Compuestos azufrados volátiles en vinos - Fundación para la ...

Organizan:Seminario TécnicoCompuestos azufradosvolátiles en vinosProblemas de reduccióny aromas varietalesTarragona, 23 de abril de 2009Madrid, 24 de abril de 2009Colaboran:

01. Relación entreel contenidonitrogenado enmosto/uva y lasíntesis de aromas:efecto sobre laproducción desulfhídricoProf. Gemma BeltranUniversidad Rovira i VirgiliProf. Jose Manuel GuillamónUniversidad Rovira i VirgiliInstituto de Agroquímica y Tecnología deAlimentos IATA-CSICContenido6 Resumen6 1. Introducción7 2. Efecto de la concentración y tipo denitrógeno sobre el crecimiento de laslevaduras y su cinética fermentativa.9 3. Efecto de la concentración y tipo denitrógeno sobre la cinética fermentativa10 4. Relación entre el contenido en nitrógeno yla síntesis de compuestos aromáticos15 Bibliografía

Seminario TécnicoCompuestos azufrados volátiles en vinosJosé M. Guillamón NavarroRequena, 6 de julio de 1967.e-mail: guillamon@iata.csic.esInvestigación:Coautor de 50 artículos científicos en revistas internacionalesde las áreas de Tecnología de Alimentos, Biotecnologíay Microbiología. Coautor de 20 artículos enrevistas de divulgación del sector agroalimentario y vitivinícola.80 comunicaciones a Congresos nacionalese internacionales, 24 de ellas como ponente invitado ocomunicación oral. Autor de 5 capítulos de libros especializadosy 37 capítulos en libros de congresos. Autorde 3 patentes de levaduras vínicas en explotación. Directorde 3 tesis doctorales (2 de ellas con formato dedoctorado europeo)Líneas de Investigación• Estudio del metabolismo de las levaduras encondiciones de fermentación vínica. Efecto de lasbajas temperaturas de fermentación y del metabolismodel nitrógeno.• Estudio de las poblaciones de levaduras y bacteriasacéticas durante los procesos de elaboraciónde vino. Utilización de marcadores molecularespara la caracterización e identificación de los microorganismosdel vino.Estancias en Centros Extranjeros:• Estancia post-doctoral en la Universidad de Utrecht(junio del 1998 a mayo del 1999).• Estancia post-doctoral en el “Institute for WineBiotechnology (Stellenbosch University)” enStellenbosch (Sudáfrica) (septiembre del 2004 amarzo del 2005).Gemma Beltran Casellas31 de octubre de 1975Posición actual:• Profesora ayudante doctor del Departamento deBioquímica y Biotecnología de la Universidad Rovirai Virgili, Facultad de Enología, desde diciembredel 2007.• Miembro del grupo de investigación de BiotecnologíaEnológica de la Facultad de Enología dela URV, dentro de la línea de estudio de las levadurasvínicas.A lo largo de su carrera investigadora Gemma Beltranha colaborado en proyectos sobre el estudio las levadurasy sus requerimientos nutricionales, analizandolos factores que pueden condicionar a una mejora enla fermentación alcohólica, tanto los que se derivandel mosto (niveles de nitrógeno disponible) como devarias prácticas enológicas (fermentaciones a bajastemperaturas, rehidratación). Sus investigaciones predoctoralesse centraron principalmente en el estudiola represión catabólica por nitrógeno a lo largo de lafermentación (Beltran et. al. 2004, 2005), así cómo enel efecto de las bajas temperaturas de fermentaciónsobre los cambios en la expresión génica global y elmetabolismo de la levadura vínica (Beltran et al. 2006,2007, 2008). Además, en su estancia post-doctoral realizadaen el grupo de Biología Molecular de levadurasdel profesor Stefan Hohmann (Suecia), estuvo involucradaen estudios de señalización de nutrientes, enconcreto estudiando el metabolismo de la tiamina y laruta de la represión catabólica por glucosa, como partede un proyecto europeo de investigación.Gemma Beltran es autora o co-autora de un total de15 publicaciones internacionales y 9 publicaciones nacionales,ha participado en un total de 12 proyectosinvestigación o contratos de transferencia, asistido a22 congresos científicos, dirigido tesis de master y estáactualmente dirigiendo una tesis doctoral.Actualmente es profesora de Bioquímica y MicrobiologiaEnológica en la Facultad de Enología, y desde sureincorporación al grupo de Biotecnología Enológicade la URV en diciembre de 2007 ha estado colaboradoen proyectos de investigación y transferencia conel sector vitivinícola, centrándose nuevamente en elestudio de los requerimientos nitrogenados de las levadurasvínicas de primera y segunda fermentación.5Ponencias

Seminario TécnicoCompuestos azufrados volátiles en vinostrógeno asimilable de manera aleatoria, sino que tieneun orden de preferencia por los distintas fuentesde nitrógeno. S. cerevisiae ha desarrollado diferentesmecanismos moleculares que le permiten utilizar preferentementeaquellas fuentes que le permiten crecermejor. Este mecanismo de selección de la fuente denitrógeno se conoce como “Represión Catabólica porNitrógeno (NCR). El NCR se caracteriza porque la célulaes capaz de detectar la presencia de las fuentes denitrógeno más ricas. Esto desencadena una cadenade señales, que culmina con la activación de los genesimplicados en el transporte y metabolismo de estasfuentes ricas y en la represión de aquellos genes implicadosen el transporte y utilización de fuentes máspobres. Una vez consumida las fuentes de nitrógenomás ricas (amonio, glutamina y asparagina), la levaduraactiva la maquinaria metabólica para la utilizaciónde las más pobres (arginina, glutamato, alanina, etc.)(Figura 1).Sin embargo, la importancia del nitrógeno no resideexclusivamente en ser necesario para la formación debiomasa. El contenido en nitrógeno también tieneuna influencia clara sobre la velocidad fermentativa(Taillandier et al., 2007). La mayor parte de la fermentaciónalcohólica se produce en una fase de no proliferacióncelular o estacionaria. En este punto el nitrógenodel medio es utilizado para el recambio proteicode los diferentes enzimas celulares. Por último, estecontenido en nitrógeno tiene una influencia manifiestaen los diferentes metabolitos producidos durante lafermentación, muchos de ellos con un impacto muyclaro en el aroma del vino. A continuación trataremosen mayor profundidad los diferentes aspectos de lafisiología y metabolismo celular que se ven afectadostanto por la cantidad como por la calidad del nitrógenodel mosto. Especial hincapié dedicaremos a lasíntesis de aromas de reducción o producción de SH2y otros compuestos derivados del metabolismo delazufre.2. Efecto de la concentración y tipo denitrógeno sobre el crecimiento de laslevaduras y su cinética fermentativa.Varela y cols. (2004) propusieron que la velocidad defermentación depende por un lado del estado metabólicode las células y por otro del número de célulasalcanzados durante la fermentación alcohólica. Dichode otro modo, de la viabilidad (número de célulasfermentando) y la vitalidad de cada una de estas células.Ambos componentes tienen una dependenciaimportante del nitrógeno disponible en el mosto. Eneste punto nos vamos a centrar en como afecta el nitrógenoa la división celular o producción de biomasay en el siguiente apartado abordaremos como afectaa la vitalidad o actividad celular.En un trabajo reciente de nuestro grupo hemos comprobadocomo el nitrógeno es el substrato limitantedel crecimiento celular hasta alcanzar valores cercanosa los 200 mg/l, aunque esto depende de la fuentede nitrógeno utilizada. Para ello hacíamos crecer laslevaduras en un mosto sintético (similar al natural)donde iba cambiando únicamente la concentraciónde N y el tipo de fuente de N. Como puede verse en lafigura 2, el número de células o biomasa (medido porla densidad óptica (O.D.) a 595 nm) iba aumentandoconforme aumentaba la concentración de nitrógeno,en este caso en forma de arginina como única fuentede nitrógeno. Esto fue así hasta niveles de 180 mg deFigura 1. Representación gráfica del mecanismo de“Represión Catabólica por Nitrógeno (NCR)” según Cooper (2002)7Ponencias

01. Relación entre el contenido nitrogenado en mosto/uva y la síntesis de aromas: efecto sobre la producción de sulfhídricoque la mayor parte de la fermentación alcohólica seproduce en la fase estacionaria o de no proliferacióncelular. A pesar de que durante este periodo no haymultiplicación celular, las levaduras necesitan nitrógenopara mantener su metabolismo activo. El medio defermentación es un ambiente cambiante y hostil querequiere una readaptación continua para las nuevascondiciones. Esta readaptación al medio supone unrecambio proteico continuo en la maquinaria enzimáticacelular. Para este recambio de proteínas celulares,es necesaria la disponibilidad de nitrógeno enel medio de fermentación. Taillandier y col. (2007) establecieronla cantidad de nitrógeno consumido porla levadura por gramo de azúcar consumido (mg N/gde glucosa o fructosa). Como siempre hay que contarcon las diferentes necesidades de las distintas cepas,esta cantidad tenía un rango de 0,61 a 0,91 mg de Npor gramo de azúcar. Es decir, una relación mg N/gazúcar prácticamente asegura cubiertas las necesidadesnitrogenadas y es una relación muy sencilla para elenólogo poder calcular las diferentes necesidades desus mostos. Una relación similar establecieron Bissony Butzke (2000), pero en este caso, entre necesidad deN asimilable frente a grado alcohólico probable (GAP)(figura 7).Figura 7. Relación entre grado alcohólico probable(GAP) y cantidad necesaria de N asimilable (mg deN/l) para alcanzar dicha cantidad (Bisson y Butzke,2000).Sin embargo, el aumento de la cinética fermentativano debe ser solo entendido por la disponibilidad denitrógeno para facilitar el recambio proteico celular,sino que se ha demostrado que algunas fuentes denitrógeno, en concreto el amonio, pueden actuarcomo activadores de la actividad de enzimas glucolíticosclaves. En concreto, se ha visto un incrementoimportante del transporte de azúcares por activaciónde las permeasas implicadas (genes HXT) (Bely et al.,1990). Taillandier y cols (2007) también informaronde una mayor actividad fructofílica (mayor consumode la fructosa frente a la glucosa) de la levaduraen presencia de mayor concentración de nitrógeno,probablemente por un cambio en la afinidad de lostransportadores de hexosas. Igualmente, Berthels ycols (2004) observaron una activación del enzima fosfofructoquinasa,enzima clave de la glucolisis, con laadición de amonio.4. Relación entre el contenido ennitrógeno y la síntesis de compuestosaromáticosAdemás del efecto sobre el crecimiento, la disponibilidadde nitrógeno también tiene un efecto importantesobre el metabolismo de las levaduras, afectando laformación de compuestos volátiles y no volátiles, loscuales son de gran importancia para las calidades organolépticasdel vino final (revisado por Alberts y col.1998, Bell y Henkschke, 2005). La concentración decompuestos no volátiles como son el glicerol, el ácidomálico, ácido succínico o ácido alfa-cetoglutárico,puede variar dependiendo de la cantidad y la fuentenitrogenada presente en los mostos. Alberts y col.(1996) observaron, por ejemplo, que la concentraciónde glicerol es mayor cuando la ratio nitrógeno amoniacalrespecto al nitrógeno orgánico representadopor los aminoácidos. En un trabajo de nuestro grupo(Beltran y col. 2005) observamos que la concentraciónde glicerol disminuye en fermentaciones con limitaciónde nitrógeno. Esto demuestra que la producciónde glicerol es directamente proporcional a la producciónde biomasa.Muchos de los compuestos volátiles, que son los quecontribuirán al aroma final del vino, también están afectadospor el tipo y/o concentración de nitrógeno disponiblepara la levadura. Los compuestos mayormenteafectados son el ácido acético, los alcoholes superiores,los ácidos grasos de cadena media y corta y sus ésteresetílicos, y los esteres de acetato. En la Figura 8 vemosrelación entre la acumulación de algunos compuestosvolátiles y la concentración inicial de nitrógeno envinos producidos a partir de mosto sintético con doscepas Saccharomyces cerevisiae (resultados obtenidospor Carrau y col. 2007). De este trabajo se desprendeque hay una relación inversa entre crecimiento (o disponibilidadde nitrógeno) y producción de alcoholessuperiores. Mientras que la mayor presencia de nitrógenoparece estimular una mayor producción de ésteres.Sin embargo, los resultados de este trabajo demuestranque la concentración óptima de nitrógeno parala síntesis de ésteres depende de la cepa en cuestión.La cepa KU1 producía su máxima concentración deésteres para una concentración de nitrógeno muchomenor que la cepa M522. Esta última tenía una mayorproducción de estos compuestos.La carencia en nitrógeno en los mostos es generalmentesubsanada mediante adiciones de sales deamonio. En la Tabla 1 y Figura 9 observamos cómoafecta también el momento de la suplementación denitrógeno a la producción de algunos de estos compuestos.10

El contenido en ácido acético varía según la concentraciónde nitrógeno en el medio, habiendo una relacióninversa entre la cantidad de ácido acético producido yla disponibilidad de nitrógeno a concentraciones bajaso moderadas de nitrógeno, pero una relación directaa concentraciones altas (Bely y col. 2003, Hernandez-Orte y col. 2006). De hecho, trabajos de Beltran y col.(2005) y de Vilanova y col. (2007) muestran que a mayordisponibilidad y consumo de nitrógeno por parte dela levadura, mayor producción de ácido acético (Figura9). Esta mayor producción de acético a mayores concentracionesde nitrógeno puede estar relacionadacon una mayor tasa de crecimiento. El acético es producidopor las levaduras como substrato para la síntesisde ácidos grasos, un mayor crecimiento podría justificaruna mayor síntesis de acético. Otra posibilidad esque siempre hay una relación directa entre síntesis deglicerol y de acético. Por tanto, a concentraciones altasde nitrógeno se produce más glicerol y, por tanto, másacético. Resultado similar se observó con la producciónde acetaldehído.Los alcoholes superiores pueden aportar aromas pesadosy desagradables a los vinos si se encuentran enSeminario TécnicoCompuestos azufrados volátiles en vinosconcentraciones muy altas (excluyendo el 2-feniletanol,que tiene aroma floral). Existe una relación inversaentre el contenido en alcoholes superiores y la concentracióninicial de nitrógeno, excepto por concentracionesmuy bajas de nitrógeno (Beltran y col. 2005,Vilanova y col. 2007, Carrau y col. 2008). Los alcoholessuperiores se pueden formar a partir de aminoácidos(via de Ehrlich) o a partir del catabolismo de los azúcares(via anabólica) (Figura 10). Esta última es la principalvía de producción de alcoholes superiores durante lafermentación alcohólica. Cuando hay poco nitrógenodisponible en el medio, hay un aumento en la síntesisde alpha-cetoácidos a partir de azúcares. Estos alfacetoácidosson los precursores en la síntesis de aminoácidos,pero la escasez de nitrógeno alfa-amíniconecesario en la reacción de transaminación, hace quelos alfa-cetoácidos formados se acaben excretando enel medio en forma de alcoholes superiores, sin llegara formar los aminoácidos necesarios. Sin embargo, enun medio con alto contenido en nitrógeno, el nitrógenodisponible permite la biosíntesis de aminoácidos,lo que reduce el exceso de alfa-cetoácidos y por tantola producción de alcoholes superiores (Oshita y col.,1995).PonenciasFigura 8. Relación entre la acumulación dealgunos compuestos volátiles y la concentracióninicial de nitrógeno en vinos producidos a partirde mosto sintético con dos cepas Saccharomycescerevisiae (cepa M522 (•) y cepa KU1 ()).(Carrau y col., 2008)11

01. Relación entre el contenido nitrogenado en mosto/uva y la síntesis de aromas: efecto sobre la producción de sulfhídricoTabla 1. Relación entre el momento de la adición de nitrógeno y la producción de metabolitos secundariospor la levadura. Las fermentaciones se realizaron con mosto sintético limitante en nitrógeno (60 mg/lYAN), al que se añadió 240 mg/l de nitrógeno (mezcla amonio y aminoácidos) en distintos momentos defermentación (densidad 1080 g/l o inicio, 1060, 1040, 1020, 1000 g/l y no suplementado). (Beltran y col. 2005)Figura 9. Relación entre la concentración demetabolitos secundarios (normalizados con elvalor de mayor producción en cada caso) y elmomento de la suplementación de nitrógeno.Las fermentaciones se realizaron con mostosintético limitante en nitrógeno (60 mg/l YAN),al que se añadió 240 mg/l de nitrógeno (mezclaamonio y aminoácidos) en distintos momentosde fermentación (densidad 1080 g/l o inicio, 1060,1040, 1020, 1000 g/l y no suplementado).Figura 10. Ruta de síntesis de alcoholes superioresa partir de aminoácidos (via de Ehrlich) o a partirde los azúcares (via anabólica)GlucosaPiruvatoVíaanabólicaodesíntesisNADHNADCOOHCOOH+HH C NH 2H C OH C OH C OHRNHRRR3 CO 2Aminoácido ‐Aldehido AlcoholsuperiorcetoácidoDesaminación Descarboxilación ReducciónViadeEhrlich:viacatabólicadeaas 12

Este efecto ha sido observado experimentalmentepor distintos trabajos. Carrau y col. (2008) muestranclaramente que la cantidad de alcoholes superioresdisminuye con el aumento de nitrógeno disponible,aunque se observa el efecto inverso en la producciónde 1-propanol (Figura 8d, 8e). Estos hechos tambiénfueron observados en estudios realizados por nuestrogrupo de investigación (Tabla 1, Figura 9). En ellosvimos que la síntesis de alcoholes superiores disminuyecuando un mosto limitante en nitrógeno se suplementadurante la fase exponencial de crecimientode las levaduras, disminuyendo así su periodo de limitación,y lo que lleva también a un mayor consumototal de nitrógeno que si se suplementa en fases mástardías de la fermentación. Por otro lado, si el nitrógenoes adicionado en fase estacionaria, después de unlargo periodo de limitación, el contenido en alcoholessuperiores aumenta considerablemente.Los esteres de etilo y de acetato muestran una relaciónmás compleja con la disponibilidad de nitrógeno,debido a sus distintos orígenes de síntesis, pero,en la mayoría de los estudios, el acetato de etilo y losesteres de acetato están relacionados positivamentecon la concentración de nitrógeno del medio.4.1 Relación entre el contenido ennitrógeno y la síntesis de compuestosazufradosLas levaduras vínicas pueden formar H2S a partir decompuestos de azufre inorgánicos (sulfato o sulfito), ocompuestos orgánicos azufrados (cisteína o glutatión).Normalmente el mosto es deficiente en compuestosorgánicos azufrados, y esto puede llevar a la levaduraa sintetizar algunos de estos compuestos a partir defuentes inorgánicas, normalmente abundantes en elmosto. En Saccharomyces cerevisiae, la producciónde H2S es el producto de la ruta de la secuencia dereducción del sulfato (SRS), y es un intermediario en labiosíntesis de los aminoácidos azufrados (metionina,y cisteína). (Figura 11).Varios factores ambientales y nutricionales se han asociadocon la producción de H2S en condiciones de vinificación:la cepa de levadura utilizada, la cantidad deazufre presente en los mostos (ya sea en forma de sulfitoo de sulfato), la carencia de vitaminas, y la carenciao disponibilidad de nitrógeno. Varios estudios se hancentrado en analizar este último punto, el impacto delnitrógeno en la formación de aromas de reducción oazufrados.Para la biosíntesis de los aminoácidos azufrados (cisteínay metionina) se requiere por un lado esqueletosde carbono que contengan nitrógeno (O-AH: O-acetilhomoserina, O-AS: O-acetilserina), los cuales derivande un pool intracelular de nitrógeno, y por otrolado sulfito, que deriva de la ruta de reducción delSeminario TécnicoCompuestos azufrados volátiles en vinosFigura 11. Ruta de síntesis de H2S a través de lasecuencia de reducción del sulfato (SRS) y la rutade biosíntesis de aminoácidos azufrados (metioninay cisteína) en S. cerevisiae. Adenosyl 5’-fosfosulfato(APS), 3’-fosfoadenosil 5’-fosfosulfato (PAPS),O-acetilserina (O-AS), O-acetilhomoserina (O-AH).(Swiegers y Pretorius, 2007)sulfato. En carencia de nitrógeno, disminuye el poolde nitrógeno intracelular y por tanto la síntesis de losprecursores nitrogenados O-AS y O-AH, con lo que elsulfito producido no podrá utilizarse para la síntesis deaminoácidos y se excretará en forma de ácido sulfhídrico(SH2). Así pues, el ratio de formación del H2S pareceestar regulado por los requerimientos celularesde aminoácidos azufrados, y por el mantenimiento delos pools de nitrógeno intracelular.Jiranek y col. (1995) observaron que en fermentacionesvínicas existe una relación directa entre la limitaciónde nitrógeno y la síntesis de sulfhídrico. Algunosde sus resultados se muestran el la Figura 12 y Tabla2. En la Figura 12 observamos que la producción desulfhídrico por parte de la levadura aumenta en elmomento en que el nitrógeno del medio se consume(en presencia de sulfito). Este efecto es mucho máspronunciado en fase exponencial de crecimiento,cuando la levadura tiene más requerimientos nitrogenados,que en fase estacionaria, donde disminuyenlas necesidades nitrogenadas, y también la producciónde sulfhídrico. Estos autores relacionaron tambiéneste aumento en la producción con la actividadsulfito reductasa, la cual es mayor en fase exponencialde crecimiento.Por otro lado, si un medio limitante en nitrógeno sesuplementa con amonio o con la mayoría de aminoácidos,la producción de sulfhídrico disminuye. Peroeste no es el caso de los aminoácidos azufrados (principalmenteCisteína, de manera individual o en combinacióncon Metionina), la adición de los cuales dalugar a un aumento incluso mayor en la producciónde H2S por parte de las levaduras (Tabla 2). Esto es debidoa la liberación del sulfhídrico como subproductoPonencias13

01. Relación entre el contenido nitrogenado en mosto/uva y la síntesis de aromas: efecto sobre la producción de sulfhídricoFigura 12. Relación entre la producción de H2Sy el momento en que se produce la limitaciónde nitrógeno durante la fermentación. Lasfermentaciones se realizaron con la cepa AWRI77en mosto sintético con distintas concentraciones denitrógeno inicial: 3.3 (◦), 16.6 () o 24.9 (•) mM.Las flechas indican el momento en que se añadiósulfito (132 μM) a los medios, 1 hora antes delconsumo total de nitrógeno. (Jiranek y col. 1995)Tabla 2. Producción de H2S por parte de lalevadura AWRI77, 6 horas después de habersuplementado un medio limitante en nitrógenocon aminoácidos o amonio de manera individual.La suplementación se realizó una hora antes deque el nitrógeno inicial fuera consumido. Los datosestán normalizados al valor obtenido por el cultivosuplementado con amonio (Jiranek y col. 1995)de la degradación / transaminación de estos aminoácidospara ser utilizados como fuente de nitrógeno.En un trabajo reciente, Mendes-Ferreira y col. (2009)analizaron en varias cepas la relación entre la concentraciónde nitrógeno en el medio y la producción devarios compuestos aromáticos, entre ellos el ácidosulfhídrico. Los resultados obtenidos variaban entrelas distintas cepas, la Figura 13 muestra los resultadosde la cepa UCD522, considerada alta productora desulfhídrico. La síntesis de H2S se produce en el momentoen que se consume el nitrógeno del medio,pero curiosamente el medio con una cantidad óptimade nitrógeno (267 mg/l), el cual se consume a las48 horas de fermentación, presenta valores mayoresque el medio muy limitante en nitrógeno (66 mg/l).El exceso de nitrógeno disminuye la producción desulfhídrico, pero este exceso puede provocar por otrolado la inestabilidad del vino y la producción de otroscompuestos indeseados.Pero el ácido sulfhídrico no es el único compuestoazufrado que podemos encontrar en los vinos, a partirde este compuesto se pueden formar mercaptanos otioles, algunos de los cuales aportan olores desagradablesa los vinos, los temidos caracteres de reducción.H2S es un compuesto altamente reactivo, y seFigura 13. Perfil de fermentación y de liberaciónde ácido sulfhídrico de la cepa UCD522 en mediosintético y con distintas concentraciones denitrógeno inicial: 66 mg/l (a), 267 mg/l (b) y 402mg/l (c). (Mendes-Ferreira y col. 2009)14

puede combinar con otros componentes presentesen el vino para formar otros compuestos volátilesazufrados (Vermeulen y col. 2005). Por ejemplo, la reaccióndel sulfhídrico con el etanol o el acetaldehídoda lugar a etil-mercaptano (con olor a cebolla o gasnatural), y por otro lado la formación de polisulfuros(dimetil disulfuro, dimetil trisulfuro y dimetil tetrasulfuro)proviene de la oxidación del metantiol, productode la degradación de la metionina (Swiegers y Pretorius,2007). La levadura puede luego reducir estoscompuestos disulfuro y formar mercaptanos, con lasconsecuencias organolépticas que esto supone.Sin embargo, a pesar de la mala popularidad que tienenlos compuestos aromáticos azufrados, no todos ellosaportan características negativas a los vinos, otros puedenllegar a contribuir positivamente, como es el casoSeminario TécnicoCompuestos azufrados volátiles en vinosde los tioles volátiles 4-mercapto-4-metilpentanona(4MMP), 3-mercaptohexanol (3-MH) y 3-mercaptohexilacetato(3MHA), los cuales forman parte de la identidadvarietal del vino, especialmente en los vinos de lavariedad Sauvingon Blanc. Estos compuestos azufradosvarietales, se originan por la levadura en fermentaciónalcohólica a partir de precursores tiolicos inodoros quecontienen moléculas de cisteína en su estructura (Swiegersy col. 2007). Thibon y col. (2008) demostraron queen Saccharomyces cerevisiae, la represión catabólicapor nitrógeno controla también la liberación de estostioles volátiles a lo largo de la fermentación, reprimiendoprobablemente las permeasas de aminoácidos quepermiten la entrada de estos precursores a la célula,y reprimiendo la expresión del gen IRC7, que codificapara el principal enzima involucrado en la bioconversiónde tioles (cistationa-β-liasa).PonenciasBibliografíaAlberts, E., C. Larsson, G. Liden, C. Niklasson, L.Gustafsson (1996) Influence of the nitrogen sourceon Saccharomyces cerevisiae anaerobic growth andproduct formation. Appl Environ Microbiol 62: 3187-3195Alberts, E., G. Lidén, C. Larsson, L. Gustafsson(1998) Anaerobic redox balance and nitrogen metabolismin Saccharomyces cerevisiae. Recent Res. Dev.Microbiol. 2:253-279.Bell, S.J., P.A. Henschke (2005) Implications of nitrogennutrition for grapes, fermentation and wine. Aust.J. Grape Wine Res. 11:242-295.Beltran, G., B. Esteve-Zarzoso, N. Rozes, A. Mas, y J.M. Guillamon. Influence of the timing of nitrogenadditions during synthetic grape must fermentationson fermentation kinetics and nitrogenconsumption. J Agric. Food Chem, 53: 996-1002,2005.Bely,M., Sablayrolles,J.M., Barre,P. (1990). Automaticdetection of assimilable nitrogen deficiencies duringalcoholic fermentation in oenological conditions.J.Ferment.Bioeng. 70, 246-252.Bely, M., A. Rinaldi, D. Dubourdieu (2003) Influenceof assimilable nitrogen on volatile acidity productionby Saccharomyces cerevisiae during high sugar fermentation.J. Biosci Bioeng. 96:507-512Bisson,L.F., Butzke,C.E. (2000). Diagnosis and rectificationsof stuck and sluggish fermentations. Am.J.Enol.Vitic. 51, 168-177.Carrau, F.M., K. Medina, L. Farina, E. Biodo, P.A.Henschke, E. Dellacassa (2008) Production of fermentationaroma compounds by Saccharomycescerevisiae wine yeasts: effects of yeast assimilable nitrogenon two model strains. FEMS Yeast Res. 8:1196-1207.Cooper,T.G. (2002). Transmitting the signal of excessnitrogen in Saccharomyces cerevisiae from the Torproteins to the GATA factors: connecting the dots.FEMS Microbiol.Rev. 26, 223-238.Hernández-Orte, P., J.F. Cacho, V. Ferreira (2002)Relationship between varietal aminoacid profile ofgrapes and wine aromatic composition. Experimetnswith model solutions and chemometric study. J. Agric.Food Chem. 50: 2891-2899.Jiranek V, Langridge P y Henschke PA (1995a) Regulationof hydrogen sulfide liberation in wine-producingSaccharomyces cerevisiae strains by assimilablenitrogen. Appl Environ Microbiol 61: 461–467.Mendes-Ferreira,A., Mendes-Faia,A., Leao,C.(2004). Growth and fermentation patterns of Saccharomycescerevisiae under different ammonium concentrationsand its implications in winemaking industry.J.Appl.Microbiol. 97, 540-545.15

01. Relación entre el contenido nitrogenado en mosto/uva y la síntesis de aromas: efecto sobre la producción de sulfhídricoMendes-Ferreira, A., C. Barbosa, V. Falcó, C. Leao,A. Mendes-Faia (2009) The production of hydrogensulphide and other aroma compounds by wine strainsof Saccharomyces cerevisiae in synthetic media withdifferent nitrogen concentrations. J. Ind. Microbiol.Biotechnol. DOI 10.10007/s10295-009-0527-xOshita, K., M. Kubota, M. Uchida, M. Ono (1995)Clarification of the relationship between fusel alcoholformation and amino acid assimilation by brewing fuselalcohol formation and amino acid assimilation bybrewing yeast using 13C-labeled amino acid. Proceedingsof the European Brewing Convention. Bruxelles,387-394.Swiegers J. H. y I. S. Pretorius (2007) Modulation ofvolatile sulfur compounds by wine yeast Appl MicrobiolBiotechnol 74:954–960Thaillandier, P., Ramon-Portugal, F., Fuster, A. yStrehaiano P. (2007) Effect of ammonium concentrationon alcoholic fermentation kinetics by wineyeasts for high sugar content. Food Microbiology 24:95-100.Thibon, C., P. Marullo, O. Claisse, C. Cullin, D. Dubourdieu,T. Tominaga (2008) Nitrogen catabolicrepression controls the release of volatile thiols bySaccharomyces cerevisiae wine fermentation. FEMSYeast Res. 1-11.Varela C, Pizarro F, Agosin E (2004) Biomass contentgoverns fermentation rate in nitrogen-deficient winemusts. Appl Env Microbiol 70:3392–3400.Vermeulen, C., L. Gijs, S. Collin (2005) Sensorial contributionand formation pathways of thiols in foods: areview. Food Rev. Int. 21:69-137.Vilanova, M., M. Ugliano, C. Varela, T. Siebert, I.S.Pretorius, P.A. Henschke (2007) Assimilable nitrogenutilisation and production of volatile and on-volatilecompounds in chemically defined medium bySaccharomyces cerevisiae wine yeasts. Appl. Microbiol.Biotechnol. 77:145-157.16

Seminario TécnicoCompuestos azufrados volátiles en vinosPonencias17

02. Los nuevos retosen microbiología delvino.Levaduras noproductoras de SH 2Isak S. PretoriusThe Australian Wine Research Institute, POBox 197, Glen Osmond, Adelaide, SA 5064,AustraliaContenido19 Resumen19 1. Introducción20 2. Control de la dinámica de la fermentaciónde la levadura para mejorar la calidad del vino21 3. Optimización de la fermentación22 4. Optimización de la calidad del vino: evitar laproducción de sabores y aromas indeseables23 5. Optimización de la calidad del vino: mejoradel aroma deseable, el sabor y el color24 6. Aumento de las opciones de los vinicultoresmediante el desarrollo de cepas de levadurasvinícolas mejoradas y novedosas25 7. Conclusiones y previsiones futuras25 8. Agradecimientos25 9. Lecturas complementarias

Professor I.S. (Sakkie) PretoriusManaging DirectorThe Australian Wine Research Institute Ltd, PO Box197, Glen Osmond, Adelaide, SA 5064, AustraliaTel.: +61-8-83036610; Fax: +61-8-83036601E-mail: Sakkie.Pretorius@awri.com.auSakkie Pretorius se licenció en la University of theOrange Free State (Sudáfrica) y obtuvo su doctoradoen genética molecular de levaduras , bajo la direccióndel Profesor Julius Marmur en el Albert EinsteinCollege of Medicine de New York en 1986. En la actualidades director gerente del Australian Wine ResearchInstitute, localizado en Adelaida. Es ademásprofesor asociado de la Universidad de AdelaidaSus investigaciones están centradas en la microbiologíay biotecnología del vino. Ha supervisado a 31estudiantes de Doctorado y 56 estudiantes de Masteren Ciencias. Ha publicado más de 200 artículosde investigación y capítulos de libros, impartido másde 500 lecciones magistrales y conferencias y es autorde 6 patentes.Defiende como principio que la investigación delvino debe perseguir en primer lugar el conocimiento,pero también responder a las necesidades deproductores y consumidores, tanto en la seleccióndel tema de investigación como en el diseño experimental.Cree que la investigación inspirada en labúsqueda de conocimiento de los principios fundamentalesy en las consideraciones de una aplicaciónfutura es la más poderosa dinamo del progresotecnológico y que con una mínima inyección de recursosobtiene una sustancial calidad mejorada delproducto, beneficios en la salud del consumidor yescaso impacto ambiental.Seminario TécnicoCompuestos azufrados volátiles en vinosResumenUn mundo sin levaduras, esos humildes hongos unicelularesque nos ayudan a confeccionar alimentos ybebidas, también nos negaría la capacidad de haceravanzar las fronteras de la ciencia y de la tecnología.La mayor parte de todo el abanico de funciones desempeñadaspor las levaduras es realizada por una solaespecie, la Saccharomyces cerevisiae. De todas sus funciones,esta levadura es bien conocida por su capacidadpara impulsar la transformación del mosto envino. Si bien la Saccharomyces cerevisiae es conocidacomo la levadura vinica, no se pueden considerar todassus cepas iguales, dadas sus diferencias en el desarrollode la fermentación y atributos organolépticos.En la enología moderna, donde es esencial disponerde fermentaciones rápidas y fiables para producir vinosestables en el tiempo y con estilo predeterminadoy una calidad predecible, se prefiere la inoculaciónen el mosto de cepas seleccionadas de Saccharomycescerevisiae. Actualmente seguimos profundizandoen el conocimiento de las interacciones asociadas conel vino que se producen entre nutrientes, precursoresde sabores derivados de la uva, condiciones de lafermentación y cepas específicas de levaduras. El presentedocumento aborda cómo los enologos puedengestionar correctamente la fermentación a través dela dinámica de las levaduras en los mostos con el finde optimizar su rendimiento y evitar el desarrollo desabores y aromas indeseables, y sacar partido de cepasespecializadas de levaduras de nuevo desarrolloy de las estrategias de inoculación para mejorar la generaciónde sabores.1. IntroducciónImagínese, si puede, un mundo sin levaduras. Imagíneseque se encuentra entre las muchas personasque asumen la comida y la bebida que hay en susmesas sin preguntarse cómo ha llegado hasta allí, tansana y rica. Imagínese un mundo sin nada para subirla masa al cocer el pan, sin nada con lo que hacercerveza, vino o bebidas de alta graduación. Imagínesetambién un mundo en el que nuestra capacidadpara hacer avanzar las fronteras de la ciencia y de latecnología en varios frentes de manera sana y relativamentebarata estuviera muy limitada. Y por últimoimagínese un mundo con muy pocas alternativas conlas que convertir los residuos agrícolas ricos en azúcaren bioetanol para el uso como fuentes de energía renovables.Si puede imaginarse todo eso, estará viendoun mundo en el que nuestro avance tecnológicoy nuestro patrón de utilización de energía, nuestragastronomía, jovialidad y buen estilo de vida se veríanafectados considerablemente.Lo que necesitamos y explotamos parar evitar talmundo inimaginable es un humilde hongo unicelularque durante milenios nos ha ayudado a confeccionarPonencias19

02. Los nuevos retos en microbiología del vino. Levaduras no productoras de SH 2alimentos y bebidas, y que en los últimos tiempos hasido moldeado por selección artificial para realizar unamás vasta, si cabe, variedad de funciones — primerocomo agente de fermentación vital en panificadoras,fábricas de cerveza, bodegas de vino y destilerías y,en los tiempos más recientes, como herramientacientífica en los laboratorios de investigación y comominifábricas para la producción de productos biotecnológicosde “bajo volumen y gran valor” tales comoenzimas, productos químicos, proteínas terapéuticasy otros productos farmacéuticos importantes comercialmente.Lo que es aún más increíble es que la mayoríade esta gama de diversas funciones es realizadapor una única especie de levadura, la Saccharomycescerevisiae. No obstante, de todas estas funciones yproductos, esta extraordinaria levadura es probablementemejor conocida por su capacidad para transformarla dulce, azucarada y poco sabrosa uva en elproducto distintivo y rico en sabor que conocemoscomo vino.Los términos levadura y fermentación provienen etimológicamentede palabras que se refieren al efectode “hervir” o “burbujear” producido cuando el azúcarse convierte bioquímicamente en alcohol etílico ydióxido de carbono, pero la fermentación producidapor las levaduras es mucho más que eso. De hecho,es la responsable de la mayoría de los cambios asociadoscon la biotransformación del mosto en vino – elaroma, el sabor, la sensación en el paladar, el color y lacomplejidad química son producidos por la levaduraconforme diversifica y amplía su mundo con los productosde su metabolismo.Tradicionalmente el vino se elaboraba con las de levadurasambientales que realizaban una fermentaciónespontánea; la inoculación deliberada de cultivos delevaduras puras es una técnica relativamente reciente.En la fermentación espontánea, existe una sucesiónde levaduras indígenas provcedentes del viñedo y dela bodega, pero las etapas finales están dominadas demanera invariable por cepas de Saccharomyces cerevisiaetolerantes al alcohol. Hace mucho tiempo estaimportante especie conocida universalmente comola levadura del vino, evolucionó su capacidad para fabricar,acumular, tolerar y, bajo ciertas condiciones decrecimiento, incluso consumir alcohol, mientras quesimultáneamente produce metabolitos que mejoranel sabor y el aroma, tan importantes en nuestra apreciaciónsensorial del vino. No obstante no todos losmiembros de la “tribu” Saccharomyces cerevisiae puedenconsiderarse “iguales”, dado que existen diferenciasen su robustez, rendimiento de la fermentación yen los atributos sensoriales que introducen en el vinoque las hacen únicas.En la vinicultura moderna, donde es esencial disponerde fermentaciones rápidas y fiables para producirhomogéneamente vino según unas especificacionesdefinibles de sabor, unos estilos predeterminados yuna calidad predecible, se prefiere la inoculación decepas seleccionadas de Saccharomyces cerevisiae enel mosto. Las funciones principales de estas cepasseleccionadas son establecer un dominio numéricoy metabólico en la fase temprana de la fermentacióndel vino y catalizar la conversión completa y eficientede los componentes de la uva a alcohol, dióxido decarbono y metabolitos que mejoran su sabor y aromasin desarrollar sabores y aromas indeseables.La elección de la cepa de levadura a inocular en el caldoy la gestión eficaz de las interacciones entre la levadura,el mosto y las condiciones de fermentación sonfactores importantes que determinan la duración dela fermentación y la composición química y las propiedadesorganolépticas de un vino. En los apartadossiguientes se aborda brevemente cómo los enólogospueden controlar la dinámica de la levadura en los caldospara optimizar el desempeño de la fermentacióny por tanto evitar el desarrollo de muchos sabores yaromas indeseables y cómo pueden aprovecharse decepas especializadas de reciente desarrollado paragestionar correctamente la fermentación del vino.2. Control de la dinámica de lafermentación de la levadura para mejorarla calidad del vinoA diferencia de las prácticas microbiológicas en otrossectores de la industria agroalimentaria, en enologíalos microorganismos asociados con las uvas, otrasmaterias primas y la maquinaria de procesamientopueden entrar en el proceso de fermentación e influiren su eficacia y en la calidad del producto. Las uvasalbergan una gran variedad de levaduras y bacteriasepifíticas y, dependiendo de la adición de sulfitos,la temperatura de la uva, el tiempo empleado en eltransporte a la bodega, el estado higiénico de las maquinariade procesamiento de la uvas y los procedimientosde premaceración, prensado y clarificación,así será la proporción de levaduras que sobreviven enel zumo o mosto. Estas levaduras pueden proliferar enel zumo o mosto junto con los microorganismos asociadosal equipo de procesamiento dependiendo delas condiciones fisicoquímicas y de nutrientes.Las etapas tempranas de la fermentación son dominadashabitualmente por especies poco fermentativascomo la Hanseniaspora uvarum (anamorfo de Kloeckeraapiculate), debido a su gran tamaño poblacionalinicial. Con una prevalencia numéricamente inferior aestas levaduras existen especies de Candida, Cryptococcus,Debaryomyces, Dekkera (anamorfo de Brettanomyces),Issatchenkia, Kluyveromyces, Metschnikowia,Pichia, Rhodotorula, Saccharomycodes, SchizoSaccharomyces,Torulaspora y ZygoSaccharomyces. Algunasde las levaduras mejor adaptadas no pertenecientesal género Saccharomyces tienden a reemplazar a lasespecies débilmente fermentativas, pero finalmente20

son también reemplazadas por las Saccharomyces, yaque éstas últimas están mejor adaptadas al elevadocontenido etílico y las condiciones anaeróbicas delmosto o zumo en fermentación. Saccharomyces cerevisiaees habitualmente la levadura dominante en lamayoría de las regiones vinícolas del mundo, si bienla especie criotolerante Saccharomyces bayanus es ladominante más frecuente en las regiones más frías.Saccharomyces paradoxus se encuentra en varias regionesfrías de Europa del Este.Los tratamientos de clarificación y la aplicación de sulfitoshabitualmente reducen el número de levadurasindígenas y, si inocula un cultivo vigoroso activador,éste dominará a la microflora indígena. Sin perjuiciode lo anterior, el uso subóptimo de sulfitos antes de lafermentación puede, por ejemplo, afectar a la eficaciade la fermentación y a la calidad del vino. Si las condicioneslo permiten, la Hanseniaspora uvarum indígenapuede desarrollarse rápidamente y eliminar nutrientesimportantes del mosto. Por ejemplo, la tiamina, la cuales esencial para que las Saccharomyces produzcanetanol eficazmente, puede consumirse rápidamente.La Hanseniaspora uvarum puede también generarsabores y aromas no deseables, especialmente ácidoacético y acetato de etilo. Los lactobacilos tambiénse pueden multiplicar rápidamente y producir ácidoacético junto con otros compuestos antagonistas delas levaduras, de modo que ralentizan o paran la fermentación.Con el reciente descubrimiento de quela Dekkera bruxellensis puede estar presente en lasuvas, al menos en la región de Burdeos, la entrada deesta levadura contaminante en la corriente del vinoahora es más obvia. Además, el uso de sulfitos aparentementeno afecta a su establecimiento durante lafermentación dado que posee una tolerancia relativamentealta a este agente antimicrobiano.A pesar de que los caldos en fermentación espontáneos(levaduras “naturales”, “salvajes” o “silvestres”) habitualmentetardan más en fermentar que los inoculados(y habitualmente más de lo que la mayoría de losvinicultores están dispuestos a aceptar) y a pesar deque el resultado de un mosto en fermentación espontáneano siempre es predecible, no existe consensoentre los vinicultores del mundo sobre si es mejor usarcultivos iniciales o dejar la fermentación espontánea.En un extremo se encuentran aquellos que continúanutilizando levaduras indígenas exclusivamente, dadoque creen que la contribución única de diversas especiesde levaduras confiere una complejidad al vino novista en fermentaciones inoculadas o guiadas. Otrosprefieren empezar con levaduras nativas y posteriormenteinocular un cultivo activador. Otros inician lafermentación con activadores pero a un nivel de inoculacióninferior al recomendado. En la producciónvinícola a gran escala, donde es esencial disponer defermentaciones rápidas y fiables para conseguir unsabor homogéneo y una calidad predecible, se prefiereutilizar cultivos seleccionados de levaduras purasSeminario TécnicoCompuestos azufrados volátiles en vinoscon una capacidad, un conteo de células viables y unavitalidad conocidos. Con el fin de obtener los beneficiosde la fermentación espontánea y guiada, cadavez más vinicultores están co-inoculando dos o máscepas diferentes pero compatibles de Saccharomycescerevisiae, o mezclas de cultivos compuestas de unacepa de Saccharomyces cerevisiae y otra especie deSaccharomyces o no perteneciente a este género. Sedebe optimizar la proporción de las cepas o especiesseleccionadas en los cultivos de siembra con el fin deobtener los mejores resultados previstos.3. Optimización de la fermentaciónCuando se prepara el mosto a partir de uvas sanas ymaduras, con una población baja de microorganismoindígenas y un buen equilibro de nutrientes, si a estemosto se inocula un cultivo de levaduras vigoroso,la fermentación empieza y finaliza rápidamente, dejandouna pequeña cantidad de azúcar residual. Bajoestas condiciones ideales, las fermentaciones subóptimasson relativamente infrecuentes. No obstante,cuando se producen, es necesario recuperar recursosconsiderables y pueden conducir a la pérdida de lacalidad del vino por un deterioro oxidativo, microbiológicoo autolítico de las levaduras.Se pueden producir fermentaciones subóptimas encualquier tipo de vino o producto en fermentación,y éstas pueden ocurrir incluso cuando se utilizan lascepas más robustas fisiológicamente hablando. Sibien las levaduras son enormemente adaptativas alambiente del mosto, las condiciones fisicoquímicasy nutritivas no siempre son favorables para una actividadfisiológica vigorosa y, a menos que la levadurase pueda adaptar a condiciones cambiantes durantela fermentación, una reducción del estado fisiológicopuede conducir a una fermentación incompleta.Habitualmente se observan cuatro tipos de fermentacionessubóptimas: (i) inicio con retraso; (ii) fermentacióncontinuamente lenta; (iii) fermentación ralentizada;y (iv) fermentación incompleta o interrumpida. Lasfermentaciones que comienzan después de un tiempo,pero que a menudo finalizan por ellas mismas demanera normal, son habitualmente el resultado de lautilización de un cultivo activador con una calidad deficiente.Las fermentaciones que constantemente sonlentas, que pueden llegar a su finalización, habitualmenteson el resultado de una cantidad reducida denitrógeno asimilable. Las fermentaciones ralentizadase interrumpidas, sin embargo, parecen ser causadaspor varios factores relacionados con las interaccionesentre la fisiología de las levaduras, el estado de losnutrientes del mosto, la presencia de inhibidores y lascondiciones de fermentación.Concentraciones elevadas de azúcar en el mosto, locual viene determinado principalmente por la ma-Ponencias21

