chloride at 1% level to the supernatant and allow it for 1 hour at roomtemperature.• Add Ethanol 50%(V/V)• The precipitate is collected by centrifugation at 6000 rpm for 10 min.• The CPPs thus obtained is lyophilized.Flow Diagram for Isolation of CPPs:Whole caseinHydrolysis with enzymes at 37ºCAdjustment of pH to 4.6 with 2N HClRemoval of unhydrolyze protein by centrifugationat 3000 rpm /10minAdjustment of pH to 7.0 using 2N NaOHCalcium chloride aggregation and ethanol extraction byCentrifuging at 6000 rpm/10minEnriched CPPs211

Chemical Analysis of Value Added Dairy Products and Their Quality AssurancePurification of Bioactive Proteins from MilkNeha Mishra 1 , Rajesh Kumar 2 and Jai K Kaushik 11Animal Biotechnology Centre, 2 Dairy Chemistry Division, NDRI, KarnalColostrum secretion in the mammary gland during the first few days after parturition provides thecalves with nourishment and passive immunity. Differences between relative protein concentrationin colostrum and milk reflect differences in immunoglobin transfer. It is a source of nutrients andcontains many kinds of bioactive molecules which are essential for specific functions. The major wheyproteins are β-lactoglobulin, α-lactalbumin, lactoperoxidase, lactoferrin and immunoglobins etc.Lactoferrin and immunoglobin G are two of the most important bioactive components in colostrumand both are contained in over 10 fold higher concentrations in colostrum as compared to normalmilk. Several proteins with antimicrobial activity, such as immunoglobulins, κ-casein, lysozyme,lactoferrin, haptocorrin, β-lactalbumin, and lactoperoxidase, are relatively resistant against proteolysisin the gastrointestinal tract. Lactoferrin is nearly 80-kDa glycoprotein belonging to transferin familywith characteristic red color due to iron binding. Apart from being present in high concentrationin colostrum, lactoferrin is also an important component of many external secretions such as saliva,tears, semen, mucosal secretions and neutrophilic granules of leucocytes. Membrane separation andchromatography are commonly used techniques for isolation of high purity lactoferrin. Comparedwith other chromatographic methods, ion-exchanger is an advantageous technique due to its low cost,reduced number of steps and easy to scale up. Lactoferrin is subjected to cation exchanger by takingadvantage of its basic nature, as LF has isoelectric point of ~ 9, while major whey proteins alphalactalbuminand ß-lactoglobulin have pI values of 4.2 and 5.4, respectively. Therefore, by employingweak cation exchanger at neutral pH, lactoferrin is allowed to bind to the resin followed by elutionusing a linear gradient of NaCl.Materials and methodFresh buffalo or cattle colostrum, 7 gms CM-sephadex per liter colostrum, Tris-HCl - 50mM, pH-8.0 equilibration buffer, Tris-HCl (50mM, pH 8.0) + 0.2M NaCl washing buffer, Tris-HCl (50mM, pH8.0) + 0.5M NaCl elution buffer, Tris-HCl (50mM, pH-8.0) +1M NaCl. Glass column of ca 1.5-2.5 cmdiameter and 50 cm in height can be employed at the first step of purification of lactoferrin in a batchmode. High resolution purification requires prepacked cation-exchanger like CM-sepharose or MonoS(GE Biosciences) connected with a medium pressure protein purification system, e.g. AktaPrimer orAkta Explorer (GE Biosciences). The cation exchanger column and purification system from othersuppliers may also be used without any effect on purification; however in our lab, the protocol forhigh resolution purification of lactoferrin has been optimized on HiLoad 16/10 SP-Sepharose highperformance cation exchange column from GE Biosciences.ProcedureCM-Sephadex (7g/litre) ion exchanger resin is equilibrated with 2 volume of Tris-HCl 50mM,pH 8.0. 2 liters of fresh colostrum is defatted by centrifuging at 3-5000 rpm for 15 mins. Fat layer canbe removed from centrifuge bottles by spatula followed by filteration of the defatted milk througha double layered cheese cloth. The skimmed milk is then resuspended in 2-3X volume of 50 mMTris-HCl pH 8.0. Pre-equilibrated CM-sephadex matrix (50 mM Tris-HCl pH 8.0) is then added andlactoferrin and other cationic proteins are allowed to bind to the matrix by continuous manual stirringfor 2-3 hours. Mixture was left overnight on the magnetic stirrer at 4 ºC for effective binding whichwas observed by change in color of the gel. Stirring is stopped and the matrix gel is allowed to settlein the bottom of the vessel. Whey can be decanted carefully without disturbing the gel. The settled gelis then washed with 3-4 volumes of Tris-HCl 50mM, pH 8.0 until whey has been completely removed212

Purification of Bioactive Proteins from Milkfrom the matrix, which can be packed in the column. Lactoperoxidase and immunoglobins are elutedby washing the matrix with Tris-HCl 50mM, pH 8.0 + 0.2M NaCl. Lactoperoxidase is eluted as ablue-greenish layer. This is followed by elution of lactoferrin with 0.5M NaCl with Tris-HCl 50 mM atpH 8.0. Isolated lactoferrin is then dialyzed in 50mM Tris-HCl pH 8.0 to remove the NaCl, followedby concentration by using 30kDa ultrafiltration devices (4000rpm for 30 mins) like Centricon fromMillipore or equivalent from other manufacturers. Highly purified lactoferrin can be obtained byloading it into SP-Sephrose column equilibrated with 0.4M NaCl + 50mM Tris-HCl, pH 8.0 and elutedthrough a linear gradient of 0.4M NaCl -0.7M NaCl with 50 mM Tris-HCl pH 8.0. Level of purity of thesample can be analyzed by SDS-PAGE.Flow diagram of purification of lactoferrin from colostrumFresh colostrumCentrifuged at 4000 rpm (250-500 ml bottle fixed rotor)Remove fat by filtering through cheese clothDilute whey 2-3 times with 50 mM Tris-HCl, pH 8.0Add CM-Sephadex C-50, pre-equilibrated with 0.05M Tris- HCl, pH 8Stir the gel in the colostrums manually for 2-3 hours, leave it O/N with stirringDecant the whey, and wash the settled gel with 0.05M Tris HCl pH 8.0Gel washing followed by decantation is repeated at-least thriceProteins like LP and Ig are washed from gel with 0.05 M Tris-HCl / 0.2 M NaCl (pH 8.0)The lactoferrin is eluted as a red solution with 0.05 M Tris-HCl/ 0.5 M NaCl (pH 8.0).Lactoferrin eluted at 0.5 M NaCl is pooled, ultrafiltered and passed through Hiload SP-Sephrosecolumn equilibrated with 0.4 M NaCl/ 50mM Tris-HCl (pH 8.0)Run SDS-PAGE for evaluating the quality of purified lactoferrinThe purified sample can be desalted for biochemical, biophysical or structural analysis work orstorage at -20ºC213

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceIntroductionImmunological Method to DetectBuffalo Milk in Cow MilkArchana VermaDairy Cattle Breeding Division, NDRI, KarnalSince buffalo milk constitutes a major share of total milk production in our country, sale of watereddown buffalo milk in the name of cow milk is commonly practiced. Due to pricing policy in most states,liking for cow milk by a specific group of users and also for manufacturing some quality productsfrom cow milk it has to be made sure that there is no admixing of buffalo milk in the milk /products. Ifbuffalo milk is manipulated in terms of fat percentage and addition of pale yellow coloration, it is verydifficult to distinguish the milk with regards to its species of origin by any physico–chemical method.The answer to the problem of such manipulations or admixing of milk from different species lies witha test known as the ‘Hansa Test’ named after the mythological bird ‘hans’, which detects the admixingof buffalo milk in cow milk. This is based on the principle of antigen-antibody reaction. The antiserumproduced after immunizing rabbit with buffalo casein, gives visible reaction only with buffalo milk.This is the “Hansa Test Serum” specific to buffalo milk. The test may also be applied to some of themilk products after reconstitution.Material required• Rabbits (Adult, healthy and preferably male).• Centrifuge- High speed upto 12000 rpm.• Laboratory (upto 5000 rpm).• Autoclave.• Homogenizer.• General laboratory items and chemicals (centrifuge tubes, beakers, conical flasks, Scalpel blade,xylene, saline, phenol, slides, pipettes, cotton, tooth-picks, adrenaline 1:50000 I.U etc.).• Syringes (2 ml and 5 ml)-needles (21G and 23G).• Source of pure cow and buffalo milk.• Pure cow casein.ProcedureThe test is carried out in following three steps:Preparation of antigen• Take 50 ml of pure buffalo milk in polypropylene tubes and centrifuge at 3000 rpm for 30minutes.• Pierce the top layer of fat to pour skimmed milk in a beaker.• Centrifuge the skim milk at 12000 rpm for 30 minutes.• Remove the clear whey and scrap out the packed casein in a clean glass beaker containingdistilled water.• Homogenize in a mechanical homogenizer and make the final volume equal to the quantity ofskim milk used.• Filter through several layers of muslin cloth and store in a refrigerator under clean sterilizedcondition and may be used for one week.• Casein, thus prepared, acts as an antigen to produce antibodies against it.214

Immunological Method to Detect Buffalo Milk in Cow MilkImmunization of rabbits• Select adult and healthy rabbits for immunization. with buffalo casein according to a definiteschedule for a specific period of time (Table).• Intra-peritoneal injections are administered taking care that needle(21G) does not pierce theviscera.• Intra-venous injections and blood collection are done through marginal vein of the ear using23G needle.• The injections should be very slow and always use one year for injections and other one forblood collection.• A period of 3 to 6 weeks of immunization is required to get the antisera of desired titre.Blood collection and testing the titre• After immunizing the rabbits for two consecutive weeks, the blood is collected from each rabbiton the first day of 3rd week, before injection and the serum is separated.• Dilute cow and buffalo milk 1:10 with water.• Place one drop of diluted milk on a clean slide. Add one drop of serum to be tested and mixthoroughly with toothpick.• Observe the agglutination giving swirling movement to the slide (Figure). Those rabbits, whosesera give good titre, further immunization is stopped and blood is collected to the maximumextent to get the antiserum. For other rabbits, injections are continued. In case, any rabbit doesnot show titre, suspend immunization after 6 weeks.• Sometimes, due to cross- reacting antibodies in cow and buffalo caseins, the titre might be seenin both the species. In such case, cow casein component of the antisera is absorbed using driedcow casein, leaving the test valid only for buffalo milk.Preservation of serumThe anti-serum is preserved without getting its efficacy affected by adding 5% solution of phenol@ 3% of the volume of the serum.Precautions• For casein (antigen) preparation, utmost care should be taken to use only pure buffalo milk toget anti-serum specific to buffalo milk adulteration.• Intravenous injections should be administered very slowly to avoid shock to the animal. Ifthe animal shows any sign of shock, 1 ml of adrenaline (1:50000 I.U.) should be given intramuscularly.• Store serum at 4ºC.• Repeated freezing and thawing of the serum should be avoided.• While testing the titre, use separate pipettes for cow milk, buffalo milk and the serum.• Homogenize milk products thoroughly before testing.Benefits of the technology• Adulteration of buffalo milk in cow milk (or any other milk) can be detected with accuracy.• The test is very fast i.e. less than 30 seconds for one lot of milk.• Only one drop of antiserum is required to test whole lot of milk.• Benefits of pricing policy may be obtained by cow breeders.• Test may be performed with equal efficacy with the formalin preserved milk also.• Good and acceptable quality products may be manufactured using pure cow milk wheneverrequired.215

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance• Test is equally effective for milk products as well.• The technology is applicable to detect admixing of milk of any species provided the antigen i.e.casein is injected from that species.Table: Immunization ScheduleWeek of the *Dose of antigen in a week (ml)Immunization**1st Day 2nd Day 3rd DayI 0.5 0.5 1.0II 1.0 1.0 1.5III 1.5 1.5 2.0IV 2.0 2.0 2.5V 2.5 2.5 3.0VI 3.0 3.0 3.5*The three days should be 3 consecutive days of theweek and the same schedule should be followed for allthe weeks of immunization.**All the injections are intravenous except the 1st dayof week II to week VI, which are intra-peritoneal.Figure: observations using hansa testa) Agglutination reaction means Positive Test i.e. thesample is either buffalo milk or admixed with buffalomilkb) Clear solution means Negative Test i.e. no admixingof buffalo milk.216

Conjugated Linoleic Acid and Its EstimationIntroductionConjugated Linoleic Acid and Its EstimationConjugated linoleic acid:A. K. Tyagi, A. Hossain, A. TyagiDairy cattle Nutrition, NDRI, KarnalCLA refers to mixture of positional and geometric isomers of LA (cis-9, cis-12 octadecadienoic acid)with a conjugated double bond system, instead of the usual methylene-separation. Each double bondcan be of cis or trans configuration giving rise to possible CLA isomers (Kelly et al., 1998). Conjugationof double bond occurs as part of free radical mediated oxidation of LA. CLA is a true isomer of LA,in that it does not possess additional oxygen (Vandenberg et al., 1995). The presence of fatty acid withconjugated double bond was first demonstrated in food products derived from ruminants by Boothet al. (1935) who observed that fatty acids obtained from summer butter differed from those obtainedfrom winter butter by exhibiting a much stronger spectrophotometric absorption at 230 mm. It wassubsequently concluded that the absorption at this wavelength was due to a conjugated double bondpair (Moore, 1939). Parodi (1977) was the first to identify cis-9, trans-11 octadecadienoic acid as a fattyacid in milk fat that contained the conjugated double bond pair. The discovery of “role of CLA as afunctional food” occurs decade ago when ground beef contained anti-carcinogen factor that consistedof a series of conjugated dienoic isomers of LA (Pariza et al., 1979 and Ha et al., 1989).Isomers of CLA:Numerous isomers of CLA have been identified and these differ by position or geometric orientationof the double bond pair (Fig. 2.1). CLA includes more than 28 positional and geometrical isomers ofwhich only cis-9, trans-11 and trans10, cis-12 have thus far been proven to have biological activities(Banny and Martin 1994; Park et al., 2003). Of the two physically important isomers, c-9, t-11 is themost prevalent, comprising 80-90% of the total CLA in food products from ruminants where as t-10,c-12 is present in small amounts at 3-5% of total CLA (Parodi, 2003). The trivial name “Rumenic Acid”(RA) has been proposed for cis-9, trans-11 CLA due to its unique relationship to ruminants (Kramer etal., 1998). Other isomer of CLA are present at low concentration, generally representing less than 0.5percent of the total CLA in ruminant fat.Sources of CLA:CLA is present in a great variety of feeds, although usually in residual quantities (Chin et al.,1992). Food products from ruminants (Table 1) are the major dietary sources of CLA for humans. Thehighest CLA concentration was found in adipose tissue (38 mg/g fatty acid) of kangaroo (Engelke etal., 2004).Potential health benefits of CLA:• Anticarcinogenic• Antiatherogenic• Altered nutrient partitioning and lipid metabolism• Antidiabetic (type II diabetes)• Immunity enhancement• Improved bone mineralization217

