June 09-41-2.indd - Kma.org.kw

More documents

Recommendations

Info

June 2009KUWAIT MEDICAL JOURNAL 119Table 1: The sequence of primers used in the project to amplify regions of the blaSHV and blaTEM ESBL genes, as well as the expectedsizes of the PCR ampliconsPrimer Sequence Gene Expected size of PCR productSHV-1SHV-2TEM-1TEM-25’ –CTGGGAAACGGAACTGAATG– 3’5’ –GGGGTATCCCGCAGATAAAT– 3’5’ –ATGAGTATTCAACATTTCCG– 3’5’ –CCAATGCTTATTCAGTGAGG– 3’blaSHVblaTEM308 bp858 bpby 32 cycles of successive alternating temperatures asfollows: denaturation step at 94 °C for one minute,annealing step at 57 °C for one minute, and extensionstep at 70 °C for one minute. A final extension stepat 72 °C for 10 minutes was allowed. On the otherhand, and for the TEM primers, the PCR mixturewas incubated for five minute at 95 °C as an initialdenaturation step, followed by 30 cycles of successivealternating temperatures as follows: denaturation stepat 94 °C for 30 seconds, annealing step at 55 °C for oneminute, and extension step at 70 °C for one minute. Afinal extension step at 75 °C for 10 minutes was alsoallowed. The PCR reaction for both sets of primerswas performed in a programmable PCR ThermalCycler (Perkin Elmer, Wellesley, MA, USA).RFLPTEM-specific PCR products were digestedby Sau3AI endonuclease using 10 μl of the PCRproduct without purification, according to therecommendation of the restriction endonucleasesuppliers (Promega, Ltd, UK). The followingamounts were used: 5 μl of restriction buffer (10 mMTris-HCL, pH 7.5, 60 mM NaCl, 7 mM MgCl2), 1 μlof BSA (0.1mg/l), 1 μl of restriction enzyme and 4 μlof sterile distilled water. Digestion was carried outfor four hours at 37 °C. For SHV, PCR products weredigested with 10 U/μl of NheI restriction enzyme(Promega, Ltd, UK), 5 μl of restriction buffer (10mM Tris-HCL, pH 7.5, 60 mM NaCl, 7 mM MgCl2),1 μl of BSA (0.1mg/l), 4 μl of sterile distilled waterand 40 μl of the amplified PCR product. Digestionwas carried out for a maximum of four hours at37 °C. Restriction pattern of PCR products forboth sets of primers were analyzed by agarose gelelectrophoresis, using 2% agarose in 1X Tris acetateEDTA (TAE) buffer, which were then stained withethidium bromide and visualized by exposureto UV light in a gel documentation system (UVPCompany, Upland, CA, USA). A DNA marker fromSigma (Sigma-Aldrich, Inc., Saint Louis, MI, USA)was run on the gel along with the PCR amplicons toidentify the sizes of these amplicons.DNA sequencingDNA sequencing was performed on 10randomly selected bacterial isolates out of the 40isolates included in this project as representativesof the whole group PCR products for the SHVgene, obtained from the PCR step above and weretaken for sequencing. These products were firstcleaned by ethanol precipitation; 25 μl of templatesuppression reagent (TSR) was added to the pellet,mixed, and finally heated for two minutes at 95 o C.For sequencing PCR, one microliter of each PCRproduct from the previous step was mixed with3.2 picomol of either a forward (5’-CTG GGA AACGGA ACT GAA TG-3’) or a reverse primer (5’-GGGGTA TCC CGC AGA TAA AT-3’), and 8 μl of a dyeterminator ready sequence reaction mix (Prism TMReady Reaction Dye-Deoxy TM Terminator CycleSequencing Kit, Perkin Elmer, Wellesley, MA, USA).The sequencing PCR reaction was then carried outin the Thermal Cycler programmed to 30 cycles of96 o C for 20 seconds, 50 o C for 20 second, and 60 o Cfor four minutes. The products were cleaned again asmentioned above, and the products were kept on icetill the sequencing was run on an automated DNAsequencer (AB13100, Applied Biosystem, Foster City,CA, USA). Sequences results were analysed by theBLAST online search engine (http://www.ncbi.nih.gov/cgi-bin/BLAST), with the susceptible strainssequences in the database.RESULTSPCR amplicons were produced successfullyin all DNA samples included in this project. Theamplified products obtained with primers specificfor both blaTEM and blaSHV were 858 bp and 308bp, respectively, which were the expected productsizes of the amplified gene with the set of primersused. That was true whether the DNA was extractedby the two simple methods described here, or usingthe commercial kit. Figure 1 shows a photograph ofagarose gel electrophoresis of these PCR amplicons.In the RFLP step, NheI restriction endonucleasewas used to cleave the SHV-specific PCR product,while Sau3AI restriction endonuclease was used tocleave the TEM-specific PCR. The results of all therestricted PCR products (SHV or/and TEM) were asexpected for each restriction enzyme. The patterns ofcutting were similar whether the DNA was extractedby the two methods introduced by the authors, orusing the commercial kit (Fig. 2 and 3).