02. Los nuevos retos en microbiología del vino. Levaduras no productoras de SH 2durez de la uva en su vendimia, es probablemente lacausa principal de fermentaciones ralentizadas e interrumpidas,y esto se debe a su vez primordialmente ala relación entre la concentración inicial de azúcar y laproducción final de etanol; cuanto más azúcar hay enla uva, más alcohol habrá en el vino. Este problema semagnifica por la tendencia a utilizar uvas muy maduraso demasiado maduras en las bodegas. Por tanto,cada vez es más importante elegir cepas de levadurascon alta tolerancia al etanol.El riesgo de que aparezcan problemas de fermentaciónaumenta cuando el mosto tiene un contenidosubóptimo de nutrientes, especialmente de nitrógenoasimilable y vitaminas. Es importante saber queestas últimas se pueden perder durante la vendimiay el procesamiento del mosto. Un elevado índice deazúcar con respecto a otros nutrientes puede provocaruna reducción de la cantidad de biomasa y unabajada de la velocidad de fermentación, así como elinicio precoz de la inactivación del transporte de azúcaren las levaduras.La clarificación del mosto es un factor importante enla fermentación de vinos blancos debido al profundoefecto que la disminución de los sólidos de las uvastiene sobre la definición de la variedad de la uva, sobreel sabor y aroma del vino y sobre la aparición dearomas fenólicos indeseables. No obstante, el excesode clarificación elimina lípidos importantes necesariospara que las levaduras puedan tolerar el etanol; enla práctica se adquiere una solución de compromisodeterminada por la experimentación para establecerel nivel de sólidos de la uva que favorecen una tasasatisfactoria de fermentación manteniendo la calidaddel vino en un nivel aceptable. La incapacidad de finalizarla fermentación de mostos demasiado clarificados,con una elevada cantidad de azúcar y una fermentaciónanaeróbica, pueden evitarse parcialmenteintroduciendo un paso de aireación breve durante lafermentación. La aireación, unida a la adición de nitrógenoasimilable después de que haya finalizado lafase de crecimiento de las levaduras, revigoriza considerablementela fermentación. Este paso de aireaciónno tiene un impacto detectable sobre el sabordel vino e incluso es beneficioso ya que minimiza elriesgo del desarrollo de sabores y aromas indeseablesque podrían originarse a partir de una fermentaciónincompleta.No obstante, cuando la fermentación se frena debidoa una cantidad elevada de azúcar, el procedimientode rescate más exitoso depende de la adaptación secuencialde un cultivo fresco de levaduras a los inhibidoresdel vino en fermentación interrumpida. Esteprocedimiento, que comienza preparando un cultivoactivador de una levadura altamente tolerante al etanol,implica multiplicar sucesivamente por dos el volumende cultivo, por adición al vino en fermentacióninterrumpida, a la vez que se mantienen la aireación yel aporte de nutrientes. Después de dos a cuatro ciclosde adaptación al vino en fermentación interrumpida,el cultivo de rescate altamente adaptado puede finalizarla fermentación en presencia de concentracionesde etanol y de ácidos grasos volátiles normalmenteinhibidoras. Los procedimientos que mantienen la levaduraen suspensión hasta que vuelve a comenzar laproducción de CO2 mejoran más la tasa y la probabilidadde que se complete la fermentación.4. Optimización de la calidad del vino:evitar la producción de sabores y aromasindeseablesEs importante gestionar los nutrientes de la fermentacióncon el fin de mantener una tasa de fermentaciónvigorosa, alcanzar un punto final de bajo contenido deazúcar residual y disminuir la producción de sabores yaromas indeseables. Las uvas cultivadas en regionescon suelos de bajo contenido orgánico y pocas lluviasen la temporada de crecimiento pueden contener unnivel de nutrientes inferior al óptimo, especialmentede nitrógeno asimilable, el cual es necesario para elcrecimiento de las levaduras y su función metabólica.Se conoce bien cómo afecta la nutrición del nitrógenosobre la producción de compuestos volátiles deazufre. Durante la fermentación de mostos con pocosnutrientes, la cantidad de nitrógeno asimilable bajaprecozmente e induce la producción de sulfuro dehidrógeno (H 2S) debido a la ausencia de compuestosque capten el sulfuro. En muchos casos se puede controlarla producción de H 2S mediante la adición de salesnitrogenadas como el fosfato de diamonio. Otrosestudios sugieren que es necesaria una concentraciónde 200 – 250 mg/L de nitrógeno asimilable para minimizarel riesgo de producción de H 2S. No obstante,no todas las cepas comerciales responden a la mejoradel mosto por la adición de fosfato de diamonio, y elfallo en la respuesta habitualmente indica una deficienciaen el mosto de una o más vitaminas, de ácidopantoténico, de piridoxina o biotina, los cuales estánimplicados en el metabolismo del H 2S. La persistenciade problemas por producción de H 2S, aún con lasuplementación de nutrientes, requiere la selecciónde una levadura de baja producción de H 2S en talesmostos. La ausencia de respuesta sobre el H 2S tambiénpuede venir originada por la presencia de azufreelemental residual que no se ha utilizado en la viñasegún las recomendaciones del fabricante o cuandola vendimia se ha realizado prematuramente debido acondiciones meteorológicas adversas.El exceso de algunos nutrientes también puede provocarla aparición de sabores y aromas indeseables.La utilización excesiva de ácido nicotínico, presenteen algunos suplementos nutritivos, se asocia con laproducción de ácido acético. La utilización excesivade fosfato de diamonio también puede provocar laaparición de sabores indeseables. El fosfato de dia-22

monio estimula la producción de ésteres, los cualesen cantidades moderadas pueden ser beneficiosos,pero cuando la concentración total de ión amonio seacerca al nitrógeno máximo que la levadura puedeconsumir (aprox. 400 – 500 mg/L de nitrógeno asimilable),la producción de acetato de etilo es excesivaprovocando un sabor indeseable debido a este éstervolátil. Como una posible alternativa, existen algunosdatos sobre productos de levaduras inactivadas queal utilizarse cuando se rehidrata la levadura seca activapueden reducir el riesgo de producción de H 2S. Dadoque el nitrógeno asimilable afecta tanto sobre la producciónde sabores indeseables durante la fermentación,es importante medir el nitrógeno asimilable enlos zumos o mostos antes de la fermentación con elfin de optimizarlo. En los viñedos con historia de problemasde fermentación, se deben llevar a cabo análisisde nitrógeno en varias temporadas.A menos que existan condiciones higiénicas deficientesen la bodega, normalmente no se puede detectarla contaminación por “Brettanomyces” durante la fermentación.Sin embargo, cuando la Dekkera bruxellensisestá presente, incluso en un número relativamentebajo, si el inicio o la terminación de la fermentaciónmaloláctica tarda mucho, el riesgo de crecimientode la D. bruxellensis y la producción de etil fenoles aumentaconsiderablemente. Las condiciones fisicoquímicasy nutritivas existentes durante la fermentaciónmaloláctica son favorables para el desarrollo de estalevadura contaminante, y toda condición que perjudiqueel desarrollo de la Dekkera bruxellensis tambiénretrasará el desarrollo de bacterias malolácticas. Portanto, para controlar esta levadura contaminante esobligatorio mantener su tamaño poblacional en unmínimo inmediatamente después de la fermentaciónalcohólica y antes de la inducción de la fermentaciónmaloláctica. Minimizar los nutrientes residuales, especialmentefructosa y nitrógeno asimilable puede serbeneficioso para este fin, y la compatibilidad entre lalevadura y las bacterias malolácticas utilizadas para lasfermentaciones primaria y secundaria está resultandoser un factor importante para el éxito de las fermentacionesmalolácticas.5. Optimización de la calidad del vino:mejora del aroma deseable, el sabor y elcolorDe lo anterior se desprende claramente que existenmuchas herramientas para minimizar el riesgo de desarrollarsabores y aromas indeseables durante la fermentación,pero debemos considerar qué estrategiaspodemos emplear para que las fermentaciones proporcionencaracterísticas positivas al vino.Seminario TécnicoCompuestos azufrados volátiles en vinosLa rehidratación de la levadura con nutrientes de levadurasinactivas puede estimular la producción dearomas afrutados. De manera similar, niveles moderadosde nitrógeno asimilable, ca. 200 – 350 mg/L, mejorael equilibrio de los ésteres florales con respectoa los alcoholes de fusel, dotando al vinos de saboresmás frescos y limpios. El fosfato de diamonio estimulala producción de ésteres de acetato especialmente,pero también de etil estéres afrutados, e impidela producción de alcoholes superiores, los cualestienden a afectar negativamente al aroma del vino.No obstante, se debe tener cuidado de no sobredimensionarla adición de nitrógeno a partir de fuentescomo el fosfato de diamonio, ya que, como se haindicado anteriormente, esto puede conducir a unaproducción excesiva de ésteres de acetato. Es más,investigaciones recientes indican que la adición defosfato de diamonio puede reducir la respuesta de losprecursores responsables de los aromas a frutas tropicalesen Sauvignon Blanc y otras variedades similares;ya que se desfavorece la hidrólisis de conjugados de lacisteína, por lo que disminuye la producción de tiolespolifuncionales de cadena larga.Otra herramienta importante que puede ayudar a losvinicultores a producir vinos con perfiles sensorialesespecíficos y según las especificaciones del mercadoes la elección de la cepa de levadura y la estrategiade inoculación. Por ejemplo, ahora sabemos que la levaduradesempeña un papel esencial en la evoluciónde moléculas responsables del aroma provenientesde la propia levadura y de la uva. Las primeras son lasgrandes responsables del carácter del vino, e incluyenmetabolitos volátiles de la levadura como ésteres, alcoholessuperiores, ácidos, carbonilos y compuestosde azufre, mientras que las últimas contribuyen a loscaracteres específicos de las variedades. Existen dosclases importantes de compuestos derivados de lauva que son precursores del sabor y el aroma: los conjugadosde la cisteína y los conjugados con grupo deenlace de azúcar (o grupo gluco-). Los conjugados dela cisteína, que están presentes en la variedad SauvignonBlanc y en variedades relacionadas, son hidrolizadosdurante la fermentación por la acción de enzimascarbono-azufre-lasas. Esta hidrólisis libera potentestioles volátiles como 4-mercapto-4-metilpentan-2-ona (4MMP) y 3-mercaptohexanol (3MH), los cualesson responsables de aromas a maracuyá, boje, pomeloy grosella negra. Además, el 3MH es esterificadopor una alcohol acetiltransferasa codificada porel gen ATF1 para producir el más potente acetato de3-mercaptohexilo (3MHA). En unos recientes estudiosde co-fermentación se inocularon dos cepas de levadurasvinícolas en zumo de uva Sauvignon Blanc. Unacepa hidrolizó el conjugado y la otra esterificó el producto,por lo que las dos se complementaban entresí y mejoraban los sabores y aromas de la SauvignonBlanc.Los glucoconjugados no volátiles de las uvas son especialmenteimportantes para el desarrollo del aromade los vinos a partir de variedades de uvas muy aromáticascomo la Muscat y la Riesling, y también de al-Ponencias23

02. Los nuevos retos en microbiología del vino. Levaduras no productoras de SH 2gunas variedades no aromáticas como la Chardonnay,la Semillon y la Sauvignon Blanc. Entre los ejemplos decompuestos derivados de la fruta con sabor y aromapotenciales se encuentran los alcoholes monoterpenosflorales linalool y geraniol, así como los norisoprenoidestales como la β-damascenona. En variedadesno aromáticas, estos sabores y aromas se desarrollandurante la fermentación, y la acidez del vino, la cualpermite una hidrólisis química de los precursores novolátiles de aromas lenta, se ha considerando durantemucho tiempo una ruta importante de la formaciónde estos compuestos. No obstante, trabajos recientesdemuestran la existencia de al menos otras cuatrosrutas (en las que están implicadas las levaduras). Deestas, la hidrólisis de glucoconjugados por glucósidosextracelulares de las levaduras parece ser la más importantecuantitativamente durante la fermentación.El color es otro atributo sensorial del vino muy importantey, en el vino tino, éste está ampliamente determinadopor los antocianinos y pigmentos derivadosde la antocianina. Existen numerosos factores viticulturalesy viniculturales implicados en la formación yen la estabilización del color del vino tinto, no obstanteel papel de la levadura solamente se ha estudiadorecientemente. La elección de la cepa de levadurano sólo afecta a la profundidad del color, sino quetambién a su matiz; los tonos rojo-morados. Existeun estudio en curso para comprender el mecanismobioquímico que afecta al desarrollo del color del vino.Los conocimientos extraídos de este estudió permitirándesarrollar estrategias genéticas para personalizarcepas de levadura con el fin de ofrecer a los consumidoresvinos de un aspecto excepcional.6. Aumento de las opciones de losvinicultores mediante el desarrollo decepas de levaduras vinícolas mejoradas ynovedosasActualmente es indudable que las levaduras desempeñanun papel esencial a la hora de dotar al vino desus propiedades sensoriales. Durante siglos de viniculturase han aislado y utilizado, accidental o deliberadamente,cepas de Saccharomyces cerevisiae porsu capacidad para convertir eficazmente el mosto deuva en vino a pesar de su exposición a un esfuerzoosmótico, de nutrientes y etílico. Estas levaduras handesarrollado una serie de características específicas decada cepa, como la producción de diversos sabores yaromas y diferentes perfiles de utilización de nutrientes,lo cual es reflejo de su historia y ahora puede emplearsepara adecuar cepas específicas a las condicionesy estilos concretos de cada vino. Además de estadiversidad de opciones disponibles en la actualidad,se han mejorado muchas cepas de levadura vinícolautilizando métodos genéticos clásicos (mutagénesis,hibridación, evolución adaptativa), y en los últimostiempos mediante ADN recombinate (también conocidacomo tecnología de modificación genética).A este respecto, el desarrollo de cepas de levadurasde vino es una fuente importante de una nueva diversidadgenética para mejorar las opciones disponiblesde los vinicultores. Por ejemplo, la producción dehíbridos intra- e inter-específicos del género Saccharomycespermite la generación de cepas novedosasde levaduras con las propiedades de fermentaciónrobusta de la levadura vinícola comercial y las diversaspropiedades sensoriales ofrecidas por otras especies.El sector está actualmente evaluando desde un puntode vista vinícola los híbridos interespecíficos de Saccharomyceskudriavzevii y Saccharomyces cariocanuscon Saccharomyces cerevisiae. Se espera que estos híbridosaporten aromas multicapa diferenciadores enciertos estilos de vinos.Otro ejemplo de aplicación satisfactoria de estrategiassin modificación genética en nuestro programa dedesarrollo de cepas es la producción y la comercializaciónde cepas novedosas de Saccharomyces cerevisiaecon la capacidad de fermentar robustamente y deproducir simultáneamente niveles óptimos de tiolesafrutados deseables y cantidades mínimas de H 2S. Enprimer lugar, la investigación de los beneficios de lasestrategias de co-inoculación ha contribuido al desarrollode dos productos comercializados mixtos (unamezcla de cepas de un proporción específica) quemejoran los aromas afrutados provenientes de tioles.En segundo lugar, se han utilizado estrategias sin modificacióngenética para desarrollar cepas de vino quefermentan excepcionalmente bien sin producir cantidadesdetectables de H 2S. Estas cepas comercialesque producen menos H 2S obtuvieron resultados excelentesa escala industrial.Con el fin de empezar a investigar las bases genéticasde las diferencias entre cepas de la levadura vínica, elAustralian Wine Research Institute (Instituto de InvestigaciónEnológica de Australia) obtuvo el genoma deuna cepa de levadura vinícola y lo comparó con el dela cepa de Saccharomyces cerevisiae de laboratorio. Lacepa de vino resultó ser muy diferente a su homólogade laboratorio. La secuenciación del genoma de otrascepas industriales proporcionará una visión más profundade las variaciones presentes en las cepas vinícolasy debería resaltar variaciones comunes y específicasde cepas que puedan asociarse con característicasindustriales importantes.Así como las investigaciones fundamentales sobre levaduraspasaron de estrategias clásicas reduccionistaa estudios que implican todo el genoma, estos últimospasarán también al siguiente nivel de investigaciónbiológica conocido como la biología de sistemas. Ladenominada revolución -ómica promete, con la ayudade modelos matemáticos, la consecución de unacomprensión total de las células de la levadura vínicaen toda su complejidad. Esta metodología permitirá el24

desarrollo de cepas con una precisión y velocidad sinrival, y facilitará la utilización a medida del metabolismode la levadura para satisfacer las cada vez mayoresdemandas de los vinicultores y las preferencias siemprecambiantes de los consumidores en un mercadomasificado y sobre-abastecido.7. Conclusiones y previsiones futurasSeminario TécnicoCompuestos azufrados volátiles en vinosEn conclusión, el sector enológico y sus organismosde investigación están continuamente profundizandoen el conocimiento de las interacciones entre nutrientes,los precursores de sabores derivados de la uva, lascondiciones de fermentación y las cepas específicasde levaduras para la producción del vino. Existen muchasoportunidades innovadoras abiertas para investigacionesfuturas. El sector del vino se centrará en eldesarrollo de la evaluación de nutrientes rápidos y elcontrol de la fermentación a través de técnicas anteriormenteinimaginables como la tecnología del infrarrojocercano en línea. También mejorarán las cepasespecializadas de la levadura vinícola y las estrategiasde inoculación que puedan potenciar los caracteresdeseables – los vinicultores ahora buscan cepas debajo alcohol, tolerantes al etanol y potenciadoras desabores deseables, con capacidades bioconservantesy biosaludables para satisfacer las demandas esperadasdel mercado en el futuro — y reducir o eliminarsabores y aromas indeseables.8. AgradecimientosEl Australian Wine Research Institute Ltd (AWRI, Institutode Investigación Enológica de Australia), unmiembro del Wine Innovation Cluster (Grupo de Innovacióndel Vino) de Adelaida, recibe el apoyo deviticultores y vinicultores australianos a través de suagencia de inversiones, la Grape and Wine Researchand Development Corporation (Corporación para laInvestigación y el Desarrollo de la Uva y el Vino), lacual lo financia según una metodología “matchingfunds” con el Gobierno australiano. Me gustaría agradecerla contribución investigadora indicada en estedocumento a todos los miembros actuales y pasadosdel departamento de biociencia del AWRI: CarolineAbrahamse, Eveline Bartowsky, Jenny Bellon, Etjen Bizaj,Paul Chambers, Anthony Borneman, Antonio Cordente,Peter Costello, Chris Curtin, Angus Forgan, PaulHenschke, Wanphen Jitjaroen, Robyn Kievit, Ellie King,Dariusz Kutyna, Jane McCarthy, Jean Macintyre, SimonSchmidt, Tina Tran, Hentie Swiegers, Maurizio Ugliano,Cristian Varela y Gal Winter.Ponencias9. Lecturas complementarias1. Alexandre, H., P.J. Costello, F. Remize, J. Guzzo, &M. Guilloux-Benatier. 2004. Saccharomyces cerevisiae–Oenococcusoeni interactions in wine: currentknowledge and perspectives. InternationalJournal of Food Microbiology 93:141–154.2. Bartowsky, E.J. & I.S. Pretorius. 2009. Microbial formationand modification of flavour and off-flavourcompounds in wine. In: H. König, G. Unden& J. Frölich (eds.), Biology of Microorganisms ongrapes, in must and wine. Springer, Heidelberg,Alemania. Capítulo 11, pp. 209-231.3. Bataillon, M., A. Rico, J.-M. Sablayrolles, J. -M. Salmon& P. Barre. 1996. Early thiamin assimilationby yeasts under enological conditions: impact ofalcoholic fermentation kinetics. Journal of Fermentationand Bioengineering 82:145–150.4. Bauer, F.F. & I.S. Pretorius. 2000. Yeast stress responseand fermentation efficiency: how to survivethe making of wine – A review. South AfricanJournal of Enology and Viticulture 21:27-51.5. Bell, S.J. & P.A. Henschke. 2005. Implications ofnitrogen management for grapes and wine.Australian Journal of Grape and Wine Research11:242-295.6. Bellon, J., A. Heinrich & P. Chambers. 2006. Yeastresearch increases choice for winemakers andconsumers. Australian & New Zealand Grapegrower& Winemaker (514):102-103.7. Bellon, J., L. Rose, B. Currie, J. Ottawa, S. Bell, H.Mclean, C. Rayment, C. Treacher & P. Henschke.2008 Summary from the winemaking with nonconventionalyeasts workshops, 13th AWITC.Australian & New Zealand Grapegrower & Winemaker(528):72-77.8. Berthels, N.J., R.R. Cordero Otero, F.F. Bauer, I.S.Pretorius and J.M. Thevelein. 2008. Correlationbetween glucose/fructose discrepancy andhexokinase kinetic properties in different Saccharomycescerevisiae wine yeast strains. AppliedMicrobiology and Biotechnology 77:1083-1091.9. Bisson, L.F. & C.E. Butzke. 2000. Diagnosis andrectification of stuck and sluggish fermentations.American Journal of Enology and Viticulture51:168-177.10. Bisson, L.F. 1999. Stuck and sluggish fermentations.American Journal of Enology and Viticulture50:107-119.25

02. Los nuevos retos en microbiología del vino. Levaduras no productoras de SH 211. Bohlscheid, J.C., J.K. Fellman, X.D. Wand, D. Ansen& C.G. Edwards. 2007. The influence of nitrogenand biotin interactions on the performance ofSaccharomyces in alcoholic fermentation. Journalof Applied Microbiology 102:390–400.12. Borneman, A.R., P.J. Chambers & I.S. Pretorius.2007. Yeast Systems Biology: modelling thewinemaker’s art. Trends in Biotechnology 25:349-355.13. Borneman, A.R, P.J. Chambers & I.S. Pretorius.2009. Systems biology as a platform for wineyeast strain development. In: H. König, G. Unden& J. Frölich (eds.), Biology of Microorganisms ongrapes, in must and wine. Springer, Heidelberg,Alemania. Capítulo 22, pp. 395-414.14. Borneman, A.R., A.H. Forgan, P.J. Chambers & I.S.Pretorius. 2008. Unravelling the genetic blueprintof wine yeast. Australian and New Zealand WineIndustry Journal 23:21-23.15. Borneman, A.R., A. Forgan, P.J. Chambers & I.S.Pretorius. 2008. Comparative genome analysisof a Saccharomyces cerevisiae wine strain. FEMSYeast Research 8:1185-1195.16. Borneman, A.R, P.J. Chambers & I.S. Pretorius. 2009.The way forward: modelling the winemaker’s artusing yeast systems biology. In: P. Romano & G.H.Fleet (eds.), Yeast in Wine Fermentation. Springer,Heidelberg, Alemania (en prensa).17. Boulton, R.B., V.L. Singleton, L.F. Bisson & R.E.Kunkee. 1998. Principles and Practices of Winemaking.USA: Aspen Publishers, Inc.18. Chambers, P.J., Bellon, J.R., Schmidt, S.A., Varela,C. & Pretorius, I.S. 2008. Non-genetic engineeringapproaches to isolating and generating novelyeasts for industrial applications. In: G. Kunze & T.Satyanarayana (eds.), Diversity and Potential BiotechnologicalApplications of Yeasts. Elsevier (enprensa).19. Cordente, A.G., A. Heinrich, I.S. Pretorius & J.H.Swiegers. 2009. Isolation of sulfite reductasevariants of a commercial wine yeast with significantlyreduced hydrogen sulfide production.FEMS Yeast Research (en prensa).20. Curtin, C.D., J.R. Bellon, A.D. Coulter, G.D. Cowey,E.M.C. Robinson, M.A. de Barros Lopes, P. W. Godden,P.A. Henschke & I.S. Pretorius. 2005. Thesix tribes of ‘Brett’ in Australia: Distribution of geneticallydivergent Dekkera bruxellensis strainsacross Australian winemaking regions. Australianand New Zealand Wine Industry Journal 20:28-35.267:159-166.21. De Barros Lopes, M., J.R. Bellon, N.J. Shirley & P.F.Ganter. 2002. Evidence for multiple interspecifichybridization in Saccharomyces sensu strictospecies. FEMS Yeast Research 1:323-331.22. Edwards, C. & J.C. Bohlscheid. 2007. Impact ofpantothenic acid addition on H 2S productionby Saccharomyces cerevisiae under fermentativeconditions. Enzyme & Microbial Technology41:1–4.23. Eglinton, J.M. & P.A. Henschke. 1993. Can theaddition of vitamins during fermentation be justified?Australian Grapegrower and Winemaker(352):47–49,51–52.24. Eglinton, J.M. & P.A. Henschke. 1999. Restartingincomplete fermentations: the effect of highconcentrations of acetic acid. Australian Journalof Grape and Wine Research. 5:71–78.25. Fleet, G.H. 2003. Yeast interactions and wine flavour.International Journal of Food Microbiology86:11-22.26. Gockowiak, H. & P.A. Henschke. 1992. Nitrogencomposition of grape juice and implications forfermentation: results of a survey made in N-E Victoria.Australian & New Zealand Grapegrower&Winemaker (340):131, 133–138.27. Henschke, P.A. 1997. Stuck fermentation: causes,prevention and cure. Allen, M.; Leske, P.; Baldwin,G., eds. Advances in juice clarification and yeastinoculation: proceedings of a seminar; 15 August1996; Melbourne, Vic. Adelaide S.A: Australian Societyof Viticulture and Oenology; 1997: 30–38,41.28. Henschke, P.A. & V. Jiranek. 1991. Hydrogen sulfideformation during fermentation: effect of nitrogencomposition in model grape must. Rantz,J.M., ed. Proceedings of the international symposiumon nitrogen in grapes and wine; 18-19June 1991; Seattle, Washington, USA. Davis, CA:American Society for Enology and Viticulture; pp.172-184.29. Houtman, A.C. & C.S. Du Plessis. 1981. The effectof juice clarity and several conditions promotingyeast growth on fermentation rate, the productionof aroma components and wine quality.South African Journal of Enology and Viticulture2:71–81.30. Howell, K.S., J.H. Swiegers, G.M. Elsey, T.E. Siebert,E.J. Bartowsky, G.H. Fleet, I.S. Pretorius, & M.A. deBarros Lopes. 2004. Variation in 4-mercapto-4-methyl-pentan-2-one release by Saccharomycescerevisiae commercial wine strains under diffe-26

ent wine fermentation conditions. FEMS MicrobiologyLetters 240: 125-129.31. Jolly, N.P., O.P.H. Augustyn & I.S. Pretorius. 2006.The role and use of non-Saccharomyces yeasts inwine production. South African Journal of Enologyand Viticulture 27:15-39.32. King, E.S., J.H. Swiegers, B. Travis, I.L. Francis, S. Bastian& I.S Pretorius. 2008. Coinoculated fermentationsusing Saccharomyces yeasts affect the volatilearoma composition and sensory propertiesof Vitis vinifera L. cv. Sauvignon Blanc wines. Journalof Agricultural and Food Chemistry 56:10829-10837.33. Le Jeune, C., M. Lollier, C. Demuyter, C. Erny, J.L.Legras, M. Aigle & I. Masneuf-Pomarede. 2007.Characterization of natural hybrids of Saccharomycescerevisiae and Saccharomyces bayanusvar. uvarum. FEMS Yeast Research 7:540–54934. Lilly, M., M.G. Lambrechts & I.S. Pretorius. 2000.The effect of increased yeast alcohol acetyltransferaseactivity on the sensorial quality of wineand brandy. Applied and Environmental Microbiology66: 744-753.35. Lilly, M., G. Styger, F.F. Bauer, M.G. Lambrechts &I.S. Pretorius. 2006. The effect of increased yeastbranched-chain amino acid transaminase activityand the production of higher alcohols on theflavor profiles of wine and distillates. FEMS YeastResearch 6:726-743.36. Lilly, M., F.F. Bauer, M.G. Lambrechts, J.H. Swiegers,D. Cozzolino & I.S. Pretorius. 2006. The effect ofincreased alcohol acetyl transferase and esteraseactivity on flavor profiles of wine and distillates.Yeast 23:641-659.37. Molina, A.M, J.H. Swiegers J.H, C. Varela, I.S. Pretorius& E. Agosin. 2007. Influence of wine fermentationtemperature on the synthesis of yeastderivedvolatile aroma compounds. AppliedMicrobiology and Biotechnology38. Monk, P.R. 1986. Rehydration and propagation ofactive dry wine yeast. Australian Wine IndustryJournal 1:3-5.39. Pretorius, I.S. 2000. Tailoring wine yeast for thenew millennium: novel approaches to the ancientart of winemaking. Yeast 16: 675-729.40. Pretorius, I.S. & F.F. Bauer. 2002. Meeting the consumerchallenge through genetically customisedwine yeast strains. Trends in Biotechnology20:426-432.Seminario TécnicoCompuestos azufrados volátiles en vinos41. Pretorius, I.S. & P.B. Høj. 2005. Grape and WineBiotechnology: Challenges, opportunities andpotential benefits. Australian Journal of Grapeand Wine Research 11:83-108.42. Renouf, V., A. Lonvaud-Funel & J. Coulon. 2007.The origin of Brettanomyces bruxellensis in wines:A review. Journal International des Sciencesde la Vigne et du Vin. 41:161-173.43. Sablayrolles, J.M., C. Dubois, C. Manginot, J.L.Roustan & P. Barre. 1996. Effectiveness of combinedammoniacal nitrogen and oxygen additionsfor completion of sluggish and stuck fermentations.Journal of Fermentation and Bioengineering82:377-381.44. Salmon, J.M. 1989. Effect of sugar transport inactivationin on sluggish and stuck oenologicalfermentations. Applied and Environmental Microbiology55:953-958.45. Schmidt, S.A., T. Tran, P.J. Chambers, M.J. Herderich& I.S. Pretorius. 2006. Developing indicatorsof wine yeast performance: an overview of theimpact of ethanol stress. Australian and NewZealand Wine Industry Journal 21:24-30.46. Subileau, M., R. Schneider, J.-M. Salmon & E.Degryse. 2008. Nitrogen catabolite repressionmodulates the production of aromatic thiolscharacteristic of Sauvignon Blanc at the level ofprecursor transport. FEMS Yeast Research (enprensa).47. Swiegers, J.H., E.J. Bartowsky, P.A. Henschke & I.S.Pretorius. 2005. Yeast and bacterial modulationof wine aroma and flavour. Australian Journal ofGrape and Wine Research 11:139-173.48. Swiegers, J.H., D. Capone, G. Elsey, M.A. Sefton, I.L.Francis, & I.S. Pretorius. 2007. Engineering volatilethiol release in Saccharomyces cerevisiae for improvedwine aroma. Yeast 24:561-574.49. Swiegers, J.H., I.L. Francis, M.J. Herderich, & I.S.Pretorius. 2006. Meeting consumer expectationsthrough management in vineyard and winery:The choice of yeast for fermentation offers greatpotential to adjust the aroma of Sauvignon Blancwine. Australian and New Zealand Wine IndustryJournal 21:34-42.50. Swiegers, J.H. & I.S. Pretorius. 2007. Modulation ofvolatile sulfur compounds by wine yeast. AppliedMicrobiology and Biotechnology 74:954-960.51. Swiegers, H., M. Ugliano, T. van der Westhuizen& P. Bowyer. 2008. Impact of yeast rehydrationon the aroma of Sauvignon Blanc wine. Austra-Ponencias27

02. Los nuevos retos en microbiología del vino. Levaduras no productoras de SH 2lian & New Zealand. Grapegrower Winemaker(528):68–71.52. Swiegers, J.H, S.M.G. Saerens & I.S. Pretorius I.S.2008. The development of yeast strains as toolsto adjust the flavour of fermented beverages tomarket specifications. In: D.H. Frenkel & F. Belanger(eds.), Biotechnology in Flavour Production.Blackwell Publishing, Oxford, Reino Unido. Capítulo1, pp.1-55.53. Swiegers J.H., R.L. Willmott, T.E. Siebert, K. Lattey,B.R. Bramley, I.L. Francis, E.S. King & I.S. Pretorius.2009. The influence of yeast on the aroma of SauvignonBlanc wine. Food Microbiology 26:204-211.54. Torrea, D., & P.A. Henschke. 2004. Ammonium supplementationof grape juice-effect on the aromaprofile of a Chardonnay wine. Technical Review150:59–63.55. Ugliano, M., P.A. Henschke & I.S. Pretorius. 2007.Nitrogen management is critical for wine flavourand style. Australian and New Zealand Wine IndustryJournal 22:24-30.56. Vilanova, M., M. Ugliano, C. Varela, T. Siebert, I.S.Pretorius & P.A. Henschke. 2007. Assimilable nitrogenutilisation and production of volatile andnon-volatile compounds in chemically definedmedium by Saccharomyces cerevisiae wine yeasts.Applied Microbiology and Biotechnology 77:145-157.28

Seminario TécnicoCompuestos azufrados volátiles en vinosPonencias29

03. La microoxigenaciónde vinos tintos:Control de lareducción yestabilizacióndel colorProf. Encarna Gómez PlazaUniversidad de MurciaContenido31 La reactividad del oxígeno en los vinos32 La técnica de la micro-oxigenación35 Bibliografía

Dra. Encarna Gómez PlazaDoctora por la Universidad de Murcia (1992). Fue becariapredoctoral en el Departamento de Viticulturay Enología del CIDA (actual Instituto Murciano deInvestigación y Desarrollo Agroalimentario) siendoel tema de la tesis doctoral el estudio de los componentesvolátiles de uvas y vinos. Realizó su estanciapost-doctoral en Fresno (Califormia, EE.UU.), contratadapor el Agricultural Research Service y la CaliforniaRaisin Advisory Board para realizar un proyectode investigación sobre la presencia de tricloroanisolesen uvas pasas. Volvió a España con un contrato dereincorporación de Doctores y Tecnólogos incorporándosede nuevo al CIDA donde durante tres añoscontinuó trabajando en uvas y vinos, centrándose enla caracterización polifenólica y cromática de éstos(1994-1996). Se incorporó a la Universidad de Murciaen 1997, primero como Profesor Ayudante, posteriormentecomo Profesor Titular del área de Tecnologíade Alimentos y desde el 2007 como Catedráticade Universidad. Ha dirigido numerosos proyectos deinvestigación con financiación regional y nacional,relacionados con el estudio de uvas y vinos. Es autorade un alto número de publicaciones científicas enrevistas tanto de divulgación como de alto impactocientífico y revisora de algunas de las mejores revistascientíficas de tecnología de alimentos.Actualmente, su área de investigación se centra sobretodo en el estudio de las características cromáticasde uvas y vinos. Los dos últimos proyectos enlos que se encuentra trabajando son el estudio delefecto de la micro-oxigenación de vinos y la crianzade estos (barrica y virutas) sobre la evolución y estabilidaddel color y en el diseño de nuevas estrategiaspara la extracción de compuestos fenólicos de lasuvas durante la vinificación.Seminario TécnicoCompuestos azufrados volátiles en vinosLa reactividad del oxígeno en los vinosEl oxigeno juega un papel importante en diversosprocesos bioquímicos en los mostos y en los vinos,tanto durante la fermentación alcohólica como enpostfermentación, e incluso durante el embotellado.Su presencia modifica el estado redox de los vinos, loque conlleva cambios que pueden afectar positiva onegativamente a la calidad de los vinos. Para una correctagestión del oxígeno es necesario conocer comoéste actúa en el vino, particularmente en el control dela actividad de las levaduras, manejo de los olores azufradosy estabilización del color de los vinos tintos.La presencia de oxígeno en el vino provoca una oxidación,un proceso donde hay una transferencia deelectrones. En el vino, el oxígeno es reducido a ciertosintermedios y finalmente a H 2O2 y a H 2O Considerandola cantidad de oxígeno que un vino puede tomar(de 60 a 600 ml/l, de acuerdo con Singleton, 1986),está claro que no hay otros compuestos oxidables enel vino en cantidad suficiente que no sean los compuestosfenólicos. Por lo tanto, éstos serán los principalesimplicados en los fenómenos de oxidación delos vinos.El oxigeno tiene una limitada reactividad en su formamolecular. El potencial oxidante del oxigeno se debea la generación de especies reactivas del oxígeno. Así,la transferencia inicial de un electrón lleva a la formaciónde O 2- que al pH del vino existe como radical hidroxiperóxido.Este paso requiere un catalizador, preferentementeun metal como Fe. La transferencia deun segundo electrón producirá un peróxido (en vinoH 2O 2). La siguiente reducción crea un agente oxidanteincluso más reactivo que los anteriores, el radicalhidroxilo. La última reacción produce agua como productofinal de la reducción del oxígenoPonenciasAdaptado de Waterhouse y Laurie, 2006Los radicales formados durante este proceso intermediopueden ser directamente reducidos por los fenolesy son mejores oxidantes que el oxígeno (Waterhousey Laurie, 2006).Los principales productos secundarios de la reduccióndel oxígeno en el vino serán quinonas y aldehídos, fundamentalmenteel acetaldehído. Las quinonas puedenparticipar en reacciones de polimerización quellevarán a la formación de grandes polímeros, normal-31

03. La micro-oxigenación de vinos tintos: Control de la reducción y estabilización del colorLa técnica de la micro-oxigenaciónAdaptado de Waterhouse y Laurie, 2006mente de color pardo, responsables del pardeamiento.Pero también, las quinonas pueden reaccionar yformar aductos con otros compuestos del vino, comolos tioles, contribuyendo al control del problema dereducción en los vinos (Waterhouse y Laurie, 2006; Vidaly Aagaard, 2008). Los aldehídos, en el caso del vinotinto sobre todo, pueden participar en reacciones queserán de interés pues favorecen la estabilización delcolor de los vinos (Timberlake y Bridle, 1976).Ya se había observado desde hace tiempo una diferenciaimportante entre los resultados en el vino deuna oxidación lenta frente a una oxidación rápida,que sugiere la existencia de unas reacciones adicionales,que ocurren de forma lenta y que aumentan elconjunto de sustratos oxidables en el vino (Singleton,1986). Así, lentamente, dos semiquinonas radicales sepueden unir covalentemente. Este proceso se llamapolimerización regenerativa y lleva a la generación deuna hidroquinona reoxidable. Tiene un potencial dereducción menor que sus constituyentes originales eincrementará la capacidad de tomar oxígeno del vino.Es decir, la polimerización regenerativa lenta lleva aunidades no oxidables (quinonas) a incorporarse enhidroquinonas reoxidables lo que incrementará lossustratos oxidables del vino y protegerá a los sustratosoriginales. Si el oxigeno se añade rápidamente, estareacción no ocurre, se agotan también rápidamentelos fenoles para reaccionar, con formación de muchasquinonas y, por tanto, el pardeamiento de los vinos.Estas observaciones pueden ser la base científica queexplica los resultados de la micro-oxigenación, técnicaque nació en la década de los 90. Está basada en elaporte controlado de pequeñas cantidades de oxígenoal vino mediante un microdifusor poroso, de formacontinua y lenta, siendo la velocidad de aporte de oxigenoinferior a la velocidad de consumo, evitando laacumulación de éste en el vino. Los efectos positivosde la micro-oxigenación sobre los vinos tintos se puedenresumir en:• Estabilización del color• Reducción de olores a reducción y sabores herbáceos• Suavización del vino por disminución de astringenciaEstos efectos se deben a la formación de esos productosfinales de la oxidación en los vinos. Así, las quinonasformadas pueden fijar compuestos azufrados ycontribuir a la disminución de los “olores a reducción”en los vinos. Además, las quinonas formadas puedencomenzar un proceso de polimerización de compuestosfenólicos, lo que puede modificar el sabor yla astringencia de los vinos. De igual forma, otro delos productos que aparecen, el acetaldehído, participaen las reacciones de estabilización de color de losvinos tintos a través de la formación de compuestosfenólicos unidos por puente de etilo (tanino-tanino yantociano-tanino fundamentalmente) y favoreciendola formación de piranoantocianos, compuestos másestables que los antocianos nativos de los vinos.a) Control de la reducciónUno de los motivos por los que a este defecto se le llamaolor a reducción es por que normalmente apareceCompuestos azufrados de bajo PmDescripción del olorUmbral olfatorio(ppb)Sulfuro de hidrógeno (H 2S) Huevos podridos 1Metanotiol (MeSH) Goma quemada, putrefacción 1,5Etanotiol (EtSH) Cebolla, goma, terroso 1,5Sulfuro de dimetilo (DMS) Col cocida, esparragos 25Sulfuro de dietilo (DES) Ajo, goma 1Disulfuro de carbono (CS 2) Dulce, goma, azufrado 5Disulfuro de dimetilo (DMDS)Vegetal, col, cebolla(a alta concentración)Disulfuro de dietilo (DEDS) Olor desagradable, cebolla 4Metil tioacetato (MeSAc) Azufrado, huevo, queso 40Etil tioacetato (EtSAc) Azufrado, cebolla, ajo 70Metionol Col cocida 12001032Adaptado de Vidal y Aagaard, 2008

cuando el potencial redox del vino es bajo y se debenormalmente a la aparición de compuestos azufradosvolátiles, generalmente descritos como olor a gomaquemada, pútridos, huevos podridos, cebolla, col,ajo..... aunque no hay que olvidar que entre los compuestosazufrados volatiles existen algunos como el3-mercaptohexanol o 3-mercaptohexil acetato queimparten aromas afrutado positivos al vino (Zoecklein,2006).El azufre tiene varias formas reducidas en el vino:- H 2S, que se produce naturalmente durante la fermentaciónalcohólica y cuya formación se debe intentarcontrolar, sobre todo al final de la fermentaciónalcohólica o formará otros compuestos azufrados,- los tioles, que se forman normalmente al final delfermentación alcohólica y en postfermentación y poseenun umbral de percepción bastante bajo y,- sulfuros y disulfuros, que se forman durante todo elproceso de vinificación y por la oxidación de tioles envinos terminados, tienen los umbrales de percepciónmas altos por lo que son menos problemáticos peroson más difíciles de eliminar y en botella pueden revertira tioles.El H 2S es un intermediario en la biosíntesis de compuestosazufrados requeridos por las células para elcrecimiento celular y su funcionamiento. El azufre enforma de SO 42-, S, SO 32- entra en la célula y se reducea sulfuro a través de dos pasos activados por ATP.En este momento el sulfuro se combina enzimaticamentecon precursores que contienen nitrógeno paraformar cisteina y metionina. En ausencia de nitrógenointracelular lo que se forma es un exceso de H2S queno se incorpora a los aminoácidos sino que se liberaal vino (Zoecklein, 2006). En otros casos, un suministrosuficiente de nitrógeno también puede llevar a altascantidades de H2S, debido a la carencia de otros nutrientesy otros efectos no tan conocidos.Hay una serie de medidas que se pueden tomar paraintentar controlar la formación de estos compuestosazufrados, tanto antes de la fermentación alcohólica(evitar uvas tratadas con S o Cu en fechas cercanasa vendimia, añadir cantidades justas de SO 2), comoen las primeras etapas de la fermentación alcohólica(utilizar nutrientes para las levaduras y cepas seguras,temperaturas moderadas de fermentación) y en lasúltimas etapas de fermentación (evitar el uso de SO2,mantener la sanidad de las levaduras..).También el oxígeno puede tener un papel importanteen este control. El oxigeno añadido al mosto en fermentación(como macro-oxigenación o micro-oxigenación)limita el impacto de compuestos azufradosvolátiles de dos formas: a) permitiendo que la levadurasintetice ácidos grasos y esteroles y así soportaSeminario TécnicoCompuestos azufrados volátiles en vinosmejor el estrés y b) incrementando el potencial redoxy reduciendo la presencia de azufrados volátiles. Otroefecto del oxígeno es que puede reaccionar con elH2S y formar S y agua. El azufre se eliminará despuéspor medio de los trasiegos.En postfermentación también se puede utilizar el oxígenopara controlar los problemas de reducción y loscompuestos azufrados volátiles. Los compuestos azufradosson sensibles al oxígeno y el aporte de oxígenoreducirá su concentración. Comúnmente se aceptaque la reacción que ocurre es (Zoecklein, 2007):O 2CH 3-SH H 3C-S-S-CH 30.2 ppb 12 ppbComo se observa, los compuestos azufrados no desaparecensino cambian a otras formas con umbralesde percepción más altos. Pero esta reacción es reversibley en ambiente reductor se puede volver a formartioles.Pero no hay que olvidar que otra reacción es posibleen presencia de oxígeno y es la reacción entre las quinonasformadas por oxidación de fenoles con los grupos–SH de los compuestos azufrados (Waterhouse yLaurie, 2006).Así, estudios realizados micro-oxigenando vinos tintoshan mostrado que los vinos con micro-oxigenacióntenían menos niveles de metanotiol y etanotiol quelos vinos testigo, disminuyendo su concentración pordebajo de su umbral aromático y además no se detectóacumulación de disulfuros (McCord, 2003).Es muy importante mantener el suficiente aporte deoxigeno para producir continuamente quinonas queatrapen las nuevas moléculas azufradas que se puedenir formando durante el envejecimiento del vino,tanto por hidrólisis de tioésteres o por condicionesanaerobias.b) Mejora de la estabilidad del colorLa importancia del oxígeno en la evolución del colordel vino tinto ya se conoce desde hace tiempo, tantocon respecto a la oxidación de polifenoles comola la formación de nuevos compuestos más establesderivados de los antocianos. Entre las reacciones queocurren como consecuencia de la presencia de oxígenohay que incluir los cambios en la longitud de lascadenas de taninos, que afecta a la astringencia, y laformación de piranantocianos y compuestos unidospor puente de etilo (por la presencia de acetaldehído)Ponencias33