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceTable 1. Total CLA (mg/g fat) content of different types of selected foodsCategory of foodDairy productsTotal CLA(mg/g fat)Percent of cis-9,trans-11 isomerCategory of foodTotal CLA(mg/g fat)Meat (fresh)Percent of cis-9,trans- 11 IsomerHomogenized Milk 5.5 92 Fresh Ground Beef 4.3 85Butter 4.7 88 Beef Round 2.9 79Sour Cream 4.6 90 Veal 2.7 84Plain Yogurt 4.8 84 Lamb 5.6 92Non-fat Yogurt 1.7 83 Pork 0.6 82Ice-cream 3.6 86 Poultry (fresh)Cheddar Cheese 3.6 93 Chicken 0.9 84Cottage Cheese 4.5 83 Vegetable oilsMozzarella 4.9 95 Soybean 0.6 25Seafood (fresh) Sunflower 0.4 38Salmon 0.3 — Mustard 0.3 42Shrimp 0.6 — Corn 0.2 39Biosynthesis of CLA:Source: Chin et al. (1992)Kepler et al. (1966) had identified CLA as the first intermediate of linoleic acid biohydrogenationin the rumen by Butyrivibrio fibrisolvens. Griinari and Bauman (1999) concluded that CLA synthesisoccurred in the rumen only. CLA found in milk and meat of ruminants originates from two sources.One source is CLA formed during ruminal biohydrogenation of linoleic acid. The second source isCLA synthesized by animal tissues (mammary gland epithelial tissue) from trans-11 C18:1 or TVA,another intermediate in the biohydrogenation of unsaturated fatty acid. Hence, the uniqueness of CLAin ruminant edible products relates to incomplete biohydrogenation of dietary unsaturated fatty acidsin the rumen.Estimation of conjugated linoleic acid in milka) Extraction of fatFat is extracted from milk by the method of Ha et al. (1989). Fresh milk (3ml) is vortexed with 3 mlof methanol and 1.5 ml of chloroform. The mixture is vortexed with 1.5 ml chloroform for an additional2 min. The homogenate is centrifuged at 2200 rpm for 10 min. The upper (methanol-water) layer isremoved through aspiration and the bottom layer (chloroform layer) is passed through anhydroussodium sulphate on Whatman filter paper No.1.The filter paper is rinsed with 3 ml of chloroform andthe extract is evaporated to dryness under vacuum and then under the stream of nitrogen.b) Hydrolysis of fatExtracted fat is hydrolyzed with 1 ml of 1N methanolic sodium hydroxide in a boiling water bathfor 15 minutes and then cooled to room temperature for 5 minutes. 1 ml Hydrochloric acid (2N) and2 ml chloroform are added to the tube containing methanolic sodium hydroxide and vortexed for 4minutes, followed by centrifugation for 10 minutes at 2200 rpm. The organic layer (lower layer) iscollected and evaporated to dryness under vacuum and then under the steam of nitrogen.c) Preparation of standardA stock solution of CLA (1mg/ml) in acetonitrile is prepared. A working standard solution isprepared by adding (500ml) stock solution to 2000 ml of acetonitrile and it gives 4mg of CLA in 20mlof standard to be injected.218

Conjugated Linoleic Acid and Its Estimationd) High performance liquid chromatography (HPLC)HPLC conditions:Column : C 18micro BondapackFlow rate : 1.5 ml per minuteWave length : 234 nmInject volume : 20 µl.Eluent used for the separation of CLA consists of acetonitrile containing 0.12 per cent glacial aceticacid (v/v) and double distilled water in the ratio of 70:30.The peak of CLA is eluted at 13 to 18 min. The retention time of samples are compared with thatof standard CLA (Sigma Chemical Co., St. Louis, MO, USA).CLA estimation by Gas chromatography (GC)Estimation of CLA and other fatty acids in feedstuffs, plasma, ruminal liquor, milk and muscleare analyzed as per direct transestrification method of O’Fallon et al. (2007) with slight modificationusing GC fitted with flame ionization detector. For the methyl ester formation 1 g feedstuff, 1.5 mlplasma, rumen liquor, milk and 1.5 g muscle samples are taken.Preparation of standardA stock solution of CLA (1mg/ml) in acetonitrile is prepared. A working standard solution isprepared by adding (500µl) stock solution to 2000 µl of acetonitrile and it gives 4µg of CLA in 20µl ofstandard to be injected.ConditionsOven temperature : Initial 15°C, Final 24ºCFID : 26ºCInjector : 24ºCFlow rate : 30 ml/min.Attenuation : 1Split ratio : 1:10Inject volume : 0.5 µlHelium can be used as a carrier gas at constant inlet pressure (205 kPa). Conjugated linoleic acidis identified by comparing its retention time with that of standard CLA and concentration of CLA iscalculated considering the peak area.AfterwordThe evident beneficial potential of CLA along with other PUFAs augmented interest in itsenhancement in milk and meat products as a consequence. This has caused a great deal of effortto be expended toward increasing the concentration of CLA in the milk and tissues of ruminantfoods because these are the predominant source of CLA in human diets. Among more than a dozenisomers of CLA detected in foods of ruminant origin, c-9, t-11, t-10 and c-12 are the ones with knownphysiological importance. While c-9, t-11 comprises 80 to 90% of total CLA and the major source ofits occurrence is endogenous synthesis via desaturation of VA by Δ9-desaturase. , t-10, c-12 comprises3 to 5% of the total. As has been shown in many studies reported in the limited review above, thereare several ways to increase CLA levels in milk and meat products from ruminants, hence, productswith enhanced CLA content which can effectively discharge their beneficial role in humans can be219

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancedesigned, however, To date, statements about health promoting effects of CLA are mainly based onanimal trials and remain to be proven largely in humans. In human trials synthetic CLA supplementsare usually used and these do not reflect natural isomer composition in foodstuffs. Whether naturalCLA sources (meat and milk from ruminants) have a similar impact on human health warrants furtherresearch.RefrencesKelly ML, Kolver E S, Bauman DE, Van Amburgh ME, Muller LD (1998) Effect of intake of pasture on concentrations ofconjugated linoleic acid in milk of lactating cows. J Dairy Sci 81:1630–1636Booth RG, Kon SK, Dann WJ & Moore T (1935) A study of seasonal variation in butter fat. A seasonal spectroscopicvariation in the fatty acid fraction. Biochem J 29, 133-37.P. Parodi, Conjugated Linoleic Acid: an anticarcinogenic fatty acid present in milk. Australian Journal of Dairy Technology49 (1977), pp. 49-93.Pariza PW, Ashoor SH, Chu FS & Lund DB (1979) Effects of temperature and time on mutagen formation in panfriedhamburger. Cancer Lett 7, 63-69.Ha YL, Grimm NK, Pariza MW (1989) Newly recognized anticarcinogenic fatty acids: identification and quantificationin natural and processed cheese. J Agric Food Chem 37:75-81Parodi, P., 2003. Conjugated linoleic acid in food. In J. Sebedio, W.W. Christie and R. Adolf (ed) Advances in ConjugatedLinoleic Acid Research, Vol. 2, pp: 101-121. AOCS Press, Champaign, IL.Banny, S and Martin, J.C. 1994. Conjugated Linoleic Acid and metabolites in trans fatty acids in human nutrition, Theoily Press, Dundee, Scotland : 261-302.Park, S.J., Park, C.W., Kim, S.J., Kim, J.K., Kim., Y.R. Kim, Y.S and Ha, Y.L. 2003. Divergent cytotoxic effects of ConjugatedLinoleic Acid isomers on NCI-N87 cells, ACS Symp. Series, 85:1113-118.Chin, S.F., Liu, W., Storkson, J.M., Ha, Y.I. and Pariza, M.W. 1992. Dietary sources of conjugated dienoic isomers oflinoleic acid, a newly recognized class of anticarcinogens. J. Food Composition Analysis, 15: 185-197.Kepler, C.R., Hirons, K.P., McNeil, J.J. and Tove, S.B. 1966. Intermediates and products of the biohydrogenation oflinoleic acid by Butyrivibrio fibrisolvens . J. Biol. Chem. 241: 1350–1354.Griinari, G.M. and Bauman, D.E. 1999. Biosynthesis of conjugated linoleic acid and its composition, incorporation in tomeat and milk in ruminants. Advance in CLA research. AOCS Press, Champaign,II. Pp: 180-200.O’Fallon, J.V., Busboom, J.R., Nelson, M.L. and Gaskins, C.T. 2007. A direct method for fatty acid methyl ester synthesis:Application to wet meat tissues, oils and feedstuffs. J. Anim. Sci. 85: 1511-1521.Vandenberg, J.J., Cook N.E. and Tribble, D.L. 1995. Reinvestigation of the antioxidant properties of Conjugated LinoleicAcid. Lipids, 30: 599-605.Moore, T., 1939. Spectroscopic changes in fatty acids. VI. General. Biochem. J. 33: 1635-1638.Kramer, J.K.G., Parodi, P.W., Jensen, R.G., Mossoba, M.M., Yurawecz, M.P., and Adlof, R.O. 1998. Rumenic acid: Aproposed common name for the major conjugated linoleic acid isomer found in natural products. Lipids. 33: 835.Engelke, C.F., Siebert, B.D., Gregg, K., Wright, A.D.G. and Vercoe, P.E. 2004. Kangaroo adipose tissue has higherconcentration of cis-9, trans-11 conjugated linoleic acid than lamb adipose tissue. J. Anim. Feed Sci., 13: 689-692.220

Importance and Estimation of Vitamins A & E In Value Added Dairy ProductsImportance and Estimation of Vitamins A & Ein Value Added Dairy ProductsHarjit KaurDairy Cattle Nutrition Division, NDRI, KarnalVitamin A, or retinol, is a colorless, alcohol compound. It is essential to the immune system,providing antioxidants that benefit growth, healing, reproduction and skin. If this vitamin is deficient,the epithelium becomes keratinized and cracks occur, giving easy access to bacteria and viruses,resulting in infectious diseases. Vitamin A plays an important role in the chemical processes whichoccur in the eye and are essential for vision. This vitamin combines with proteins in the retina of the eyeand forms the pigment called visual purple. These cells, together with the lens pigment, are responsiblefor vision in dim light. During this process, some of the vitamin A is excreted and has to be replenishedfrom the blood, if normal vision is to be maintained. Vitamin A affects bone development throughits effect on bone metabolism. Essentially, Vitamin A deficiency results in unchecked bone growththat in turn manifests as malformed bones and joints. Vitamin A directly affects immunity throughboth production of antibodies and through maintaining an adequate barrier to infection with healthyepithelial cells. Its deficiency also affects reproduction by interfering with the production of spermin males, and by causing resorption of the foetus in females. The symptoms of vitamin A deficiencyare scouring, low resistance to bacterial infection, stiffness of joints and uncoordinated movements,lesions around the eyes and dull watery eyes followed by night blindness at more advanced stages.Excess vitamin A has been demonstrated to have toxic effects in most species.VITAMIN E: Vitamin E has very strong antioxidant properties and is involved in the mammalianantioxidant defense system where it stimulates the immune response. For certain purposes, theantioxidant functions of vitamin E can be performed by Se, which is present in glutathione peroxidaseand decomposes peroxides. Most species hydrolyze dietary tocopheryl esters effectively at the mucosalsurface of the small intestine. Vitamin E is absorbed as the free alcohol, tocopherol. The vitamin isinsoluble in the aqueous environment of the intestinal lumen. Its enteric absorption, like that of otherfat-soluble nutrients, therefore is dependent upon its micellar solubilization. Consequently, impairmentof pancreatic function or bile production results in impaired absorption of vitamin E. The efficiencyof absorption of tocopherols is relatively low at 20 to 40 percent. Absorption is increased by mediumchaintriglycerides and is decreased by high levels of linoleic acid. In mammals, absorbed tocopherol istransported by chylomicrons via the lymphatic circulation to the liver and subsequently to the generalcirculation in very low density lipoproteins (VLDL). Most species show normal plasma α-tocopherolconcentrations in the range of 1-5 μg/ml. The dietary requirements for vitamin E are estimated in therange of 5 to 50 IU/kg of diet for most animal species. Vitamin E is generally considered to be one ofthe least toxic of the vitamins. Dietary intakes of at least 20 times the nutritionally adequate levelsshould be well tolerated by most species.Estimation of vitamins A and E by HPLCEvaluation of vitamin A in dairy products is highly required because of its important roles invision, maintenance of epithelial lining and immunity in man and animals. Vitamin E (α-tocopherol),another non enzymatic antioxidant, is involved in maintenance of immunity status Due to the criticalrole of these vitamins, their quantitative analysis is very important to know their content in the diet aswell as to know the changes in their concentration under different storage and processing conditions.High performance liquid chromatography is extensively used for measuring vitamins in milkand milk products. Earlier methods of vitamin estimation such as, colorimetric lack the ability to221

