Ecole Nationale Supérieure Agronomique de Montpellier ... - CIAM

Ecole Nationale Supérieure Agronomique de Montpellier
Agro.Montpellier
T H E S E
pour obtenir le grade de
DOCTEUR
DE L’ECOLE NATIONALE SUPERIEURE AGRONOMIQUE DE MONTPELLIER
Discipline : Biologie des Populations et Ecologie
Formation Doctorale : Ressources Phytogénétiques et Interactions Biologiques
Ecole Doctorale : 167: Biologie des Systèmes Intégrés - Agronomie, Environnement
présentée et soutenue publiquement
par
Gaël THEBAUD
le 15 décembre 2005
Titre :
_______
Etude du développement spatio-temporel d’une maladie transmise par vecteur
en intégrant modélisation statistique et expérimentation :
cas de l’ESFY (European stone fruit yellows)
_______
JURY
Jean-Noël BACRO Professeur à l’Université Montpellier II Président
Avner BAR-HEN Professeur à l’Université Paris 13 Rapporteur
Ivan SACHE Chargé de Recherche à l’INRA, Grignon Rapporteur
Jean-Loup NOTTEGHEM Professeur à l’Agro.M, Montpellier Directeur de Thèse
Manuel PLANTEGENEST Maître de Conférences à l’ENSAR, Rennes Examinateur
Wolfgang JARAUSCH Chercheur à AlPlanta, Neustadt/W. Examinateur

Remerciements
Je tiens à remercier Jean-Loup Nottéghem et Rachid Senoussi de m’avoir
chaleureusement accueilli au sein des Unités BGPI (Montpellier) et Biométrie
(Avignon).
Un très grand merci également à Joël C. 1 et Gérard Labonne pour leur jovialité
quotidienne, pour leur disponibilité et pour avoir su me guider sans me brider.
Je souhaite aussi remercier du fond du cœur tous les membres des deux équipes
que j’ai eu plaisir à côtoyer pendant ces trois années.
En particulier, je suis infiniment reconnaissant à celles et ceux qui se sont dévoués
pour me transporter régulièrement entre la gare et le centre INRA de Montfavet. Un
grand merci, donc, à Emilie, Sabrina, Nathalie et Pascal, qui ont souvent été de corvée.
J’en profite pour remercier la SNCF pour les longues (voire très longues, parfois)
heures de lecture qu’elle m’a aménagées.
Enfin, mes plus tendres remerciements à Caroline pour sa relecture patiente de ce
manuscrit et surtout pour son soutien pendant ces 3 années... et pour avoir su, ces
derniers temps, me partager avec un ordinateur sans trop s’en offusquer.
Par contre, je ne remercie pas Chronos qui a été très glouton récemment.
1 Joël Chadœuf ayant pour principe de ne pas accepter les remerciements, son nom a été soigneusement
dissimulé ici.
- 2 -

Glossaire
A leur première occurrence, les mots définis dans ce glossaire figurent dans le texte en
caractères gras et sont suivis d’un astérisque. La définition de certains termes variant selon les
auteurs, aucune source n’est citée pour les définitions fournies : les définitions données ici
précisent le sens qui a été retenu dans ce mémoire.
Epidémiologie : Etude des facteurs de risque d’une maladie dans une population ; par
extension, ces facteurs eux-mêmes et leurs conséquences sur la répartition des cas de
maladie dans l’espace et/ou dans le temps.
Etiologie : Etude des causes d’une maladie dans un individu ; par extension, ces causes ellesmêmes.
Monocyclique/Polycyclique : Dans une épidémie monocyclique, les infections présentes
dans une parcelle ne constituent pas une source d’inoculum interne ; l’évolution de
l’incidence n’est donc liée qu’à une succession de transmissions primaires. A l’inverse,
dans une épidémie polycyclique, les infections présentes dans une parcelle sont à leur tour
des sources d’inoculum pour la parcelle ; l’évolution de l’incidence est alors liée à la fois
aux transmissions primaires et aux transmissions secondaires.
(Nested-) PCR (Polymerase Chain Reaction) : La réaction de PCR consiste à réaliser in vitro
la duplication cyclique d’un fragment d’ADN à l’aide d’une enzyme ; la présence du
fragment amplifié peut ensuite être facilement détectée. Dans le cas d’une nested-PCR
(ou PCR nichée), cette première amplification est suivie d’une seconde étape destinée à
amplifier un second fragment inclus dans le premier, ce qui augmente considérablement
la sensibilité (et parfois la spécificité) de la méthode.
Plante pérenne ou vivace : Végétal à durée de vie indéfinie (vivant 3 ans et plus, par
opposition aux plantes annuelles ou bisannuelles).
Polycyclique : cf. Monocyclique.
Transmission primaire/secondaire : Les transmissions secondaires impliquent un pathogène
issu de l’intérieur d’une population cible, souvent définie implicitement ; on observe alors
des infections secondaires dues à un inoculum secondaire (ou endo-inoculum). Par
opposition, les transmissions primaires (et les infections primaires résultantes) impliquent
un pathogène issu de l’extérieur de la population cible (inoculum primaire ou exoinoculum).
Univoltin, ine : Qualifie le cycle biologique d’un insecte ayant une seule génération par an.
- 3 -

~ Table des Matières ~
INTRODUCTION......................................................................................................................... 7
I. Enjeux des maladies émergentes ou ré-émergentes............................................................. 8
A. Définition et causes des (ré-)émergences ............................................................................. 8
B. Enjeux économiques et sociaux des (ré-)émergences......................................................... 10
C. Enjeux scientifiques des (ré-)émergences........................................................................... 10
II. L’ESFY, une maladie grave mais dont l’épidémiologie est mal connue ........................ 12
A. Une menace pour la filière agricole des fruits à noyau ...................................................... 12
1) Impact économique de l’ESFY sur la filière abricot, en France ...................................................12
(a) Coût de la perte de récolte........................................................................................................................ 12
(b) Coût de la lutte contre l’ESFY................................................................................................................. 13
(c) Coût d’opportunité ................................................................................................................................... 13
2) Impact environnemental de la maladie..........................................................................................13
B. Etat de l’art concernant l’épidémiologie de l’ESFY........................................................... 13
1) Historique de la maladie en France ..............................................................................................13
2) Extension géographique de l’épidémie..........................................................................................14
3) Symptomatologie............................................................................................................................15
4) Gamme d’hôtes ..............................................................................................................................16
5) Etiologie et diagnostic ...................................................................................................................17
6) Vection ...........................................................................................................................................19
(a) Biologie de C. pruni................................................................................................................................. 19
(b) Caractéristiques de la vection .................................................................................................................. 21
7) Incubation, latence et période infectieuse de la plante..................................................................21
8) Propagation entre parcelles ..........................................................................................................22
9) Bilan sur le cycle épidémique de l’ESFY.......................................................................................22
C. Enjeux scientifiques............................................................................................................ 23
III. Objectifs et stratégie d’étude ............................................................................................ 23
A. Objectifs.............................................................................................................................. 23
B. Stratégie .............................................................................................................................. 24
PARTIE I : IDENTIFIER DES FACTEURS DE RISQUE PAR UNE ENQUETE A
L’ECHELLE D’UN BASSIN DE PRODUCTION .................................................................. 25
I. Article I : “Identifying Risk Factors from a Survey with a Logistic Regression Model:
the Case of European Stone Fruit Yellows” ............................................................................ 26
II. Bilan...................................................................................................................................... 45
PARTIE II : IDENTIFIER LES CYCLES BIOLOGIQUES DE ‘CANDIDATUS
PHYTOPLASMA PRUNORUM’ ET DE SON VECTEUR CACOPSYLLA PRUNI – DU
TERRAIN AU LABORATOIRE ET VICE VERSA............................................................... 47
I. Introduction........................................................................................................................... 48
II. Détection spécifique et quantification de ‘Ca. P. prunorum’.......................................... 48
A. Article II : “A Toolbox for the Specific Detection and Quantification of the
Phytopathogenic Agent ‘Candidatus Phytoplasma prunorum’ in Plants and Insects” ........... 48
B. Bilan.................................................................................................................................... 60
III. Prévalence et transmissibilité de ‘Ca. P. prunorum’ dans les populations naturelles
de son vecteur............................................................................................................................ 60
A. Article III : “Survival of European Stone Fruit Yellows Phytoplasma Outside Fruit
Crop Production Areas: a Case Study in Southeastern France”.............................................. 60
B. Méta-analyse des résultats expérimentaux européens ........................................................ 66
1) Méthode du maximum de vraisemblance pour les tests par lots....................................................66
2) Estimation : les vecteurs infectés ne sont pas tous infectieux........................................................67
3) Y a-t-il des tendances générales dans la prévalence des phytoplasmes au sein des populations
vectrices ? ..........................................................................................................................................69
- 4 -

C. Conclusions sur l’étude des vecteurs de l’ESFY en conditions naturelles ......................... 70
IV. Article IV : “The Spread of European Stone Fruit Yellows is Regulated by the Life
Cycle of its Vector and by the Growth Rate of the Hosted Phytoplasma, as Assessed by
Real-Time PCR”........................................................................................................................ 70
V. Bilan sur le fonctionnement de la vection.......................................................................... 83
PARTIE III : TESTER DES HYPOTHESES SUR LE DEVELOPPEMENT DE
L’ESFY EN VERGER................................................................................................................ 85
I. Traduction des hypothèses biologiques en hypothèses d’indépendance.......................... 86
II. Analyse exploratoire des motifs spatiaux et temporels.................................................... 88
A. Un programme générique pour tester des hypothèses d’indépendance.............................. 88
B. Article V : “Spatio-Temporal Analysis of Disease Spread Provides Insights into the
Epidemiology of European Stone Fruit Yellows”................................................................... 89
C. Bilan.................................................................................................................................... 96
III. Article VI : “Investigating Disease Spread Between Two Dates with Permutation
Tests on a Lattice”..................................................................................................................... 96
IV. Application à l’analyse de cartes pluriannuelles de l’ESFY en verger ....................... 115
A. Présentation des vergers étudiés ....................................................................................... 115
B. Résultats et interprétations................................................................................................ 116
1) Analyse de la répartition de l’ensemble des arbres symptomatiques ..........................................116
2) Analyse des dépendances spatiales interannuelles......................................................................118
V. Bilan sur les apports des tests d’hypothèses.................................................................... 120
PARTIE IV : SYNTHETISER L’INFORMATION DANS UN MODELE DE
SIMULATION DES EPIDEMIES D’ESFY........................................................................... 123
I. Hypothèses du modèle ........................................................................................................ 124
II. Description du modèle ...................................................................................................... 125
III. Perspectives ...................................................................................................................... 126
CONCLUSION.......................................................................................................................... 127
I. Conclusions sur l’épidémiologie de l’ESFY...................................................................... 128
A. Conséquences des résultats obtenus pour la gestion de la maladie .................................. 128
1) Apports sur l’effet de la génétique des arbres .............................................................................129
2) Apports sur les transmissions primaires multiples ......................................................................129
3) Apports sur les transmissions inter-annuelles .............................................................................129
B. Perspectives....................................................................................................................... 131
II. Conclusions sur la démarche retenue.............................................................................. 133
REFERENCES BIBLIOGRAPHIQUES................................................................................ 137
ANNEXES.................................................................................................................................. 147
I. Annexe 1 : Programme R pour estimer une proportion à partir de tests groupés....... 148
II. Annexe 2 : Programme R pour tester des hypothèses d’indépendance par
permutation............................................................................................................................. 150
III. Annexe 3 : Programme R pour simuler le développement spatio-temporel de
l’ESFY dans un verger d’abricotier ..................................................................................... 153
IV. Annexe 4 : “Testing Boolean Assumption in the Non Convex Case When a Bounded
Grain can be Assumed”........................................................................................................... 155
- 5 -

~ Table des Illustrations ~
FIGURES
Figure 1. Augmentation des échanges planétaires. ....................................................................................................... 9
Figure 2. Evolution de la température à la surface de la terre (1860-2000). ................................................................. 9
Figure 3. Un cadre commun pour l’étude des maladies mal connues (émergentes ou non)........................................ 11
Figure 4. Répartition géographique des pays dans lesquels des cas d’ESFY ont été mentionnés............................... 15
Figure 5. Symptômes de l’ESFY. ............................................................................................................................... 16
Figure 6. Hiérarchie de la sensibilité à l’ESFY parmi les Prunus............................................................................... 17
Figure 7. Observation au microscope électronique de ‘Candidatus Phytoplasma prunorum’ .................................... 17
Figure 8. Cacopsylla pruni, vecteur de l’ESFY. ......................................................................................................... 18
Figure 9. Hiérarchie de la sensibilité à l’ESFY parmi les Prunus............................................................................... 19
Figure 10. Evolution pluriannuelle des dates de présence et des effectifs des stades adultes de C. pruni.. ................ 19
Figure 11. Evolution synchrone des effectifs des stades adultes de C. pruni sur prunellier, prunier domestique,
abricotier et myrobolan. ............................................................................................................................ 20
Figure 12. Cycle de base de l’épidémie d’ESFY. ....................................................................................................... 22
Figure 13. Connaissances initiales sur le cycle de C. pruni et de la vection de l’ESFY. ............................................ 23
Figure 14. Stratégie d’étude de l’épidémiologie de l’ESFY et organisation des différentes approches envisagées. .. 24
Figure 15. Connaissances acquises sur le cycle de C. pruni et sur la vection de l’ESFY. .......................................... 83
Figure 16. Evolution temporelle de l’ESFY dans 4 vergers d’abricotier (cv. Polonais) greffés sur myrobolan ....... 115
Figure 17. Caractéristiques spatiales des arbres symptomatiques sur l’ensemble de la période de prospection....... 117
Figure 18. Test d’indépendance totale entre les localisations des arbres symptomatiques sur l’ensemble de la
période de prospection.. .......................................................................................................................... 118
Figure 19. Deux exemples de tests d’indépendance spatio-temporelle entre la fin et le milieu de la dynamique
temporelle (1996-1999 vs. 1990-1995)................................................................................................... 119
Figure 20. Cycle de la transmission de l’ESFY. ....................................................................................................... 124
Figure 21. Schéma de l’algorithme de simulation d’une épidémie d’ESFY dans un verger d’abricotier. ................ 126
Figure 22. Interrelations entre les différents “acteurs” conditionnant l’épidémiologie de l’ESFY........................... 128
Figure 23. Différentes méthodes de lutte envisageables contre l’ESFY dans l’état actuel des connaissances.......... 130
Figure 24. Schéma général des relations entre le système épidémique étudié, l’expérimentation, la modélisation
et la stratégie de gestion de la maladie.................................................................................................... 135
TABLEAUX
Tableau 1. Liste des pays dans lesquels les symptômes caractéristiques de l’ESFY et/ou l’agent pathogène
associé ont été identifiés. .......................................................................................................................... 14
Tableau 2. Synthèse bibliographique sur les proportions de C. pruni porteurs de l’ESFY ou infectieux. .................. 68
Tableau 3. Eléments de comparaison des proportions de vecteurs porteurs de différents phytoplasmes.................... 69
Tableau 4. Propriétés attendues des motifs spatio-temporels selon les comportements du vecteur............................ 88
Tableau 5. Caractéristiques des vergers analysés...................................................................................................... 116
Tableau 6. Propriétés biologiques retenues pour construire un modèle stochastique simulant le développement de
l’ESFY dans un verger d’abricotier. ....................................................................................................... 125
Tableau 7. Avantages et inconvénients des principales méthodes de lutte envisageables contre l’ESFY en verger
d’abricotier.............................................................................................................................................. 131
Tableau 8. Apports des différentes approches dans l’analyse des facteurs impliqués dans le développement
spatio-temporel de l’ESFY...................................................................................................................... 133
~ Table des Articles ~
Article I : “Identifying Risk Factors from a Survey with a Logistic Regression Model: the Case of European
Stone Fruit Yellows”................................................................................................................................. 26
Article II : “A Toolbox for the Specific Detection and Quantification of the Phytopathogenic Agent ‘Candidatus
Phytoplasma prunorum’ in Plants and Insects”......................................................................................... 48
Article III : “Survival of European Stone Fruit Yellows Phytoplasma Outside Fruit Crop Production Areas: a
Case Study in Southeastern France” ......................................................................................................... 60
Article IV : “The Spread of European Stone Fruit Yellows is Regulated by the Life Cycle of its Vector and by
the Growth Rate of the Hosted Phytoplasma, as Assessed by Real-Time PCR” ...................................... 70
Article V : “Spatio-Temporal Analysis of Disease Spread Provides Insights into the Epidemiology of European
Stone Fruit Yellows”................................................................................................................................. 89
Article VI : “Investigating Disease Spread Between Two Dates with Permutation Tests on a Lattice”..................... 96
- 6 -

Introduction
- 7 -
« Deux grands mobiles font agir les
hommes : la peur et la nouveauté »
(Machiavel)

L’ESFY (European stone fruit yellows) est une maladie ré-émergente touchant les arbres
fruitiers à noyau (Prunus) en Europe. La démarche mise en œuvre pour l’étudier, présentée
dans ce mémoire, a plus généralement vocation à être utilisée dans l’étude de maladies
émergentes et ré-émergentes, notamment dans une phase initiale d’exploration du
fonctionnement épidémique. Cette démarche est donc davantage orientée vers l’étude des
maladies dont l’épidémiologie est mal comprise que vers l’étude des maladies émergentes en
un lieu mais déjà bien connues.
I. Enjeux des maladies émergentes ou ré-émergentes
A. Définition et causes des (ré-)émergences
En prenant pour base une série de définitions plus ou moins spécifiques aux agents
pathogènes de l’homme (Morse & Schluederberg, 1990 ; Morse, 1995 ; Institute of Medicine,
1992 ; Taylor et al., 2001 ; Woolhouse et al., 2005), on peut définir de façon générale une
maladie émergente ou ré-émergente comme une maladie dont l’incidence réelle 1 dans une
population donnée augmente pour la première fois ou à la suite d’une modification durable de
son épidémiologie * . Notons que cette définition exclut les cas sporadiques et les maladies
saisonnières, ainsi que les “pseudo émergences” dues uniquement à une meilleure mesure de
l’incidence réelle voire à un sursaut d’activité médiatique ou scientifique à l’égard d’une
maladie donnée. Notons également que cette définition est relative car elle dépend de la
population considérée : une maladie peut être émergente en un lieu et endémique ailleurs, par
exemple. On trouvera de nombreux exemples de maladies émergentes végétales, animales et
humaines dans Moffat (2001), Woolhouse (2002), Anderson et al. (2004), Morens et al.
(2004) et Woolhouse et al. (2005), ainsi que dans la base de données ProMED 2 . Dans le cas
des maladies infectieuses, une émergence peut être provoquée par :
(i) la modification de l’environnement de la relation hôte-(vecteur-)pathogène, y compris
par un changement dans les mesures sanitaires ;
(ii) l’augmentation des contacts – directs ou indirects – existants entre un pathogène et
son hôte, ou l’établissement d’un nouveau contact, par exemple par l’introduction
d’un hôte sensible, par la migration d’un pathogène hors de son aire de répartition
habituelle, ou par son introduction volontaire (bioterrorisme, lutte biologique) ou
involontaire (échanges commerciaux) ;
(iii) l’augmentation de la sensibilité de l’hôte, par exemple suite à une immunosuppression
ou à l’absence de sélection pour la résistance ;
(iv) un changement dans le génotype d’un agent pathogène préexistant, par mutation,
recombinaison ou transfert horizontal de gènes.
L’examen des causes possibles d’émergence révèle que si la dernière possibilité
envisagée est probablement stable dans le temps, le contexte actuel est plus propice que
jamais aux deux premiers mécanismes d’émergence (Morse, 1995 ; Woolhouse, 2002 ;
Anderson et al., 2004), principalement par l’action conjointe de l’augmentation des échanges
internationaux, du réchauffement climatique et de l’action de l’homme sur les milieux. Ainsi,
le trafic aérien (Figure 1A) a été multiplié par 3 entre 1975 et 1995 (Penner et al., 1999) et les
échanges internationaux, par exemple de fruits et légumes (Figure 1B), ont plus que quintuplé
ces 40 dernières années (FAOSTAT 3 , 2005). Outre l’hypothèse d’une attaque bioterroriste,
1 Par opposition à l’incidence mesurée, qui peut être différente de l’incidence réelle pour de multiples raisons.
Dans ce mémoire, conformément à Ahrens & Pigeot (2005), l’incidence est définie pour une maladie donnée
comme la proportion de la population saine qui développe cette maladie par unité de temps, contrairement à la
prévalence qui désigne la proportion de la population qui est malade à une date donnée.
2 Program for Monitoring Emerging Diseases : http://www.fas.org/promed/
3 Food and Agriculture Organization of the United Nations : http://faostat.fao.org/
- 8 -

l’intensification permanente de la circulation pacifique des biens et des personnes entre pays
géographiquement éloignés entraîne presque mécaniquement une introduction plus fréquente
de pathogènes, de vecteurs et d’hôtes nouveaux.
A
B
Quantité de fruits et légumes
échangés (Mt)
1,4E+08
1,2E+08
1,0E+08
8,0E+07
6,0E+07
4,0E+07
2,0E+07
(d’après Penner et al., 1999)
0,0E+00
1960 1970 1980
Année
1990 2000
- 9 -
Figure 1. Augmentation des
échanges planétaires.
(A) Exemple du trafic
aérien : les passagers sont
plus nombreux et se
déplacent plus loin, d’où
l’augmentation observée
(puis prédite) du nombre de
passagers-kilomètres. (B)
Exemple du volume des
échanges de fruits et légumes
entre pays (données
FAOSTAT, 2005).
En parallèle, on assiste actuellement au début d’un réchauffement climatique rapide
(Figure 2) : selon l’International Panel on Climate Change (2001), la température moyenne a
augmenté de 0,75°C lors des 150 dernières années et cette évolution devrait s’accentuer dans
les années à venir (selon les scénarios et les modèles, les intervalles de confiance s’étendent
entre +0,6 et +5,5°C en 100 ans).
(d’après IPCC, 2001)
Figure 2. Evolution
de la température à
la surface de la
terre (1860-2000).
Or, on note déjà une relation entre l’augmentation de la température et le déplacement de
l’aire de répartition de certaines espèces (Parmesan & Yohe, 2003 ; Root et al., 2003) et on

peut s’attendre à ce que des pathogènes, leurs hôtes et/ou d’éventuels vecteurs suivent cette
tendance, contribuant ainsi à l’émergence de maladies dans de nouvelles zones ou dans de
nouvelles populations. Enfin, l’écologie des pathosystèmes peut être modifiée par le climat,
mais aussi par l’intervention directe de l’homme, par exemple par la modification des
systèmes de production agricoles : la réduction de la diversité génétique des espèces
domestiques, l’intensification de la production ou la modification de la lutte contre la maladie
en sont des exemples.
B. Enjeux économiques et sociaux des (ré-)émergences
Les enjeux socio-économiques des maladies infectieuses émergentes dépendent de l’hôte
et, secondairement, des caractéristiques épidémiques du pathogène. Si l’émergence concerne
un pathogène de l’homme, ou un pathogène animal suspecté de pouvoir infecter l’homme, les
enjeux de santé publique, économiques et sociaux peuvent être énormes (Morens et al., 2004 ;
Weiss & McLean, 2004), comme l’ont déjà démontré les épidémies de SRAS (syndrome
respiratoire aigu sévère) et de SIDA (syndrome d’immunodéficience acquise). Ainsi, le SIDA
a été responsable de 3,1 millions de morts dans le monde au cours de la seule année 2004
(UNAIDS, 2004) ; en parallèle, l’émergence du SRAS a fait moins de 1000 morts mais
l’impact de cette maladie sur l’économie du sud-est asiatique est estimé à 25 milliards
d’Euros (WHO, 2003). L’émergence ou la ré-émergence de maladies qui ne sont pas
susceptibles d’infecter l’homme peuvent engendrer des famines et des exodes si elles touchent
l’agriculture vivrière des populations les plus pauvres, comme en Irlande au XIX ème siècle à la
suite de l’apparition du mildiou de la pomme de terre (dû à Phythophtora infestans). Plus
fréquemment, on enregistre des pertes économiques considérables pour la filière agricole
concernée par la maladie, éventuellement associées à des conflits politiques internationaux
suite aux mesures de protection (ou de protectionnisme déguisé) prises à l’occasion de ces
crises sanitaires. Parmi les nombreux exemples de maladies émergentes ou ré-émergentes
économiquement dévastatrices, on peut citer la ré-émergence en 2001 de la fièvre aphteuse en
Grande-Bretagne dont le coût pour l’économie anglaise est estimé à 11 milliards d’Euros
(Thompson et al., 2002), ou celle du chancre citrique en 1995 aux Etats-Unis qui a déjà coûté
plus de 150 millions d’Euros juste pour le programme d’éradication (Brown, 2001).
C. Enjeux scientifiques des (ré-)émergences
A l’inverse des enjeux socio-économiques, les enjeux scientifiques sont très souvent
identiques quel que soit le type d’hôte considéré, qu’il s’agisse de questions théoriques ou de
questions plus immédiatement opérationnelles.
Parmi les questions générales relatives à l’émergence, on peut citer les suivantes :
- La fréquence des émergences s’accélère-t-elle ?
- Y a-t-il des grandes tendances qui président aux émergences (type de pathogène, type
de cause, type de lieu) ?
- Peut-on prédire les risques d’émergence ?
La problématique de la prédiction des émergences se heurte à un obstacle de taille :
l’imprévisibilité du lieu et de la date de l’apparition de pathogènes complètement nouveaux
(Weiss & McLean, 2004). Cependant, la prédiction est un enjeu important pour les
émergences en lien avec des pathogènes déjà connus ; en particulier, quand l’extension
géographique d’un pathogène est limitée par le climat, le couplage d’un modèle
épidémiologique avec des scénarios climatiques afin de prévoir le déplacement possible des
aires de répartition des pathogènes est un domaine de recherche actif (Brasier & Scott, 1994 ;
Scherm & Yang, 1999 ; Sutherst, 2001 ; Mark & Hoddle, 2004 ; Pivonia & Yang, 2004 ;
Yonow et al., 2004). Cette approche permet d’identifier les émergences futures les plus
probables, et de s’y préparer.
- 10 -