03. La micro-oxigenación de vinos tintos: Control de la reducción y estabilización del colorFigura. Comparación de la concentración deetanotiol, metanotiol y dimetilsulfuro en vinoscontrol, micro-oxigenados, micro-oxigenadosy con aplicación de duelas de roble y microoxigenadosy con aplicación de segmentos deroble (adaptado de McCord, 2003).que son mas estables que los antocianos originales,dando lugar a una mayor estabilidad e intensidad delcolor de los vinos micro-oxigenados (Timberlake y Bridle,1976; Francia-Aricha et al., 1997; Salas et al., 2004).La correcta aplicación de la técnica para conseguirlos mayores beneficios va a depender del periodo deaplicación y el tipo de vino a micro-oxigenar. Fundamentalmente,las mayores ventajas las vamos a encontrarcuando el vino esté equilibrado, la proporción deantocianos-taninos sea correcta y haya una cantidadimportante de antocianos libres. Si no hay suficientesantocianos libres en el vino para reaccionar se puedeacumular acetaldehído y verse favorecida la polimerizaciónde taninos, hasta que las moléculas formadassean tan grandes que precipiten. Los diversos ensayosrealizados han puesto de manifiesto que la etapa comprendidaentre fermentación alcohólica y fermentaciónmaloláctica es la que mejores resultados suele dar poruna alta presencia de antocianos libres, ácido pirúvicoy ausencia de SO 2. Esto se observa en los trabajos deCano-López et al. (2006), donde se ha puesto de manifiestoque se observa un incremento en la intensidadde color fundamentalmente en el primer periodo demicrooxigenación (entre la fermentación alcohólica yel inicio de la fermentación maloláctica) en los vinosmicrooxigenados. Al finalizar la fermentación malolácticase observó en todos ellos un descenso, probablementeconsecuencia de la variación del pH y laprecipitación de materia coloidal que arrastra materiacolorante. Aunque el aporte de oxigeno durante el segundoperiodo (se comenzó cuando la fermentaciónalcohólica ya esta finalizada) fue menor, se observó denuevo un aumento de intensidad de color en los vinosmicrooxigenados, diferenciándose todos los vinos encolor, y observándose también el efecto de la dosis deoxígeno aplicada. El incremento de color se adscribió auna mayor concentración de piranoantocianos y com-Figura. Evolución del grado medio de polimerización de los taninos en vinos micro-oxigenados y suscorrespondientes testigos (W1: vino de bajo contenido polifenólico, W2: vino de contenido polifenólicomedio, W3: vino de alto contenido polifenólico). Adaptado de Cano-López et al. 2008Concentración de las principales familias de antocianos y compuestos derivados en vinos de Monastrellmicro-oxigenados (Cano-López et al., 2006).Compuestos identificados t0 tfControl Control Dosis 1 Dosis 2Antocianos monoméricos (mg L-1) 277.9±4.2c 185±0.9b 178±7.4b 159±16.1aAductos directos (µg L-1) 1900±87a 2121±51b 1945±84a 1858±110aSuma de Piranoantocianos 14872±374b 9974±225a 14524±99b 14091±16bCompuestos unidos por etilo (µg L-1) 5008±46a 5503±14a 5883±18b 6262±145cPico polimérico (mg L-1) 19.7±0.2a 19.2±0.7a 21.6±2ab 23.4±1.1b34

Evolución desde final de fermentación alcohólicahasta la finalización del proceso de microoxigenaciónde la intensidad de color en vinos(no se aplicó la micro-oxigenación durante lafermentación maloláctica)puestos unidos por puente de etilo en los vinos microoxigenados(Cano-López et al., 2006).También los efectos de la micro-oxigenación sobrelos taninos del vino han sido estudiados (Cano-Lópezet al., 2008). Se han observado diferentes comportamientoscon respecto a la evolución del grado mediode polimerización. Este parámetro siempre se incrementaen el primer periodo (fin de fermentaciónalcohólica-inicio de fermentación maloláctica) paraSeminario TécnicoCompuestos azufrados volátiles en vinostodos los vinos y después cae, excepto para el vino decontenido fenólico bajo. Este incremento se correspondea la fase estructurante descrita en las observacionesempíricas y suele ocurrir incluso cuando no seestá aplicando oxigeno al vino. La reducción que seobserva después, principalmente en los vinos de contenidofenólico medio y alto micro-oxigenados puedeser debido a un rearreglo estructural de los taninosa formas mas cortas, y ésto se asocia a un descensoen astringencia. También la reacción de estas cadenasmas cortas con antocianos reducirá la astringencia. Elcomportamiento diferente del vino de contenido fenólicobajo microoxigenado puede estar relacionadocon una sobre-oxigenación del vino, debido a su bajocontenido en antocianos libres.El conjunto de observaciones realizadas en el trabajode Cano-López et al. (2008) pone de manifiesto comola micro-oxigenación mejora las características de losvinos de mas alto contenido fenólico por tener altascantidades de antocianos libres, incrementándose sucolor y mejorando notablemente su estructura.Todas estas observaciones nos llevan a concluir que lamicro-oxigenación es una técnica de aplicación muyinteresante en vinos tintos, sobre todo en vinos conpotencial fenólico. No acelera el envejecimiento perosi lo puede optimizar y ayudar a controlar problemasde reducción en los vinos.PonenciasBibliografíaCano-López, M.; Pardo-Mínguez, F.; López-Roca,J.M.; Gómez-Plaza, E. (2006). Effect of microoxygenationon anthocyanin and derived pigment contentand chromatic characteristics of red wines. AmericanJournal of Enology and Viticulture 57, 325-331.Cano-López, M.; Pardo-Mínguez, F.; Schmauch, G.;Saucier, C.; Teissedre, C.; López-Roca, J.M.; Gómez-Plaza, E. (2008). Effect of Micro-oxygenation on Colorand Anthocyanin-Related Compounds of Wines withDifferent Phenolic Contents. Journal of Agricultural andFood Chemistry, 56, 5932-5941Francia-Aricha, E.; Guerra, M.T.; Rivas-Gonzalo,J.; Santos-Buelga, C. (1997). New anthocyanin pigmentsformed after condensation with flavanols. Journalof Agricultural and Food Chemistry, 45, 2262-2266.Rauhut. D (2002). Volatile sulfur compounds. Impacton reduced sulfur flavor defects and atypical aging inwine. 31st Annual New York Wine Industry Conference.Salas, E.; Atanasova, V.; Poncet-Legrand, E.; Meudec,E.; Mazauriz, J.; Cheynier, V. (2004). Demostrationof occurrence of flavanol-anthocyanin adducts inwine and model solutions. Analytica Chimica Acta, 213,367-370.Singleton, V. (1987). Oxygen with phenols and relatedreactions in musts, wines and model systems. Observationsand practical implications. American Journalof Enology and Viticulture, 38, 69-77.Timberlake, C.; Bridle, P. (1976). Interaction betweenanthocyanins, phenolic compounds and acetaldehydeand their significance in red wines. AmericanJournal of Enology and Viticulture, 27, 97-105.Vidal, S., Aagaard, O. (2008). Oxygen managementduring vinification and storage of Shiraz wine. WineIndustry Journal, 23, www. Winebiz.com.auWaterhousse, A.; Laurie, F. (2006). Oxidation of winephenolics. A critical evaluation and hypothesis. AmericanJournal of Enology and Viticulture, 57, 306-312.Zoecklein, B. (2006). Sulfur compounds: impact onaroma, flavor and texture and practical management.Enology notes, 113Zoecklein, B. (2007). Factors impacting sulfur-like offodors in wine and winery options. 8th Annual Enologyand Viticulture British Columbia Wine Grape CouncilConference.35

04. ¡Los compuestosvolátiles no sontodos perjudiciales!Los tioles varietalesy el sulfuro dedimetiloRémi GUERIN-SCHNEIDERInstitut Français de la Vigne et du VinENTAV-ITV FranceContenido38 1. Los tioles varietales39 2. El sulfuro de dimetilo40 Conclusión

Seminario TécnicoCompuestos azufrados volátiles en vinosRémi Guerin-SchneiderIngeniero Agrónomo y Enólogo,Schneider, completa su formacióncon una Tesis Doctoral, en elaño 2001, sobre el potencial aromáticode los vinos de Muscadet.Ingeniero de Investigación y Desarrolloel Instituto francés de laViña y del Vino desde 2001, estáencargado del Proyecto “Útiles ymétodos de caracterización de lacalidad de uvas y vinos”Particularmente especializadoen el análisis de compuestosaromáticos de vinos y de susprecursores, Remi Schneider, esautor de numerosas publicacionescientíficas centradas en lapuesta apunto de metodologíasanalíticas sensibles y fiables,particularmente empleando diluciónisotópica, así como métodosde estimación del potencialaromático de uvas procedentesde viñedos de alta producción.Desde el año 2006, coordina unprograma de investigación (UMT« Qualinnov ») agrupando equiposde el INRA y del IFV.Publicaciones principalesR. SCHNEIDER, A. RAZUNGLES, C. AUGIER, R. BAUMES, 2001. Monoterpenicand Norisoprenoidic Glycoconjugates of Vitis vinifera L. cv. Melon B. asPrecursors of Odorants in Muscadet Wines. J. Chromatogr., 936, 145-147.R. SCHNEIDER, A. RAZUNGLES, F. CHARRIER, R. BAUMES, 2002. Effet dusite, de la maturité, et de l’éclairement des grappes sur la composition aromatiquedes baies de Vitis vinifera L. cv. Melon B. dans le vignoble du Muscadet.Bulletin de l’OIV,855-856, 269-283.A. BELANCIC-MAJCENOVIC, R. SCHNEIDER, J.P. LEPOUTRE, V. LEMPE-REUR, R. BAUMES, 2002. Synthesis and Stable Isotope Dilution Assay ofEthanethiol and Diethyl Sulfide in Wine using Solid Phase Microextraction.Effect of Aging on their Levels in Wine. J. Agric. Food Chem., 50, 6653-6658.R. SCHNEIDER, Y. KOTSERIDIS, J.L. RAY, C. AUGIER, R. BAUMES, 2003.Quantitative Determination of Sulfur-Containing Wine Odorants at sub-ppbLevels. Part II : Development and Application of a Stable Isotope DilutionAssay. J. Agric. Food Chem., 51, 3243-3248.R. SCHNEIDER, F. CHARRIER, M. MOUTOUNET, R. BAUMES, 2004. RapidAnalysis of Grape Aroma Glycoconjugates using Fourrier-Transform InfraredSpectrometry and Chemometric Techniques. Analytica Chimica Acta, 513,91-96.C. PROUTEAU, R. SCHNEIDER, Y. LUCCHESE, F. NEPVEU, R. RENARD, C.VACA-GARCIA, 2004. Improving Headspace Solid phase Microextraction of3-Isobutyl-2-methoxypyrazine by Experimental Design with Regard to StableIsotope Dilution Gas Chromatography- Mass Spectrometry Analysis ofWine. Analytica Chimica Acta, 513, 223-227.DÍAZ-MAROTO M.C., SCHNEIDER R., BAUMES R., 2005. Formation pathwaysof ethyl esters of branched short-chain fatty acids during wine aging.J. Agric. Food Chem., 53, 3503-3509.DAGAN L., SCHNEIDER R., LEPOUTRE J.P., BAUMES R., 2006. Stability ofsotolon in acidic and basic aqueous solutions. Application to the synthesisof a deuterated analogue for its quantitative determination in wine. AnalyticaChimica Acta, 563, 365-374.SCHNEIDER R., CHARRIER F.,RAZUNGLES A., BAUMES R., 2006. Evidencefor an alternative biogenetic pathway leading to 3-mercaptohexanol and4-mercapto-4-methylpentan-2-one in wines. Analytica Chimica Acta, 563,58-64.M. SUBILEAU, R. SCHNEIDER, JM. SALMON, E. DEGRYSE, 2008 Nitrogencatabolite repression modulates the production of aromatic thiols characteristicofSauvignonBlanc at the level of precursor transport, FEMS Yeast Res,8, 771–780Ponencias37

04. ¡Los compuestos volátiles no son todos perjudiciales! Los tioles varietales y el sulfuro de dimetiloLos compuestos azufrados volátiles están presentesen gran número en los vinos. Se acostumbra a separarlosen dos clases distintas, los compuestos sulfurososligeros, cuyo punto de ebullición es inferior a 90ºC,y los compuestos sulfurosos pesados que presentanun punto de ebullición más elevado. Esta clasificación,práctica por su simplicidad, aporta sin embargo escasainformación acerca de la naturaleza de los compuestosy de su origen.Si nos adentramos con más detalle en el tema, encontramostres grandes familias de compuestos entérminos de estructura química: los tioles, los mono-opolisulfuros y los tiol-éster.De manera general, las funciones químicas azufradasconfieren a estos compuestos olores desagradables,intensos, que son percibidos negativamente. No obstante,cuando su peso molecular aumenta, el efectonegativo del grupo funcional sulfuroso se atenúa ylas percepciones olfativas de los compuestos son másagradables. Así pues, la mayor parte de los compuestossulfurosos ligeros, principalmente en productos en cursode fermentación son perjudiciales para la calidad delaroma, mientras que los compuestos sulfurados máspesados, pueden contribuir de manera favorable a mejorarel perfil aromático de los vinos. Es concretamenteel caso de los tioles varietales (Tominaga et al. 1998) ydel sulfuro de dimetilo (Ségurel, 2005).1. Los tioles varietalesLos compuestos sulfurosos varietales se forman durantela fermentación a partir de los S- conjugados a lacisteina de la uva. Estos S-conjugados a la L-cisteina oprecursores cisteinicos han sido evidenciados e identificadosdirectamente en la uva recientemente (Darrietet al., 1993; Tominaga et al., 1995; Tominaga et al.,1998b). Únicamente 3 de estos precursores han sidoidentificados formalmente en la uva : la S-(1-hidroxihex-3-yl)-L-cisteina(P3MH), el S-(4-metil-2-oxopent-4-yl)-L-cisteina (P4MMP) y el S-(4-metill-2-hidroxipent-4-yl)-L-cisteina (P4MMPOH ; (Tominaga et al., 1995;Tominaga et al., 1998b). Este último interviene raramenteen el aroma del futuro vino.Debido a las dificultades analíticas han sido publicadospocos datos cuantitativos acerca de los S-conjugadosa la cisteina. Sus contenidos son reducidos y no superanla centena de ug/L en caso del P3MH, el más abundante,en el mosto del Sauvignon Blanc, (Peyrot desGachons et al., 2000; Peyrot des Gachons et al., 2002a;Peyrot des Gachons et al., 2005 Dagan, 2006). En cuantoa sus evoluciones durante la maduración de la uva,se muestran variables en función del precursor y de laañada (Peyrot des Gachons et al., 2000, Dagan, 2006).En la baya de la uva, la P4MMP se reparte por igual enla piel y en la pulpa mientras que el P3MH está mayoritariamentepresente en la piel (Murat et al., 2001b;Peyrot des Gachons et al., 2002a). Así pues, la maceraciónpelicular afecta principalmente al P3MH, cuyascantidades recuperadas en el mosto son más importantesen relación a una vinificación clásica (Murat etal., 2001b; Peyrot des Gachons et al., 2002a).Cabe señalar igualmente la presencia en los mostosde Sauvignon Blanc de un conjugado del 3 mercaptohexanolo glutathion que será el precursor biogenéticodel conjugado a la cisteina correspondiente,por hidrólisis de los dos aminoácidos asociados a lacisteina del glutation (Peyrot des Gachons et al., 2001).Más recientemente (Fedrizzi et al, 2009) un conjugadode la 4MMP al glutathion, ha sido formalmente identificadoen un mosto de Sauvignon.Aún que poco abundantes y poco numerosos, estosprecursores cisteinicos contribuyen sin embargoen gran manera al aroma del vino. Son en efecto elorigen de cuatro tioles extremadamente olorosos,ausentes en la uva, pero responsables en el vino denotas olfativas reconocibles cuando sus contenidosson los suficientes el 3-sulfanilhexan-1-ol (3MH), elacetato de 3-sulfanylhexyle (ac3MH), el 4-metil-4-sulfanilpentan-2-one(4MMP), presentando umbrales depercepción olfativa muy bajos, respectivamente de 60ng/L, 4,2 ng/L y 0,8 ng/L en solución hidroalcohólica(Tominaga et al., 2000). Estos presentan respectivamenteolores de pomelo, de corteza de cítricos y deboj, que participan de manera importante en el afrutadode numerosos vinos blancos y rosados.Si la 4MMP parece específica de un reducido númerode variedades (Sauvignon, Bacchus, Scheurebe), el3-sulfanyl-hexanol y su acetato han sido observadosen un gran número de variedades. Estos participanno solamente en el aroma de los vinos de numerosasvariedades blancas como pueden ser la Gewürztraminer,Scheurebe, Colombard, Petit Manseng, MelonBlanc sino igualmente en tintas, como en la Garnacha,Merlot, Cabernet franc, Cabernet Sauvignon, Syrah,Mourvèdre, Cinsault (Darriet et al., 1993; Darriet et al.,1995; Güth, 1997a; Tominaga et al., 2000; Tominaga etal., 1996; Güth, 1997a; Bouchilloux et al., 1998; Kotseridiset Baumes, 2000; Lopez et al., 2003; Murat et al.,2003; Schneider et al., 2003; Fretz et al., 2005, Ferreiraet al., 2002, Schneider et Masson, 2009). Estudiosrecientes (Ferreira et al 2002; Masson et Schneider,2009), han demostrado que el mercaptohexanol erapor otra parte un aroma clave en los vinos rosados deGarnacha, y más concretamente en los Rosados deProvence (Masson et Schneider, 2009).Esta ubicuidad del 3MH es en parte debida a unasegunda vía de formación de este tiol durante la fermentación,no proveniente de S-conjugados a la cisteinade la uva, sino al añadido de fuentes sulfurosas al(E)-2-hexenal en un mosto en fermentación (Schneideret al., 2006). Esta vía de formación ha sido por otra38

parte demostrada en las mismas condiciones para el4-metil-4-sulfanil-pentan-2-one vía oxido de mesitilo,pero este último o su hidrato no ha sido jamás encontradoen la uva. Vías análogas han sido por otra parteevidenciadas para el 2-furanmetanetiol (umbral depercepción olfativa de 5ng/l en el vino tinto), responsablede las notas de café tostado de los vinos elaboradosen barricas de roble (Blanchard, 2001), y podríanexplicar la formación de otros tioles olorosos del vino,como el 3-mercapto-3-metilbutan-1-ol.Es durante la fermentación cuando la levadura, porintervención de las enzimas de tipo liasa, libera lostioles olorosos por ruptura de la asociación C-S de laparte cisteina de los precursores cisteinicos de la uva(Tominaga et al., 1998b). Los rendimientos de transformaciónde los precursores cisteinicos al final de lafermentación en diferentes cepas de levadura Saccharomycescerevisiae son débiles y variables, independientementede cual sea el precursor estudiado en elmedio de muestra o natural, aunque la mayor partede los precursores iniciales se hayan degradado : de0,06% a 0,6% para la P4MMP (Murat et al., 2001a), yde 0,6% a 10,2 % para el P3MH ( Murat et al., 2001b).En lo relativo al ac3MH que no tiene en la uva ningúnS-conjugado a la cisteina, es igualmente la levaduraquien lo forma mediante acetilación del 3MH, al igualque ésta acetila los alcoholes de su metabolismo nitrogenado.Así pues, la formación de estos tioles por lalevadura depende mucho de la cepa de levadura, delmosto y de las condiciones de fermentación e inclusode algunas cepas salvajes de Saccharomyces bayanusvar. Uvarum eran especialmente activas (Murat et al.,2001a; Masneuf et al., 2002; Howell et al., 2004; Dubourdieuet al., 2006 ; Masneuf-Pomarede et al., 2006,Subileau, 2008).En lo relativo a la evolución de estos tioles olorososdurante la conservación del vino, sus contenidosdisminuyen generalmente, pero esta disminucióndepende en gran parte de los fenómenos de oxidaciónligados a esta conservación. Así los factores queprevienen la alteración del potencial reductor del vino(contacto limitado con el oxigeno, dióxido de azufre,lías, glutathion, antocianos) limitan estas pérdidas entioles olorosos (Murat et al., 2003).2. El sulfuro de dimetiloEl sulfuro de dimetilo (DMS) es un compuesto sulfurosoligero evidenciado por Du Plessis et Loubster (1974)en el vino, en el que sus umbrales de percepción olfativaeran del orden de 25 µg/l. Sus contenidos en losvinos jóvenes eran más bien inferiores a este umbral,pero podían alcanzar los 900 µg/l en vinos más evolucionados(Dagan 2006 y referencia mencionada). ElDMS es uno de los constituyentes importantes delaroma de trufas, una nota olfativa a menudo citadapara el bouquet de reducción de los grandes vinosSeminario TécnicoCompuestos azufrados volátiles en vinostintos y de los vinos de vendimia tardía (Du Plessis et Loubster, 1974; Spedding et Raut, 1982; Anocibar-Beloqui, 1998). En los vinos tintos, de débil concentraciónparece amplificar las notas de frutas rojas, mientrasque en fuertes concentraciones, contribuye a lasnotas de garriga, olivas y trufas (Ségurel, 2005; Escudroet al, 2007). Contrariamente sería percibido más biende manera negativa en los vinos blancos (Goniak etNoble, 1987).Durante la fermentación, el DMS es liberado por laacción de las levaduras a partir de aminoácidos azufrados,en especial la cisteina, el glutation, la S-adenosilmetionina(Schreier et al., 1974; De Mora et al., 1986;Anocibar Beloqui, 1998). Sin embargo, el DMS producidopor las fermentaciones es en gran medida eliminadopor arrastre por el CO2, ya que es muy volátil(punto de ebullición 37°C/1 atm). Así pues, sus contenidosen los vinos en proceso de finalizar su fermentaciónson generalmente muy inferiores a su umbral depercepción, pero pueden producirse en cantidadeselevadas, asociados a otros compuestos azufradosligeros nauseabundos, en los vinos que presentan eldefecto de olor a reducción (Park et al., 1994).No obstante, algunos trabajos han mostrado que loscontenidos en DMS se incrementan con el tiempo yla temperatura durante el proceso de envejecimientoen botella, hasta llegar ha alcanzar contenidos delorden de mg/L, (Marais, 1979; De Mora et al., 1986; DeMora et al., 1993; Anocibar Beloqui, 1998; Ségurel etal., 2004; Dagan, 2006). El DMS así producido duranteen el envejecimiento, sería percibido de manera favorableen la génesis del bouquet de reducción de losgrandes vinos tintos y de los vinos de vendimia tardía,contrariamente a su percepción en los vinos blancosjóvenes (ver más arriba). Estas informaciones sensorialesson sin embargo bastante limitadas y deberán sercompletadas para el conjunto de las variedades y desus diferentes tipos de vino.Por otra parte, un método de mediad de los precursoresdel DMS en el vino ha sido recientemente desarrollado,(Ségurel et al., 2005), el cual realiza una estimacióncorrecta del DMS susceptible de ser liberadoen el vino durante el envejecimiento (Ségurel et al.,2005). Además, estos trabajos han demostrado quela uva posee igualmente un PDMS. Entre los derivadosdel metil-sulfonium a día de hoy conocido enlas plantas (Howard et Russell, 1997), únicamente elSMM podría ser el precursor del DMS, presente en lauva, la SMM sería transmitida al vino, donde liberaríaDMS por medio de una reacción de degradación químicadurante su conservación. La formación de DMSseguiría un proceso químico lento, dependiendo dela duración y de las condiciones de conservación. Deesta manera, las diferencias en las concentraciones deDMS para vinos de edades equivalentes, se explicaríanesencialmente por las diferencias de PDMS inicialen el embotellado.Ponencias39

04. ¡Los compuestos volátiles no son todos perjudiciales! Los tioles varietales y el sulfuro de dimetiloLos análisis de uvas efectuados a día de hoy han reveladoun potencial en DMS extremadamente heterogéneo,y a veces muy elevado en algunas muestras deuva de la variedad Petit y Gros Manseng en estado desobremaduración, de hasta 4,5 mg/L (Dagan, 2006),mucho más elevado que los contenidos encontradosen la Garnacha y el Syrah en maduración tecnológica(Ségurel et al., 2004). Para las muestras de estas cuatrovariedades, las únicas estudiadas a día de hoy, elPDMS es dependiente de la variedad, del terreno y dela añada, y sus contenidos aumentan de manera muyimportante en estado de sobremaduración en el casode la variedad Manseng, los únicos estudios realizadosa día de hoy para este parámetro. Sin embargo, enalgunas de las muestras de estas cuatro variedades, elPDMS de las uvas, quizás mucho más elevado que enlos vinos correspondientes, la simple degradación químicano puede explicar estas pérdidas a veces considerablesde transmisión de PDMS. Las causas de estaspérdidas son a día de hoy desconocidas, pero existenvarias hipótesis que podrían explicarlas. La hipótesisde la degradación de la SMM por las levaduras es muyplausible, ya que ha sido descubierta recientementeuna nueva permeasa, capaz de transportar de maneraespecífica la SMM, que permitiría a la Saccharomycescerevisiae utilizar la SMM como fuente de azufre(Rouillon et al., 1999), pero la evolución de la SMM enla levadura no ha sido todavía estudiada. Sea cual sea,el DMS formado sería casi enteramente eliminado porarrastre por el gas carbónico durante la fermentaciónalcohólica o mediante simple vaporización mientrasel vino no esté en un medio cerrado.ConclusiónLos compuestos sulfurados juegan un papel importanteen el aroma de los vinos. Si los compuestos sulfuradosligeros, excepto el DMS, son sistemáticamentevectores de defectos organolépticos cuando superansus umbrales de detección olfativa, los compuestossulfurados más pesados pueden conferir notas olfativasmuy interesantes y refinadas. Es especialmente elcaso de los tioles varietales, caracterizados por sus notasde cítricos y de boj de los Sauvignon, que de unamanera general aportan frescor y afrutado a los vinos.El caso del DMS se muestra mucho más complejo sicabe, por una parte su efecto realzante en bajas concentraciones,pero que en elevadas concentracionespuede ser percibido negativamente en algunos tiposde vinos blancos.Así pues, disponemos a día de hoy de numerososelementos tecnológicos para controlar y dominar loscontenidos de estos compuestos en los vinos, no hayque olvidar que el aroma de un vino es un conjuntocomplejo, y que al exacerbar uno u otro de sus componentes,nos arriesgamos a desequilibrar el perfilaromático y ofrecer simplemente una caricatura.40

Influence of theTiming of NitrogenAdditions duringSynthetic GrapeMust Fermentationson FermentationKinetics andNitrogenConsumptionBeltran, G.; Esteve-Zarzoso, B.; Rozès, N.; Mas, A. AndGuillamón J.M.Unitat d’Enologia del Centre de Referència deTecnologia d’Aliments, Department Bioquímica iBiotecnologia, Facultat d’Enologia de Tarragona,Universitat Rovira i Virgili, Ramón y Cajal, 70, 43005Tarragona, Spain, and Bodegas Miguel Torres, MiquelTorres i Carbó 6, 08720 Vilafranca del Penedès,Barcelona, SpainNitrogen deficiencies in grape musts are one of the maincauses of stuck or sluggish wine fermentations. In thepresent study, we have supplemented nitrogen-deficientfermentations with a mixture of ammonium and aminoacids at various stages throughout the alcoholic fermentation.The timing of the nitrogen additions influencedthe biomass yield, the fermentation performance, thepatterns of ammonium and amino acid consumption,and the production of secondary metabolites. These nitrogenadditions induced a nitrogen-repressed situationin the cells, and this situation determined which nitrogensources were selected. Glutamine and tryptophan werethe main amino acids consumed in all the fermentations.Ammonium is the preferred nitrogen source for biomassproduction but was hardly consumed when it was addedin the final stages of the fermentation. The higher ammoniumconsumption in some fermentations correlatedwith a greater synthesis of glycerol, acetate, and acetaldehydebut with a lower synthesis of higher alcohols.KEYWORDS: Saccharomyces cerevisiae; AlcoholicFermentation; Amino acids; Ammonium; GAP1;MEP2Seminario TécnicoCompuestos azufrados volátiles en vinosINTRODUCTIONThe nitrogen composition of grape musts affects thegrowth and metabolism of yeast, the fermentationrate, and the completion of fermentation (1). Nitrogendeficiencies are one of the main causes of stuckor sluggish fermentations. One way of avoiding theseproblems is to add nutritional supplements, usuallyinorganic forms of nitrogen such as ammonium salts,to grape must prior to fermentation (2-4). These additionsare generally made empirically in wine cellars,and the initial nitrogen concentration in the must orthe nitrogen requirements of the usual yeast strainused in the cellar are not determined. Yeasts respondmetabolically to differences in nitrogen availability, sothis lack of control of nitrogen leads to differences inwine composition.Nitrogen affects yeast cells in two ways: it increasesbiomass production and stimulates the rate of sugarutilization. Nitrogen additions during the period of cellgrowth have resulted in maximum cell populations.Later additions during the stationary phase have hadno effect on the cell population but have increasedthe specific fermentation rate, thus reducing the lengthof the fermentation (2, 5, 6).Nitrogen supplementation affects the pattern of nitrogenuptake. Ammonium is a preferred yeast nitrogensource, and when plentiful, it represses the expressionof catabolic pathways by degrading other nitrogenouscompounds (7, 8). This mechanism, called nitrogencatabolite repression (NCR), has recently been studiedduring wine fermentations (9). It inhibits the uptake ofarginine and alanine and stimulates the consumptionof branched-chain and aromatic amino acids. Changesin the nitrogen uptake patterns influence the productionof aroma and spoilage compounds (particularlyhydrogen sulfide) and the amount of urea, the majorprecursor of the carcinogen ethyl carbamate (10 -1 3).The volatiles identified in wines are usually dominatedby fermentation products. Organic acids, higheralcohols, and esters are the main group of flavor compoundscoming from yeast metabolism (12). Higheralcohols can be produced either by the catabolicconversion of the branched-chain amino acids (viaEhrlich) or by the anabolic formation of these aminoacids de novo from a sugar substrate (14). An excess ofhigher alcohols (above 400 mg L -1 ) can be regarded asa negative influence on the quality of wine, but at theconcentrations generally found in wines (below 300mg L -1 ), they usually contribute to the desirable complexityof wine. Furthermore, these alcohols, togetherwith the acids in wine, are substrates for ester formation.Most esters, with the exception of ethyl acetate,impart a pleasant smell of fruits and flower notes inthe wine (15).Textos asociadosJ. Agric. Food Chem. 2005, 53, 996 - 100241

Influence of the Timing of Nitrogen Additions during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen ConsumptionAs mentioned, in winemaking, most of the nitrogenadditions are made empirically and do not take intoaccount the different nitrogen needs of the cell duringwine fermentation, the proper timing of theseadditions, or the nitrogen source added. In this study,we supplemented nitrogen-deficient fermentationswith a mixture of ammonium and amino acidsat different stages of the alcoholic fermentation. Wethen studied the effect of these additions on the fermentationkinetics, the consumption of organic andinorganic nitrogen throughout the fermentation, andthe influence of this consumption on the organolepticprofile of the wines. We also monitored the effectof the nitrogen supplementations on the NCR systemand the effect of the nitrogen-repressed situation onnitrogen uptake.MATERIALS AND METHODSStrain, Fermentations, and Sampling. A commercialSaccharomyces cereVisiae Var. bayanus wine strainQA23 (Lallemand S. A., Toulouse, France) was used inthis study. Fermentations were carried out in a syntheticgrape must (pH 3.3) as described by Riou et al. (16)but with 200 g L -1 of reducing sugars (100 g L -1 Glucoseand 100 g L -1 Fructose) and without anaerobic factors.Only the nitrogen content changed in the differentfermentations.The yeast assimilable nitrogen (YAN) content in thecontrol synthetic grape must was 300 mg N L -1 , ammoniacalnitrogen (NH4Cl) 120 mg N L -1 , and aminoacids 180 mg N L -1 (Table 2). This medium also contained426 mg L -1 of Proline, but it should not be consideredas assimilable nitrogen (17). The proportionsof the different amino acids and ammonium weremaintained in all the fermentations. Nitrogenlimitedfermentations were carried out with 60 mg L -1 of YAN(24 mg L -1 of ammoniacal nitrogen and 36 mg L -1 ofamino acid nitrogen), and 240 mg L -1 of YAN nitrogenwas added at different fermentation points (96 mg L -1of ammoniacal nitrogen and 144 mg L -1 of amino acidnitrogen).The supplementation points were chosen by monitoringthe decrease in density of the media. Density wasmeasured throughout the fermentation by weighing5 mL, and nitrogen was added when the density ofthe must was 1060 g L -1 (30 h after inoculation), 1040 gL -1 (72 h), 1020 g L -1 (144 h), and 1000 g L -1 (240 h). Fermentationstook place at room temperature (22-28 °C)in laboratory-scale fermenters: 2 L bottles filled with1.8 L of medium and fitted with closures that enabledthe carbon dioxide to escape and the samples to beremoved. Fermentations were in semi-anaerobic conditionssince limited aeration was necessary in orderto harvest samples for the subsequent analysis. Thepopulation inoculated in every flask was 2 106 cellmL -1 from dry yeast rehydrated in water at 37 °C.In the latter stages of the fermentation, the sugarconsumption was assayed by enzymatic kits (RocheApplied Science, Germany). Fermentation was consideredto be complete when the residual sugars werebelow 2 g L -1 . Cell growth was determined by absorbanceat 600 nm. Absorbance values were correctedfor the initial absorbance reading obtained for juice.Cells were harvested at different points during thefermentation so that mRNA could be analyzed. Flaskswere magnetically stirred to resuspend settled biomass,transferred to centrifuge tubes, and centrifugedat 5000 rpm for 5 min at room temperature to preventtemperature shock. Cell pellets were transferred to 1.5mL Eppendorf tubes and frozen immediately in liquidnitrogen. They were kept at -80 °C until they wereanalyzed. The supernatant of these samples was storedat -20 °C for extracellular metabolites and nitrogencontent analysis.Nitrogen Content Analysis. YAN was analyzed bythe formol index method (18), and the ammoniumcontent was quantified using an enzymatic method(Roche Applied Science, Germany). The individualamino and imino acids were analyzed by OPA andFMOC derivatizations, respectively, using the Agilent1100 Series HPLC equipped with a low-pressure gradientquaternary pump, a thermostated autosampler,a DAD ultraviolet detector, and a fluorescence detector(Agilent Technologies, Germany). The sample (2 íL)was injected into a 4.6 mm 250 mm 5 ím HypersilODS column (Agilent Technologies, Germany). Thegradient solvent system was: solvent A (16 mM sodiumacetate and 0.022% triethylamine, adjusted topH 7.2 with 1-2% acetic acid, and 0.6% tetrahydrofuran)from 100% at t ) 0 to 0% at t ) 18 min, and solventB (20% of 66 mM sodium acetate, adjusted to pH7.2 with 1-2% acetic acid, 40% acetonitrile and 40%methanol) from 0% at t ) 0 to 100% at t ) 18 min. Theanalysis temperature was 40 °C, and the flow rate was1.5 mL min -1 . Several dilutions of each sample wereanalyzed and averaged using the analysis software.The concentration of each amino acid was calculatedusing external and internal standards and expressedas mg L -1 . The software used was Agilent ChemStationPlus (Agilent Technologies, Germany).Ethanol, Glycerol, and Organic Acid Analysis. Ethanol,glycerol, and organic acids were analyzed in allthe samples at the end of the fermentation process.Analytical HPLC was carried out on a Hewlett- PackardHP 1050 connected to a Hewlett-Packard Integrator3395 equipped with an HP 1047 RI detector (AgilentTechnologies, Wilmington, DE) (19). The wine sample(450 íL) was mixed with 50 íL of formic acid (internalstandard), and 25 íL was injected into a 300 mm 7.8mm AMINEX HPX-87H column (BioRad, Hercules, CA).The solvent used was sulfuric acid 2.5 mM at 0.5 mLmin -1 . The analysis temperature was 60 °C. The con-42

centration of each metabolite was calculated usingexternal and internal standards.Fatty Acid Analysis. Fatty acids were extracted usingthe method published by Lo´pez et al. (20). AnalyticalGC was carried out on a Hewlett-Packard 6890N connectedto a computer with the ChemStation software(Agilent Technologies, Wilmington, DE). The extract(2 íL) was injected (splitless, 0.75 min) into a Tracer TRcolumn of 60 m 250 ím and 0.25 ím phase thicknesswith an HP automatic injector (Agilent). The temperatureprogram was 40 °C for 5 min followed by 2 °Cmin -1 to 240 °C (15 min). Injector and detector temperatureswere 220 and 240 °C, respectively. The carriergas was hydrogen at 60 mL min -1 . 2-Ethylphenol (0.2mg L -1 ) was added as internal standard. Internal patternswere used to estimate the quantity of the differentcompounds.Analysis of Higher Alcohols and Esters. Higheralcohols and esters were extracted by liquid/liquidextraction (wine 10 mL, 200 íL 1,1,2- trichlorotrifluoroethane,0.5 g NaCl), with n-decanol (0.2 mg L -1 ) asinternal standard (21). After agitation for 2 min andcentrifugation, the organic phase was extracted and 2íL was injected. The chromatographic program used isthe same as that used for the fatty acid analysis.Quantification was conducted by comparison withknown quantities of different products in a hydro alcoholicsolution.RNA Extraction and cDNA Synthesis. Total RNA wasisolated from yeast samples as described by Sierkstraet al. (22) and resuspended in 50 íL of DEPC-treatedwater. Total RNA suspensions were purified using theHigh Pure Isolation kit (Roche Applied Science, Germany)following the protocol provided by the manufacturer.RNA concentrations were determined usinga GenQuant spectrophotometer (Pharmacia, Canada),and the quality of RNA was verified electrophoreticallyon 0.8% agarose gels. Solutions and equipment weretreated so that they were RNase free, as outlined inSambrook et al. (23).Total RNA was reverse-transcripted with SuperscriptII RNase Hreverse transcriptase (Invitrogen, Carlsbad,CA) in a GenAmp PCR System 2700 (Applied Biosystems,Foster City, CA). Oligo (dT)12 -1 8 primer ( 0.5 íg,Invitrogen) was used with 0.8 íg of total RNA as templatein a reaction volume of 20 íL. Following the protocolprovided by the manufacturer, after denaturationat 70 °C for 10 min, cDNA was synthesized at 42°C for 50 min. Finally, the reaction was inactivated at70 °C for 15 min.Real-Time Quantitative PCR. The PCR primers usedin this study are ACT-F, TGGATTCCGGTGATGGTGTT,and ACT-R, CGGCCAAATCGATTCTCAA (ACT, for actinegene); GAP1-F, CTGTGGATGCTGCTGCTTCA, andSeminario TécnicoCompuestos azufrados volátiles en vinosGAP1-R, CAACACTTGGCAAACCCTTGA (GAP1, for generalamino acid permease gene); and MEP2- F, GG-TATCATCGCTGGCCTAGTG, and MEP2-R, ACAACGGCT-GACCAGATTGG (MEP2, for ammonium permeasegene) (9).They were all designed with the availableGenBank sequence data and the Primer Express software(Applied Biosystems) in accordance with theApplied Biosystems guidelines for designing PCR primersfor quantitative PCR. All amplicons were short,which ensured maximal PCR efficiency and, therefore,the most precise quantification.For each gene, a standard curve was made with yeastgenomic DNA. DNA extraction was performed as describedby Querol et al. (24), digested by RNase, andisolated by 2-fold phenol-chloroform extractions andethanol precipitation. Concentration was determinedusing a GeneQuant spectrophotometer (Pharmacia,Canada). Serial 10-fold dilutions of DNA were carriedout to yield DNA concentrations from 4 to 4 10-5 ngíL -1 . These dilution series were amplified (in duplicate)by SYBR PCR for each gene to obtain standard curves(see above). The standard curve displays the Ct valuevs log10 of each standard’s starting quantity. The startingquantity of the unknown samples was calculatedagainst the standard curve by interpolation, and geneexpression levels are shown as the concentration ofthe studied gene normalized with the concentrationof the housekeeping ACT gene.The real-time quantitative PCR reaction was performedusing SYBR Green I PCR (Applied Biosystems).In SYBR PCR, amplification is monitored by the gainin fluorescence of the double-strand-specific DNAbindingdye SYBR green. The 25 íL SYBR PCR reactionscontained 300 nM of each PCR primer, together with1 íL cDNA (or 5 íL of each DNA serial dilution for standardtubes) and one time SYBR master mix (AppliedBiosystems).All PCR reactions were mixed in 96-well optical plates(Applied Biosystems) and cycled in a PE AppliedBiosystems 5700 thermal cycler under the followingconditions: 50°C for 2 min, 95°C for 10 min, and 40 cyclesat 95°C for 15 s and at 60 °C for 60 s.The PE5700 cycler provided cycle-by-cycle measurementof the fluorescence emission from each PCRreaction. Analysis resulted in the assignation of athreshold cycle (Ct) value to each PCR reaction.The Ct value is the cycle number at which an increasein reporter fluorescence above a baseline signal canfirst be detected. The threshold was positioned to intersectthe exponential part of the amplification curveof positive reactions, as recommended by AppliedBiosystems.The Ct value is inversely proportional to the log of theamount of template in the PCR reaction; the lower theTextos asociados43

Influence of the Timing of Nitrogen Additions during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen ConsumptionCt value, the higher the concentration of template inthe PCR reaction. Assuming a 100% effective PCR amplification,a difference of one Ct value corresponds toa 21 ) 2-fold difference in the amount of template. Allsamples were analyzed in duplicate, and the expressionvalues were averaged by the analysis software(Applied Biosystems). The coefficient of variation in allsamples analyzed was less than 10%.RESULTSEffect of Nitrogen Addition on Fermentation Kineticsand Nitrogen Consumption. Five fermentationsstarted with a nitrogen content of 60 mg L -1 , whichis low enough for a fermentation to be sluggish buthigh enough for it to finish.Four of these nitrogen-deficient fermentations weresupplemented at different points with 240 mg L -1 ofYAN; the first one at a density of 1060 g L -1 , and thesecond, third, and fourth at 1040, 1020, and 1000 gL -1 , respectively. The remaining fermentation was notsupplemented, but subjected to nitrogen deficiencythroughout the process. As a fermentation control, weused the same medium with a nondeficient amountof nitrogen (300 mgN L -1 ) (9).Figure 1 shows the effect of nitrogen additions on O.D. measures throughout the fermentations studied.The nitrogendeficient fermentations had lower O. D.values than the control fermentation. When nitrogenwas added in the first half of the fermentations(density of 1060 and 1040), these effects were almostovercome, and the O. D. values were similar to thoseof the control fermentation. Additions at densities of1020 and 1000, however, had minimal effects on O. D.measures.and amino acid nitrogen. Unlike their effect on the O.D. values, the nitrogen additions clearly stimulated thefermentation regardless of when they were made. Inthe nitrogen-deficient fermentation, yeast consumedthe total YAN after the first day (data not shown).However, nitrogen was not completely consumed inthe control fermentation. The nitrogen additions wereall carried out when the initial YAN had already beendepleted, and the later the nitrogen was added, thelower the amount of YAN was consumed (Table 2).The ammonium consumed was 54% of the total YANconsumed in the control fermentation (Table 2), butthis proportion decreased when nitrogen was addedlater in the fermentation. Ammonium was proportionallypreferred as the nitrogen source when the additionswere made in the first half of the fermentations(N1060 and N1040). In later additions (N1020 andN1000), the small amount of nitrogen consumed wasmostly from amino acids.The consumption of amino acids was monitored atdifferent points during the fermentations. The yeast’spattern of amino acid utilization changes with thetime of YAN supplementation (Table 2). The aminoFigure 1. Effect of nitrogen additions on O. D.measures (λ = 600 nm) throughout synthetic grapemust fermentations. The arrows indicate the timeof addition.Table 1 summarizes the evolution of the fermentationand nitrogen consumption, measured as ammoniumTable 1. Determination of Yeast Assimilable Nitrogen (YAN) in the Fermentation Media, Represented bythe Amino Acid Fraction (YAN aas) and bythe Ammonium fraction (YAN NH 4+)density(ρ)time(h)control fermentation N addition at F) 1060 Naddition at ρ = 1040YAN NH 4+(mg NL - 1 )YAN aas(mg NL - 1 )time(h)YAN NH 4+(mg NL - 1 )YAN aas(mg NL - 1 )time(h)YAN NH 42+(mg NL - 1 )YAN aas(mg NL - 1 )1080 0 120 168 0 25 41 0 25 401060 30 70 98 36 0.5 (90 a ) 4 (145 a ) 36 0.1 41040 56 52 95 62 50 105 78 0.1 (92 a ) 4 (136 a )1020 96 36 98 96 45 104 120 68 1041000 168 35 98 168 42 108 192 65 110990 (end b ) 312 41 102 312 50 110 336 66 114density(ρ)time(h)N addition at ρ =1020 N addition at ρ = 1000 no N additionYAN NH 4+(mg NL - 1 )YAN aas(mg NL - 1 )time(h)YAN NH 4+(mg NL - 1 )YAN aas(mg NL - 1 )time(h)YAN NH 4+(mg NL - 1 )YAN aas(mg NL - 1 )1080 0 25 41 0 26 40 0 26 401060 36 0 7 36 0 7 36 0 51040 78 0 7 78 0 4 78 0 21020 150 0 (92 a ) 4 (143 a ) 150 0 4 150 0 11000 240 81 109 264 0 (99 a ) 2 (147 a ) 264 1 1990 (end b ) 408 88 118 456 100 130 504 1 144aNH 4+ and aas YAN content just after the nitrogen addition. b End of fermentation.