Chemical Analysis of Value Added Dairy Products and Their Quality Assurancedifferentiate between the vitamin congeners with varying activity. In milk, vitamin A occurs mainlyas a mixture of fatty acid retinyl esters. β-carotene, the provitamin A, is the predominant form ofvitamin A in the milk. Evaluation of vitamin A and β-carotene together enables the evaluation of totalvitamin A activity of the milk. The major form of vitamin E in the milk is α-tocopherol. VitaminsA, β-carotene and vitamin E are fat soluble vitamins and are found in the fat fraction of the milk. Itis therefore necessary to extract the vitamins from the sample. Saponification (alkaline hydrolysis)provides an effective means of removing the preponderance of neutral lipids (mainly triglycerides)from the sample. Saponification involves refluxing the sample with ethanolic KOH solution and addedantioxidant for 30 min. The hydrolysis attacks ester linkages and releases the fatty acids from theglycerol moiety of glycerides and phospholipids and from esterified sterols and carotenoids. Henceester forms of the vitamins are hydrolysed to their respective alcohols which allow the estimation oftotal vitamin content in the sample.1. HPLC method for simultaneous estimation of retinol (Vitamin A), β-carotene and α-tocopherol(Vitamin E) (Chawla and Kaur, 2001)PrincipleThe sample is saponified with ethanolic potassium hydroxide solution and vitamins A, β-caroteneand vitamin E are extracted into petroleum ether. The petroleum ether is removed by evaporation andthe residue is dissolved in mobile phase. The vitamins A, β-carotene and vitamin E concentrations aredetermined simultaneously by reverse-phase liquid chromatography.1. Reagents : Potassium hydroxide solution, 60%, Ethanol, 95 % , Petroleum ether, boilingrange 40º C to 60º C, 0.5 N potassium hydroxide, All-trans-retinol, vitamin A alcohol, α-tocopherol,β-carotene, Water, HPLC grade,Methanol, HPLC grade,Acetonitrile, HPLC grade, Tetrahydrofuran,HPLC grade, Ascorbic acid, Whatman phase separator filter paper, Inert gas, nitrogen.Preparation of Standards: Prepare stock solutions of α-tocopherol (300 µg/ml) and retinol (30 µg/ml) in 100 % ethanol. Prepare stock solution of β-carotene (30 µg/ml) in chloroform. Take requisitealiquots of individual stock solutions in amber coloured tubes and dry under nitrogen at roomtemperature. Reconstitute the dried standards in mobile phase (mobile phase is prepared by mixingacetonitrile, tetrahydrofuran and HPLC water in the ratio of 47: 42:11). Prepare a working standardsolution containing 100µg/ml α-tocopherol, 10µg/ml retinol and 10 µg/ml β-carotene, at the time ofuse. Store all the vitamin stock standards at –20ºC.Extraction of samples: Take 2-3 ml milk in a 50 ml stoppered test tube. Add 5 ml of absoluteethanol containing 0.1% (w/v) ascorbic acid or 1% pyrogallol (w/v) and 2ml of 50% KOH. The tubesare agitated carefully and placed in a water bath at 80ºC for 20 min. After saponification, cool thetubes with running water and place in an ice water bath. Add 10 ml petroleum ether (40-60ºC) andshake for 15 minutes. Transfer the upper ether layer in another tube. Repeat the extraction thrice andcollect the ether portion. Transfer the combined ether extract to a separating funnel, wash with 10 mlof 0.5 N KOH and subsequently with distilled water (2-3 times) to remove excess alkali. Pass the etherextract through phase separator filter paper to remove water, if any. Evaporate the ether extract undernitrogen in a water bath maintained at 37°C. Perform all the extractions under subdued incandescentlight using amber coloured glassware.HPLC system and procedure: The HPLC system consists of a model 510 pump, UV visibleabsorbance detector 486, rheodyne injector with 20 µl loop, using multiwavelength detector. A reversephase Discovery C-18 (15 cm x 4.6 mm) column is used. The flow rate is 1.5ml/minute. The programmefor the separation of retinol, α-tocopherol and β-carotene using millennium software method is givenin Table 1.222

Importance and Estimation of Vitamins A & E In Value Added Dairy ProductsFig. 1 Chrotomatogram of standard Retinol, α-Tocopherol and β-CaroteneTable 1. Program for HPLC analysis of Retinol, α-Tocopherol and β-CaroteneVitamin Wavelength (nm) Change Time (min) Retention time (min)Retinol 325 0.00 1. 73α-tocopherol 290 2.5 3.37β-carotene 450 4.5 5.67Reconstitute the residue in the mobile phase prior to injection on HPLC. Filter the reconstitutedextract through a 0.45-µm filter and inject 20 µl into the HPLC column. The run time is 6 minutesper sample. Measure the area of the retinol, α-tocopherol and β-carotene peaks. Determine theirconcentrations in the extracted sample with reference to the peak area of respective standards.2. Simultaneous estimation of vitamins A and E in milk by HPLCFollow the same procedure as mentioned above (for simultaneous estimation of α-tocopherol,retinol and β-carotene) upto extraction of samples. Prepare mobile phase by mixing methanol andFig. 2 Chromatogram of standard retinol and α-tocopherolwater in the ratio of 95:5 and filter through a membrane filter.Separation of Vitamins A and EReconstitute the dried residue in Table 2: Program for HPLC analysis of retinol and α-tocopherolthe mobile phase and filter through0.45µ membrane filter for injectionon HPLC column. Inject 20 µl ofVitamin Wavelength(nm)Change Time(min)Retention time(min)sample extract onto the column of the Retinol 325 0.00 1.98liquid chromatograph. A programmefor the separation of retinol andα-tocopherol at different wavelengthssimultaneously is presented in Table 2.α-tocopherol 290 4.00 7.35The chromatographic separation of vitamins A and E is shown in Fig. 2.223

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceCalculate the mean peak area from replicate injections of the sample extract and determine theretinol and α-tocopherol concentrations of the extract by reference to the mean peak area found fromreplicate injections of standards. Table 3 shows the average values of vitamin A and E in the milk ofdifferent species.Table 3. Vitamin A and E content of milk /serving (244 g)VitaminCow Milk,3.25% fatCow,Skim milkGoat Sheep BuffaloA, ug 68 149 139 108 129E, mg 0.15 0.02 0.17 ND NDReferenceChawla, Rajiv and Harjit Kaur (2001). Isocratic HPLC method for simultaneous determination of carotene, retinol andtocopherol in feeds and blood plasma. Indian J. Dairy Sci., 54: 84 - 90.224

Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk ProductsUse of Atomic Absorption Spectrophotometer for theEstimation of Minerals in Milk and Milk ProductsVeena ManiDairy Cattle Nutrition, NDRI, KarnalBy atomic absorption spectrophotometer, the metals in water /organic sample can be analyzed. Itis the highly sensitive technique highly useful for the determination of the presence and concentrations(even at very low levels) of metals in liquid samples. Thus, prior to the estimation the solid samplesshould be accurately weighed and then dissolved often using strong acids. Metals include Ca, mg,Fe, Cu, Al, Pb, Zn, Cd and many more. Typical concentrations range in the low mg/L (ppm) range.As the elements in the sample to be analyzed are not in the free state but are combined with otherelements invariably to make a so-called molecule. For the analysis the combination must be cut off bysome means to free the atoms. This is called atomization. The most popular method of atomizationis dissociation by heat. Samples are heated to a high temperature so that molecules are convertedinto free atoms. This method is classified into the flame method, in which a chemical flame is used asthe heat source; and an electro thermal atomization method, in which a very small electric furnace isusedThe technique is designed to determine the amount (concentration) of an object element in asample, utilizing the phenomenon that the atoms in the ground state absorb the light of characteristicwavelength passing through an atomic vapour layer of the element of interest and attain excitedstates. During excitation element being analyzed is dissociated from its chemical bond and is placedin an unionized state. This is normally achieved by aspirating the sample into the flame or graphitefurnace. Each metal has a characteristic wavelength that will be absorbed. . The AAS instrumentlooks for a particular metal by focusing a beam of UV light at a specific wavelength through a flameand into a detector. The instrument measures the change in intensity As a result of absorption,the intensity of light decreases, which is proportional to the number of the examined atoms beingpresent. The more concentrated the solution, the more light energy is absorbed!In atomic absorption, the method is based on the attenuation (weakening) of a beam of nearlymonochromatic light as a consequence of its interaction with and partial absorption by the ground stateatoms of the element being analyzed. The amount of light absorbed at the characteristic wavelengthincreases with the number of atoms of the selected element in the light path. By comparison withsuitable standards, the concentration of the element in the sample can be inferred from the amount oflight absorbed. A computer data system converts the change in intensity into an absorbance.Quantitative analysis by Atomic absorption depends on: 1)accurate measurement of the intensityof the light ,2) the assumption that the radiation absorbed is proportional to atomic concentrationInstrumentationThere are six basic components of an atomic absorption spectrometer1. A light source(hollow cathode lamp), which emits a beam of radiation of a wavelengthcharacteristic of the element to be determined.2. An "absorption cell" or atomizer section for atomizinig the sample, in which the sample solutionis reduced to a cloud of ground state atoms, for example a flame or graphite furnace.3. A monochromator to select the wavelength that is being absorbed by the element to bemeasured.4. A photomultiplier tube ,which is a detector for converting the light into an electrical signal.Thus, it detects and measures the intensity of the resultant beam of radiation. The PMTdetermines the intensity of photons of the analytical line exiting the monochromator225

Chemical Analysis of Value Added Dairy Products and Their Quality Assurance5.6.226An amplifier and associated electronics to amplify and process the signal from the photomultipliertube.A display and/or a recorder which shows themeasured signal after it has been processed.Hollow cathode lamp To produce the propermonochromatic light necessary for the AAS, so called“hollowcathode lamps” are used which is situated in the centre of thelamp and is normally composed of either the pure form ofthe element or an alloy of the element It means that different Schematic Diagram for atomic absorptionspectrophotometer (source :http://www.lamps are used for the determination of each elementthebritishmuseum.ac.uk/science/techniques/It is named after the cylindrical shape of the cathode sr-techaas.html)that gives direction to emerging beam, and helps re-depositsputtered atoms back on cathode. The hollow cathode lamp for the light source consists of a hollowcathode and an anode(made of tungsten) enclosed in a glass (quartz) tube and neon or argon gas isfilled at around 10 Torr. in pressure in it. Being made up of the element to be measured or its alloy,it emits the light its wavelength is equal to that absorbed by the atoms of the sample. These lampsare available for about 70 elements. They are generally reliable and most have operating lives well inexcess of 5000 mA hours. The life of lamps with cathodes constructed of alloys of volatile elementssuch as arsenic or selenium is shorter. Multi-element lamps are also available and can be useful bothfrom the point of view of economy in lamp numbers and also in reduced warm-up time.Absorption Cell/NebulizerIt sucks up liquid sample at a controlled rate. Create a fine aerosol spray for introduction into theflame. It mixes the aerosol and fuel and oxidant thoroughly for introduction into the flameThe following atomization methods are known:1) Flame atomization 2) Graphite furnace atomizationFlame: The source of atoms is usually flame (“flame atomisation”). Metals could be measured atppm concentration (part per million, that is mg kg -1 or mg dm -3 in case of dilute solutions). The mostcommonly employed technique in atomic absorption spectrometry is that in which the sample, eitheras a liquid or in solution, is sprayed into a flame as a mist of droplets. The liquid or solution is reducedto mist by being drawn through a pneumatic nebulizer which normally employs an impact bead.Once in the flame, the liquid droplets are dried to give solid particles which are then decomposed togive molecules in the gaseous phase. The molecules then dissociate to give free atoms. Only about10% of the solution actually reaches the flame. This is one reason for the limited sensitivity of flametechniques. The other important reason for the limited sensitivity is the rather short residence time offree atoms in the flame (and especially in the light path).The sensitivity, however, could be increasedwhen the light travels for longer in the flame. Therefore most of the burners are about 5-10 cm long.The air/acetylene flame is the most used type of flame which provides a temperature high enoughfor the determination of many elements. There is no considerable ionization in the flame (with theexception of the alkali elements) and almost no absorption at wavelengths above 230 nm. Furthermorelight emission by this flame is rather low. The nitrous oxide/acetylene flame with its high temperatureis recommended for the determination of elements which need a high energy for dissociation (thatis, formation of free atoms). For those elements, this flame provides suitable chemical, thermal andoptical conditions. Background emission, however, is rather high at certain wavelengths and the hightemperature leads to a considerable risk of ionization for certain elements. The air/propane or air/hydrogen flames are mainly recommended for the analysis of alkali elements since the temperatureis low enough to prevent larger ionization effects. The hydrogen/argon-diffusion flame is especiallysuitable for the determination of arsenic and selenium, since its absorption at wavelengths below200 nm is much smaller than absorption of other flame types. Due to its low temperature, chemical

Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk Productsinterferences must be expected.Fuel gas Oxidant Flame temp. (ºC)Graphite furnace atomisation The graphite Fuel Gas Oxidant Flame Temp. (ºC)furnace AAS (GFAAS), a more recent technique isHydrogen Argon/ air(diffusion) 400 (350-1000)even more sensitive than the traditional, cheaperPropane Air 1930AAS using flame. Measurements could be done atHydrogen Air 2000-2050ppb level (part per billion, ppb = 10-3 ppm, thatis µg kg -1 or µg dm -3 Acetylene Air 2100-2400in case of dilute solutions!).Since the presence of toxic heavy metal i.e as Acetylene Nitrous oxide 2650-2800contaminants even in very low concentration maybe of concern from human health point of view, therefore the technique has the importance with thisreference.In graphite furnace AAS, a heatable graphite tube as atomization device is located in the raypath. A droplet of the sample is pipetted into the graphite tube, where it dries through electricalheating and the residues are ashed. The temperature of the tube can be increased in a stepwisefashion such that in the first stage, the tube will be heated to a relatively low temperature in orderto vaporize the solvent. In the second stage, the temperature will be increased by increasing thecurrent such that the solid residue is dry ashed without the loss of analyte. Finally, the tube is rapidlyheated to a temperature of up to 3000°C in order to atomize the analyte. The heated graphite furnaceprovides the thermal energy to break chemical bonds within the sample held in a graphite tube, andproduce free ground state atoms. Ground-state atoms then are capable of absorbing energy, in theform of light, and are elevated to an excited state. The amount of light energy absorbed increases asthe concentration of the selected element increases.The atomic absorption signal is then measured atthis stage. A purge gas of argon or nitrogen is passed through the tube during the drying and ashingstages but normally the flow of inert gas will be stopped during the atomization stage so that thefree atoms will remain in the absorption cell for a longer period. It is important to control the dryingand ashing stages such that drying comes about without spitting or spreading of the sample andthat ashing occurs in such a way as not to interfere with the final atomization stage.The use of automatic background correction is essential when using a graphite furnace, since thelevel of non-specific background absorption is much more significant than is the case with the flameatomization. Matrix effects can be compensated for by the method of standard additions and/orby the addition of matrix or analyte modifiers. The addition of analyte modifiers usually decreasesthe volatility of the analyte so that it is not lost during the ashing stage or increases the volatilityof the matrix making it more readily removable Matrix modifiers, on the other hand, decrease thevolatility of interfering compounds and contribute to time resolved analyte/background signals.Monochromator: the main purpose of monochromator is to isolate the absorption lines fromthe background lightdue to the interferences. Comparison of Flame and Electrothermal atomization methodThus, monochrometerFlame Atomization Electrothermal Atomizationis used for selecting theanalysis wavelength ofSensitivity ppm level in the solution ppb level in the solutionthe target element, and Sample Volume about 1mL for one analysis 5 - 50 µL for one analysisa detector for converting Atomizing effi ciency about 10% More than 90%the light into an electricalMatrix effect Small largesignal. Thus,it Isolate theanalytical line photons Time for analysis 10 - 30 sec. For one sample 2 - 5 min. for one samplepassing through the flameand remove scattered light of other wavelengths from the flame In doing this, only a narrow spectralline impinges on the PMT.227

