Blueprint of life - Millennium

Gill Sans BoldAccording to the punctuated equilibrium theory, evolution is a suddenand random process rather than a continuous and gradual one. Thepunctuated equilibrium theory does not replace the theory of naturalselection but instead broadens it to better explain life’s history asobserved in the fossil records.Genetic evidence for evolutionIn Part 1 it was mentioned that the biomolecular technology of today isproviding scientists with new clues about the relationships betweenspecies. The genetic revolution in particular has provided techniques thatenable biologists to determine connections between species bycomparing how closely their DNA matches.This technique, known as DNA sequencing, simply compares the numberof matching nucleotides in a common section of DNA. For example, theDNA sequence below compares the number of matches between anoctopus and a rat.982TGTTTGCTAAAGCTTCAGCTATCCACAACCCAATTGTCTACoctopus961 TCTTTGCTAAGACCGCCTCCATCTACAACCCAATCATCTACNitrogen base sequences in similar sections of DNA.ratHow many matches did you notice? Scientists have found that thegenetic codes of even quite different organisms or more similar than waspreviously expected.For example, the Human Genome Project, which was an internationalcollaboration to identify the genes in human DNA, has found thathumans have approximately 30 000 genes. Of these, more than 200 areidentical to genes found in bacteria. Many human genes have existed fora very long time and are shared with other organisms.The existence of identical genes in different organisms furtherstrengthens the theory that organisms have changed over time. Whilesome genes have been added or changed, others from an ancient ancestorhave remained because they control a vital, common process.Primates- an example of changing technologyproducing changes in classificationThe primates include humans, the great apes, monkeys and prosimians.Based on anatomical evidence gorillas and chimpanzees were thought tobe closely related. Using molecular and genetic evidence such as DNA-DNA hybridization and haemoglobin analysis it was found that humansand chimpanzees were more closely related than gorillas and humans.This has led to changes in the classification system with some scientistsPart 4: How genes operate 37