aminoacidsSeminario TécnicoCompuestos azufrados volátiles en vinosTable 2. Total Consumption of Amino Acids and Ammonia at the End of Each FermentationExpressed as mg N L -1acontrolconsumptionN1060consumptionN1040consumptionN1020consumptionN1000consumptionaIn the fermentations with nitrogen additions, post-add represents the nitrogen taken up after this addition.no Nconsumptionfull Nmediacontent total total post-add total post-add total post-add total post-add totalGln 47.4 25.5 34.9 22.1 24.5 11.8 29.0 16.2 23.1 10.3 12.8Trp 10.3 6.6 6.8 4.2 7.7 4.1 8.1 4.5 7.8 4.1 3.6Thr 9.9 9.4 3.6 1.4 2.6 0.7 2.0 0.2 1.9 0.1 1.8His 3.8 3.7 1.5 1.5 1.2 1.2 0.8 0.8 0.4 0.4 −Leu 4.7 4.2 2.6 1.1 1.8 0.8 1.4 0.4 1.2 0.2 1.0Ile 3.8 3.2 1.8 0.6 1.4 0.7 0.8 0.2 0.7 0.1 0.6Phe 2.8 2.4 1.2 0.4 1.3 0.5 1.2 0.4 0.9 0.1 0.8Val 5.1 3.0 1.6 0.4 1.1 0.1 1.0 − 1.1 − 1.0Ser 7.5 2.8 2.9 0.8 1.7 − 1.7 − 1.9 0.1 1.8Met 1.8 1.8 1.1 0.5 1.0 0.6 0.6 0.3 0.5 0.2 0.3Lys 1.9 1.1 0.7 − 1.0 0.9 1.0 0.9 0.1 − 0.2Arg 47.9 0.6 5.9 − 9.0 0.9 8.8 0.7 8.2 − 8.2Tyr 1.4 0.4 0.2 − 0.3 − 0.3 − 0.3 − 0.3Glu 11.8 0.5 2.3 − 2.0 − 2.7 0.2 2.5 − 2.5Gly 3.1 0.2 − − − − − − 0.3 − 0.4Ala 12.1 − 1.2 − 1.7 − 2.7 − 3.1 − 3.2Asp 4.2 − − − − − − − − − 0.1YAN aas 179.5 65.5 68.4 34.5 58.2 22.2 62.1 24.6 53.9 15.7 38.6YAN NH+ 4 120.0 79.2 64.9 39.5 51.4 26.0 29.5 4.1 25.4 − 25.4acids can be grouped in different sets according tothe preference of the cell in the different conditions.The amino acids that are most consumed are glutamineand tryptophan. Together they represented 32% ofthe total assimilable amino acids of the synthetic grapemust (Table 2), and regardless of the fermentationconditions, their consumption accounted for 50% to65% of the total amino acids consumed.On the other hand, the consumption of arginine, glutamate,glycine, alanine, and aspartate, which wereapproximately 44% of the total assimilable aminoacids in the medium (Table 2), was together hardly2% of the total amino acids consumed in the controlfermentation. The consumption of these amino acidswas much higher in the fermentations supplementedwith nitrogen. However, yeast cells only consumedthese amino acids before the nitrogen addition: thatis, when the fermentations were nitrogen-deficient.Last, there is one other set of amino acids, consistingof threonine, histidine, leucine, isoleucine, phenylalanine,valine, and methionine, which was consumedproportionally more in the control fermentation thanin the supplemented fermentations.GAP1 and MEP2 Gene Expression. The expression ofthe nitrogen transporters GAP1 and MEP2 was analyzedand quantified relative to the expression of thehousekeeping actine gene. Time zero was the expressionof yeast before inoculation (and after rehydration).Both genes were repressed in the first hoursafter inoculation in the must-like medium (Figure 2).In the nitrogen-deficient fermentation, these genesstarted to be activated/de-repressed after 30 h, whennitrogen was almost depleted. The expression of bothgenes increased continuously during the first days offermentation and peaked after 4 and 6 days for GAP1Figure 2. Gene expression of ammonium permease(MEP2) and general amino acid permease (GAP1) attime zero (before inoculation) and at different pointsduring the control fermentation and the nitrogendeficientfermentation (without nitrogen addition). Thedata were quantified by calculating the ratio betweenthe concentration of the studied genes normalized withthe concentration of the housekeeping ACT gene, andexpressed as a percentage (the quantity ratio 1 was setas 100%). YAN and ammonia consumption throughoutthe fermentations are also indicated.and MEP2, respectively. The expression of the genesdecreased in the last days of fermentation, after severaldays without a nitrogen source. On the other hand,the presence of residual nitrogen in the control fermentationrepressed these genes throughout.Textos asociados45

Influence of the Timing of Nitrogen Additions during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen ConsumptionFigure 3. Relative gene expression of GAP1 andMEP2 at different points in the first 24 h after thenitrogen addition. Time zero represents the pointjust before this addition. The data were calculatedas in Figure 2.Figure 3 shows the gene expression of GAP1 andMEP2 in the first 24 h after the nitrogen addition. Theywere both repressed in all the fermentations. However,the later the addition took place in the fermentationprocess, the longer it took for the genes to be repressed.When nitrogen was added at the end of thefermentation (density 1000), the effect was negligiblebecause of the low expression at this point.Analytical Profile. We analyzed the residual sugars,ethanol, glycerol, and acids in the wines obtainedfrom the different fermentations and such flavor compoundsas higher alcohols, volatile fatty acids, and esters,which arose from yeast metabolism (Table 3). Thelater the nitrogen addition was, the lower the concentrationof glycerol, acetic acid, and acetaldehyde was.The higher alcohol content was lower when excessnitrogen was available at the beginning of the fermentation(control fermentation and N1060). Thesedifferent concentrations were accounted for by theincrease in isoamyl alcohol and 2-phenylethanol.The concentration of these compounds increasedconsiderably in the fermentations with nitrogen additionsin the later phases (or no addition), and wereapproximately 2 and 5 times higher than in the controlfermentation. The increase in isoamyl alcohol didnot lead to a corresponding clear increase in its ester(isoamyl acetate) in these fermentations, and thephenyl-2-ethanol acetate ester only increased slightly.In fact, the differences in the concentration of thetotal acetate esters between the fermentations weredue to the concentration of ethyl acetate, which wasmore than 95% of the total acetate esters.Table 3. Secondary Metabolites Produced by Yeastsduring the Different Fermentations aIts concentration was higher in the control fermentationand the N1060 and 1040 fermentations, whichcorrelated with a higher acetate concentration. Thedifferences in the concentration of fatty acids andtheir esters were smaller in the final products of thefermentations.DISCUSSIONcontrolferm. N1060 N1040 N1020 N1000no NadditionAlcohols and Acids (gL 1)ethanol 98.7 97.2 98.0 98.0 98.7 101.1glycerol 6.56 6.57 6.32 6.11 5.78 6.12acetate 1.17 1.22 0.98 0.80 0.89 0.81acetaldehyde 0.33 0.28 0.26 0.25 0.24 0.22citrate 0.41 0.41 0.38 0.41 0.39 0.41succinate 0.13 0.21 0.27 0.26 0.23 0.23lactate 0.04 0.05 0.04 0.03 0.02 0.02Higher Alcohols (mg L 1)n-propanol 37 33 28 20 13 12isobutanol 11 13 16 16 16 16isoamylic alcohol 50 48 81 97 94 94phenyl-2-ethanol 11 21 42 46 53 43109 115 167 179 176 165Fatty Acids (mg L 1)isobutyric acid 0.39 0.40 0.43 0.39 0.50 0.41butyric acid 0.63 0.73 0.67 0.72 0.59 0.60isovaleric acid 0.63 0.37 0.30 0.44 0.80 0.60valeric acid 0.12 0.09 0.09 0.10 0.18 0.15hexanoic acid 2.06 1.58 1.40 1.53 1.90 1.85octanoic acid 2.30 1.95 1.84 2.34 2.43 2.49decanoic acid 0.39 0.37 0.21 0.19 0.14 0.46dodecanoic acid 0.16 0.14 0.09 0.16 0.32 0.286.70 5.63 5.02 5.87 6.86 6.83Acetate Esters (mg L 1 )ethyl acetate 35 35 32 25 19 28isobutyl acetate 0.023 0.024 0.012 0.016 0.011 0.011isoamyl acetate 0.49 0.46 0.39 0.69 0.39 0.29hexyl acetate 0.006 0.005 − − − −phenyl-2-ethanol acetate 0.21 0.37 0.41 0.47 0.41 0.2935.73 35.86 32.81 26.18 19.81 28.59Fatty Acid Esters (mg L 1)ethyl butyrate 0.224 0.220 0.163 0.232 0.164 0.124ethyl isobutyrate 0.006 0.005 0.006 0.005 0.004 0.007ethyl hexanoate 0.089 0.071 0.23 0.31 0.23 0.085ethyl octanoate 0.022 0.022 0.060 0.081 0.059 0.020ethyl decanoate 0.002 0.004 0.019 0.024 0.019 0.0040.343 0.322 0.478 0.652 0.446 0.240aValues are the average of two determinations and thecoefficient of variation in all the compounds analyzedwas less than 10% with the exception of decanoic acid(18%), dodecanoic acid (38%), ethyl octanoate (16%),and ethyl decanoate (29%).The addition of nitrogen to grape musts, especiallyin the form of ammoniacal nitrogen, is a commonwinemaking practice that prevents nitrogen-relatedfermentation problems. Several studies, in whichgrape musts were supplemented with diammoniumphosphate, have proved that nitrogen supplementscan optimize fermentation performance (2-4). In thepresent study, we supplemented a nitrogen-deficientsynthetic must with a mixture of ammonium and aminoacids at different stages of the alcoholic fermentation.Then we studied the effect of these additions on46

Seminario TécnicoCompuestos azufrados volátiles en vinosthe fermentation kinetics, the consumption of organicand inorganic nitrogen throughout the fermentation,and the influence of this consumption on the aromacompound profile of the wines.We observed a reduction in the fermentation lengthregardless of the time of addition and, consequently, areduction in the total fermentation time. However, thefermentation length decreased even further when nitrogenwas added during the exponential phase andyeast cells probably used this nitrogen for biomassproduction. These results largely agree with thosepreviously reported (2-4). However, the yeast strainQA23 used in this study seems to have low nitrogenrequirements. It used only 147 mg N L -1 in the controlfermentation and finished it with only 60 mg N L -1 .Agenbach (25) established that fermentations requirea minimal amount of 140 mg N L -1 to avoid gettingstuck. In fact, nitrogen demands and preferences arestrain dependent (26-28) and, therefore, it should betaken into account that we only used one strain.As in previous experimental studies (2, 6), we observedthat nitrogen additions during the period of cellgrowth resulted in an increase in cell biomass. Duringthe cell growth phase of the fermentation, most carbon-and nitrogen-containing compounds are divertedto biomass production. When growth stops,however, only small amounts of these nutrients arerequired, primarily for cell maintenance (3).The metabolism of nitrogen depends heavily on itsuptake through the different nitrogen transporters. Inthis study, we monitored the activity of the genes encodingtwo important permeases in the transport ofamino acids (GAP1) and ammonium (MEP2) throughoutfermentation. In a previous study (5), we observedthat both permeases were repressed in a nitrogen-richmedium by the mechanism called nitrogencatabolite repression (NCR). The present study confirmsthis repression because in the control fermentationtheir expressions were almost negligible andin the limiting nitrogen condition their expressionsdropped sharply at the beginning, when nitrogen wasstill available, and increased continuously when it wasnot. The NCR of both transporters was fast and effective,as seen with the nitrogen additions, although thecell response to the excess of nitrogen in the mediumwas quicker when the nitrogen addition was in thefirst half of fermentation. During the last stages of fermentation,ethanol content is high and it is well establishedthat the first target of ethanol toxicity is theplasma membrane (29, 30), which can be impaired fora long period of anaerobic growth. Therefore, the sensingsystem of the cell, mainly located in the plasmamembrane, may be affected by both effects (31).The moment of the fermentation process at whichthe NCR was established (by the nitrogen addition)determined the pattern of amino acid consumption.As previously reported (9), arginine, alanine, aspartate,glutamate, and glycine were the amino acids that weremost affected by the NCR because they were hardlyconsumed when there was an excess of nitrogen. Infact, they were not taken up until the medium was depletedof good nitrogen sources. These amino acidsmust be transported mainly by the general amino acidpermease (Gap1p) or by other specific permeases alsosubjected to NCR. A similar uptake pattern for theseamino acids was previously reported in both syntheticand natural grape juices (1, 26). On the other hand, inbrewing conditions (32) arginine and glutamine wererapidly consumed whereas ammonium uptake wasdelayed. Branched-chain and aromatic amino acidsbehaved in a completely different way.Except for tryptophan, they were mostly consumedin the first stages of the control fermentation: that is,when the cells were subjected to NCR from the beginningof the fermentation process. A common featureof the genes that encode the permeases of thebranched-chain amino acids (BAP1 and BAP2) andaromatic amino acids (TAT1 and TAT2) is that they areinduced in a nitrogen-rich medium (33, 34).Regardless of the time of addition, glutamine andtryptophan were the main amino acids consumed afterthe nitrogen additions, and therefore, they may bevery important for the yeast cell metabolism throughoutthe process.Ammonium accounted for 40% of the total YAN ofthe fermentation media. However, its consumptiondepended on the timing of the addition. Ammoniumis the preferred nitrogen source for biomass productionbut was hardly consumed when it was added inthe final stages of the fermentation. These differencesin ammonium uptake are difficult to explain in termsof permease regulation. In the present study and inour previous one (9), we detected that, the more nitrogenthere was in the fermentation media, the morerepressed the three MEP genes were. Marini et al. (35)have proposed two possible hypotheses to explainthis paradox: either the yeast possesses additionalammonium transport systems unrelated to the Mepproteins, or highly concentrated ammonium is takenup into the cells by simple diffusion.The timing of the nitrogen additions directly determinedthe likely aroma characteristics of the wines.Glycerol increased in the fermentations with higherbiomass production and higher ammonium consumption.The relationship between biomass formationand glycerol synthesis has already been reported(36- 38). Likewise, a higher glycerol yield was also observedon a synthetic glucose-rich medium when ammoniumwas used as the sole nitrogen source insteadof a mixture of ammonium and amino acids (39). Michnicket al. (40) also related the production of glycerolto the accumulation of acetate and acetaldehyde.Textos asociados47

Influence of the Timing of Nitrogen Additions during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen ConsumptionHigher alcohols were also affected by the changes innitrogen utilization. These compounds can be producedeither by the catabolic conversion of the branched-chainamino acids (via Ehrlich) or by the anabolicformation of these amino acids de novo froma sugar substrate (14, 15). Our results show that theanabolic route is of greater importance because theincrease in isoamyl alcohol and 2-phenyl ethanol wasinversely proportional to the consumption of leucineand phenylalanine, respectively.Furthermore, the closer the nitrogen concentrationis to the growth-limiting level, the higher the yield offusel alcohols is.There is also an inverse correlation between ammoniumconsumption and the production of fusel alcohols(12). A greater concentration of higher alcoholsdid not seem to determine an increase in esters. Incontrast, the acetate concentration seemed to determinea greater concentration of acetate esters, especiallyethyl acetate.In conclusion, our study shows the quantity and qualityof the nitrogen demands of the wine strain QA23.Although further studies should be carried out withother wine strains, our data show that cell growthand fermentation have different preferred nitrogensources. Nitrogen additions always improved fermentationperformance but had a minimal effect on biomassproduction when added in the second half ofthe fermentation. These nitrogen additions subjectedthe cells to NCR and changed the profile of nitrogenconsumption. The differences in the pattern of nitrogenconsumption were related to different aromacompound compositions in the wines. In our opinion,this study is a starting point for further investigationinto using an ammonium/amino acid mixture as nitrogensupplementation in the wine industry and theeffect that these additions have on yeast physiology,fermentation performance, and wine quality.ACKNOWLEDGMENTThis work was supported by grant AGL2000-0205-P4-03 from the Comisión Interministerial deCiencia y Tecnología, Spain.The authors wish to thank the language service of theRovira i Virgili University for revising the manuscript.LITERATURE CITED(1) Bisson, L. F. Influence of nitrogen on yeast and fermentationof grapes. In Proceedings of the InternationalSymposium on Nitrogen in Grapes andWine; Ranz, J. M., Ed.; American Society of Enologyand Viticology: Davis, CA, 1991.(2) Bely, M.; Sablayrolles, J. M.; Barre, P. Automatic detectionof assimilable nitrogen deficiencies duringalcoholic fermentation in oenological conditions.J. Ferment. Bioeng. 1990, 70, 246- 252.(3) Jiranek, V.; Langridge, P.; Henschke, P. A. Yeast nitrogendemand: selection criterion for wine yeastsfor fermenting low nitrogen musts. In Proceedingsof the International Symposium on Nitrogenin Grapes and Wine; Ranz, J. M., Ed.; AmericanSociety of Enology and Viticology: Davis, CA,1991. (4) Monteiro, F. F.; Bisson, L. F. Nitrogen supplementationof grape juice. I. Effect on aminoacid utilization during fermentation. Am. J. Enol.Vitic. 1992, 43, 1 -1 0.(5) Bely, M.; Sablayrolles, J. M.; Barre, P. Description ofalcoholic fermentation kinetics: its variability andsignificance. Am. J. Enol. Vitic. 1990, 41, 319-324.(6) Mendes-Ferreira, A.; Mendes-Faia, A.; Leao, C.Growth and fermentation patterns of SaccharomycescereVisiae under different ammoniumconcentrations and its implications in winemakingindustry. J. Appl. Microbiol. 2004, 97, 540-545.(7) Cooper, T. G. Nitrogen metabolism in SaccharomycescereVisiae. In The molecular Biology of theYeast Saccharomyces; Stratherm, J. N., Jones, E.W., Broach, J. R., Eds.; Cold Spring Harbor Laboratory:Cold Spring Harbor, New York, 1982.(8) ter Schure, E. G.; van Riel, N. A.; Verrips, C. T. The roleof ammonia metabolism in nitrogen cataboliterepression in Saccharomyces cereVisiae. FEMSMicrobiol. ReV. 2000, 24, 67- 83.(9) Beltran, G.; Novo, M.; Rozes, N.; Mas, A.; Guillamon,J. M. Nitrogen catabolite repression in SaccharomycescereVisiae during wine fermentations.FEMS Yeast Res. 2004, 4, 625-632.(10) Jiranek, V.; Langridge, P.; Henschke, P. A. Regulationof hydrogen sulfide liberation in wine-producingSaccharomyces cereVisiae strains by assimilablenitrogen. Appl. EnViron. Microbiol. 1995, 61, 461-467.48

(11) Ough, C. S. Influence of nitrogen compounds ingrapes in ethyl carbamate formation in wines.In Proceedings of the International Symposiumon Nitrogen in Grapes and Wine; Ranz, J. M., Ed.;American Society of Enology and Viticology: Davis,CA, 1991.(12) Rapp, A.; Versini, G. Influence of nitrogen compoundsin grapes on aroma compounds of wines.In Proceedings of the International Symposiumon Nitrogen in Grapes and Wine; Ranz, J. M.,Ed.; American Society of Enology and Viticology:Davis, CA, 1991.(13) Marks, V. D.; van der Merwe, G. K.; van Vuuren, H.J. Transcriptional profiling of wine yeast in fermentinggrape juice: regulatory effect of diammoniumphosphate. FEMS Yeast Res. 2003, 3,269-287.(14) Äyräpää, T. Biosynthetic formation of higher alcoholsby yeast. Dependence on the nitrogenousnutrient level of the medium. J. Inst. Brew. 1971,77, 276.(15) Lambrechts, M. G.; Pretorius, I. S. Yeast and its importanceto wine aroma. S. Afr. J. Enol. Vitic 2000,21, 97 -1 29.(16) Riou, C.; Nicaud, J. M.; Barre, P.; Gaillardin, C. Stationaryphasegene expression in SaccharomycescereVisiae during wine fermentation. Yeast 1997,13, 903-915.(17) Salmon, J. M.; Barre, P. Improvement of nitrogenassimilation and fermentation kinetics underenological conditions by derepression of alternativenitrogen-assimilatory pathways in an industrialSaccharomyces cereVisiae strain. Appl.EnViron. Microbiol. 1998, 64, 3831-3837.(18) Aerny, J. Compose´s azote´s des mouˆts et vins.ReV. Suisse Vitic. Arboric. Hortic. 1996, 28, 161 -165.(19) Torija, M. J.; Beltran, G.; Novo, M.; Poblet, M.; Rozes,N.; Mas, A.; Guillamon, J. M. Effect of organic acidsand nitrogen source on alcoholic fermentation:study of their buffering capacity. J. Agric. FoodChem. 2003, 51, 916-922.(20) Lopez, R.; Aznar, M.; Cacho, J.; Ferreira, V. Determinationof minor and trace volatile compounds inwine by solid-phase extraction and gas chromatographywith mass spectrometric detection. J.Chromatogr. A 2002, 966, 167 -1 77.Seminario TécnicoCompuestos azufrados volátiles en vinos(21) Ferreira, V.; Sharman, M.; Cacho, J.; Dennis, J. Newand efficient microextraction/solid-phase extractionmethod for the gas chromatographic analysisof wine volatiles. J. Chromatogr. A 1996, 731,247-259.(22) Sierkstra, L. N.; Verbakel, J. M.; Verrips, C. T. Analysisof transcription and translation of glycolyticenzymes in glucoselimited continuous culturesof Saccharomyces cereVisiae. J. Gen. Microbiol.1992, 138, 2559-2566.(23) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Methods inYeast Genetics: A Laboratory Manual, 2 ed.; ColdSpring Harbor Laboratory: Cold Spring Harbor,New York, 1989.(24) Querol, A.; Barrio, E.; Ramon, D. A comparative studyof different methods of yeast strain characterization.Syst. Appl. Microbiol. 1992, 21, 315-323.(25) Agenbach, W. A. A study of must nitrogen contentin relation to incomplete fermentations, yeastproduction and fermentation. Proc. South Afr.Soc. Enol. Vitic. 1977, 87.(26) Jiranek, V.; Langridge, P.; Henschke, P. A. Aminoacid and ammonium utilization by SaccharomycescereVisiae wine yeasts from a chemical definedmedium. Am. J. Enol. Vitic. 1995, 46, 75-83.(27) Manginot, C.; Roustan, J. L.; Sablayrolles, J. M. Nitrogendemand of different yeast strains duringalcoholic fermentation. Importance of the stationaryphase. Enzyme Microb. Technol. 1998, 23,511-517.(28) Ough, C. S.; Huang, D. A.; Stevens, D. Amino aciduptake by four commercial yeasts at two differenttemperatures of growth and fermentation:Effects on urea excretion and readsorption. Am.J. Enol. Vitic. 1991, 41, 26-40.(29) Alexandre, H.; Rousseaux, I.; Charpentier, C. Relationshipbetween ethanol tolerance, lipid compositionand plasma membrane fluidity in SaccharomycescereVisiae and Kloeckera apiculata.FEMS Microbiol. Lett. 1994, 124, 17-22.(30) Alexandre, H.; Rousseaux, I.; Charpentier, C. Ethanoladaptation mechanisms in SaccharomycescereVisiae. Biotechnol. Appl. Biochem. 1994, 20,173 -1 83.(31) Gagiano, M.; Bauer, F. F.; Pretorius, I. S. The sensingof nutritional status and the relationship to filamentousgrowth in Saccharomyces cereVisiae.FEMS Yeast Res. 2002, 2, 433-470.Textos asociados49

Influence of the Timing of Nitrogen Additions during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen Consumption(32) Pierce, J. S. The Margaret Jones Memorial Lecture:Amino acids in malting and brewing. J. Inst. Brew.1982, 88, 228-233.(33) Forsberg, H.; Ljungdahl, P. O. Sensors of extracellularnutrients in Saccharomyces cereVisiae. Curr.Genet. 2001, 40, 91 -1 09.(34) Regenberg, B.; During-Olsen, L.; Kielland-Brandt,M. C.; Holmberg, S. Substrate specificity and geneexpression of the amino acid permeases in SaccharomycescereVisiae. Curr. Genet. 1999, 36,317-328.(35) Marini, A. M.; Soussi-Boudekou, S.; Vissers, S.; Andre,B. A family of ammonium transporters in SaccharomycescereVisiae. Mol. Cell Biol. 1997, 17,4282-4293.(36) Bakker, B. M.; Overkamp, K. M.; van Maris, A. J.;Kotter, P.; Luttik, M. A.; van Dijken, J. P.; Pronk, J. T.Stoichiometry and compartmentation of NADHmetabolism in Saccharomyces cereVisiae. FEMSMicrobiol. ReV. 2001, 25, 15-37.(37) Radler, F.; Schu¨tz, H. Glycerol production of variousstrains of Saccharomyces. Am. J. Enol. Vitic.1982, 33, 36-40.(38) Watanabe, M.; Uehara, M.; Shinohara, T. Effect ofcell number on the formation of glycerol andsome volatile components by yeast. J. Brew. Soc.Jpn. 1982, 77, 346.(39) Albers, E.; Larsson, C.; Liden, G.; Niklasson, C.; Gustafsson,L. Influence of the nitrogen source onSaccharomyces cereVisiae anaerobic growthand product formation. Appl. EnViron. Microbiol.1996, 62, 3187-3195.(40) Michnick, S.; Roustan, J. L.; Remize, F.; Barre, P.; Dequin,S. Modulation of glycerol and ethanol yieldsduring alcoholic fermentation in SaccharomycescereVisiae strains overexpressed or disrupted forGPD1 encoding glycerol 3-phosphate dehydrogenase.Yeast 1997, 13, 783-793.Received for review August 2, 2004. Revisedmanuscript received November 12, 2004. AcceptedNovember 17, 2004.50

Formación decompuestos volátilesazufrados porlevaduras vinicas.Swigers, J. H.; Pretorius, I.S.Australian Wine Research Institute AWRI.El artículo íntegramente reproducido a continuación sepublico on line en Applied Microbiol Biotechnol en Enerode 2007.ResumenLos compuestos de azufre en el vino constituyenuna espada de doble filo. Por una parte, ciertos compuestosvolátiles que contienen azufre como el sulfurode hidrógeno ofrecen un aroma similar a huevospodridos, por lo que pueden afectar negativamentea la calidad sensorial del vino pero, por otra parte,algunos compuestos de azufre como el 3-mercaptohexanol,que proporciona notas afrutadas, puedetener un impacto positivo sobre el sabor y el aromadel vino. Además, estos compuestos se pueden volvermás o menos atractivos o repulsivos dependiendo desus concentraciones absolutas y relativas. Por consiguientees un desafío interesante que los vinicultoresmodulen las concentraciones de tales compuestosdeterminantes de la calidad del vino según las preferenciasde los consumidores. La levadura del vino,Saccharomyces cerevisiae, desempeña un papel claveen la producción de compuestos volátiles de azufre.A través de la ruta de la secuencia de reducción delsulfato se forma HS-, el cual puede conducir a la formaciónde sulfuro de hidrógeno y diversos mercaptanos.Por tanto, limitar la formación del ión HS es unobjetivo importante en la ingeniería metabólica deesta levadura. La levadura del vino también es responsablede la transformación de precursores de azufreno volátiles presentes en la uva, en tioles volátiles conpropiedades aromatizantes. En particular, 4-mercapto-4-metilpentan-2-ona,3-mercaptohexanol y acetatode 3-mercaptohexilo son los tioles volátiles másimportantes que añaden aromas afrutados al vino. Elpresente documento revisa brevemente el procesometabólico implicado en la producción de importantescompuestos volátiles de azufre y las principalesestrategias a la hora de conseguir desarrollar cepas delevaduras como herramienta para ajustar el aroma delvino a las especificaciones del mercado.Palabras clave: Aroma . Sabor . Bebidas fermentadas. Tioles . Vino . LevaduraSeminario TécnicoCompuestos azufrados volátiles en vinos1- IntroducciónEl azufre es un elemento abundante en la naturaleza ypresente en muchos compuestos. Puede presentarseen forma oxidada (sulfato) o reducida (sulfuro). El azufrees uno de los elementos más importantes necesariospara la vida, particularmente como componentede los aminoácidos cisteína y metionina, y también esun componente de cofactores esenciales. Los microorganismospueden metabolizar los compuestos deazufre a través de dos rutas. En la ruta de reducciónasimilativa del azufre se toma sulfato y se utiliza para labiosíntesis de compuestos orgánicos como la cisteínay la metionina. En la ruta de reducción disimilativa delsulfato, la molécula de sulfato se reduce como partede una ruta respiratoria a sulfito o sulfuro. Ninguno deestos metabolitos se vuelve a metabolizar y la mayoríase excreta (Kappler y Dahl 2001). La ruta anterior esrealizada por bacterias reductoras de sulfato que estánampliamente distribuidas en ambientes anaeróbicoscomo el suelo, los sedimentos, agua de mar y aguadulce y en la boca e intestino de muchos animales(Purdy et al. 2002). Los microorganismos también soncapaces de descomponer los aminoácidos con azufrecisteína y metionina para formar sulfuros y posteriormenteotros compuestos volátiles de azufre y tioles(Dainty et al. 1989; Russell et al. 1995; Bonnarme et al.2000; Seefeldt y Weimer 2000; Morales et al. 2005).La levadura de vino Saccharomyces cerevisiae esresponsable de la producción de varios compuestosvolátiles de azufre que afectan a la calidad sensorialdel vino. Estos importantes compuestos volátiles deazufre son: (1) sulfuro de hidrógeno (aroma a huevospodridos); (2) metanotiol (metilmercaptano; aroma acol cocida); (3) dimetilsulfuro, dimetildisulfuro y dimetiltrisulfuro(aromas a col, coliflor y ajo); (4) metiltioesteres(tioacetato de S-metilo, tiopropanato de S-metiloy tiobutanato de S-metilo; aromas a coliflor cocida,queso y cebolleta); y (5) los “tioles volátiles afrutados”del vino (aromas a maracuyá, pomelo, grosella espinosa,guayaba y aromas a boje; Swiegers y Pretorius2005; Swiegers et al. 2006). Durante la fermentacióndel vino, la reducción asimilativa de sulfato por la levadura(para biosintetizar cisteína y metionina) puedeproducir un exceso de iones HS-, lo que genera la formaciónH 2S en el vino (Jiranek et al. 1995; Spiropouloset al. 2000; Mendes- Ferreira et al. 2002; Swiegers et al.2005a). Esto es probablemente uno de los problemasmás comunes en una bodega y, si no se trata, el vinoresultante estará contaminado provocando una pérdidade calidad y la posibilidad de que sea rechazadopor los consumidores (Vos y Gray 1979; Henschke y Jiranek1991; Rauhut 1993). Los vinos fermentados finalizadosa menudo se tratan con sulfato de cobre conel fin de que reaccione con los compuestos de azufrepara formar complejos estables y, por tanto, eliminarlos efectos negativos del H 2S y de los mercaptanos.No obstante no es deseable utilizar sulfato de cobreen el vino. La concentración de H S producido duranteApplied Microbiol Biotechnol, Enero de 2007 (on line)Textos asociados51

Formación de compuestos volátiles azufrados por levaduras vinicasla fermentación del vino depende de varios factorescomo la presencia de compuestos de azufre, la cepade la levadura, las condiciones de fermentación y losnutrientes del zumo de uva (Henschke y Jiranek 1991;Rauhut 1993; Spiropoulos et al. 2000). No obstante,algunas cepas parecen producir H 2S intrínsecamentesin que les afecten las condiciones ambientales,lo que posiblemente indica un defecto metabólico(Jiranek et al. 1995; Spiropoulos et al. 2000; Mendes-Ferreira et al. 2002).Por otra parte, las levaduras de vino pueden producircompuestos volátiles de azufre beneficiosos parala calidad del vino. Algunos de estos son el furfuriltiol,un compuesto identificado en el aroma del PinotManseng blanco, tintos de Burdeos, y en las duelastostadas (Tominaga et al. 2000). El furfuriltiol es unaromatizante extremadamente potente (umbral depercepción de 0,4 ng/l) y también se ha identificadoen el café tostado, la carne, el pan de trigo y en laspalomitas de maíz. Se cree que la levadura forma elfurfuriltiol mediante la transformación del furfural liberadodurante la fermentación a partir de las duelasde roble tostadas (Tominaga et al. 2000).Otros tioles volátiles que mejoran el aroma producidospor la levadura a partir de los precursores dela uva son el 4-mercapto-4-metilpentano- 2-ona(4MMP), el 3-mercaptohexan-1-ol (3MH) y el acetatode 3-mercaptohexilo (3MHA). Los tioles volátiles sonextremadamente potentes y tienen umbrales de percepciónbajos: 0,8 ng/l (4MMP), 60 ng/l (3MH) y 4 ng/l(3MHA). En los Sauvignon Blanc, estos compuestosson de particular importancia para diversos caracteresdado que ofrecen aromas a “boje” (4MMP), “maracuyá”,“pomelo”, “grosella espinosa” y guayaba (3MH y 3MHA;Tominaga et al. 1995, 1998a,b; Dubourdieu et al. 2006).No obstante, también se han identificado 4MMP, 3MHy 3MHA en distintas concentraciones en vinos elaboradosa partir de uvas Colombard, Riesling, Semillon,Merlot y Cabernet Sauvignon, por lo que también podríanafectar al aroma y la calidad de tales vinos (Tominagaet al. 1995, 1998a,b; Murat et al. 2001b).levadura del vino que resultan en la producción decompuestos volátiles de azufre. Además, se discutenlos últimos avances en la modificación del metabolismodel azufre de la levadura del vino para mejorar elsabor y el aroma del vino.2.- Mecanismo de formación de azufrevolátil2.1 Formación de sulfuro de hidrógenoa través de la ruta de secuencia dereducción de sulfato.La levadura del vino puede formar metabólicamenteH 2S a partir de compuestos inorgánicos de azufrecomo los sulfatos y sulfitos, así como de compuestosorgánicos como la cisteína y el glutatión (Henschkey Jiranek 1993; Rauhut 1993; Hallinan et al. 1999; Spiropouloset al. 2000). En general, la uva debe ser deficienteen compuestos orgánicos de azufre, ya queéstos pueden activar la síntesis de tales compuestosde azufre a partir de fuentes inorgánicas habitualmenteabundantes en el mosto (Henschke y Jiranek1993; Park et al. 2000; Moreira et al. 2002). En la S. cerevisiae,H 2S es el producto de la ruta de la secuenciade reducción de sulfato (SRS) (Fig. 1; Yamagata 1989;Rauhut 1993). En la ruta SRS, el H 2S procede del iónHS-, un intermedio metabólico de la reducción delsulfato o sulfito necesario para la síntesis de compuestosorgánicos de azufre. Si durante la fermentaciónestas reacciones se producen en presencia de unFig. 1 Un diagrama que representa la ruta SRSy la biosíntesis de aminoácidos en S. cerevisiae.Adenosil 5′-fosfosulfato (APS); 3′-fosfoadenosil5′-fosfosulfato (PAPS); O-acetilserina (O-AS);O-acetlilhomoserina (O-AH)El desafío de la enología moderna es limitar (o eliminar)la producción de H 2S y mercaptanos indeseablesy, al mismo tiempo, mejorar la producción de tiolesvolátiles beneficiosos. El uso de sulfato de cobre introduceun interesante dilema para el vinicultor, yaque es utilizado para tratar vinos contaminados conH 2S y mercaptanos, pero al mismo tiempo reduce laconcentración de tioles volátiles deseables ya que elión Cu2+ no discrimina entre los dos tipos de compuestosde azufre. Por tanto, la mejor solución yaceen el desarrollo de levaduras que produzcan durantela fermentación concentraciones absolutas y relativasde tioles volátiles que mejoren el aroma sin la formaciónde H 2S ni mercaptanos (Pretorius 2000; Pretoriusy Bauer 2002). En el siguiente apartado de este documentose detallan los elementos metabólicos de la52

aporte adecuado de nitrógeno, el ión HS- es captadopor la O-acetilserina y la O-acetilhomoserina, que sonproductos derivados del metabolismo del nitrógeno,para formar compuestos orgánicos de azufre comometionina y cisteína (Henschke y Jiranek 1993; Park etal. 2000; Moreira et al. 2002). Sin embargo cuando lasfuentes de nitrógeno son insuficiente o inadecuadas,el H 2S puede acumularse en la célula y pasar al mostoen fermentación por difusión (Vos y Gray 1979; Henschkey Jiranek 1991; Giudici y Kunkee 1994; Jiranek etal. 1995, 1996).Parece que, al menos parcialmente, la capacidad deproducción de H 2S de una cepa determinada es genética,ya que la producción de H 2S de diferentes cepasvaría en las mismas condiciones (Thornton y Bunker1989; Henschke y Jiranek 1993; Jiranek et al. 1995; Spiropouloset al. 2000). El primer paso de la ruta metabólicaSRS implica el transporte del sulfato desde elmedio hasta la célula de levadura mediante la sulfatopermeasa. El sulfato se reduce a continuación a sulfuroa través de una serie de pasos que implican el usode la enzima ATP-sulfurilasa (que emplea dos moléculasde ATP) y de la sulfito reductasa. El siguiente pasoconduce la captación del sulfuro: la O-acetilserina (delaminoácido serina) se combina con el sulfuro para formarcisteína, y la O-acetilhomoserina (del aminoácidoaspartato) se combina con el sulfuro para formar homocisteína,la cual se puede convertir en metionina(Thornton y Bunker 1989; Yamagata 1989; Henschkey Jiranek 1993; Rauhut 1993; Jiranek et al. 1995; Spiropouloset al. 2000).Dado que las concentraciones de cisteína y metioninaen los zumos de uva habitualmente no son suficientespara cubrir las necesidades metabólicas de las célulasen crecimiento, se activa la ruta metabólica SRS paracubrir esta demanda (Henschke y Jiranek 1993). Cuandoexiste una cantidad adecuada de nitrógeno en elmedio, existirán suficientes precursores de estos aminoácidos(O-acetilserina y O-acetilhomoserina) paracaptar el sulfuro. Si la cantidad de nitrógeno es limitada,no habrá suficientes precursores; la ruta SRS seactivará y el sulfuro se acumulará debido a la ausenciade precursores. El exceso de sulfuro se libera de las célulasen forma de H 2S (Henschke y Jiranek 1993; Rauhut1993; Jiranek et al. 1995; Spiropoulos et al. 2000).Algunas veces, se producen cantidades importantesde H 2S cuando en el producto en fermentación haysulfito, el cual se difunde hacia las células. Por tanto,en condiciones de poco nitrógeno, se observa unaproducción elevada y continua de H 2S en presenciade sulfito (Jiranek et al. 1995; Hallinan et al. 1999).Otros factores ambientales que pueden afectar a la producciónde H 2S son (1) niveles elevados de azufre elemental,(2) presencia de dióxido de azufre, (3) presenciade compuestos orgánicos con azufre, (4) deficienciade pantotenato, (5) alto contenido relativo de treoninacon respecto a otros aminoácido y (6) de metioninaSeminario TécnicoCompuestos azufrados volátiles en vinoscon respecto a la concentración de amonio (Henschkey Jiranek 1991; Rauhut 1993; Spiropoulos et al. 2000).En un estudio se ha investigado recientemente elpapel de la enzima bifuncional O-acetilserina/Oacetilhomoserinatiolasa como medio para modularla producción de H 2S por la levadura industrial (Spiropoulosy Bisson 2000). El estudio demostró que lasobreexpresión del gen MET17, que codifica la O-acetilserina/O-acetilhomoserina tiolasa, en una cepade S. cerevisiae originó que se formara mucho menosH 2S en un vino en fermentación. Sin embargo esto nosucedió en otra cepa de S. cerevisiae con sobreexpresiónde MET17, lo que indica que la actividad de laO-acetilserina/O-acetilhomoserina tiolasa no está directamenterelacionada con la formación de H 2S (Spiropoulosy Bisson 2000).Se ha demostrado que la sobreexpresión de dos genes,el MET14, que codifica una adenosilfosfosulfatocinasa, y SSU1, que codifica un portador de sulfito, aumentala formación de sulfito (Donalies y Stahl 2002).Por tanto, se ha postulado que la ausencia del genMET14 o del gen MRX1, que codifican una metioninasulfoxido reductasa, podría ser la manera más eficazde impedir que la levadura del vino produzca H 2Sdurante la fermentación (Pretorius 2000, 2003, 2004;Pretorius y Høj 2005).Otro método para evitar la formación de H 2S fue lamodificación de la actividad de la enzima sulfito reductasamediante la alteración de una de las subunidadesde la enzima (Sutherland et al. 2003). La sulfitoreductasa es un heterotetrámero compuesto de dossubunidades α y dos subunidades β, las cuales soncodificadas por los genes MET10 y MET5 respectivamente(Sutherland et al. 2003). La enzima, una hemoflavoproteína,enlaza los cofactores flavín adeninadinucleótido, flavín mononucleótido y sirohemo. Seintrodujeron mutaciones en el gen MET10 de modoque la subunidad α no se pudiera enlazar a los cofactorespero pudiera formar aun un complejo proteínicoheterotetrámetro con la subunidad β. De este modo,la sobreexpresión del gen MET10 mutante produciríauna subunidad no funcional que podría reducir la proporciónde sulfito reductasa funcional en la célula, ypor tanto reducir la formación de sulfuro. Sin embargo,es necesario investigar más para confirmar si estaestrategia es capaz de evitar la formación de H 2S en elvino en fermentación.El H 2S es muy reactivo y se puede combinar con otroscomponentes del vino para formar compuestos volátilesde azufre relacionados (Vermeulen et al. 2005).Por ejemplo, el etanotiol se puede formar por reacciónde H 2S con etanol o acetaldehído (Amerine et al.1980; Rauhut 1993). En el vino, se piensa que la formaciónde disulfuro de dimetilo, trisulfuro de dimetiloy tetrasulfuro de dimetilo se produce mediante laoxidación del metanotiol, un compuesto que se con-Textos asociados53

Formación de compuestos volátiles azufrados por levaduras vinicassidera procedente de la descomposición de la metionina(Rauhut 1993). La concentración de disulfuro dedimetilo encontrada en algunos vinos está muy porencima del umbral sensorial de 25 μg/l (vino blanco)y 60 μg/l (vino tinto; Rauhut 1993). En bajas concentraciones,se considera que el disulfuro de dimetilo esun compuesto beneficioso que contribuye al aromaasociado al tiempo de maduración en botella (Rauhut1993; Ribéreau-Gayon et al. 2000).2.2. Formación de tioles volátilesmediante la levadura a través de carbonotiolasasSe ha propuesto que la formación de furfuriltiol a partirde furfural por la S. cerevisiae es catalizada por la enzimacisteína desulfidrasa, la cual es necesaria para la producciónde cisteína (Tominaga et al. 2000). Por tanto el aniónHS- se produce a través de esta enzima, originando laformación de H 2S. La formación de H 2S mejora a su vezla formación de furfuriltiol a partir de furfural. Esto se haconfirmado al observar que el vino en fermentación conuna fuente añadida de nitrógeno (por tanto se inhibe laformación de H 2S) no produce tanto furfuriltiol. Por consiguiente,la producción de furfuriltiol se vincula a la produccióndel anión HS-, el cual no se produce cuando elsulfato de amonio se añade a un caldo en fermentaciónen cantidades suficientes (Tominaga et al. 2000).Los tioles volátiles 4MMP, 3MH y 3MHA son prácticamenteinexistentes en el zumo de uva y solamente sedesarrollan durante la fermentación (Fig. 2). No obstante,se ha demostrado que 4MMP y 3MH existen enla uva en forma de conjugados enlazados a la cisteínano volátiles y que la levadura del vino es responsablede extraer el tiol del precursor (Darriet et al. 1995).Ciertos experimentos demuestran que una célula deun extracto de enzima libre de célula de la Eubacteriumlimosum (que contiene enzimas carbono–tiolasa)podría liberar 4MMP de su precursor S-4-(4-metilpentan-2-ona)-Lcisteína(Cis-4MMP) lo que indica quela presencia de un mecanismo similar de liberación através de las carbono-tio-lasas de la levadura es másprobable durante la fermentación del vino (Tominagaet al. 1995). La hipótesis de Tominaga et al. (1995) secomprobó investigando la capacidad de la levadurade liberar 4MMP a partir de Cis-4MMP cuando se eliminanlos genes que codifican las posibles carbonotio-lasasen una cepa de laboratorio de S. cerevisiae(Howell et al. 2005). Cuatro genes, identificados comoresponsables de las posibles enzimas carbono–tiolasas,influyeron en la liberación del tiol volátil 4MMP,lo que indica que el mecanismo de liberación implicaprobablemente varios genes. Se eliminaron tambiénlos genes identificados en una variación homocigosade la levadura comercial VL3, y el resultado mostró quela eliminación de los cuatro genes asociados a la carbono–tio-lasaconducía a una disminución de la cantidadde 4MMP liberado (Howell et al. 2005). En esteúltimo estudio no se observó que la sobreexpresiónde estos genes produjera un aumento de la liberaciónde 4MMP. No obstante, recientemente, nuestro gruposobreexpresó un gen heterolocigoso que codificauna enzima carbono-tio-lasa en una levadura comercialampliamente utilizada (VIN13) y demostró comoconclusión que, en vinos en fermentación modelos, lacepa VIN13 modificada liberaba diez veces más 4MMPy 3MH de sus precursores sintetizados químicamenteque la cepa control VIN13. Además, el vino SauvignonBlanc producido por la levadura modificada tuvo unmuy potente aroma no detectado en el vino control.Por tanto, es posible modificar levaduras para utilizarmás precursores de tioles derivados de la uva y portanto mejorar el aroma del vino (Swiegers et al. sinpublicar).Se ha demostrado anteriormente que la cantidadliberada de 4MMP en el vino depende de qué cepade levadura se utilice para llevar a cabo la fermentación(Dubourdieu et al. 2006). Por tanto, la genética yla fisiología de la cepa determinan su capacidad paraliberar tioles volátiles. Algunos estudios del primer trabajoindicaron que las cepas comercialmente disponiblesde S. cerevisiae VL3 y EG8 liberan más tioles quelas cepas VL1 y 522d. Además, las cepas de Saccharomycesbayanus liberan más 4MMP que las cepas deS.cerevisiae VL3 y EG8. Los vinos confeccionados concepas híbridas de S.bayanus/S. cerevisiae muestranun contenido superior de tioles volátiles (Murat et al.2001b). Estos hallazgos se han confirmado al observarque diferentes cepas comerciales tienen capacidadesdiferentes de liberación de 4MMP a partir del precursorCis-4MMP en vinos modelo en fermentación (Howellet al. 2004). Howell et al. (2004) han identificado cepascomerciales de levaduras que liberan aún más tiolesque VL3. En un estudio de seguimiento, el SauvignonBlanc producido por siete cepas diferentes de levaduradel vino (VL3 entre ellas) mostró perfiles únicosde tioles volátiles, siendo la cepa VIN7 la que produjomayor concentración de 4MMP y 3MHA, mientrasque VIN13 produjo mayores concentraciones de 3MH(Swiegers et al. 2006). Se ha demostrado que durantela fermentación, el 3MHA se forma a partir del 3MH porla acción de la alcohol acetiltransferasa que forma ésteresy que es codificada por el gen ATF1 (Swiegers etal. 2005b). La sobreexpresión del gen ATF1 en la cepade levadura VIN13 produjo un aumento significativode la cantidad de 3MHA producido. Por otra parte, lasobreexpresión del gen IAH1, el cual codifica un enzimaque descompone ésteres, produjo una reducciónen la concentración de 3MHA. También se investigóla capacidad de diferentes levaduras comerciales paraconvertir 3MH en 3MHA durante la fermentación. Seobservaron grandes variaciones en la concentraciónde 3MHA y, en la mayoría de los casos, no correspondíancon la capacidad de liberación de 4MMP de laslevaduras (Swiegers et al. 2005b). Por tanto, quedapuesto de manifiesto que la selección de la cepa delevadura es de máxima importancia en la modulación54