Chemical Analysis of Value Added Dairy Products and Their Quality AssurancePhotomultiplier tube (PMT)This is the detector. The PMT determines the intensity of photons of the analytical line exiting themonochromator. The PMT is the most commonly used detector for atomic absorption spectroscopy.They consists of a photocathode and a series of dynodes in an evacuated glass enclosures. However,solid state detectors are now replacing conventional vacuum-type photomultipliers. High techelectronics amplify, filter, and process the electrical signal, using a series of chips and microprocessors,transmitting the result to an internal or external computer which handle all data-handling anddisplayAnalysis of minerals in milk and milk products using Atomic absorption spectrophotometerThey can be divided into macro minerals (major elements) and micro minerals (trace elements).The macro minerals such as sodium, potassium, magnesium, calcium and phosphorus are requiredby the body in amounts greater than 100mg per day whereas the micro minerals such as iron, copper,zinc and manganese are required in amounts less than 100mg per day.Sampling and processing of samplesThe processing of milk/ products samples for mineral analysis can be done dry ashing or wetdigestion, since milk is not totally homogenous therefore, it is utmost important that bulk sampleshould be sufficiently homogenized to ensure that the aliquot/sub-sample which is taken for analysisis representative of the whole. The size of the sample should be proportional to the bulk. Thoroughmixing of sub-samples from a large bulk is preferred in representative sampling(a) Dry Ashing Generally, 5 to 25 ml sample (depending upon the concentration of the desiredmineral) is taken in a silica crucible and weighed. For powdered milk/product, 1-2 gm sample istaken. Then, the sample is placed in the muffle furnace and the temperature is brought to 550ºC andheld for 4 hr. After cooling, the ash obtained is dissolved in dilute HCl (6M) and then made uptosuitable volume. The resulting solution is used in mineral element determination.Advantages and Disadvantages: Dry ashing is a convenient and versatile method using relativelylarge sample size for the sample preparation. It also minimizes the contamination due to reagents.Because ,the ashing is usually done between 400-600ºC, therefore, some elements such as Se, Pb, Asand Hg, are lost through volatilization or by adsorption on the walls of the crucible. Other metals suchas, tin may form un-soluble refractory compounds during ashing(b) Wet digestion: Wet digestion procedure requires the use of strong oxidizing acid mixtureof nitric, sulphuric and perchloric acid. A mixture of HNO 3and HClO 3is useful for many routineapplications. The use of mixtures containing H 2SO 4is particularly useful when sample containingfats are to be oxidized. The addition of H 2SO 4increases speed of wet oxidation process as it raisesthe temperature of digestion. Extra care should be taken to avoid charring of samples when elementslike As, Se or Hg are to be determined. It is essential that HNO 3should be in excess at all time duringdigestion. Even H 2SO 4and HNO 3mixture can be used, but complete digestion of fat may take hours.Generally, milk (10-20ml) or 1-2 g milk product is taken in 60 ml test tubes/ kjeldahl flask andweighed. To this, 10 ml triacid mixture (HNO 3: HClO 4: H 2SO 4:: 3 : 2 : 1) is added. Tubes are heated tillthe contents become clear and perchloric acid fumes cease to come out. The volume is made to 25 mlwith double distilled water.Advantages/ Disadvantages: When compared with dry ashing, this method gives better recoveryfor most of the elements as there is less danger of loss of volatile elements (Pb, Cd, As). But the chancesof contamination are high as relatively large volumes of reagents are required to be added. The otherdrawback with this method is that it is suitable only for small size samples.AnalysisHCl extract or wet digested samples after suitable dilution are used for the estimation of majorand trace elements by atomic absorption spectrophotometer.228

Use of Atomic Absorption Spectrophotometer for the Estimation of Minerals in Milk and Milk Products• Take 1 ml of digested sample / HCl extract in a clean test tube.• For Ca estimation, add 1 ml 2% SnCl 2to 1ml of digested sample to eliminate interfering elements(such as Al, Be, P, Si, Ti) and make the volume to 10 ml with doubled distilled water. Theconcentration of 0.2% Sn is required in the test sample as well as in standards. This sampleis ready for estimation on AAS at 422.7 nm wavelength using acetylene as fuel and air as anoxidant.• For Mg estimation, add 1 ml 2% SnCl 2to 1ml of digested sample to eliminate interferingTable 1 Conditions for various mineralselements (such as Al, Be, P, Si,Ti) and make the volume to 10ml with doubled distilled water.The concentration of 0.1% Sn isrequired in the test sample aswell as in standards. This sampleis ready for estimation on AASat 285.2 nm wavelength usingacetylene as fuel and air as anoxidant.MineralWavelength(nm)Lower range(ppm)Upper range(ppm)Calcium 422.7 1.8 18Magnesium 285.2 0.06 0.6Sodium 589 0.26 2.6Potassium 766.5 0.24 2.4Iron 248.3 0.5 8• For other mineral the estimationsare carried out in the and suitablydiluted digested sample. Theconditions for the estimationand range for preparation ofCopperZincManganese324.7213.9279.60.080.50.58855.8standards of different minerals are given in Table 1.• Plot the standard curve for a particular mineral and find out the concentration in the unknownsample from the standard curve considering dilution factor. Express the concentration as percentin case of Ca and Mg and ppm for other minerals.The samples and standards are often prepared with duplicate acid concentrations to replicate the analyte'schemical matrix as closely as possible. Acid contents of 1% to 10% are common. High acid concentrationshelp keep all dissolved ions in solution.Preparation of standards for some trace minerals of nutritional significanceZinc standard stock solution, 1 mg/ml - Take 0.25 g pure zinc metal in 250 ml volumetric flask addabout 50 ml distilled water and then add 1 ml sulphuric acid. Heat to dissolve Zn. Dilute to volume andstore in pyrex bottle. Or dissolve 4.3984 g ZnSO 4.7H 20 in 0.1N HCl and dilute to 1 liter. This solutionwill give 1000 ppm concentration. Make working stock solution of 100 ppm and then prepare workingstandards.Cu Standard stock solution,1 mg/ml - Dissolve 1.9645 g CuSO 4.5H 2O in distilled H 2O and diluteto 500 ml. One ml of the solution contains 1 mg Cu. Make further dilutions with double glass distilledwater.Fe Standard stock solution, 100 µg/ml - Dissolve 0.7022 g (FeSO 4(NH 3) 2SO 4.6H 2O in 100 ml water.Add 5 ml concentrated H 2SO 4, warm it slightly and add potassium permanganate solution (0.1 N)until solution shows slight pink colour. Make volume to 1 liter. It will give 100 µg/ml solution of Fe.Make serial dilutions to get standards in the rangeMn Standard solution ,100 µg/ml - Dissolve 0.5756 g dry KMnO 4in 50 ml water. Add 40 ml conc.H 2SO 4and reduce the permanganate by careful addition of sodium metabisulphite solution until Mnsolution is colorless. Oxidise excess of H 2SO 4in hot solution by addition of little HNO 3. Cool, andtransfer the contents to 2 liter volumetric flask. Make volume upto the mark. This solution contains 0.1mg of Mn/ ml. Solution must be protected from light. Make further dilutions.Standard calcium solution – Dissolve 100.1 mg of dry calcium carbonate in 30 ml of 0.1 N HCl anddilute to 200 ml with water. This solution contains 20 mg of calcium per 100 ml. Further dilutions aremade to get required working standards229

Chemical Analysis of Value Added Dairy Products and Their Quality AssurancePesticides: Their Analysis in Milk Using HighPerformance Liquid ChromatographyChander Datt and Monica PuniyaDairy Cattle Nutrition Division, NDRI, KarnalPesticides are defined as the substances intended to repel, kill or control any species designatedas pest including weeds, insects, rodents, fungi, bacteria or other organisms. The family of pesticidesincludes herbicides, insecticides, rodenticide, bacteriocide, nematocide etc. Pesticides that maycontaminate feeds originate from most of the major groups including organochlorine, organophosphateand carbamates. Although the residues of pesticides are potentially toxic to farm livestock, theprimary focus of concern is centered on residues in animal products destined for human consumption.Organochlorine pesticides residues (OCP) are lipophilic in nature and relatively stable. Most of theOCPR’s and their metabolites are readily excreted in milk. Unlike organochlorines, organophophatepesticide (OPP) compounds are readily decomposed by physico-chemical and enzymatic processesin plant and animal systems, therefore, these are less persistent but could lead to acute toxicity ifconsumed beyond toxic levels. Normally, the milk and milk products get contaminated with OPPR ifthe animals are given a feed which is treated with pesticides during storage or the feed is manufacturedfrom the plant material treated during its cultivation. The other sources of contamination of feeds,milk and milk products can be- direct treatment of animals against parasites, control of flies/insectsin the milk processing area and use of contaminated water for drinking of animals and for processingof milk. The carry over rate of these pesticides from feed to milk varies from 20 to 80% dependingupon the nature and stability of the pesticide, method of its application, duration of exposure andmetabolism within the animalThe OCPR’s damage the peripheral nerves, cause blindness and sometimes show tumerogenic effects.In addition, an induction of liver enzymes, hydrolases and mixed function oxidases also occurs. A negativeinfluence on the reproductive functions is also observed. The toxicity of these compounds leads to cardiacand respiratory impairment due to disorders of autonomous nervous system. Some of the OPPR,s inducemyopathy in exposed human beings and animals, which is characterized by muscle cell degeneration andrespiratory muscles are affected. Human erythrocyte cholinesterase activity is inhibited and pathologicalalterations are observed in several tissues. Acute poisoning leads to respiratory distress, nervousness,convulsions, paralysis and death.During the past few years, there has been a drastic reduction in the level of residues of organochloropesticides in feeds as well as in milk. For the protection of consumers, Codex Committee on PesticideResidues of Codex Alimentarius Commission of FAO/WHO takes care to establish the MRL fordifferent pesticides for animal feeds and foods of animal origin. In India, there is an urgent need tomonitor the level of pesticide residues in milk with special reference to organophosphates. Thoughmethods for multiresidue analysis of pesticide residues have been developed but these have notbeen tried for simultaneous analysis of most commonly used OPP and OCP compounds in India.Therefore, a technique (Singh and Chhabra, 2004) has been evolved in DCN Division for simultaneousdetermination of commonly used OCP and OPP compounds.MethodologyRequirements1. Pesticide standards (Sigma-Aldrich): Eighteen OPP including acephate (ACP), chlorpyrifos(CPP), chlorpyrifos-methyl (CPP-me), diazinon (DZN), dichlorvos (DCV), dicrotophos (DCP),dimethoate (DMT), fenitrothion (FTN), malaoxon (MOX), malathion (MTN), monocrotophos(MCP), paraoxon-ethyl (POX), parathion-methyl (PTN), phorate (PRT), phosphamidon (PMD),230

Pesticides: Their Analysis in Milk Using High Performance Liquid Chromatography2.3.4.5.profenophos (PFP), quinalphos (QNP), tetrachlorvinphos (TCV) and 10 OCP namely aldrin(ADR), dieldrin (DER), endosulfan (ESF), endrin (EDR), heptachlor (HCR), lindane (LDN), 2,4DDE, 2,4 DDT, 4,4 DDD and 4,4 DDT.HPLC system: Waters HPLC with binary gradient solvent delivery module, injector, C18µBondaPak column (300 mm x 10 mm i.d.; particle size: 10 µ) with heater to provide columntemperature of 39ºC, UV-VIS absorbance detector, Millennium 32 chromatography software.Acetonitrile, toluene, methanol, water (all HPLC grade) and sodium sulphate (anhyd.)Solvent filtration apparatus with membrane filters (47 mm dia.) viz., aqueous HVLP 04700 andorganic FHLP 04700 (Millipore India Pvt. Ltd., Bangaluru), Whatman filter paper No. 41, Solidphase extraction (SPE) cartridgeOther equipments: Analytical balance, mixture/blender, vortex mixture, solvent evaporatoryapparatus, vacuum manifold and vacuum pumpHPLC conditions for analysisGradient programmeA gradient programme has been developed for separation of various pesticides at 200 nm detectionwavelength with column temperature of 39ºC. All the pesticides are separated within a run time of 60min., however, for proper cleaning the total duration is increased to 86 min, The subsequent samplecan be injected at or after 90 min. of run. Acephate is the first pesticide to be eluted while aldrin is thelast one.Limit of detection (LOD)LOD is the minimum concentration of each pesticide that produces a response which is equal totwice the short term noise at 200 nm. For each pesticide, it was worked out from the average response/area of 4 injections of standard pesticide mixture. The LOD was calculated by keeping a min. area of1000 units for each pesticide.LinearityLinearity for each pesticide is determined by injecting upto 5 times different concentrations ofmixed standard pesticide solution. From the area units and concentration for each pesticide, thecorrelation coefficients are calculated. The correlation coefficient for most of the residues was about0.99.RepeatabilityFor validation, area units for individual pesticides, 5 samples of standard mixture run during theentire analysis period are randomly selected for the determination of coefficient of variation (CV). TheCV values for different OPP and OCP ranges from 0.86 to 8.13 and 1.24 to 19.2%, respectively.Extraction, drying and clean up procedures for sample preparation for injection in HPLCExtraction: Milk sample (25 ml) is mixed with 100 ml of acetonitrile at high speed for 5 min. It isthen mixed with 10g and 20g anhydrous sodium sulphate each time for 2 min. in 2 steps. The sampleis kept undisturbed for 2 min. Supernatant is filtered through Whatman No. 41 and kept overnight ina dark place. For determination of per cent recoveries, 1 to 5 ppm of individual pesticides are addedto 25 ml milk sample and after mixing, it is kept overnight in dark before carrying out the extractionwith solvent as explained above.Drying: A 50 ml portion of the extract is taken in 500 ml solvent evaporatory apparatus and driedunder a stream of N2 gas and vacuum in 500 ml capacity beaker containing water at 45-50ºC. Then 5ml of acetonitrile was added to flask and contents were mixed using a vortex mixture. Acetonitrile isevaporated to dryness.231