Ceci nous amène aux enjeux liés à la prévention des émergences. Bien que cet aspect soit
éludé dans la plupart des articles généraux consacrés aux émergences, une prévention réelle
semble possible contre une partie des émergences (par exemple, par le contrôle sanitaire des
marchandises échangées, par une gestion durable des traitements et des gènes de résistance,
par la sélection d’espèces domestiques plus rustiques). Cependant, devant l’infinité des
émergences possibles, les questions se posent plus souvent en termes de réactivité (Finley et
al., 2004) qu’en termes de prévention totale. A cet égard, la conception de méthodes
d’épidémio-surveillance permettant de détecter rapidement les émergences (puis de continuer
à recueillir et analyser les données nécessaires au cours du temps) est un enjeu scientifique et
organisationnel majeur (Institute of Medicine, 1992 ; Morse, 1995 ; Woolhouse, 2002 ;
Anderson et al., 2004 ; Morens et al., 2004).
Enfin, en cas d’émergence d’une maladie complètement nouvelle ou peu étudiée
précédemment, les enjeux scientifiques les plus immédiats sont de l’ordre de l’aide à la
décision : ils concernent l’identification, l’acquisition et le transfert des connaissances
épidémiologiques permettant de contenir la maladie rapidement, efficacement et, si possible,
durablement. Ces enjeux immédiats sont les mêmes que dans l’étude épidémiologique de tout
pathosystème mal connu, l’urgence en plus ; ils sont en outre souvent indépendants de la
nature de l’hôte. On peut donc proposer un cadre général à l’étude de ces problèmes (Figure
3), basé sur le traitement en parallèle de différentes questions concourant à identifier des
méthodes de lutte contre la maladie et à optimiser leur mise en œuvre en une stratégie
cohérente.
Etudes
de risque
Risque
d’émergence
Emergence
Développement de la maladie Régression
Estimation du risque de persistance et
du coût de la maladie
- 11 -
Risque de
ré-émergence
Diagnostic
Identification des symptômes
caractéristiques Détection spécifique
Démonstration
expérimentale
des processus
biologiques
de la présence de l’agent pathogène
Détermination de l’étiologie de la maladie
et de la biologie de sa
Détermination
transmission
des facteurs favorables
à la maladie et à sa transmission
Etudes
d’association
Analyse des facteurs de risque associés à la maladie
Description quantifiée du développement spatio-
Modélisation
temporel de la maladie et tests
Modélisation mécaniste du
d’hypothèses
développement spatio-temporel de la maladie
Gestion de la
Identification et mise en œuvre d’une
maladie
stratégie de gestion de la maladie
Evaluation
de la lutte
Estimation a priori du rapport bénéfice/coût de la
lutte contre la maladie
Estimation a posteriori
du rapport bénéfice/coût de la lutte contre la maladie
Etudes
rétrospectives
Analyse des causes d’émergence, de maintien
et de régression de la maladie
Figure 3. Un cadre commun pour l’étude des maladies mal connues (émergentes ou non). L’objectif est de
fournir le plus rapidement possible les éléments scientifiques nécessaires à une gestion optimale de la
maladie.
L’intérêt de traiter ces questions en parallèle et de façon coordonnée réside dans le gain
de temps et dans la faible redondance entre les travaux des différentes équipes impliquées
(Finley et al., 2004), mais aussi dans l’enrichissement réciproque des différentes approches.
Cependant, mener sur une maladie donnée l’ensemble de ces tâches de façon coordonnée
nécessiterait la création d’un vaste programme regroupant de nombreuses équipes de

echerche appartenant à des disciplines différentes, ce qui ne saurait se justifier que par la
gravité et l’urgence d’une situation donnée. Les émergences sont donc actuellement plutôt
étudiées par des spécialistes s’investissant dans une seule approche. Les collaborations
pluridisciplinaires visant à utiliser simultanément différentes démarches mentionnées dans la
Figure 3 sont rares, malgré les effets synergiques associés à la prise en compte immédiate des
connaissances nouvelles apportées par les autres approches. En particulier, la confrontation
permanente entre les expérimentations et les modèles développés peut être particulièrement
fructueuse pour lutter efficacement contre une maladie donnée. C’est dans cette optique que
s’inscrit ma thèse, qui sera focalisée sur l’étude par des approches complémentaires de
l’épidémiologie de l’European stone fruit yellows (ESFY).
II. L’ESFY, une maladie grave mais dont l’épidémiologie est mal connue
Initialement nommée “dépérissement de l’abricotier par apoplexie” en France (Chabrolin,
1924) et “leptonécrose” en Italie (Goidanich, 1934), puis rebaptisée “enroulement chlorotique
de l’abricotier” ou ECA (Morvan & Castelain, 1965), la maladie qui nous intéresse est
actuellement dénommée “European stone fruit yellows” depuis que Lorenz et al. (1994) ont
établi la très forte proximité génétique entre les phytoplasmes associés à plusieurs
dépérissements incurables des Prunus en Europe.
A. Une menace pour la filière agricole des fruits à noyau
1) Impact économique de l’ESFY sur la filière abricot, en France
En 2004, la France était le 5 ème producteur mondial d’abricots (FAOSTAT 1 , 2005). La
culture de l’abricotier est principalement localisée dans le Sud ; elle génère près de 5000
UTA 2 (dont environ 50 % d’emplois permanents), ainsi que de nombreux emplois indirects
dans la distribution et les industries de transformation (d’après AGRESTE, 2003).
En France, l’ESFY est la maladie de l’abricotier qui a le plus de répercussions
économiques, car les arbres malades deviennent improductifs, puis ils meurent ou sont
arrachés (Lichou & Audubert, 1989). L’ESFY fait dépérir environ 5 % des abricotiers tous les
ans (Desvignes, 1999). Lors de la première manifestation connue de l’ESFY, en 1921 « la
maladie a pu apparaître alors comme un véritable désastre dans les régions où domine
l’Abricotier » avec un taux de mortalité des arbres atteignant parfois 20, 30, voire 40 % en 1
an (Chabrolin, 1924). Le coût des maladies des plantes en général est rarement chiffré ; celui
de l’ESFY en particulier n’a, à notre connaissance, jamais été estimé. Au cours des
paragraphes suivants, nous évoquerons donc uniquement les différents coûts liés à l’ESFY
sans les quantifier.
(a) Coût de la perte de récolte
En règle générale, les arbres malades dépérissent progressivement et finissent par mourir
en quelques années après l’expression des premiers symptômes (Chabrolin, 1924 ; Morvan
1977). Pendant cette phase de dépérissement, leur vigueur diminue et ils portent moins de
fleurs, ce qui réduit leur rendement. Parfois, le mûrissement des fruits et leur chute est
prématurée ; la pulpe des fruits peut brunir, sécher et se flétrir, ce qui les rend non
commercialisables (Chabrolin, 1924 ; Morvan, 1977). La perte d’un arbre se traduit
évidemment par une perte de récolte sur plusieurs années, même si un autre arbre est replanté
en remplacement.
1 Food and Agriculture Organization of the United Nations : http://faostat.fao.org/
2 Unité de Travail Annuel : équivalent à un emploi à temps plein pendant un an.
- 12 -

(b) Coût de la lutte contre l’ESFY
Il n’existe pas de traitement curatif autorisé contre les phytoplasmes : les produits du
groupe de la tétracycline sont efficaces en conditions contrôlées (Llácer et al., 1976 ; Firrao et
al., 2004), mais l’utilisation d’antibiotiques pour la protection des plantes est interdite en
Europe. L’amélioration génétique de l’espèce sensible est la méthode de lutte la plus durable,
mais aussi la plus longue à aboutir. La lutte contre l’ESFY suit donc les principes
prophylactiques qui sont les mêmes pour tous les phytoplasmes et la plupart des virus :
protection des pépinières, plantation de matériel certifié, arrachage des plantes malades, et
traitements contre les insectes vecteurs. Actuellement, la principale méthode de lutte repose
sur la détection précoce et l’arrachage des arbres avec des symptômes (afin de limiter le plus
possible les transmissions secondaires * à partir de ces arbres infectieux), ce qui nécessite des
moyens humains supplémentaires, donc un coût.
La suspicion d’une transmission par des cicadelles (présentes surtout en fin d’été) avait
incité certains arboriculteurs à réaliser en été des traitements insecticides de précaution – mais
finalement en pure perte. La découverte du vecteur de la maladie (Carraro et al., 1998b) et la
démonstration de sa présence au printemps dans les vergers du sud de la France (Labonne &
Lichou, 2003 et 2004) suscite maintenant l’utilisation d’insecticides au printemps, qui
représentent également un surcoût (achat du produit, main d’œuvre, carburant) et peuvent
nuire à l’image d’une culture traditionnellement peu traitée. Notons que dans certaines
situations, l’utilisation d’insecticides peut priver un arboriculteur d’un marché potentiel si son
client (une grande surface, le plus souvent) lui impose un cahier des charges spécifiant
l’absence de traitement insecticide.
(c) Coût d’opportunité
Le manque à gagner dû à l’ESFY est vraisemblablement très important. Il est lié au fait
que l’ESFY est le premier facteur limitant l’extension de la culture du prunier japonais (P.
salicina), très sensible à cette maladie, mais par ailleurs très intéressant économiquement
(Duval, 1999).
2) Impact environnemental de la maladie
L’effet direct de l’ESFY sur les plantes sauvages paraît négligeable car les Prunus
sauvages sont soit résistants, soit très tolérants (Carraro et al., 2002). L’ESFY peut néanmoins
avoir un effet indirect sur l’environnement, via les méthodes de lutte utilisées. Ainsi, depuis
2004, deux spécialités insecticides bénéficient d’une extension d’usage permettant de traiter
contre le vecteur de la maladie. Ces insecticides à large spectre peuvent avoir un impact
négatif sur l’entomofaune des vergers, en particulier sur les prédateurs naturels du vecteur de
l’ESFY. La découverte de prunelliers (P. spinosa) infectés (Jarausch et al., 2001b) et
abondamment colonisés par le vecteur (Labonne & Lichou, 2004) risque également de
déclencher des interventions (traitements, arrachage) sur les massifs de prunelliers sauvages et
donc indirectement sur les espèces animales qui en dépendent. Ce type d’interventions est
susceptible non seulement de réduire la biodiversité des zones cultivées et de leurs abords,
mais aussi de nuire à la régulation naturelle du vecteur par ses prédateurs inféodés aux
prunelliers.
B. Etat de l’art concernant l’épidémiologie de l’ESFY
1) Historique de la maladie en France
La première émergence documentée de l’ESFY a eu lieu en France en 1921, mais cette
maladie était probablement présente de longue date à l’état endémique en France, voire en
- 13 -

Europe. En effet, d’après Chabrolin (1924) : « Pour les années qui précèdent 1921, les
renseignements recueillis parmi les arboriculteurs sont assez concordants ; on peut en faire
état. De tout temps on a observé des cas de dépérissements de l’Abricotier par apoplexie dans
la région. Ils avaient plus ou moins d’importance suivant les années, mais leur nombre s’est
considérablement accru au cours des dernières années, jusqu’à atteindre son maximum en
1921 ». Par la suite, étant donné l’absence chronique de données objectives sur l’incidence
annuelle de la plupart des maladies, on se base sur les indications des acteurs du
développement agricole. D’après eux, après une période de retour à un régime endémique à
faible incidence, la maladie progresse depuis quelques années, en particulier sur les variétés
les plus récentes, qui sont souvent les plus intéressantes économiquement (Lichou &
Audubert, 1989 ; Mascherpa, 1996 ; Delgado, 1997 ; Breniaux, 2000). Cette maladie semble
donc ré-émerger en France, mais aussi dans d’autres pays européens (Laimer Da Câmara
Machado et al., 2001 ; Seljak & Petrovic, 2001 ; Ramel & Gugerli, 2004). Le lien évoqué
avec le renouvellement des variétés pourrait s’expliquer par des évolutions concomitantes (par
exemple une intensification du système de production), mais aussi par des facteurs génétiques
ou par la circulation de matériel infecté.
2) Extension géographique de l’épidémie
L’ESFY touche de nombreux pays européens, mais la maladie semble restreinte à cette
zone (Tableau 1 et Figure 4).
Tableau 1. Liste des pays dans lesquels les symptômes caractéristiques de l’ESFY et/ou l’agent pathogène
associé ont été identifiés.
Pays Date
Méthode
d’identification a Référence
Albanie 2003 S+T Myrta et al., 2003
Allemagne 1994 S+T Lorenz et al., 1994
Angleterre 2000 S+M+T Davies & Adams, 2000
Autriche 2001 S+T Laimer Da Câmara Machado et al., 2001
Belgique 2004 S+T Olivier et al., 2004
Bosnie-Herzégovine 2005 S+T Delic et al., 2005
Bulgarie 2000 S+T Topchiiska et al., 2000
Espagne 1994 S+T Lorenz et al., 1994
France 1994 S+T Lorenz et al., 1994
Grèce 1985 S+M Rumbos & Bosabalidis, 1985
Hongrie 1994 S+T Lorenz et al., 1994
Italie 1993 S+M+T Poggi Pollini et al., 1993
République Tchèque 2001 S+T Navrátil et al., 2001
Roumanie 1980 S+M Ploaie, 1980
Serbie 1963 S Gavrilovic & Paunovic, 1963
Slovénie 2001 S+T Brzin et al., 2001
Suisse 2001 S+T Ramel et al., 2001
Turquie 2000 S+T Jarausch et al., 2000b
a
S, symptômes ; M, microscopie ; T, techniques moléculaires
- 14 -

Royaume-
Uni
Espagne
Allemagne
Belgique Rep.
Tchèque
France
Suisse
Autriche Hongrie
Roumanie
Italie Bosnie-
Herz.
Bulgarie
Serbie-
Slovénie
Montén.
Observation de symptômes typiques de l’ESFY
Détection spécifique de ‘Ca. P. prunorum’
- 15 -
Albanie
Grèce
Turquie
Figure 4. Répartition géographique des pays dans lesquels des cas d’ESFY ont été mentionnés. Cette
maladie n’a jamais été décrite hors d’Europe.
3) Symptomatologie
L’intensité des symptômes varie selon l’espèce cultivée, sa variété, son porte-greffe, les
conditions pédoclimatiques locales (Chabrolin, 1924, Morvan 1977) et également selon les
isolats du pathogène associé à la maladie (Kison & Seemüller, 2001). Plusieurs symptômes
(Figure 5) évoquent un dérèglement physiologique : les entre-nœuds se raccourcissent (Figure
5A), les fleurs sont peu nombreuses et apparaissent après les feuilles, la dormance hivernale
est écourtée (feuillaison précoce), voire supprimée (Morvan, 1977). En été, les feuilles des
arbres les plus atteints sont plus petites et présentent une chlorose et un enroulement en cône
caractéristiques (Morvan, 1977 ; Desvignes & Cornaggia, 1983), et la maturation des fruits est
perturbée (Chabrolin, 1924 ; Morvan 1977). Enfin, on observe une nécrose du phloème
(Figure 5B) en cas d’hiver froid, puis un brusque dépérissement (apoplexie, Figure 5C) lors
des périodes sèches de l’été (Chabrolin, 1924 ; Morvan & Castelain 1968). Les symptômes,
initialement localisés, s’étendent à l’ensemble de l’arbre en 2 ans ou plus (Morvan, 1977).
Outre ces symptômes spécifiques, les arbres atteints d’ESFY (Figure 5D) « se reconnaissent à
leur aspect général, difficile à définir. C’est l’aspect languissant qu’ont tous les arbres
souffreteux » (Chabrolin, 1924).
En général, les arbres malades meurent en quelques années (Chabrolin, 1924 ; Morvan
1977). Il arrive cependant que de rares arbres guérissent spontanément ; dans ce cas, un isolat
faiblement pathogène (générant peu de symptômes) peut parfois être transmis par greffage sur
un arbre sain (Castelain et al., 1997). L’inoculation préventive d’abricotiers sains par ces
isolats dits « prémunitifs » dans une expérience de protection croisée semble montrer une
certaine efficacité en verger contre les isolats agressifs d’ESFY, même si la vigueur des arbres
prémunis est un peu inférieure à celle des arbres sains (Castelain et al., 1997). Cependant,
l’absence de recul et de compréhension des mécanismes impliqués dans la prémunition n’ont
pas permis la généralisation de cette méthode qui requiert l’inoculation systématique des
arbres par un isolat faible.

A C
B D
Figure 5. Symptômes de l’ESFY. (A) Court-noué et débourrement précoce en hiver : les feuilles
apparaissent avant les rares fleurs. (B) Nécrose du phloème : la bande nécrosée suit les vaisseaux dans
lesquels le phytoplasme a proliféré et s’arrête au niveau du point de greffe. (C) Arbre mort d’apoplexie
pendant la sécheresse de l’été 2003. (D) Arbre dépérissant. (Photographies : G. Labonne, sauf (B) : C.
Castelain)
4) Gamme d’hôtes
L’ESFY peut être transmis par greffage à la quasi-totalité des Prunus (Morvan, 1977 ;
Carraro et al., 2004a). Il semble que chaque espèce comporte des variétés plus ou moins
sensibles. Cependant, à partir d’une quantité assez importante d’observations et
d’expérimentations, on peut indiquer les tendances générales qui se dégagent concernant la
sensibilité des différentes espèces (Figure 6). Le pêcher (P. persica) est décrit comme
extrêmement sensible, de même que l’abricotier (P. armeniaca) et le prunier japonais (P.
salicina) (Carraro et al., 1998a et 2004a ; Desvignes & Cornaggia, 1983 ; Goidanich, 1933 ;
Kison & Semüller, 2001 ; Morvan, 1977). Le porte-greffe GF 8-1 (P. marianna) est moins
sensible que l’abricotier (Morvan & Castelain, 1968 ; Desvignes et Cornaggia, 1983 ), ainsi
que le mirabellier (P. insititia) (Kison & Semüller, 2001). Les espèces les moins sensibles
manifestent peu ou pas de symptômes malgré la présence du phytoplasme et atténuent les
symptômes des greffons qui leur sont associés : il s’agit du myrobolan (P. cerasifera)
(Chabrolin, 1924 ; Morvan & Castelain, 1968 ; Kison & Semüller, 2001 ; Carraro et al.,
2004a), mais surtout du prunier (P. domestica) (Morvan, 1977 ; Desvignes & Cornaggia,
1983 ; Carraro et al., 1998a ; Jarausch et al., 2000a ; Kison & Semüller, 2001), de l’amandier
(P. amygdalus) (Morvan, 1977), et du prunellier (P. spinosa) (Morvan & Castelain, 1972 ;
Carraro et al., 2004a). Le cerisier du Japon (P. serrulata) est sensible (Lederer & Seemüller,
- 16 -

1992) ; par contre, le cerisier doux (P. avium) apparaît très fortement résistant (Jarausch et al.,
1999), de même que le cerisier à grappes (P. padus) et le bois de S te Lucie (P. mahaleb)
(Carraro et al., 2002). A l’exception de ces cerisiers, tous les Prunus cités ont déjà été trouvés
naturellement infectés par le pathogène associé à l’ESFY (Lorenz et al., 1994 ; Jarausch et al.,
1998, 2001b ; Carraro et al., 2002). De nombreux autres hybrides interspécifiques et Prunus
plus rares ont également été contaminés expérimentalement (Morvan, 1977 ; Carraro et al.,
2004a) ou naturellement (Jarausch et al., 1998, 2000b).
Sensibilité
Pêcher (P. persica)
Abricotier (P. armeniaca)
Prunier japonais (P. salicina)
Cerisier du Japon (P. serrulata)
GF 8-1 (P. marianna)
Mirabellier (P. insititia)
Myrobolan (P. cerasifera)
Amandier (P. amygdalus)
Prunier (P. domestica)
Prunellier (P. spinosa)
Cerisier à grappes (P. padus)
Bois de S te Lucie (P. mahaleb)
Cerisier doux (P. avium)
5) Etiologie et diagnostic
Figure 6. Hiérarchie de la sensibilité à l’ESFY parmi les Prunus.
Cette synthèse de nombreuses observations et expérimentations
n’a qu’une valeur qualitative, en particulier parce qu’il existe une
certaine variabilité intra-spécifique de la sensibilité.
Le pathogène associé à l’ESFY a également été
détecté occasionnellement dans des plantes n’appartenant
pas au genre Prunus : noisetier (Corylus avellana)
(Marcone et al., 1996) ; frêne (Fraxinus excelsior),
micocoulier (Celtis australis) et églantier (Rosa canina)
(Jarausch et al., 2001b) ; vigne (Vitis vinifera) (Duduk et
al., 2004). La plupart de ces résultats restent toutefois à
confirmer avec d’autres marqueurs moléculaires
(Seemüller & Schneider, 2004). Enfin, le phytoplasme a
également été transmis expérimentalement par cuscute à
quelques hôtes herbacés (Morvan et al., 1973 ; Loi et al.,
1995).
La multiplicité des noms qui ont été donnés à l’ESFY est symptomatique de la difficulté à
définir l’étiologie * commune à différentes maladies des arbres fruitiers européens, ce qui a
longtemps limité la compréhension de son épidémiologie. Initialement, aucun organisme
n’ayant été identifié au microscope optique ni cultivé à partir des arbres malades, l’ESFY a
été considéré comme une maladie physiologique (Chabrolin, 1924), puis comme une maladie
virale car elle était transmissible par greffage (Morvan, 1957), avant de découvrir grâce au
microscope électronique à transmission la présence dans le phloème des phytoplasmes
(Morvan et al., 1973) (Figure 7), petites bactéries sans paroi d’un diamètre compris entre 0,2
et 0,8 µm (Firrao et al., 2004).
A B
- 17 -
Figure 7. Observation au
microscope électronique de
‘Candidatus Phytoplasma
prunorum’. Cellules du phloème
(A) d’un abricotier malade de
l’ESFY, et (B) d’une cuscute
parasitant un arbre atteint de
l’ESFY. (Photographies :
(A) Musetti et al., 2005 ;
(B) Morvan et al., 1973)

Les phytoplasmoses les plus connues des Prunus européens (rassemblées sous le nom
d’ESFY) sont associées à un seul phytoplasme (Lorenz et al., 1994), nommé ‘Candidatus
Phytoplasma prunorum’ (Seemüller & Schneider, 2004), possédant un génome de taille très
réduite (630 kpb), dont une carte physique simple a été publiée (Marcone & Seemüller, 2001).
Les postulats de Koch 1 n’ont été vérifiés pour aucun phytoplasme car ceux-ci n’ont jamais pu
être cultivés sur un milieu acellulaire ; il existe cependant un faisceau d’arguments qui
indiquent clairement que ‘Ca. P. prunorum’ est bien l’agent pathogène responsable de
l’ESFY : détection systématique de ‘Ca. P. prunorum’ dans les arbres présentant des
symptômes typiques de l’ESFY (Jarausch et al., 1998 ; Carraro et al., 1998a), observation des
symptômes de l’ESFY et de phytoplasmes dans des plantes – initialement saines – greffées
avec du matériel contaminé (Morvan et al., 1973), disparition des symptômes après traitement
avec de la tétracycline (Llácer et al., 1976) à laquelle les phytoplasmes sont sensibles, et
détection de ‘Ca. P. prunorum’ dans le vecteur de l’ESFY (Carraro et al., 1998b).
Le diagnostic de la maladie repose souvent sur l’observation des symptômes
caractéristiques. L’identification de la maladie est parfois complétée par l’observation du
pathogène en microscopie optique (avec du DAPI (4’,6-diamidino-2-phenylindole) comme
colorant) ou en microscopie électronique, mais la méthode de référence repose sur les
techniques de biologie moléculaire qui permettent de diagnostiquer l’ESFY par
l’identification spécifique de ‘Ca. P. prunorum’ (Seemüller & Schneider, 2004). En verger, le
diagnostic est presque toujours basé sur la symptomatologie, éventuellement après greffage
sur un indicateur sensible dans le cas de la production de matériel certifié (Desvignes &
Cornaggia, 1983). L’observation directe des symptômes est évidemment inefficace pour les
espèces tolérantes, mais parmi les espèces ou variétés sensibles il existe également des arbres
asymptomatiques infectés par ‘Ca. P. prunorum’ (Davies & Adams, 2000 ; Laimer Da
Câmara Machado et al., 2001 ; Torres et al., 2004 ; Genini & Ramel, 2004), sans que la
signification épidémiologique de ce fait soit établie (ces arbres sont-ils des sources de
pathogènes ?).
A B
D
C
Figure 8. Cacopsylla pruni,
vecteur de l’ESFY. Les
adultes réimmigrants (A)
quittent les conifères en fin
d’hiver et se reproduisent sur
les Prunus où des groupes
d’œufs (B) sont pondus le
long des nervures ; après
éclosion, 5 stades larvaires
(C) se succèdent avant
l’émergence des jeunes
adultes (D) qui quittent les
Prunus pour les conifères en
début d’été. (Photographies :
G. Labonne)
1 ème
A la fin du XIX siècle, Koch a énoncé trois principes permettant de prouver rigoureusement qu’un organisme
est l’agent étiologique d’une maladie donnée : (i) le pathogène putatif est présent chez tous les individus atteints
par cette maladie, dans des conditions permettant d’expliquer les observations pathologiques et cliniques ; (ii) le
pathogène putatif n’est pas un organisme anodin dans d’autres situations ; (iii) après avoir été isolé à partir d’un
individu malade et multiplié en culture pure, il induit la même maladie quand on l’inocule à un individu
initialement sain. Considérés par Koch lui-même comme des directions générales, ces postulats ont par la suite été
institués en véritable dogme (Fredricks & Relman, 1996).
- 18 -

6) Vection
Le vecteur de l’ESFY (Figure 8), Cacopsylla pruni Scopoli a été identifié très
tardivement (Carraro et al., 1998b). De ce fait, tous les paramètres épidémiologiques liés à la
vection sont encore assez mal connus, qu’il s’agisse de la biologie du vecteur ou des
caractéristiques de la vection.
(a) Biologie de C. pruni
C. pruni est un Hémiptère appartenant
à la famille des psylles. Au printemps, lors
de la reproduction des adultes
réimmigrants (de couleur foncée), les
plantes hôtes de C. pruni sont des Prunus.
Les mesures d’abondance sur le terrain
(Labonne & Lichou, 2004) et de
mortalité/fécondité au laboratoire
(Carraro, 2004a) donnent des résultats
assez cohérents concernant les hôtes
préférés de C. pruni (Figure 9) : le
prunellier surtout, puis, en ordre
décroissant, les pruniers (domestiques,
japonais et myrobolan), l’abricotier, le
pêcher et l’amandier ; les “cerisiers”
(cerisier doux, cerisier à grappes, lauriercerise,
bois de S te Lucie) sont moins
propices au développement de C. pruni au
laboratoire ; le mirabellier a également été
signalé comme hôte naturel de ce psylle
(Ossiannilsson, 1992).
- 19 -
Valeur hôte
pour C. pruni
Mirabellier (P. insititia)
Prunellier (P. spinosa)
Myrobolan (P. cerasifera)
Prunier (P. domestica)
Prunier japonais (P. salicina)
Abricotier (P. armeniaca)
Pêcher (P. persica)
Amandier (P. amygdalus)
Cerisier doux (P. avium)
Bois de Ste Lucie (P. mahaleb)
Cerisier à grappes (P. padus)
Laurier-cerise (P. laurocerasus)
Figure 9. Hiérarchie de la sensibilité à l’ESFY
parmi les Prunus. Cette synthèse de quelques
observations et expérimentations n’a qu’une
valeur qualitative. Elle est basée sur l’abondance
de C. pruni sur les Prunus dans la nature et/ou
de sa longévité et de sa fécondité en conditions
expérimentales.
Au printemps, on trouve des œufs et des larves sur les plantes hôtes les plus favorables,
puis de jeunes adultes émigrants (de couleur claire) qui disparaissent des Prunus en début
d’été. Une mesure pluriannuelle de la densité des individus (Figure 10) indique que les dates
de présence et les effectifs fluctuent légèrement d’une année à l’autre (Labonne & Lichou,
2004). Cependant, pour une année donnée, l’évolution parallèle des effectifs entre les
différents Prunus (Figure 11) semble indiquer que C. pruni ne colonise pas ces espèces
successivement mais bien de façon synchrone (Labonne & Lichou, 2004).
Nombre de psylles
120
100
80
60
40
20
0
17/1
31/1
14/2
28/2
13/3
27/3
10/4
24/4
8/5
22/5
5/6
2000
Date
2001 2002
19/6
3/7
17/7
Figure 10. Evolution
pluriannuelle des
dates de présence et
des effectifs des stades
adultes de C. pruni.
Les effectifs indiqués
correspondent au
battage de 20
branches au-dessus
d’une toile de 1 m²
dans une haie de
prunelliers située à
Montbazin (Hérault).