Seminario TécnicoCompuestos azufrados volátiles en vinosde las concentraciones de tioles en el vino.Se ha demostrado que cuando disminuye la concentracióndel precursor de tioles S-3- (hexan-1-ol)-L-cisteina (Cis-3MH), aumenta la cantidad de 3MHdurante la fermentación. No obstante, solamente unapequeña fracción (1,6%) del precursor enlazado a lacisteína presente originalmente se libera como 3MH(Dubourdieu et al. 2006). Además en mostos CabernetSauvignon y Merlot, se ha observado que la cantidadde 3MH liberada era proporcional a la concentraciónde Cis-3MH presente al inicio de la fermentación. Portanto, cuanto mayor es la concentración de precursoresde tioles conjugados a la cisteína en el mosto,mayor es la concentración de tioles volátiles en el vinoresultante (Murat et al. 2001a). No obstante, en el estudioanterior, solamente el 3,2% del precursor presenteoriginalmente en el mosto se liberó en forma de tiolesvolátiles durante la fermentación.Recientemente se ha determinado el impacto de latemperatura de fermentación sobre la concentraciónde tioles volátiles en un medio modelo y en zumo deuva. Se demostró que las concentraciones de 4MMP,3MH y 3MHA fueron mayores cuando se produjo lafermentación alcohólica a 20 °C con respecto a 13°C,independientemente de la cepa utilizada (MasneufPomarède et al. 2006). Por el contrario, Swiegers et al.(2006) ha demostrado que en vinos en fermentaciónmodelos, se libera más 4MMP y más 3MH se convierteen 3MHA a bajas temperaturas (18°C) en comparacióncon altas temperaturas (23 y 28 °C) al final de lafermentación. No obstante, al principio de la fermentación,hay más tioles volátiles en los caldos en fermentaciónmás calientes (Swiegers et al. 2006).3. ConclusiónEl objetivo final de todo vinicultor es conseguir unvino con unas características óptimas de calidad, precioy apariencia al consumidor (Pretorius 2006). Paralograr este objetivo, es necesario un control exhaustivodel método de producción, de las condiciones defermentación, de la elección de la cepa de levadura yde la producción de componentes que afectan favorablementea la calidad organoléptica del vino.Los compuestos volátiles de azufre son aromatizantesy saborizantes potentes que pueden tener un efectoTextos asociadosFig. 2 El vino es una mezcla muy compleja de compuestos derivados de la uva, de los microorganismo y, en algunos casos, delroble, que definen en gran medida su apariencia, aroma, sabor y sensaciones en el paladar (Swiegers et al. 2005ª). Los compuestosderivados de la uva distinguen al vino por su variedad y lo dotan de su estructura básica. La fermentación de los azúcares porparte de las levaduras no sólo produce etanol y dióxido de carbono, sino que también una gama de metabolitos menores peroimportantes organolépticamente que proporcionan el carácter del vino. Estos metabolitos volátiles que son ésteres, alcoholessuperiores, carbonilos, ácidos grasos volátiles y compuestos de azufre, son derivados del metabolismo de los azúcares y de losaminoácidos. Los tioles volátiles, particularmente 4MMP, 3MH y 3MHA, contribuyen de manera importante al aroma de los vinos,particularmente en variedades como la Sauvignon Blanc. Durante la fermentación del vino, la S. cerevisiae favorece la división deprecursores no volátiles con cisteína (Cis-4MMP y Cis-3MH) existente el zumo de uva para liberar 4MMP y 3MH. La ausencia detioles volátiles en la uva indica la importancia de la fermentación de la levadura para su formación (Swiegers et al. 2006)55

Formación de compuestos volátiles azufrados por levaduras vinicasconsiderable sobre la calidad del vino. Las levadurasde vino son las principales generadoras de compuestosvolátiles de azufre, los cuales son producidos a partirde fuentes de azufre y precursores derivados de lasuvas (y en algunos casos por productos añadidos porel vinicultor, e.g., SO2). A día de hoy se han conseguidoavances significativos para dilucidar las rutas metabólicasresponsables de la formación de compuestos volátilesde azufre. Este conocimiento se está utilizandoactualmente para desarrollar cepas de levaduras devino que: (1) produzcan nada o mucho menos sulfurode hidrógeno y mercaptanos asociados y (2) tenganuna mayor capacidad de producir compuestos volátilesde azufre deseables que aporten aromas afrutadosal vino. En algunos casos, se ha aplicado ingenieríagenética con el objetivo de evaluar la viabilidad deldiseño de tales cepas para lograr los resultados deseados.Si bien los consumidores actuales son aún muyresistentes a consumir bebidas producidas por microorganismosmodificados genéticamente, la recientecomercialización de una levadura genéticamentemodificada en la industria vitivinícola norteamericanapodría indicar la aceptación gradual de esta tecnología(Husnik et al.2006). No obstante, aunque enel futuro cercano no se utilice para producir vino comercialninguna de estas levaduras genéticamentemodificadas con metabolismos del azufre alterados,sirven como modelos y prototipos útiles para aportarmás información que podría aplicarse para desarrollarcepas no modificadas genéticamente utilizando técnicasmás convencionales (por ejemplo, mutagénesis,hibridación y evolución adaptativa). Por tanto, existeun gran consenso sobre la posibilidad de confeccionara medida levaduras de vino sin acudir a ingenieríagenética. Sin embargo, para personalizar levaduras nomodificadas genéticamente con el fin de que los vinicultoresajusten las concentraciones de compuestosque determinan la calidad del vino, el conocimientofundamental requerido continuará generándose ampliamentea partir de información obtenida mediantecepas prototipo modificadas genéticamente.Agradecimientos: la investigación en el AustralianWine Research Institute (Instituto de InvestigaciónEnológica de Australia) es posible gracias al apoyo deviticultores y vinicultores australianos a través de suorganismo inversor, la Grape y Wine Research DevelopmentCorporation, la cual financia según una metodología“matching funds” junto al Gobierno australiano.ReferenciasAmerine MA, Berg HV, Kunkee RE, Ough CS, SingletonVL, Webb AD (1980) The technology of winemaking,4th edn. AVI Technical Books, Westport, CTBonnarme P, Psoni L, Spinnler HE (2000) Diversityof L-methionine catabolism pathways in cheese-ripeningbacteria. Appl Environ Microbiol 66:5514–5517Dainty RH, Edwards RA, Hibbard CM, MarnewickJJ (1989) Volatile compounds associated with microbialgrowth on normal and high pH beef stored at chilltemperatures. J Appl Bacteriol 66:281–289Darriet P, Tominaga T, Lavigne V, Boidron J, DubourdieuD (1995) Identification of a powerful aromaticcompound of Vitis vinifera L. var. Sauvignon wines:4-mercapto-4-methylpentan-2-one. Flavour Fragr J10:385–392Donalies UEB, Stahl U (2002) Increasing sulfite formationin Saccharomyces cerevisiae by overexpressionof MET14 and SSU1. Yeast 19:475–484Dubourdieu D, Tominaga T, Masneuf I, Peyrot desGachons C, Murat ML (2006) The role of yeasts ingrape flavor development during fermentation: theexample of Sauvignon Blanc. Am J Enol Vitic 57:81–88Giudici P, Kunkee RE (1994) The effect of nitrogendeficiency and sulfur-containing amino acids onthe reduction of sulfate to hydrogen sulfide by wineyeasts. Am J Enol Vitic 45:107–112Hallinan CP, Saul DJ, Jiranek V (1999) Differentialutilization of sulfur compounds for H2S liberation bynitrogen-starved wine yeast. Austral J Grape Wine Res5:82–90Henschke PA, Jiranek V (1991) Hydrogen sulfideformation during fermentation: effect of nitrogencomposition in model grape must. Proceedings of theinternational symposium on nitrogen in grapes andwine, Seattle, USA. American Society for Enology andViticulture, Davis, CA, pp 172–184Henschke PA, Jiranek V (1993) Yeast−growth duringfermentation. In: Fleet GH (ed) Wine microbiology andbiotechnology. Harwood Academic, Chur, Switzerland,pp 27–54Howell KS, Swiegers JH, Elsey GM, Siebert TE, BartowskyEJ, Fleet GH, Pretorius IS, de Barros LopesMA (2004) Variation in 4-mercapto-4-methyl-pentan-2-one release by Saccharomyces cerevisiae commercialwine strains. FEMS Microbiol Lett 240:125–12956

Howell KS, Klein M, Swiegers JH, Hayasaka Y, ElseyGM, Fleet GH, Høj PB, Pretorius IS, de Barros LopesMA (2005) Genetic determinants of volatile thiolrelease by Saccharomyces cerevisiae during wine fermentation.Appl Environ Microbiol 71:5420–5426Husnik JI, Volschenk H, Bauer J, Colavizza D, LuoZ, van Vuuren HJ (2006) Metabolic engineering ofmalolactic wine yeast. Metab Eng 8(4):315–323Jiranek V, Langridge P, Henschke PA (1995) Validationof bismuthcontaining indicator media for predictingH2S producing potential of Saccharomyces cerevisiaewine yeasts under enological conditions. Am JEnol Vitic 46:269–273Jiranek V, Langridge P, Henschke PA (1996) Determinationof sulphite reductase activity and its responseto assimilable nitrogen status in a commercialSaccharomyces cerevisiae wine yeast. J Appl Bacteriol81:329–336Kappler U, Dahl C (2001) Enzymology and molecularbiology of prokaryotic sulfite oxidation. FEMS MicrobiolLett 203:1–9Masneuf-Pomarède I, Le Jeune C, Durrens P, LollierM, Aigle M, Dubourdieu D (2006) Influence offermentation temperature on volatile thiols concentrationsin Sauvignon blanc wines. Int J Food Microbiol108:385–390Mendes-Ferreira A, Mendes-Faia A, Leao C (2002)Survey of hydrogen sulphide production by wineyeasts. J Food Prot 65:1033–1037Morales P, Fernandez-Garcia E, Nunez M (2005)Volatile compounds produced in cheese by Pseudomonasstrains of dairy origin belonging to six differentspecies. J Agric Food Chem 53:6835–6843Moreira N, Mendes F, Pereira O, Guedes de PinhoP, Hogg T, Vasconcelos I (2002) Volatile sulphurcompounds in wines related to yeast metabolism andnitrogen composition of grape musts. Anal Chim Acta458:157–167Murat ML, Masneuf I, Darriet P, Lavigne V, TominagaT, Dubourdieu D (2001a) Effect of Saccharomycescerevisiae yeast strains on the liberation ofvolatile thiols in Sauvignon Blanc wine. Am J Enol Vitic52:136–139Murat ML, Tominaga T, Dubourdieu D (2001b) Assessingthe aromatic potential of Cabernet Sauvignonand Merlot musts used to produce rose wine by assayingthe cysteinylated precursor of 3-mercaptohexan-1-ol. J Agric Food Chem 49:5412–5417Seminario TécnicoCompuestos azufrados volátiles en vinosPark SK, Boulton RB, Noble AC (2000) Formation ofhydrogen sulfide and glutathione during fermentationof white grape musts. Am J Enol Vitic 51:91–97Pretorius IS (2000) Tailoring wine yeast for the newmillennium: novel approaches to the ancient art ofwinemaking. Yeast 16:675–729Pretorius IS (2003) The genetic analysis and tailoringof wine yeasts. In: de Winde JH (ed) Genetics and genomicsof industrial yeasts. Springer, Berlin HeidelbergNew York, pp 99–134Pretorius IS (2004) The genetic improvement ofwine yeasts. In: Arora DK, Bridge PD, Bhatnagar (eds)Handbook of fungal biotechnology. Marcel Dekker,New York, USA, pp 183–223Pretorius IS (2006) Grape and wine biotechnology:setting new goals for the design of improved grapevines,wine yeast and malolactic bacteria. In: Hui HY,Barta J, Cano MP, Gusek T, Sidhu JS, Sinha N (eds) Handbookof fruits processing science and technology.Blackwell, Ames, IA, USA, pp 453–489Pretorius IS, Bauer FF (2002) Meeting the consumerchallenge through genetically customized wine-yeaststrains. Trends Biotechnol 20:426–432Pretorius IS, Høj PB (2005) Grape and wine biotechnology:challenges, opportunities and potential benefits.Austral J Grape Wine Res 11:83–108Purdy KJ, Embley TM, Nedwell DB (2002) The distributionand activity of sulphate reducing bacteria inestuarine and coastal marine sediments. Antonie VanLeeuwenhoek 81:181–187Rauhut D (1993) Yeasts−production of sulfur compounds.In: Fleet GH (ed) Wine microbiology and biotechnology.Harwood Academic, Chur, Switzerland, pp183–223Ribéreau-Gayon P, Dubourdieu D, Donéche B,Lonvaud A (2000) Handbook of Enology, vol 1: themicrobiology of wines and vinification. Wiley, Chichester,UK, p 454Russell SM, Fletcher DL, Cox NA (1995) Spoilagebacteria of freshbroiler chicken carcasses. Poult Sci74:2041–2047 Seefeldt KE, Weimer BC (2000) Diversityof sulfur compound production in lactic acid bacteria.J Dairy Sci 83:2740–2746Spiropoulos A, Bisson LF (2000) MET17 and hydrogensulfide formation in Saccharomycescerevisiae.Appl Environ Microbiol 66:4421–4426Textos asociados57

CapítuloSpiropoulos A, Tanaka J, Flerianos I, Bisson LF(2000) Characterization of hydrogen sulfide formationin commercial and natural wine isolates of Saccharomyces.Am J Enol Vitic 51:233–248Swiegers JH, Pretorius IS (2005) Yeast modulationof wine flavour. Adv Appl Microbiol 57:131–175Swiegers JH, Bartowsky EJ, Henschke PA, PretoriusIS (2005a) Yeast and bacterial modulation ofwine aroma and flavour. Austral J Grape Wine Res11:139–173Swiegers JH, Willmott R, Hill-Ling A, Capone DL,Pardon KH, Elsey GM, Howell KS, de Barros LopesMA, Sefton MA, Lilly M,Pretorius IS (2005b) Modulation of volatile thiol andester aromas in wine by modified wine yeast. Proceedingsof the Weurman flavour research symposium,Roskilde, Denmark, 21– 24 June 2005, Developmentsin Food Science, Elsevier, Amsterdam, The NetherlandsSwiegers JH, Francis IL, Herderich MJ, PretoriusIS (2006) Meeting consumer expectations throughmanagement in vineyard and winery: the choice ofyeast for fermentation offers great potential to adjustthe aroma of Sauvignon Blanc wine. Austral NZ WineInd J 21:34–42Sutherland CM, Henschke PA, Langridge P, de BarrosLopes M (2003) Subunit and cofactor binding ofSaccharomyces cerevisiae sulfite reductase−towardsdeveloping wine yeast with lowered ability to producehydrogen sulfide. Austral J Grape Wine Res 9:186–193Thornton RJ, Bunker A (1989) Characterisation ofwine yeasts for genetically modifiable properties. JInst Brew 95:181–184Tominaga T, Masneuf I, Dubourdieu D (1995) A S-cysteine conjugate, precursor of aroma of white sauvignon.J Int Sci Vigne Vin 29:227–232Tominaga T, Peyrot des Gachons C, DubourdieuD (1998a) A new type of flavour precursors in Vitisvinifera L. cv. Sauvignon Blanc: S-cysteine conjugates. JAgric Food Chem 46:5215–5219Tominaga T, Furrer A, Henry R, Dubourdieu D(1998b) Identification of new volatile thiols in thearoma of Vitis vinifera L. var. Sauvignon Blanc wines.Flavour Fragr J 13:159–162Tominaga T, Blanchard L, Darriet P, DubourdieuD (2000). A powerful aromatic volatile thiol, 2-furanmethanethiol,exhibiting roast coffee aroma in winesmade from several Vitis vinifera grape varieties. J AgricFood Chem 48:1799–1802Vermeulen C, Gijs L, Collin S (2005) Sensorial contributionand formation pathways of thiols in foods: areview. Food Rev Int 21:69–137Vos PJA, Gray RS (1979) The origin and control ofhydrogen sulphide during fermentation of grapemust. Am J Enol Vitic 30:187–197Yamagata S (1989) Roles of O-acetyl-L-homoserinesulfhydrylases in micro-organisms. Biochimie71:1125–114358

Una revolución en elsector enólogico:Levaduras devinificación que noproducen Sulfuro dehidrógeno (H 2S)Cordente, T.; Swiegers, H.; (Australian Wine ResearchInstitute AWRI), Heinrich, A.; (Mauri Yeast Australia)El artículo íntegramente reproducido a continuación sepublico por primera vez en la revista The Australian andNew Zealand Grapegrover ans Winemaker Magazine ennoviembre de 2007. Publicado con el permiso de la citadarevista .Las cepas de levadura descritas en este artículo como sucorrespondiente proceso de desarrollo están pendientesde patente.IntroducciónLa producción excesiva de Sulfuro de Hidrógeno (H 2S)que tiene lugar en el transcurso del proceso de fermentacióndel mosto constituye un problema bastantecomún en lo que a vinificación se refiere (Monk1986; Henschke and Jiranek 1991). El principal motivode ello radica en la baja concentración de elementosnitrogenados en el medio. Con el objeto de paliareste problema, los enologos pueden, en el transcursodel proceso de fermentación, aumentar el gradode nitrógeno en el mosto, añadiéndole fosfato diamónico(DAP) o utilizando sulfato de cobre despuésde la fermentación con el fin de suprimir el H 2S delvino. Pero a pesar del aporte en DAP, la levadura sigueproduciendo H 2S en algunos medios y todo ello sinhablar del hecho de que la mayoría de los enólogospreferiría no tener que recurrir al uso del sulfato decobre. Los vinos que contienen H 2S desprenden unolor desagradable (a huevo podrido), pero además,debido a su olor, el H 2S, no solo reduce las cualidadesorganolépticas del vino sino también oculta las notasaromáticas favorables de éste.¿Cabría imaginar que en el futuro podamos llevar acabo una fermentación con levaduras de vinificaciónque no produzcan H 2S detectable sea cual sea el contenidoen nitrógeno asimilable del medio y sin ningúnaporte en DAP? Por otro lado, ¿Estas cepas de levaduraserían capaces de realzar aromas favorecedoresSeminario TécnicoCompuestos azufrados volátiles en vinosmanteniendo a la vez una excelente capacidad defermentación? El Instituto de Investigación Vitivinícolade Australia (AWRI) ha desarrollado, en colaboracióncon la Sociedad Mauri Yeast Australia, nuevas cepasde levadura que producen cantidades indetectablesde H 2S. Estas levaduras son Advantage, Platinum yDistinction.¿Cómo han sido desarrolladas estáslevaduras de baja producción de H2S?Para el desarrollo de estas cepas, el AWRI ha utilizadométodos biológicos clásicos (no OGM). La cepa MaurivinPDM era la cepa parental ideal, dada la popularidadde la que goza entre los elaboradores a nivel internacional.El objetivo radicaba en adaptar la cepa demanera que ésta realzara sus propiedades favorables,es decir su capacidad en no producir cantidades detectablesde H 2S y a partir de ella se han obtenido lascepas cuyos ensayos se exponen a continuación.Estas cepas, pendientes de patente, están clasificadascomo “no OGM” en todos los países vitivinícolas delmundo.Probar las cepas en mostosempobrecidos en nitrógeno asimilableLas cepas seleccionadas se probaron en mostos quecontenían bajas cantidades de nitrógeno asimilable(100 mg. N/L). No se añadió ningún aporte en DAPdurante el proceso de fermentación. Las fermentacionesde laboratorio se realizaron a 18º C, por triplicado,con una concentración inicial en azúcar de240 gr./lt. (aproximadamente 13.5 B). Unas cintasreactivas (tipo Fluka) extremadamente sensibles alH 2S fueron insertadas en cada frasco con el fin deponer en evidencia la producción de H 2S; las cintasblancas, indicaban la ausencia de liberación de H 2S.Las cintas de color marrón indicaban, por otra parte,una presencia de H 2S en cantidades indetectablespara el olfato humano. Las cintas negras indicabanen cambio una presencia de H 2S más allá del límiteperceptible por el olfato humano aún que en un nivelde concentración no perjudicial para la calidaddel vino.Al finalizar la fermentación, las cintas reactivas sumergidasen las muestras que contenían Advantagey Distinction se quedaron blancas o de color muyclaro Platinum (Figura 1) Este resultado confirmó queestas cepas no producían cantidades detectables deH 2S, incluso en presencia de cantidades muy bajas denitrógeno asimilable. El patrón , Maurivin PDM, quedoclaramente coloreado. Conviene destacar que enlos mostos que contenían cantidades suficientes denitrógeno asimilable, Maurivin PDM no produjo nadade H 2S.The Australian and New Zealand Grapegroverans Winemaker Magazine, noviembre de 2007Textos asociados59

Una revolución en el sector enólogico: Levaduras de vinificación que no producen Sulfuro de hidrógenoEstos resultados demuestran que estas tres cepas Advantage,Platinum y Distinction, fermentan mostosempobrecidos en nitrógeno asimilable sin producircantidades de H 2S detectables por la nariz humana.Asimismo, estas tres cepas de levadura presentancinéticas de fermentación comparables con las dela cepa de levadura PDM, conocida por su robustez(Tabla 1, Figura 2).cantidad de H 2S que sobrepasaba el límite de la percepciónsensorial.Las catas llevadas a cabo al finalizar el análisis demostraronque los vinos presentaban características sensorialespositivas. Además, las cepas revelaron unascinéticas de fermentación comparables a la obtenidacon la cepa Maurivin PDM .Y en condiciones reales de vinificaciónLas cepas han sido probadas en condiciones reales devinificación con el fin de reflejar su aptitud en las condicionesambientales propias al vino. Se sometió aprueba un mosto de Chardonnay con una concentraciónde azúcar de 190 gr./lt. Y, al igual que en la pruebaanterior, no se añadió DAP en todo el transcurso delproceso de fermentación. Utilizando condiciones defermentación similares a las anteriormente descritas,la fermentación se llevó a cabo a una temperatura de15º C y, de la misma manera, los grados de fermentaciónobtenidos fueron similares a los obtenidos conla cepa testigo de referencia (Maurivin PDM). Lascintas reactivas de todos los mostos de Chardonnayfermentados con las tres nuevas cepas se quedaronblancas. Hecho que confirma que, sin ningún aporteen DAP estas cepas no producen H 2S con la variedadChardonnay.Las catas tampoco revelaron presencia alguna de H 2S.Los catadores indicaron la presencia de notas afrutadas,dada la ausencia de notas azufradas. Estas cepasde levadura presentan pues con la variedad Chardonnay,unas capacidades de fermentación indudables;y por este motivo fueron sometidas a prueba otrasvariedades con el fin de confirmar dicha aptitud fermentaría.Resultados obtenidos con la variedadSauvignon BlancA lo largo de este estudio, se uso un mosto de SauvignonBlanc para llevar a cabo la fermentación, conel objetivo de marcar más las diferencias sensorialesusando una variedad aromática. El mosto presentabalas características analíticas siguientes: 190 gr./lt. deazúcar, pH 3.3, acidez total de 5.1 gr./lt. Las fermentacionesse realizaron a una temperatura 18°C. Lascintas reactivas confirmaron de nuevo que en ausenciade cualquier aporte de DAP las cepas Advantage,Distinction y Platinum no producían H 2S mientrasque en el mismo tiempo, la cepa testigo producía unaEn resumenLa producción de H 2S es perjudicial para la producciónde vinos de calidad. Felizmente, hoy en día, existencepas de levaduras llamadas Advantage, PlatinumDistinction.. Estas cepas se adaptan especialmentea los mostos que, empobrecidos en nitrógeno, evitanla producción de H 2S. Por lo general se trata decepas polivalentes que permiten la fermentación deuna amplia gama de variedades a la vez que una producciónde vinos de calidad con características sensorialesconsiderablemente mejoradas. Además, al notener que recurrir al DAP (o emplearlo en cantidadesinferiores) se facilita así el procesos de vinificación.AgradecimientosLos autores dan las gracias al Dr. Nick Yap, al Dr. DanJohnson y al Profesor Sakkie Pretorius por su valiosacolaboración a lo largo de todo este proyecto asícomo por la crítica constructiva que hicieron de esteartículo. El Dr. Toni Cordente se ha beneficiado delapoyo económico del grupo AB Mauri. El Dr.HentieSwiegers es investigador en el Instituto de InvestigaciónVitivinícola de Autralia, subvencionado por laasociación de los vinificadores y viticultores Australianosa través de su organismo de inversión: la sociedadde Desarrollo de la Investigación sobre Uva y Vino asícomo por los fondos del gobierno de Australia.ReferenciasMonk, P.R. Formation, utilization and excretion ofhydrogen sulfide by wine yeast. (1986) Wine IndustryJournal, Noviembre 10-16.Henschke PA, Jiranek V (1991) Hydrogen sulfideformation during fermentation: effect of nitrogencomposition in model grape must. Proceedings of theinternational symposium on nitrogen in grapes andwine, Seattle, USA. American Society for Enology andViticulture, Davis, CA, Pág.172–18460

Tabla 1. Análisis químicos de los vinosSeminario TécnicoCompuestos azufrados volátiles en vinosPDM Advantage Platinum DistinctionAzúcar residual (Fructosa) gr./lt. 1.7 1.2 0.2 0Glicerol gr./lt. 4.8 5.8 5.2 5.3Ácido acético gr./lt. 0.28 0.35 0.06 0.20Etanol % 11.4 11.3 11.3 11.5Días de fermentación (

Nitrogenmanagement iscritical for wineManaging Director,flavour and styleUgliano, M.; Henschke, P.A.; Herderich, M.J.; Pretorius,I.S.The Australian Wine Research Institute, PO Box 197, GlenOsmond (Adelaide), South Australia 5064, Australia“Winemaking begins in the vineyard” is a mantrathat has widespread support amongst winemakers.It conveys the concept of vineyard or, in French jargon,terroir as an intrinsic property of grape, andconsequently the corresponding wine. There is nodoubt that many great wines are associated withgreat vineyards. So, where do yeast fi t in?The perception that fermentation yeast faithfullytransform grape must into wine has been changingin the detail over the past decades. This is a result ofscience uncovering the many roles that yeast perform,and the wider selection of strains available thatpromote these various attributes. For example, whereasmost strains produce a relatively similar, generic,fermentation bouquet only some strains possess astrong ability to hydrolyse cysteine conjugates responsiblefor Sauvignon Blanc character, meaning thatonly selected strains can enhance varietal expression(Swiegers et al. 2006).Winemakers today have many options through fermentationmanagement to enhance the varietal characteristicsof their wine, or to express further regionalattributes. Furthermore, yeast strongly respond totheir environment. It is well known that temperatureaff ects the rate of fermentation, that grape solidsenhance survival and that high osmotic stress, asimposed by a Botrytis-aff ected must, leads not onlyto increased glycerol production but also to highervolatile acidity. The latter example highlights the remarkableability of yeast to adapt to stressful (i.e. highsugar) environments. However, there is an accompanyingmetabolic adaptation which can have positive ornegative fl avour implications.At the time of inoculation, yeast are subjected to arange of stresses to which the cell must adapt in orderto exploit its new environment. Some of the knownstresses are osmotic pressure, oxidative conditions,Seminario TécnicoCompuestos azufrados volátiles en vinossulphite toxicity and temperature shock (Bauer andPretorius 2000). Nutrients, whether present in sub- orsuper-optimal concentration, can also induce stressand metabolic responses. The primary response isaimed at protecting the cell from committing to reproductionwhen key nutrients are lacking or dealingwith potential toxicity when the concentration is outsidethe normal range. The metabolic response ofteninvolves a cascade of biochemical reactions, some ofwhich can lead to altered metabolism of nutrientssuch that the yeast will secrete end-products in different amounts (Albers et al. 1998). Some of the endproducts that have sensory properties can lead tochanges in the fl avour profi le of the wine. H 2S formationis an all-too-well known example relating tonitrogen depletion stress.Clearly, the vineyard environment and interventionby the viticulturist shape the development of the vineand especially the composition of the grape. Becausethe viticulturist attempts to balance a long list of prioritiesin order to produce fruit to specifi cation, mostattention will focus on those factors that cannot bemodifi ed once the fruit has been harvested.Therefore, yeast nutrients, especially nitrogen, mightnot be optimised for fermentation, largely in the beliefthat nutrients can be easily corrected in the winery. Giventhat we estimate that up to 500t of diammoniumphosphate (DAP) could be used each year to produceAustralian wine, is this winemaking input being usedeff ectively? Our current state of knowledge on theimplications of controlling vineyard nitrogen as opposedto fermentation nitrogen on fermentation performanceand wine composition has been recently reviewedby Bell and Henschke (2005). In this article, wewill focus on the role that fermentation nitrogen hasin modulating metabolism and some of the changesthat this can have on wine fl avour. We will fi rst summarisecurrent best practice for managing fermentationnitrogen and then describe the main fl avourchanges that are aff ected by nitrogen.Finally, we will consider the fl avour implications of nitrogenfor white and red wine fermentations.CURRENT BEST PRACTICE FORMANAGING FERMENTATION NITROGENA common practice amongst winemakers is to makea standard addition of DAP to the juice or must (100-300mg/L) at inoculation without measuring the nitrogenconcentration. This article will show that DAPaddition has signifi cant fl avour consequences andthat measuring the initial nitrogen concentration providesthe opportunity to adjust DAP addition not onlyto achieve an adequate fermentation rate, but also tomore reliably guide the fl avour profi le and style ofwine required. This work is still in a conceptual stageTextos asociadosWine Industry Journal > Vol 22 No 6 > November / December 200763

Nitrogen management is critical for wine Managing Director, flavour and stylebased on studies with Chardonnay and Shiraz; however,it should stimulate winemakers to experimentwith these and other varieties.1.1 Measuring YANGrapes contain a variety of nitrogenous compoundsof which the most important are the primary or alphaamino acids, ammonium ion and small peptides. Proline,a dominant secondary amino acid in many grapevarieties, cannot be assimilated under anaerobicconditions (Ingledew et al. 1987). These nitrogenouscompounds, excluding proline, constitute what iscommonly referred to as yeast assimilable nitrogen(YAN).Figure 1. Summation of free amino nitrogenand ammonia nitrogen levels provides a usefulestimate of the yeast assimilable nitrogen level.Because amino acids are chemicallydiverse molecules,the most convenient measure of assimilablenitrogen relates to assaying the free or alpha-aminogroup of the primary amino acids, which is commonlyreferred to as free amino nitrogen (FAN). Proline, a secondaryamino acid, and protein are excluded in FANassay methods. Of the several chemical, enzymaticand physical methods available (Shively and Henick-Kling 2001; Bell and Henschke 2005; Filipe-Ribereiroand Mendes-Faia 2007) the method of choice is theo-phthaldialdehyde/N-acetyl-L-cysteine (NOPA) method(Dukes and Butzke 1998). An additional enzymaticmethod is needed to determine ammonia, ofwhich 82% is nitrogen. Summation of these two nitrogenmeasurements yields YAN (Figure 1). This procedureis used by NATA-accredited laboratories such asAWRI’s Analytical Service laboratory (http://www.awri.com.au/analytical_ service/analyses/yeast_assimilable_nitrogen/), which can provide a timely service duringvintage.The so-called Formol Titration is a simpler, rapid methodfor measuring YAN (Shively and Henick-Kling2001; Gump et al. 2002; Filipe-Ribereiro and Mendes-Faia 2005), although the use of formaldehyde, a toxicvolatile reagent, requires a well-trained analyst andsuitable laboratory. YAN determination with midinfrared(MIR) spectrometry, which is most rapid, hasrecently been developed by the AWRI (Dambergs etal. 2005).YAN measurements, ideally, should be performed directlyon juice or must samples at the point of inoculationto avoid over-estimation due to processinglosses which inevitably occur between vineyard andthe fermentor. Furthermore, juice samples taken fromgrape musts can under-estimate total berry YAN dueto an important proportion of amino acid containedin the grape skin. Refer to the review by Bell and Henschke(2005) for a detailed discussion of these points.Nevertheless, an early warning for low YAN can beachieved by sampling in the vineyard one to two weeksprior to harvest, such as during maturity sampling.1.2 Supplementing must YANThe YAN content of Australian grape juices varies widelyfrom approximately 50-350mg/L, with a meanvalue of around 200mg/L. As a benchmark, it is generallyagreed that maximum yeast biomass yield andfermentation rate results when YAN exceeds 400mg/L,whereas 150mg/L YAN marks a transition zone, belowwhich the risk of slow or stuck fermentation notablyincreases (Henschke and Jiranek 1993; Blateyron et al.2003). Since much of the background research workto establish these benchmarks has been carried outin synthetic and fi ltered grape juices, this risk valueis technically only valid for highly clarifi ed, anaerobic,juice fermentations. Nonetheless, it represents aworst-case scenario and is a useful guide for other typesof fermentation.In general, in order to achieve an adequate rate offermentation to dryness, a cellar bright juice containing

article, when we consider the fl avour consequencesof juice YAN content, some winemakers might chooseto supplement low YAN juices up to a fi nal concentrationof 250-300mg/L YAN so as to produce a cleaner,fruitier style.DAP is widely used as a YAN supplement for this purpose.DAP contains 21% N, therefore, for conveniencewe can consider 100mg DAP to contain 20mg YAN. Byway of an example, it will be necessary to add 500mg/LDAP to a juice to increase its YAN concentration from100mg/L to 200mg/L. While this fi gure seems a largeaddition of DAP, the YAN equivalent of 1.5g DAPwould be needed to reach the point at which maximumfermentation rate would be achieved. Australianwinemakers can visit the AWRI website to accessthe calculator to estimate DAP additions: http://www.awri.com.au/ practical_solutions/calculators/.One disadvantage of DAP as a supplement is the acidification that can result in some juices, leading toa lowerthan- expected wine pH. Utilisation of theammonium cation by yeast leaves a notable proportionof the phosphate anion, which can lower pH,depending on initial pH and must titratable acidity(TA). Furthermore, large additions of DAP can lead toexcessive wine phosphate content. In practice, themaximum addition of DAP is limited by the concomitantconcentration of soluble phosphate remaining inthe wine, which is set at 400mg P/L (Australian andNew Zealand Food Standard 4.5.1). This concentrationof phosphate-P would correspond to a maximum of1.7g/LDAP (equivalent to 360mg/L YAN) if we assume thatthe juice/must contained no phosphate; in practice alesser amount of DAP can only, therefore, be added.Overuse of DAP can also stimulate overproduction ofacetate esters, especially ethyl acetate, resulting in theperception of volatile acidity (VA) and suppression ofvarietal character. As discussed in the following sections,high YAN (exceeding 450-500mg/L YAN) canstimulate ethyl acetate production by many yeaststrains.When working with very low YAN juices, we have observedthat other nutrients can similarly be low. Thus,when YAN is low and other nutrient defi ciencies aresuspected, it can be useful to add a proprietary yeastfood that contains more complex forms of N, as wellas vitamins, lipids and minerals. Indeed, continuedH2S production after DAP addition suggests a generalvitamin defi ciency (Henschke 1996; Wang et al. 2003),though other causes are also possible.Most yeast suppliers can advise on the use of yeastfoods, which are generally produced from inactivatedyeast.Seminario TécnicoCompuestos azufrados volátiles en vinosGENERAL METABOLIC RESPONSES OFYEAST TO YANThe principal role of sugar metabolism in yeast is togenerate energy and carbon skeletons for building allthe components of the cell. These metabolic activitiesresult in the accumulation of several by-products, includingesters, higher alcohols and polyols, carbonyls,acids and thiols which contribute to the aroma and flavour of wine. Nitrogen metabolism, which is involvedin the assimilation of nitrogen for the synthesis ofprotein and nucleic acids, also contributes to the poolof aroma and fl avour compounds. Because nitrogenmetabolism is central to cell growth, it regulates otherpathways, including sugar and sulphur metabolism.Consequently, nitrogen availability can signifi cantlyimpact on the production of many fl avouractive metabolites.The nitrogen status of a juice or must, therefore,contributes to wine fl avour as well as aff ectingyeast growth and the fermentation of sugars.2.1 Major fermentation productsIn addition to ethanol and CO 2, other major productsof sugar metabolism are the polyols, such as glyceroland butanediol and the organic acids, especially aceticand succinic acids and, to a lesser extent, the ketoacids,such as pyruvic acid and -ketoglutaric acid.The production of many of these primary metabolitesof sugar metabolism is modulated by YAN, althoughthe magnitude of changes has been observed todepend on the yeast strain under consideration. Furthermore,the type of nitrogen source used, DAP oramino acids, aff ects metabolite production (Albers etal. 1996). Because low YAN juices are typically supplementedwith DAP, only the impact of ammonium ionconcentration on the production of yeast metaboliteswill be discussed in this article.ConcentrationGlycerolMalicacidSuccinicacidAceticacidSO2100 200 300 400YANFigure 2. Effect of yeast assimilable nitrogenon production or utilisation of major metabolicproducts of sugar fermentation and sulphurassimilation.Textos asociados65

Nitrogen management is critical for wine Managing Director, flavour and styleEthanol is the major product of sugar fermentation.However, while DAP addition increases yeast growthand the rate of fermentation, it has little to no practicaleff ect on fi nal ethanol yield.Theoretically, DAP-grown yeast are forced to synthesiseamino acids for cell growth when compared withamino acid grown yeast. This decreases the proportionof sugar available for ethanol production (Alberset al. 1996), but in our experiments this has a minor affect on ethanol yield.Glycerol and acetic acid, which are important to winecomposition and fl avour, respond relatively stronglyto juice YAN concentration (Albers et al. 1998; Torrea etal. 2005; Vilanova et al. 2007).Figure 2 summarises general trends observed in syntheticjuice and white wine fermentations. Both glyceroland acetic acid production depends stronglyon the yeast strain used. For example, when usingyeast Vitilevure M05 DAP addition increases glycerolproduction whereas the reverse is the case for AWRI796 (Vilanova et al. 2007). Both yeast, however, producethe lowest concentrations of acetic acid at moderateYAN concentrations (range of 200-250mg/L)while higher concentrations are produced at bothlower and higher concentrations of YAN. Malic acidconsumption does, however, increase with increasingDAP concentration, irrespective of yeast strain. On thecontrary and depending on the strain, succinic acidconcentration can increase with increasing DAP addition(Coulter et al. 2004). In general, YAN can aff ect TAand the balance of organic acids which can aff ect flavour (Sowalsky and Noble 1998).Sulphur dioxide production during fermentation canalso be stimulated by initial YAN concentration, butthe response seems to be yeast strain dependent.Experimental work in synthetic media and wort suggeststhat low SO2 is produced in low YAN mediabut increases when initial YAN availability is higher(Duan et al. 2004; Osborne and Edwards 2006). SO 2production contrasts with H2S production, which isgenerally lowered by increasing YAN. Increased riskof MLF inhibition has also been associated with highYAN addition but this inhibition has not been conclusivelycorrelated with SO 2production (Osborne andEdwards 2006). Nevertheless, until better informationis available, consideration should be given to limitinghigh YAN conditions when malolactic fermentation(MLF) is required.2.2 Volatile aroma compoundsAmong the various yeast metabolic pathways that areinfl uenced by the nitrogen composition of the juice,those leading to volatile compounds are of particularimportance due to the primary role played by fermentation-derivedvolatiles in the aroma character of wine(Smyth et al. 2005). Several studies have indicated thatboth the total available nitrogen and the balance ofamino acids and ammonia can signifi cantly aff ectthe production of different groups of fermentationderivedvolatile compounds.From a practical point of view, the problem of juice nitrogencomposition is primarily linked to the frequentoccurrence of juices with suboptimal concentrationsof nitrogen, and higher risk of slow or stuck fermentation.As this problem is frequently corrected in thewinery through the addition of DAP, several studieshave investigated the implications of this commonwinery practice on the volatile composition of wine(Ayrapaa 1971, Rapp and Versini 1991; Carrau 2003; Torreaand Henschke 2004; Hernandez-Orte et al. 2005,2006; Vilanova et al. 2007). Due to the variety of yeaststrains and fermentation conditions employed, it issomewhat diffi cult to extrapolate from the literaturedefi nitive conclusions concerning the eff ect of DAPaddition on wine aroma. Nevertheless, some generaltrends relating to DAP supplementation and wine volatilecomposition are summarised in Figure 3.Higher alcohols, which are directly related to aminoacid metabolism in the cell, exhibit a characteristicbehaviour. Therefore, when total nitrogen is increasedby adding ammonium to a medium containing verylow levels of YAN, the production of higher alcoholsis initially increased, but then tends to decrease aftera peak between 200-300mg/L YAN. This activity dependson various factors, including yeast strain andfermentation conditions.Higher alcohols are characterisedby fusel-like odours, and are generally thoughtto contribute to the complexity of wine fermentationbouquet. However, when present in very highconcentrations they can have a negative impact onwine aroma, mainly because they mask fruity characters.Several authors have reported that ammoniumsupplementation can improve wine sensory qualityConcentration of yeast aroma compoundsHigher alcoholsEthyl acetateAcetate estersFatty acidsethyl estersBranched chainesters100 200 300 400 500YANFigure 3. Relationship between initial YANconcentration and fi nal concentration of volatilecompounds after fermentation.66

y lowering higher alcohols production (Rapp andVersini 1991). However, based on the trend shown inFigure 3, this advice has to be taken cautiously as itmight apply only to fermentations with initial YAN inthe range included in the descending part of higheralcohols production pattern, i.e. YAN >200mg N/L.The production of fatty acids ethyl esters, as well as ofacetate esters, including ethyl acetate, is generally increasedwhen DAP is added to the juice prior to alcoholicfermentation (Figure 3). This can have interestingimplications for wine fl avour as fatty acids ethyl estersand acetates are generally responsible for the fruitycharacter of wine (Guth and Sies 2002). However,ethyl acetate, one of the dominant yeast-derived volatilemetabolites, when present at very high concentrations,can give unwanted sensory characteristics,often described with terms like nail lacquer/solventand volatile acidity. Branched chain esters are, from aquantitative point of view, the less abundant volatilesproduced during fermentation. Although their contributionto wine fl avour has still to be clarifi ed, tentativeevidence is available in the literature for thesecompounds to be important contributors to the redberry fruit character of some red wines (Diaz- Marotoet al. 2005). Their concentration appears to decreasewith increased DAP additions, however.The existence of a variety of diff erent responses forthe various groups of yeastderived volatile compoundsto DAP supplementation arises from the factthat each group of volatiles is derived from a diff erentmetabolic pathway, each of which respond differentlyto DAP supplementation. However, from a practicalpoint of view, understanding the potential of DAPsupplementation as a tool to modulate wine sensorycharacteristics cannot be based simply on compositionaldata. The various volatiles or groups of volatilesillustrated in Figure 3 occur in wine over an extremelybroad range of concentrations. However, this fi guredoes not represent the actual quantitative relationshipbetween diff erent chemical species. For example,higher alcohols, characterised by herbaceous, fusellikeodours, typically occur in concentrations that canbe up to 400 times higher than ethyl fatty acid esters,Odour Activity Value120100806040200Isoamyl alcoholEthyl octanoateIsoamyl acetateEthyl 3-methylbutanoateEthyl acetate100 200 300 400 500YANFigure 4. Theoretical relationship between initialYAN concentration and Odour Activity Values ofselected yeast-derived aroma compounds.Seminario TécnicoCompuestos azufrados volátiles en vinoscharacterised by fruit-like odours. Nevertheless, relativelysmall variations in the concentration of ethyl fattyacid esters, such as those introduced by variations inYAN content, are more likely to aff ect the aroma ofwine than if proportionally similar variations wouldoccur for higher alcohols. This is due to the fact thatsome of the possible sensory modifi cations associatedwith changes in the concentration of specifi caroma compounds depend, among other factors, onthe ability of that aroma compound to generate anolfactory stimulus at a given concentration.This complex relationship is often simplifi ed bymeans of the concept of odour threshold, defi ned asthe minimum concentration at which a given compoundcan be detected by the sense of smell (Guth1997). This is referred to as the odour activity value(OAV). Some of the fermentation-derived volatilecompounds, such as esters, that are generally associatedwith the fruity character of wine, are extremelypowerful odourants (i.e. have a very low odour threshold)and can, therefore, impart specifi c sensory attributeseven when present in low concentrations. Onthe contrary, compounds like higher alcohols possessa much higher odour threshold and, therefore, arelikely to generate variations in the aroma profi le ofa wine only when their concentration varies to a verylarge extent. In Figure 4, a theoretical relationship betweenthe OAV of selected volatile compounds, belongingto the chemical classes of Figure 3, and DAP supplementationis illustrated. It appears clear then thatthe range of variations potentially introduced by DAPin the concentration of acetates and fatty acid ethylesters (isoamyl acetate and ethyl octanoate are usedas reference compounds for these two classes) canhave a dramatic impact on the volatile character ofwine, whereas variations in compounds such as higheralcohols (isoamyl alcohol), although quantitativelyextremely large, are likely to have a limited impact.Although it has to be stressed that OAVs only give aprojection of the potential of a given compound tocontribute to the overall aroma of a wine, the trendsshown in Figure 4 provide a good indication of whichone of the compositional changes associated withDAP supplementation is likely to have a greater impacton wine aroma.IMPLICATIONS OF NITROGEN FOR WINEFERMENTATIONS3.1 Implications of nitrogen for white winefermentationsInterestingly, the results obtained in various winemakingtrials conducted at the AWRI with sub-optimalYAN juices have indicated that, under typical winemakingconditions, DAP supplementation is an extremelypowerful tool for modulating the production of esterswhich, based on the previous discussion, are probablyTextos asociados67