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceClean up using SPE cartridge: Fresh SPE cartridges were conditioned over vacuum manifoldassembly using 3 ml methanol thrice followed by acetonitrile (3 ml thrice). When acetonitrile phasewas just near to the level of sorbent, the individual valves of the vacuum manifold assembly wereclosed. The dried sample extract was dissolved in 1.0 ml acetonitrile and transferred to preconditionedcartridge. Subsequent rinsing twice with 0.5 ml acetonitrile was also transferred to SPE cartridge. Thena flask was kept below SPE cartridge in vacuum manifold assembly. The contents were collected inthe flask after addition of methanol twice. The sample is then evaporated to dryness and the residueis dissolved in 1.0 ml acetonitrile. After filtering it through membrane filter, it is injected in HPLCsystem or stored in a refrigerator until used. Likewise, pesticide standards are run in order to knowthe concentration of each pesticide in unknown samples.232

Estimation of Microbial GOS by High Performance Liquid ChromatographyIntroductionEstimation of Microbial GOS by HighPerformance Liquid ChromatographyVikas Sangwan and Sudhir Kumar TomarDairy Microbiology Division, NDRI, KarnalGalacto-oligosaccharides belong to the group of non-digestible oligosaccharides (NDO), whichcan be regarded as soluble dietary fibres because they are completely soluble and are fermented byspecific bacteria present in the colon, resulting in the production of short-chain fatty acids (propionate,acetate and butyrate). Their chemical formula is (Galactose)n - Glucose, with n ranging from 1 to 4. Thegalactose-galactose linkage is a β-(1-3), β-(1-4), β-(1-6) linkage, with the β-(1-4) being predominant:the galactose-glucose linkage is mainly β-(1-4). Some disaccharides are also present in GOS (e.g.allolactose and galactobiose).GOS have a high solubility and a relative sweetness about 35 % that of sucrose. They are moreviscous than high-fructose corn syrups, decrease the water activity and freezing point, and show goodmoisture retention capacities. They also have remarkable stability at high temperatures and variable pHlevels. In particular, the stability of GOS in acidic and high-temperature conditions enables them to beapplied without decomposition in a wider variety of foods. GOS remain unchanged after treatment at160ºC for 10 min at pH-2, where about a half or more of the sucrose is degraded. Even in acidic conditionsat room temperature, GOS tend to be stable during long-term storage. Galacto-oligosaccharides (GOS)are carbohydrate-based food ingredients that can enhance health- related physiological activities,which can provide protection from infection; decrease the number of potentially pathogenic bacteria;facilitate the normal functions of the gut; stimulate the absorption of some minerals and decreaseblood lipids content (Dias and others 2009).Production of GOSGOS molecules (for example, Gal (β1→4) Gal (β1→4) Glc) are typically synthesised by theenzymatic activity of β-galactosidase on lactose in a reaction known as transgalactosylation (Goslingand others 2010). β-D-Galactosidases (β-D-galactoside galactohydrolase, EC 3.2.1.23), which are alsoreferred to as lactases, hydrolyze the β(1→4) linkage of lactose (galactosyl β(1→4) glucose) to glucoseand galactose and transfer the galactose formed from lactose cleavage onto the galactose moiety ofanother lactose to yield galacto-oligosaccharides (Park and others, 2009).The use of lactic acid bacteria (LAB) as producers of β galactosidase enzymes offers substantialpotential for the production of GOS. First, LAB are known to be good producers of extracellularβ-galactosidases that enable GOS production from lactose. Second, LAB have a safe tradition in foodFig. 1. Production of GOSFig 2. Schematic diagram of HPLCfermentations and exhibit rapid anaerobic growth on agricultural substrates including waste productssuch as whey. Therefore, GOS may be produced from crude cellular extracts without costly downstreamprocessing. Moreover, GOS may be produced in situ during food fermentations or by using whey toproduce food-grade GOS preparations.233

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceDetection of GOS by High Performance Liquid Chromatography (HPLC)High performance liquid chromatography is basically a highly improved form of columnchromatography. Instead of a solvent being allowed to drip through a column under gravity, it isforced through under high pressure that makes it much faster.Flow Scheme for HPLCLiquid chromatography involves a sample beingdissolved in a mobile phase (liquid, acetonitrile: w1ter, 80:20,in case of GOS). The mobile phase is then forced throughan immobile, immiscible stationary phase. The stationaryphases are chosen such that components of the sample havedifferent solubility in each phase. A component, which isquite soluble in the stationary phase, will take longer to travelthrough it than a component, which is not very soluble in thestationary phase but very soluble in the mobile phase. As aresult of these differences in mobility, sample componentswill become separated from each other as they travel throughthe stationary phase. Figure 3 represents a chromatogramfor GOS obtained in HPLC.Detection limits of substances using HPLC in generalare largely dependent on the compound being analyzed as well as the sensitivity of detector used.Whereas the RI detector is not the most sensitive, for example being 100 to 1000 less sensitive thanUV detectors, its suitability with detection range of micrograms per milliliter (μg/mL) is convenientenough for GOS detection and analysis (Otieno, 2010)Materials of chromatographic separationDifferent types of materials can be used as a solid phase for chromatographic separation. Thestationary phase is the key element in a chromatography system. Separation is enhanced by usingstationary phases that present the shortest possible diffusion pathways to the solutes, have lowresistance to mass transfer, reasonably narrow particle size distribution, and are uniformly packed inthe column. The most frequent materials used in sugar separation are:a) Active carbonIn sugar industry, the most used adsorbent is active carbon, because is the cheapest and does notrequire a difficult pretreatment. Use of active carbon for the separation of GOS has shown that the carbonhas higher affinity for oligosaccharides and low affinity for monosaccharides (glucose and galactose).b) Ion exchange materialsCation exchange resins have been used HPLC program for GOS detectionextensively in the sugar industry for differenttypes of separation. The use of cation-exchange Mobile phase Acetonitrile: Water (80:20)resins together with water as the mobile phase ColumnAmino (NH2) columnresulted in a better separation of saccharides DetectorRefractive Index Detectorthan when anion exchangers were used. Use Run time20 minof a method for the separation of sugars on theFlow rate0.4 ml/mincation-exchange resin Dowex 50W-X4 (K+),Column temperature800Cusing water as the eluent separate varioussugars including oligosaccharides, hexoses, pentoses, acetals, methyl-α-D-glycosides and other sugarderivatives, with recoveries of greater than 95%.FractionationFig. 3. HPLC chromatogram of GOS sample:Glc: glucose, Gal: galactose, Lac: lactose, a(1–6)galactobiose, DP: degree of polymerisation.The separation of carbohydrates plays an important role in food production and in cosmetic andpharmaceutical industries. Also, 90% of the cost in food production is related with separation processes.234

Estimation of Microbial GOS by High Performance Liquid ChromatographyLiquid chromatography offers high selectivity, efficiency and loading capacity of the stationary phaseand speed of process. Purification of GOS is important because by removing monosaccharide andlactose from GOS, there is a decrease in sweetness and calorie value. Different techniques are beingused for the fractionation of oligosaccharides including• Diafiltration• Yeast treatment,• Activated charcoal treatment• Size exclusion chromatography (SEC) (Hernandez and others 2009).Other methods of detectionQuemener and others (1997) developed a method based on high performance anion-exchangechromatography with pulsed amperometric detection (HPAE-PAD) to measure GOS in food andfeed products. A few years later, de Slegte (2002) organized collaborative study of this method inwhich galactose and other sugars were separated on a CarboPacTM PA1 column and detected bypulsed amperometric detection (PAD) using a triple potential waveform. Thin layer chromatography(TLC) and spectrophotometric (UV spectra) methods are also used for GOS detection. TLC is onlyqualitative and less sensitive as compared to HPLC. The UV method together with chemometricmodels of calibration is an acceptable analytical method for a fast, simple and inexpensive monitoringof total GOS production in a predefined fermentation process, allowing to promptly verifying if thefermentation is running as expected, or if some correction action is needed, which is crucial whenan industrial GOS production is envisaged, being a possible alternative to the standard analyticalmethods usually used (Dias and others 2009).ConclusionLiquid chromatography has been largely used depending on the matrix from which GOS is to beextracted and analyzed. However, HPAE-PAD has been found to be more superior in the detectionof GOSs than high-performance liquid chromatography with RI detection. Nevertjeless, in the eventthat HPAE-PAD is not available for use, HPLC-RI can be reliably used instead. Concerning thechemometric methods analyzed, in general, the ANN multiple is robust and present the best globalprediction performance. However, further studies are needed in order to obtain better results withthese chemometric models. Although the RI detector has several limitations, namely the dependenceof sensitivity on changes in solvent composition, temperature, and pressure, it however remains themost useful tool so far in the determination of sugar concentrations in foods.Referencesde Slegte J. 2002. Determination of trans-galactooligosaccharides in selected food products by ion-exchangechromatography. J AOAC Int 85:417–23.Dias LG, Veloso ACA, Correia DM, Rocha O, Torres D, Rocha I, Rodrigues LR, Peres AM. 2009. UV spectrophotometrymethod for the monitoring of galacto-oligosaccharides production. Food Chemistry 113:246–252.Gosling A, Stevens GW, Barber AR, Kentish SE, Gras SL. 2010. Recent advances refining galactooligosaccharideproduction from lactose. Food Chemistry 121:307–318.Hernandez O, Matute AIR, Olano A, Moreno FJ, Sanz ML. 2009. Comparison of fractionation techniques to obtainprebiotic galactooligosaccharides. International Dairy Journal 19:531–536.Morales V, Sanz ML, Olano A, Corzo N. 2006. Rapid separation on activated charcoal of high oligosaccharides in honey.Chromatographia 64:233–238.Otieno DO. 2010. Synthesis of β-Galactooligosaccharides from Lactose Using Microbial β-Galactosidases. ComprehensiveReviews in Food Science and Food Safety 9:471-482.Park AR, Oh DK. 2009. Galacto-oligosaccharide production using microbial β-galactosidase: current state andperspectives. Appl Microbiol Biotechnol.235

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceEstimation of Trehalose Production by PropionibacteriaIntroduction236Poonam and Sudhir Kumar TomarDairy Microbiology Division, NDRI, KarnalTrehalose also known as mycose, is a non reducing disaccharide in which two glucose moleculesare linked together in a 1,1-glycosidic linkage. Although there are three possible anomers of trehalose,that is, α,β-1,1, β,β-1,1, and α,α-1,1, only the α,α -trehalose (Figure 1) has been isolated from andbiosynthesized in living organisms.This naturally occurring disaccharide is widespread throughout the biological world with thefirst tentative report being in ergot of rye. Trehalose isfound naturally in insects, plants, fungi, and bacteria,the major natural dietary source is mushrooms. It isimplicated in anhydrobiosis—the ability of plants andanimals to withstand prolonged periods of desiccation.It has high water retention capabilities and is usedin food and cosmetics. The sugar forms a gel phase Fig. 1. Structure of naturally occurring isomer ofas cells dehydrate, which prevents disruption oftrehalose, α,α-1,1 trehaloseinternal cell organelles by effectively splinting themin position. Rehydration then allows normal cellularactivity to be resumed without the major, lethal damage that would normally follow a dehydration/rehydration cycle. Trehalose has the added advantage of being an antioxidant. Trehalose is a naturallyoccurring reducer of cell stress, protecting these organisms from extremes in heat shock and osmoticstress (Crowe, 2002). It acts by altering or replacing the water shell that surrounds lipid and proteinmacromolecules. It is thought that its flexible glycosidic bond allows trehalose to conform to theirregular polar groups of macromolecules. In doing so, it is able to maintain the 3-dimensional structureof these biologic molecules under stress, preserving biologic functions. Furthermore, trehalose is verypromising as a sugar substitute in food: it is repeated as being anti-cariogenic and can be consideredas a dietetic sugar since it is only partially digested in the human intestine (Neta et al., 2000). Theseproperties place trehalose in the category of compounds known as nutraceuticals, defined as foodsand food components with benefits for human and animal health (Hugenholtz et al., 2002).Trehalose production by propionibacteriaDairy Propionibacteria are important starter organisms involved in typical flavor and eyesformation in Swiss-type of cheeses and in the production of other dairy products. Besides theirtechnological role, these bacteria can also be used as cell factory for the production of a variety ofbiomolecules like vitamin B 12, folate, riboflavin and propionic acid. They also have been recognizedas potential probiotics in recent years. In cheese manufacturing and during other applications,Propionibacteria are subjected to different kind of stress conditions and a part of this defense systeminvolves the intracellular accumulation of trehalose.Pathways for trehalose biosynthesisAt least four pathways for the synthesis of trehalose in biological system have been reportedthus far: (i) the OtsA–OtsB pathway, the most common route, involves the transfer of glucose fromUDPglucose to glucose 6-phosphate to yield trehalose 6- phosphate, which is subsequently convertedto trehalose (ii) the TreS pathway, Trehalose synthase (TS) catalyses an intramolecular arrangementof maltose, in order to convert the glycosidic bond α-(1-4) of this disaccharide to the α -(1-1) trehalosebond (iii) the TreY–TreZ pathway, a two-step reaction involving maltooligosyl-trehalose synthase(TreY) catalyzing the conversion of maltodextrines to maltooligosyl-trehalose and subsequently themaltooligosyl-trehalose trehalohydrolase (TreZ) breaks this intermediate to generate trehalose and