Nombre de psylles
Nombre de psylles
120
100
80
60
40
20
0
120
100
80
60
40
20
0
17/1
17/1
31/1
31/1
14/2
14/2
28/2
28/2
13/3
27/3
Hérault 2002
10/4
24/4
8/5
22/5
5/6
19/6
- 20 -
3/7
Prunellier
Date
Prunier Abricotier
Pyrénées Orientales 2002
13/3
27/3
10/4
24/4
8/5
22/5
5/6
19/6
Date
Prunellier Myrobolan
3/7
17/7
17/7
Figure 11. Evolution synchrone
des effectifs des stades adultes
de C. pruni sur prunellier,
prunier domestique, abricotier
et myrobolan. Les effectifs
indiqués correspondent au
battage de 20 branches audessus
d’une toile de 1 m².
Le reste de l’année, les plantes “refuges” de C. pruni sont des conifères (Conci et al.,
1992 ; Lauterer, 1999). Les œufs et les larves n’ont jamais été observés sur conifères et il ne
se déroule qu’un seul cycle sur les Prunus ; par conséquent, on peut supposer que C. pruni
est une espèce univoltine * vivant environ un an (Conci et al., 1992 ; Ossiannilsson, 1992).
Cependant, ce point reste à démontrer formellement.
Les comportements de ce psylle sont certainement la partie la plus mal connue de sa
biologie. Les larves peuvent se déplacer en marchant et les adultes en sautant ou en volant ;
on ne connaît rien d’autre sur les distances et la fréquence des déplacements de C. pruni si ce
n’est que les adultes semblent capables de voler sur de longues distances, puisqu’on le trouve
au printemps en nombre dans des plaines situées à plusieurs dizaines de kilomètres des zones
refuges identifiées. Par analogie avec son proche parent C. pyri, on sait qu’il ne faut pas
négliger les vols de ce petit insecte sur de longues distances. En effet, Blomquist &
Kirkpatrick (2002) ont estimé qu’en 18 ans, C. pyri s’est déplacé vers le sud des Etats-Unis de
60 km/an en moyenne. De plus, parmi les Hémiptères, plusieurs espèces de pucerons, de
cicadelles et de psylles sont réputées migrer sur de très grandes distances, probablement en
profitant de courants aériens favorables (Byrne & Bellows, 1991 ; Loxdale & Lushai, 1999).
On ne sait pas non plus si C. pruni possède un comportement d’agrégation, mais de nombreux
insectes émettent des signaux acoustiques (Cocroft, 2005), en particulier des psylles pendant
la période de reproduction (D. M. Percy 1 , 2005). Enfin, l’existence de phéromones sexuelles a
été démontrée chez un autre psylle du même genre, C. bidens (Soroker et al., 2004). Il n’est
donc pas impossible qu’au moins l’un de ces procédés d’agrégation soit également utilisé par
C. pruni.
1 Diana M. Percy (20/01/2005) Song, sex and psyllid systematics : http://www.psyllids.org/psyllidsSOUND.htm

(b) Caractéristiques de la vection
Les phytoplasmes sont en général transmis sur le mode persistant (circulant multipliant)
et sans transmission à la descendance (Garnier et al., 2001). Il semble en être de même pour
C. pruni. En effet, d’après Carraro et al. (2001), (i) les insectes infectieux sont capables de
transmettre l’ESFY pendant plusieurs semaines à plusieurs plantes-tests successivement ; (ii)
certains des tous premiers insectes capturés au début du printemps sont porteurs de ‘Ca. P.
prunorum’ et immédiatement infectieux, ce qui suggère qu’ils ont conservé le phytoplasme
pendant 9 mois environ (du début de l’été à la fin de l’hiver) ; et (iii) l’acquisition, la latence
dans l’insecte et la transmission semblent durer en moyenne 3, 25 et 3 jours, respectivement.
Ces longues durées sont caractéristiques du mode de transmission circulant : la transmission
n’a lieu que lors des piqûres d’alimentation, ce qui nécessite que le vecteur décide de
s’alimenter, puis dirige ses stylets jusqu’aux faisceaux conducteurs, pour finalement injecter
de la salive (et des phytoplasmes) dans le phloème puis ingérer la sève (et les phytoplasmes)
qui y circulent. De plus, entre l’acquisition et la transmission, le phytoplasme doit se
multiplier puis passer du tube digestif du vecteur à ses glandes salivaires, via l’hémolymphe
(Garnier et al., 2001). Tous ces processus demandent du temps.
Les jeunes adultes émergents et les vieux adultes réimmigrants capturés sur les Prunus
sont capables de transmettre l’ESFY (Carraro et al., 1998b, 2001, 2004c). Certains jeunes
adultes sont donc infectieux avant de quitter le verger, mais il est probable que pour la
majorité de ces individus porteurs du phytoplasme, la latence s’achève en dehors des Prunus
(Carraro et al., 2004c). Par contre, aucune expérience n’indique clairement si les larves sont
capables de transmettre ‘Ca. P. prunorum’, si les jeunes adultes peuvent acquérir puis
transmettre le phytoplasme avant de quitter les Prunus, ni si les adultes réimmigrants sont
capables d’acquérir le pathogène puis de le transmettre avant la fin de leur vie. Ces
paramètres sont pourtant fondamentaux car ils déterminent les échelles auxquelles se déroule
le cycle de base de l’épidémie.
7) Incubation, latence et période infectieuse de la plante
La durée d’incubation est définie comme le temps écoulé entre la date de contamination
et la date d’apparition des symptômes, alors que la durée de latence correspond au temps
écoulé entre la date de contamination et la date à laquelle la plante devient infectieuse
(Vanderplank, 1963). Certaines espèces ou variétés sont tolérantes (infectées, mais
asymptomatiques) ; pour les autres, l’incubation dure de 7 à 12 mois lorsque la transmission
est réalisée par greffage de matériel infecté (Morvan & Castelain, 1968 ; Giunchedi et al.,
1983). Quand des pruniers japonais de moins d’un an sont inoculés par des groupes de
psylles, les premiers symptômes apparaissent 4 à 5 mois environ après la transmission
(Carraro et al., 1998b, 2004a). En verger, selon l’espèce et la variété considérée, les premiers
symptômes apparaissent 2 à 5 ans après la plantation de matériel sain (Morvan, 1977 ; Carraro
et al., 1992 ; Labonne et al., 2000 ; Jarausch et al., 2001a). Les symptômes mettent ensuite au
moins 2 ans à se propager à l’ensemble des charpentières (Morvan, 1977) des arbres malades.
Il reste cependant plusieurs questions en suspens qui, à notre connaissance, n’ont pas été
examinées, malgré leur importance, en particulier dans un contexte où la détection de la
maladie est en général basée sur les symptômes (qui apparaissent après une période
d’incubation) : quelle est la durée de la latence ? Est-elle plus courte que la durée
d’incubation ? Les vecteurs peuvent-ils acquérir le phytoplasme sur une plante qui n’a pas
encore de symptômes ? Les vecteurs peuvent-ils acquérir le phytoplasme pendant toute la
période où la plante présente des symptômes (en particulier au début et à la fin de l’expression
des symptômes) ? Comment varient les périodes d’incubation et de latence en fonction de
l’âge de la plante lors de son inoculation ?
- 21 -

8) Propagation entre parcelles
Compte tenu des éléments fournis précédemment, trois scénarios peuvent expliquer
l’introduction de l’ESFY dans un verger : (i) l’arrivée de vecteurs réimmigrants infectieux
ayant acquis le phytoplasme l’année précédente, impliquant l’environnement lointain du
verger (zones de moyenne montagne), (ii) l’arrivée de vecteurs récemment infectés,
impliquant les abords de la parcelle (vergers adjacents ou Prunus sauvages présents aux
alentours), ou (iii) une introduction humaine. En particulier, les pépinières sont susceptibles
de fournir du matériel contaminé, notamment si un arbre donneur de greffons malade n’a pas
été détecté (Morvan, 1977 ; Laimer Da Câmara Machado et al., 2001 ; Torres et al., 2004).
9) Bilan sur le cycle épidémique de l’ESFY
Les principales caractéristiques du cycle épidémique de l’ESFY sont résumées dans la
Figure 12. La Figure 13 synthétise les connaissances disponibles sur le cycle de C. pruni et
sur le cycle de la vection.
Introduction de
l’ESFY dans le
verger par un
vecteur ou par
l’homme
3 jours
Transmission par
le vecteur
Vecteur infectieux
Arbre
infecté
2-5 ans ?
Incubation dans l’arbre
Latence dans l’arbre
Arbre = Prunus
Vecteur = C. pruni
25 jours
Latence dans le vecteur
DISPERSION DU VECTEUR
- 22 -
Arbre symptomatique
Arbre
infectieux
Acquisition par
le vecteur
Vecteur infecté
Arbre
mort
3 jours
Figure 12. Cycle de base de l’épidémie d’ESFY. En conditions naturelles, on ne sait pas à quelles échelles
de temps et d’espace se déroule ce cycle. (Photographies : G. Labonne)

Conifères ?
Rétention du
phytoplasme ?
Octobre
Janvier
Juillet
Départ
des Prunus
Retour sur
les Prunus
- 23 -
Adultes
réimmigrants
(vieux)
Avril
Œufs
Larves
Adultes
émergents
(jeunes)
Acquisition du
phytoplasme ?
Transmission
du phytoplasme
Acquisition du
phytoplasme
Transmission du
phytoplasme ?
Prunus
en plaine
Figure 13. Connaissances initiales sur le cycle de C. pruni et de la vection de l’ESFY. Les parties
hachurées indiquent les points qui n’ont pas été établis avec certitude lors de travaux précédents.
(Photographies : N. Sauvion)
C. Enjeux scientifiques
Ce tour d’horizon des connaissances accumulées sur l’ESFY depuis 1924 montre que
cette maladie grave ré-émerge en Europe mais qu’elle reste encore assez mal comprise. En
particulier, du fait de la découverte relativement récente de C. pruni, la vection de l’ESFY n’a
été que partiellement étudiée, alors qu’il s’agit du moteur de l’épidémie. Il reste dans ce
domaine des lacunes dont l’étendue nuit à la compréhension du fonctionnement de l’épidémie
et à l’identification des méthodes de lutte optimales contre cette maladie : dynamique de
population (en fonction du climat) et cycle biologique du vecteur, stades compétents pour
acquérir et transmettre le phytoplasme, comportements et déplacements à courte distance
(transmission de l’ESFY intra- et inter-vergers) et à longue distance (migrations), zones
d’estivage et d’hivernage.
D’autres questions concernant les différentes espèces de Prunus mériteraient également
d’être examinées pour estimer leur contribution au développement de la maladie : valeur
source, période infectieuse, d’incubation et de latence (en fonction du climat, et de l’âge de la
plante lors de l’inoculation), durée relative de l’incubation et de la latence.
Enfin, la gestion de la maladie pourrait bénéficier directement de l’amélioration des
méthodes et des connaissances dans certains domaines : identification des pratiques culturales
influençant la quantité de maladie, estimation (a priori et a posteriori) de l’efficacité de
différentes méthodes de lutte contre la maladie, compréhension du mécanisme de prémunition
pour limiter les dégâts causés par l’ESFY.
III. Objectifs et stratégie d’étude
A. Objectifs
Toutes les questions mentionnées ci-dessus sont intéressantes sur un plan cognitif et/ou
plus appliqué. Cependant, dans ce mémoire, seuls seront abordés les sujets susceptibles

d’améliorer à la fois la compréhension du processus de vection et la gestion de l’ESFY.
L’objectif principal de ce travail est de montrer comment l’intégration résultant de l’étude
pluridisciplinaire des questions épidémiologiques (en particulier de la vection) améliore la
compréhension des épidémies d’une maladie à phytoplasme touchant des plantes pérennes*.
B. Stratégie
La stratégie d’étude retenue est résumée dans la Figure 14. L’analyse de la bibliographie a
permis d’identifier les facteurs de risque et les processus épidémiques déjà connus. Pour
identifier et quantifier les autres processus, on privilégie les démonstrations expérimentales
directes, dans la mesure du possible. Cependant, l’étude expérimentale de nombreux
paramètres, processus et facteurs de risque est difficilement envisageable, pour des questions
de pertinence des échelles (plantation de vergers), de moyens financiers ou techniques (suivi
direct de petits insectes) et de durée (expérimentations pluriannuelles). Ainsi, dans la première
partie de ce mémoire, les situations variées rencontrées à l’échelle d’une petite région de
production seront mises à profit pour étudier certains de ces facteurs, mais aussi pour émettre
des conjectures sur les processus de dissémination de l’ESFY dans l’espace. La seconde partie
sera consacrée aux expérimentations visant à établir le potentiel infectieux des différents
stades du vecteur, ce qui conditionne très fortement les processus de dispersion de la maladie,
et donc les motifs spatio-temporels formés par les arbres malades. La troisième partie
montrera que les motifs attendus ont des caractéristiques qui peuvent se traduire en termes
d’hypothèses d’indépendance, et que la construction et l’application de tests d’hypothèses
peuvent améliorer la compréhension des processus de dispersion. Dans la dernière partie, les
connaissances acquises sur l’ESFY par les diverses approches utilisées seront formalisées et
intégrées dans un modèle mécaniste à l’échelle de la parcelle destiné à estimer les paramètres
liés aux comportements – peu accessibles expérimentalement – du vecteur dans les vergers.
Enfin, la conclusion situera ces résultats dans la perspective concrète de la gestion de l’ESFY
et replacera la démarche suivie dans le cadre plus général de l’étude des maladies émergentes
ou ré-émergentes.
Analyse de la
bibliographie
Modèle
exploratoire
régional
Tests
d’hypothèses
locales
Démonstrations
expérimentales
Facteurs de risque
Processus
Paramètres
- 24 -
modulation
Modèle
mécaniste
estimation
Figure 14. Stratégie d’étude de l’épidémiologie de l’ESFY et organisation des différentes approches
envisagées.

Partie I : Identifier des
facteurs de risque par
une enquête à l’échelle
d’un bassin de
production
- 25 -

En cas d’émergence, l’étude de données de terrain disponibles à grande échelle permet de
profiter de la diversité des situations préexistantes pour identifier et hiérarchiser rapidement
les facteurs de risque associés à la maladie considérée. C’est pourquoi la première phase de la
stratégie décrite précédemment consiste à analyser à l’échelle d’une région de production les
corrélations entre la quantité d’ESFY et les caractéristiques des vergers. Pour chaque verger,
on dispose du nombre d’arbres plantés et du nombre d’arbres morts ou malades de l’ESFY
depuis la plantation du verger jusqu’à 2004 (incidence cumulée de l’ESFY) et d’un certain
nombre de variables explicatives potentielles (âge, exploitant, cultivar, porte-greffe, origine
du matériel, surface, densité, coordonnées spatiales). La nature des données et la volonté
d’analyser finement les corrélations spatiales ont nécessité l’utilisation de méthodes peu
courantes en épidémiologie végétale : modèle logistique surdispersé (pour gérer la variabilité
extra-binomiale), bootstrap paramétrique (pour obtenir des intervalles de confiance fiables sur
les faibles proportions), test d’indépendance spatiale entre les résidus du modèle (pour
signaler des écarts aux hypothèses du modèle, potentiellement liés à la transmission de la
maladie). Ces différents aspects sont présentés dans l’article ci-dessous.
I. Article I : “Identifying Risk Factors from a Survey with a Logistic
Regression Model: the Case of European Stone Fruit Yellows”
Gaël Thébaud, Nicolas Sauvion, Joël Chadœuf, Arnaud Dufils and Gérard Labonne
(Soumis à la revue Phytopathology)
- 26 -

Identifying Risk Factors from a Survey with a Logistic Regression Model:
the Case of European Stone Fruit Yellows
Gaël Thébaud, Nicolas Sauvion, Joël Chadœuf, Arnaud Dufils and Gérard Labonne
First, second, and fifth authors: Institut national de la recherche agronomique (INRA), UMR
BGPI, CIRAD TA 41/K, Campus international de Baillarguet, 34398 Montpellier Cedex 5,
France; first and third authors: INRA, Unité de Biométrie, Domaine Saint-Paul, Site
Agroparc, 84914 Avignon Cedex 9, France; and fourth author: Station Expérimentale La
Pugère, Chemin de la Barque, 13370 Mallemort, France.
Corresponding author: Gaël Thébaud, INRA - UMR BGPI, CIRAD TA 41/K, Campus
international de Baillarguet, 34398 Montpellier Cedex 5, France. E-mail address:
thebaud@ensam.inra.fr.
ABSTRACT
Thébaud, G., Sauvion, N., Chadœuf, J., Dufils, A., and Labonne, G. Identifying risk factors
from a survey with a logistic regression model: the case of European stone fruit yellows.
European stone fruit yellows (ESFY) is becoming a major economic problem for Prunus
growers in Europe. The causal agent (‘Candidatus Phytoplasma prunorum’) and its vector
(Cacopsylla pruni) have been identified, but the present knowledge of the risk factors for this
disease relies at best on specific experiments. To estimate the influence of several factors on
disease incidence in the field, an exhaustive survey was performed on apricot and Japanese
plum orchards in the Crau plain (France). After a preliminary multivariate exploration of the
data, we used a logistic regression model to analyze and predict the cumulative number of
diseased trees on the basis of a set of quantitative (age, planting density and area of the
orchard) and categorical variables (species, cultivar and rootstock). Because of the nature of
the data, we used an overdispersed binomial model and we developed a parametric bootstrap
procedure based on the beta-binomial distribution to obtain confidence intervals. Our results
indicated that the age, species and cultivar of the scion were the major factors explaining the
observed number of diseased trees. The planting density and the rootstocks used in the zone
under study were less significant, while the area of the orchard had no effect. The residuals of
the model showed that some explanatory variables had not been taken into account, since part
of the remaining variability could be explained by a grower effect. The spatial distribution of
the residuals suggested that one of the reasons for this grower effect was the correlation
between orchards closer than 100 m, possibly caused by the flight behavior of infectious
vectors. The impact of this survey on our perception of the epidemiology of ESFY is
presented, as well as its role in the identification of targets for future investigation.
Keywords: epidemiology, generalized linear model, Monte Carlo, Prunus armeniaca, Prunus salicina.
INTRODUCTION
A frequent goal of epidemiological studies is to highlight the factors that are highly
correlated with disease incidence or severity, or even to point at causal factors explaining the
emergence of a new disease. To these aims, the analysis of surveys can be seen as an
introduction or an alternative to the experimental approach, in particular (i) for quarantine
diseases, (ii) when many potential factors are considered, (iii) when the investigated factors
are related to the agricultural landscape (e.g., size, shape, or density of the plots), (iv) when an
immense number of replicates would be necessary to achieve enough statistical power, or (v)
- 27 -

when a lack of knowledge on the biological system could question the epidemiological
significance of the experiments. For example, if an unknown insect transmits a disease, the
study of risk factors by the experimental inoculation of plant material may not reflect field
conditions because of the vector’s behavior, among other reasons. In contrast, analyzing
survey data allows taking advantage of many “natural experiments” that occur under field
conditions, where more factors can be investigated simultaneously, the side effect being a
lack of a priori control by an experimental design. Such observational studies are common in
animal and human epidemiology, but are rarer in botanical epidemiology, probably because
the networks for a high-quality data collection on a large scale are infrequent for plant
diseases, and because many risk factors can be investigated directly through cost-effective
experiments. Most of these surveys linked disease incidence with climatic parameters such as
temperature and moisture. Soil structure or pH (40), and the quantity and proximity in space
or time of putative sources of inoculum (12,38) have also been examined. Finally, only a few
observational studies have characterized how the amount of disease was influenced by
human-driven factors such as agricultural practices, control methods and the choice of the
cultivated genotype (21,43,47). However, for some of these variables, prophylactic practices
can be defined so that the growers can make preventive choices to reduce disease incidence
without the economic and environmental costs associated with the use of pesticides. Our
study focused on these human-driven factors because of high practical impact on the
management of European stone fruit yellows (ESFY).
ESFY is a systemic disease affecting the genus Prunus (32). It has been present in Europe
since at least the beginning of the 20 th century (7,19), but its prevalence has increased in the
last decades (30) and ESFY is now a major economic problem on apricot (P. armeniaca) and
Japanese plum (P. salicina) in Europe. We know that ‘Candidatus Phytoplasma prunorum’
(42), the causal agent of the disease, is transmitted on the persistent mode by Cacopsylla
pruni (5), but the risk factors of ESFY are still poorly understood. Standardized captures in
the field (29) and experimental breeding (3,4) showed the vector’s strong host preference for
blackthorn (P. spinosa), myrobalan (P. cerasifera), Japanese plum, and plum trees (P.
domestica). Experimental vector transmissions and graft inoculations (3,4) demonstrated that
there is a wide range of susceptibility to ‘Ca. P. prunorum’ within the genus Prunus, with
cherry trees being highly resistant (27) and Japanese plum being highly susceptible (19). Field
evaluations (6) and experimental inoculations (16,26,28) also repeatedly indicated a
differential sensitivity to infection between cultivars and between rootstocks. Although these
factors have been tested individually, the relative contribution of several potential risk factors
of ESFY (including agricultural practices) has never been investigated; however, such data
would help prioritize the targets of control methods. Clarifying these contributions with an
experimental approach would require an immense number of trees and a lot of time because
the annual incidence in apricot is quite low. Thus, we preferred the alternative of analyzing
survey data generated by a prophylactic program undertaken in France. This program intends
to reduce the number of secondary transmissions and the regional pool of inoculum, on the
basis of experience with Plum pox virus, another vector-borne disease of Prunus with a high
economic impact.
In the Crau plain (France), a partnership was initiated to collect epidemiologically
relevant data, in addition to the data that were necessary for disease management. Several
potential risk factors were recorded to explain the dependent variable, which was defined as
the number of diseased trees among a known number of exposed trees in each orchard. In
order to analyze such binomial data, a generalized linear model (GLM) with a logit link
function (i.e., logistic regression) is generally preferred to the more classical linear models
because it appropriately takes into account the binomial nature of the dependent variable
(8,18,25,35). However, since few studies have analyzed survey data with GLMs
(1,13,36,38,43), we present in this paper a logistic regression model for identifying and
quantifying risk factors of ESFY, through the analysis of a regional survey.
- 28 -

MATERIALS AND METHODS
Data Record and Selection. The survey extended inside a square of approximately 25km
side in the Crau plain, an area of apricot production in southeastern France. Most of the
data were collected in 2003 by well-trained technical staff and the database was updated in
2004. In each orchard, 9 variables were recorded. The dependent variable was a count data:
the cumulative number of diseased trees from the date of orchard planting to March 1994 (the
term “incidence” will be used instead of “cumulative number of diseased trees” in the rest of
the paper). Except for a few trees that were excluded from the analysis, ESFY was the only
cause of tree death. The growers frequently removed the trees with typical symptoms and new
trees were often replanted, but only the initial trees were considered in the analysis. Thus, the
incidence was estimated on the basis of the number of trees that were dead or removed, or
with the characteristic winter symptom of early leafing. Some of the potential risk factors that
we recorded were directly related to the biological characteristics of the system (species and
cultivar of the scion, rootstock, surface, planting density, and age of the orchard). We also
recorded human factors such as the grower and the nurseries that provided the planting
material (the abbreviated names of the variables are indicated in Table 1). The mean temporal
evolution of ESFY in the study area was assessed in 517 apricot orchards. For more reliability
in the estimated effects, we removed the plots with missing data and those with uncommon
cultivars or rootstocks. The mean of the quantitative variables and the levels of the categorical
variables in the final data subset (225 orchards and about 69,000 trees from 17 farms) are
summarized in Table 1. The mean ESFY incidence in these orchards was 6.3%.
Method Overview. Our general approach to the statistical analysis of this survey
consisted of five successive steps: (i) a multivariate analysis to remove overly correlated
variables from the model; (ii) the most parsimonious overdispersed logistic regression model
was built by a stepwise selection of the variables; (iii) the adequacy of this final model was
then checked by an analysis of the residuals and by assessing its predictive power for an
external data set; (iv) we subsequently evaluated the relative influence of the different
variables on disease incidence, and then (v) a test was performed on the residuals to track the
remaining spatial covariates. Unless otherwise stated, all the analyses were performed with
the R statistical software (41), version 2.0.1.
Selection of the Variables. In order to avoid overloading the model with redundant
explanatory variables, a preliminary multivariate exploration of the data was undertaken. We
first performed a normalized principal components analysis (23) on the quantitative variables
(Y, AREA, AGE, DENS), and a multiple correspondence analysis (2) on the categorical
variables (CLV, RST, OCLV, ORST). Then, a Hill and Smith analysis (22) was performed to
mix these two analyses and thus to simultaneously analyze the relationships between all
variables. The ADE-4 software (46) was used for the computation and generation of factorial
maps.
Logistic Regression Model. To estimate simultaneously the influence of potential factors
on ESFY incidence, we built a logistic regression model (35). This GLM was dedicated to the
analysis of proportions arising from binomial data: in each orchard, the numbers of exposed
(ni) and affected trees (Yi) were known. The number of affected trees in the i th orchard was
initially assumed to have a binomial distribution with probability pi for each tree to show
symptoms, while a given combination of k explanatory factors defined this probability pi.
Thus, the model could be written Yi|pi ~ B (ni,pi), where pi was defined by ln(pi/(1-pi)) = a0 +
a1,i (Fact1) + a2,i (Fact2) + … + ak,i (Factk). The best-fitting model was obtained by a manual
stepwise procedure for selecting significant variables and biologically meaningful second-
- 29 -

order interactions. The R function glm was used for model fitting by iteratively reweighted
least squares.
Modeling Overdispersion. In the model described above, the observed number of
diseased trees (Yi) should have a binomial variance: Var(Yi) = ni pi (1-pi). However, in
observational studies, the presence of overdispersion (extrabinomial variation, here) is very
common (18,35), and it was also encountered in this study. Following Collett (8), we
accounted for the extrabinomial variance with Williams’ iterative algorithm (48) because the
number of trees was not identical in all the orchards. Overdispersed models were fitted with
the dispmod R package.
Model Assessment. The standard goodness-of-fit criterion for GLMs (the ratio between
the residual deviance and the residual degrees of freedom) is meaningless for overdispersed
models (8). Hence, several other procedures were carried out in order to check the model.
First, we examined the standardized deviance residuals in order to look for outlying values or
for correlation with the linear predictors or with the variables (included or not in the final
model). Then, after weighting each point by the corresponding number of trees in the orchard,
we compared the linear regression between observed and predicted values with their expected
linear relationship. We also performed both an external validation and a robustness analysis
by assessing the ability of the final model to provide an accurate estimate of incidence in an
independent data set composed of the 57 orchards excluded from the initial data because their
rootstocks were unknown or under-represented. To obtain predictions in these new orchards,
the parameters associated with the rootstock were replaced by the weighted mean of rootstock
effects obtained after fitting the final model.
A characteristic of the data set was the low number of expected diseased trees in many
orchards. Thus, for this discrete variable, the validity of confidence intervals based on
asymptotic theorems could be questioned. Consequently, we used a parametric bootstrap
approach (17) to derive confidence intervals (i) for the predicted number of diseased trees in
each orchard, and (ii) for the estimated value of the ak parameters. This bootstrap procedure
was performed as follows: first, the fitted overdispersed binomial model provided estimates of
disease incidence in each orchard (pi) and of an overdispersion parameter φ. These parameters
were used (as shown in the Appendix) to draw for each orchard 1,000 independent
realizations from a beta-binomial distribution, corresponding to a binomial law with extrabinomial
variance (8,10,24). For the predicted number of diseased trees in each orchard, 95%
confidence intervals could then be derived from the quantiles 2.5% and 97.5% of the
simulated distributions. After refitting the model (with Williams’ procedure) on the 1,000
simulated data sets, the subsequent 1,000 re-estimated values of each ak parameter were used
similarly to define a 95% confidence interval around their mean value.
Influence of the Risk Factors. The relative significance of the different factors was
evaluated through deviance analysis. We initially assessed the significance of each variable
alone. Afterwards, to evaluate the influence of each variable adjusted for the other variables,
we used the final weights of the best overdispersed model to fit reduced models in which each
factor and its interactions with other factors were removed in turn. A chi-square test was then
used to compare the full model with each reduced model. The influence of the variables was
visualized by predicting the temporal evolution of the disease for different levels of the
variables (default parameters to their mode or mean: CLV = Orangered, RST = Peach, DENS
= 384 trees/ha).
Spatial Analysis of the Residuals. The coordinates of the orchards’ centroids were
obtained from aerial orthophotographs (BD ORTHO, Institut Géographique National,
France). The residuals could then be plotted at the location of the corresponding orchard for a
- 30 -

visual inspection of their spatial pattern. The spatial dependence of the residuals was further
investigated with a nonparametric test relying on the empirical semivariogram (34). This
function γ is based on the squared difference between the values of the residuals separated by
a distance h±ε (i.e., residuals with coordinates s within the distance class h):
1
2
γ(h) = ∑ ( r ( s+
h)
- r(
s)
) , where N(h) is the number of pairs of residuals r in the distance
2N
( h)
N ( h)
class h. We chose 32 meter-wide distance classes (ε=16) in order to have at least 50 pairs of
points in each class. Under the hypothesis of spatial independence, the values of the residuals
should be distributed at random among the locations of the orchards’ centroids. Therefore,
this hypothesis of independence was challenged by a random labeling test (14,39): the
function γ(h) computed on the observed residuals was compared to 1,000 random reallocations
of the values of these residuals. After ordering the 1,000 simulated values, a bilateral P-value
was computed, following Manly (33), as twice the proportion of simulated values more
extreme or equal to the observed value of γ(h). A 95% confidence envelope was also derived
from the 25 th and 975 th values of γ(h). The hypothesis of spatial independence between
residuals should be rejected at the 5% significance level when the observed variogram is
outside this envelope. However, when the model is misspecified in some way (e.g., biased
estimate or different variance for some levels, or significant variable not included), the
grower’s trend to plant similar orchards side by side could also produce spatial correlation
between residuals under the null hypothesis of independence; as a precaution, the random
labeling procedure was therefore adapted to perform the permutations inside groups with
homogeneous characteristics (see ref (33), pp. 182-199, for more details). Splitting the initial
data set on the basis of the grower, cultivar and age of the orchards defined 76 highly
homogeneous groups that were used for conditioning the simulations.
RESULTS
Influence of the Species. The subset that was specially selected to analyze the species
effect included 15 Japanese plum orchards and 10 apricot orchards with the same
characteristics: all six to eight years old, on myrobalan rootstocks. The age of the orchards
had no significant influence on disease incidence (not shown), thus the resulting model for pi
was simply: ln(pi/(1-pi)) = a1,Species. The estimated disease incidence (23.1% for the Japanese
plum and 5.96% for the apricot plots) and the corresponding confidence intervals shown in
Table 2 indicated that 6 to 8 years after planting, Japanese plum orchards were considerably
more affected by ESFY than apricot orchards. An analysis of deviance showed that, even after
allowing for overdispersion (φ = 0.019), this fourfold effect of the species was highly
significant (P = 1.7×10 -14 , chi-square test on 1 df). Therefore, in the rest of the study, the few
orchards planted with Japanese plum trees were excluded, so that our model only analyzed the
incidence of ESFY in apricot orchards.
Multivariate Analysis. When initially included in the preliminary multivariate analysis,
GRW completely defined the first factorial plane and thus masked any correlation between
the variables. Thus, it was treated as a supplementary variable in this analysis (Fig. 1), which
showed that the data set was quite structured, because many categorical variables were
interrelated. The projections of the orchards on the first factorial plane (Fig. 1A) could be
subdivided into distinct groups (denoted I to V) sharing some specific combinations of the
variables, as indicated by Fig. 1K and by a visual comparison between maps in Fig. 1A-J. The
most significant multicorrelation involved sparse and older orchards with cultivar 1 (Early
Blush), origin 6, and rootstock 2 (Montclar) and 5 (GF 305) in group I, or dense and young
orchards with cultivar 2 (Goldrich), rootstock 4 (peach) and origins 3 and 9 in group II. The
only dependence between quantitative variables was the slight anticorrelation of AGE and
- 31 -