Nitrogen management is critical for wine Managing Director, flavour and stylethe most sensorially-interesting group of compoundsgenerated during fermentation. Figures 5 and 6 showthe variations in volatile compounds and the sensoryprofi le of Chardonnay wines made at diff erent DAPconcentrations. In good agreement with the trendsshown in Figure 3, DAP had a positive eff ect on esterproduction, while it lowered the formation of higheralcohols. However, the wines obtained with moderatenitrogen supplementation of the juice were preferredby panellists compared with those obtained withoutor with high DAP addition. This preference might bedue to a combination of higher acetates, ethyl fattyacid ester concentrations and moderate levels of ethylacetate, the latter being associated with unwanted,solvent-like characteristics when present at very highconcentrations. DAP addition to low YAN juices alsosuppresses the production of H2S and mercaptans bymany wine yeasts, which although not quantifi ed inthis study, no doubt contributed to the preference ofthe moderate YAN wines. The impact of DAP additionon the production of fruity thiols, such as 4MMP, 3MHand 3MHA, still needs to be determined.These results highlight the complexity of predictingwine aroma from compositional data. They also underlinethe importance of measuring YAN and addingthe appropriate amount of DAP, if necessary, before orduring fermentation in order to reduce the potentiallynegative eff ects that inadequate or excessive DAP supplementationcan have on wine aroma. Particularly,the risk of excessive formation of ethyl acetate has tobe considered as this ester is relatively stable duringwine ageing, compared with other acetate and ethylfatty acid esters, which tend to decrease signifi cantlyafter several months of bottle storage.3.2 Implications of nitrogen for red winefermentationsMore recently, researchers at the AWRI have investigatedthe eff ect of DAP supplementation on the volatilecomposition of Shiraz wine (Ugliano et al. 2007). It is generallybelieved that the conditions normally adoptedfor the production of red wine (i.e. higher temperatures,aeration of the fermenting must during cap managementoperations, extraction of YAN and other nutrientsfrom skin during maceration) render fermentations lesssusceptible to slow or stuck fermentations, even whenYAN concentrations approach the sub-optimal range.Nevertheless, several surveys have shown that YANlevels in red grapes can be well below optimal (Gockowiakand Henschke 1992; Butzke 1998; Nicolini et al.2004; Ugliano and Henschke, unpublished data).Although during red wine fermentations YAN deficiencies are likely to have a more moderate eff ect onfermentation kinetics, they can still negatively aff ectthe formation of important aroma compounds. Fromthe results of a trial which was carried out on a lowYAN Shiraz must (YAN 100mg/L) with S. cerevisiaeAWRI 796, it is again clearly evident that DAP supplementationis a powerful tool for modulating the volatilecomposition of red wine. This confi rms some ofthe trends observed during experiments with modelsubstrates and white grape juices. As can be seen inFigure 7, DAP supplementation resulted in higher productionof ethyl fatty acid esters and acetate esters,while higher alcohols were scarcely affected.Preliminary results also indicated that YAN supplementationof must can have an impact on red wineConcentration µg/L12,00010,000800060004000160mg/L YAN 320mg/L YAN 480mg/L YANLess preferred aromasWet cardboardSweatyCheesyAceticBanana43.532.521.510.50Fruit esterArtificial grapeMuskFloralMore preferred aromas2000Nail lacquerStewed fruit0Fatty acids ethyl esters Acetates Ethyl acetate/10 Higher alcohols/100Stale beerHoneyBruised appleCitrusTropicalFigure 5. Volatile compounds of wines obtainedfrom a low YAN (160mg/L) Chardonnay juicesupplemented with two increasing concentrationsof DAP, to a fi nal YAN of 320mg/L and 480mg/L,respectively. Fermentations were carried out at18ºC using S. cerevisiae AWRI 796.Figure 6. Sensory characteristics of wines obtainedfrom a low YAN (160mg/L) Chardonnay juice(green line) supplemented with two increasingconcentrations of DAP, to a fi nal YAN of 320mg/L(red line) and 480mg/L (blue line), respectively.Fermentations were carried out at 18ºC using S.cerevisiae AWRI 796.68

colour composition. Analytical parameters related tocolour intensity and hue were indeed found to varywith DAP supplementation (Ugliano et al. 2007). Thefactors responsible for this eff ect are currently beinginvestigated at the AWRI. The eff ect might be ascribableto various aspects of yeast metabolism thatare known to modulate wine colour and phenolicscomposition. Factors include variations in the rate ofethanol production, absorption of anthocyanins onyeast cell walls (Morata et al. 2003) or reactions withyeast-derived metabolites such as pyruvic acid andacetaldehyde to form pigmented polymers (Romeroand Bakker 1999).CONCLUSIONThis work shows that the concentration of yeast assimilablenitrogen is not only important for ensuringthat adequate yeast growth and fermentation kineticsare achieved, but also can aff ect the production ofthe major metabolites arising from sugar fermentation.Whereas ethanol concentration is little aff ected,that of glycerol and various carboxylic acids can bemarkedly modulated. These changes are likely to affect wine fl avour. Most importantly, however, is the finding that YAN can strongly infl uence production ofsome of the volatile metabolites, especially the acetateand ethyl esters, which are known to be positiveto wine aroma when in balance. The impact of higheralcohols, which can be negative when present in highconcentration, can also be modulated by YAN. Thesevarious yeast metabolites were also found to vary inConcentration µg/L10,0009000800070006000500040003000200010000100mg/L YAN 250mg/L YAN 400mg/L YANFatty acids ethyl estersAcetatesEthyl acetateHigher alcohols/100Figure 7. Volatile compounds of wines obtainedfrom low YAN (100mg/L YAN) Shiraz grapessupplemented with two increasing concentrationsof DAP, to a fi nal YAN of 250mg/L and 400mg/Lrespectively. Fermentations were carried outat 22ºC using S. cerevisiae AWRI 796, with capplunging three times per day.Seminario TécnicoCompuestos azufrados volátiles en vinosred wine fermentations, suggesting that, as in whitewines, must YAN can aff ect the development of winefl avour. Our preliminary data suggest that wine colourand phenolics composition can also be infl uencedby YAN.Overall, these results suggest that, at least for Chardonnay,the fl avour and style of wine is dramaticallymodulated by the initial YAN concentration of the grapejuice. Low YAN level juices favour the production ofmore complex wines with less fruity aromas, whereasmoderate YAN levels produce cleaner and fruitier wines.However, high YAN levels can lead to excessivelyestery wines. Similar eff ects can be expected in othervarieties, excepting for those varieties that depend onthiols, for which no information is presently available.Clearly, more wine sensory studies need to be undertakento better understand the eff ects of must YANand amino acid profi le on wine fl avour.A red wine trial is currently in progress to understandbetter the impacts of managing nitrogen in the vineyardcompared with that in the winery on wine flavour and quality. This research can be expected toprovide grapegrowers and winemakers with betterinformation for optimising wine style and quality accordingto consumer preferences and other desiredoutcomes.ACKNOWLEDGEMENTSWe thank our many colleagues for supporting thisproject, especially Tracey Siebert and Dimitra Caponefor help with analysis of fermentation volatiles; MariolaKwiatkowski and Meagan Mercurio for analysisof phenolic compounds; Kate Lattey, Belinda Bramleyand Dr Leigh Francis for carrying out the sensoryanalyses; Industry Development and Supportand Analytical Service team members for help withchemical analyses; and Dr Paul Chambers, Dr CristianVarela and Biosciences team members for manyhelpful discussions. Professor Francisco Carrau, ofUruguay, and visiting scientists Drs Diego Torrea andMar Vilanova, from Spain, have made important contributionsto this project. We are especially grateful toMike Farmilo, of Boar’s Rock winery, for supplying alarge number of juice samples and donating must forthe Shiraz fermentation trials, and Russell Johnstoneand Inca Pearce, of Orlando Wines, and Louisa Roseand Simon Dillon of The Yalumba Wine Company, forsupplying white wine juices. Current work on nitrogenmanagement also involves collaboration with DrSally-Jean Bell and Marcel Essling. Rae Blair is thankedfor her editorial assistance. This project is supportedby Australia’s grapegrowers and winemakers throughtheir investment agency, the Grape and Wine Researchand Development Corporation, with matchingfunds from the Australian Government. The AWRI is amember of the Wine Innovation Cluster.Textos asociados69

Nitrogen management is critical for wine Managing Director, flavour and styleREFERENCES1 Albers, E.; Larsson, C.; Liden, G.; Niklasson, C. &Gustafsson, L. (1996) Infl uence of the nitrogensource on Saccharomyces cerevisiae anaerobicgrowth and product formation. Appl. Env. Microbiol.62: 3187-3195.2 Albers, E.; Lidén, G.; Larsson, C.; Gustafsson, L.(1998) Anaerobic redox balance and nitrogen metabolismin Saccharomyces cerevisiae. Recent Res.Develop. Microbiol. 2: 253-279; 1998.3 Äyräpää, T. (1971) Biosynthetic formation of higheralcohols by yeast.Dependence on the nitrogenous nutrient level ofthe medium. J. Inst.Brew. 77: 266-276.4 Bauer, F.F.; Pretorius, I.S. (2000). Yeast stress responseand fermentation effi ciency: how to survivethe making of wine – A review. S. Afr. J. Enol. Vitic.21: 27-51.5 Bell, S.-J.; Henschke, P.A. (2005) Implications of nitrogennutrition for grapes, fermentation and wine.Aust. J. Grape Wine Res. 11: 242-295.6 Blateyron, L.; Ortiz-Julien, A; Sablayrolles, J.M.(2003) Stuck fermentations: oxygen and nitrogenrequirements – importance of optimising their addition.Aust. N.Z. Grapegrower Winemaker 478: 73-79.7 Butzke, C. (1998). Survey of Yeast Assimilable Nitrogenstatus in musts from California, Oregon, andWashington. Am. J. Enol. Vitic. 49: 220-224.8 Carrau, F.M. (2003) Characterization of yeast in relationto the ability to utilize nitrogen – Studies ofaroma compounds. PhD thesis, Universidad de laRepublica, Uruguay.9 Coulter, A.D.; Godden, P.W.; Pretorius, I.S. (2004)Succinic acid-how is it formed, what is its eff ect ontitratable acidity, and what factors infl uence its concentrationin wine? Aust. N.Z. Wine Ind. J. 19: 16-20,22-25.10 Dambergs, R.G.; Kambouris, B.; Cynkar, W.; Janik,L.J.; Cozzolino, D.; Henschke, P.A.; Gishen,M. (2005) A comparison of near infrared and midinfraredspectroscopy for the analysis of yeast-assimilablenitrogen in grape juice. Blair, R.J.; Williams,P.J.; Pretorius, I.S. (eds.) Proceedings of the twelfthAustralian wine industry technical conference; 24-29 July 2004; Melbourne, Vic. Australian Wine IndustryTechnical Conference Inc., Adelaide SA: 334.11 Diaz-Maroto, M.C.; Schneider, R.; Baumes, R.(2005) Formation pathways of ethyl esters of branchedshort-chain fatty acids during wine aging. J.Agric Food Chem., 53, 3503-3509.12 Duan, W.; Roddick, F.A.; Higgins, V.J.; Rogers, P.J.(2004) A parallel analysis of H2S and SO2 formationby brewing yeast in response to sulphur-containingamino acids and ammonium ions. J. Am. Soc. Brew.Chem. 62: 35-41.13 Dukes, B.C.; Butzke, C.E. (1998) Rapid determinationof primary amino acids in grape juice using ano-phthaldialdehyde/N-acetyl-L-cysteine spectrophotometricassay. Am. J. Enol. Vitic. 49: 125-134.14 Eglinton, J.; Siebert, T.; Kwaitkowski, M.; Francis,L.; Henschke P. (2005) Compositional and sensoryimplications of practical strategies for ensuringcomplete fermentation with non-conventionalyeast. Blair, R.J.; Williams, P.J.; Pretorius, I.S.(eds.) Proceedingsof the twelfth Australian wine industry technicalconference; 24-29 July 2004; Melbourne, Vic.Australian Wine Industry Technical Conference Inc.,Adelaide SA: 288.15 Filipe-Ribeiro, L.; Mendes-Faia, A. (2007) Validationand comparison of analytical methods usedto evaluate the nitrogen status of grape juice. FoodChem. 100: 1272-1277.16 Gockowiak, H.; Henschke, P.A. (1992) Nitrogencomposition of grape juice and implications for fermentation:results of a survey made in N-E Victoria.Aust Grapegrower Winemaker 340: 131, 133-138.17 Gump, B.H.; Zoecklein, B.W.; Fugelsang, K.C.;Whiton, R.S. (2002) Comparison of analytical methodsfor prediction of prefermentation nutritionalstatus of grape juice. Am. J. Enol. Vitic. 53: 325-329.18 Guth, H. (1997) Quantitation and sensory studiesof character impact odorants of diff erent white winesvarieties. J. Agric. Food Chem., 45: 3027-3032.19 Guth, H.; Sies, A. (2002) Flavour of wines: Towardsan understanding by reconstitution experimentsand an analysis of ethanol’s eff ect on odour activityof key compounds. Blair, R.J.; Williams, P.J.; Høj, P.B.(eds.). Proceedings of the eleventh Australian WineIndustry Technical Conference, 7-11 October 2001,Adelaide SA. Australian Wine Industry TechnicalConference Inc., Adelaide SA 128-139.20 Henschke, P.A. (1996) Hydrogen sulphide productionby yeast during fermentation. ProceedingsEleventh international oenological symposium, Sopron,Hungary (International Association for WineryTechnology and Management: Breisach, Germany)pp. 83-102.70

21 Henschke, P.A.; Jiranek, V. (1993) Yeasts – metabolismof nitrogen compounds. In: Wine Microbiologyand Biotechnology. Fleet, G.H. (ed.) (HarwoodAcademic Publishers: Chur, Switzerland) pp. 77-164.22 Hernández-Orte, P.; Ibarz, M.J.; Cacho, J.; FerreiraV. (2005) Eff ect of the addition of ammoniumand amino acids to must of Airen variety on aromaticcomposition and sensory properties of the obtainedwines. Food Chem. 89: 163-174.23 Hernández-Orte, P.; Bely, M.; Cacho, J.; Ferreira,V. (2006) Impact of ammonium additions onvolatile acidity, ethanol, and aromatic compoundsproduction by diff erent Saccharomyces cerevisiaestrains during fermentation in controlled syntheticmedia. Aust. J. Grape. Wine Res. 12: 150-160.24 Ingledew, W.M.; Magnus, C.A.; Sosulski, F.W.(1987) Infl uence of oxygen on proline utilizationduring wine fermentation. Am. J. Enol. Vitic. 38: 246-248.25 Morata, A.; Gomez-Cordoves, M.C.; Suberviola,J.; Bartolomé, B.; Colomo, B.; Suárez, J.A. (2003)Adsorption of anthocyanins by cell walls during thefermentation of red wines. J. Agric. Food. Chem. 51,4084-4088.26 Nicolini, G.; Larcher, R.; Versini, G. (2004) Statusof yeast assimilable nitrogen in Italian grape mustsand eff ect of variety, ripening and vintage. Vitis, 43:89-96.27 Osborne, J.P.; Edwards, C.G. (2006) Inhibition ofmalolactic fermentation by Saccharomyces duringalcoholic fermentation under low- and highnitrogenconditions: a study in synthetic media. Aust. J.Grape Wine Res. 12: 69-78.28 Rapp, A.; Versini, G. (1991). Infl uence of nitrogencompounds in grapes on aroma compoundsof wine. Proceedings of the International Symposiumon Nitrogen in Grapes and Wine. Davis USA: AmericanSociety for Enology and Viticulture, 156-164.29 Ribéreau-Gayon, J.; Dubourdieu, D.; Donéche,B.; Lonvaud, A. (2000) Handbook of Enology, Volume1: The microbiology of wines and vinifi cation.John Wiley & Sons Ltd: Chichester, UK.: 454.30 Romero C.; Bakker, J. (1999) Interactions betweengrape anthocyanins and pyruvic acid, with effect of pH and acid concentration on anthocyanincomposition and color in model systems. J. Agric.Food Chem. 47, 3130-3139.31 Shively, C.E.; Henick-Kling, T. (2001) Comparisonof two procedures for assay of free amino nitrogen.Am. J. Enol. Vitic. 52: 400-401.Seminario TécnicoCompuestos azufrados volátiles en vinos32 Smyth, H., Cozzolino, D., Herderich, M.J., Sefton,M.A.; Francis, I.L. (2005) Relating volatilecomposition to wine aroma: identifi cation of keyaroma compounds in Australian white wines. Blair,R.J.; Williams, P.J.; Pretorius, I.S. (eds.) Proceedings ofthe Twelfth Australian Wine Industry Technical Conference,Melbourne, Vic, 24-29 July 2004. AustralianWine Industry Technical Conference Inc., AdelaideSA: 31-33.33 Sowalsky, R.A.; Noble, A.C. (1998) Comparisonof the eff ects of concentration, pH and anion specieson astringency and sourness of organic acids.Chem. Senses 23: 343-349.34 Swiegers, J.H.; Francis, I.L.; Herderich, M.J.; Pretorius,I.S. (2006) Meeting consumer expectationsthrough management in the vineyard and winery:the choice of yeast for fermentation off ers great potentialto adjust the aroma of Sauvignon Blanc wine.Aust. N.Z. Wine Ind. J. 21: 34-42.35 Torrea, D.; Henschke P.A. (2004) Ammonium supplementationof grape juice – eff ect on the aromaprofi le of a Chardonnay wine. Tech. Rev. 150, 59-63.36 Torrea, D.; Siebert, T.; Liebich, B.; Ancin, C.; Francis,L.; Henschke, P.A. (2005) Eff ect of ammoniumsupplementation of a Chardonnay must on winearoma. Blair, R.J.; Williams, P.J.; Pretorius, I.S. (eds.)Proceedings of the Twelfth Australian Wine IndustryTechnical Conference, Melbourne, Vic,, 24-29 July2004. Australian Wine Industry Technical ConferenceInc., Adelaide, SA: 293.37 Ugliano, M.; Siebert, T.; Capone, D.; Mercurio,M.; Henschke, P.A. (2007) Colour, aroma and flavour compounds in Shiraz wine as aff ected by DAPaddition before fermentation. Blair, R.J.; Williams, P.J.;Pretorius, I. S. (eds.) Proceedings of the thirteenthAustralian Wine Industry Technical Conference,Adelaide, SA, 28 July-2 August 2007. Australian WineIndustry Technical Conference Inc. Adelaide, SA: inpress.38 Vilanova, M.; Ugliano, M.; Siebert, T.; Pretorius,I.J.; Henschke, P.A. (2007) Assimilable nitrogen utilizationand production of volatile and nonvolatilecompounds in chemically defi ned medium by Saccharomycescerevisiae wine strains. App. Microbiol.Biotechnol. 77: 145-157.39 Wang, X.D.; Bohlscheid, J.C.; Edwards, C.G.(2003) Fermentative activity and production ofvolatile compounds by Saccharomyces grown insynthetic grape juice media defi cient in assimilablenitrogen and/or pantothenic acid. J. Appl. Microbiol.94: 349-359.Textos asociados71

Unravelling thegenetic blueprint ofwine yeastBorneman, A.R.; Forgan, A.H.; Chambers, P.J.; and Pretorius,I.S.The Australian Wine Research Institute, PO Box 197, GlenOsmond (Adelaide), South Australia 5064, AustraliaIn a world first, scientists at the Australian Wine ResearchInstitute have sequenced the wine yeast genome,characterising the ‘recipes of life’ that shapethis winemaker’s ‘friend’.Unlocking the secret to what makes wine yeast tickwill put winemakers in a stronger position to usescience to their advantage. This work paves the wayfor the development of new yeast strains, potentiallyleading to innovative solutions to tackle stuckfermentation and to create wines with desired alcohollevels and flavour profiles.Every four years, the Olympic Games inspire the worldwith spectacular performances and feats of endurance,speed and grace. We marvel at the athletic performanceof the competitors; most of us can only wonderhow these champions reach the standards theydo. What makes world record-breakers so profoundlydifferent to the rest of us? Are we not the same species,and therefore shouldn’t we all have the samepotential? Couldn’t we also win gold in swimming orrunning if we had the same training regimes, diet, lifestyle,etc.? The answer is no. Elite athletes are bornwith a potential that has ‘gold’ stamped all over it. Theyhave muscle-types, physique, physiology and aptitudethat, with training, can be honed for internationalsuccess. Unfortunately, most of us would require agreat deal more than honing to reach this elite level;until bionics is able to rebuild what we are born with,when it comes to athletics, most humans will have tosettle for amateur league or less (Figure 1(a)).Differences in performance of individuals of the samespecies are not peculiar to humans; in fact we see iteverywhere in nature. Take, for example, the humbleyeast that winemakers use to craft complex, deliciouswine from sweet, syrupy grape juice. Most wine yeastare the same species, Saccharomyces cere visiae, butnot all members of this group are able to producewine, and, among those that do, there is considerablevariation in how reliably and efficiently they work, andin the quality of the wine they produce.Seminario TécnicoCompuestos azufrados volátiles en vinosThis begs the question: What makes a wine yeast tick?What, in the inner workings of this elite athlete, enablesit to grow in such an inhospitable environment and delivergold medal wines when other S. cerevisiae strainsdon’t even leave the starting blocks? Research at theAustralian Wine Research Institute (AWRI) is beginningto unravel the mysteries of the variation across the S.cerevisiae species, and early results on what they tellus about wine yeast are tantalising.The variation in performance that we see across strainsof S. cerevisiae is inheritable; this means that it isgenetically determined. The starting point for characterisingthis variation, therefore, should focus on yeastgenetics.Fortunately, S. cerevisiae was the first organism of itstype to have its genetic make-up (its genome) sequenced,and this was done over ten years ago on a strain,known as S288c, chosen for its ‘laboratory friendly’characteristics (for more information on what genesand genomes are, see the breakout box). Scientistslove this yeast because it is very easy to work with, butit would not win any medals in the winemaking arena;in fact, it is probably not even up to amateur status.Nevertheless, if you want to find out what makes wineyeast so different from other S. cerevisiae strains, youhave to have something to compare it with, and S288cis a good starting point.Another strain of S. cerevisiae, YJM789, recently hadits genome sequenced. The genome of this yeast, anopportunistic pathogen isolated from the lungs of anAIDS patient, turned out to be quite different to thatS288c. Thus we had two different versions of S. cerevisiaeto compare a wine yeast against, and this is whatwe found.It turns out that our wine yeast is a little more differentto the two previously sequenced strains than they areto each other (Figure 2). About 0.6% of the letters ofthe wine yeast sequence are different to what is foundin the laboratory strain. This might seem like a smalldifference, but if you consider that genetic differencesbetween humans and chimpanzees amount to onlyabout 1-2%, it is really quite large.Perhaps of greater interest, however, is that thereare extra DNA sequences in the wine yeast; enoughto carry at least 27 genes that are not present in thetwo yeasts it was compared against. In fact, some ofthe sequences in this extra DNA do not resemble anythingfound in other species of Saccharomyces; theyappear to be more like genes found in very distantfungal relatives. We do not yet know how they gotinto the wine yeast genome, but we are curious tofind out whether or not they play a part in distinguishingwine yeast from other S. cerevisiae, particularly inthe winemaking stakes.Some of the wine yeast-specific genes encode proteinsthat are probably associated with the cell wall,Textos asociadosWine Industry Journal > Vol 23 No 5 > September /October 200873

Unravelling the genetic blueprint of wine yeasta feature of yeast that is undoubtedly important forresilience in inhospitable environments.We are curious to find out whether these genes impacton robustness of wine yeast, a feature that is crucialfor completing fermentations. Do these genes, forexample, make the yeast more or less vulnerable tobecoming stuck or sluggish in a ferment? We have alsoidentified genes that probably encode proteins associatedwith amino acid uptake (a neutral amino acidtransporter) and metabolism (an aspartate transaminase).Because amino acid metabolism is associatedwith flavour development, it is tempting to suggestthat these genes will impact on sensory attributes inwine, but, of course, this will have to be tested.Then there are lots of genes that we cannot guess thefunction(s) of yet, and these might turn out to be themost exciting of all; time and experimental work will tell.Interestingly, we also found some sizeable rearrangementsin the genome that we are also curious about,but cannot even guess what their significance will be.What does the future hold now that we have this richsource of information on a wine yeast? We will, ofcourse, ascertain as far as possible, which of the uniquefeatures of a wine yeast genome are important ina winemaking context.However, we also plan to build on data gatheredfrom this project by sequencing and comparing thegenomes of several other wine yeast strains that areknown to have different winemaking properties Thiswill enable us to work out what is common to all wineyeasts (i.e. what constitutes the core requirements ofa wine yeast) and what differences between themdrive production of wines with differing qualities (e.g.different propensities to deliver fruity flavours andaromas).Once we understand what makes a wine yeast tick,and the significance of variation among wine yeasts,we will be much better placed to develop strains of1(a)1(b)Figure 1. No two humans have the same genetic make-up. An elite athlete, for example, is born witha genome that has ‘gold medal’ stamped all over it (Figure 1(a)). Similarly, not all wine yeasts are thesame; different wine yeasts have different genetic make-up (Figure 1(b)). This is why some wine yeaststrains are more robust that others and different strains impart different sensory properties to wines.Understanding what, in the genome of a wine yeast, determines its robustness and its ability to producedesirable (and undesirable) sensory attributes will enable the development of improved strains that willassist winemakers to craft wines for an increasingly demanding and constantly changing market.74

Seminario TécnicoCompuestos azufrados volátiles en vinosACKNOWLEDGEMENTSFigure 2. The genome sequences of three strainsof Saccharomyces cerevisiae has revealed howsimilar they are to each other. The numbers incircles on the arrows separating the differentstrains represent the number of ‘letters’ in thegenome that differ between the strains. The 60,399differences between a wine yeast and a laboratoryyeast is equivalent to about 0.6% of the genome.this microorganism that can complete the marathonof fermentation without becoming stuck or sluggishen route, while producing gold medal wines; and allof this should be possible without the need of performanceenhancing additives.Just like our Olympians at the Australian Institute ofSport, the wine sector has gold-medal aspirations.Backed by sound science and robust research it shouldbe gold all of the way for Australian winemakers.The AWRI, a member of the Wine Innovation Clusterin Adelaide, is supported by Australia’s grapegrowersand winemakers through their investment body, theGrape and Wine Research and Development Corporation,with matching funds from the Australian Government.Systems biology research at the AWRI isperformed using resources provided as part of the NationalCollaborative Research Infrastructure Strategy,an initiative of the Australian Government, in additionto funds from the South Australian State Government.We gratefully acknowledge the contribution of theAustralian Genome Research Facility, a member ofBioplatforms Australia, where the actual sequencingof the wine yeast genome was carried out. We alsothank Sharon Mascall and Rae Blair for editorial assistance,and JeffEglinton for the preparation of the illustrations.The detailed results of this work are publishedin the peer-reviewed journal FEMS Yeast Research.FURTHER READINGBorneman, A.R, Forgan; A., Chambers, P.J. and Pretorius,I.S. (2008) Comparative genome analysis of aSaccharomyces cerevisiae wine strain.FEMS Yeast Research 8:1185-1195.Borneman, A.R.; Chambers, P.J. and Pretorius,I.S. (2007) Yeast Systems Biology: modelling thewinemaker’s art. Trends in Biotechnology 25:349-355.Goffeau A.; Barrell B.G.; Bussey H.; Davis R.W.; DujonB.; Feldmann H.; Galibert F.; Hoheisel J.D.; JacqC.; Johnston M,; Louis E.J.; Mewes H.W.; MurakamiY.; Philippsen P.; Tettelin H. and Oliver S.G. (1996)Life with 6000 genes. Science 274: 546, 563-567.Cracking the Code: Genes and GenomesGenes are recipes for making proteins. For example, your cells carry a gene/recipe for making the protein insulin, which is a hormonethat regulates blood sugar level. You also have genes/recipes that instruct your cells how to make proteins that control how tall youcan grow, the colour of your eyes, the general shape of your body, etc. It is these recipes of life that dictate whether you will haveathletic potential or not, and, because you inherited them from your parents you end up looking like them.If genes are recipes then genomes are recipe books. The human genome carries all of the recipes required for making proteins to build ahuman body from conception to adulthood, and repair and defend that body during its life. All of our physiology and anatomy is shaped by acollection of 20,000-25,000 genes that comprise the human genome. And, unless you have an identical twin, your recipe book diff ers a littlefrom everyone else’s.The language of the genes is very diff erent the languages we use to communicate with each other. It is based on an alphabet of only fourletters (A, T, G and C) and its lexicon is limited to three letter words, which means there are only 64 words in the genetic dictionary. Howeverthis is more than enough to string together sets of instructions for building all of the proteins (enzymes, hormones, muscles, antibodies,cartilage etc.) we require for life.The ‘paper’ on which the words that make up the recipes of life is written is known as DNA, and when we read an entire recipe book of anorganism, decoding what is recorded in its DNA, we say we are sequencing its genome. What we end up with in this process is a long sequenceof millions of A, T, G, and Cs, with no spaces or obvious punctuation marks, that we have to decipher. Thankfully, sophisticated computationalaids can do most of this for us.Textos asociados75

When the heat is on,yeast fermentationruns out of puffCoulter, A.D.; Henschke, P.A.; Simos, C.A. and Pretorius,I.S.The Australian Wine Research Institute, PO Box 197, GlenOsmond (Adelaide), South Australia 5064, AustraliaSouth Australia was sweltering. For more than twoweeks in March this year, Adelaide sweated in unrelentingheat. Thermometers glared red as daytimetemperatures refused to drop below 35°C. Scientistscalled it a record-breaking heatwave: a once in threemillennia event. On the vines, sugar levels also soaredto record-breaking heights. Varieties that normallymature weeks apart ripened together. Winemakersscrambled to harvest their fruit and crammed theirfermentors full. Everyone hoped for the best.Fermenting a must through to dryness with such highsugar concentrations would have been challengingeven for the toughest yeast due to the high levels ofethanol produced. Ferments kicked-offwell but latermany started to run out of puffand required robust fermentationrescue procedures. Some were still tickingover months later. In the past, the number of querieswe receive about stuck fermentations has been fairlyconstant. This year they doubled.The Australian Wine Research Institute (AWRI) regularlyhandles calls from winemakers looking for helpand advice. But, although the chemistry behind stuckfermentation is simple, the causes are invariably complexmaking them frustratingly difficult to predict.There is evidence that most of the ‘stuck ferment’ querieswe received were related to the heatwave that hitmuch of South Australia and Victoria in the first halfof March 2008. But stuck fermentation is a complex% Ethanol128400 100 200 300 400Time (hr)Figure 1. Optimal and sub-optimal fermentationprofi les. Four types of sub-optimal fermentationare commonly observed: delayed on-set;continuously slow ferments; sluggish ferments;and incomplete or stuck ferments.24201612840°BrixAlcoholBiomassStuckSluggishSlowDelayedonsetOptimalSeminario TécnicoCompuestos azufrados volátiles en vinosproblem and research has identified a multitude ofpotential causes, any combination of which can beinvolved. Our inability to measure or assess many ofthese factors in real time further exacerbates the problem.As a result, it can be difficult to work out why ithappens.The definition is straightforward. At some point duringfermentation, the process slows or stops too soon,preventing the remaining sugar in the wine from beingconverted to alcohol and carbon dioxide (Figure1). Yeast activity – or a lack of it – is usually the culprit.The yeast might be feeling quite stressed due to itsenvironment, or there might be something wrongwith the yeast itself, preventing it from doing its job.Wine yeast works best when the temperature is nottoo hot, or not too cold and there are plenty of nutritiousside-dishes to go with the main carbohydraterichcourse. Like any selfrespecting organism, it enjoyssanitary conditions and relative freedom from the irritatingexcesses of unwanted dinner guests (Figure 2)that can spoil the best parties. Coming up for air turnsout to be surprisingly important for fermenting yeast– a sniffof oxygen will repay the winemaker manyfold with renewed enthusiasm to get back to the jobat hand. Inebriating ‘agents’ render it incompetent.Too much ethanol, for example, can stop yeast fromgrowing by starving it of nutrients and increasing thetoxicity of other compounds.The advice from the AWRI is that stuck fermentation isusually avoidable if winemakers keep the basics in balance:moderation of sugar levels, adequate supply ofkey nutrients including nitrogen and oxygen, effectivesulfur dioxide, pH control, avoiding over-clarification,vigilant barrel management and clean conditionsfrom harvester to fermentor. But this year, the heatcreated a new set of problems.During March’s heatwave, winemakers reported fruitarriving at the crusher with temperatures in the mid tohigh 30s. On one particular day, fruit arrived at one winerywhere temperatures topped 40°C. Some coolingsystems could not cope. The scramble to harvest anddeliver the rapidly ripening fruit made matters worse.Inside the wineries, in the fermentors, dehydrated andshrivelled fruit was hard to process, causing blockagesin heat exchangers. The first week of the heatwavewas bad enough with rapidly rising sugar levels, ashas been seen in previous hot vintages. But, the secondweek stressed the already drought stressed vinesbeyond their limit producing heavily dehydratedfruit, perhaps as the parched vines deprived sunburntberries of moisture. Outside, in the trucks queued upwith their precious loads, the microbes took hold.Micro-organisms had a field day in the mountains ofwarm berries. Delays, lack of refrigeration and the un-Textos asociadosWine Industry Journal > Vol 23 No 5 > September /October 200877

When the heat is on, yeast fermentation runs out of puffrelenting heat offered an opportunity for growth. Thecombination of heat stress, dehydration and mechanicalharvesting had left more fruit damaged than usual.‘Enemy’ microbes had the perfect breeding ground.Left to grow unchecked, some ‘bugs’ can wreak havoc.The grape apiculate yeast Hanseniaspora uvarum candevelop quickly, for example, robbing grape must ofimportant nutrients. One of its targets is thiamine, forwhich it has an insatiable appetite. Thiamine is essentialfor the efficient production of ethanol by Saccharomycesyeast. There is no easy procedure to detectvitamin deficiencies until the ferment becomes sluggishand responds to supplements. When excessivegrowth of wild yeast (Figure 2) is observed betweenthe harvester and fermentor it is important to addthiamine and other vitamins to the starter culture.For musts from vineyards with a history of fermentationproblems, the addition of complex inactivatedyeast nutrients can also be beneficial.Hanseniaspora uvarum can also produce off-flavoursincluding the vinegary taste of acetic acid. Researchhas shown that hot conditions can dramatically increasethe production of acetic acid and, this year, winemakershave reported high levels of volatile acidity(VA) to the AWRI.Lactic acid bacteria also thrive in warm conditions,producing acetic acid as well as other unwanted compoundsfrom the grape sugars and acids. Growth ofcertain lactic acid bacterial strains is enough to leavethe pluckiest wine yeast running for cover. Spoilagein addition to stuck fermentation is often the result.CandidaMetschnikowiaDebaryomycesKluyveromycesCryptococcusSaccharomycesHanseniasporaSchizosaccharomycesSaccharomycodesDekkeraLactic acidbacteriaKloeckeraPichiaZygosaccharomycesAcetic acidbacteriaWild yeastSpoilage bacteriaFigure 2. Grapes harbour a variety of yeasts andbacteria, and depending on the addition of sulfi tes,grape temperature and time taken for transport tothe winery, the hygienic status of grape processingmachinery, pre-maceration, pressing and clarification procedures, a variable proportion of grapeyeasts survive in the juice or must. Together withmicroorganisms associated with processingequipment, these yeasts can proliferate in juice ormust, depending on physicochemical and nutrientconditions.Accumulation of acetic acid beyond a gram per litrestarts to affect yeast growth and becomes more toxicas the alcohol level builds.When this year’s stuck ferments were tested at theAWRI, sensory analysis revealed that a number ofthem were affected by a mousy off-flavour. They hadhigh concentrations of acetic acid, low concentrationsof malic acid – many ferments underwent malolacticfermentation – and they contained various unwelcomemicro-organisms. The results after analysing onered wine with stuck fermentation were typical of thosetested (Table 1, see page 27). Lactic acid bacteriaare also known to produce mousy off- flavour in grapebins when given a long journey under warm conditionswithout sufficient protective sulfites.The winemakers’ usual weapons against enemy microbesare sulfites, and clarification treatments for whites.But a review of research into stuck fermentationpublished by the AWRI shows that in extreme conditions,adding sulfur dioxide to grape bins might notbe enough. Sulfur dioxide has a tendency to ‘hook up’with sugar, sapping its effectiveness. The high levels ofsugar caused by this year’s heatwave would have hadsuch an effect. The higher levels of spoilage noted thisyear signals that the levels of sulfites normally used tocontrol wild yeast and bacteria was often inadequateunder these exceptional conditions.As a result, winemakers needed to increase their useof sulfites and clean their harvester bins regularly tokeep the bugs at bay. Without these kinds of controlmeasures, the development of large populations ofindigenous microorganisms could have depleted nutrients.This would have made it very hard for the wineyeast to complete the fermentation, which with thehigher sugar levels would have been an even hardertask.Table 1. Results of analysis of a typical ‘high VA’2008 red ferment.Analysis ResultAlcoholAcetic acidGlucose + fructoseMalic acid12.0% v/v1.94g/L47.0g/L

Even when microbes were kept in check, the heatwavestill took its toll. Yeast is particularly sensitiveto heat in its growth phase and when temperaturestop well over 30°C, in combination with high ethanol,it becomes stressed. When the heat is on, researchhas shown that the viability and vitality of yeast areaffected; it produces more volatile acidity and stuckfermentation is more likely.High temperatures also increase yeast consumptionof nitrogen. If yeast assimilable nitrogen (YAN; Figure3) is low – due to growth of wild micro-organisms orprevailing drought conditions – then stuck fermentationis also more likely.The AWRI’s analysis of YAN levels in several hundredjuice samples – taken from tanks in two South Australianwine regions after crushing – show a drop inYAN levels for the 2008 vintage, compared with theprevious year (Figure 4(a)).There were also greater variations between YAN levelsin samples taken from the 2008 vintage (Figure 4(b)).This means that some juices would have had relativelylow concentrations and the risk of stuck fermentationwas more likely.Glucose (g/L)20016012080400Optimal400250Initial YAN (mg/L)Figure 3. The risk of fermentation problemsis increased when grape must is sub-optimalin nutrient content, especially for assimilablenitrogen, and vitamins, the latter of which can belost during grape harvest and must processing.A high ratio of sugar to other nutrients can leadto low biomass and fermentation rate, and theearly onset of sugar transport inactivation in yeast.The general rule of thumb is that musts with YANlevels of

When the heat is on, yeast fermentation runs out of puff4(a)2007 20084(b)250120200100YAN concentration (mg/L)15010050YAN concentration SD (mg/L)806040200Region ARegion B0Region ARegion BFigure 4(a). The average YAN concentration in juices from two regions in South Australia for the 2007vintage and the 2008 vintage. For region A, n = 855 in 2007 and 1272 in 2008; for region B, n = 414 in 2007and 788 in 2008. Figure 4(b). Standard deviation in average YAN concentration from wine regions A and Bwas greater in 2008 than in 2007.concentrations of inhibitors in the stuck wine, especiallyethanol. It is, however, critically important thatthe yeast not be starved of sugar or nitrogen duringthe stepwise acclimatisation procedure. The cultureshould also be briefly aerated at each step.Fresh yeast lees from successfully completed fermentscan also be useful for reinvigorating or restarting fermentswhen a relatively small amount of residual sugarremains. A small addition of DAP and limited aeration,once the yeast is actively fermenting, promotesgood activity. This procedure provides a more convenientrescue option when yeast lees are available.Looking ahead, the AWRI is also alerting winemakersto the longer term effects of the 2008 heatwave. If redwines contain higher than usual amounts of residualsugar, and other nutrients added as fermentationstimulants, for example, the Brettanomyces/Dekkerayeast, can strike later in the maturation cycle or evenafter bottling of unfiltered wines. The higher alcoholconcentrations of 2008 wines might slow the growthof this spoiler meaning that greater vigilance shouldbe maintained further on down the process chain.Malolactic fermentation is also adversely affected byhigh alcohol levels such that Brettanomyces/Dekkerayeast can have a greater opportunity while the wineis unprotected by sulfites. The more alcohol tolerantlactobacilli, which are capable of forming biogenicamines, will also thrive if the pH is not maintained below3.5, which is more favourable to Oenococcus. Theimpact of March 2008 might continue if not managedwith greater care due to the perturbed nature of thisyear’s wine chemistry.Stuck fermentations – what you can do• Increase the concentration of sulfur dioxideadded to grape bins. Th is will keep microbial‘bugs’ at bay and slow oxidation whichcan speed up at higher temperatures.• Sanitise bins between loads. Cover binsduring transport to keep the sun off fruit.Clean all equipment to stop bacteria.• Choose yeast known to have high toleranceto alcohol and prepare it properly. Rehydrationof dried yeast with complex inactivatedyeast nutrients can be benefi cial forstressful ferments.• Dilute very high sugar musts with lowstrength juice (LSJ) before fermentation toimprove wine balance, in accordance withwine statutory regulations.• Add tartaric acid as soon as must tanks aremixed and acidity levels are known. Checkagain after thorough mixing to ensure levelsare correct.• Take steps to reduce pH to improve the efficacy of sulfur dioxide. Lower pH increasesits antimicrobial and antioxidant properties.It controls the growth of unwantedmicroorganisms including lactobacilli,some species of which are known to inhibityeast development.• Monitor pH during fermentation and maintainit between 3.4-3.5.• Measure YAN, preferably on the last vineyardmaturity sample before harvest, sothat DAP can be added accordingly. If thisis not possible, add DAP as a precautionagainst low YAN, especially in dry years andwhen sugar concentrations are high, sincemore YAN is needed by yeast to achieve lowresidual sugars.• Aeration of ferments around the mid pointof fermentation can be highly benefi cial byrestoring lagging rates and has no knownadverse impact on wine fl avour, rather itcan prevent quality losses which sometimesresult from stuck fermentations.• Increasing juice turbidity consistent withtarget wine style can considerably improvegrowth and fermentation activity.• Consider adding lysozyme to must of fermentsto control bacterial development.80

Seminario TécnicoCompuestos azufrados volátiles en vinosACKNOWLEDGEMENTSThe Australian Wine Research Institute, a member ofthe Wine Innovation Cluster in Adelaide, is supportedby Australia’s grapegrowers and winemakers throughtheir investment body, the Grape and Wine Researchand Development Corporation, with matching fundsfrom the Australian Government. We thank SharonMascall and Rae Blair for editorial assistance, and JeffEglintonfor the preparation of illustrations.FURTHER READINGBell, S.J. and Henschke, P.A. (2005) Implications ofnitrogen management for grapes and wine. AustralianJournal of Grape and Wine Research 11:242-295.Bisson, L.F. and Butzke, C.E. (2000) Diagnosis andrectification of stuck and sluggish fermentations.American Journal of Enology and Viticulture 51:168-177.Bisson, L.F. (1999) Stuck and sluggish fermentations.American Journal of Enology and Viticulture 50:107-119.Eglinton, J.M. and Henschke, P.A. (1999) Restartingincomplete fermentations: the effect of high concentrationsof acetic acid. Australian Journal of Grape andWine Research. 5:71-78.Henschke, P.A. (1997) Stuck fermentation: causes,prevention and cure. Allen, M.; Leske, P.; Baldwin, G.,eds. Advances in juice clarification and yeast inoculation:proceedings of a seminar; 15 August 1996; Melbourne,Victoria. Adelaide, South Australia: AustralianSociety of Viticulture and Oenology; 1997: 30-38, 41.Sablayrolles, J.M.; Dubois, C.; Manginot, C.; Roustan,J.L. and Barre, P. (1996) Effectiveness of combinedammoniacal nitrogen and oxygen additions forcompletion of sluggish and stuck fermentations. Journalof Fermentation and Bioengineering 82:377-381.Schmidt, S.A.; Tran, T.; Chambers, P.J.; Herderich,M.J. and Pretorius, I.S. (2006) Developing indicatorsof wine yeast performance: an overview of the impactof ethanol stress. Australian and New Zealand WineIndustry Journal 21:24-30.Ugliano, M.; Henschke, P.A.; Herderich, M.J. andPretorius, I.S. (2007) Nitrogen management is criticalfor wine flavour and style. Australian and New ZealandWine Industry Journal 22:24-30.These articles can be obtained by contacting the AWRI’sJohn Fornachon Memorial Library.Email library@awri.com.au, telephone (08) 8303 6600.Further information is also available on the AWRI’s websitewww.awri.com.au A summary of factors affectingsub-optimal fermentation is presented by Dr Paul Henschkein a webcast at www.awri.com.au.This site is accessible to all Australian grape and wine levypayers.Summary• The 2008 vintage in southern Australia experienced an increase incases of stuck fermentation.• The March heatwave was a key factor. Yeast does not thrive in extremeheat or cold, or indeed when subjected to rapid changes intemperature.• Heat stress, transport delays and refrigeration problems gaveunwanted microbes a head start, further compromising yeast activity.• High sugar levels led to high amounts of ethanol, which can be toxicto yeast, leading to higher residual sugar levels in wine. Highernutrients can stimulate Brettanomyces/Dekkera yeast during maturation.• Low YAN levels after persistent drought also had an impact.• Simple strategies such as keeping bins and equipment clean, monitoringpH and using the right yeast and nutrients, can give winemakersthe upper hand.Textos asociados81