Estimation of Trehalose Production by Propionibacteria(iv) a single-step pathway involving trehalose glycosyltransferringsynthase, that catalyses the reversible conversion of glucose andNDP-glucose into trehalose.Pathways leading to trehalose accumulation in Propionibacteriafreudenreichii have been studied (Cardoso et al., 2007). P.freudenreichii uses the OtsA–OtsB pathway for trehalose synthesis,whereas trehalose catabolism proceeds via TreS. Maltose derivedfrom TreS activity can be processed by amylomaltase, releasingglucose which is further catabolized via glycolysis (Figure 2).Given the beneficial properties of trehalose, there is a needto estimate the level of trehalose accumulated by differentPropionibacteria strains so that high trehalose accumulating strainscan be selected which will act as robust cheese starter and can beused for enhanced trehalose production at industrial level.Estimation of trehalose productionDifferent types of methods are available for estimationof trehalose production by Propionibacterium strains. All thesemethods include growth of culture in YELA medium, extraction ofintracellular trehalose from the cells and then estimating the level of trehalose.Growth conditionsFor investigating trehalose biosynthesis, culturing of the cells is required in Erlenmeyer flasks(500mL). At the beginning of the experiment, a 3% inoculums (v/v) is introduced in 200 mL of YELA(Yeast extact lactae agar) medium and strieedd at 50 rpm in a water bath at 30 ºC. To establish anaerobicconditions, the medium is aseptically gassed with argon during the 15-min preceding inoculation. Aculture grown until exponential phase is used as inoculum to obtain an initial optical density of about0.06.Trehalose extraction from the cellTrehalose extraction using ethanol extraction: Cells are centrifuged (13800 g, 10 min) and washed inan isotonic solution. The cell pellets are transferred into a glass tube with 80 % ethanol and stirredby vortex for 30 min at ambient temperature. They are evaporated to dryness by means of a rotaryevaporator. The residues obtained are then dissolved in the 1.5 ml of acetonitrile : water (70:30) anddirectly taken up for HPLC analysis. (Ferreira et al., 1996).Trehalose extraction using TCA: The cell pellet obtained is mixed with 3 volumes of TCA 0.5 M for1hr at room temperature. Then the suspension is centrifuged at 20000 g for 10 min. The supernatant isneutralized before trehalose conc. Measurement (Cola et al., 2010).Trehalose extraction using hot water: The cell pellet obtained is washed with 1 ml of water. Cells areresuspended in 0.2 ml of water and transferred to a boiling water bath, followed by incubation for 10min to extract intracellular compounds. After centrifugation of the boiled sample, the supernatant isobtained and used for measuring the trehalose content (Mahmud et al., 2010).Trehalose extraction using Bead mill: The test tubes are directly taken up from the freezer andimmersed in boiling water for 10 min. followed by cooling on ice. Glass beads are added to tubesand cells are disintegrated in the bead mill for 30 min. Cell debris are removed by centrifugation andsupernatant is taken for further analysis (Schulze et al., 1995).Estimation of trehalose from the cell extractFig.2. Proposed scheme of trehalosemetabolism in P. freudenreichii.1, Glucokinase; 2, trehalose-6-phosphate synthase; 3, trehalose-6-phosphate phosphatase; 4, trehalosesynthase; 5, amylomaltose; PolyP,polyphosphate; G, glucose.HPLC method: Trehalose concentration in the supernatant obtained is measured using a HPLCsystem equipped with refractometer detector and a silica-amino column (250x4 mm i.d.) coupled to aguard-column (10x4 mm i.d.). Mobile phase used is acetomitrile : water (70:30) at 1mL. min (Deborde237

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceet al., 1996)Enzymatic (Trehalase) method: Trehalose can also be determined by incubating the cell free extractswith a stable trehalase preparation. Extracts (100 µl) plus 25 µl trehalase are incubated overnight (14h) at 40ºC. The resulting glucose is assayed with glucose oxidase by adding to the spectrophotometercell (2.0 ml final volume), the following reagents: 1% odianisidine, prepared by diluting in 0.1 Mphosphate buffer pH 6.0; digested trehalose sample; peroxidase, 200 lg/ml in distilled water (1.5 U/ml of the assay mixture); and glucose oxidase (1 mg/ml in distilled water, to obtain 21 U/ml in 2 mlof the assay mixture). Absorbance changes are measured in the spectrophotometer at 460 nm and 25ºCand compared to a glucose standard curve (Gonzalez-Hernandez et al., 2005).Anthrone method: Trehalose extracts are submitted to the reaction with anthrone and the colourformed measured at 620 nm, according to the procedure described by Brin (1966). Quantification isachieved using trehalose as external standard.NMR method: After overnight ethanol extraction, the samples are dried in a desiccator for at least48 h. Dried samples are resuspended in D 2O (Aldrich Chemical) and analyzed by NMR spectroscopyusing a Bruker AMX300 spectrometer with a 5-mm inverse detection probe head, 32 K data points, a90j flip angle and a repetition delay of 42.7 s. The water resonance is suppressed with a pre-saturationpulse. The trehalose peak is identified against that of the pure substance. (Cardoso et al., 2004).Megazyme kit method: The trehalose content in the supernatant can also be measured using aenzymatic assay kit from Megazyme International Ireland Ltd. (Wicklow, Ireland). The basic principleincludes hydrolysis of trehalose to D-glucose by trehalase and then D-Glucose released is measuredby phosphorylating with enzyme hexokinase (HK).Cell protein determination: For expressing the trehalose content in the cell, the total protein in thecell is determined by the method of Lowry et al. (1951) after cell lysis with 1 M NaOH (85ºC, 5 min),and using bovine serum albumin as a standard. Trehalose content of the cell is expressed in terms ofprotein content of the cell (Cardoso et al., 2004).ReferencesBrin, M. (1966). Transketolase: clinical aspects ed. In. S. P. Colowick & N. 0. Kaplan, Methods in Enzymology, 9,Academic Press, pp. 506514.Cardoso, F. S., Castro, R. F., Borges, N., Santos, H. (2007). Biochemical and genetic characterization of the pathwaysfor trehalose metabolism in Propionibacterium freudenreichii and their role in stress response. Microbiology, 153, 270–280.Cardoso, F. S., Gaspar, P., Hugenholtz, J., Ramos, A., Santos, H. (2004). Enhancement of trehalose production in dairyPropionibacteria through manipulation of environmental conditions. International Journal of Food Microbiology, 91,195– 204.Colla, E., Pereira, A. B., Hernalsteens, S., Maugeri F., Rodrigues, M. I. (2010). Optimization of trehalose productionby Rhodotorula dairenensis following a sequential strategy of experimental Design. Food Bioprocess Technol, 3,265–275.Crowe, L. M. (2002). Lessons from nature: the role of sugars in anhydrobiosis. Comp Biochem Physiol AMol Integr Physiol,131, 505–13.Deborde, C., Coree, C., Rolin, D. B., Nadal, L., de certaines, J. D., Boyaval, P. (1996) Trehalose biosynthesis in dairyPropionibacterium. Journal of magnetic resonance analysis, 2, 297-304.Ferreira, J. C., Paschoalin, V. M. F., Panek, A. D., Trugo, L. C. ( 1997). Comparison of three different methods fortrehalose determination in yeast extracts. Food Chemistry, 60(2), 251-254.Gonzalez-Hernandez, J. C., Jimenez-Estrada, M. (2005). Comparative analysis of trehalose production by Debaryomyceshansenii and Saccharomyces cerevisiae under saline stress. Extremophiles, 9, 7–16.Hugenholtz, J., Hunik, J., Santos, H., Smid, E. (2002). Nutraceutical production by propionibacteria. Lait, 82, 103– 112.Mahmud, S. A., Hirasawa, T., Shimizu, H. (2010). Differential importance of trehalose accumulation in Saccharomycescerevisiae in response to various environmental stresses. Journal of Bioscience and Bioengineering, 109 (3), 262–266.Neta, T., Takada, K., Hirasawa, M. (2000). Low-cariogenicity of trehalose as a substrate. Journal of Dentistry, 28, 571–576.Schulze, U., Larsen, M. E., Villadsen, J. (1995). Determination of intracellular trehalose and glycogen in Saccharomycescerevisiae. Analytical Biochemistry, 228, 143-149.238

Spore Based Biosensor as A Quality Control Tool in Dairy IndustrySpore Based Biosensor as A QualityControl Tool in Dairy IndustryNaresh Kumar, Raghu H. V. and AvinashDairy Microbiology Division, NDRI, KarnalThe development of sensors for detecting foodborne pathogens has been motivated by the needto produce safe foods and to provide better healthcare (Irudayaraj, 2009). Improving food and watersafety and security depends on the ability to detect, identify, and trace food and water pathogens.As milk is a compulsory part of daily diet and being nutritious food for human beings, also servesas a good medium for the growth of many microorganisms which cause spoilage of milk and milkproducts. Earlier for detection of pathogens conventional methods which rely on specific media toenumerate and isolate viable bacterial cells in food were used, and are considered as gold-standardfor their detection. These methods are very sensitive, inexpensive and can give both qualitative andquantitative information and involve the basic steps: pre-enrichment, selective enrichment, selectiveplating, and biochemical screening and serological confirmation. Hence, a complete series of tests areoften required before any identification can be confirmed (Mandal et al., 2011) Although methods arepowerful, error-proof, and dependable but are lengthy, cumbersome and are often ineffective becausethey are not compatible with the speed at which the products are manufactured and the short shelflife of products. To overcome these challenging criteria of time and sensitivity rapid methods whichinclude nucleic acid, fluorescent antibody or immuno-based techniques have been developed whichgives instant or real time results but requiring additional expensive devices and equipments (Ivnitskiet al., 1999). Biosensor based tools offer the most promising solutions and address some of the moderndayneeds for fast and sensitive detection of pathogens in real time.Biosensors are defined as analytical devices integrating biological elements and signal transducers.The biological elements interact specifically with an analyte, producing a signal that the transducerrecognizes and converts into measurable parameters as shown in fig.1 (Rasooly and Herold, 2006).Currently biosensor is defined as a sensor that integrates a biological element with a physiochemicaltransducer to produce an electronic signal proportional to a single analyte which is then conveyed toa detector.Biosensor achievements have revolutionized the detection method and provide us with simple touse device, cost-effective, rapid and appropriate detection method that give immediate and accurateresults comparable to or better than the conventional analytical systems in terms of performancei.e. reliability, sensitivity, selectivity,specificity and robustness and can identifythe contaminants much faster, more efficientand can give effective real time monitoringof pathogens and most importantly ensuringcustomer safety (Scott, 1998).History of biosensor: In 1956, LelandC Clark Jr., who is known as the father ofBiosensors and he published his definitivepaper on the oxygen electrode. In 1962, he Fig. 1. Diagrammatic representation of Biosensor and itsdescribed "how to make electrochemical working principlesensors more intelligent" by adding Source:www.realtimebiosensor.com (Mattias Rudh, 2007)"enzyme transducers as membrane enclosedsandwiches”. The year wise development in the field of biosensor is as follows:1922: First glass pH electrode;1956: Invention of the oxygen electrode;1962: First description of abiosensor- an amperometric enzyme electrode for glucose; 1969: First potentiometer biosensor- Urease239

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceimmobilized on an ammonia electrode to detect urea; 1972/5: First commercial biosensor-YellowSprings Instruments glucose biosensor;1975: First microbe-based biosensor, First immunosensorovalbuminon a platinum wire, Invention of the pO 2/pCO 2optode; 1982: First fibre optic-basedbiosensor for glucose; 1983: First surface plasmon resonance (SPR) immunosensor; 1984: Firstmediated amperometric biosensor: ferrocene used with glucose Oxidase for the detection of glucose;1996: Glucocard launched; 1998: Launch of LifeScan Fast Take blood glucose biosensor; 2001: LifeScanpurchases Inverness Medicals glucose testing business for $1.3 billion.Types of biosensors:1. Optical biosensors: Technique used in this biosensor is based on surface plasma resonance.2. Electrochemical sensing biosensors: Technique used in this biosensor is based on amperometricsensing, Conductometric sensing. In amperometric sensing, increasing potential is applied tothe cell until oxidation of the substance to be analysed occurs. This in turn increases the cellcurrent and gives a peak current. The height of this peak current will be directly proportionalto the concentration of electroactive substances or molecules. In conductive sensors substrateconcentration is measured using relationship between conductance and concentration of ionicspecies.3. Enzymatic biosensors: This type of sensors is widely used as they are easy to use. For exampleglucose biosensors. In glucose biosensor enzyme acts as a biorecognition element and recognizesonly the glucose molecule. These enzymes are present in the electrode surface. When enzymerecognizes the glucose molecule it act as biocatalyst and produces gluconic acid and hydrogenperoxide using glucose and oxygen from the air. This reaction leads to the flow of electronsfrom hydrogen peroxide/oxygen coupling. This flow of electron is directly proportional to thenumber of glucose, molecules present in the biological fluid such as blood.Classification of biosensor:It may be classified according to the biological specificity conferring mechanism or to the mode ofsignal transduction, or alternatively a combination of both (Belluzo et al., 2008).Classification based on bioreceptors: A Bioreceptor is a biological molecular species or aliving biological system that utilizes a biochemical mechanism for recognition (Tantilipikara, 2005).Depending upon the mechanism of biochemical interaction between the receptor and the analyte thebiosensor can categorised into two types:1. Biocatalytic sensors: They are based on the recognition and binding of an analyte followed bya catalyzed chemical conversion of the analyte from a non-detectible form to detectible formwhich are detected and recorded by a transducer. This includes:i) Monoenzyme, multienzyme ii) Microorganisms (such as bacteria, fungi, yeast), or sub cellularorganelles and particles (mitochondria, cell walls); iii) Animal / plant tissue slice2. Bioaffinity sensors: They are based on the interaction of the analyte with biological components,such as antibodies, nucleic acid, lectins, cell membrane receptor or harmone receptor (Rogers,2000).Classification based on transduction system: The transducing element of a biosensor is used toconvert the biological recognition step into the measurable signal that can be detected and displayed.It is further classified into following types:a) Electrochemical : Electrochemical detectors measure changes in electron transfer caused byan oxidation/reduction reaction involving the analyte at the surface of a suitable electrode(Thevenot et al., 2001). It further includesi)Amperometric : It detects the changes in current as a function of concentration of electroactive species e.g. - Solid electrolyte gas sensors, electronic noses.ii) Potentiometric : It depends on changes in potential of a system at constant current (I=0) orit detects the change in distribution of charge. e.g. - Ion-selective electrodes (such as pH240