DENS (r = -0.29). As expected, OCLV and ORST were almost completely correlated (Fig.
1E-F and 1K). Additionally, these variables were strongly unbalanced and included 71
missing values; hence they had to be removed. The supplementary variable GRW was clearly
structured by the other variables (Fig. 1B), and thus strongly correlated to them. As we were
more interested in these underlying correlates, the descriptive variable GRW was not included
in the model until the ultimate step of the analysis. Finally, Fig. 1K showed that no
explicative factor or variable was obviously correlated to the dependent variable Y, further
highlighting the need for an explicative model.
GLM. An initial GLM was built with the 5 remaining variables and their biologically
meaningful interactions. AREA was then dropped because it was not significant (P = 0.24,
chi-square test on 1 df). The deviance of the resulting model was much higher than twice the
number of degrees of freedom, a value that is used as a rule of thumb for the detection of
overdispersion (31). As the analysis of the residuals indicated no obvious problem with the
model, intra-orchard dependence was the most probable cause of overdispersion. Thus the
model was corrected to allow extrabinomial variation (φ = 0.042) so as not to overestimate the
significance of the effects. As the remaining 4 variables and 4 interactions were significant
(all P-values < 4.3×10 -3 ), the final model for pi was thus: ln(pi/(1-pi)) = a0 + a1,i (CLV) + a2,i
(RST) + a3×AGEi + a4×DENSi + a5,i (CLV:AGE)×AGEi + a6,i (RST:AGE)×AGEi + a7,i
(RST:DENS)×DENSi + a8×AGEi×DENSi.
This model was then checked. One point appeared to be overly influential on the basis of
Cook’s distance (9). As the analyses provided consistent results with or without this point, it
was not discarded from the data set. The asymptotic results and parametric bootstrap
distributions consistently identified only one slightly outlying value that was conserved
because the associated information was accurate. A quantile-quantile plot indicated that the
normal distribution roughly approximated the distribution of the standardized deviance
residuals (Fig. 2A). There was no indication of inadequacy in the linear predictors because
they were not correlated to the residuals. When plotted against the included variables, the
residuals showed no particular trend other than a slight overestimation of ESFY incidence in
young (2 to 4 year-old) orchards. The residuals were also randomly distributed with respect to
the excluded variable AREA. On the contrary, the residuals significantly differed with respect
to the grower (Fig. 2C) and origin of the planting material (Fig. 2D): the observed mean of the
residuals was frequently outside the range expected under the null hypothesis of
independence. This fact indicates that the human factors not only summarized the other
variables, but also had an additional significant effect that remained even after including some
of the underlying factors in the model.
The weighted linear regression between observed and predicted incidence (Fig. 2B) had
the equation: Observed = 0.946×Predicted + 0.003 (R 2 = 0.49, and standard error (SE) of 0.065
and 0.006, respectively). On the logit scale, a R 2 of 0.42 confirmed that the fit of the model
was acceptable for an observational study: this model captured half of the variability of the
data with a relatively small number of parameters (21 of the initial 224 df were used). The
same procedure carried out on the external data set resulted in a higher R 2 of 0.63, but the
model tended to overestimate the incidence, as shown by the equation of the regression line:
Observed = 0.870×Predicted - 0.016 (SE = 0.088 and 0.009, respectively). Thus, despite the
lack of information on the rootstock in the validation data set, the model still provided an
acceptable prediction of ESFY incidence.
The extent of the confidence intervals for some parameters of the model (Table 3)
confirmed that the 4 variables and 4 interactions included in the model only explained part of
the variability of the observed incidence. For these parameters, the discrepancy between
bootstrap and the asymptotic confidence intervals was sometimes quite high (e.g., for the
rootstocks), indicating that the assumptions of the asymptotic results were not fulfilled. Thus,
in the rest of the study, we used the more reliable and more conservative bootstrap intervals.
- 32 -

Influence of the Risk Factors. The mean temporal evolution of ESFY incidence in the
study area (Fig. 3A) was summarized by the equation: Y=1/(1+e -0.198t+4.69 ). However, this
binomial overdispersed model was not satisfactory (R 2 = 0.1), thus indicating a major role for
the other variables. The analysis of deviance for the one-variable models (Table 4) showed
that the grower was the best single explanatory factor, much better than the cultivar or the
other variables. However, because of the observed multicorrelation, it was statistically more
accurate to assess the role of each variable after adjusting for the effect of the others. The
corresponding deviance analysis (Table 5) showed that tree age was the most significant
variable, followed by both density and cultivar, and then the rootstock, with the area of the
orchard having no influence on disease incidence. These results were robust to some
alterations of the model, because congruent conclusions (except that CLV became much more
significant than DENS) were drawn when the same procedure was performed after fitting a
simpler model without the interaction terms (not shown). The interaction between the density
and the age of the orchard was more significant than any other interaction. No conclusion
could be drawn from the model concerning the effect of different levels of the factors,
because the interactions were significant. The predictions for specific values were generally
inconclusive as well, because of the wide confidence intervals. However, the analysis of the
model without interaction terms indicated that the incidence was significantly higher on GF
305 rootstock and on the cv. Orangered. This was further confirmed by the predicted ESFY
progress in cv. Orangered and cv. Hargrand with the complete model (Fig. 3B).
Spatial Analysis of the Residuals. A simple map of the standardized deviance residuals
clearly pointed out the spatial correlation between residuals. However, this correlation could
have been at least partly explained by the spatial factor GRW (Fig. 2C), which had been
discarded from the model. Thus, the mean of each level of this factor was deducted from the
corresponding residuals. Then, the grower-adjusted residuals were used to compute an
empirical variogram and its confidence envelopes obtained by random labeling within
homogeneous subgroups (Fig. 4). The first values of γ(h) (up to a distance of 100 m) were
below or near the 95% confidence envelope (P-values ranging from

factor on disease incidence, with cv. Orangered more heavily infected than the other cultivars.
This could be the result of a high attraction to the vector, or the consequence of a high level of
susceptibility or sensitivity to the pathogen. Thus, to reduce the cost of ESFY, the growers
should take into account the relative disease risk of the planted scion. The planting density
stood at a surprising third rank, which points out original speculative explanations: denser
orchards could be more attractive, could influence the mobility of the vector, or could speed
up symptom expression in plants that are under more severe stress. The rootstock played an
unexpected minor role in the system, which was confirmed by the relatively good prediction
obtained even when it is unknown or different from the subset used to build the model. This
apparent discrepancy with previous observations indicating a major role of the rootstock in
the evolution of the disease (37,28) may be caused by the excessive homogeneity of the
rootstocks in the zone under study (80% of the rootstocks being peach cultivars). However, a
competing explanatory hypothesis is that a faster visual detection of diseased trees (enabled
by acute symptoms) has a decreasing influence on the cumulative incidence as the orchards
grow old. This could also explain the significant interaction between the age of the orchard
and the rootstock.
Human factors. Both human variables had a significant influence on ESFY incidence,
but the growers had much more influence than the nurseries (Table 4 and Fig. 2C-2D). The
grower was the best informative one-variable model (Table 4). On the one hand, a large part
of this high influence was the result of the correlation between the grower and many other
variables (Fig. 1), with the grower being a good summary of several variables. On the other
hand, the analysis of the residuals unequivocally demonstrated the existence of a grower
effect not explained by the other variables (Fig. 2C). This result indicates that at least one
grower-specific risk factor, though significant, was not included in the model. In practice, a
more in-depth analysis of the differences in the agricultural practices of the growers with
extremely low and extremely high incidence could point to the interesting factors. The level
of prophylaxis, the insecticide protection, and the location of P. spinosa hedges are among the
additional factors that could be investigated. Concerning the apparent nursery effect, we
cannot completely rule out the possibility that some nurseries have differential levels of
exposure to infectious vectors. However, it is more probably a case of confounding resulting
from the strong correlation between growers and nurseries (Fig. 1B and 1E). The use of
grower-adjusted residuals considerably reduces the variability between nurseries shown in
Fig. 2D, whereas the symmetrical nursery-adjusted residuals only slightly attenuate the
grower effect revealed in Fig. 2C (not shown).
Spatial factors. The spatial dependence was significant up to 100 m, and cannot be
explained by an underlying grower effect because we used grower-adjusted residuals. Neither
could it be the biologically uninteresting result of a spatial proximity between orchards with
similar characteristics because we simulated the null hypothesis conditional on such
similarity. Several hypotheses can be proposed to account for the remaining spatial
dependence. It might be indirectly caused by underlying physical spatial factors that have not
been recorded, such as the impact of soil characteristics on symptom expression. The spatial
dependence can also originate from some properties of the vectorial transmission of ESFY.
The most obvious explanation comes from the presence in the data of cultivar mixtures within
some plots (with very close centroids), where the vector could transmit the phytoplasma
equivalently to one cultivar or the other. However, as this is not sufficient to give rise to the
observed range of dependence, other hypotheses are required, but they are more speculative.
The population density of C. pruni could be higher in some places, thereby forming small
patches with a range of action limited to the adjacent orchards. The other processes that can
play a role are either multiple primary or secondary transmissions occurring across orchards,
mainly in a radius of approximately 100 m. For testing hypotheses related to these processes
of disease spread, it would probably be interesting to analyze in detail the individual trees and
the spatiotemporal pattern of diseased trees (45).
- 34 -

Model Application
This kind of model-based analysis of a case study can raise questions related to its
generality. The results showed that our model was more efficient for identifying and ranking
the risk factors of ESFY than for predicting the evolution of this disease, because of the
significant unexplained variability. However, the model is suitable for an approximate
evaluation of disease evolution in the Crau plain as far as it is not used to extrapolate to other
levels of the factors (except for other rootstocks). This allows the participating growers to
integrate the cost of disease control in the evaluation of the profitability of their orchards. Of
course, outside the Crau plain, it would be inappropriate to make predictions with this model.
The results on the risk factors clearly show that even if the conclusions concerning particular
levels of these factors may only be of local interest, the respective influence of the different
factors are expected to be quite general. To this regard, the demonstration of a substantial
effect of the grower should be highlighted because it indicates that, in addition to the choice
of the cultivar, some agricultural practices can reduce or increase the incidence of ESFY.
Validity of the GLM
The data, by some of their features (dependence and small binomial coefficients), did not
strictly correspond to the assumptions of the logistic regression model. As these problems
frequently arise in the analysis of surveys with GLMs, we discuss how they have been
detected and handled.
Dependence in the data. The spatial correlation between residuals can be seen as an
unwelcome characteristic that does not meet the assumption of independence between
observations, which underlie most of the common statistical models. It can also be seen as a
biologically meaningful feature that may motivate further investigation. Whatever the
purpose, simple and versatile nonparametric tests based on random labeling can be included
in the final steps of the analysis of the data to track spatial dependence in the residuals
(33,40). For this purpose, a multiscale exploration of spatial dependence (e.g., using a
variogram) or local indices could be a more powerful approach than global indices (such as
Moran’s I or Geary’s C) to detect residual spatial correlation at short-distance in a large-scale
study. In this study, we detected a significant spatial correlation up to 100 m. Taking this
residual spatial correlation into account in the analysis is an interesting prospect for this study.
However, building a statistically irreproachable model to this aim would require developing
cutting-edge spatial statistics methods that extend far beyond the scope of this article.
Moreover, the hierarchy of the factors is expected to be quite robust to the incorporation of
spatial effects in the model, and the observed P-values (Table 5) are so low that all the
corresponding effects would still be significant after an improbable 10-fold correction. It
should also be noticed that the spatial correlation between residuals does not always challenge
the assumption of independence between the observations because it can be the consequence
of land management (e.g., grouping identical plots in clusters can also produce spatial
correlation if the model is slightly misspecified). In addition to the inter-orchards dependence,
the assumption of independence can be challenged within the orchards, leading to
extrabinomial variation. This phenomenon can be suspected when the fit of a binomial model
is unsatisfactory though nothing in the residuals indicates an incorrect specification of the
model (35). In this study, both sources of dependence were identified (i.e., intra- and interorchards).
A previous analysis of the spatial pattern of diseased trees within an orchard also
indicated dependence between transmission events (44). These results can be partly explained
by short-distance secondary transmissions. Moreover, as the phytoplasma is persistently
transmitted by C. pruni (5), multiple transmissions can also account for the observed
dependence within (and to a lesser extent, between) orchards. Finally, it should be mentioned
that the data experience a slight dependent censoring, as some orchards have been removed in
the past when the growers considered that they were too heavily infected. Thus the apparent
temporal evolution underestimates the real temporal evolution of the disease.
- 35 -

Parametric bootstrap. When some predicted values (pi) are close to zero or when the
number of individuals in some orchards (ni) is very low, the assumptions for the asymptotic
results are not met. This situation can arise quite frequently in epidemiological surveys. In
such circumstances, parametric bootstrap procedures could be used more frequently when
satisfactory resampling models are available. Here, we expressed the parameters of the betabinomial
distribution as a function of φ and pi (the overdispersion parameter and estimated
proportions, respectively). To our knowledge, it is a new result that allows computing
parametric bootstrap confidence intervals for overdispersed logistic models. In practice,
bootstrap and asymptotic methods gave consistent results in the identification of outliers, and
similar confidence intervals for the species effect (Table 2) as well as for half of the
parameters of the final model (Table 3). For the other parameters, the bootstrap intervals were
wider, hence more conservative.
Concluding Remarks
Performing a large-scale disease assessment, for a control program for example
(11,12,20), can provide reliable information for epidemiological studies. In such situations, a
close collaboration with plant protection services from the initial steps is a prerequisite to
ensure an optimal exploitation of the collected data. Otherwise, some data which are
inexpensively and easily obtained and which are important for epidemiological exploitation
could be omitted because of lack of interest in the control strategy. The analysis of such a
survey with a logistic regression model enabled the identification and ranking of general risk
factors for ESFY incidence. In summary, in addition to the obvious cumulative effect of the
age, the main determinant was the choice of the scion (the species being of major importance,
followed by the cultivar). This result highlights the need for a rigorous experimental or field
evaluation of the sensitivity of different cultivars to ESFY, as a basis for future genetic
improvement. The planting density and the rootstock appeared to play a secondary role, and at
least one unidentified human factor had a significant impact. More detailed investigations of
the grower-specific agricultural practices would possibly identify other risk factors, and the
analysis of the spatiotemporal point pattern formed by the diseased trees would probably
provide insight into the transmission behavior of C. pruni.
APPENDIX
Here we show how the parameters of a beta-binomial model can be derived from an
overdispersed binomial model fitted by the Williams procedure (48) providing estimates of
both pi and the overdispersion parameter φ.
Let Yi be a binomial random variable: Yi ~ B(ni,pi). The variance of Yi is: Var(Yi) = ni pi
(1-pi). As explained in pp.192-195 of Collett (8), the variance of an overdispersed binomial
variable Yi can be written: Var(Yi) = ni pi (1-pi) (1+(ni-1)φ). This is in particular the variance
of a beta-binomial random variable Yi in which Yi|Pi ~ B(ni,pi), Pi having a Beta distribution
with E(Pi) = pi and Var(Pi) = φ pi (1-pi). As the mean and variance of a random variable Pi
with a Beta distribution (with shape parameters αi and βi) are E(Pi) = αi/(αi+βi) = pi, and
Var(Pi) = pi (1-pi)/(αi+βi+1), we obtain by identification and resolution of the subsequent twoparameter
equation:
⎛ 1 ⎞
⎛ 1 ⎞
αi = pi⎜
−1⎟
and βi = (1-pi) ⎜ −1⎟
.
⎝φ
⎠
⎝φ
⎠
Thus, the parameters pi and φ estimated by Williams’ algorithm define the parameters αi
and βi of the beta-binomial distribution. These parameters can then be used in a parametric
bootstrap procedure to derive confidence intervals for the predicted incidence in the orchards
(pi) and for the parameters (ak) of the logistic regression model.
- 36 -

ACKNOWLEDGEMENTS
We are much indebted to the growers of Crau, to I. Ricavy and Y. Fradin (experimental
station La Pugère), and to the Chambre d’Agriculture des Bouches-du-Rhône for data
collection, and for creating and actualizing the database. We wish to thank E. Klein and C.
Bruchou for helpful discussions, J.-N. Bacro and S. Dallot for critically reviewing the
manuscript and M. Hilf for improving the English. This study was partly funded by the
Conseil Régional de PACA.
LITERATURE CITED
1. Aegerter, B. J., Nuñez, J. J., and Davis, R. M. 2003. Environmental factors affecting rose
downy mildew and development of a forecasting model for a nursery production system.
Plant. Dis. 87:732-738.
2. Burt, C. 1950. The factorial analysis of qualitative data. Br. J. Stat. Psychol. 3:166-185.
3. Carraro, L., Ferrini, F., Ermacora, P., and Loi, N. 2002. Role of wild Prunus species in the
epidemiology of European stone fruit yellows. Plant Pathol. 51:513-517.
4. Carraro, L., Ferrini, F., Ermacora, P., and Loi, N. 2004. Transmission of European stone
fruit yellows phytoplasma to Prunus species by using vector and graft transmission. Acta
Hortic. 657:449-453.
5. Carraro, L., Loi, N., and Ermacora, P. 2001. Transmission characteristics of the European
stone fruit yellows phytoplasma and its vector Cacopsylla pruni. Eur. J. Plant Pathol.
107:695-700.
6. Carraro, L., Osler, R., Refatti, E., and Favali, M. A. 1992. Natural diffusion and
experimental transmission of plum leptonecrosis. Acta Hortic. 309:285-290.
7. Chabrolin, C. 1924. Quelques maladies des arbres fruitiers de la vallée du Rhône. Annales
des Epiphyties 10:263-338.
8. Collett, D. 1991. Modelling Binary Data. 1st ed. Chapman and Hall, London.
9. Cook, R. D., and Weisberg, S. 1982. Residuals and Influence in Regression. Chapman and
Hall, London.
10. Crowder, M. J. 1978. Beta-binomial anova for proportions. Appl. Stat. 27:34-37.
11. Dallot, S., Gottwald, T., Labonne, G., and Quiot, J.-B. 2003. Spatial pattern analysis of
Sharka disease (Plum pox virus strain M) in peach orchards of southern France.
Phytopathology 93: 1543-1552.
12. Dallot, S., Gottwald, T., Labonne, G., and Quiot, J.-B. 2004. Factors affecting the spread
of Plum pox virus strain M in peach orchards subjected to roguing in France.
Phytopathology 94:1390-1398.
13. De Wolf, E. D., Madden, L. V., and Lipps, P. E. 2003. Risk assessment models for wheat
Fusarium head blight epidemics based on within-season weather data. Phytopathology
93:428-435.
14. Diggle, P. J. 1983. Statistical Analysis of Spatial Point Patterns. Mathematics in Biology.
Academic Press, London.
15. Duval, H. 1999. Prunes japonaises : un défi à relever. L'Arboriculture Fruitière 524:35-41.
16. Duval, H., Jullian, J.-P., and Lemaire, J.-M. 1999. Enroulement chlorotique de
l'abricotier : évaluation de la sensibilité des principales variétés de prunier japonais... et du
nouveau sur le vecteur. Phytoma 516:38-40.
17. Efron, B., and Tibshirani, R. J. 1993. An Introduction to the Bootstrap. Chapman and
Hall, New York.
18. Garrett, K. A., Madden, L. V., Hughes, G., and Pfender, W. F. 2004. New applications of
statistical tools in plant pathology. Phytopathology 94:999-1003.
19. Goidanich, G. 1933. Un deperimento dei susini. Boll. Reg. Staz. Patol. Veg. Roma
13:160-173.
20. Gottwald, T. R., Sun, X., Riley, T., Graham, J. H., Ferrandino, F., and Taylor, E. L. 2002.
Geo-referenced spatiotemporal analysis of the urban citrus canker epidemic in Florida.
- 37 -

Phytopathology 92:361-377.
21. Hamel, C., Vujanovic, V., Nakano-Hylander, A., Jeannotte, R., and St-Arnaud, M. 2005.
Factors associated with fusarium crown and root rot of asparagus outbreaks in Quebec.
Phytopathology 95:867-873.
22. Hill, M. O., and Smith, A. J. E. 1976. Principal component analysis of taxonomic data
with multi-state discrete characters. Taxon 25:249-255.
23. Hotelling, H. 1933. Analysis of a complex of statistical variables into principal
components. J. Educ. Psychol. 24:417-441.
24. Hughes, G., and Madden, L. V. 1993. Using the beta-binomial distribution to describe
aggregated patterns of disease incidence. Phytopathology 83:759-763.
25. Hughes, G., and Madden, L. V. 1995. Some methods allowing for aggregated patterns of
disease incidence in the analysis of data from designed experiments. Plant Pathol. 44:927-
943.
26. Jarausch, W., Eyquard, J. P., Lansac, M., Mohns, M., and Dosba, F. 2000. Susceptibility
and tolerance of new French Prunus domestica cultivars to European stone fruit yellows
phytoplasmas. J. Phytopathol. 148:489-493.
27. Jarausch, W., Eyquard, J. P., Mazy, K., Lansac, M., and Dosba, F. 1999. High level of
resistance of sweet cherry (Prunus avium L.) towards European stone fruit yellows
phytoplasmas. Adv. Hortic. Sci. 13:108-112.
28. Kison, H., and Seemuller, E. 2001. Differences in strain virulence of the European stone
fruit yellows phytoplasma and susceptibility of stone fruit trees on various rootstocks to
this pathogen. J. Phytopathol. 149:533-541.
29. Labonne, G., and Lichou, J. 2004. Data on the life cycle of Cacopsylla pruni, Psyllidae
vector of European stone fruit yellows (ESFY) phytoplasma, in France. Acta Hortic.
657:465-470.
30. Lemaire, J.-M., Jullian, J.-P., Audergon, J.-M., and Castelain, C. 1998. Enroulement
chlorotique de l'abricotier : symptomatologie et gamme d'hôtes. L'Arboriculture Fruitière
520:21-24.
31. Lindsey, J. K. 1999. On the use of corrections for overdispersion. Appl. Stat. 48:553-561.
32. Lorenz, K.-H., Dosba, F., Poggi-Pollini, C., Llácer, G., and Seemüller, E. 1994.
Phytoplasma diseases of Prunus species in Europe are caused by genetically similar
organisms. Z. Pflanzenk. Pflanzen. 101:567-575.
33. Manly, B. F. J. 1991. Randomization and Monte Carlo Methods in Biology. Chapman and
Hall, London, UK.
34. Matheron, G. 1965. Les Variables Régionalisées et leur Estimation. Masson, Paris.
35. McCullagh, P., and Nelder, J. 1989. Generalized Linear Model. Chapman and Hall,
London.
36. Mila, A. L., Carriquiry, A. L., and Yang, X. B. 2004. Logistic regression modeling of
prevalence of soybean Sclerotinia stem rot in the north-central region of the United States.
Phytopathology 94:102-110.
37. Morvan, G. 1977. Apricot chlorotic leaf roll. EPPO Bull. 7:37-55.
38. Nicot, P. C., and Rouse, D. I. 1987. Relationship between soil inoculum density of
Verticillium dahliae and systemic colonization of potato stems in commercial fields over
time. Phytopathology 77.
39. Ribeiro, P. J. J., Christensen, O. F., and Diggle, P. J. 2003. geoR and geoRglm: software
for model-based geostatistics. 3 rd International Workshop on Distributed Statistical
Computing, March 20–22, Vienna, Austria.
40. Rosso, P. H., and Hansen, E. M. 2003. Predicting Swiss needle cast disease distribution
and severity in young Douglas-fir plantations in coastal Oregon. Phytopathology 93:790-
798.
41. R Development Core Team. 2004. R: A Language and Environment for Statistical
Computing. R Foundation for Statistical Computing, Vienna, Austria.
- 38 -

42. Seemüller, E., and Schneider, B. 2004. ‘Candidatus Phytoplasma mali’, ‘Candidatus
Phytoplasma pyri’ and ‘Candidatus phytoplasma prunorum’, the causal agents of apple
proliferation, pear decline and European stone fruit yellows, respectively. Int. J. Syst.
Bacteriol. 54:1217-1226.
43. Shtienberg, D. 1996. Variables associated with intensity of Alternaria leaf spot in Pima
cotton. Phytopathology 86:123-128.
44. Thébaud, G., Labonne, G., Castelain, C., and Chadœuf, J. 2004. Spatio-temporal analysis
of disease spread provides insights into the epidemiology of European stone fruit yellows.
Acta Hortic. 657:471-476.
45. Thébaud, G., Peyrard, N., Dallot, S., Calonnec, A., and Labonne, G. 2005. Investigating
disease spread between two assessment dates with permutation tests on a lattice.
Phytopathology. In Press.
46. Thioulouse, J., Chessel, D., Dolédec, S., and Olivier, J. M. 1997. ADE-4: a multivariate
analysis and graphical display software. Stat. Comput. 7:75-83.
47. Welham, S. J., Turner, J. A., Gladders, P., Fitt, B. D. L., Evans, N., and Baierl, A. 2004.
Predicting light leaf spot (Pyrenopeziza brassicae) risk on winter oilseed rape (Brassica
napus) in England and Wales, using survey, weather and crop information. Plant Pathol.
53:713-724.
48. Williams, D. A. 1982. Extra-binomial variation in logistic linear models. Appl. Stat.
31:144-148.
TABLE 1. Summary of the variables used in the preliminary multivariate analysis.
Name of the variable
Levels (frequency) or
Abbreviated Full Mode
Mean (range)
Y Cumulative number of Dependent, 19.4 (0-144) trees
diseased plants quantitative
GRW Grower Categorical 17 levels (2-55 orchards/grower)
CLV Cultivar Categorical Goldrich (27), Early Blush (33),
Hargrand (66), Orangered (99)
RST Rootstock Categorical Manicot - GF 1236 (11), Montclar (28),
myrobalan (36), GF 305 (61), peach (89)
OCLV Origin of the cultivar Categorical 8 levels (1-119 orchards/origin) + 71 NA a
ORST Origin of the rootstock Categorical 9 levels (1-118 orchards/origin) + 71 NA
AGE Age Quantitative 8.3 (2-15) years
AREA Area Quantitative 0.73 (0.08-2.5) ha
DENS
a
Not available
Planting density Quantitative 410 (238-571) trees/ha
TABLE 2. Estimated mean and confidence intervals for the effect of the species on ESFY
incidence (one-variable overdispersed GLM).
Logit scale Response scale a
Species Estimate ± SE Estimate
- 39 -
Bootstrap b
confidence interval
Asymptotic c
confidence interval
P. armeniaca -2.76 ± 0.209 0.060 0.038-0.085 0.039-0.089
P. salicina -1.20 ± 0.097 0.231 0.197-0.265 0.197-0.268
a The estimated disease incidence and the corresponding 95% confidence interval are back-
transformed from the logit scale.
b The parametric bootstrap procedure is described in the text.
c From a t-distribution on 23 df.