Taking control ofalcoholVarela, C.; Kutyna, D.; Henschke, P.A.; Chambers, P.J.;Herderich, M.J.; Pretorius, I.S.The Australian Wine Research Institute, PO Box 197, GlenOsmond (Adelaide), South Australia 5064, AustraliaAlcohol is the backbone of wine, yet too much canput a wine off-balance. Taking control of alcohol levelsin wine is, therefore, critical to the winemaker’sart; can winemakers bottle the sunshine flavours weexpect of Australian wine but leave out some of thealcohol? One of the keys is wine yeast. Previouslychosen for their efficiency in converting sunshineinto alcohol, we are now generating new strains ofyeast that make reduced levels of alcohol; still lotsof sunshine in the bottle but with less risk of ‘sunburn’.Getting the alcohol level right in winemaking can besurprisingly difficult. This is particularly evident whengrapes are grown where the weather is warm and fruitis given lots of time on the vine for flavour development;in these conditions ‘high alcohol’ can becomea problem.Over the past 20 years, the Australian Wine ResearchInstitute has charted an increase in average alcohol levelsin Australian wine. In 1984, levels were 12.4% v/v;in 2004, they had risen to 14.2% v/v, and similar storiesare heard from around the grapegrowing regions ofthe world. The 2008 vintage hit another ‘sugar high’as the heatwave across southern Australia midwaythrough harvest took its toll.Hot weather accelerates ripening, which leads to higherlevels of sugar. Higher amounts of sugar lead tohigher levels of alcohol. In countries like ours, wherethe sun shines for long hours and some grapes are lefton the vine to create rich, full-bodied flavours, highalcohol is becoming an issue.Wine with high alcohol levels can mean higher costs.In countries where taxes are levied according to ethanolcontent, high alcohol wines can be taxed out ofthe market. High alcohol can also compromise flavour,and today’s society is seeking a healthier approach tohigh alcohol consumption.To tackle the problem, the Australian wine sector isinvestigating new ways to lower the concentration ofethanol in wine. One strategy is to harvest grapes beforethey reach full maturity, when the concentrationof sugar in the berries is lower. To a degree, this approachis already being used by some winemakers. But,until we understand viticultural factors that advanceSeminario TécnicoCompuestos azufrados volátiles en vinosflavour development in relation to sugar ripeness,this approach can undermine the full-bodied characterand ripe fruit flavours for which some Australianwines are known. Removing sugar from grape mustbefore fermentation is another way to lower ethanolbut is relatively expensive to carry out. A third strategyused successfully at a number of wineries around theworld is to remove alcohol from wine after fermentation.Even this has its drawbacks: it adds to productioncosts; might impact wine flavour under certain conditions,and not all international markets might acceptAustralian wine that has undergone this procedure.Another strategy is to target wine yeast. The hunt is onfor strains of wine yeast that convert less of the sugarthey consume into ethanol (see, for example, Figure1). Commercially available Saccharomyces cerevisiaestrains have been categorised by some yeast manufacturersaccording to the concentrations of ethanolthey produce.But how different are these yeasts? Do strains really differin terms of the ethanol they produce? To find out,scientists at the AWRI checked how much ethanol isproduced by six commercial wine yeasts described bymanufacturers as low- or high-ethanol strains.We also investigated two of our own novel wineyeasts – produced at the AWRI – to see how efficientthey were at fermentation and how much ethanolthey produced. The two strains came from early stageexperimental work at the AWRI aimed at generatingyeast that produce reduced amounts of ethanol.AGrape sugars:GlucoseFructoseBGrape sugars:GlucoseFructoseGlycerolEthanolC0 2EthanolFigure 1. Sugar metabolism of wine yeast. A:Consumption of sugars leads mainly to theproduction of ethanol and carbon dioxide and,to a lesser extent, glycerol. B: Modifying yeastmetabolism so more glycerol is synthesisedreduces the amount of ethanol produced.Textos asociadosWine Industry Journal > Vol 23 No 6 > September /October 200883

Taking control of alcoholEthanol [% v/v]Ethanol [% v/v]12.0 –11.5 –11.0 –10.5 –CDGJ10.0 –AWRI 796 Maurivin B A WRI R2 PDM UCD522 N96 AWRI 1689 AWRI 169013.5 –13.0 –12.5 –12.0 –11.5 –11.0 –Chardonnay10.5 –AWRI 796 Maurivin B A WRI R2 PDM UCD522 N96 AWRI 1689 AWRI 1690Figure 2. Ethanol content of wine producedfrom chemically defined grape juice (CDGJ)and Chardonnay juice, fermented with differentcommercial wine yeast strains.We tested the eight different yeasts using chemicallydefined grape juice (CDGJ), containing specified levelsof sugar and yeast assimilable nitrogen, and Chardonnayjuice. Fermentation took place in controlledlaboratory conditions and, once complete, sampleswere collected for analysis. The researchers measuredresidual sugar, ethanol, glycerol, malic acid and aceticacid as well as alcohol in the synthetic wine (CDGJ)and Chardonnay using advanced analysis techniques.The concentrations of ethanol produced by the sixcommercial wine strains are shown in Figure 2. In syntheticwine, ethanol concentrations varied between11.3% v/v and 11.6% v/v with a maximum differenceof 0.3% v/v. In Chardonnay, ethanol content variedbetween 12.4% v/v and 12.9% v/v, with a maximumdifference of 0.5% v/v. The differences look small butare statistically significant. They are also supported bya previous research study that tested 113 strains ofwine yeast grown in synthetic grape juice.Although there are no published data on final ethanolconcentrations in red varieties, our research shows itis very likely that 0.5% v/v is the maximum differencepossible by choosing a currently available, commercialwine yeast strain. Commercial strains do not giverise to large differences in ethanol concentrations.As a result, we are trying to generate novel strains ofwine yeast that metabolise sugar in such a way thatless ethanol is produced while maintaining high winequality.Using a non-genetically modified (non-GM) approach,known as adaptive evolution, we are workingto create the right conditions to ‘persuade’ yeast toproduce less ethanol. Even though the science is notstraightforward, early results have been promising.So far, two prototype yeast strains have been produced– AWRI 1689 and AWRI 1690. Both generate lessethanol than their parent strain – N96 (similar to stra-Table 1. Product concentrations in wine made from Chardonnay juice using N96 and wine yeast variantsobtained by adaptive evolution.Strain Ethanol [% v/v] Glycerol [g/L] Acetic acid [g/L]Fermentationefficiency* [g sugarper 1% ethanol]N96 12.9 ± 0.1 5.8 ± 0.1 0.1 ± 0.0 16.1 ± 0.1AWRI 1689 12.7 ± 0.1 7.0 ± 0.0 0.1 ± 0.0 16.4 ± 0.1AWRI 1690 12.6 ± 0.1 7.1 ± 0.0 0.0 ± 0.0 16.5 ± 0.1* Initial and residual sugar concentrations were used to calculate fermentation efficiency.Table 2. Product concentrations in wine made from Chardonnay juice using a range of differentcommercial wine yeast strains.Strain Ethanol [% v/v] Glycerol [g/L] Acetic acid [g/L]Fermentationefficiency* [g sugarper 1% ethanol]AWRI 796 12.4 ± 0.1 7.7 ± 0.2 0.1 ± 0.0 16.8 ± 0.2Maurivin B 12.7 ± 0.1 6.4 ± 0.0 0.5 ± 0.0 16.5 ± 0.1AWRI R2 12.7 ± 0.1 6.4 ± 0.0 0.1 ± 0.0 16.4 ± 0.1PDM 12.8 ± 0.1 5.9 ± 0.1 0.2 ± 0.0 16.3 ± 0.1UCD 522 12.8 ± 0.0 6.3 ± 0.1 0.1 ± 0.0 16.2 ± 0.0N96 12.9 ± 0.1 5.8 ± 0.1 0.1 ± 0.0 16.1 ± 0.1* initial and residual sugar concentrations were used to calculate fermentation efficiency.84

Seminario TécnicoCompuestos azufrados volátiles en vinosins known in the industry as EC1118, Pris de Mousseand PDM) – but were still fast at fermentation. The twonew strains metabolised a small portion of sugar insuch a way that it did not turn into ethanol (Table 1).It was also important to investigate other metabolites,since major distortions in their concentrations mightaffect aroma or flavour. Table 2 shows glycerol andacetic acid concentrations in Chardonnay wines, fermentedusing commercial wine yeast strains. For allstrains, there was clearly a link between ethanol andglycerol concentrations. Higher glycerol was associatedwith lower ethanol. The major component of volatileacidity, acetic acid, was not affected.The decrease in ethanol concentration might be smallcompared with the two ‘lowered ethanol’ prototypeyeast strains produced by the AWRI, but we are confidentour ‘non-GM’ strategy is working.The AWRI’s technology should be capable of generatingstrains that are even lower in ethanol thanthose currently available. For winemakers wanting totake control of high alcohol, innovation is driving theevolution of wine yeast in the right direction. Naturetook some 20 million years to evolve highly efficientfermentation yeast, we hope to reverse some of thisevolution in a relative blink of the eye!AcknowledgementsThe Australian Wine Research Institute, a member ofthe Wine Innovation Cluster in Adelaide, is supportedby Australia’s grapegrowers and winemakers throughtheir investment body, the Grape and Wine Researchand Development Corporation, with matching fundsfrom the Australian Government.The authors wish to thank Rae Blair and Sharon Mascallfor editorial assistance.Further readingDe Barros Lopes, M.; Eglinton, J.M.; Henschke, P.A.;Høj, P.B. and Pretorius, I.S. (2003) The connectionbetween yeast and alcohol production in wine: Managingthe double edged sword of bottled sunshine.Australian and New Zealand Wine Industry Journal18:27-31.Godden, P.W. and Gishen, M. (2005) Trends in thecomposition of Australian wine 1984-2004. In: Blair,R.J.; Francis, M.E. and Pretorius, I.S. (ed) Advances inwine science – commemorating 50 years of The AustralianWine Research Institute, The Australian WineResearch Institute, pp115-139.Guth, H. and Seis, A. (2002) Flavour of wines: towardsan understanding by reconstitution experiments andan analysis of ethanol’s effect on odour activity of keycompounds. Blair, R.J.; Williams, P.J. and Høj, P.B., (eds).In: Proceedings of the eleventh Australian Wine IndustryTechnical Conference; 7-10 October 2001. Adelaide,SA Australian, Australian Wine Industry TechnicalConference Inc.; pp128-139.Jenson, I. (1997) Differences in alcohol productionby various yeast strains: myth or fact? Allen, M.; Leske,P. and Baldwin, G. (eds.) Advances in juice clarificationand yeast inoculation: Proceedings of a seminar; 15August 1996; Melbourne, Vic. Adelaide, SA: AustralianSociety of Viticulture and Oenology; pp24-25.Palacios, A.; Raginel, F. and Ortiz-Julien, A. (2007)Can the selection of Saccharomyces cerevisiae yeastlead to variations in the final alcohol degree of wines?Australian and New Zealand Grapegrower and Winemaker527, 71-75.Piskur, J.; Rozpedowska, E.; Polakova, S.; Merico, A.and Compagno, C. (2006) How did Saccharomycesevolve to become a good brewer? Trends in Genetics22, 183-186.Textos asociadosSummary• Hot weather and mature fruit make high alcohol levels in wine more likely.• The 2008 vintage is set to hit a ‘sugar high’, with high levels of ethanol.• Winemakers want to keep alcohol under control for cost, taste and health reasons.• Scientists at the AWRI have pioneered a new, GM-free approach to ‘persuade’ yeast to produce less ethanol during fermentation.• Studies have shown that the maximum variation in ethanol levels from current, commercial yeast strains is 0.5% v/v.• Innovation at the AWRI is driving the evolution of new, ‘low ethanol’ yeast in the right direction.85

A la recerca del codidigital dels llevatsdel viBorneman, A.R.; Forgan, A.H.; Chambers, P.J. i Pretorius,I.S.The Australian Wine Research Institute, Glen Osmond(Adelaida), Australia.Per primera vegada, científics del Australian WineResearch Institute han seqüenciat el genoma d’unllevat del vi, caracteritzant la «recepta de la vida»d’aquest microorganisme amic de l’enòleg. Un camíobert al desenvolupament de noves soques que puguincontribuir amb solucions innovadores al problemade les parades fermentatives i a augmentarles opcions de l’enòleg.Cada quatre anys, els Jocs Olímpicsinspiren al món amb actuacionsespectaculars i proeses deresistència, velocitat i elegància.Ens sorprenem davant les fitesatlètiques dels competidors i lamajoria de nosaltres només podempreguntar-nos com aconsegueixenaquests campions arribara aquests estàndards de somni.Què fa a aquests guanyadors tandiferents de la resta de persones?No som la mateixa espècie, i pertant, no hauríem de tenir tots el mateix potencial? Nopodríem, també nosaltres, guanyar una medalla d’oren natació o atletisme si comptéssim amb el mateixentrenament, dieta i estil de vida?La resposta és negativa. Els atletes d’elit neixen ambun potencial que porta el segell de l’«or» ja estampat.Tenen el tipus de fibres musculars, el físic, la fisiologiai les aptituds que, amb entrenament adequat, podenarribar a ser perfeccionats per a l’èxit internacional. Lamentablement,la majoria de nosaltres requeriríem demolt més que aquest afinament per assolir aquest nivell;fins que la biònica ens permeti substituir allò ambel que vam néixer, quan parlem d’atletisme, la majoriade nosaltres ens haurem de conformar amb participaren una lliga amateur o, fins i tot, menys.La variació individualAlgunes de lesseqüències de DNAaddicional trobadesen el llevat del vi,no s’assemblena res trobat end’altres espècies deSaccharomycesSeminario TécnicoCompuestos azufrados volátiles en vinosAquestes diferències en el rendiment dels individusd’una mateixa espècie no són tan sols exclusives del’ésser humà. De fet, podem apreciar- les contínuamenta la natura. Prenem, per exemple, l’humil llevatque els enòlegs utilitzen per produir el complex i irresistiblevi a partir del most del raïm. La majoria dels llevatsdel vi són de la mateixa espècie, Saccharomycescerevisiae, però no tots els membres d’aquest grupsón capaços de produir vi i, entre aquelles soquesque ho són, hi ha una considerable variació de comd’eficients són i com fidedignament fan la seva feina icom poden produir vins de qualitat.Això ens porta a la següent pregunta: Què marca a unllevat del vi? Què existeix en el funcionament internd’aquest atleta d’elit, que li permet créixer en un ambienttan hostil i aconseguir vins amb medalles d’ormentre altres soques de S. cerevisiae no passen de lalínia de sortida? Estudis portats a terme a l’AustralianWine Research Institute (AWRI) comencen a desvetllarmisteris de les variacions entre soques de S. cerevisiae,essent els primers resultats obtinguts realmentprometedors.La variació en el rendiment que observem entre soquesde S. cerevisiae és un atribut heretable; aixòsignifica que està genèticamentdeterminat. Per tant, el punt departida per caracteritzar aquestavariació s’hauria d’enfocar prioritàriamenten la genètica dels llevats.Sortosament, S. cerevisiae vaser el primer organisme del seutipus en tenir el seu genoma seqüenciat.Això va assolirse fa unsdeu anys en una soca conegudacom S288c, escollida per la sevaidoneïtat a les condicions del laboratori(per una informació mésdetallada sobre què són els gensi els genomes, consulteu requadre). Als científics elsencanta aquest llevat ja que és molt fàcil treballar ambell, però d’altra banda, no seria una soca capaç deguanyar cap medalla en el camp de la producció devi, de fet, és possible que ni tan sols arribi a nivells delsque en diríem «amateurs ». No obstant, per discernirquè és el que fa un llevat del vi tan diferent d’altressoques de S. cerevisiae és necessari disposar d’algunacosa amb qui comparar-la, i S288c és un bon punt departida.El genoma d’una altra soca de S. cerevisiae, YJM789,s’ha seqüenciat recentment. El genoma d’aquest llevat,un patogen oportunista aïllat dels pulmons d’unpacient amb SIDA, va resultar força diferent al d’S288c.Així, ara disposem de dues versions diferents de S. cerevisiaeamb les que poder comparar el llevat del vi, iaixò va ser el que vam trobar.Textos asociadosL’especificitat genètica del llevat del viEl nostre llevat del vi presenta més diferències ambles dues soques prèviament seqüenciades, que lesque presenten aquelles dues entre elles. Prop del 0,6ACE Revista d’Enologia 4rt Trimestre 200887

A la recerca del codi digital dels llevats del vi% de les lletres genètiques de la seqüència del llevatdel vi són diferents de les de la soca de laboratori. Aixòpot semblar una molt petita diferència, però si consideremque la distància genètica entre dues espèciescom els humans i els ximpanzés és únicament d’un1-2 %, el 0,6 % seria una xifra força considerable per adues soques d’una mateixa espècie.D’altra banda, potser el que sigui més interessantd’aquests resultats, és que s’han trobat seqüènciesaddicionals al llevat del vi, que són suficients per afegircom a mínim 27 gens que no estan presents en lessoques de Saccharomyces amb que va ser comparada.De fet, algunes de les seqüènciesen aquest DNA addicional nos’assemblen a res trobat en d’altresespècies de Saccharomyces. Defet, aquestes seqüències són méssimilars a gens trobats en fongsforça llunyans filogenèticament.Encara no sabem com van arribaral genoma del llevat del vi, peròtenim una certa curiositat per avaluarsi aquestes seqüències estaninvolucrades en la diferenciacióentre llevats del vi i altres S. cerevisiae,especialment en allò referenta les característiques necessàries per produir vi.Alguns dels gens específics en el llevat del vi codifiquen,probablement, proteïnes associades ambla paret cel·lular, un tret del llevat que és, sense capmena de dubte, important per a la seva resistència enambients inhòspits. Ens agradaria descobrir si aquestsgens tenen alguna mena d’impacte en la robustesa delEn el futur, seremcapaços d’esbrinarquins d’aquests tretsúnics del genomad’un llevat del vi sóndeterminants enl’àmbit de la produccióvinícolallevat del vi, una característica que és de gran importànciaper completar la fermentació. Ens preguntem,per exemple, si aquests gens fan al llevat del vi, més omenys vulnerable a fermentacions lentes o a paradesfermentatives. També hem identificat gens que probablementcodifiquen proteïnes associades amb lacaptura d’aminoàcids (un transportador d’aminoàcidsneutre) i el seu metabolisme (una aspartat transaminasa).Pel fet que el metabolisme d’aminoàcids estàdirectament relacionat amb el desenvolupament decompostos associats a sabor i aroma, és temptador suggerirque aquests gens podrien tenir un impacte enels atributs sensorials del vi, encara que això s’hauriad’investigar i confirmar.A més a més, existeixen multitudgens dels quals encara no podeminferir les seves funcions. Aquestspodrien resultar ser els més interessantsde tots; el temps i el treballexperimental ens ho diran.De manera molt interessant,també hem trobat alguns reordenamentscromosòmics en elgenoma d’aquest llevat i sobreels quals també estem intrigats,encara que de moment no podem fer-nos una ideade quina serà la seva veritable importància i abast.El que fa a un llevat del viQuè ens portarà el futur a partir d’ara que ja disposemd’aquesta enorme font d’informació sobre un lle-Desxifrant el codi: gens i genomesEls gens són receptes per fabricar proteïnes. Per exemple, les cèl·lules del lector posseeixen un gen o recepta per fer la proteïna insulina,que és una hormona que regula els nivells de sucre en sang. També tenim gens o receptes que instrueixen a les nostres cèl·lules sobrecom fer proteïnes que controlen l’estatura fins la que creixerem, el color dels nostres ulls, la forma general del nostre cos, etc. Sónaquestes mateixes receptes de la vida les que dicten si disposarem de potencial atlètic o no i, degut a que les heretem dels nostrespares, acabarem semblant-nos a ells. Si els gens són receptes, llavors els genomes són llibres de receptes. El genoma humà disposa de totes lesreceptes necessàries per fabricar les proteïnes que es requereixen per construir un cos humà, des del moment de la concepció fins la maduresa,i per reparar i defensar aquest cos durant tota la vida. Tota aquesta fisiologia i anatomia estan modelades per una col·lecció de 20 000 – 25000 gens que s’estenen pel genoma humà. Excepte en el cas de tenir un bessó idèntic, el nostre llibre de receptes és diferentdel que tenen la resta dels nostres congèneres.El llenguatge dels gens és molt diferent dels llen- guatges que fem servir habitualment per comunicar-nos els unsamb els altres. Està basat en un alfabet de tan sòls quatre lletres (A, T, G i C), i el seu lèxic està limitat a paraulesamb tres lletres, fet que significa que només existeixen 64 paraules en el diccionari genètic. Tot i el que semblariaa primer cop d’ull, això és més que suficient per elaborar tot el conjunt d’instruccions que permeten construirtotes les proteïnes (enzims, hormones, anticossos, cartílags, etc.) que requerim per a la vida.El paper en que les paraules que configures les receptes de la vida esta escrites es coneix com DNA, iquan nosaltres llegim el llibre de receptes complet d’un organisme, desxifrant el que està gravatal DNA, diem que estem seqüenciant el seu genoma. El que acabem tenint en aquest procésés una llarga seqüència de milions de lletres A, T, C i G, sense espais o signes de puntuació evidents,i que hem de desxifrar. Afortunadament, disposem de programes informàtics que podenfer la major part d’aquesta feina per nosaltres.88

Seminario TécnicoCompuestos azufrados volátiles en vinosEls membres de l’equip investigador australià. D’esquerra a dreta: Paul Chambers, Angus Forgan,Sakkie Pretorius i Anthony Borneman.vat del vi? Per suposat, serem capaços de determinarquins d’aquests trets únics del genoma d’un llevat delvi són determinants en l’àmbit de la producció de vi.Tot i això, també ens plantegem acumular més dadesa partir d’aquest projecte mitjançant la seqüenciació icomparació dels genomes d’altres llevats del vi, aquellesque posseeixen diferents propietats per la sevacapacitat per produir vi. Això ens permetrà determinarquè és comú a tots els llevats del vi (per exemple,quins són els requeriments fonamentals d’un llevatdel vi) i quines diferències entre elles condueixen a laproducció de vins amb diferents qualitats (per exemple,la predisposició a produir uns determinats aromesi matisos frutals).Un cop puguem entendre que és allò que determinael destí d’un llevat del vi, i el significat profundd’aquestes variacions entre soques de llevats del vi,estarem en una millor posició per desenvolupar variantsd’aquest microorganisme que puguin completarla marató de la fermentació sense alentir-la oevitant quedar parades durant el seu curs, produint almateix temps vins mereixedors d’una medalla d’or; itot això seria possible sense afegir additius que incrementinel rendiment.De manera similar als nostres esportistes olímpics, elsector del vi també ha de tenir aspiracions a medallesd’or. Amb el suport d’una ciència de qualitat i una recercarobusta, haurien de ser tot ors per als productorsde vi.AgraïmentsEls membres de l’equip del AWRI responsables de discernirel mapa genètic del llevat del vi són els doctorsAnthony Borneman, Angus Forgan, Paul Chambers iSakkie Pretorius.L’Australian Wine Research Institute, un dels membresdel Wine Innovation Cluster a Adelaida, disposa delsuport econòmic dels productors de raïm i de vi a travésdel seu organisme d’inversió, el Grape and WineResearch and Development Corporation, a més d’unasubvenció equivalent del Govern australià.La recerca en l’àrea de la biologia de sistemes al AWRIes realitza amb recursos provinents en part del NationalCollaborative Research Infrastructure Strategy, unainiciativa del Govern australià, amb fons addicionalsdel Govern de l’Estat de South Australia. Agraïm tambéla contribució de la Australian Genome ResearchFacility, membre de Bioplatforms Australia, on es vaportar a terme la seqüenciació del genoma del llevatdel vi. També volem agrair a Sharon Mascall i Rae Blairper l’ajut en la redacció, i a Jeff Eglinton per la preparacióde les il·lustracions. Els resultats científics detallatsd’aquest treball han estat publicats a la revista FEMSYeast Research.BibliografiaBorneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius,I.S.: «Comparative genome analysis of a Saccharomycescerevisiae wine strain», FEMS Yeast Research 2008;8: 1185-1195.Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius,I.S.: «Unravelling the genetic blueprint of wine yeast»,Australian and New Zealand Wine Industry Journal2008; 23: 21-23.Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius,I.S.: «Cracking the genetic code of wine yeast», WineBusiness Monthly 2008, octubre: 41-43.Borneman, A.R.; Chambers, P.J.; Pretorius, I.S.: «YeastSystems Biology: modelling the winemaker’s art»,Trends in Biotechnology 2007; 25: 349-355.Goffeau, A.; Barrell, B.G.; Bussey, H.; Davis, R.W.; Dujon,B.; Feldmann, H.; Galibert, F.; Hoheisel, J.D.; Jacq,C.; Johnston, M.; Louis, E.J.; Mewes, H.W.; Murakami, Y.;Philippsen, P.; Tettelin, H.; Oliver, S.G.: «Life with 6000genes»,Textos asociados89

Effect of Microoxygenationon Colorand Anthocyanin-Related Compoundsof Wines withDifferent PhenolicContentsCano-López, M.; Pardo-Mínguez, F.; Schmauch,G.; Saucier, C.; Teissedre, P.L.; López-Roca, J.M.; andGómez-Plaza, E.Departamento de Tecnología de Alimentos, Nutricióny Bromatología, Facultad de Veterinaria, Universidadde Murcia, Spain, Bodegas San Isidro, Jumilla, Murcia,Spain, and Faculté d’Oenologie, Université VictorSegalen, Bordeaux 2, FranceSeveral factors may affect the results obtained whenmicro-oxygenation is applied to red wines, the mostimportant being the moment of application, the dosesof oxygen, and the wine phenolic characteristics.In this study, three red wines, made from Vitis viniferavar. Monastrell (2005 vintage) and with different phenoliccharacteristics, were micro-oxygenated to determineas to how this technique affected the formationof new pigments in the wines and their chromaticcharacteristics. The results indicated that the differentwines were differently affected by micro-oxygenation.In general, the micro-oxygenated wines had a higherpercentage of new anthocyanin-derived pigments,being that this formation is more favored in the wineswith the highest total phenol content. These compounds,in turn, significantly increased the wine colorintensity. The wine with the lowest phenolic contentwas less influenced by micro-oxygenation, and theobserved evolution in the degree of polymerizationof tannins suggested that it might have suffered overoxygenation.KEYWORDS: Wine; color; anthocyanins; anthocyanin-derivedcompounds; micro-oxygenation.INTRODUCTIONPhenolic compounds are responsible for many of theorganoleptic characteristics of wines. Among them,anthocyanins are responsible for the color of red wine,Seminario TécnicoCompuestos azufrados volátiles en vinoswhile their interactions with other compounds largelydetermine the color changes observed in maturingwines. The wine phenolic content depends on thegrape characteristics and on the winemaking process.Factors such as phenolic maturity of the grapes, lengthof maceration, frequency of pumping over, etc. determinethe final wine phenolic content (1–3).The importance of oxygen in the evolution of winecolor has been studied for many years, both as regardsits role in polyphenol oxidation (4–7) and as a promoterof the formation on new anthocyanin-derivedcompounds (5, 8–11). Indeed, one way of manipulatingthe phenolic structure of a wine is to use themicro-oxygenation (MO) technique, which relies onthe formation of microbubbles through the injectionof gaseous oxygen into the wine using a microdiffuser(12). These bubbles rise through the wine, dissolvingas they travel to the surface.Empirical results have indicated that MO benefits includethe stabilization of wine color, the softening oftannins, and the lessening of vegetative aromas (13,14). Reactions involving wine polyphenols are the keyto these processes, which include changes in proanthocyaninchain length and the consequent effect onwine astringency and the linking of anthocyanins andtannins to form more stably colored forms. Dissolvedoxygen leads to the formation of acetaldehyde that, inturn, reacts with flavanols and anthocyanins to inducethe formation of a very reactive carbocation that quicklyreacts with another flavanol molecule or with anthocyanin,producing ethyl bridge-linked compounds(15, 16). They are unstable (17) and undergo reactionsthat lead to the formation of new compounds suchas flavanyl pyranoanthocyanins. These end productsare more stable and colored than the original compounds(11). Moreover, incorporation of anthocyanininto tannin structures also may lead to a decrease inastringency (18).Since its commercial adoption, MO has become commonpractice and is now used worldwide, althoughmost of the available information is from empirical results.Only a few scientific publications can be foundthat are related to the effects of MO (8, 19–23). Severalfactors may affect the final results obtained by MO,the most important being the moment of application,doses of oxygen, and wine characteristics. Wines havemarked differences in their respective abilities to consumeoxygen. As a general rule, this facility is directlyrelated to their relative concentration of polyphenolssince phenolic compounds are the main consumersof oxygen (60%) together with ethanol (20%) and SO 2(12%) (22). In our first studies, we tested the use of differentdoses of oxygen and the effect of the momentof application on wine chromatic characteristics (23,24). Here, we report the results of a commercial scaleMO experiment where the influence of applying oxygento three wines made from Monastrell grapes ofJ. Agric. Food Chem. 2008, 56, 5932–5941Textos asociados91

Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic ContentsTable 1. Evolution of Some PhysicochemicalParameters during MO of Monastrell Wines apHtitratable acidity bvolatile acidity cfree SO 2(mg/L)total SO 2(mg/L)acetaldehyde (mg/L)pHtitratable acidity bvolatile acidity cfree SO 2(mg/L)total SO 2(mg/L)acetaldehyde (mg/L)pHtitratable acidity bvolatile acidity cfree SO 2(mg/L)total SO 2(mg/L)acetaldehyde (mg/L)t 0t 1t 2t 3W13.725.870.39253922.2W23.666.310.33254129.1W33.636.450.40274832.3W1(C)3.785.760.40263213.5W2(C)3.715.830.33313523.0W3(C)3.665.700.37324425.6W1(MO)3.765.35*0.4122*28*12.8W2(MO)3.675.960.3422*3324.7W3(MO)3.665.560.3825*3523.2different phenolic contents was investigated.MATERIALS AND METHODSW1(C)3.855.380.43375015.1W2(C)4.005.600.29386132.2W3(C)4.015.660.33266428.7W1(MO)3.835.17*0.47374916.6W2(MO)4.005.73*0.32336123.4*W3(MO)4.025.27*0.37296428.4W1(C)3.835.060.42224821.3W2(C)3.835.080.37165141.4W3(C)3.775.090.37166122.3W1(MO)3.79*4.90*0.3414*4632.6*W2(MO)3.804.900.3311*35*45.2W3(MO)3.784.89*0.39*11*38*35.0*aAn asterisk indicates significant differences betweencontrol and microoxygenated wines for each time considered.b Expressed as g/L of tartaric acid.cExpressed as g/L of acetic acid.Wine Samples. Three different red wines, made fromVitis Vinifera var. Monastrell (2005 vintage), differingin their total phenol content, were used for the experiment(W1, W2, and W3). Each wine was distributedinto four 17 500 L tanks, and the MO experimentwas carried out in triplicate, with a control (C) andthree MO tanks for each type of wine. The heightof each tank was 4.5 m, enough for the completedissolution of oxygen microbubbles into the wine.MO began just after alcoholic fermentation had finished(November 7, 2005), applying a oxygen doseof 10 mL/L/month. Malolactic fermentation (MLF)occurred spontaneously. When MLF started (detectedby the decrease in malic acid), the MO systemwas stopped (November 30 for W1 and December20 for W2 and W3). During MLF, the bacteria consumethe acetaldehyde produced. They are capable ofmetabolizing acetaldehyde, even the acetaldehydebound to sulfur dioxide (25); therefore, any excess ofacetaldehyde produced during the MO process willdisappear.When MLF was complete for all wines, SO 2was addedto leave the wines with a free SO 2content close to 30mg/L, and MO was resumed (January 19, 2006). At thismoment, the oxygen supply was reduced to avoidaccumulation of acetaldehyde (3 mL/L/month). After2 months, the oxygen supply was reduced again (1.5mL/L/month) before it was completely stopped. Thewine was analyzed immediately before the MO systembegan (t0), at the beginning of MLF (t1), when MO beganagain after MLF (t2), and 15 days after the MO systemwas stopped (t3) since wines take 8-10 days to absorbthe oxygen, depending on temperature and phenoliccomposition of the wines (26). The MO system (AgrovinS.A., Alcazar de San Juan, Spain) was comprised of anoxygen cylinder (food grade) and a dosing chamberthat allowed the doses of oxygen flowing through ninedifferent microdiffusers to be programmed.General Determinations. pH and titratable aciditywere measured using an automatic titrator (Metrohm,Herisau, Switzerland). Volatile acidity was determinedaccording to the OIV Official Methods (27). Acetaldehydeand malic acid concentration were determinedusing enzymatic test kits from Roche Boehringer,Mannheim, Germany. The SO 2concentration (freeand total) was measured iodometrically by the Ripperprocedure (28) modified to detect the end point potentiometricallywith an automatic titrator (Metrohm,Herisau, Switzerland).Identification and Quantification of Anthocyanins.Wines were analyzed by direct injection of thesamples previously filtered through a 45 μm nylon filter(Teknokroma, Barcelona, Spain). The HPLC analyseswere performed on a Waters 2690 liquid chromatograph(Waters, Milford, MA), equipped with aWaters996 diode array detector and a 250 mm × 4 mm i.d.,5 μm particle size Lichrocart RP-18 column (Merck,Darmstadt, Germany), using as solvents 4.5% aqueousformic acid (solvent A) and acetonitrile (solvent B) at aflow rate of 0.8 mL/ min. Elution was performed witha gradient starting with 10% B to reach 14.5% B at 30min, 15.2% B at 45 min, 18% B at 60 min, 25% B at 100min, and 25-100% B in 30 min. Chromatograms wererecorded at 520 nm.Compounds were identified by comparing their UVspectra recorded with the diode array detector andthose reported in the literature (11, 29). In addition,an HPLC-MS analysis was conducted to confirmeach peak identity. An LC-MSD-Trap VL-01036 liquidchromatograph-ion trap mass detector (Agilent Technologies,Waldbronn, Germany) equipped with anelectrospray ionization (ESI) system was used. Elutionwas performed with the HPLC analysis conditionsdetailed previously. The heated capillary and voltagewere maintained at 350 °C and 4 kV, respectively.Mass scans (MS) were measured from m/z 300-1100.Mass spectrometry data were acquired in the positiveionization mode. Anthocyanins and anthocyanin-92

derived compounds were quantified at 520 nm asmalvidin- 3-glucoside, using malvidin-3-glucosidechloride as an external standard (Extrasynthe`se, Genay,France).Color Determinations in Wines. Absorbance measurementswere made in a Helios Alpha spectrophotometer(Thermo Electron Corp., Waltham, MA) with 0.1,0.2, or 1 cm path length glass cells. Samples were previouslycentrifuged, and the pH was adjusted to 3.6.CIELab parameters were determined by measuringthe transmittance of the wine every 10 nm from 380to 770 nm, using a D65 illuminant and a 10° observer.The L* (measure of lightness), C* (measure of chroma),and H* (hue angle) parameters were determined. Colorintensity (CI), calculated as the sum of absorbanceat 620, 520, and 420 nm, and percentages of red (%R),yellow (%Y), and blue (%B) color were determined accordingto Glories (30); the hue was calculated as theratio between absorbance at 420 nm and absorbanceat 520 nm (31).Total phenols (abs280) were calculated according toRibe´reau Gayon et al. (32). Wine color (WC), total colorof pigments (WCP), and color due to derivatives resistantto SO 2bleaching (CDRSO 2) were determined usinga method adapted from that described by Levengoodand Boulton (33), with all measurements made at 520nm. These parameters were calculated as follows.WC. Twenty microliters of 10% acetaldehyde solutionwas added to 2 mL of a wine sample in a 10 mm plasticcuvette to release any anthocyanins involved in bisulfiteadducts. After 45 min, the sample was placed ina 1 mm cuvette. The reading was corrected to 10 mmpath length by multiplying by 10.WCP. A total of 0.5 mL of wine was diluted in 20 mLof 0.1 N HCl. Absorbance was measured in a 10 mmcuvette after 30 min to ensure complete conversionof anthocyanins into the flavylium form. The readingwas corrected for dilution.CDR SO2 . A total of 160 μL of a 5% SO 2solution (10%potassium metabisulfite solution) was added to 2 mLof the wine sample. After 1 min, the sample was placedin a 2 mm cuvette. The reading was corrected to10 mm path length by multiplying by 5.Determination of Total Tannins. The wine tanninconcentration was evaluated using a protein precipitationassay, with bovine serum albumin (BSA).Sample preparation and a protein precipitation assaywere conducted according to methods described byHarbertson et al. (34). For quantification, results werecompared with a (+)-catechin standard and reportedas mg/L (+)-catechin equivalents.Seminario TécnicoCompuestos azufrados volátiles en vinosAnalysis of Proanthocyanidins. Proanthocyanidincomposition was determinated by HPLC-DAD-MS afterpurification and concentration of the wine extractand acid catalysis in the presence of excess phloroglucinol.The results of phloroglucinolysis providedinformation on the proanthocyanidin subunit composition(terminal and extension unit concentrations)and the mean degree of polymerization (mDP). Theanalyses were carried out in triplicate.The phloroglucinolysis protocol, described by Drinkineet al. (35), included a purification step using C18solid-phase extraction (SPE). Water (15 mL) was addedto 5 mL of wine, and the sample was passed througha preconditioned cartridge. The retained compoundswere eluted with 50 mL of methanol with a flow rateof 2 mL/min. This fraction was dried under reducedpressure and then dissolved in 2 mL of methanol.The second step was the phloroglucinolysis reaction.A solution of 0.2 N HCl in methanol, containing 100g/L phloroglucinol and 20 g/L ascorbic acid, was prepared.A total of 100 μL of the wine sample was reactedwith 100 μL of the phloroglucinol reagent at 50 °Cfor 20 min, and then 1 mL of 80 mM aqueous sodiumacetate was added to stop the reaction.The extension and terminal units resulting fromphloroglucinolysis (catechin, epicatechin, (epi)catechingallate, and (epi)gallocatechin) were determinedby LC-MS. LC-MS analyses were performedon a Micromass Platform II simple quadruple massspectrometer (Micromass- Beckman, Roissy Charlesde-Gaulle,France) equipped with an electrosprayion source. The mass spectrometer was operated innegative-ion mode. The source temperature was 120°C, the capillary voltage was set at 3.5 kV, and thecone voltage was -30 V. HPLC separations were performedon a Hewlett-Packard 1100 series (Agilent,Massy, France) instrument including a pump moduleand a UV detector. Both systems were operatedusing Masslynx 3.4 software. The absorbance was recordedat 280 nm, and mass spectra were recordedfrom 200 to 1200 amu.The elution conditions were wateras follows: aceticacid (99:1; v/v) as solvent A, methyl alcohol as solventB, and the following elution gradient: from 5 to 15% Bin 5 min, 15% B for 2 min, from 15 to 20% B in 3 min,from 20 to 50% B in 10 min, from 50 to 100% B in 2min, and from 100 to 5% B in 2 min, with a flow of 1mL/min. The column used was a reversed-phase 4.6mm × 100 mm i.d., 3.5 μm packing C18 Waters Xterraprotected with a guard column of the same material(Agilent, Saint Quentin-en-Yvelines, France).Statistical Analysis. Significant differences betweenwines and for each variable were assessed with analysisof variance (ANOVA). This statistical analysis, togetherwith a cluster analysis and a principal componentsanalysis, was performed using Statgraphics 5.1(Statistical Graphics Corporation, Rockville, MD).Textos asociados93

Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic ContentsFigure 1. Development of monomeric anthocyanins and ethyl-linked compounds in W1, W2, and W3wines (±SD). Each point corresponds to t 0, t 1, t 2, and t 3.RESULTS AND DISCUSSIONWhen comparing the initial composition of the studiedwines (Table S1 in the Supporting Information and initialpoint in all figures), W1 and W2 showed a very similarphenolic content (abs280 of 52 and 58, respectively),while the highest phenolic content was found in W3(abs280 of 76), mainly due to its high tannin content.Although tannins and color density were higher in W3,monomeric anthocyanins and WCP showed higher valuesin W2, a wine that showed a low degree of anthocyaninpolymerization (CRDSO2). Color percentages alsodiffered between the wines. W1 presented a higher yellowpercentage and lower red percentage. W3 was thedarkest wine, with the highest blue percentage. Thetannin characterization showed that the percentagesof the different flavanol units also differed. The profileof W1, with the highest percentage of epicatechinand epigallocatechin, indicated a high percentage ofskin tannins (18, 36), whereas the lowest percentageof epigallocatechin and relatively high percentage ofepicatechin gallate in W3 were according to the longermaceration period used during the elaborationof W3, with seed tannins contributing significantly tothe tannin fraction. The profile found in W2 indicatesan intermediate situation, the maceration time beingintermediate between W1 and W3.As seen in Table 1, there was little effect of MO on pH,and small differences were observed in titratable acidityafter MLF (t2) and at the end of the experiment(t3). With regard to concerns about potential microbialspoilage, the volatile acidity did not increase duringthe studied period. When the MO application wasfinished, a higher concentration of acetaldehyde wasdetected in the W1 and W3 MO wines, as comparedto their control counterparts, and similar quantitiesof acetaldehyde were found in W2 (C) and W2 (MO).Excessive oxidation may result in increased levels ofacetaldehyde, a compound that at sensory thresholdlevels adversely affects wine flavor and aroma. Sensorydetection limits for red wines are typically in the rangeof 40-100 ppm (37, 38). Our results showed that, evenin wines containing the highest content of acetaldehyde,its sensory detection limit barely was reached.MO promoted a slightly lower content of free SO 2in the wines, but differences were small. Total SO 2was also lower in W2 and W3 MO wines. Boulet andMoutounet (12) reported no effect of MO on SO 294

Seminario TécnicoCompuestos azufrados volátiles en vinosFigure2. Development of carboxypyranoanthocyanins and sum off lavanyl- and vinylpyranoanthocyaninsin W1, W2, and W3 wines (±SD).Each point corresponds to t 0, t 1, t 2, and t 3.content, whereas Pérez-Magariño et al. (39) reportedsmall decreases due to MO, results that are similar toour findings. The results of Tao et al. (21) showed thatSO 2had a moderating effect on the interaction of oxygenwith wine polyphenols since it has the ability toreduce oxidized polyphenols and to remove peroxide.The levels of SO 2in MO wine affect the rate of developmentof wine polyphenol chemistry, including theformation of polymeric pigments and changes in tanninstructure, affecting wine astringency.Anthocyanins and Derived Compounds. The predominantcompounds detected in HPLC analyses werethe monoglucosides of malvidin, petunidin, delphinidin,peonidin, and cyanidin and their respective acetyl andcoumaryl derivatives. The combined concentration of allthese compounds diminished with time (Figure 1) thedecrease being larger in the MO wines, as also found byAtanasova et al. (8), a decrease that might be explainedby the various reactions where anthocyanins are involved,including degradation or polymerization reactions.The most significant decrease was detected between t0and t2, except in W1, whose concentrations barely changedduring this period. This was probably due to the factthat W1 wines were MO for 17 days before MLF started,whereas W2 and W3 were MO for 44 days since the startingof MLF was delayed in these wines.Acetaldehyde-mediated condensation between anthocyanin-3-glucoside and (epi)catechin leads toethyl bridge-linked compounds. Three possible isomerswere elucidated as well as another compound inwhich the flavanyl moiety is a dimer. Throughout theexperiment, the concentration of ethyl-linked compoundswas higher in the MO wines (Figure 1). Theseare compounds with a purple color, less sensitive tobleaching by SO 2and pH than monomeric anthocyanins,and their formation is favored by oxygen (8, 40).A very large increase was observed in W2 (MO) fromt0 to t1, after which it fell sharply. These compoundsare unstable and have a tendency to increase in size inthe presence of available acetaldehyde. The behavioris in accordance with their reactivity; they are rapidlyformed, but also, they can be rapidly broken down,releasing ethyl-flavanol units that, in turn, may reactagain with anthocyanins or dimers, giving more condensedproducts or even polymers (11).Pyroanthocyanins are compounds formed whena pyran ring is introduced between the C4 and theTextos asociados95

Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic ContentsFigure 3. Development of direct anthocyanin-flavanol adducts and polymeric compounds in W1, W2, andW3 wines (±SD). Each point corresponds to t 0, t 1, t 2, and t 3.hydroxyl group attached to C5 in the anthocyaninmolecule. Some compounds result from the additionof anthocyanin and pyruvic acid (carboxypyranoanthocyanins).Several of these compounds weredetected in our samples: petunidin 3-glucoside pyruvate,vitisin A (malvidin 3-(glucoside)pyruvate), acetylvitisin A (malvidin 3-(acetylglucoside) pyruvate), andcoumaryl vitisin A (malvidin 3-(coumarylglucoside)pyruvate). Another pyranoanthocyanin resulting fromthe cycloaddition of acetaldehyde to malvidin 3-glucoside,and referred to as vitisin B, also was found, andits quantification was included with the carboxypyranoanthocyanins.Pyranoanthocyanins are consideredto be important compounds concerning the color ofred wine since the cycloaddition process seems tostrongly increase the stability of the products, and, inthis way, vitisin A has been reported as being morestable than malvidin 3-glucoside or ethyl-linked compoundsand more resistant to oxidation (41). The sumof carboxypyranoanthocyanins and vitisin B increasedfrom t0 to t1 (Figure 2), with MO wines increasingmore (except for W1). At the end of the experiment,carboxypyranoanthocyanins showed lower concentrationsin the control wines than in the MO wines,the greatest increases being detected in W2. Otherauthors found a strong decrease in vitisin A and re-lated compounds during the first year of wine storage,after which the concentration remained relativelyconstant (42–44). Such a decrease, observed mainly inour study between t1 and t2, was ascribed to their incorporationinto polymeric compounds (42). The concentrationof carboxypyranoanthocyanins in wines isa result of a balance between the formation reactionsand their incorporation in the polymeric compounds.The formation of vitisin A and related compoundsrequires the presence of free monoglucosides andpyruvic acid. Oxygen or reactive oxygen species arealso necessary for the reaction to proceed since allcycloaddition pathways require an oxidation step torecover the flavylium moiety within the final structures(45–47). Therefore, the MO process seemed toenhance the formation of vitisin-type compounds byproviding oxygen. This result is contrary to that of Atasanovaet al. (8), who stated that the addition of pyruvicacid to anthocyanins is not influenced by oxygen.W2, with a higher anthocyanin monoglucoside content(as quantified by HPLC), was the wine showingthe highest final concentration of carboxypyranoanthocyanins.Another group of anthocyanins, constituted byhydroxyphenyl- pyranoanthocyanins, results from96