Spore Based Biosensor as A Quality Control Tool in Dairy Industrymeter), Ion-selective field effect transistors, LAPS.iii) Conductometric : It measures the change in conductance of the biological complexsituated between electrodes. or it involves the measurement of changes in conductancedue to the migration of ions. e. g.-Optical fibers, surface plasmon resonance, absorbance,luminescence.b) Optical : In optical biosensors, the optical fibers allow detection of analyte on the basis ofabsorption, fluorescence or light scattering (Chauhan et al., 2004) e.g.-Surface plasmonresonancec) Piezoelectric: The change in frequency is proportional to the mass absorbed material orSensitive to changes in mass, density, viscosity and acoustic coupling phenomena e. g.Surface acoustic wave sensorsd) Calorimetric : Many enzyme catalyzed reactions are exothermic, generating heat which maybe used as a basis for measuring the rate of reaction and, hence, the analyte concentration.Whole-cell bacterial biosensorsBacteria can be used as biosensors to demonstrate the toxicity of a variety of environmentalmedia including soil, sediment, and water by coupling bacteria to transducers that convert a cellularresponse into detectable signals (Biran et al., 2003). These bacterial biosensors are engineered bypairing a reporter gene that generates a signal with a contaminant-sensing component that respondsto chemical or physical change, such as exposure to a specific analyte. When the biosensor is exposedto such a change, the sensing component stimulates the reporter gene through a biochemical pathwayin the cell. The reporter gene then produces a measurable response, such as emitting visible light,which is indicative of the degree of chemical or physical change (Biran et al., 2003; Tauriainen et al.,2000, Turpeinen et al., 2003; Daunert et al., 2000). Several biosensors have been developed that indicatetoxicity of any chemical or physical change; new biosensors are being developed to respond toparticular analytes. Such biosensors have been developed for heavy metals and metalloids includingarsenic, cadmium, mercury, and lead (NRC, 2003).Biosensors measure the bioavailability concentration for the contaminant they are designed todetect (Tauriainen et al., 2000). To test the measurements made by biosensors, a chelating agent knownto decrease bioavailability of lead was added to a lead solution. Measurements of the lead solutioncontaining chelating agents were taken and compared to measurements of the lead-only solution. Adecrease in the biosensors luminescence matched a decrease in bioavailability concentration of leadin the solution. This demonstrates that biosensors are sensitive to the bioavailability fraction of thecontaminant and their luminescence reflects the bioavailability concentration (Tauriainen et al., 2000).Spores based biosensor: Bacterial spores appears to have great potential for their application asbio-sensor as they have the ability to sense environmental changes and to respond using explosivemolecular mechanisms that transform dormant spores into rapid growing cells. There are a greatnumber of bacterial species which produce spores for example; genus Bacillus (widely dispersed in soil,plant matter, and air) may be readily grown in the laboratory to form spores: B. cereus, B. licheniformis,B. megaterium, B. sphaericus, B. stearothermophilus, B. subtilis, and B. thuringiensis. They can also survivein a very harsh condition. For the development of bacterial spore as a biosensor, it is a prerequisite tohave a complete or descriptive knowledge regarding their germinants (carbohydrates, nucleotides,amino acids etc.) which by their action on the dormant spores convert them into vegetative cells. Thegermination process of a whole population of spore may be completed in a very short duration oftime (15-30min) followed by a sequence of metabolic reactions and synthesis of enzymes resulting inoutgrowth of vegetative cells. After germination de novo acetyl esterase is released from the core ofthe spore which act upon DAF and its hydrolysis results in flouroscence and the signal can be capturedusing optical device to quantify the presence of target analyte (Rotman, 2001).Characteristic features of spores: Bacillus species have inherent characteristics to produce241

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceendospore. These are the dormant form of life having no metabolic activity. They are resistant toenvironmental stress like heat, desiccation, irradiation and chemical compounds and can be storedin a medium for long time even in the absence of nutrients. Spores are resistant due to the Calciumdipicolinatepresent in the spores that stabilize and protects the DNA from denaturation. DNA-bindingproteins helps in protecting the DNA from heat, drying, chemicals, and radiations. While dehydrationprocess that is the loss of water provides them resistance toward heat and radiation. And finally duringthe germination process damaged DNA they get repaired by DNA repair enzymes (Setlow, 2003).Sporulation: Spore formation, sporogenesis or sporulation, normally commences when growthceases due to lack of nutrients. It is a complex process and may be divided into seven stages .An axialfilament of nuclear material forms (Stage-I), followed by an inward folding of the cell membrane toenclose part of the DNA and produce the forespore septum (Stage-II). The membrane continues togrow and engulfs the immature spore in a second membrane (Stage-III). Next, cortex is laid down inthe space between the two membranes, and both calcium and dipicolinic acid is accumulated (Stage-IV). Protein coats then are formed around the cortex (Stage-V), and maturation of the spore occurs(Stage-VI). Finally, lytic enzymes destroy the sporangium releasing the spore (Stage-VII). Diagramrepresenting the different stages of sporulation (Prescott et al., 2002).Germination: In the presence of favorable growth conditions spores get germinated. Thegermination process is essentially a biophysical and degradative one – the spore’s inner membraneincreases in fluidity and ion fluxes resume; monovalent cations, potassium and sodium, move acrossthe spore membrane, and calcium ions and dipicolinate are excreted. The peptidoglycan of thespore cortex is degraded, and the coat layers are partially degraded. ATP synthesis and oxidativemetabolism resume, DNA damage is repaired and the DNA-complexing small acid-soluble proteins(SASPs) are degraded by a specific protease, providing a source of amino acids for outgrowth. Asgermination events precede any de novo synthesis of macromolecules, the apparatus required forspore germination must be already present in the mature spore (Moir et al., 2002).Application of spores as biosensor: Bacterial spores are suitable for use as biosensor because theyhave the ability to sense environmental changes in response to specific “germinant” and transforminto rapid growing cells. The spores are heat resistant and can remain in non metabolic state for manyyears. This characteristic can effectively be used as a biosensor for tracking these residues in milk andmilk products and the details of biosensor developed are as follows:242

Spore Based Biosensor as A Quality Control Tool in Dairy Industry1.2.3.4.Development of analytical process for detection of antibiotic residues in milk using bacterialspores as biosensor.(Patent no Reg# IPR /4.9.1/05074/2006)(Kumar et al., 2006)A kit for detection of β-lactam antibiotic group in milk using bacterial spore as biosensor (PatentReg # IPR/ 4.14.1/08073/del/2009) (Kumar et al., 2009)Development of Spore Inhibition Based -Enzyme Substrate Assay (SIB-ESA) for monitoringAflatoxin M1 in milk (Patent Regd.# IPR /4/14.4/10045)Development of Enzyme Substrate Assay (ESA) for Monitoring Enterococci in Milk(Setlow, P, 2003.)Development of analytical process for detection of antibiotic residues inmilk using bacterial spores as biosensorThe bacterial spores have unique ability to sense environmental changes in response to specific“germinant” and transform rapidly into growing vegetative cells. The spores are heat resistant and canremain in non metabolic state for many years. This characteristic can effectively be used as a biosensorfor tracking these residues in milk and milk products. In the present invention, an analytical processof transformation of dormant spore of Bacillus stearothermophilus into active vegetative cell throughactivation, germination and outgrowth has been developed .This analytical process can track majorgroups of antibiotic residues in milk within 2.30-3.0 hours at MRL / or above levels recommended bycodex.Brief of Invention: An analytical process which involves sporulation & activation of dormantspores of B.stearothermophilus in newly developed medium & their germination/ outgrowth inpresence of selective germinant mixture has been developed (Patent Reg # IPR/ 4.9.1.4/ 05074/ 1479/DEL /2006). The validated process is in line with AOAC approved charm 6602 system & can beused effectively for semi-quantitative detection of antibiotic residues in different types of milk systemwithin 2.30-3.0 hrs at MRL/ or above levels as recommended by the codex /EU. This cost effectiveprocess can also find applications in targeting spoilage and pathogenic organisms in dairy and nondairy foods.Market Potential: For monitoring of drug residues in milk well defined test / rapid assay techniqueare not available in India. MDR test Kit was offered to various stake holders like m/s Duke ThomsonPvt. Ltd., Indore; Hi-media Pvt. Ltd, Mumbai, NDDB; M/s Neugen diagnostic secunderabad etc. Theproduct was appreciated by all these potential customers and finally one non-exclusive license withfee of Rs. 2.50 lakhs, royalty 2.0% & validity of license for period of 7 years was given to M/s Neugendiagnostic Secunderabad who currently is selling our product to different dairy units like MotherDairy, Delhi; Paras Dairy (3 units); Bholebaba Dairy; Hatsun Dairy, TN; Aavin Dairy, TN; Kolar Dairy,Karnataka; Shipra Lab, Bengaluru; Delhi Milk Scheme etc. Microbial Drug Residues Test Kit (15 settest) developed at dairy microbiology division were sold to different dairy units through M/s NeugenDiagnostic Pvt. Ltd. @ 1200/- + CST @ 10.30% in last six months period. Further steps are required for243

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceAOAC approval of this product which will be costing around 10 lakhs and may expand its applicationat domestic level by incorporating in our legal standard (PFA standard) as well as in export.Novel features of process:1. Cost effective2. Better sensitivity3. Semi-quantitative detection4. No false positive /negative results5. Insensitivity towards detergents / sanitizers6. Consistency in color development with in 3.0 hrs7. Validated with AOAC approved charm 6602 system8. Wide spectrum of application for different types of milk244

Spore Based Biosensor as A Quality Control Tool in Dairy IndustryA kit for detection of β-lactam antibiotic group in milk using bacterial spore as biosensor:This invention relates to application of dormant bacterial spores as biosensor. The study isbased on the resistance mechanism of some β-lactamase generating Bacillus spp. Some spore formingbacteria such as B. cereus and B. licheniformis produce β-lactamase enzyme due to induction by β-lactamantibiotics and the enzyme production is proportional to the concentration of inducer present in milk.A real time microbial assay based on β-lactamase enzyme using starch iodine as color indicator hasbeen developed. The microbial assay is working on principle of non competitive enzyme action oninducer (β-Lactam) resulting in indirect reduction of starch iodine mixture through penicilloic acid. Acomparison of the intensity of the test reaction with that of a control was taken as criteria to determineswhether the sample is positive or negative (Kumar et al., 2009) .The assay can detect specifically β-lactam groups in spiked milk with in 15-20 min at regulatory codex limits with negligible sensitivitytowards non β- lactam groups. The presence of Inhibitors other than antibiotic residues in milk did notinterfere with the working principle of microbial assays. A significant correlation between microbialassay & receptor based assay (charm 6202) was established in survey work with raw, pasteurizedmilk and dried products with no false positive/ negative results. Spore suspension was found stableup to 5 months when stored under refrigeration conditions. The microbial assay (Rs 20.54/- test) iscost effective can find immense application in dairy industry as “ON FARM” milk screening test forβ- lactam group (Kumar et al., 2009).The impact of innovation on life of Rural India: The invention was carried out to test drug residuesat farm level. These drug residues have immense public health and processing implications. The fieldlevel testing will be of public heath and processing value to dairy farmers and entrepreneurs who areinvolved in dairy small business.Development of spore inhibition based–enzyme substrate assay (sib-esa)for monitoring aflatoxin M1Brief about Innovation: Aflatoxins are toxic, carcinogenic, mutagenic immuno-suppressiveagents produced as secondary metabolites by the fungi Aspergillus flavus & A. parasiticus. Four majorAflatoxins B1, B2, G1, and G2 have been isolated from feeds. Aflatoxin M1 is hydroxylated derivativePatent on development of spore inhibition based–enzyme substrate assay (SIB-ESA) for monitoring aflatoxinM1 in milk has been filed at NDRI and is under processing(Patent Regd.# IPR /4/14.4/10045)245

Chemical Analysis of Value Added Dairy Products and Their Quality Assuranceof Aflatoxin B1.The bacterial spores as nano-detector have unique ability to sense environmentalchanges in response to specific “germinant” and transform rapidly into growing vegetative cells.This characteristic can be effectively used as biosensor for tracking microbial and non–microbialcontaminants (Kumar et al.,2005; Rotman 2001 & 2003).The present hypothesis is based on the specificspore germination inhibition principle in presence of specific analyte i.e. aflatoxin M1. In case whereanalyte is absent in milk system, specific indicator enzyme (s) are produced by active bio-sensingmolecules which will act specifically on chromogenic/or fluorogenic substrate resulting in coloredreaction/or fluorescence as end product which is measured semi-quantitatively by either visually/orusing optical system at specific excitation/emission spectra (Kumar et al., 2010).The end product response is significantly different in case of buffer/ or milk system containingspecific analyte i. e. aflatoxin M1. The developed test assay was validated by analyzing 25 samples ofeach raw and pasteurized milk procured from different organized/or private own dairies and otherreputed brands using AOAC approved RIA and ELISA based system and a significant correlationwith ELISA at Codex MRL Limit (0.5 ppb) of Aflatoxin M1 was established.Development of Enzyme Substrate Assay (ESA) For Monitoring Enterococci in Milk: AnEnzyme Substrate Assay (ESA) based on β-D-glucosidase activity was attempted for specificdetection of Enterococci to meet the emerging demand of dairy industry. Four enrichment brothscommercially available in the market were screened for selective recovery of Enterococci based onβ-D-glucosidase activity. One of these broths namely Chromocult Enterococcus Broth (CEB) showedbetter performance in terms of selectivity and enzyme activity with partial inhibition of contaminantsother than Enterococci. The selected medium was further improved for desired features by increasingthe concentration of sodium azide from 0.06 to 0.15 g/100 ml resulting in significant inhibitoryeffect on growth pattern of L. lactis, L. casei, Leuconostoc mesenteroides and L. monocytogenes. Othermedia components and supplements were also optimized for enhanced sensitivity and selectivityof Enterococcus sp. The optimized selective enrichment medium i. e. Esculin Based Sodium AzideMedium (EBSAM) demonstrated superior features in terms of sensitivity, selectivity, fastness, accuracyetc. and may be a suitable substitute for existing media used for routine monitoring of Enterococci inR&D institutions. Developed assay was screened for Enterococci count with 32 samples of raw milkand it could detect 2.67, 3.50, 4.25 and 4.8 log counts within incubation period of 12, 7½, 6½ and 5 hrrespectively. ESA could also detect Enterococci log counts of 2.84 in pasteurized milk within 12 hrsof incubation; however, assay was insensitive at very low level of 1.13 and 0.915 log counts. As suchESA developed in current investigation may find industrial application as Hygiene Indicator test fordetection of Enterococci in raw milk & pasteurized milk with in 5-12 hrs as against 36-48hrs required246