TABLE 3. Estimates and confidence intervals for the parameters a of the final overdispersed
GLM.
Parameter Estimate ± SE
- 40 -
Bootstrap b
confidence interval
Asymptotic c
confidence interval
(Intercept) -24.2 ± 6.36 -94.9 -16.8 -36.7 -11.7
CLV Goldrich 1.31 ± 1.37 -1.06 4.34 -1.39 4.00
CLV Hargrand -1.24 ± 1.20 -3.45 1.46 -3.61 1.13
CLV Orangered 0.85 ± 1.17 -1.31 3.50 -1.45 3.15
RST Montclar -0.12 ± 6.66 -10.5 67.7 -13.3 13.0
RST myrobalan 9.87 ± 6.36 2.21 80.2 -2.66 22.4
RST peach 11.5 ± 6.14 4.24 82.5 -0.61 23.6
RST GF305 11.5 ± 6.10 4.48 82.5 -0.57 23.5
AGE 1.54 ± 0.39 0.95 8.30 0.76 2.31
DENS (×10 -2 ) 3.67 ± 1.53 0.46 8.42 0.65 6.69
CLV Goldrich:AGE (×10 -1 ) -1.59 ± 1.57 -5.28 1.12 -4.67 1.50
CLV Hargrand:AGE (×10 -1 ) 1.50 ± 1.21 -1.12 3.76 -0.89 3.89
CLV Orangered:AGE (×10 -1 ) -0.08 ± 1.19 -2.71 2.20 -2.43 2.27
RST Montclar:AGE -0.21 ± 0.34 -7.00 0.32 -0.88 0.46
RST myrobalan:AGE -0.55 ± 0.34 -7.43 -0.07 -1.22 0.12
RST peach:AGE -0.57 ± 0.33 -7.41 -0.09 -1.23 0.09
RST GF305:AGE -0.59 ± 0.33 -7.40 -0.14 -1.24 0.06
RST Montclar:DENS (×10 -2 ) 0.24 ± 1.54 -4.14 3.53 -2.79 3.27
RST myrobalan:DENS (×10 -2 ) -1.36 ± 1.48 -5.79 1.67 -4.28 1.56
RST peach:DENS (×10 -2 ) -1.67 ± 1.47 -6.16 1.45 -4.56 1.23
RST GF305:DENS (×10 -2 ) -1.46 ±1.48 -6.04 1.51 -4.37 1.46
AGE:DENS (×10 -3 ) -2.08 ± 0.53 -3.18 -1.08 -3.12 -1.04
a All the values are on the logit scale.
b The parametric bootstrap procedure is described in the text.
c From a t-distribution on 203 df.
TABLE 4: Analysis of deviance for each one-variable GLM (without overdispersion)
Variable Δdf a Deviance AIC b P-value c
5761 6514
GRW 16 4273 5057 < 10 -40
CLV 3 4970 5728 < 10 -40
OCLV 8 5298 6066 < 10 -40
ORST 9 5338 6108 < 10 -40
AREA 1 5449 6203 < 10 -40
MAT 2 5543 6299 < 10 -40
RST 4 5613 6374 5.8 × 10 -31
AGE 1 5643 6397 1.7 × 10 -27
DENS 1 5756 6510 2.1 × 10 -2
a Difference between the number of degrees of freedom in the null model and the number of
degrees of freedom in each one-variable model.
b The models are sorted by increasing AIC (AIC = -2×log-likelihood + 2×df); a smaller value
of AIC indicates a more parsimonious fit.
c From a chi-square distribution on Δdf degrees of freedom.

TABLE 5: Analysis of deviance for each variable adjusted for the other effects (final model)
in the GLM.
Variable Δdf a Deviance P-value b
203.3
Main effect and its interactions
AGE 9 360.5 2.77 × 10 -29
DENS 6 243.4 4.18 × 10 -7
CLV 6 242.1 7.67 × 10 -7
RST 12 250.5 4.19 × 10 -6
Interaction only
AGE:DENS 1 219.4 5.99 × 10 -5
RST:AGE 4 223.2 5.13 × 10 -4
CLV:AGE 3 218.5 1.64 × 10 -3
RST:DENS 4 218.5 4.27 × 10 -3
a Difference between the number of degrees of freedom in each reduced model and the
number of degrees of freedom in the full overdispersed model.
c From a chi-square distribution on Δdf degrees of freedom.
- 41 -

Fig. 1. Factorial maps from a multivariate Hill & Smith analysis coupling the categorical and
quantitative variables that describe the 225 apricot orchards. A, projections of the orchards on the
first factorial plane (F1×F2, F1 and F2 representing respectively 13.8% and 8.5% of the total
inertia). B-F, categorical variables. For a given variable, each circle represents the mean position
(barycenter) of one modality on F1×F2, in connection with all the associated orchards. The
supplementary variable GRW was not used to define F1×F2 (see in text). G-J, quantitative
variables. For a given variable, each orchard is represented by a gray circle (positive value) or a
white square (negative value) with an area proportional to the absolute value of the normalized
variable. K, projection of the variables defining F1×F2. Thin arrows: categorical variables; thick
arrows: quantitative variables. Correlated variables have collinear vectors; the weight of the
variables in the analysis increases with their distance from the center of the graph.
- 42 -

Fig. 2. Examination of the model fit. A, normal quantile-quantile plot of the residuals. B,
linear regression of observed against predicted incidence (solid line), and expected line
(dashed). C and D, boxplot of the residuals by grower (GRW) and origin of the planting
material (OCLV), respectively. Points: mean of the residuals; brackets: 95% confidence
interval for the expected mean under the null hypothesis of independence between residuals
and GRW or OCLV, respectively.
- 43 -

Fig. 3. Mean temporal evolution of the disease. A, observed disease incidence in relation to
the age of the orchards in the initial data set (517 orchards). B, predicted disease progress
(bold lines) in the data subset including 225 orchards: cv. Orangered and cv. Hargrand, with
the associated 95% bootstrap confidence envelopes (thin lines).
Fig. 4. Bilateral random labeling test (α = 5%) of spatial independence between the
standardized deviance residuals. Solid line: variogram of the observed residuals; dotted line:
mean of the simulated values; dashed lines: 95% confidence envelope. After a correction for
the grower effect, the residuals were randomized conditional on the similarity between the
orchards (see in text).
- 44 -

II. Bilan
Au-delà des effets évidents (impact de l’âge du verger sur l’incidence cumulée depuis la
plantation) et des facteurs attendus compte tenu des acquis bibliographiques (rôle de l’espèce
cultivée, de la variété et – dans une moindre mesure – du porte-greffe), cette étude a permis de
mettre en évidence l’influence importante des pratiques culturales spécifiques à chaque
arboriculteur, ainsi que des effets spatiaux assez marqués (dépendance entre vergers distants
de moins de 100 m). La plupart des hypothèses émises pour expliquer cette dépendance sont
liées aux modalités de la vection de l’ESFY : hétérogénéité locale de la densité des vecteurs,
transmissions primaires multiples ou transmissions secondaires entre vergers. La partie
suivante présente les observations et les expériences complémentaires qui ont été effectuées
afin d’éclaircir les caractéristiques de la vection de ‘Ca. P. prunorum’ par C. pruni.
- 45 -

- 46 -

Partie II : Identifier les
cycles biologiques de
‘Candidatus Phytoplasma
prunorum’ et de son
vecteur Cacopsylla
pruni – du terrain au
laboratoire et vice versa
- 47 -
« Rassemblons des faits pour
nous donner des idées »
(Buffon)

Ce chapitre est le fruit d’un travail réalisé en commun avec Michel Yvon et Gérard
Labonne, dans lequel j’ai participé activement aux phases situées en amont et en aval des
expérimentations : définition des objectifs et des protocoles, analyse des résultats et rédaction
des articles.
I. Introduction
La Figure 13 (p. 23) souligne combien la réalisation du cycle épidémique théorique
présenté dans la Figure 12 (p. 22) dépend de l’adéquation entre le cycle biologique (voire
physiologique) du vecteur, le cycle de végétation de son hôte, la disponibilité du pathogène
dans l’hôte, et la durée de latence dans le vecteur. Ainsi, pour bien comprendre la biologie de
la transmission par le vecteur, il est indispensable de connaître avec certitude la partie de son
cycle biologique se déroulant hors des Prunus, sur laquelle on a de fortes présomptions mais
pas de preuve directe. Par ailleurs, du fait de la fenêtre relativement étroite pendant laquelle
chaque génération du vecteur se nourrit sur les Prunus, la durée effective séparant sur le
terrain l’acquisition du phytoplasme et sa transmission peut dépasser la durée théorique
correspondante (qui est la somme du temps d’acquisition, de latence et de transmission). Il
s’agit d’un point fondamental de l’épidémiologie de l’ESFY car une migration à longue
distance entre l’acquisition et la transmission modifierait radicalement la compréhension et la
modélisation des épidémies d’ESFY, voire leur gestion. La stratégie choisie pour identifier les
caractéristiques de la vection consiste (i) dans un premier temps, à évaluer l’évolution des
taux d’insectes porteurs du phytoplasme sur le terrain (à la fois par des suivis en conditions
naturelles et par l’analyse de résultats comparables disponibles dans la bibliographie), et (ii)
dans un deuxième temps, à approfondir et expliquer les observations de terrain en mesurant
au laboratoire l’évolution de la quantité de phytoplasme dans C. pruni au cours du temps. En
fin de chapitre, on reviendra au terrain en examinant les conséquences des résultats acquis sur
la propagation de l’ESFY. Mais, pour commencer, on doit disposer des méthodes de détection
les mieux adaptées aux objectifs poursuivis.
II. Détection spécifique et quantification de ‘Ca. P. prunorum’
Disposer de méthodes de détection sensibles et spécifiques est un point crucial pour
améliorer le diagnostic et les études épidémiologiques sur les pathogènes émergents, surtout
si, comme le phytoplasme de l’ESFY, ils ne peuvent pas être cultivés. En l’occurrence, la
mise au point d’outils sensibles et spécifiques permettant de détecter et de quantifier ‘Ca. P.
prunorum’ dans son vecteur et dans les plantes constitue un préalable nécessaire aux études
portant sur la biologie de la vection. L’article suivant présente ces différentes techniques et
leur intérêt respectif en fonction des questions auxquelles on souhaite répondre.
A. Article II : “A Toolbox for the Specific Detection and Quantification of the
Phytopathogenic Agent ‘Candidatus Phytoplasma prunorum’ in Plants and
Insects”
Michel Yvon*, Gaël Thébaud*, Rémi Alary et Gérard Labonne
(En préparation)
- 48 -

A toolbox for the specific detection and quantification of the phytopathogenic
agent ‘Candidatus Phytoplasma prunorum’ in plants and insects
Michel Yvon 1* , Gaël Thébaud 1* , Rémi Alary 2 and Gérard Labonne 1
1 Institut National de la Recherche Agronomique (INRA), UMR BGPI, CIRAD TA 41/K,
Campus international de Baillarguet, 34398 Montpellier Cedex 5, France; 2 INRA, UMR PIA,
2 Place Viala, 34060 Montpellier Cedex 1, France.
Abstract
‘Candidatus Phytoplasma prunorum’ is the wall-less bacterium associated with European
stone fruit yellows (ESFY), a severe disease of Prunus (mainly apricot and Japanese plum
trees). It can be spread by one insect vector, Cacopsylla pruni, and by the trade of infected
material. The availability of PCR-based methods allowing a sensitive and specific detection
of ‘Ca. P. prunorum’ is crucial for this phytoplasma because, at present, it is uncultured and it
cannot be detected serologically. In contrast to the existing detection tools, we developed a
PCR test allowing both a sensitive and specific detection of ‘Ca. P. prunorum’ in plants and
insects. The sensitivity of this test was assessed by serial dilutions and its specificity was
demonstrated both in silico and experimentally against several phytoplasmas, included the
closely related ‘Ca. P. pyri’ (pear decline) and ‘Ca. P. mali’ (apple proliferation). This test
can also be used semi-quantitatively using real-time PCR. For studies requiring an absolute
quantification of the phytoplasma load in C. pruni (thus including an internal standard for C.
pruni), we developed quantitative real-time PCR assays for the two available chemistries.
Keywords: diagnosis; epidemiology; primer; probe; Prunus armeniaca; Prunus salicina; quantitative PCR.
1. Introduction
Phytoplasmas are uncultivated plant pathogenic bacteria belonging to the class
Mollicutes. These wall-less bacteria are linked with more than 100 plant diseases (Seemüller
et al., 1998). The ‘Candidatus Phytoplasma’ genus is presently subdivided into 15 groups on
the basis of their 16S ribosomal DNA (rDNA) sequence (Firrao et al., 2004), and ‘Candidatus
Phytoplasma prunorum’ is a member of the 16SrX group. It is associated with European stone
fruit yellows (ESFY) (Lorenz et al., 1994; Seemüller and Schneider, 2004), a disease
affecting most of wild and cultivated Prunus species (Carraro et al., 2001; Jarausch et al.,
1998). This disease – previously known as ‘apricot chlorotic leaf roll’ or ‘plum leptonecrosis’
– is widespread in Europe and causes substantial economic loss because of the decline and
death of the infected trees (mainly apricot and Japanese plum trees). Only one insect species,
Cacopsylla pruni, was identified as a vector of this phytoplasma (Carraro et al., 1998), which
can also be transmitted by the grafting of infected buds (Morvan, 1957) and the trade of
planting material. On cultivated stone fruit trees, ESFY generally induces yellows, decline,
and vegetative disorders with typical symptoms, such as early budbreak and leaf rolling
(Lorenz et al., 1994). Nevertheless, the nature and intensity of these symptoms can differ
depending on the season, the host plant, and the isolate of ‘Ca. P. prunorum’ (Jarausch et al.,
2000; Kison and Seemüller, 2001); some infected plants can even be asymptomatic (Carraro
et al., 2002; Torres et al., 2004). Thus, for epidemiological studies on ESFY and disease
management by plant protection services, more objective methods should be available to
detect and quantify ‘Ca. P. prunorum’ plants and in insects, either in experimental,
commercial, or natural conditions.
As no serological test is available and the phytoplasmas are yet uncultured, PCR
amplification is the main detection procedure, at present. The level of specificity of this
* These authors contributed equally to this work.
- 49 -

sensitive technique can be adapted to the objectives, through the design of different primer
sets. For routine diagnosis and experiments, one frequently uses the PCR primers fU5/rU3
(Lorenz et al., 1995) that were designed to detect all the phytoplasmas. However, these
universal primers can match portions of the genome of some epi- or endophytic bacteria:
some plants can shelter on their surface Acholeplasma sp. (Tully et al., 1994) or other bacteria
that cross-react with the universal primers, generating false positives (Baric and Dalla-Via,
2004; Skrzeczkowski et al., 2001). Moreover, several other phytoplasmas have been detected
in Prunus, some of which with a significant prevalence. Peach trees (P. persicae) clearly
exemplify this situation: in the orchard, some symptoms of ESFY, western X-disease, and
peach yellow leaf roll (PYLR) are similar (Kison et al., 1997). Furthermore, peach trees
naturally infected by ‘Ca. P. phoenicium’ (Abou-Jawdah et al., 2002) or by ‘Ca. P. asteris’
(Anfoka and Fattash, 2004) also showed yellows symptoms. Such yellows symptoms,
typically displayed by phytoplasma-infected plants, can be confounded with ESFY symptoms
and thus result in an erroneous diagnosis. The same identification problems occur with the
insects: of course they show no ‘Ca. P. prunorum’-specific symptom, and they contain a
wealth of endogenous prokaryotes. Indeed, they carry gut and cuticle bacteria, symbionts (at
least one species), and parasites (potentially including other phytoplasmas) that should not be
detected by primers designed for ‘Ca. P. prunorum’ phytoplasma. Thus, a more specific
method is often required for the detection and specific identification of ‘Ca. P. prunorum’ in
plants and insects. Two group-specific primers (detecting subclades within the genus ‘Ca.
Phytoplasma’) are also used: fO1/rO1 (Lorenz et al., 1995) and R16(X)F1/R1 (Lee et al.,
1995), but they amplify several phytoplasmas, including the phytoplasma associated with
PYLR. Thus, a classical approach to the specific detection of ‘Ca. P. prunorum’ relies on the
amplification of a 16S rDNA fragment with generic primers followed by time- and resourceconsuming
additional enzymatic digestions (Lorenz et al., 1995). A primer pair targeting a
genomic DNA sequence has also been designed to detect ‘Ca. P. prunorum’ (Jarausch et al.,
1998), but the specific detection was obtained at the expense of sensitivity. Highly specific
and sensitive primers would therefore be useful to detect ‘Ca. P. prunorum’ in plants and
insects.
Quantitative real-time PCR (Q-PCR) can be used either as a very sensitive and specific
detection tool or, of course, as a way to quantify the phytoplasma in plants or insects. This
method has already been developed for several phytoplasmas in plants (Baric and Dalla-Via,
2004; Christensen et al., 2004; Wei et al., 2004) and insects (Jarausch et al., 2004). However,
no protocol was available to quantify ‘Ca. P. prunorum’ in its vector, although this would
allow considerable insights into the (spatio-) temporal dynamics of this phytoplasma within
C. pruni.
In this paper, we describe a new set of complementary tools for the specific detection
and/or quantification of ‘Ca. P. prunorum’ in its plant hosts and insect vector. These tools
consist in (i) a specific primer pair that can be used either for the detection of this
phytoplasma for conventional PCR or for its quantification by real-time PCR with the SYBR
Green device, and (ii) a set of TaqMan primers and probes for the absolute quantification of
‘Ca. P. prunorum’. Primers and probe were available for the quantification of C. pruni DNA
as an internal standard with these two chemistry.
2. Materials and methods
2.1. Sources of phytoplasma
Healthy and ESFY-infected Prunus rootstocks (P. marianna GF 8-1, P. armeniaca cv.
Manicot, P. persicae cv. Montclar) were grown in an insect-proof greenhouse. Several French
ESFY isolates were used. The other phytoplasmas (fig.1A) were maintained on the
experimental host Catharanthus roseus and were kindly provided by X. Foissac (INRA,
- 50 -

Bordeaux). Plant samples were also collected in orchards or in blackthorn (P. spinosa) hedges
in southeastern France. Petioles of C. roseus or phloem from woody shoots of Prunus (about
0.5 g) were used.
Overwintering adults C. pruni were collected from Prunus trees or from shelter conifers.
Nymphs and adults of the new generation were reared in cages in a climatic chamber from the
eggs laid by the overwintering adults. They were reared on either healthy or infected P.
marianna, to provide healthy or infected insects. Psyllids collected were conserved at –80°C
in 1.5 ml Eppendorf tubes until DNA extraction.
2.2. DNA extraction
Collection of plant material and DNA extraction appeared to be crucial for obtaining
accurate diagnosis without false positives. Preliminary trials had demonstrated that accidental
contamination from fingers, surfaces and tools could happen, particularly with experimental
woody material with a high phytoplasma titer. Thus, the routine protocol included the
disinfection of surfaces and experimental tools between samples and precautions to avoid
touching the tested plant material.
Total DNA from plant material was extracted using CTAB (cetyltrimethylammonium
bromide) as described by Maixner et al. (1995). Total DNA of each insect was extracted by
the same procedure with some modifications, following Marzachi et al. (1998). Each psyllid
was ground in 40 µl of CTAB buffer with 3 µl of proteinase K (20 mg/ml) (Invitrogen) with a
sterile micropestle, completed with 460 µl of CTAB buffer and incubated for 30 min at 65°C.
The extraction was performed with 500 µl of chlorophorm-isoamyl alcohol (24:1). Then, 1 µl
of Glycoblue (15 mg/ml) (Ambion) was added to 350µl of cold isopropanol to improve
precipitation and to dye DNA pellets in blue. Total DNA was washed with 70% ethanol and
dried 30 min at 37°C in an incubator. Finally, plant and insect DNA was eluted in 100 µl and
30 µl of sterile water, respectively and stored at –20°C.
To control the reproducibility of DNA extraction, the amount of DNA extracted from
each of 10 insects was measured with the Quant-iT PicoGreen quantification kit, using λDNA
as a standard and according to the manufacturer’s instructions (Invitrogen). After excitation at
480 nm, the fluorescence emission was measured at 526 nm with a F-2500 spectrofluorimeter
(HITACHI SciencTec).
2.3. Specific PCR
The ESFY-specific primer pair ESFYf/r (Table 1) was based on the primers fAT/rPrus
(Smart et al., 1996), with appropriate modifications (i.e., slight shifts). ESFYf was located in
the 16S rDNA and ESFYr in the adjacent intergenic region of the phytoplasma genome,
generating a 504 bp fragment. Sequence alignment using GenBank database showed that
ESFYr had at least three mismatches with the sequences of the other phytoplasma species of
the 16SrX group (fig.3), allowing the specific identification of ‘Ca. P. prunorum’. Each
reaction was performed in 20 µl including 1X PCR buffer (Invitrogen), 1.5 mM of MgCl2,
125 µM of dNTP, 0.35 µM of each primer (Invitrogen), 1 unit of Taq polymerase
(Invitrogen), 10–100 ng of template DNA. To find a good balance between sensitivity and
specificity, a touch-down PCR was designed with a high annealing temperature during the
first cycles: 1 min of denaturation at 94°C, followed by 20 cycles of 30 s at 94°C, 20 s at
65°C, 45 s at 72°C, and then 20 cycles of 30 s at 94°C, 20 s at 62°C, 45 s at 72°C.
Amplification was carried out both in a T1 thermocycler (Biometra) and in a PT100
thermocycler (MJ Research) applying different ramping rates to check the robustness of the
method. Amplification products (8 µl) were analyzed by electrophoresis on 1.5% agarose gel
in 0.5X TBE buffer and visualized using a UV transilluminator after ethidium bromide
staining.
- 51 -

2.4. Semi-quantitative real-time PCR
The specific primer pair designed for conventional PCR (ESFYf/r) could also be used
in semi-quantitative PCR. The reactions were performed in 20 µl with Fullvelocity SYBR
Green QPCR Master mix (Stratagene), 5 µl of a 10-fold dilution of the total DNA extract
(from plant or insect), and 0.30 µM of each primer. Thermal cycle parameters were as
follows: 5 min at 95°C (1 cycle) followed by 10 s at 95°C, 30 s at 62°C (40 cycles) and 1 min
at 95°C, 30 s at 55°C, 30s at 95°C (1 cycle). Analyses were performed using the MX 3000P
real-time PCR system and software (v.2 Stratagene).
2.5. Quantitative real-time PCR
The sequence delimited by ESFYf/r was not suited to design primers (ECAQf/r) and
probe ECAQp. There (Table 1) were designed only in the 16S rDNA region of the
phytoplasma genome using the Primer Express (version 1.0) software (Applied Biosystems).
The probe (Applied Biosystems) was labeled at its 5’-end with the fluorescent reporter dye
VIC and at the 3’-end with the fluorescent quencher TAMRA (6-carboxy-tetramethylrhodamine).
Sequence alignment using GenBank database showed the specificity of the designed
primers and probes in relation to other phytoplasmas belonging to the 16SrX group or
occurring in stone fruit trees (fig.3).
To take account of any variability in the yield of DNA extraction, an internal standard (an
housekeeping gene from C. pruni) was used. As no sequence was available for C. pruni, we
designed a primer pair and a probe on a highly conserved portion of the 18S rDNA gene. The
search for this gene was done with 7 C. pruni caught in different French areas to avoid
possible intraspecific differences in the C. pruni populations. Total DNA from a single insect
was extracted according to the method described above. Primers were designed on the highly
conserved 18S rDNA gene. First, a 500 bp segment was amplified by standard PCR
techniques using the primers previously designed for this region in the Rotifera-
Acanthocephala clades : 5’-CCACATCCAAGGAAGGCAGCAGGC-3’ (forward) and 5’-
CCCGTGTTGAGTCAAATTAA-3’ (reverse) and according to the thermal cycle parameters
described by Miquelis et al. (2000).
The PCR products were directly sequenced using an automated sequencer (Megabace,
Amersham), and the 7 C. pruni sequences were deposited in GenBank (accession numbers:
??). A BLAST search on the NBCI database was used to detect any possible homology with
known prokaryote sequences. We obtained the first DNA sequence of C. pruni (286 bp),
which revealed some intraspecific genetic diversity within the 18S rDNA (outside the
fragment chosen to design the primers). CPf/q/r were designed in a slowly evolving zone of
this gene, as confirmed by the complete homology with the corresponding sequence from
Trioza eugeniae (Psyllidae). Thus, CPf/q/r are expected to amplify any C. pruni, and probably
any Cacopsylla. However, this fragment is different from the homologous regions in the rest
of living organisms. The probe was labeled at its 5’-end with the fluorescent reporter dye
FAM (6-carboxy-fluorescein) and at the 3’-end with the fluorescent quencher dye, TAMRA
(6-carboxy-tetramethyl-rhodamine). All the sequences of primers and TaqMan probes are
listed in Table 1.
Reactions were performed in 25 µl with 2X TaqMan Universal PCR Master mix (Applied
Biosystems), on 5µl of total DNA. Psyllid DNA and ‘Ca. P. prunorum’ DNA quantification
required an optimization of the primers and probes concentrations. Optimized concentrations
were respectively 200 nM of CPf, 200 nM of CPr, 200 nM of probe and 600 nM of ECAQf,
600 nM of ECAQr, 250 nM of probe. Thermal cycle parameters were as follows: 2 min at
50°C (1 cycle) and 10 min at 95°C (1 cycle) followed by 15 s at 95°C and 1 min at 60°C (40
- 52 -

cycles). The analyses were performed using the ABI Prism 7700 and the Sequence Detector
software (v.1.6.3, Applied Biosystems). Samples were tested in triplicate.
CPf/r primers could also be effective with the SYBR Green chemistry. The reactions
were performed in the same conditions describe in semi-quantitative real time paragraph but
with 0,20µM of each primer.
2.6. Standard curves
Plasmids containing the interest genes and the housekeeping genes were used as standard
template. The ‘Ca. P. prunorum’ gene and the C. pruni genes were amplified by classic PCR
with the designed primers. PCR products were purified with Wizard SV gel and PCR clean up
System (Promega), then cloned in a plasmid vector with the pGEM-T Easy Vector System II
(Promega) and purified with Wizard Plus SV Minipreps DNA Purification System (Promega).
Plasmid DNA references samples (standard template) were quantified with an Ultraspec 3000
spectrophotometer (Pharmacia Biotech Ltd, Cambrigde, UK) to evaluate the target copy
number per pg. Standard curves were generated by performing three independent serial
dilution of these DNA references samples with known concentrations (fig. 4) and a negative
control. Comparing the threshold cycle (CT) for unknown samples to this standard curve
enabled to quantify the target copy number. CT is inversely proportional to the log of the
initial copy number (Higuchi et al., 1993). The slope (S) of this graph was used to determine
the reaction efficiency. The PCR efficiency was calculated as 10 -1/S -1. After the real-time
PCR, the copy number of the unknown samples could be interpolated using the linear
regression modeling the standard curve.
3. Results
3.1. Reproducibility of insect DNA extraction
A sample of 10 total DNA extracts of individual insects was analyzed with the
PicoGreen dsDNA quantification kit to estimate the quality of the extraction of insect DNA.
The extraction yield varied little, as the mean DNA concentration was 246.3 ng/ml with a
standard error of only 6.17 ng/ml.
3.2. Validation of specific PCR
The specificity and the sensitivity were tested in comparison with universal ribosomal
primers fU5/rU3 (Lorenz et al., 1995). The primer specificity was checked against 7 different
phytoplasmas (Fig.1A). ESFYf/r detected only the 2 ESFY isolates while the other
phytoplasmas were also amplified by fU5/ rU3. Three independent repetitions were made
with the same result. The sensitivity of ESFYf/r was monitored by serial dilutions consisting
in 1 µl of total DNA extract from a plant infected by a local ESFY isolate into increasing
volumes of healthy plant DNA extracts. The primer pair ESFYf/r was slightly less sensitive
that fU5/rU3 (limit dilution of 5. 10 -4 and 10 -4 , respectively) (Fig.1B).
3.3. Validation of the real-time PCR
The primers ESFYf/r designed to be used in conventional PCR were also efficient with a
semi-quantitative PCR with SYBR Green chemistry. Specific detection was performed in
plants and in insects. The slope of standard (fig. not shown) curve allows to calculate a PCR
efficiency of 95%. The specificity of ECAQf/r and CPf/r primers, designed to avoid the
unspecific amplification of prokaryotic organisms included in total DNA extraction, was
confirmed by conventional PCR (Fig. 2).
- 53 -