Seminario TécnicoCompuestos azufrados volátiles en vinosFigure 4. Development of color intensity and hue in W1, W2, and W3 wines (±SD). Each point correspondsto t 0, t 1, t 2, and t 3.the reactions of anthocyanins and vinyl derivatives(48, 49). Malvidin 3-glucoside- 4-vinylphenol, pinotinA (malvidin 3-glucoside-4-vinylcatechol), and malvidin3-glucoside-4-vinylguaiacol were detected in oursamples. The presence of vinyl derivatives in wine wasattributed to enzymatic decarboxylation of phenolicacids by yeast enzymes (48). However, Schwarz andWinterhalter (50) demonstrated that pinotin A alsocould be formed as a result of the direct addition ofcaffeic acid to malvidin-3-glucoside, without the needfor prior decarboxylation of cinnamic acid derivativesby wine yeasts (51). Also, flavanylpyranoanthocyaninwas detected in our samples. We found that the concentrationof vinyl and flavanylpyranoanthocyaninsincreased with time (Figure 2), the increases being largerin the MO wines, especially from t2 to t3.We also detected compounds formed by direct reactionsbetween anthocyanins and flavanols (Figure 3).These may result from the addition of flavanols to anthocyanins(47, 52). Little differences were detected inthe direct adducts between control and MO wines.A broad peak at the end of the chromatogram wasobserved (polymeric peak). It absorbed at around 540,indicating that it contained flavylium units. Its concentrationincreased with time while its λmax valuedecreased, perhaps because anthocyaninethyl- flavanoladducts would first have been formed duringwinemaking and then transformed into flavanyl-pyranoanthocyaninsduring wine aging, compounds thatpresent lower λmax values. The contribution of thesepolymeric pigments to the overall color of aged redwines may be superior to the contribution of eithergenuine monomeric anthocyanins or pyranoanthocyanins(50). The area of this peak, as shown in Figure 3,is larger, in general, in MO wines, although no significantdifferences were observed between W3 (C) andW3 (MO) at the end of the experiment.Chromatic Characteristics of Wine. Figure 4 reflectsthe evolution of color intensity and hue. The winesbehaved in a similar way, independently of their phenoliccontent. An increase from t0 to t1 was observedin all wines and was higher in MO wines, thesewines also being darker in color (see Table S2 in theSupporting Information). A decrease during MLF wasthen detected, probably due to an increase in pH andthe degradation of pigmented compounds by lacticbacteria. After MLF, CI increased, although MO winesmaintained a statistically higher CI value. The higher CIin MO wines was probably due to the contribution ofTextos asociados97

Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic ContentsFigure 5. Development of WC, WCP, and CRDSO2 in W1, W2, and W3 wines (±SD). Each point correspondsto t 0, t 1, t 2, and t 3.the newly formed pigments, for example, ethyllinkedpigments, since the absorbance of these molecules at620 nm is higher than that of genuine anthocyanins(the percentage of blue color in MO wines was higherthan in control wines).Pyranoanthocyanins also may have participated inthe higher CI as they show both higher absorbanceat 420 nm and contribute to the redness of wines. Thehue evolved in a very similar way in all the wines, witha tendency to increase, but more so in control wine,demonstrating that no detectable browning occurredin the MO wines.Figure 5 reflects the evolution of WC, WCP, and CRD-SO 2. A very small decrease in WC was observed in allwines with no differences due to MO. WCP decreasedwith time, and the decreases were concomitant withthe loss of free anthocyanins usually observed duringwine evolution, meaning that the formation of anthocyanin-derivedpigments did not compensate for freeanthocyanin degradation.Figure 6. Development of abs280 and tannins indifferent wines (±SD). Each point corresponds to t 0,t 1, t 2, and t 3.A continuous increase in pigments resistant to SO 2bleaching was observed. The formation of pyranoanthocyanins,which are very stable compounds toward98

Seminario TécnicoCompuestos azufrados volátiles en vinosWith regard to optical density and tannin content (Figure6) and mean degree of polymerization (mDP) (Figure7), no changes in abs280 were detected in any ofthe wines, indicating the absence of significant winepigment precipitation. As regards tannins, their levelsdecreased during MLF in W2 and W3, but since nodecrease in abs280 was detected, this phenomenonwas probably due to tannins breaking down to givesmall structures that were not detected by the BSAmethod. Similar values for the control and MO wineswere observed at t2. From t2 to t3, the concentrationbarely changed, although MO wines showed a slightlyhigher tannin content.Figure 7. Development of mean degree ofpolymerization of tannins in W1, W2, and W3 wines(±SD). Each point corresponds to t 0, t 1, t 2, and t 3.Figure 8. Graphical plot representing thedistribution of the wine samples in the planedefined by principal components 1 and 2 asregards their chromatic characteristics (MO wines:solid symbols; control wines: open symbols; W1:circles; W2: squares; and W3: triangles). Thevariance explained by each principal component isshown in parentheses.SO 2and pH due to the substitution of C4 (47), wasprobably associated with this evolution. Ethyl-linkedcompounds also should be resistant to sulfite additionand may have contributed to the observed changes,explaining as to why the values were higher inMO wines.Different behavior with regard to mDP was observedfor the different wines. This parameter always increasedin the first period (from t0 to t1) for all wines and thenfell, except for W1. According to Nikfardjam and Dykes(53), this increase corresponds to the wine structuringphase described in empirical observations (13), and thisphase appears to occur irrespective of whether oxygenis being dosed into the wine. The reduction of mDP observedafterward, mainly in W2 (MO) and W3 (MO), maybe due to a possible structural rearrangement of thetannins to shorter forms, which would correlate withthe small decreases observed in the tannins measuredby the BSA method. This reduction in mDP may be responsiblefor a reduction in wine astringency (54, 55).The interaction of these newly formed intermediateswith anthocyanins also may reduce astringency sincethey can form terminal units of these shorter forms,preventing further polymerization (56). The differentbehavior of W1 (MO) was similar to that described byDu Toit et al. (57) when MO was applied to a wine fortoo long a period of time. It seems that W1 could havesuffered overoxygenation in the MO wine, and therefore,an increase of mDP was observed.Multivariate statistical analysis was used in this studyto check as to whether the wines could be groupedaccording to the variables studied. First, a clusteranalysis was conducted using all the studied variablessince this is a powerful visualization tool that enablesgroupings to be observed within the data. This is anunsupervised method for pattern recognition, wherethe samples were clustered without prior knowledgeof their belonging to any wine type. The distance matrixwas calculated using square Euclidean distancesand an average linkage method algorithm. Distancemeasures the similarity or dissimilarity between thedifferent samples. Two clearly differentiated clusterswere found (data shown in Supporting Information).In one of them we found W1, both control and MO wines,and W2 (C), showing that W1 (C) and W2 (C) werequite close. W2 (MO) was classified as closer to the W3wines. In the case of W2, it seems that MO originatedthe maximum differences in the wine characteristics.MO promoted changes in its phenolic structure, leadingto a wine with chromatic characteristics closer toa wine with a higher phenolic content.Textos asociados99

Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic ContentsHaving obtained this grouping, a principal componentsanalysis was conducted with the same dataand using the same variables to find as to whichvariables were mainly responsible for the groupingfound (Figure 8). The first two principal componentsexplained 83% of the variance. The representation ofthese two principal components showed that all MOwines had lower values in component 1 than theircorresponding control wines mainly due to lower valuesof L*, H*, and hue and higher values of CI andanthocyanin-derived compounds, among others. Thewines with the highest phenolic content showed negativevalues of PC1, while W2 differed from the otherwines especially in the highest values of PC2, due tothe high WC and anthocyanin monoglucoside values.W2 (MO) and W3 (C) were again very close. MO favoredreactions that led to the greater formation of newpigments, which, in turn, increased CI and CRDSO 2inall the wines, regardless of their phenolic content. W1wine was less influenced by MO and the observedincreases in mDP for W1 (MO) suggested overoxygenation.This wine presented an anthocyanin contentthat was too low to promote any great level of condensationreactions. W3 was favored by MO, but themost evident results were found in W2 (MO), with itshigh anthocyanin content that favored the formationof more stable derived pigments and led to a wineclose to W3 (C).Supporting Information Available: Figure of differentiatedclusters and tables of wine characteristicsat the end of alcoholic fermentation and evolution ofCIELab and color. This material is available free of chargevia the Internet at http://pubs.acs.org.LITERATURE CITED(1) Pérez-Magariño, S.; González-San José, M. L. Evolutionof flavanols, anthocyanins, and their derivativesduring the aging of red wines, elaboratedfrom grapes harvested at different stages of ripening.J. Agric. Food Chem. 2004, 52, 1181–1189.(2) Bautista-Ortı´n, A. B.; Fernández-Fernández, J. I.;López-Roca, J. M.; Gómez-Plaza, E. The effect ofgrape ripening stage on red wine color. J. Int. Sci.Vigne Vin 2006, 40, 14–24.(3) Bautista-Ortı´n, A. B.; Fernández-Fernández, J. I.; López-Roca,J. M.; Gómez-Plaza, E. Wine-making ofhighly colored wines: Extended pomace contactand run-off of juice prior to fermentation. FoodSci. Technol. Int. 2004, 10, 287–295.(4) Ribéreau-Gayon, P.; Glories, Y. Phenolics in grapesand wines. In The Sixth Australian Wine IndustryTechnical Conference; Lee, T. H., Ed.; Australian IndustrialPublishers: Adelaide, Australia, 1986; pp247-256.(5) Singleton, V. A survey of wine aging reactions, especiallywith oxygen. In Proceedings of the 50thAnniVersary Annual Meeting; Rantz, J. M., Ed.;American Society for Enology and Viticulture:Davis, CA, 2000; pp 323-336.(6) Singleton, V. Oxygen with phenols and relatedreactions in must, wines, and model systems:Observations and practical implications. Am. J.Enol. Vitic. 1987, 38, 69–77.(7) Danilewicz, J. Review of reaction mechanism ofoxygen and proposed intermediate reductionproducts in wine: Central role of iron and copper.Am. J. Enol. Vitic. 2003, 54, 73–85.(8) Atanasova, V.; Fulcrand, H.; Cheynier, V.; Moutounet,M. Effect of oxygenation on polyphenol changesoccurring in the course of wine-making. Anal.Chim. Acta 2002, 458, 15–27.(9) Jordao, A. M.; Ricardo-da-Silva, J. M.; Laureano, O.Effect of oak constituents and oxygen on theevolution of malvidin-3- glucoside and (+)-catechinin model wine. Am. J. Enol. Vitic. 2006, 57,377–381.(10) Salmon, J. M. Interactions between yeast, oxygen,and polyphenols during alcoholic fermentations:Practical implications. Food Sci. Technol. 2006,39, 959–965.(11) Alcalde-Eon, C.; Escribano-Bailon, M. T.; Santos-Buelga, C.; Rivas-Gonzalo, C. Changes in the detailedpigment conposition of red wine duringmaturity and ageing. A comprehensive study.Anal. Chim. Acta 2005, 563, 238–254.(12) Boulet, J.; Moutounet, M. Micro-oxigenación delos vinos. In Enologı´a: Fundamentos Cientı´ficosy Tecnológicos; Flanzy, C., Ed.; MundiPrensa Ediciones:Madrid, 2000; pp 638-642.(13) Parish, M.; Wollan, D.; Paul, R. Micro-oxygenation.A review. Aust. Grapegrower Winemaker 2000,438, 47–50.(14) Kamio, I.; Kamio, X.; Roig, G.; Otero, B.; Yerle, S.Microoxygenation dans la Péninsule Ibérique:Repenser l’elevage des vins du sud. ReV. Oenol.2008, 126, 22–27.(15) Dallas, C.; Ricardo da Silva, J. M.; Laureano, O. Productsformed in model wine solutions involvinganthocyanins, procyanidin B2, and acetaldehyde.J. Agric. Food Chem. 1996, 44, 2402–2407.(16) Es-Safi, N.; Fulcrand, H.; Cheynier, V.; Moutounet, M.Studies on the acetaldehyde-induced condensationof (-)-epicatechin and malvidin-3-glucoside100

Seminario TécnicoCompuestos azufrados volátiles en vinosin model solution systems. J. Agric. Food Chem.1999, 47, 2096–2102.(17) Escribano-Bailon, T.; Alvarez-Garcia, M.; Rivas-Gonzalo, J. C.; Heredia, F. J.; Santos-Buelga, C.Color and stability of pigments derived from theacetaldehyde-mediated condensation betweenmalvidin 3-O-glucoside and (+)-catechin. J. Agric.Food Chem. 2001, 49, 1213–1217.(18) Cheynier, V.; Dueñas, M.; Salas, E.; Maury, C.;Souquet, J.; Sarni- Manchado, P.; Fulcrand, H.Structure and properties of wine pigments andtannins. Am. J. Enol. Vitic. 2006, 57, 298–305.(19) Llaudy, M.; Canals, R.; Gonzalez-Manzano, S.; Canals,J. M.; Santos-Buelga, C.; Zamora, F. Influenceof micro-oxygenation treatment before oakaging on phenolic compound composition, astringency,and color of red wine. J. Agric. FoodChem. 2006, 54, 4246–4252.(20) Pérez-Magariño, S.; Sánchez-Iglesias, M.; Ortega-Heras, M.; González-Huerta, C.; González-Sanjose,M. L. Color stabilization of red wines by microoxygenationtreatment before malolactic fermentation.Food Chem. 2007, 101, 881–893.(21) Tao, J.; Dykes, S. I.; Kilmartin, P. A. Effect of SO 2concentration on polyphenol development duringred wine micro-oxygenation. J. Agric. FoodChem. 2007, 55, 6104–6109.(22) Devatine, A.; Chiciuc, I.; Poupot, C.; Mietton-Peuchot,M. Microoxygenation of wine in presenceof dissolved carbon dioxide. Chem. Eng. Sci.2007, 62, 4579–4588.(23) Cano-Lopez, M.; Pardo, F.; Lopez-Roca, J. M.; Gómez-Plaza,E. Effect of the micro-oxygenation onanthocyann and derived pigment content andchromatic characteristics of red wines. Am. J.Enol. Vitic. 2006, 57, 325–331.(24) Cano-López, M.; López-Roca, J. M.; Gómez-Plaza,E.; Pardo- Minguez, F. Efecto de la microoxigenaciónen vinos tintos con diferente contenido polifenólico.Tecnol. Vino 2006, Julio-Agosto, 45–50.(25) Osborne, J.; Mira de Orduña, R.; Pilone, G.; Liu, S.Acetaldehyde metabolism by wine lactic acidbacteria. FEMS Microbiol. Lett. 2000, 191, 51–55.(26) Vivas, N.; Glories, Y. Racking of red wine matured inbarrels. A tentative classification of racking techniques.Aust. NZ Wine Ind. J. 1995, 10, 241–243.(27) O.I.V. Recueil des Méthodes Internationalesd’Analyse des Vins et des Mouts; Office Internationalde la Vigne et du Vin: Paris, 1990.(28) Ough, C. S.; Amerine, M. A. Methods for Analysis ofMusts and Wine; Wiley Interscience Publications:Νew York, 1974.(29) Boido, E.; Alcalde-Eon, C.; Carrau, F.; Dellacassa, E.;Rivas- Gonzalo, C. Aging effect of the pigmentcomposition and color of Vitis Vinifera L. c.v. Tannatwines. Contribution of the main pigment familiesto wine color. J. Agric. Food Chem. 2006,54, 6692–6704.(30) Glories, Y. La coleur des vins rouges: 1° partie. Lesequilibres des anthocyanes et des tanins. Con.Vigne Vin 1984, 18, 195– 217.(31) Sudraud, P. Interpretation des courbes d’absortiondes vins rouges. Ann. Technol. Agric. 1958, 7,203–208.(32) Ribéreau Gayon, P.; Glories, Y.; Maujean, A.; Dubourdieu,D. Traité d’Oenologie. 2. Chimie du Vin.Stabilisation et Traitements; Dunod: Paris, 1998.(33) Levengood, J.; Boulton, R. The variation in colordue to copigmentation in young Cabernet Sauvignonwines. In Red Wine Color. ReVealing theMysteries; Waterhouse, A., Kennedy, J., Eds.; AmericanChemical Society: Washington, DC, 2004;pp 35- 52.(34) Harbertson, J. F.; Kennedy, J. A.; Adams, D. O. Tanninin skins and seeds of Cabernet Sauvignon,Syrah, and Pinot Noir berries during ripening.Am. J. Enol. Vitic. 2002, 53, 54–59.(35) Drinkine, J.; Lopes, P.; Kennedy, J. A.; Teissedre, P.L.; Saucier, C. Analysis of ethylidene-bridged flavan-3-olsin wine. J. Agric. Food Chem. 2007, 55,1109–1116.(36) Fernandez, K.; Kennedy, J. A.; Agosin, E. Characterizationof Vitis Vinifera L. Cv. Carmanere grape andwine proanthocyanidins. J. Agric. Food Chem.2007, 55, 3675–3680.(37) Peynaud, E. The Taste of Wine; Wiley: New York,1996.(38) Amerine, M.; Roessler, E. Wines, Their Sensory EValuation;W. H. Freeman: New York, 1982.(39) Perez-Magariño, S.; Sánchez-Iglesias, M.; Ortega-Heras, M.; González-Huerta, C.; González-Sanjosé,M. L. Color stabilization of red wines by microoxygenationtreatment before malolactic fermentation.Food Chem. 2007, 101, 881–893.(40) Rivas-Gonzalo, J.; Bravo-Haro, S.; Santos-Buelga,C. Detection of compounds formed through thereaction of malvidin-3- monoglucoside and ca-Textos asociados101

Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic Contentstechin in the presence of acetaldehyde. J. Agric.Food Chem. 1995, 43, 1444–1449.(41) Morata, A.; Gomez-Cordoves, C.; Colomo, B.; Suarez,J. A. Pyruvic acid and acetaldehyde by differentstrains of Saccharomyces cereVisiae: Relationshipwith vitisin A and B formation in redwines. J. Agric. Food Chem. 2003, 51, 7402–7409.(42) Schwartz, M.; Quast, P.; von Baer, D.; Winterhalter,P. Vitisin A content in Chilean wines from Vitis Viniferacv. Cabernet Sauvignon: A contribution tothe color of aged red wines. J. Agric. Food Chem.2003, 51, 6261–6267.(43) Revilla, I.; González-San José, M. L. Evolution duringthe storage of red wines treated with pectolyticenzymes: New anthocyanin pigment formation.J. Wine Res. 2001, 12, 183–197.(44) Asestorfer, R.; Markides, A.; Iland, P.; Jones, G. Formationof vitisin A during red wine fermentationand maturation. Aust. J. Grape Wine Res. 2003, 9,40–46.(45) Lee, D.; Swinny, E.; Asenstorfer, R.; Jones, G. Factorsaffecting the formation of red wine pigments.In Red Wine Color. ReVealing the Mysteries. ACSSymposium Series 886; Waterhouse, A., Kennedy,J. A., Eds.; American Chemical Society: Washington,DC, 2004; pp 125-142.(46) Pozo-Bayon, M. A.; Monagas, M.; Polo, M. C.; Gomez-Cordoves,C. Occurrence of pyroanthocyaninsin sparkling wines manufactured with redgrape varieties. J. Agric. Food Chem. 2004, 52,1300–1306.(47) Fulcrand, H.; Atanasova, V.; Salas, E.; Cheynier, V.The fate of anthocyanins in wine. Are they determiningfactors? In Red Wine Color. ReVealingthe Mysteries. ACS Symposium Series 886; Waterhouse,A., Kennedy, J. A., Eds.; American ChemicalSociety: Washington, DC, 2004; pp 68-88.(48) Monagas, M.; Nuñez, V.; Bartolomé, B.; Gomez-Cordobes, C. Anthocyanin-derived pigments inGraciano, Tempranillo, and Cabernet Sauvignonwines produced in Spain. Am. J. Enol. Vitic. 2003,54, 163–169.(49) Schwartz, M.; Winterhalter, P. A novel syntheticroute to substituted pyranoanthocyanins withunique color properties. Tetrahedron Lett. 2003,44, 7583–7587.(50) Schwartz, M.; Winterhalter, P. Novel aged anthocyaninsfrom Pinotage wines: Isolation, characterization,and pathway of formation. In Red WineColor. ReVealing the Mysteries. ACS SymposiumSeries 886; Waterhouse, A., Kennedy, J. A., Eds.;American Chemical Society: Washington, DC,2004; pp 179- 197.(51) Schwarz, M.; Hofmann, G.; Winterhalter, P. Investigationson anthocyanins in wines from VitisVinifera cv. Pinotage: Factors influencing the formationof Pinotin A and its correlation with wineage. J. Agric. Food Chem. 2004, 52, 498–504.(52) Salas, E.; Atanasova, V.; Poncet-Legrand, C.; Meudec,E.; Mazauric, J. P.; Cheynier, V. Demostrationof the occurence of flavonol-anthocyaninadducts in wine and in model disolutions. Anal.Chim. Acta 2004, 513, 325–332.(53) Nikfardjam, M.; Dykes, S. I. Micro-oxygenation researchat Lincoln University. Part 3: Polyphenolicanalysis of Cabernet Sauvignon wines under theapplication of micro-oxygenation. Aust. NZ GrapegrowerWinemaker 2003, 467, 41–44.(54) Vidal, S.; Cartalade, D.; Souquet, J. M.; Fulcrand, H.;Cheynier, V. Changes in proanthocyanidin chainlength in winelike model solutions. J. Agric. FoodChem. 2002, 50, 2261–2266.(55) Cheynier, V.; Remy, S.; Fulcrand, H. Mechanisms ofanthocyanin and tannin changes during winemakingand aging. In The ASEV 50th AnniVersaryAnnual Meeting; Rautz, J., Ed.; ASEV: Davis, CA,2000; pp 337-344.(56) Du Toit, W.; Marais, J.; Pretorius, I. S.; du Toit, M.Oxygen in must and wine: A review. S. Afr. J. Enol.Vitic. 2006, 57, 76–94.(57) Du Toit, W.; Lisjak, K.; Marais, J.; du Toit, M. The effectof micro-oxygenation on the phenolic composition,quality, and aerobic wine-spoilage microorganismsof different South African red wines. S.Afr. J. Enol. Vitic. 2006, 27, 57–67.Received for review February 28, 2008. Revised manuscriptreceived May 9, 2008. Accepted May 9, 2008. Thiswork was made possible by financial assistance from theFundación Séneca (PB/31/FS/02).102

Efectos de lamicrooxigenación envino tintoCano Lopez, M,; Fuentes Peralta, S.; Pardo Minguez,F. (1) ; López-Roca, J.M.; Gómez-Plaza, EDepartamento de Tecnología de Alimentos, Nutricióny Bromatología. Facultad de Veterinaria, Universidadde Murcia. Campus de Espinardo, 30071 Murcia(1)Bodegas B.S.I. Ctra. Murcia, Jumilla, MurciaAutor de contacto: e-mail: encarnag@um.es, tel. 968367323RESUMENLa microoxigenación está basada en el aporte controladode pequeñas cantidades de oxigeno de formacontinua y lenta; siendo la velocidad del aporte deoxigeno inferior a la velocidad de su consumo, evitandola acumulación de oxigeno. El objetivo de estatécnica es favorecer la condensación entre taninos yantocianos y la formación de nuevos pigmentos; proporcionandoasí un incremento y estabilización delcolor del vino. Se ha estudiado el efecto de la técnicaaplicando distintas dosis de oxigeno (dosis baja, mediay alta), a vinos de Monastrell. Los resultados obtenidosmuestran que la aplicación de oxigeno no afectaa la sanidad del vino. Los vinos microoxigenadospresentan mayor intensidad colorante que el testigo.La tonalidad es similar en todos ellos, manifestando lamínima oxidación de polifenoles producida. Se destacael incremento de la fracción de color debido apigmentos poliméricos, el índice de ionización y dePVPP en los vinos microoxigenados, presentando susSeminario TécnicoCompuestos azufrados volátiles en vinosvalores máximos en el vino microoxigenado con dosismedia. Estos parámetros muestran que se ha favorecidola formación de nuevos pigmentos en los vinos.Por otro lado, el contenido de acetaldehído libre enlos vinos microoxigenados es menor que en el testigo,manifestando que el acetaldehído generado formaparte de nuevos pigmentos, no interfiriendo en lascaracterísticas organolépticas de los vinos microoxigenados.Al final del tratamiento se realizó un análisisorganoléptico de los vinos, que junto a los resultadosobtenidos se concluye que la dosis media resultó serla mas adecuada al finalizar la microoxigenación.INTRODUCCIÓNLos compuestos fenólicos en un vino tinto determinansus características sensoriales, principalmente elcolor y la astringencia. La composición fenólica dependede la composición de la uva, factores edafoclimáticos,procesos de vinificación y diferentes prácticasenológicas.El oxigeno juega un papel importante en diversosprocesos bioquímicos en los mostos y en los vinos,tanto durante la fermentación alcohólica como en lasreacciones de oxidación y/o polimerización de compuestospolifenólicos que se producen durante elenvejecimiento del vino. Por ello, tradicionalmente sehan efectuado aportes de oxigeno, bien mediante remontadosal inicio de la fermentación alcohólica; bienmediante trasiegos tras la fermentación alcohólica yfermentación maloláctica cuyo objetivo es eliminary/o evitar la formación de compuestos sulfhídricos yretirar las lías gruesas (1).Durante el envejecimiento del vino en barrica de roblese produce la cesión de compuestos fenólicos yaromas propios de la madera al vino, además de unamicrooxigenación natural, al difundirse pequeñas cantidadesde oxígeno a través del esquive de la barrica,Textos asociadosFigura 1.- Estructura del polímero por condensación directa, A) tanino-antociano y B) compuesto bicíclicoformado por la reacción entre el flavano y Mv-3Glu. (Remy et al. 2000).Enólogos Efecto de la microoxigenación en vinos tintos. Enologos 34,46-50, 2005103

Capítuloentre las uniones de las duelas y los poros de la madera.Este oxigeno se ha demostrado que influye notablementeen la composición fenólica del vino, ya queinterviene en reacciones de oxidación y/o polimerización,generando nuevos pigmentos que incrementany estabilizan el color del vino (7,8,9,10,11,12,13,14, 15).La generación de estos pigmentos sigue los siguientesmecanismos:a) Reacciones de condensación directa entre antocianos(A) y taninos (T):Los nuevos compuestos se forman mediante procesosde adición nucleofílica dando lugar a estructurasA+-T y T-A+. Han sido encontradas en vinos envejecidos(10, 16), ya que es una reacción lenta (17). Ambasestructuras son mas complejas que los antocianosmonómeros, de color similar a los antocianos peroresistentes a la decoloración por SO 2, especialmentela estuctura A+-T. La formación de estos compuestosgenera una disminución de la astringencia de los vinosdurante el envejecimiento (Figura 1).b) Reacción de condensación mediante puentesde etilo.En estas reacciones está involurado el acetaldehído,producto que aparece en el vino producido en pequeñascantidades por las levaduras durante el metabolismode azúcares (18) y por la oxidación de etanol. Elresultado son productos enlazados por puente de etilo,incluyendo taninos (T-etil-T), aductos de taninos-antocianos(T-etil-A) y oligómeros de antocianos (A-etil-A).La reacción de polimerización finaliza cuando en elotro extremo del polímero se encuentra unido un antociano(20, 21). Su formación es más rápida que la de lospigmentos poliméricos por condensación directa (17).La presencia de estos pigmentos produce incrementoy estabilización del color del vino; su color es malva,son resistentes a las variaciones de pH, a la decoloracióndel sulfuroso y a las oxidaciones (19, 24), aunquese ha demostrado que su estabilidad en el tiempoes pequeña y evolucionan hacia otros tipos de compuestospoliméricos (Figura 2).Figura 2.- Compuestos formados en presencia de acetaldehído y de otros metabolitos de las levaduras.(Cheynier 2005).104

Figura 3.- Estructura química Vitisina 1) A y 2) B.(Cheynier 2005).c) Nuevos pigmentos de bajo peso molecular.Estos pigmentos se forman mediante la cicloadicónde metabolitos producidos por las levaduras, como elacetaldehído, ácido pirúvico o vinilfenoles, con el antociano,generando pigmentos como la Vitisina A y By los antocianovinilfenoles. Han sido identificados envinos envejecidos (8,9,12,13,15,22) en botella y en barricay en vinos microoxigenados (7). Son pigmentosligeramente anaranjados, más resistentes a las variacionesde pH, al sulfuroso (9) y a las oxidaciones quelos antocianos; estabilizando así el color del vino (12,23) (Figura 3).Debido a la importancia de la presencia de pequeñascantidades de oxígeno y de acetaldehído en laformación de estos pigmentos, nació en la décadade los 90 la técnica de la microoxigenación, basadaen el aporte controlado de pequeñas cantidades deoxigeno al vino mediante un microdifusor poroso, deforma continua y lenta, siendo la velocidad de aportede oxigeno inferior a la velocidad de consumo, evitandola acumulación en vino y generando la máximacantidad posible de este aldehído.Determinadas experiencias han observado que tantola crianza en barrica como la microoxigenación producenresultados similares en cuanto al incrementode color y disminución de astringencia, pudiendocon esta técnica reproducir, e incluso acelerar, partede las transformaciones que sufren los compuestosfenólicos durante la crianza en barrica (3, 4). En esteestudio se pretende conocer el efecto de esta técnica,aplicando distintas dosis de oxigeno, sobre el color deun vino tinto de la variedad Monastrell.Seminario TécnicoCompuestos azufrados volátiles en vinosMATERIALES Y MÉTODOSa) Condiciones de microoxigenación de los vinosPara la experiencia de microoxigenación se ha utilizadoun vino tinto de la variedad Monastrell, elaboradopor Bodegas BSI de Jumilla (Murcia), que presentabalas siguientes características cromáticas iniciales: intensidadcolorante (IC): 14.7, tono: 0.51, índice depolifenóles totales (IPT): 67.40 y antocianos totales:443.63 mg/LTras la fermentación alcohólica el vino se dispuso endepósitos de 17.500L., uno de ello se utiliza como testigo,en los otros se aplicó tres dosis diferentes de oxígenoy en tres periodos distintos de la elaboración.La adición de oxigeno se ha realizado durante tres periodos:- Durante dos semanas, entre el final de la fermentaciónalcohólica y el inicio de maloláctica, con dosisaplicadas de 5, 10 y 15 mL/L/mes. La cantidad deoxigeno aplicada en este periodo, es la mas alta, parafavorecer la generación de acetaldehído.- Después de la fermentación maloláctica, durante unperiodo de 45 días, las dosis aplicadas fueron 3, 5 y 7mL/L/mes.- Tras un análisis organoléptico de los vinos, se continuómicroxigenando 15 días más, suavizando los vinosmicroxigenados, aunque en este periodo las dosisen los tres casos se reduce a la mitad, puesto que elcontenido de antocianos había descendido en todoslos vinos.La Figura 4 muestra un esquema del sistema de microoxigenación.Cada salida de oxigeno esta conectada aun microdifusor poroso que se encuentra suspendidoen el interior del depósito sin llegar a tocar el fondo,de tal manera que las microburbujas se disuelvan enel vino antes de que lleguen a la superficie.b) Determinaciones fisico-químicas y espectrofotométricasEl pH, la acidez total (g/L de ácido tartárico) y la acidezvolátil se determinaron según los métodos oficiales.Las medidas de absorbancia se realizan en un espectrofotómetroHelios Alpha (Thermospectronic). Lasmuestras son centrifugadas y se ajustó el pH a 3.6. Laintensidad de color (IC) se calculó como la suma deabsorbancias a 620 nm, 520 nm y 420 nm; otras variablescalculadas son los porcentajes de rojo, amarilloy azul del color del vino (30). El tono como el coeficienteentre la absorbancia a 420 nm y 520 nm (25).El análisis del índice de polifenoles totales (IPT), antocianostotales y taninos totales (g/L), y los índicesTextos asociados105

CapítuloSISTEMADEALIMENTACIÓNBOMBONADEOXÍGENOMANÓMETROMICRODIFUSORFigura 4.- Esquema de la disposición del sistema de microoxigenación en el depósito.de PVPP, ionización y HCl se efectuó siguiendo losmétodos descritos por Ribereau-Gayon et al. (29). Lafracción de color debida a los pigmentos poliméricosse calculó de acuerdo con los métodos descritos porBoulton (27).RESULTADOS Y DISCUSIÓNEl Gráfico 1 muestra la evolución de pH, acidez total yacidez volátil durante la microoxigenación. Dichos parámetrosson similares en los vinos microoxigenados yel testigo, manifestando que el aporte de oxigeno noaltera la sanidad del vino.Se observa un incremento en la IC (Gráfico 2a) en elprimer periodo de microoxigenación (Octubre-Diciembre/03)en los vinos microoxigenados. Tras la fermentaciónmaloláctica (Enero/04) se observó en todosellos un descenso, probablemente consecuenciade la variación del pH y la precipitación de materia coloidalque arrastra materia colorante. Aunque el aportede oxigeno durante el segundo periodo fue menor,se observó de nuevo un aumento de IC en los vinosmicrooxigenados, diferenciándose todos los vinos encolor. Este incremento de color en presencia de pequeñascantidades de oxigeno durante los primerosmeses de la elaboración también ha sido encontradopor otros autores (3,5,6, ). Por otra parte, la evolucióndel tono, representado por el Gráfico 2b; es similar enlos distintos vinos, indicando que los compuestos fenólicossufren una mínima oxidación durante el tratamiento.Mientras que la IC varió para los diferences vinos, el %rojo tras la microoxigenación (Gráfico 3) se mantuvoconstante en todos los vinos; sugiriendo que ambosparámetros no están relacionados directamente, taly como se ha indicado en otros trabajos (31,32), sinoque la IC depende también de la absorbancia de loscompuestos que aportan tonos amarillos y azules. ElGráfico 1.- Evolución durante la microoxigenaciónde a) pH, b) acidez total y c) acidez volátil de losvinos durante la microoxigenación.106

Seminario TécnicoCompuestos azufrados volátiles en vinosEl contenido de antocianos totales (Gráfico 4) desciendepor igual en todos los vinos durante la experiencia.El incremento de color y la disminución de antocianostotales en los vinos microoxigenados son datos aparentementecontradictorios, pero tiene su explicacióncuando se analiza la evolución de la fracción de colordebido a pigmentos poliméricos, como muestra elGráfico 5. El color debido a los pigmentos poliméricosincrementa durante la aplicación de oxigeno, aligual que los resultados recogidos por Atanasova etal. (7). Su evolución es similar a la variación del color(Gráfico 2a), dicha relación también fue observada porCastellari et al. (6), presentando al finalizar la microoxigenaciónsu valor máximo en el vino con dosis media.El incremento de color en los vinos microoxigenadospuede explicarse también mediante el análisis delíndice de ionización y PVPP, como muestra el Gráfico6. El índice de ionización indica el porcentaje deantocianos que presentan color en el vino. Los vinosmicrooxigenados presentan mayor valor que el testigo,de forma similar a los resultados encontrados porCabanillas et al.(3). Finalizada la microoxigenación, elvino testigo sufre una disminución de este índice ysu valor se incrementa en los vinos microoxigenado,poniéndose de manifiesto de esta forma la presenciade pigmentos coloreados formados mediante puentede acetaldehído y por cicloadición del aldehído a losantocianos. Siendo el índice de ionización máximo enel vino con dosis media de oxigeno.Por otro lado, el índice de PVPP, que representa el porcentajede antocianos combinados con taninos, nosda una idea del incremento y estabilidad del color,ya que estos compuestos presentan un color malvay son menos sensibles a las oxidaciones, a las variacionespH y al sulfuroso que los antocianos libres. Sucomportamiento es similar al índice de ionización, suvalor es mayor en los vinos microxigenados, pero enel testigo disminuye tras el periodo de la microoxigenación,de forma opuesta a lo que ocurre en los vinosmicrooxigenados, siendo máximo su valor en el vinocon dosis media.Gráfico 2.- Evolución de a) intensidad colorante(I.C.) y b) tono durante la microoxigenación.Gráfico 3 muestra la variación de la componente amarillay azul en los vinos tras la microoxigenación. Seobserva un incremento de la componente azul en losvinos microoxigenados, siendo máxima para el vinodonde se aplicó la dosis media de oxígeno; mientrasque la componente amarilla se mantiene constanteen todos ellos excepto en el testigo. Estos resultadosseñalan la presencia de pigmentos poliméricos unidosmediante acetaldehído en los vinos microoxigenados,ya que como propone Gómez-Cordovés et al.(23) existe una correlación directa con la componenteazul y la polimerización de polifenóles.Gráfico 3.- Variación al inicio y al final de lamicrooxigenación de los distintos vinos, % rojo, %amarillo y % azul.Textos asociados107

CapítuloGráfico 4.- Evolución de antocianos totales (mg/L)de los vinos durante la microoxigenación.Gráfico 5.- Evolución de la fracción de color debidoa pigmentos poliméricos.Gráfico 7.- Evolución de A) IPT y B) taninos totales(g/L) de los vinos durante la microoxigenación.Gráfico 6.- Índice de ionización y de PVPPen el vino inicial y en todos los vino tras lamicrooxigenación.Gráfico 8.- Índice de HCl finalizada lamicrooxigenaciónLos Gráficos 7a y 7b muestran la evolución de IPT ytaninos totales. Ambos parámetros son similares entodos los vinos; lo que indica que no se produce ningunaprecipitación de taninos durante la aplicaciónde esta técnica.El análisis del contenido en taninos (procianidinas),representado por el Gráfico 7b, muestra que los nivelesse mantiene durante la microoxigenación y essemejante en todos los vinos. No obstante, el índicede HCl, indicador del porcentaje de la polimerizaciónde taninos presentes en vino; es superior en los vinosmicrooxigenados que en el testigo tras el periodo demicrooxigenación (Gráfico 8), al igual que a Cabanillaset al.(2001), presentando el máximo en el vino microoxigenadocon la dosis media. Confirmando que lapresencia de oxigeno favorece la polimerización detaninos, traduciéndose en una disminución de astringencia.Tras la microoxigenación se realizó el análisis organolépticode los vinos, concluyendo que:- El vino testigo era ligeramente áspero en boca contaninos agresivos.- Los vinos microoxigenados con dosis baja y mediaen boca eran redondos y con gusto agradable a mitad108

Seminario TécnicoCompuestos azufrados volátiles en vinosde boca. En nariz aparecía aroma afrutado y sin notasa reducción.- El vino microoxigenado con dosis más altas en bocaera similar a los otros dos vinos microoxigenados,aunque se apreciaban aromas a fruta madura y algomás evolucionado.Concluyendo que organolépticamente las dosis másadecuadas son las dosis baja y media.Teniendo en cuenta los resultados expuestos y el análisisorganoléptico de los diferentes vinos se concluyeque la dosis adecuada durante la microoxigenaciónes la dosis media. Cabe esperar que estas diferenciassean mayores con el tiempo, haciendo interesante elseguimiento durante el envejecimiento en barrica ybotella.BIBLIOGRAFÍA(1) Delteil D.(2000). Los diferentes roles del oxigeno.Viticultura/ Enología Profesional, 74, 35-45.(2) Pérez- Magariño y Gozález San-José Mª L. (2003).Efectos de la aplicación de la microoxigenacióndurante la fermentación de los vinos tintos. Tecnologíadel vino, 47, 107-112.(3) Cabanillas P, Canals J.M., Rozés N., Arola L. Y ZamoraF.(2001) “ Influencia de la microoxigenaciónen el color y las características organolépticas delos vinos tintos” Tecnología del vino, Sept/Octubre2001,51-55.(4) Llaudy C., Canals R., Cabanillas P., Rozés N., CanalsJ.M. y Zamora F. (2004) Logroño “ Influencia de lamicrooxigenación en presencia y ausencia de líassobre la composición en polifenoles y el color delvino; comparación con la crianza en barricas” IVForo Mundial del vino 13-14 mayo 2004.(5) González D.C., Herrera P., Fernández J.A., SánchezM.,Pérez S., Ortega M., González M.L.(2003) Memoriade Actividades de Investigación 2002/2003.Instituto Tecnológico Agrario de Castilla y León.Estación Enologíca 03.(6) Castellari M., Matricardi l., Arfelli G., Galassi S.,Amati A. (2000) “ Level of single bioactives phenolicsin red wine as a function of the oxygensupplied during storage”, Food Chemistry 69,61-67.(7) Atanasova V., Fulcrand H., Cheynier V., MoutonetM. (2002) “Effect of the oxigenation on polyphenolchanges occurring in the course of wine-making”Analitica Chimica Acta 458, 15-27.(8) Wang H., Edward J.R., Shrikhande J. (2003). Anthocyanintransformation in Cabernet SauvignonWine during Aging. J. Agric. Food Chem.,51,7989-7994.(9) Bakker J. and Timberlake C.F. (1997). Isolation,Identification and Characterization of New Color-StableAnthocyanins Occuring in Some RedWine. J. Agric. Food Chem.,45,35-47.(10) Vivar- Quintana A.M., Santos-Buelga C., Rivas-Gonzalo J.C. (2002). Analytica Chimica Acta,458,147-155.(11) Mateus N. and Freitas V. (2001). Evolution and Stabilityof Anthocyanin-Derived Pigments duringPort Wine Aging. J. Agric. Food Chem.,49,5217-5322.(12) Mateus N, Silva A.M.S., Vercauteren J., FreitasV.(2001). Occurrence of Anthocyanin- DerivedPigments in Red Wines. J. Agric. FoodChem.,49,4936-4840.(13) Mateus N., Pascual-Teresa S., Rivas-Gonzalo J.C.,Santos Buelga C. (2002). Stuctural diversity of anthocyanin-derivedpigments in port wines. FoodChemistry,76, 335-342.(14) Cameira-dos-Santos P.J., Brillouet J.M., Cheynier V,Moutounet M. (1996) Detection and Partial Characterisationof New Anthocyanin- Derived Pigmentsin Wine. J. Agric. Food Chem.,70,204-208.(15) Revilla I., Pérez-Magariño S., González-SanJoséM.L., Beltran S. (1999) Identification of anthocyaninderivatives in grape skin extracts and redwine by liquid chromatography with diode arrayand mass spectrometric detection. J. Chromatogr.A, 847, 83-90.(16) Remy S., Fulcrand H., Labarbe B., Cheynier V.(2000). First confirmation in red Wine of productsresulting from direct anthocyanin-tannin reactions.J. Sci. Food Agric. 80, 745-751.(17) Dallas C., Ricardo-da-Silva J., Laureano O. (1996).Products Formed in Model Wine Solutions involvingAnthocyanins, Procyanindin B2 , and Acetaldhyde.J. Agric. Food Chem.,44, 2402-2407.(18) Morata A., Gómez-Cordovés M.C., Colomo B.,Suárez J.A.(2003). Pyryvic Acid(19) Sims C.A. and Morris J.R. (1986) “Effects of acetaldehydeand tannins on the color and chemicalage of red Muscadine (Vitis Rotundifolia) Wine”Research Note JEV 37(2), 163-165.Textos asociados109

Capítulo(20) Es-Safin.E, Fulcrand H., Cheynier V., MountounetM.(1999). Studies on the Acetaldhyde-Inducedconcensacion of (-)- epicatequina and Malvini-3– Glucoside in a Model Solution system. J. Agric.Food Chem.,47,2096-2102.(21) Es-Safin.E, Cheynier V., Mountounet M.(2002).Role of Aldehydic Derivates in the Condensationof Phenolic Compounds with emphasis onthe sensorial Propieties of fruit-derived foods. J.Agric. Food Chem.,50,5571-5585.(22) Fancia- Aricha E.M., Guerra M.T., Rivas- GonzaloJ.C., Santos-Buelga C. (1997) ”New anthocyaninPigments formed after condensation with flavanols”J.Agric. Food Chem.,45,2262-2266.(23) Sarni-Manchado P., Fulcrand H., Souquet JM.,Cheynier V., Moutounet M.(1996). Stability andColor of unreported wine anthocyanin-derivedPigments. J.Food Science,61,938-941.(24) Escribano-Bailon T., Álvarez-García M., Rivas-Gonzalo J., Heredia F.J., Santos-Buelga C.(2001).Color and Stabity of Pigments-Derived fromAcethaldehido medianted condensation betweenMv-3-O-Glu and (+)-catequin. J.Agric. FoodChem.,49,1213-1217.(25) Sudraud P.(1958). Interpretationdes courbesd´absortion des vins rouges. An TechnolAgric.,7,203-208.(26) OIV (1990).Récueil des Méthodes Internationalesd´Analyse des vins et moûts. Office Internationalde la Vigne et du Vin, Paris, Francia.(27) Boulton R.B. (2001). The copigmentationof anthocyaninsand its role in the color in red wine: acritical review. Am. J. Enol. Vitic. 52, 67-87.(28) Ribéreau-Gayon J, Peynaud E., Sudraud P., Ribéreau-GayonP. (1982) Traité dÓenologie. Scienceset Thechniques et du Vin.Tome I. Analise et contrôledes Vins.Ed.Dunod. Paris. Francia.(29) Ribéreau-Gayon P., Gories Y., Maujean A., DubourdieuD.(1998). Traité d´Oenologie.2. Chimie duVin. Stabilisation et traitaments. Editorial Dunod.(30) Glories Y. (1978). Recherches sur la materie colorantdes vins rouges. Thesis de la Universite deBourdeaux, Université de Bourdeaux.(31) Revilla I., González-SanJosé M.L. and Gómez Cordovés(1999). Modificaciones cromáticas del vinotimto de crianza según el tipo de varrica en queenvejece. Food Sci. Tech. Int., 5(2): 177-181.(32) Pérez-Prieto L.J., De la Hera-Orts M.L., López RocaJ.M., Fermandez-fernández J.I. y Gómez Plaza E.(2003). Oak-matured wines: Influence of the caracteristicsof the barrel on wine colour and sensorycharacteristics. J. Sci. Food Agric., 83: 1445-1450.(33) Gómez- Cordovés C and González-SanJosé M.L(1995). Interpretation of color Varibles during theaging of red wines: Relathionship with Familiesof phenolic compounds. J.Agric. Food Chem.,43(3): 557-561.(34) Cheynier V. (2005). Polyphenols in foods are morecomplex than often thought. Am. J. Clin. Nutr., 81(suppl): 223S-229S.110

Avd. de los Vinos s/n. Pol. Alces13600 Alcázar de San Juan (Ciudad Real)Tel.: +34 926 55 02 00Fax.: +34 926 54 62 54central@agrovin.comwww.agrovin.comModesto Lafuente 41-2º D28003 Madridfundacion@culturadelvino.orgwww.culturadelvino.org