Spore Based Biosensor as A Quality Control Tool in Dairy Industryin conventional method (Thakur et al., 2010).Concluding remarks: Biosensors are making a great impact on the development of rapid, sensitiveassays for the detection of microbial and non – microbial contaminants in food system. Kits are nowavailable for several organisms such as E. coli O157:H7 and Salmonella typhimurium and it is hoped thatmore will become available shortly. The most viable openings in the food industry will arise wherea biosensor can rapidly detect total microbial contamination. The largest area of application for theenvironment lies in the development of biosensors for monitoring bacteria in drinking and wastewater, rivers, reservoirs and supplies. Spores have a great potential to be used as a biosensor andthe bioassay are cost effective, rapid, easy to perform and require almost negligible infra-structuralfacilities.References:Belluzo, M. S., Ribone, M. E., Lagier, C. M., 2008. Assembling Amperometric Biosensors for Clinical Diagnostics. Sensors8, 1366-1399.Biran, I., Rissin, D., Ron, E. and D. Walt. 2003. Optical imaging fiber-based live bacterial cell array biosensor. AnalyticalBiochemistry, 315:1, pp. 106-113.Chauhan, S., Rai, V., Singh, H. B., 2004. Biosensors. Resonance. 33-44.Daunert S., Barrett G., Feliciano J., Shetty R., Shrestha S., and W. Smith-Spencer. 2000. Genetically Engineered Whole-Cell Sensing Systems: Coupling Biological Recognition with Reporter Genes. Chem. Rev., 100, pp. 2705-2738.Irudayaraj, J., 2009. Pathogen Sensors. Sensors 9, 8610-8612.Ivnitski, D., Abdel-Hamid, I., Atanasov, P., Wilkins, E., 1999. Biosensors for detection of pathogenic bacteria. Biosensors& Bioelectronics 14, 599–624.Kumar, N., Das, S., Manju, G., 2009. A kit for detection of β-lactam antibiotic group in milk using bacterial spore asbiosensor (Patent Reg # IPR/115/del/2009).Kumar, N., Sawant, S., Malik, R.K., Patil, G.R., 2005. Development of analytical process for detection of antibioticresidues in milk using bacterial spores as biosensor (Patent Reg # IPR/4.9.1.4/05074/1479/del/2006).Kumar, N., Singh, N., Singh, V.K., Bhand, S., Malik, R.K., 2010. Development of spore inhibition based–enzyme substrateassay (SIB-ESA) for monitoring aflatoxin M1 in milk (Patent Regd.# IPR /4/14.4/10045).Mandal, P. K., Biswas, A. K., Choi, K., Pal, U. K., 2011. Methods for Rapid Detection of Foodborne Pathogens: AnOverview. American Journal of Food Technology 6(2), 87-102Moir, A., Corfe, B. M., Behravan, J., 2002. Spore germination. Cell Mol Life Sci 59, 403–409.National Research Council (NRC), 2003. Bioavailability of Contaminants in Soils and Sediments: Processes, Tools, andApplications. The National Academies Press.Prescott, L. M., Harley, Klein., 2002. Microbiology. 5th Edition. The McGraw-Hill companies. (Chapter 3)Rasooly and Herold, 2006. Biosensors for the Analysis of Food- and Waterborne Pathogens and their Toxins. Journal ofAOAC international 89(3), 873-883.Rogers, K. R., 2000. Principles of affinity-based biosensors. Molecular Biotechnology 14(2), 109-129.Rotman, B., 2001. Using living spores for real-time biosensing. Gen. Eng. News 21, 65.Rotman, B., Cote, M. A., 2003. Application of a real-time biosensor to detect bacteria in platelet concentrates. Biochem.Biophys. Res. Comm 300, 197-200.Scott, A. O., 1998. Biosensor for food analysis. Published by Royal Society of chemistry, Cambridge, UK. (Chapter 1)Setlow, P., 2003. Spore germination. Current Opinion in Microbiology 6, 550–556.Tantilipikara, P., 2005. Optical biosensor for microalbumin determination. A thesis submitted in partial fulfilment of therequirement for the degree of Master of Science. Mahidol University.Tauriainen, S., Virta, M. and M. Karp. 2000. Detecting Bioavailable Toxic Metals and Metalloids from Natural WaterSamples Using Luminescent Sensor Bacteria. Water Research, 34:10, pp. 2661-2666.Thakur, G., Kumar, N., Raghu, H. V., Malik, R. K., (2010). Development of Off-Line Enzyme Substrate Based Assay forMonitoring Enterococci in Milk. NDRI Newsletter Apr – June 2010. Pp 2-3.Thevenot, D. R., Toth, K., Durst, R. A., Wilson, G. S., 2001. Electrochemical biosensors: recommended definitions andclassification. Biosensors & Bioelectronics 16(1), 121-131.Turpeinen R., Virta M., and M. Haggblom. 2003. Analysis of Arsenic Bioavailability in Contaminated Soils. EnvironmentalToxicology and Chemistry, 22:1, pp. 1-6.247

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceDetection and Evaluation of Antimicrobial Activities ofBacteriocins and Bioactive Peptides Produced by LABShilpa Vij, Subrota Hati and Meenakshi DahiyaDairy Microbiology Division, NDRI, KarnalLactic Acid Bacteria (LAB) have been used for centuries in the fermentation of a variety of dairyproducts. The preservative ability of LAB in foods is attributed to the production of anti-microbialmetabolites including organic acids and bacteriocins. Bacteriocins generally exert their anti-microbialaction by interfering with the cell wall or the membrane of target organisms, either by inhibitingcell wall biosynthesis or causing pore formation, subsequently resulting in death. Bioactive Peptidesare released from milk proteins on enzymatic hydrolysis by the proteolytic enzymes such as trypsin,pepsin , chymotrypsin and LAB fermentation of milk proteins i.e. whey and casein by proteolytic LABsuch as L.helveticus, L.fermentum, L.acidophilus, L casei and Lactococci. A large variety of techniques haveevolved to assess the ability of microorganisms to produce antagonistic substances.Antimicrobial activities of bacteriocins/ Bioactive Peptides produced by LABMaterials Required:Sterile Petri-plates, sterile pipettes, Micropipettes, Sterile Micro tips, incubator, MRS agar, TGEagar, TGE soft Agar (0.8 % agar) tubes, indicator strains, the glass tube with a suction bulb, sterile filterpaper discs, forceps, ethyl alcohol (70%).Indicator strainCulture ConditionPediococcus acidilactici LB4230/37ºC MRS / TGE BrothLactobacillus plantarum NCDO 955 37ºC MRS / TGE BrothLactobacillus helveticus37ºC Whey/ Sodium CaseinateImportant:• Only freshly grown (3-4 hours incubation) active indicator strains should be used for determiningantibacterial activity.• Do not use stored (refrigeration temperature) indicator strain for the assay.• Do not use the over night incubated culture for the assay.Procedure:• Grow LAB/ Bacteriocin producing LAB cultures in MRS / M17 broth for 18-24 H as its optimalgrowth temperature (30/37ºC).• Grow proteolytic strains of LAB in whey or sodium caseinate (supplemented with 0.5% glucose)for 24 - 48 h as its optimal growth temperature (30/37ºC) for bioactive peptide production.• Remove the cells by centrifugation at 12000 rpm for 20 min at 5ºC.• Sterilize the supernatant from broth by passing through a 0.22 µm membrane or heat treat thesupernatant at 90ºC for 3 min in a dry bath/ water bath.• Alternatively cells are killed by boiling for 3-5 min and heat killed cultures can be employed.• Ultrafilterate whey qnd sodium caseinate fermentate from 10K Da membrane for separatingbioactive peptides of less than 10 KDa molecular weight.• Prepare agar plates by pouring melted agar (MRS/M17) in sterile Petri plates• After solidification of the agar transfer the plates to the incubator at 37ºC overnight for dryingof the agar surface.248

Detection and Evaluation of Antimicrobial Activities of Bacteriocins and Bioactive Peptides Produced by LAB• Overlay 5-7 ml of soft agar (0.8% agar) which had been seeded with 50 µl of the freshly grown(3-4 h) indicator strain. This will generate a potential mat of the indicator bacteria.• Refrigerate the plates at 5ºC for 1-2 h before the wells are punched out of the agar.• Punch out the wells with the broad end of a sterile Pasteur pipette and remove the agarbuttons.• Fill the wells 100 µl of the prepared culture supernatant/ heat killed cultures and less than 10 KDa bioactive peptides from whey and sodium caseinate• Put the plates in the refrigerator (5-7ºC) for 3-4 h to facilitate the diffusion of the antimicrobialcompound (Do not invert the plates).• Incubate the plates at optimum temperature of the indicator strain for 18-24 h (Do not invert theplates).• Observe the plates for zone of clearance (if any) around the edge of the wells.• A clear zone of 1 mm or greater extending laterally from the edge of the wells is consideredpositive inhibition. Use sterile distilled water as a control.Detection of bacteriocin (Nisin) produced by LABThis is a faster MTT [3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide] colorimetricassay (MCA) for quantitative measurement of polypeptide bacteriocins in solutions with nisin as anexample. After an initial incubation of nisin and indicator bacterium Micrococcus luteus NCIB 8166 intubes, MTT was added for another incubation period. After that, nisin was quantified by estimatingthe number of viable bacteria based on measuring the amount of purple formazan produced bycleavage of yellow tetrazolium salt MTT. Then MCA was compared to a standard agar diffusionassay (ADA).1. Indicator bacterial strain and cultivation: Inoculate a loop of Micrococcus luteus on the S1 agar(0.8% tryptone , 0.5% yeast extract 0.5% D-glucose 0.5% NaCl and 0.2% Na 2HPO 4. In agarmedium add 1.5% (w/v) Tween 20.) plate and incubate at 37°C for 18~24 h. Then, transfer asingle colony of bacteria from the S1 agar to S1 broth and incubate at 37°C for 12 h.2. Dissolve MTT in phosphate buffered saline (pH 7.2) to a concentration of 5 mg/ml, and thenfiltere through a 0.2-μm syringe filter.3. Add 100µl of MTT solution into each of 2 ml fresh S1 broth with indicator bacteria (from 106 to101 CFU/ml) and then incubate at 37°C for 1, 2, 3, 4, 5 and 6 h, respectively.4. Keep the broth culture in boiling water for 5 min to stop reaction.5. After cooling, centrifuge the cultures at 1 500×g for 20 min to precipitate formazan crystals6. Remove the supernatant. To dissolve the formazan crystals, add 2 ml of dimethylsulfoxide(DMSO) and then incubate the mixture for 10 min at room temperature.7. Measured the optical density (OD) of the formazan solution at the wavelength of 510 nm.249

Chemical Analysis of Value Added Dairy Products and Their Quality AssuranceList of Selected Participants for Winter School1.Sh. Shiv Shanker Chasta7.Dr. S.G. NarwadeAssistant Professor,Assist. Prof. (Dairy Science)DFT Department, College of Dairy & FoodDepartment of Animal Husbandry & DairyScience Technology, MPUAT, Udaipur-313001Science, College of Agriculture M.A.U.(Rajasthan)Parbhani.431 402chasta_ss@rediffmail.com, 09828566021narwades@rediffmail.com, 090285845372.Dr. M. Ilamaran8.Dr. R.A. Patil3.4.5.6.Assistant Professor (FSN)Department of Food Science and Nutrition,Home Science College and Research Institute,Tamil Nadu Agricultural University,Madurai - 625 104drilla@rediffmail.com, 09865175206Dr. R. SaravanakumarAssistant Professor (FSN) Department of FoodScience and Nutrition, Home Science Collegeand Research Institute,Tamil Nadu Agricultural University,Madurai - 625 104sarofsn@yahoo.com, 09942893107Mr. Durga Shankar BunkarAssistant Professor,Center of Food Science & Technology,Institute of Agricultural Sciences,Banaras Hindu University,Varanasi- 221 005dsbunkar.mtech@gmail.com, 09389835175Dr. Raj Kumar DuaryAssistant Professor,Department of Food Processing Technology,School of Engineering, Tejpur University,Napaam, Sonitpur, Assam -784 028rkduary@gmail.com, 09957669564Dr. Ashim Kumar BiswasDepartment of Livestock Products Technology,COVS, Gadvasu,Ludhiana-141 004 (Punjab)biswaslpt@gmail.com, 09463320622Assistant Professor (AHDS)Dept. Animal Husbandry & Dairy Science,College of Agriculture, Latur-412 513 (M.S.)rapatil1976@gmail.com, 094221890019. Dr. D.D. PatangeAssistant Professor, College of Agriculture,Kohlapur-416004 (MS)patange1@rediffmail.com, 0942180094110. Dr. K.D. ChavanAssistant Professor,Animal Science and Dairy Science Section,College of Agriculture, Pune, Behind MariaiGate , Khadki, Pune 411 003 (MS)chavankrd@rediffmail.com, 0942205869311. Mr. Ramachandra. BAssistant Professor, Dairy Science College,KVAFSU, Bidar-585 401bangalorerama@yahoo.com, 0948119172812. Mr. Harsh Prakash SharmaAssistant ProfessorDepartment of Food EngineeringCollege of Food Processing Technology & BioEnergy AAU,Anand-388110 Gujarat,harshsharma1983@yahoo.co.in, 0940839873713. Dr. Pawas GoswamiAssistant ProfessorDepartment of MicrobiologyMaharshi Dayanand Saraswati UniversityAjmer – 305009pawasgoswami@gmail.com, 09829273453

List of Selected Participants for Winter School14.Dr. Rakesh Kumar20.Mr. Devraja Naika H.SMS (Dairy Technology) 303-C, AradhanaVeterinary college, Koravangala Gate,Enclave, Khajpura, Bailey Road, Patna-800 014Arsikere road, Hassan-573201, Karnatakarakesh.dt27@gmail.com, 09934263033devraaz@gmail.com, 990070469515.Sh. Yogesh Khetra21.Dr. S. Shive KumarScientist, Dairy Technology Division,Assistant Scientist (DT)NDRI, KarnalCollege of Dairy Science & Technologyyogeshndri@gmail.com, 09813902989GADVASU, Ludhiana-141 004 (Punjab)16.Dr. P. Narender RajuScientist, Dairy Technology Division,22.drshiva2003@yahoo.com, 09646434238Mr. Vilas Mahadeorao ThakreNDRI, KarnalProgramme Coordinator17.pnr.ndri@gmail.com, 09896038983Mr. Awanish Kr. SrivastavaUnipex Dairy Product Co. Ltd. UAEPO Box 5646, Sharjah, United Arab Emirate23.KVK, Sindewahi, Distt. Vhandrpur(Maharashatra)suraj820@gmail.com, 09881149896Mr. Saraff Sripad18.avi_indian29@yahoo.co.in, 0097150 3637840Er. Tariq AhmadAsstt. Professor & Head,Department of Dairy Chemistry,Dairy Technology Programme,Assistant ProfessorSVVU, Kamareddy, Distt. Nizamabad-AP 503Department of Food TechnologyIslamic University of Science and TechnologyAvantipora (J & K)24.111 sripad_saraff@yahoo.co.in, 09848721561Ms. Nikam Pranali Balkishan19.tariqtech@gmail.com, 09906480112Dr. Arun Goel,Assistant ProfessorDFT Department,25.College of Dairy Technology, Warud,Pusad -445204pranali2801@gmail.com, 09225235250Dr. Vishakha SinghCollege of Dairy & Food Science Technology,Assistant ProfessorMPUAT, Udaipur-313001 (Rajasthan)Department of Foods & Nutrition,arungoel09@gmail.com, 09887182750College of Home science, Maharana PratapUniversity of Agriculture & Technology,Udaipur 313001(Rajasthan)vishakha.udaipur@gmail.com, 09414029748