Quantification of ‘Ca. P. prunorum’ DNA
The primers were designed on the 16S ribosomal gene and delimited a fragment of 108
bp. The linear regression of that standard curve attested the accuracy of the dilution. The slope
of standard curve (fig.4) allows to calculate a PCR efficiency of 95%.
Quantification of C. pruni DNA
On the highly conserved 18S rDNA, a region of 232 bp was specific to Cacopsylla and
deposited in GenBank. The primers designed on this sequence delimited a fragment of 92 bp.
No signal was detected with healthy psyllids. This control showed that no prokaryote included
in the vector was amplified. The slope of the standard curve (not shown) corresponds to a
PCR efficiency > of 98% with two chemistries.
4. Discussion
In this study, our aim was to propose a set of PCR-based tools for the detection and
quantification of ‘Ca. P. prunorum’, the phytoplasma associated with the European stone fruit
yellows disease. Thus, we obtained and validated a pair of primers suitable for classical or
quantitative PCR in plants or insects, and a set of primers and probes to quantify ‘Ca. P.
prunorum’ in its vector.
All the primers and probes were based on rDNA of C. pruni and ‘Ca. P. prunorum’. The
rDNA is the most frequently sequenced portion of the genomes throughout the tree of life,
providing good knowledge of the nucleotide diversity in this zone within and between
species. In addition, rDNA genes are duplicated in ‘Ca. P. prunorum’ (Marcone and
Seemüller, 2001), which doubles the sensitivity of the detection relatively to other genes.
However, the 16S rDNA is so highly conserved within the 16SrX group that it has been
considered as inappropriate to design primers discriminating ‘Ca. P. pyri’ from ‘Ca. P.
prunorum’ (Malisano et al., 1996). Hence the interest of designing a primer on the subsequent
intergenic spacer (IS), which is less conserved.
The choice between the available molecular tools depends on the required level of
specificity and sensitivity. If the issue is to detect any phytoplasma in a given sample, specific
primers for the genus ‘Ca. Phytoplasma’ are welcome, even if only one phytoplasma has been
previously recognized in the tested species. If one’s aim is to detect the presence of ‘Ca. P.
prunorum’ in plants or insects, specific primers such as ESFYf/r are more appropriate. Using
these primers with the described touch-down PCR program allows a reliable, specific, and
sensitive detection of ‘Ca. P. prunorum’ in plants or insects, suitable for routine diagnostic.
These primers are slightly less sensitive than fU5/rU3 universal primers; they can
nevertheless detect the pathogen in 5×10 -5 dilutions. If the highest sensitivity is required (e.g.,
for detecting the phytoplasma in plant species with a high level of resistance), ESFYf/r can be
used in a nested PCR after a first round of amplification with an outer phytoplasma-specific
primer pair such as PA2F/PA2R (Heinrich et al., 2001). The use of ESFYf/r in routine
diagnostic has generated no unspecific amplification of other prokaryotic organisms included
in the total DNA extract.
Despite the length of the amplicon (504 bp), these primers can also provide semiquantitative
information for plant or insect samples through comparing the real-time
amplification of the tested DNA to serial dilutions of standard DNA of known concentration
(e.g., a plasmid containing the target gene). The result is only semi-quantitative because no
precise information is included as regards the amount of tested material. This quantity can be
roughly estimated by expressing the result as a number of targets per mg of fresh plant
material or per insect. Therefore, using ESFYf/r for real-time PCR is a valuable alternative to
the classical PCR-electrophoresis procedure (in particular for high-throughput applications
such as routine diagnosis) because it provides more information without any post-PCR
manipulation.
- 54 -

The above semi-quantification relies on the assumption of a constant yield of DNA
extraction. Even if our results show that this assumption can be fulfilled for C. pruni, an
internal standard is required for the precise quantification of ‘Ca. P. prunorum’. Thus,
ECAQf/p/r were designed to quantify ‘Ca. P. prunorum’ 16S rDNA and CPf/p/r were
designed to quantify C. pruni 18S rDNA. None of these sets of primers and probes are strictly
specific at the species level, but they have been designed in parts of the rDNA that are highly
divergent from the rest of the available sequences (except for some of the closer relatives
species). Thus, ECAQf/p/r should be used when no mixed-phytoplasma infections occurs in
the insect; this is not a major limitation because quantification studies often involve
experimentally inoculated material with only one phytoplasma. For quantifying ‘Ca. P.
prunorum’ in host plants, the plant-specific primers and probe defined elsewhere (Christensen
et al., 2004) can be used to standardize the data.
In conclusion, new molecular tools are now available for ‘Ca. P. prunorum’ diagnosis and
quantification, as well as for further studies on the epidemiology of ESFY and on the
phytoplasma/vector interactions.
ACKNOWLEDGMENTS
This work was partly founded by a grant INRA-DADP / Région Languedoc-Roussillon
and a grant INRA EpiEmerge.
LITERATURE CITED
Abou Jawdah, Y., A. Karakashian, H. Sobh, M. Martini, and I. M. Lee. 2002. An epidemic of almond witches'broom
in Lebanon: classification and phylogenetic relationships of the associated phytoplasma. Plant
Disease 86 (5):477-484.
Anfoka, G. H., and I. Fattash. 2004. Detection and identification of aster yellows (16SrI) phytoplasma in peach
trees in Jordan by RFLP analysis of PCR-amplified products (16S rDNAs). Journal of Phytopathology 152
(4):210-214.
Baric, S., and J. Dalla-Via. 2004. A new approach to apple proliferation detection: a highly sensitive real-time
PCR assay. Journal of Microbiological Methods 57 (1):135-145.
Carraro, L., R. Osler, N. Loi, P. Ermacora, and E. Refatti. 1998. Transmission of European stone fruit yellows
phytoplasma by Cacopsylla pruni. Journal of Plant Pathology 80 (3):233-239.
Carraro, L., N. Loi, and P. Ermacora. 2001. Transmission characteristics of the European stone fruit yellows
phytoplasma and its vector Cacopsylla pruni. European Journal of Plant Pathology 107 (7):695-700.
Carraro, L., F. Ferrini, P. Ermacora, and N. Loi. 2002. Role of wild Prunus species in the epidemiology of
European stone fruit yellows. Plant Pathology 51 (4):513-517.
Christensen, N. M., M. Nicolaisen, M. Hansen, and A. Schulz. 2004. Distribution of phytoplasmas in infected
plants as revealed by real-time PCR and bioimaging. Molecular Plant-Microbe Interactions 17 (11):1175-
1184.
Firrao, G., M. Andersen, A. Bertaccini, E. Boudon, J. M. Bove, X. Daire, R. E. Davis, J. Fletcher, M. Garnier, K.
S. Gibb, D. E. Gundersen-Rindal, N. Harrison, C. Hiruki, B. C. Kirkpatrick, P. Jones, C. R. Kuske, I. M. Lee,
L. Liefting, C. Marcone, S. Namba, B. Schneider, B. B. Sears, E. Seemuller, C. D. Smart, C. Streten, and K.
Wang. 2004. 'Candidatus Phytoplasma', a taxon for the wall-less, non-helical prokaryotes that colonize plant
phloem and insects. International Journal of Systematic and Evolutionary Microbiology 54:1243-1255.
Heinrich, M., S. Botti, L. Caprara, W. Arthofer, S. Strommer, V. Hanzer, H. Katinger, A. Bertaccini, and M.
Laimer Da Câmara Machado. 2001. Improved detection methods for fruit tree phytoplasmas. Plant
Molecular Biology Reporter 19 (2):169-179.
Higuchi, R., C. Fockler, G. Dollinger, and R. Watson. 1993. Kinetic PCR analysis - Real-time monitoring of
DNA amplification reactions. Bio-Technology 11 (9):1026-1030.
Jarausch, W., M. Lansac, C. Saillard, J. M. Broquaire, and F. Dosba. 1998. PCR assay for specific detection of
European stone fruit yellows phytoplasmas and its use for epidemiological studies in France. European
Journal of Plant Pathology 104 (1):17-27.
Jarausch, W., J. P. Eyquard, M. Lansac, M. Mohns, and F. Dosba. 2000. Susceptibility and tolerance of new
French Prunus domestica cultivars to European stone fruit yellows phytoplasmas. Journal of Phytopathology
148 (7-8):489-493.
Jarausch, W., T. Peccerella, N. Schwind, B. Jarausch, and G. Krczal. 2004. Establishment of a quantitative real-
- 55 -

time PCR assay for the quantification of apple proliferation phytoplasmas in plants and insects. Acta
Horticulturae 657:415-420.
Kison, H., B. C. Kirkpatrick, and E. Seemuller. 1997. Genetic comparison of the peach yellow leaf roll agent
with European fruit tree phytoplasmas of the apple proliferation group. Plant Pathology 46 (4):538-544.
Kison, H., and E. Seemüller. 2001. Differences in strain virulence of the European stone fruit yellows
phytoplasma and susceptibility of stone fruit trees on various rootstocks to this pathogen. Journal of
Phytopathology 149 (9):533-541.
Lee, I. M., A. Bertaccini, M. Vibio, and D. E. Gundersen. 1995. Detection of multiple phytoplasmas in perennial
fruit trees with decline symptoms in Italy. Phytopathology 85 (6):728-735.
Lorenz, K. H., F. Dosba, C. Poggi Pollini, G. Llacer, and E. Seemuller. 1994. Phytoplasma diseases of Prunus
species in Europe are caused by genetically similar organisms. Zeitschrift fur Pflanzenkrankheiten und
Pflanzenschutz 101 (6):567-575.
Lorenz, K. H., B. Schneider, U. Ahrens, and E. Seemuller. 1995. Detection of the apple proliferation and pear
decline phytoplasmas by PCR amplification of ribosomal and nonribosomal DNA. Phytopathology 85
(7):771-776.
Maixner, M., U. Ahrens, and E. Seemuller. 1995. Detection of the German grapevine yellows
(Vergilbungskrankheit) MLO in grapevine, alternative hosts and a vector by a Specific PCR procedure.
European Journal of Plant Pathology 101 (3):241-250.
Malisano, G., G. Firrao, and R. Locci. 1996. 16S rDNA-derived oligonucleotide probes for the differential
diagnosis of plum leptonecrosis and apple proliferation phytoplasmas. Bulletin OEPP 26 (2):421-428.
Marcone, C., and E. Seemuller. 2001. A chromosome map of the European stone fruit yellows phytoplasma.
Microbiology Reading 147 (5):1213-1221.
Marzachi, C., F. Veratti, and D. Bosco. 1998. Direct PCR detection of phytoplasmas in experimentally infected
insects. Annals of Applied Biology 133 (1):45-54.
Miquelis, A., J. F. Martin, E. W. Carson, G. Brun, and A. Gilles. 2000. Performance of 18S rDNA helix E23 for
phylogenetic relationships within and between the Rotifera-Acanthocephala clades. Comptes Rendus de
l'Academie des Sciences, Série III 323 (10):925-941.
Morvan, G. 1957. Mise en évidence de l'action d'un virus dans le dépérissement de l'abricotier. Comptes Rendus
de l'Academie d'Agriculture de France 43:13-14.
Seemüller, E., C. Marcone, U. Lauer, A. Ragozzino, and M. Goschl. 1998. Current status of molecular
classification of the phytoplasmas. Journal of Plant Pathology 80 (1):3-26.
Seemüller, E., and B. Schneider. 2004. 'Candidatus Phytoplasma mali', 'Candidatus Phytoplasma pyri' and
'Candidatus phytoplasma prunorum', the causal agents of apple proliferation, pear decline and European
stone fruit yellows, respectively. International Journal of Systematic and Evolutionary Microbiology
54:1217-1226.
Skrzeczkowski, L. J., W. E. Howell, K. C. Eastwell, and T. D. Cavileer. 2001. Bacterial sequences interfering in
detection of phytoplasma by PCR using primers derived from the ribosomal RNA operon. Acta Horticulturae
(550):417-424.
Smart, C. D., B. Schneider, C. L. Blomquist, L. J. Guerra, N. A. Harrison, U. Ahrens, K. H. Lorenz, E.
Seemuller, and B. C. Kirkpatrick. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-
23S rRNA spacer region. Applied and Environmental Microbiology 62 (8):2988-2993.
Torres, E., M. P. Martin, S. Paltrinieri, A. Vila, R. Masalles, and A. Bertaccini. 2004. Spreading of ESFY
phytoplasmas in stone fruit in Catalonia (Spain). Journal of Phytopathology 152 (7):432-437.
Tully, J. G., R. F. Whitcomb, D. L. Rose, J. M. Bove, P. Carle, N. L. Somerson, D. L. Williamson, and S.
Edengreen. 1994. Acholeplasma brassicae sp. nov. and Acholeplasma palmae sp. nov., 2 non-sterol-requiring
mollicutes from plant surfaces. International Journal of Systematic Bacteriology 44 (4):680-684.
Wei, W., S. Kakizawa, S. Suzuki, H. Y. Jung, H. Nishigawa, S. Miyata, K. Oshima, M. Ugaki, T. Hibi, and S.
Namba. 2004. In planta dynamic analysis of onion yellows phytoplasma using localized inoculation by insect
transmission. Phytopathology 94 (3):244-250.
- 56 -

Table 1. Sequence of the primers and probes designed to detect or quantify ‘Ca. P. prunorum’
and C. pruni DNA.
Name Sequence (5’→ 3’)
‘Ca. P. prunorum’ 16S rDNA
ESFYf (forward) CCATCATTTAGTTGGGCACT
ESFYr (reverse) ATAGGCCCAAGCCATTATTG
ECAQf
AAACGACTGCTAAGACTGGATATGAA
(forward)
ECAQp (probe) VIC-CCCGCAAGGGTATGCTGAGAGATGG
ECAQr (reverse) TTACCAACTAACTAATGTGCCGCA
C. pruni 18S rDNA
CPf (forward) CAAGTACGTCCCCGTTGATCA
CPp (probe) FAM-TTAGAGGTTCGAAGGCGATCAGATACCGC
CPr (reverse) GCTGGCTGACATCGTTTATGG
Table 2. Guidelines to the choice of the primer set depending on the purpose (i.e.,
identification or quantification).
Source Conventional Semi-quantitative
Quantitative PCR
organism specific PCR specific PCR ‘Ca. P. prunorum’ Internal control
Insect ESFYf/r ESFYf/r ECAQf/p/r CP f/p/r
Plant ESFYf/r ESFYf/r (see Christensen et al., 2004)
- 57 -

A B
Fig. 1. Specificity (A) and sensitivity (B) validation to ESFYf/r primers by conventional PCR. Agarose gel
(1.5%) showing amplification products obtained by universal primer fU5/rU3. (A) phytoplasmas: (1) ‘Ca. P.
prunorum’ laboratory; (2) ‘Ca. P. prunorum’ field isolate; (3) ‘Ca. P. asteris’ (European aster yellows); (4) Peach
Western X; (5-6) ‘Ca. P. mali’ (apple proliferation, strains AP and AT, respectively); (7) ‘Ca. P. phoenicium’;
(8) ‘Ca. P. pyri’ (pear decline); (9) Stolbur; (10) Healthy sample (Catharantus roseus); M, 100 pb DNA marker.
(B) Dilution series of ‘Ca. P. prunorum’ laboratory isolate: (1) 10 -1 ; (2) 5 10 -2 ; (3) 10 -2 ; (4) 5 10 -3 ; (5) 10 -3 ; (6)
510 -4 ; (7) 10 -4 ; (8) 5 10 -5 ; (9) 10 -5 ; (10) 510 -6 ; (11) 10 -6 ; (12) Healthy sample (C. roseus); (13) PCR mix. All the
isolates were kindly provided by X. Foissac (INRA, Bordeaux) except ‘Ca. P. prunorum’ field isolate.
A
1500 bp-
600 bp-
100 bp-
M 1 2 3 4 5 6 7 8 9 10 M
M 1 2 3 4 5 6 7 8 9 10 11 12 13 M
Fig. 2. phytoplasma specificity of ECAQf/r (A) and Psyllid specificity of CPf/r (B). (A) Agarose gel (2%): M:
size marker; (1) ‘Ca. P. prunorum’ laboratory; (2) ‘Ca. P. prunorum’ orchard isolate; (3) ‘Ca. P. asteris’ (Aster
Yellow European); (4) Peach Western X; (5-6) ‘Ca. P. mali’ (apple proliferation, strains AP and AT,
respectively); (7) ‘Ca. P. phoenicium’; (8) ‘Ca. P. pyri’ (Pear Decline); (9) Stolbur; (10) Healthy plant sample
(Catharantus roseus); (11) Infected psyllid; (12) Healthy psyllid; (13) PCR mix. (B) Agarose gel (2%): M, size
marker; (1) Cacopsylla pruni (near Perpignan); (2) C. pruni (near Montpellier); (3) Psyllid sp. (4) Aphid (Myzus
persicae); (5) Escherichia coli; (6) Operator contamination; (7) PCR mix.
- 58 -
M 1 2 3 4 5 6 7 8 9 10 11 12 13 M
1500 bp-
600 bp-
100 bp-
B
M 1 2 3 4 5 6 7 M

ESFY G1R (X)
ESFY G2 (X)
AP15R (X)
PD1R A
(X)
SpaWB (X)
BWB (X)
OY-M (I)
AlmWB (IX)
WX (III)
CCATCATTTAGT--TGGGCACT 464 bp CAA------TAATGG-CTTGGGCCTAT
............--........ 464 bp ...------......-...........
............--........ 463 bp A..------......T.CG........
............--........ 465 bp T..------......-.CG........
............--........ 463 bp AT.------.T.C..TT.G........
...G....C...--....G... 459 bp .T.------.G.------A........
...G..CG..A.GG....G... 485 bp TT.ATCTTT.T.A.ATTAA........
.G.C..CA..A.GG..A..... 468 bp TTT-------TGATAT.C.........
...G...G..A.GA....G... 467 bp TT.-------.GGCATTAA........
B ECAQf ECAQp ECAQr
ESFY G1 R (X)
ESFY G2 (X)
AP15 R (X)
PD1 R (X)
SpaWB (X)
BWB (X)
OY-M (I)
AlmWB (IX)
WX (III)
ESFYf ESFYr
AAACGACTGCTAAGACTGGATATGAA 30 bp CCCGC----AAGGGTATGCTGAGAGATGGGCTTGCGGCACATTAGTTAGTTGGTAA
.......................... .....----...............................................
......................G... .....----...........A...................................
......................G... .....----...............................................
......................G... ..T.A----...................A...........................
......T...............G... ..T..----..A..........A........................T........
......................G..G ..TAG--CA.TA........T..G..G.A.......T.................GG
....AGT...............G... ..TTTTTCGG.A........T.A...G.........C...................
....AGT...............G... T.TT.TTT-G.A........T.AG..G.........A..................G
Fig. 3. Sequence alignment of the 16S-IS-23S rDNA region showing the specificity of the designed primers and
probes in relation to other phytoplasmas belonging to the 16SrX group or occurring in stone fruit trees. The 16S
rDNA groups are indicated in parenthesis. (A) ESFYf/r primers for the specific detection and semi-quantification
of ‘Ca. P. prunorum’ in plants or insects. (B) ECAQf/p/r primers and probe for the quantification of ‘Ca. P.
prunorum’ in insects.
Fig. 4. Real-time simplex PCR standard curves on ‘Ca. P. prunorum’ DNA reference sample dilution.
- 59 -

B. Bilan
Ce travail a permis de disposer d’une technique pour détecter spécifiquement l’agent
responsable de l’ESFY dans des plantes ou des insectes ; des protocoles de quantification du
phytoplasme dans son vecteur ont également été définis. Ces méthodes peuvent ensuite être
utilisées dans deux types d’études présentées dans les paragraphes suivants : un suivi
exploratoire du taux d’infection du vecteur en conditions naturelles, et une série d’expériences
en conditions contrôlées sur les capacités de C. pruni à acquérir et à transmettre le
phytoplasme.
III. Prévalence et transmissibilité de ‘Ca. P. prunorum’ dans les
populations naturelles de son vecteur
On souhaite connaître l’évolution des capacités d’acquisition et de transmission de C.
pruni au cours de sa vie pour déterminer en particulier si chaque stade peut acquérir et
transmettre le phytoplasme de l’ESFY pendant la période qu’il passe sur les Prunus. Une
première approche a consisté à explorer le fonctionnement du système en conditions
naturelles. La proportion d’insectes porteurs du phytoplasme a été suivie d’une part sur les
lieux d’hivernage identifiés, et d’autre part au cours de la période passée par le vecteur dans
un massif de prunelliers isolé contenant des plantes infectées par ‘Ca. P. prunorum’.
A. Article III : “Survival of European Stone Fruit Yellows Phytoplasma Outside
Fruit Crop Production Areas: a Case Study in Southeastern France”
Michel Yvon, Gérard Labonne et Gaël Thébaud
Acta Horticulturae (2004) 657 : 477-481
- 60 -

Survival of European Stone Fruit Yellows Phytoplasma Outside Fruit
Crop Production Areas : a Case Study in Southeastern France
M. Yvon, G. Labonne and G. Thébaud
INRA, UMR BGPI, 2 place Viala, 34060 Montpellier, France
Keywords: ESFY, epidemiology, Cacopsylla pruni, Prunus spinosa, overwintering
ABSTRACT
The aim of the study was to assess the role of blackthorn (Prunus spinosa) in the
epidemiological cycle of ESFY and to search if an epidemiological cycle may exist
independantly of stone fruit orchards. A typical blackthorn hedge was chosen in an area free
of fruit orchards. A sample of 58 plants was tested for ESFY and 2 plants were detected
infected. Samples of the population of Cacopsylla pruni (vector of ESFY) found on the hedge
were taken at regular intervals from February to June and were tested for the presence of
ESFY. The proportion of reimmigrants (C. pruni arriving after overwintering to reproduce on
Prunus) infected remained stable during their 3 months of presence. Infected individuals were
also detected in the new generation. On overwintering sites (conifers in a montainous area
several km apart on the North-West), 2 C. pruni were detected infected by ESFY. From these
results it is suggested that an epidemiological cycle of ESFY can be achieved in wild
reservoirs of the phytoplasma even in the absence of Prunus orchards. On the other hand, the
blackthorn hedge do not seem to be a very efficient reservoir of ESFY.
INTRODUCTION
European stone fruit yellows phytoplasma (ESFY-P) damages mainly apricot (Prunus
armeniaca) and Japanese plum (P. salicina) crops, but can also be hosted by other Prunus
species, either cultivated (P. amygdalus, P. domestica), used as rootstock (P. cerasifera, P.
marianna) or wild (P. spinosa).
In the south of France, the desease on apricot trees (apricot chlorotic leaf roll) has been
noticed many years ago (Chabrolin, 1924) and is considered to be the first cause of decline of
this crop in some areas (Lemaire et al., 1998). During the last years, large apricot and
Japanese plum orchards were planted over previously uncultivated areas. In some cases a high
prevalence of ESFY has been observed in the new orchards. Thus the question of the arrival
of the first inoculum in these new areas arised.
The first inoculum can originate from planting material, from infectious vectors comming
from abroad or from wild reservoirs of phytoplasma which act as sources for the vectors.
Each of these 3 origins is possible : althought a strict certification scheme is used for Prunus
trees, infected plants are sometimes noticed in nurseries ; wild spontaneous or subspontaneous
Prunus reservoirs of ESFY phytoplasma were demonstrated (Carraro et al., 2002, Jarausch et
al , 2001) ; the vector has been identified as the psyllid Cacopsylla pruni (Carraro et al.,
1998). It is suspected to migrate between Prunus and conifers (Ossiannilsson, 1992 ; Lauterer,
1999) and to be infectious at the time it arrives on its Prunus host-plants (reimmigrants) to
reproduce (Carraro et al., 2001).
In this work, we search if an epidemiological cycle may exist independantly of stone fruit
orchards and can constitute a threat for new plantations. We investigated the infection status
of the psyllid population from a typical P. spinosa hedge far from any area of infected Prunus
orchards and then the status of infection of 2 populations at their overwintering sites.
MATERIAL AND METHODS
Location of the Blackthorn Plants
The study was carried out in the Languedoc plain, in an area of « garrigue» vegetation
and vineyards. The first stone fruit orchards were 25 to 30 km apart and they are grown under
- 61 -

the same climatic and altitude conditions. Only a few plum and cherry trees are planted in
private gardens in the vicinity of the site.
The chosen hedge of blackthorns (P. spinosa) was about 50 m long and 2 to 5 m wide, on
the border of a cultivated field. Several other clumps or hedges of P. spinosa are spreaded all
around.
A sample of C. pruni had been taken one year before in this area to verify that some
ESFY infected individuals could be found.
Location of Overwintering Sites
Several individuals of C. pruni were found on conifers (Abies, Picea and Pinus), in what
seem overwintering sites of the psyllid. The first site was 25 km on the West at a 700 m
altitude (Séranne). The second site was 35 km on the North-West at a 1300 m altitude (Lingas
mountain).
Collected Samples of C. pruni
Samples of C. pruni (200 individuals when possible) were collected with a beating tray.
The reimmigrants (adults coming from their overwintering site at the end of the winter and
morphologically distinguishable by their dark color) were collected each week from the end
of February to the end of May. In May and June, 4 samples of adults of the new generation
(adults coming from eggs laid on the P. spinosa plants by the reimmigrants, distinguishable
by their light color) were collected. When possible, 40 C. pruni of each sample were tested
individually.
Collected Samples of P. spinosa
58 regularly spaced P. spinosa plants were labelled along the border of the hedge. One
shoot per plant was then collected to be tested by PCR. The plants detected infected were cut
into distinct parts according to their morphology and each part was tested by PCR to obtain an
assessment of the distribution of the phytoplasma in the plant.
Detection method of ESFY Phytoplasma
ESFY-P was detected by simple and nested-PCR both for plants and insects. DNA was
extracted from plants (0.3-0.5 g of phloem) or individual psyllid using a CTAB method as
described by Maixner et al. (1995). A nested-PCR using universal phytoplasma primers P1/P7
(Schneider et al., 1995) then U3/U5 (Lorenz et al.,1995) was used to detect phytoplasma in
psyllid or plant extracts. DNA amplification was carried out in a Biometra T1 thermocycler.
For P1/P7 a denaturation step of 4 min at 94°C was followed by 40 cycles of 1 min at 94°C, 1
min at 55°C, 1 min at 72°C and ended by a final step of 4 min at 72°C. Then, the product was
diluted 1:30 th and 1 µl was used in a second reaction with U3/U5. A first denaturation step of
1 min at 92°C was followed by 35 cycles of 30 sec at 92°C, 30 sec at 55°C, 45 sec at 72°C
and a final step of 4 min at 72°C. Amplification products (8µl) were analyzed by 1% agarose
gel electrophoresis. DNA was stained with ethydium bromide and visualized on a UV
transilluminator.
A simple PCR was run on positive samples with a pair of ESFY specific primers
(protocole to be published) to confirm the identity of ESFY. An additional confirmation was
done on a sample of positive plants and psyllids by sequencing the internal spacer of 16S-23S
rRNA genes.
RESULTS - DISCUSSION
P. spinosa Plants
Two plants out of 58 were detected infected. One plant was entirely infected (14/14
infected parts). Only one part (1/24) was detected infected for the second plant. This indicates
that only a small proportion of the hedge could provide an ESFY source for C. pruni.
- 62 -

C. pruni Reimmigrants
The percentage of infected reimmigrants of C. pruni seems to remain stable during their
entire period of presence on blackthorns (table 1). Only one statistically significant difference
appeared on the 7 th May, at the end of the life period for the reimmigrants : more infected C.
pruni were detected by nested-PCR. To explain this difference, several hypotheses can be
made : 1) Some adults came from an other infected clump of P. spinosa ; 2) the reimmigrants
were mainly collected on an infected part of the hedge ; 3) the reimmigrants have had enough
time to accumulate or multiply the phytoplasma to a detectable amount. The third hypothesis
seems to be the most likely as the simple PCR detected only 1 C. pruni infected, which is
equivalent to the other periods .
C. pruni Adults of New Generation
The adults of the new generation collected during the end of May to mid-June had very
variable infection rates, from 2 to 49 %. According to the fact that the hedge is not uniformly
infected, an hypothesis could be that the collected adults were agregated either on infected or
healthy branches of P. spinosa.
From the 43 individuals detected infected by nested-PCR, only 7 were detected infected
by the simple PCR. Thus it seems that only a few individuals fly away to their overwintering
sites with a large amount of phytoplasma.
C. pruni at Overwintering Sites
No C. pruni could be found on conifers in the area of the studied blackthorn hedge
althought numerous Pinus sp are present. On the contrary, C. pruni were regularly caught on
conifers at both mountainous sites (table 2) which thus seem to be overwintering sites. At the
end of the winter, C. pruni diseappeared from conifers and could be found on P. spinosa.
From 88 C. pruni caught on conifers and tested by nested-PCR, 2 were detected infected (1
from each site). Both were also detected infected when using the simple PCR.
CONCLUSIONS
In this case study on a defined blackthorn hedge, we demonstrate : 1) that the hedge can
host infected reimmigrants during all the reproductive period of C. pruni ; 2) that it can
provide ESFY infected C. pruni in the emerging new generation ; 3) that some infected C.
pruni can be found on conifers in overwintering sites at the end of the winter (which prove
that the same insects migrate from Prunus to conifers and that the phytoplasma is retained
through all the period from July to the end of winter).
The overall observations suggest that an epidemiological cycle of ESFY can be achieved
in wild reservoirs of the phytoplasma even in the absence of Prunus orchards. On the other
hand, the blackthorn hedge do not seem to be an efficient reservoir of ESFY able to change
healthy reimmigrants landing on it into infected reimmigrants. Thus, for neighbouring
orchards, a blackthorn hedge would be more a reservoir for the vector and its natural
ennemies than a direct source of infection for the fruit trees.
LITERATURE CITED
Carraro L., Osler R., Loi N., Ermacora P., Refatti E., 1998.Transmission of european stone
fruit yellows phytoplasma by Cacopsylla pruni. Journal of Plant Pathology 80 : 233-239.
Carraro L., Loi N., Ermacora P., 2001.Transmission characteristics of the european stone fruit
yellows phytoplasma and its vector Cacopsylla pruni. European Journal of Plant
Pathology, 107 : 695-700.
Carraro L., Ferrini F., Ermacora P., Loi N., 2002. Role of wild Prunus species in the
epidemiology of European stone fruit yellows. Plant Pathology, 51 : 513-517.
Chabrolin C., 1924. Quelques maladies des arbres fruitiers de la Vallée du Rhône. Annales
des Epiphyties 10 : 265-333.
- 63 -