120Heat Treatment of Bacteria: A Simple Method of DNA Extraction for Molecular TechniquesJune 2009Fig. 1: Agarose gel electrophoresis showing the 858-bp and 308-bp PCR amplicons for TEM and SHV, respectively. Lanes 7 and 8show positive and negative PCR amplicons for TEM, respectively,while lanes 5 and 4 show positive and negative PCR ampliconsfor SHV, respectively. Lanes 9 and 3 shows PCR products for TEMand SHV, respectively, from DNA extracted using microwavemethod. Lanes 10 and 2 show PCR products for TEM and SHV,respectively, from DNA extracted using boiling method. Lanes11 and 1 show PCR amplicons for TEM and SHV, respectively,from DNA extracted using the commercial kit. Lane 6 has a DNAmarker.Fig. 2: Digestion of TEM PCR products with Sau3AI endonuclease.Sau3AI cuts the 858-bp amplicons into fragments with thefollowing sizes: 341, 258, 105, 46, 37, 36, 18 and 17 bp. Sizes lessthan 50-bp could not be demonstrated on the agarose gel usedhere. Lane 6 show digestion of TEM PCR amplicon from DNAextracted using the microwave irradiation method. Lanes 4 and5 show digestion of TEM PCR amplicons from DNA extractedusing the boiling method. Lane 3 shows digestion of TEM PCRamplicons from DNA extracted using the commercial kit. Lane2 contains a positive control, while lane 1 has a 100-bp DNAmarker.Fig. 3: Digestion of SHV PCR products with NheI endonuclease.The presence of Gly238Ser mutation creates a restriction site forthe NheI, cutting the PCR amplicons (308-bp) into 218- and 90-bp fragments. Lanes 7 to 9 contain PCR amplicons from DNAsamples extracted using the microwave irradiation method.Lanes 4 to 6 contain PCR amplicons from DNA samples extractedusing the boiling method. Lane 3 contains a PCR amplicon from aDNA sample extracted using the commercial kit. Lane 2 containsa positive control, while lane 1 has a 100-bp DNA marker.The automated analysis of the sequenced SHVPCR products showed the expected nucleotidesequences in all the 10 representative bacterial isolates.Moreover, four out of the 10 isolates were found tohave a Gly238Ser mutation that is characteristic ofSHV-2 ESBL; while the rest of the isolates harbouredthe Gly238Ser mutation as well as a Glu240Lysmutation; presence of both is characteristic of SHV-5 ESBL (Fig. 4). That was true in all the three DNAextraction methods used in this project.DISCUSSIONMolecular biology techniques to study bacterialDNA (like PCR, RFLP, and DNA sequencing) usuallyneed DNA extraction and purification from thebacteria with a high quality for perfect performance.However, present DNA purification procedures,especially the commercial ones, are costly, laboriousFig. 4: DNA sequencing results showing the SHV2 and SHV5mutations (Gly238Ser and Gly238Ser + Glu240Lys, respectively).and need a large number of reagents and equipment.Several researchers have tried to liberate DNA frombacterial cells by breaking bacterial cell walls usingcertain reagents, especially by enzymatic treatmentwith lysosymes and proteases [5,7,9,10-14] . However,Agersborg reported that lysozyme and proteinaseK treatment, was not always sufficient to hemolysecertain cells [7] . On the other hand, Merk et al foundprotienase K to be superior to other methods inextracting DNA [14] . Other researchers have tried othersynthetic lysing solutions like SDS (sodium dodecylsulfate), TWEEN20 [8] , Triton X-100 [7] and guanidineisothiocyanate (GITC) [5,10,14] . GITC was reported tobe able to damage cells with hard walls like fungi.Besides chemical methods, several researchers havesuccessfully extracted bacterial DNA using physicalpower; for example, forceful rupture of cells wasachieved by vortexing suspensions of cells [8] , orbeating cells with beads [12] or ultrasound waves [27] .Moreover, certain glass or iron beads were used tocapture DNA molecules, which could later be elutedand separated [9,17-18] . Other physical powers werealso used, like high or low temperatures. Heating
Page 2 and 3: Vol. 41 No. 1KUWAIT MEDICAL JOURNAL
Page 4: KUWAIT MEDICAL JOURNALKUWAIT MEDICA
Page 8 and 9: June 2009KUWAIT MEDICAL JOURNAL 91E
Page 10 and 11: June 2009KUWAIT MEDICAL JOURNAL 93R
Page 12 and 13: June 2009KUWAIT MEDICAL JOURNAL 95O
Page 14 and 15: June 2009KUWAIT MEDICAL JOURNAL 97c
Page 16: June 2009KUWAIT MEDICAL JOURNAL 99p
Page 20 and 21: June 2009KUWAIT MEDICAL JOURNAL 103
Page 74 and 75: June 2009400 mg/kg/day for five day
Page 86 and 87:
March 2009KUWAIT MEDICAL JOURNAL 16
Page 88 and 89:
June 2009KUWAIT MEDICAL JOURNAL 171
Page 90 and 91:
Page 92 and 93:
Page 94 and 95:
Page 96 and 97:
Page 98 and 99:
Page 100 and 101:
show all

June 09-41-2.indd - Kma.org.kw

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?