Jarausch W., Danet J. L., Labonne G., Dosba F., Broquaire J. M., Saillard C., Garnier
M.,2001. Mapping the spread of apricot chlorotic leaf roll (ACLR) in southern France and
implication of Cacopsylla pruni as a vector of European stone fruit yellows (ESFY)
phytoplasmas. Plant Pathology 50 : 782-790.
Lauterer P., 1999. Results of the investigations on Hemipterain Moravia, made by the
Moravian Museum (Psylloidea 2). Acta Musei Moraviae, Scientiae biologicae 84 : 71-
151.
Lemaire J.M., Julian J.P., Audergon J.M., Castelain C., 1998. Enroulement chlorotique de
l’abricotier : symptomatologie et gamme d’hôtes. L’arboriculture fruitière 520 21-24.
Lorenz K.H.., Schneider B., Ahrens U., Seemüller E., 1995. Detection of the apple
proliferation and pear decline phytoplasmas by PCR amplification of ribosomal and non
ribosomal DNA. Phytopathology 85 : 771-776.
Maixner, M., Ahrens, U., Seemuller, E., 1995. Detection of the German grapevine yellows
(Vergilbungskrankheit) MLO in grapevine, alternative hosts and a vector by a specific
PCR procedure. European Journal of Plant Pathology 101 : 241-250.
Ossiannilsson F., 1992. The Psylloidea (Homoptera) of Fennoscandia and Denmark. E.J.
Brill, Leiden, 347pp.
Schneider B., Seemüller E., Smart CD., Kirkpatrick BC., 1995. Phylogenetic classification of
plant pathogenic mycoplasma-like organisms or phytoplasma. In: Razin R and Tully JG
(eds), Molecular and Diagnostic Procedures in Mycoplasmology, Vol 1, pp. 369-380,
Academic Press, San Diego.
- 64 -

Table 1. Detection of ESFY from C. pruni on a blackthorn hedge.
Date :
Collected
C. pruni
Tested
C. pruni
ESFY
detected by
nested PCR
- 65 -
% infected
ESFY
detected
by simple
PCR
% infected
Reimmigrants :
28/02/2002 175 40 2 5.0% 1 2.5%
08/03/2002 220 40 4 10.0% 1 2.5%
12/03/2002 240 60 11 18.3% 1 2.5 a 1.7%
21/03/2002 218 40 1 2.5% 0 2.5 a 0%
27/03/2002 200 60 3 5.0% 1 1.7%
05/04/2002 200 40 4 10.0% 2 5.0%
12/04/2002 47 40 3 7.5% 1 2.5%
18/04/2002 131 40 4 10.0% 0 2.5 a 0%
25/04/2002 60 40 1 2.5% 1 2.5%
30/04/2002 80 40 1 2.5% 1 2.5%
07/05/2002 46 46 15 32.6% 1 2.5 a 2.2%
15/05/2002 8 8 0 0.0% 0 0.0%
24/05/2002 6 6 0 0.0% 0 0.0%
New generation :
24/05/2002 200 40 19 47.5% 1 2.5%
29/05/2002 140 64 1 1.6%
13/06/202 109 49 24 49.0% 5 10.2%
19/06/2002 20 20 2 10.0%
a Erratum to the published version.
Table 2. Detection of ESFY from C. pruni on conifers at 2 overwintering sites.
Site 1 : Séranne (700 m) Site 2 : Lingas (1300 m)
Date : Collected ESFY detected Date : Collected ESFY detected
C. pruni: positive/tested
C. pruni: positive/tested:
05/01/2003 9 1 / 8 12/01/2003 * 5 0 / 5
25/01/2003 11 0 / 11 26/01/2003 * 6 0 / 6
08/02/2003 15 0 / 15 29/03/2003 * 22 1 / 22
22/02/2003 20 0 / 18 06/04/2003 * 3 0 / 3
08/03/2003 Change to P. spinosa
total
* snow on the trees
1 / 52 total 1 / 36

B. Bilan
Au cours de cette étude, des sites d’hivernage ont été identifiés dans le sud de la France :
il s’agit de conifères appartenant aux genres Abies, Picea et Pinus situés en moyenne
montagne. Environ 2 % de C. pruni infectés se trouvent sur ces sites, ce qui renforce
fortement les présomptions sur la capacité du vecteur à conserver le phytoplasme pendant les
9 mois passés sur les conifères. Dans la haie de prunellier contenant des plantes infectées, la
proportion de psylles réimmigrants infectés évolue peu au cours du temps ; en particulier, la
proportion de réimmigrants très infectés (détection possible en PCR * simple) reste la même
que dans les populations hivernantes. Malgré cela, on trouve de nombreux psylles émergents
infectés. Les quelques prunelliers atteints par l’ESFY constituent donc une source de
phytoplasme. Ces observations indiquent-elles que les adultes réimmigrants ne multiplient pas
le phytoplasme ou que les plantes infectieuses étaient trop peu nombreuses dans la haie
étudiée ? Ces résultats (en particulier la proportion d’individus porteurs) sont-ils universels ou
spécifiques à la zone étudiée ? Pour le savoir, nous avons regroupé et comparé les résultats
obtenus dans différents travaux réalisés en Europe.
C. Méta-analyse des résultats expérimentaux européens
Depuis l’identification du vecteur, neuf études permettent d’estimer les proportions
d’insectes porteurs de ‘Ca. P. prunorum’ ou infectieux en conditions naturelles. En règle
générale, ces quantités ne figurent pas dans les articles mais elles peuvent être calculées
d’après les résultats reportés (issus le plus souvent de tests groupés 1 ).
1) Méthode du maximum de vraisemblance pour les tests par lots
Les tests par lots considérés ici donnent une réponse binaire pour l’ensemble du lot : le lot
est positif (quand au moins l’un des individus du lot est infecté) ou négatif (quand tous les
individus du lot sont sains). On cherche à déterminer τ, la probabilité pour qu’un individu
choisi au hasard dans une population soit positif. Pour simplifier les expérimentations quand τ
est a priori faible, les individus sont testés par lots ; la plupart du temps, plusieurs lots
d’effectif identique sont testés au cours d’une expérience. Malheureusement, les résultats sont
alors souvent exprimés en pourcentage de lots positifs, ce qui ne donne pas directement
l’information qui nous intéresse, c’est-à-dire la valeur de τ. De plus, dès lors que les lots ont
des effectifs différents, il est impossible de cumuler les résultats obtenus dans une même
expérience et a fortiori de comparer différentes expériences. Il est donc nécessaire de
déterminer τ ) , un estimateur de τ palliant ces défauts. Nous avons choisi un estimateur simple,
intuitif et asymptotiquement sans biais, celui du maximum de vraisemblance, c’est-à-dire la
valeur de τ pour laquelle la probabilité d’observer les valeurs obtenues expérimentalement est
maximale.
Chaque individu a la probabilité τ d’être positif. Sous l’hypothèse d’indépendance entre
individus, le résultat du test du i ème lot composé de Ii individus suit une loi de Bernoulli avec
Ii
la probabilité p = 1− ( 1−
τ)
d’être positif, c’est-à-dire de comporter au moins 1 individu
positif. Si on répète de façon indépendante cette expérience de Bernoulli sur Li lots de même
effectif Ii, le nombre de lots positifs Ni suit une loi binomiale de paramètre p.
ni
ni
Li
−ni
Par conséquent, P ( N = n ) = C p ( 1−
p)
.
i
i
L
i
1 Afin de conserver une cohérence d’ensemble, les études reposant sur des tests individuels (Fialová et al., 2004 ;
Yvon et al., 2004) sont analysées de la même façon que les autres, c’est-à-dire en considérant que les tests sont
effectués sur des lots de 1 individu.
- 66 -

Si l’expérience est répétée de façon indépendante pour k valeurs différentes de Ii et Li, la
vraisemblance de l’ensemble des k expériences s’écrit : v = ∏ P ( Ni
= ni
) .
i=
1
Après avoir remplacé p par son expression en fonction de τ, la log-vraisemblance de
l’ensemble des k expériences s’écrit :
k
⎡ ⎛ ni
Ii
V=ln(v)= ⎜ [ 1−
( 1−
τ)
]
∑
i=
1
⎢
ln C ⎣ ⎝
L
i
- 67 -
n
i
k
× ( 1−
τ)
I ( L −n
)
On cherche sur l’intervalle [0,1] la valeur de τ qui maximise V, ce qui implique que la
)
τ = τ tel que :
dérivée de V par rapport à τ s’annule en ce point τmax. On doit donc trouver max
k
Ii
−1
n × − τ
k
i Ii
( 1 max ) 1
∑
= ∑[
Ii
( Li
− ni
) ]
Ii
i=
1 1−
( 1−
τmax
) 1−
τmax
i=
1
)
Quand tous les groupes ont le même effectif (k=1), on obtient facilement τ = 1−
I 1−
p . Dans
le cas général, on obtient l’estimateur à l’aide d’un algorithme de minimisation, faute d’avoir
pu résoudre analytiquement cette équation.
Un intervalle de confiance à α % peut être obtenu à partir de v(τmax). En effet, on peut
vraisemblance
de la vraie valeur de τ v(
τ)
définir le rapport : R =
= , tel que -2ln(R) suive
vraisemblance
de la valeur de τmax
v(
τmax
)
asymptotiquement une loi du χ² à 1 degré de liberté (la démonstration figure par exemple
( 1)
dans Saporta (1990), p. 327). Soit K le quantile d’ordre 1-α de la loi du χ² à 1 degré de
1−α ( 1)
K1
liberté, on a donc : P( v( τ) ≥ vlim
) =1-α , où
2 −α
v lim = v(
τmax
) × e .
Si τ ) est différent de 0 et de 1, vlim possède deux antécédents par la fonction de
vraisemblance qui définissent les deux bornes d’un intervalle de confiance de niveau 1-α
autour de τ ) . Le programme permettant de calculer τ ) (et l’intervalle de confiance associé) à
l’aide du logiciel R (R Development Core Team, 2004) figure en Annexe 1. Il a été utilisé
pour obtenir les estimations présentées dans les paragraphes suivants.
2) Estimation : les vecteurs infectés ne sont pas tous infectieux
Le Tableau 2 rassemble les résultats permettant d’évaluer la prévalence et/ou la
transmission de l’ESFY par les populations naturelles de C. pruni. Il ressort de l’ensemble de
ces essais que la proportion maximale d’insectes porteurs du phytoplasme est de l’ordre de
25 % (deux échantillons) ; en moyenne, cette proportion est plutôt de l’ordre de 15 % dans les
zones où la prévalence de l’ESFY est forte et de 5 % environ hors des zones de verger (à
plusieurs dizaines de km). La prévalence de l’ESFY dans la population vectrice est donc
modérée compte tenu de la sensibilité de la nested-PCR*, capable de détecter aussi bien les
insectes infectieux que ceux qui se sont nourris récemment sur des plantes malades et qui
peuvent ne jamais devenir infectieux. Les essais de transmission permettent d’estimer la
proportion de vecteurs infectieux, qui globalement semble relativement faible, en tout cas plus
faible que la proportion de vecteurs porteurs du phytoplasme. Dans les zones où l’ESFY est
endémique, on compte 4 % de vecteurs réimmigrants infectieux, ce qui – dans les cas où la
comparaison est possible – ne diffère pas significativement de la proportion porteuse du
phytoplasme, les intervalles de confiance étant largement chevauchants. A l’inverse, la
proportion des psylles émergents infectieux (environ 2 %) est significativement inférieure à la
proportion de psylles porteurs et à la proportion de réimmigrants infectieux (méta-analyse des
5 articles de Carraro et al.). Ce dernier résultat indique (i) une durée de latence s’étendant au-
-1
i
i
i
⎞⎤
⎟
⎠
⎥ .
⎦

delà du moment où C. pruni quitte son hôte de reproduction, et/ou (ii) une mortalité
importante des psylles émergents au début des essais de transmission, (iii) une mortalité
importante des insectes porteurs pendant l’hivernage, (iv) une redistribution des psylles à
grande échelle. Par une comparaison à plus large échelle, une tendance à l’hétérogénéité se
dessine entre pays. En particulier, la proportion d’individus infectieux dans les zones d’étude
en France semble un peu moins élevée qu’en Italie.
Tableau 2. Synthèse bibliographique sur les proportions de C. pruni porteurs de l’ESFY ou infectieux.
Age des vecteurs
Réimmigrants Emergents
Infectés a,b Infectieux a,c Infectés a,b Infectieux a,c
Origine des vecteurs
(PAYS d ) Référence e
2,3 %
0,8 % Verger de prunier et myrobolan, Carraro et
[1,2 – 4]
[0,2 – 2,2] ESFY endémique (IT) al., 1998b
6,9 %
2 % Verger de prunier japonais très Carraro et
[2,3 – 16,7]
[0,9 – 3,8] contaminé par l’ESFY (IT) al., 2001
9,7 % 3,8 %
Vergers de Prunus, Carraro et
[4,5 – 17,5] [1,9 – 7,1]
ESFY endémique (IT) al., 2002
Initiaux Initiaux
12,2 % 8,6 %
[8,1 – 17,5] [5,4 – 12,9] 10,1 % 1,7 % Vergers de prunier et de prunier *Carraro et
Tardifs
26,8 %
[19,7 – 34,8]
[6,9 – 14,1] [0,6 – 4] japonais, ESFY endémique (IT) al., 2004c
16,7 % 3,5 %
Prunus variés, Carraro et
[9,2 – 27] [2,6 – 4,6]
ESFY endémique (IT) al., 2004a
4 %
Prunier, myrobolan et prunellier, Jarausch et
[2,6 – 6]
ESFY endémique (FR) al., 2001a
2,6 %
Prunelliers, très loin des cultures *Duriez,
[0,1 – 10,9]
Sur conifères
de Prunus (FR) 2003
2,3 %
[0,4 – 6,9]
Sur Prunus
9,8 %
[7,4 – 12,6]
26,6 %
[20,4 – 33,5]
Conifères en moyenne montagne
et prunelliers très loin des
cultures de Prunus (FR)
Yvon et al.,
2004
18,5 %
Vergers et Prunus sauvages dans Fialová et
[12,9 – 25]
des zones variées (CZ) al., 2004
a
Les valeurs indiquées correspondent aux proportions estimées et à un intervalle de confiance à 95 %.
b
Détection par nested-PCR.
c
Durées d’inoculation variable mais toujours supérieure à 4 jours (et souvent jusqu’à la mort des insectes).
d
Pays dans lequel l’étude a été réalisée : IT, Italie ; FR, France ; CZ, République Tchèque.
e
Pour les références précédées d’un astérisque, les valeurs indiquées ont été calculées par les auteurs.
Enfin, dans les quelques études où C. pruni a été confiné sur des plantes sources d’ESFY
(Carraro et al., 2001 ; Labonne, communication personnelle), le taux de transmission est aussi
faible que celui obtenu à partir des individus prélevés dans la nature. Si cette tendance se
confirmait, il faudrait expliquer (i) pourquoi on n’obtient pas 100 % d’insectes infectieux et
(ii) pourquoi les psylles élevés sur des plantes sources ne sont pas plus efficaces que ceux
prélevés sur le terrain. Un défaut dans le protocole d’acquisition-transmission en conditions
contrôlées peut fournir une réponse unique à cette double question. Si, au contraire, ce
protocole est optimal, alors la première question peut indiquer une latence longue, une
répartition hétérogène du pathogène dans la plante source, ou l’incompétence vectorielle
d’une partie de la population vectrice ; la deuxième question peut signaler que, sur le terrain,
tous les vecteurs ont accès à au moins une plante source de phytoplasme.
- 68 -

Il y a cependant deux réserves à considérer pour interpréter les proportions estimées de
vecteurs infectieux : (i) une hypothèse de la méthode d’estimation est que tous les vecteurs
infectieux du groupe ont transmis, donc le refus de s’alimenter ou la mort de certains vecteurs
aboutit à une sous-estimation de la proportion d’insectes infectieux ; en revanche, le maintien
des vecteurs sur des plantes-tests au-delà de la date à laquelle ils quittent les Prunus surestime
le pouvoir infectieux de la population naturelle ; (ii) l’application de la méthode d’estimation
suppose que tous les événements soient indépendants, ce qui peut être faux en particulier si
l’une des plantes-tests utilisées est très résistante à l’infection ou si la probabilité individuelle
de transmission dépend de la densité des insectes sur la plante. Dans le cas ou l’on cherche à
évaluer la proportion d’insectes porteurs du phytoplasme par un test moléculaire, il est
probable que la détection des vecteurs peu infectés soit d’autant meilleure que l’effectif de
chaque lot testé est faible (dilution du phytoplasme dans les psylles sains).
3) Y a-t-il des tendances générales dans la prévalence des phytoplasmes au sein des
populations vectrices ?
On peut rapprocher la prévalence de ‘Ca. P. prunorum’ dans les populations de C. pruni
échantillonnées et le taux d’infection de différents vecteurs de phytoplasmes touchant des
plantes pérennes (Tableau 3). Pour que cette comparaison ne soit pas biaisée par la sensibilité
de la méthode de détection choisie (PCR ou nested-PCR), les études sur l’ESFY comparant
ces deux méthodes figurent dans le Tableau 3.
Tableau 3. Eléments de comparaison des proportions de vecteurs porteurs de différents phytoplasmes.
Maladie Vecteur
ESFY
ESFY
Cacopsylla
pruni
Cacopsylla
pruni
Proportion de vecteurs infectés a
Age des
vecteurs Nested-PCR PCR Référence b
Réimmigrants
initiaux
tardifs
Emergents
Réimmigrants
sur conifères
sur Prunus
Emergents
Réimmigrants
12,2 % [8,1 – 17,5]
26,8 % [19,7 – 34,8]
10,1 % [6,9 – 14,1]
2,3 % [0,4 – 6,9]
9,8 % [7,4 – 12,6]
26,6 % [20,4 – 33,5]
3,1 % [2,3 – 3,9]
- 69 -
9,1 % [6 – 13]
12,5 % [9 – 16,7]
7,8 % [5,3 – 10,9]
2,3 % [0,4 – 6,9]
2 % [1 – 3,5]
4,3 % [1,4 – 9,2]
*Carraro et al.
(2004c et
communication
personnelle)
Yvon et al., 2004
Apple Cacopsylla
Tedeschi et al.,
proliferation melanoneura Emergents 0,5 % [0,03 – 2,1]
2003
Apple Cacopsylla Réimmigrants 12 %
*Jarausch et al.,
proliferation picta Emergents 14 – 23 %
2004b
Pear decline Cacopsylla
pyricola
3 – 17 %
*Davies et al.,
1995
Pear decline Cacopsylla
pyricola
13,8 – 19 %
*Blomquist &
Kirkpatrick, 2002
Elm
yellows
Macropsis
mendax
5,6 % [0,3 – 23]
Carraro et al.,
2004b
Grapevine
yellows
Hyalesthes
obsoletus
7 – 34 %
*Weber &
Maixner, 1998
a
Les valeurs indiquées correspondent aux proportions estimées et à un intervalle de confiance à 95 %.
b
Pour les références précédées d’un astérisque, les valeurs indiquées ont été calculées par les auteurs.
Il apparaît que les valeurs typiques présentées dans le Tableau 3 (entre 5 et 15 % pour une
détection par nested-PCR) sont assez proches des valeurs obtenues pour d’autres couples
phytoplasme-Cacopsylla. Il s’agit ainsi d’un point commun supplémentaire entre les
pathosystèmes de l’ESFY, du Pear decline et de l’Apple proliferation, trois maladies causées
par des phytoplasmes appartenant au même groupe transmis par des psylles du genre

Cacopsylla et touchant des arbres fruitiers appartenant à la famille des rosacées. Plus
généralement, la cicadelle Macropsis mendax et le cixiide Hyalesthes obsoletus ont des taux
d’infection du même ordre que les psylles, ce qui peut indiquer – sous l’hypothèse d’une
mobilité comparable des vecteurs – que la prévalence de ces phytoplasmoses parmi les
plantes hôtes reste dans une gamme similaire. En effet, du fait de la sensibilité de la détection,
le taux d’insectes porteurs du pathogène représente probablement moins le potentiel
infectieux du vecteur que l’état sanitaire de ses plantes hôtes dans la zone échantillonnée.
Sous certaines conditions, on peut d’ailleurs y voir un moyen original et économique de
comparer, entre différentes zones, la prévalence d’une maladie transmise par vecteur.
Enfin, la comparaison des deux études sur l’ESFY ayant utilisé en parallèle la PCR
classique et la nested-PCR souligne deux phénomènes intéressants qui montrent l’intérêt de
ne pas s’appuyer exclusivement sur la méthode de détection la plus sensible : (i)
contrairement à ce qu’on observe en nested-PCR, la proportion de vecteurs réimmigrants
détectés par PCR classique (vecteurs très infectés) n’augmente pas de façon significative au
cours du temps par rapport à celle mesurée sur les vecteurs en fin d’hivernage, que la zone
étudiée soit en France et éloignée des vergers ou au milieu de vergers touchés par l’ESFY en
Italie ; (ii) par contre, la proportion moyenne de C. pruni très infectés diffère selon la zone
géographique considérée. Ce dernier point conforte les résultats exposés précédemment
concernant les taux de transmission. Bien entendu, il faudrait réaliser une étude multilocale
pour confirmer ces résultats qui pourraient n’être représentatifs que du site expérimental
choisi dans chaque pays.
D. Conclusions sur l’étude des vecteurs de l’ESFY en conditions naturelles
Au vu des différents travaux permettant d’estimer les proportions de C. pruni porteurs de
l’ESFY et infectieux, nous pouvons bâtir le scénario explicatif suivant, cohérent avec
l’ensemble des résultats : certains vecteurs hivernants sont porteurs du pathogène (0,4 à
13 % dans les zones étudiées), dont une forte proportion transmet le phytoplasme lors du
retour sur les Prunus. Suite à leur passage sur des Prunus source de phytoplasme, certains des
psylles réimmigrants acquièrent le phytoplasme, qui s’accumule rarement à un niveau
permettant sa détection en PCR simple. Ces adultes pondent sur des plantes saines ou
infectées, et – selon la prévalence de la maladie dans la zone – les larves et les adultes
émergents acquièrent le phytoplasme en proportion variable. Une partie des vecteurs
émergents accumulent assez de phytoplasme pour qu’il soit détecté en PCR simple, mais très
peu (même parmi ceux qui sont nés sur des plantes infectieuses) deviennent infectieux avant
de quitter les Prunus en conditions naturelles ou de mourir sur ces plantes en conditions
expérimentales. La majorité des vecteurs ne sont infectieux qu’à leur retour sur les Prunus
l’année suivante.
Les expériences présentées dans l’article suivant ont pour objectifs (i) de tester en
conditions contrôlées le scénario présenté dans le paragraphe précédent, en suivant la
cinétique d’accumulation de ‘Ca. P. prunorum’ au cours du cycle de C. pruni à l’aide de la
méthode de quantification présentée au paragraphe II.A, et (ii) de valider expérimentalement
la partie hypothétique du cycle du vecteur en déplaçant manuellement des groupes de vecteurs
entre Prunus et conifères au moment des migrations présumées.
IV. Article IV : “The Spread of European Stone Fruit Yellows is Regulated
by the Life Cycle of its Vector and by the Growth Rate of the Hosted
Phytoplasma, as Assessed by Real-Time PCR”
Gaël Thébaud, Michel Yvon et Gérard Labonne
(En préparation)
- 70 -

The spread of European stone fruit yellows is regulated by the life cycle of
its vector and by the growth rate of the hosted phytoplasma, as assessed by
real-time PCR
G. Thébaud, M. Yvon, and G. Labonne
Institut National de la Recherche Agronomique, UMR BGPI, CIRAD TA 41/K, Campus
international de Baillarguet, 34398 Montpellier cedex 5, France.
ABSTRACT
The spread of ‘Candidatus Phytoplasma prunorum’ by its vector Cacopsylla pruni has
been intensively studied these last years, but some issues about the biology of the vector and
about the transmission processes remain unclear and prevent a clear understanding of the
epidemiology of the disease. In this work, we obtained new information on the overwintering
of C. pruni and we measured the evolution of the quantities of phytoplasma in the insects
after acquisition. The cycle of C. pruni was completed for the first time, demonstrating
directly that it is a univoltine species. From the data obtained at the overwintering sites, we
hypothesized that the overwintering is conditioned by long distance migrations from Prunus
to conifers (in the range of several tens of kilometers). When C. pruni are grown on an
infected plant, they accumulate the phytoplasma and then multiply it so that at the end of the
overwintering period the phytoplasma concentration is at its uppermost value. Adults of the
new generation, though highly infected, had low transmission efficiency. Reimmigrants that
arrive healthy to reproduce on their host plant did not appear to have enough time to acquire
the phytoplasma from an infected plant and then to transmit it to another plant. It seems thus
that the infected overwintering reimmigrants are the main efficient vectors of the phytoplasma
and that the dissemination of the disease require considering both local and regional scales.
Keywords: Apricot, psyllid, Q-PCR, secondary spread.
INTRODUCTION
European stone fruit yellows (ESFY) is a disease damaging mainly apricot (Prunus
armeniaca) and Japanese plum (P. salicina) orchards in Europe. It is due to a phytoplasma for
which the name ‘Candidatus Phytoplasma prunorum’ has been proposed (Seemüller &
Schneider, 2004). It is spread by the psyllid Cacopsylla pruni (Carraro et al., 1998).
C. pruni is a European and Middle-Asiatic species (Lauterer, 1999). In the entomological
records, the species is described as a univoltine species reproducing on Prunus sp., mainly P.
spinosa, and overwintering mainly on conifers (Ossiannilsson, 1992; Hodkinson & White,
1979; Lauterer, 1999). In France, its distribution, host preference and period of presence on
Prunus have been studied (Labonne & Lichou, 2004), and the insect has been found in all the
areas where it was searched, either on wild or cultivated Prunus. The period of presence on
Prunus corresponds to the reproduction of the insect. It extends, with some variations
according to the geographical area, from the beginning of February to the end of June or July.
Two successive morphs were observed during this period: a dark-winged form corresponding
to the reimmigrants coming back on Prunus after overwintering; a light-colored form
corresponding to the adults of the new generation. However, the knowledge about the
overwintering period is very poor and the biological cycle of the species has not been
completed until now, so that the assertions about it are not demonstrated.
C. pruni has been found infected by the phytoplasma in several countries (Italy: Carraro
et al., 1998; Poggi Pollini et al., 2004; France: Jarausch et al., 2001; Spain: Laviña et al.,
2004; Switzerland: Ramel et al., 2001; Czech Republic: Fialová et al., 2004; Bosnia-
Herzegovina: Carraro et al., 2005). Both reimmigrants and adults of the new generation are
- 71 -

infected and infectious in natural populations (Carraro et al., 2004). During the last six years,
the transmission properties of ‘Ca. P. prunorum’ by C. pruni have been intensively studied,
mainly by Carraro et al. (1998, 2001, 2002, 2004). They measured the proportions of infected
and infectious insects in orchards under their conditions; they demonstrated that the
phytoplasma was persistently transmitted; they characterized the minimum acquisition (4
days) and transmission (2 days) periods; they showed that the latency period lasted at least 2
weeks. However, two important points for the epidemiology of the disease remain unclear:
the persistence of the phytoplasma in its vector during the overwintering period and the
possibility of successful transmission by reimmigrants if they acquire the phytoplasma after
their return on an infected plant. These two points determine if transmission from infected
plants to healthy plants occurs within a year or between years, which is of major concern to
define the basic scale of ESFY epidemics and to improve its control since C. pruni migrates
between years.
The aim of this work was to obtain a clear demonstration of the cycle of the insect, to get
information about what happens to the phytoplasma in the vector during the overwintering
period, to assess the possibility of the reimmigrants to acquire and transmit the phytoplasma
during their reproductive period on Prunus, and to connect the biology of the vector to the
transmission processes to improve the knowledge on the epidemiology of ESFY. The
overwintering of C. pruni was investigated during the last years by searching for the insect,
mainly on conifers, in different places at a regional scale and by setting samples of C. pruni
on conifers. A real-time PCR method was designed and used to measure precisely the
evolution of the phytoplasma titer in different stages of the insect.
MATERIAL AND METHODS
Collecting of C. pruni
Reimmigrant C. pruni were collected on blackthorn (Prunus spinosa) hedges during the
months of February to May. The hedges are located in a plain at the north of Montpellier
(Languedoc-Roussillon, France) with “garrigue” and vineyard landscapes. The first stone fruit
orchards are 25 to 30 km away, and only a few Prunus trees are planted in private gardens in
the vicinity of the sites.
Overwintering C. pruni were searched on conifers (Abies, Picea, and Pinus) in the whole
Languedoc area. Samples were mainly collected either on the first line of a high plateau
25 km on the west at an altitude of 700 m (Séranne: site 1), or in the mountains 50 km on the
north-west at an altitude of 1300 m (Aigoual: site 2).
Samples of C. pruni were collected with a beating tray. The reimmigrants were collected
each week on a defined blackthorn hedge with a standardized protocol (20 P. spinosa
sampled). During the same period, overwintering C. pruni were searched on Abies sp. trees in
the site 1 (sampling of 20 min each time).
Life cycle of C. pruni
To complete the life cycle of C. pruni, adults of the new generation were obtained on
Prunus marianna ‘GF 8-1’ in climatic chambers and deposited during July and August on
conifers at site 1 on Abies sp., at site 2 on Picea abies and near the laboratory (site 3) on Pinus
halepensis. They were maintained on the shoots inside sleeve cages made of fine-meshed
tissue closed at both extremities until they were collected in February of the following year.
To test the hypothesis that some C. pruni could overwinter on P. spinosa plants,
experiments were made on a natural bush of P. spinosa where the psyllid was regularly
collected. A part of the bush was enclosed under two cages in December after the departure of
the new generation but before the arrival of the reimmigrants. Each cage enclosed a surface of
1.8 × 1.8 m. Two sticky blue traps (which had proven to be attractive for C. pruni) were set
- 72 -

inside the cage. The cages were removed and the traps controlled the following year, after the
arrival of C. pruni on the P. spinosa plants. The experiment was repeated twice.
Acquisition of ‘Ca. P. prunorum’ by C. pruni from infected plants
Reimmigrants of C. pruni were collected from natural populations on P. spinosa, either
near Montpellier or on the Larzac plateau. To acquire the phytoplasma, the insects were set on
infected plants covered by sleeve cages. The source plants were previously tested to confirm
the presence of ‘Ca. P. prunorum’. They were mainly P. marianna inoculated by grafting with
the same isolate of ‘Ca. P. prunorum’ one or two years before the experiments. To avoid any
problem which could be linked to the Prunus species or to the phytoplasma isolate, a small
number of acquisition experiments were also made with other isolates and 2 other species (P.
armeniaca, P. salicina). After a defined time of acquisition, the insects were set on healthy
test plants (young cuttings of P. marianna) by groups of 5 to 15 adults. To achieve enough
statistical power for detecting an effect of a preliminary acquisition on the transmission
efficiency 1155 and 630 C. pruni were included as control in transmission experiments in
2003 and 2004, respectively.
Infected nymphs and adults of the new generation were obtained in climatic chambers
from eggs laid by the reimmigrants on the previously described source plants. Psyllids were
collected 20 days after inoculation when still alive. Test plants were then sprayed with an
insecticide and incubated in an insect-proof greenhouse.
Detection of ‘Ca. P. prunorum’
Detection of ‘Ca. P. prunorum’ in plants and insects was performed by PCR using the
primer pair ESFYf/r described previously (Yvon et al., in preparation). The test plants were
checked for phytoplasma infection the year following the inoculation.
Quantification of ‘Ca. P. prunorum’ in C. pruni
The quantities of phytoplasma in samples of C. pruni were measured by real-time PCR
using the TaqMan method described in Yvon et al. (in preparation). As the extraction process
proved to be highly reproducible, the number of phytoplasma detected in each insect is
generally used directly. However, to give an estimate of the absolute quantity of phytoplasma
in a given class of insect, the number of phytoplasma detected was expressed relatively to the
quantity of cells of each insect (determined by the internal standard of psyllid DNA) and this
quantity was then weighted by the mean quantity of cells per class of individual (nymph,
emergent or reimmigrant). By using this calculation, the number of cells was supposed to be
constant inside each class, the number of cells calculated for each individual being the result
of its specific extraction quality.
The psyllids came either from natural populations, or from rearing in controlled
conditions and overwintering on conifers in sites 1 and 2 (Table 1). The insects coming from
natural populations were supposed to be generally healthy as the proportion of infected
individuals was only 2.6% in another experiment with the same populations and 3.1% at the
overwintering sites. Only one insect which successfully transmitted the phytoplasma to a
healthy P. marianna could be recovered and its phytoplasma titer was measured. A small
number of male and female reimmigrants were compared for the quantity of phytoplasma
they have accumulated after a 21-day acquisition period on the same infected plant.
RESULTS
Overwintering of C. pruni
Entomological data on the overwintering of C. pruni indicate mainly conifers as shelter
plants during winter. But the possibility for the vector to overwinter on some parts of P.
- 73 -

spinosa was not totally excluded, as indicated by Lauterer (1999) and based on the occurrence
of another Cacopsylla species, C. pyri, in bark crevices of its host (pear tree) during winter.
The experiments carried out during two successive years by enclosing parts of a bush of P.
spinosa gave negative results: no C. pruni was collected on the traps under the cages although
C. pruni reimmigrants were found on the other parts of the bush.
During the overwintering period of the 4 last years, an episodic survey was carried out on
the conifers in the whole area around Montpellier (Table 2). We were unable to detect C.
pruni on the Pinus halepensis surrounding the blackthorn hedges and bushes in the plain
(except one individual found in December 2003 on a P. halepensis on the top of a hill). C.
pruni was found on P. halepensis in small numbers but regularly on the first line of hills north
of Montpellier. It was found regularly on Abies sp. at site 1 and at some places on the plateau
north of site 1 on Pinus nigra. It was found regularly in the whole mountainous area including
site 2 on Abies alba, Picea abies, and Pinus sylvestris. Additional samplings in site 1 and site
2 indicated a heterogeneous distribution of C. pruni with apparent accumulation in specific
parts of the forest.
Enclosing C. pruni on conifer shoots under sleeve cages allowed recovering surviving C.
pruni at the end of their natural overwintering period at all 3 sites. The proportion of
surviving adults inside these cages was irregular (0% to 54%) but generally small (Table 3).
For each site, a sample of surviving C. pruni was recovered and set on a P. marianna
plant. The eggs laid on each plant developed normally in nymphs and new adults. Thus, for
the first time, the biological cycle of C. pruni has been completed, demonstrating directly that
the individuals found on conifers are the same than those reproducing on Prunus and that
there is only 1 generation per year.
C. pruni were sampled weekly on P. spinosa and then on Abies at site 1 (Fig. 1). The
highest numbers of adults of the new generation occurred in weeks 23 and 24 on P. spinosa.
Later samplings gave only a few individuals and not any one after week 27. On conifers, the
first C. pruni was collected on week 26 and the highest numbers were obtained on week 30
and after. Thus, the period of emigration of the new generation from P. spinosa in the plain
corresponded roughly to the period of arrival of the insects on conifers. However, the
synchronism is not strict as there is at least a gap of 2 weeks between the decrease of C. pruni
populations on the monitored P. spinosa hedge and their increase on conifers on site 1.
Detection of ‘Ca. P. prunorum’ in overwintering C. pruni
Samples of C. pruni collected on conifers in winter at sites 1 and 2 were checked for the
presence of the phytoplasma. One out of 52 was detected infected at site 1, and 7 out of 204 at
site 2. This result demonstrates that the phytoplasma persists in its vector during the
overwintering period.
Transmission of ‘Ca. P. prunorum’ by C. pruni
Transmission experiments carried out in 2003 and 2004 with reimmigrants indicated that
about 0.5% of the sampled populations of C. pruni were infectious (confidence intervals:
[0.19% - 1.13%] in 2003; [0.04% - 1.14%] in 2004). Whatever the duration of the acquisition
period on infected plants and the duration of the transmission period, we were unable to find
out any significant increase of the transmission efficiency, despite the rather large number of
insects tested (Table 4).
The adults of the new generation reared on infected plants were able to infect a few test
plants but they showed a transmission efficiency of only 0.6% (Table 5). As the emerging
adults of C. pruni exhibit a strong emigration behavior from their Prunus hosts, it can be
thought that the feeding behavior of the new adults on Prunus plants can prevent the
transmission of the phytoplasma. Thus, 16-day old nymphs reared on infected plants were
deposited on healthy test plants in comparison to young adults. There was no significant
difference in the transmission efficiency between nymphs and young adults.
- 74 -

Quantification of ‘Ca. P. prunorum’ in C. pruni
When C. pruni was reared on infected plants, the quantity of phytoplasma increased
during the time from a mean of 5.4×10 4 phytoplasma in the nymphs collected 19 to 21 days
after hatching to 2.0×10 7 phytoplasma in the adults at the end of the overwintering period
(Fig. 2). As the highest phytoplasma titer was found in C. pruni overwintering on conifers, it
can be assumed that the phytoplasma is conserved or multiplied in the insects outside their
reproduction host. Within each experimental modality, the variability in the phytoplasma
quantities measured is rather low, but in the sample of 85-day old and in the sample of
overwintering C. pruni, a few individuals seemed to have lost almost all the phytoplasma. We
hypothesize that these individuals were not able to multiply the phytoplasma.
Even after 1 day on an infected plant, the reimmigrants contained a measurable quantity
of phytoplasma, clearly differentiating them from the control insects. This demonstrates that
they have fed on the plants and have acquired the phytoplasma. The mean quantity of
phytoplasma measured after 1, 2, 10 or 21 days of acquisition remained around 10 4
phytoplasmas detected and the quantities measured in each individual are quite similar one to
another. After they were transferred from infected plants to healthy plants, the quantity of
phytoplasma differed greatly depending on the individuals (Fig. 3). Many insects lost almost
completely the phytoplasma (particularly those remaining only 1 day on the infected plant). In
other insects, the quantity of phytoplasma reached values between 10 6 and 10 7 . This 100-fold
increase relatively to the previous values can be explained only by a multiplication of the
phytoplasma inside the insects after a latency period. Through these results, the latency period
can be evaluated around 30 days after acquisition.
No significant difference appeared between the samples of 4 males and 9 females (not
shown). The comparison of gave. In the unique individual that was recovered after a
successful transmission, the number of detected phytoplasma was the higher (1.9×10 8 ) than in
any other tested C. pruni.
DISCUSSION
For the first time, the entire life cycle of C. pruni was experimentally completed. It
allowed obtaining several insects which were reared on source plants. It was thus possible to
test these insects after the overwintering period (8 months later) and it is the first time that the
evolution of the quantities of a phytoplasma has been monitored by quantitative PCR in its
vector over the lifetime of the insect.
Real-time PCR offers the possibility to quantify phytoplasmas in plants or insects. The
SYBR green technology has recently be used for quantifying the titer of ‘Ca. P. mali’ (apple
proliferation) in plants (Torres et al., 2005; Jarausch et al., 2004) or in insects (Jarausch et al.,
2004) and TaqMan technology in plants (Christensen et al., 2004). Here we used the TaqMan
technology to quantify ‘Ca. P. prunorum’ in its vector. The first pair of primers and probe
obtained for a psyllid was associated to new primers and probe for the phytoplasma.
For the insects reared on infected plants, the phytoplasma titer increased after the
emergence of adults, kept up during the overwintering period and was at the uppermost titer at
the end of the overwintering period, when the insects return to their reproduction hosts. These
measures are in agreement with the detection of some infected C. pruni in natural populations
found on conifers during winter (Yvon et al., 2004). They are also in agreement with the
detection of infected C. pruni in the first reimmigrants caught in orchards (Carraro et al.,
2004).
The quantities of phytoplasma measured in nymphs and young emigrants is much lower
(between 10 4 and 10 5 ) than in the old emigrants (around 10 7 ). With these values, it seems
unlikely that nymphs and young emigrants could efficiently transmit the phytoplasma to a
plant. This is in agreement with the absence of difference in the experiment where either
infected nymphs or adults were set on healthy test plants. Although the nymphs necessarily
- 75 -

fed on the plants, they did not transmit more than the adults set later: they appeared to be
unable to infect the plants at this stage. This is also in agreement with the high quantity (10 8 )
phytoplasma observed in the unique infectious C. pruni tested.
Old emigrants were able to inoculate a few test plants in the transmission experiments,
but the proportion of infectious insects remained low (0.6%). This is in agreement with the
results of Carraro et al. (2003; 2004). The quantity of phytoplasma measured in these insects
did not explain the low proportion of infection, as it reached its highest value in the old
emigrants. The feeding behavior of the emigrants may be the cause of the low transmission
rate. In natural conditions, emigrants did not remain a long time on Prunus and in
transmission experiments most insects died when they were set on the healthy test plants. We
hypothesize that the newly emerged adults are repelled by the Prunus and generally do not
feed on it.
The quantity of phytoplasma in reimmigrants that have had an access to an infected plant
is quite low (around 10 4 ) and almost the same for acquisition periods between 1 and 21 days.
But at the end of the transmission period, 20 days later, the quantity of phytoplasma measured
in some insects was much higher. It can be assumed that during the first step the phytoplasma
just accumulated in the insects but that a multiplication took place after at least 3 weeks post
acquisition. Nine C. pruni out of the 28 tested showed such an increase of the quantity of
phytoplasma. Only one insect exhibited a value higher than 10 7 , similar to what was measured
in the old emigrants reared on infected plants. Even in this case, it cannot be certain that the
quantity of phytoplasma resulted from the acquisition on the infected plant as the 28 insects
came from a natural population in which a proportion of about 3% of insects are infected. The
experiments made by comparing the proportions of transmission from natural populations of
reimmigrants with populations that have had an access to an infected plant demonstrated no
difference, even with the insects which had 40 days post acquisition. Thus, these results
question the ability of the reimmigrants to acquire and transmit ‘Ca. P. prunorum’ if they are
not infected before the overwintering period: even if they acquire the phytoplasma by landing
and feeding on an infected plant, only very few of them will multiply the phytoplasma fast
enough to be infectious before their death.
Thus, from the transmission experiments and the measures of the quantity of
phytoplasma, the nymphs, the emigrants, and the healthy reimmigrants appeared to be much
less efficient vectors of ‘Ca. P. prunorum’ than the reimmigrants which arrive infected from
the overwintering sites.
The dynamics of C. pruni on the observed P. spinosa hedge indicated that the emerging
adults leave their host plants quickly: the peak of emergence lasted only 2 weeks. As there
seemed to be a good correlation between the dynamics of C. pruni at several sites in the same
area (Labonne & Lichou, 2004), a large number of C. pruni will leave their host plant at the
same time to go to another plant or area. Most of the reports of C. pruni out of Prunus plants
indicated conifers as shelter plants, and we were also unable to detect the insect on other
plants. The search for C. pruni on conifers in the plain, near the sites where P. spinosa were
abundant and where the insect reproduce gave an almost negative result. The closest site
where a significant density of C. pruni was detected is the first border of the Larzac plateau
(site 1), about 15 km west from the reproduction area that we observed. The highest density of
C. pruni was found in a mountainous site (site 2) were P. spinosa and other wild Prunus are
absent or very rare at a distance of several kilometers. All of these facts suggest the
hypothesis that C. pruni migrates on distances of several kilometers or more after its
emergence on Prunus, probably by using the dominant winds which blow from the sea to the
land at this season. The results of forced overwintering on conifers suggested also that the
survival, while possible in plain (Table 3), might be more efficient when the insects are in
altitude.
The synthesis of the results on the life cycle of C. pruni and of its transmission efficiency
at different stages of its life suggests the following scenario for the dissemination of ‘Ca. P.
- 76 -

prunorum’: the infectious reimmigrants would be the main vectors of the phytoplasma; they
would inoculate susceptible plants when they return to reproduce on Prunus at the end of the
winter; emerging psyllids would get infected when living on an infected plant, either
cultivated or wild and, after migrating to overwinter on the conifers, the insects would either
conserve or multiply the phytoplasma. In this scenario, the wild Prunus may play a central
role because they produce numerous vectors and they are reservoirs of the phytoplasma
(Carraro et al., 2002); on the contrary, most of the cultivated Prunus are treated with
insecticides and some of them are second-hand hosts to the vector, and thus their contribution
to the pool of C. pruni is limited. Some questions remain about the distances and trajectory of
the migratory flights, but this scenario implies a regional scale for the spread of the
phytoplasma, as the migrations of C. pruni seem to occur at distances of several tens of
kilometers.
ACKNOWLEDGMENTS
This work was partly supported by the INRA / Région Languedoc-Roussillon program
PSDR and by the INRA AIP EpiEmerge. The experimental overwintering of C. pruni was
undertaken with the collaboration of ONF and Parc National des Cévennes.
REFERENCES
Carraro L., Osler R., Loi N., Ermacora P., Refatti E. (1998). Transmission of European
stone fruit yellows phytoplasma by Cacopsylla pruni. Journal of Plant Pathology 80: 233-239
Carraro L., Loi N., Ermacora P. (2001). Transmission characteristics of the European
stone fruit yellows phytoplasma and its vector Cacopsylla pruni. European Journal of Plant
Pathology 107: 695-700
Carraro L., Ferrini F., Ermacora P., Loi N. (2002). Role of wild Prunus species in the
epidemiology of European stone fruit yellows. Plant Pathology 51: 513-517
Carraro L., Ferrini F., Labonne G., Ermacora P., Loi N. (2004). Seasonal infectivity of
Cacopsylla pruni, vector of European stone fruit yellows phytoplasma. Annals of Applied
Biology 144: 191-195
Christensen N. M., Nicolaisen M., Hansen M., Schulz A., 2004. Distribution of
phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Molecular
Plant-Microbe Interactions 17 (11): 1175-1184
Delic D., Martini M., Ermacora P., Carraro L., Myrta A. (2005). First report of fruit tree
phytoplasmas and their psyllid vectors in Bosnia and Herzegovina. Journal of Plant Pathology
87: 149-150
Fialova R., Navratil M., Valova P., Kocourek F., Poncarova-Vorackova Z., Lauterer P.
(2004). Epidemiology of European stone fruit yellows phytoplasma in the Czech Republic.
Acta Horticulturae 657: 483-487
Hodkinson I.D., White I.M., 1979. Homoptera Psylloidea. Handbooks for the
identification of British insects II (5). Royal Entomological Society of London
Jarausch W., Danet J. L., Labonne G., Dosba F., Broquaire J.M., Saillard C., Garnier M.
(2001). Mapping the spread of apricot chlorotic leaf roll (ACLR) in southern France and
implication of Cacopsylla pruni as a vector of European stone fruit yellows (ESFY)
phytoplasmas. Plant Pathology 50: 782-790
Jarausch W.; Peccerella T.; Schwind N.; Jarausch B., Krczal G., 2004.Establishment of a
quantitative real-time PCR assay for the quantification of apple proliferation phytoplasmas in
plants and insects. Acta Horticulturae 657: 415-420
Labonne G., Lichou J. (2004). Data on the life cycle of Cacopsylla pruni, psyllidae vector
of European stone fruit yellows (ESFY) phytoplasma, in France. Acta Horticulturae 657: 465-
470
- 77 -

Lauterer P., 1999. Results of the investigations on Hemipterain Moravia, made by the
Moravian Museum (Psylloidea 2). Acta Musei Moraviae, Scientiae biologicae 84: 71-151.
Laviña A., Sabate J., Garcia-Chapa M., et al. (2004). Occurrence and epidemiology of
European stone fruit yellows phytoplasma in Spain. Acta Horticulturae 657: 489-494
Ossiannilsson F., 1992. The Psylloidea (Homoptera) of Fennoscandia and Denmark. E.J.
Brill, Leiden, 347 pp.
Poggi Pollini C.P., Bissani R., Giunchedi L., et al. (2004). Detection of European stone
fruit yellows phytoplasma (ESFYP) in Homoptera insects and in wild stone fruit trees
collected in peach orchards in Northern Italy. Acta Horticulturae 657: 513-518
M. E. Ramel, P. Gugerli, L. Bourquin, J. d. Meyer and L. Schaub, 2001. Characterization
of apricot chlorotic leaf roll and detection of ESFY phytoplasma in western Switzerland.
Revue Suisse de Viticulture, Arboriculture et Horticulture 33: 279-286
Seemüller E., Schneider B. (2004). ‘Candidatus Phytoplasma mali’, ‘Candidatus
Phytoplasma pyri’ and ‘Candidatus Phytoplasma prunorum’, the causal agents of apple
proliferation, pear decline and European stone fruit yellows, respectively. International
Journal of Systematic and Evolutionary Microbiology 54: 1217-1226
Torres E., Bertolini E., Cambra M., Montón C., Martín M.P., 2005. Real-time PCR for
simultaneous and quantitative detection of quarantine phytoplasmas from apple proliferation
(16SrX) group. Molecular and Cellular Probes 19: 334-340
Table 1. Origins of the individual C. pruni tested in real-time PCR
Stage Origin
Nymphs controlled conditions on P. marianna
New generation controlled conditions on P. marianna
Overwintering adults controlled conditions on P. marianna then
(181 day old) site 2 on Picea abies
Overwintering adults controlled conditions on P. marianna then
(319 day old) site 1 on Abies sp.
Reimmigrants natural population from P. spinosa
(except Ri21)
Reimmigrants Ri21 controlled conditions
(healthy adults overwintering on site 1)
- 78 -

Table 2. Occurrence of Cacopsylla pruni on conifers in the Languedoc area (2001-2005).
Each sample was obtained in 20 minutes with a beating tray (except those indicated *)
Site Altitude Host plant Occurrence a Mean b
Gigean 170 m Pinus nigra & P. halepensis 0/1 0
Fabrègues 200 m Pinus nigra & P. halepensis 0/3 0
Mas de Londres 180 m Pinus nigra & P. halepensis 0/3 0
Villeveyrac 100 m Pinus halepensis 0/2 0
Montferrier
(site 3)
100 m Pinus halepensis 0/4 0
Vailhauques 300 m Pinus halepensis 1/1 1
St Guilhem le
Désert
650 m Pinus nigra salzmanni 2/2 1
Les Lavagnes
(site 1)
700 m Abies sp 24/26 8.4
Les Lavagnes 700 m Pinus nigra 0/2 0
Les Lavagnes 700 m Cedrus sp 0/3 0
Les Lavagnes -
Coupette
710 m Abies sp 1/1 4
Les Lavagnes -
Sauvie
560 m Abies sp & Pinus sp. 0/1 0
Les Lavagnes - 660 m Pinus nigra 0/1 0
Laret
La Vacquerie 700 m Pinus nigra 0/1 0
La Couvertoirade 800 m Pinus nigra & P. sylvestris 5/5 2 (+ 125*)
Millau 800 m Pinus nigra & P. sylvestris 0/1 0
LeCaylar 800 m Pinus nigra 1/1 1
LeCaylar 800 m Cedrus sp 0/1 0
L'Escandorgue 780 m Pinus nigra 0/2 0
L'Escandorgue 780 m Pseudotsuga menziesii 0/1 0
Col du Minier 1260 m Abies alba & Picea abies 1/1 2
L'espérou - MF 1300 m Abies alba & Picea abies 2/2 3.5
L'espérou 1230 m Abies alba & Picea abies 0/1 0
Les Pises (site 2) 1260 m Abies alba, Picea abies, Pinus
nigra
5/5 13.2
Col de l'Homme 1340 m Abies alba & Picea abies 1/1 4
Mort
Col de Faubel 1320 m Picea abies 1/3 1
Camprieu 1130 m Abies alba & Picea abies 1/3 1 (+ 51*)
Douch 1020 m Pinus nigra & P. sylvestris 1/1 2
a Number of samples with C. pruni / total number of samples
b Mean number of insects collected per sample
* Intensive sampling during several hours
- 79 -

Table 3. Proportion of Cacopsylla pruni alive after overwintering on conifers.
Number of C. pruni
set from June to C. pruni alive on Percentage
Site August 2004 February 2005 of survival
1 1380 113 8.19%
2* 1020 11 1.08%
3 975 12 1.23%
* Fungal epidemics killed a large proportion of the psyllid populations at this site (both
natural populations and laboratory psyllids inside sleeve cages).
Table 4. Transmission of ‘Ca. P. prunorum’ by C. pruni reimmigrants collected from natural
populations on P. spinosa after acquisition on infected Prunus sources.
Modality 2003 * 2004 *
control 6 / 1155 2 / 630
1 day acquisition 4 / 400
7-10 days acquisition 6 / 1235
20 days acquisition 1 / 200 4 / 480
* Infectious C. pruni / total number tested
Table 5. Transmission of ‘Ca. P. prunorum’ by C. pruni new generation after rearing on
healthy or infected Prunus sources; the psyllid were deposited either at the nymph or adult
stage.
Rearing plant Stage at the deposition Experiment 2004 *
healthy adult 0 / 620
infected nymph 3 / 300
infected adult 2 / 600
* Infectious C. pruni / total number tested
- 80 -

Number of C. pruni on P. spinos
40
35
30
25
20
15
10
5
C. pruni 2004
0
0
6 11 16 21 26 31 36 41 46 51
Week
- 81 -
reimmigrants
new generation
on conifers
Fig. 1. Assessment by sampling on plants of the period of presence and density of C. pruni
reimmigrants and emigrants on Prunus spinosa and period of presence of the emigrants on
conifers. The sampling includes either 20 P. spinosa or 20 min on conifers.
phytoplasma quantity
1,E+08
1,E+07
1,E+06
1,E+05
1,E+04
1,E+03
1,E+02
1,E+01
1,E+00
Ec38 1-1
Ec65 1-1
Li19a 1a-2
Li19a 2a-2
Li19a 2a-4
Li19a 1b-3
Li19a 1b-5
Li21a 2-6
C. pruni reared on infected plants
Li21a 2-8
Ei38a 1a-1
Ei38a 1b-3
Ei38a 1b-5
Ei44a 1-2
Ei44a 1-4
Ei65a 1a-1
Ei65a 1b-3
Ei65a 1b-5
individual C. pruni
control nymphs new gen 38 d new gen 44 d new gen 65 d new gen 85 d wint 181 wint 319
Fig 2. Quantity of phytoplasma detected in individual C. pruni reared on an infected plant.
Control: adults of the new generation reared on a healthy plant; nymphs: nymphs 19 or 21
days after hatching; new gen 33, 44, 65, 85: adults of the new generation 33, 44, 65 and 85
day-old (calculated after egg hatching); wint 181, 319: adults 181 and 319 day-old
overwintering on conifers.
Ei65a 2a-2
Ei65a 2a-4
Ei65b 1a-1
Ei65b 1b-3
Ei65b 1b-5
Ei65b 2b-2
Ei65b 2b-4
Ri181W 1a-1
Number of C. pruni on conifers
Ri181W 1b-3
Ri319W 2-2
18
16
14
12
10
8
6
4
2
Ri319W 2-4
Ri319W 2-6

phytoplasma quantity
1,E+08
1,E+07
1,E+06
1,E+05
1,E+04
1,E+03
1,E+02
1,E+01
1,E+00
Rc50 1a-1
Rc50 1c-4
Rc21 1-2
Rc21 1-5
Ri1a 1-3
Ri1a 2-1
C. pruni after acquisition on an infected plant
Ri1a 2-4
Ri2a 1-2
Ri2a 1-5
Ri10a 1-3
Ri10a 2-1
Ri10a 2-4
Ri21a 2-2
Ri21af 2-1
control acq 1 d acq 2 d acq 10 d
individual C. pruni
acq 21 d acq 1 d +tr acq 10 d +tr acq 20 d +tr
Fig 3. Quantity of phytoplasma detected in individual reimmigrant C. pruni after acquisition
on an infected plant. Control: adults reimmigrants from a natural population; acq 1, 2, 10,
21d: reimmigrants tested just after a 1, 2, 10 or 21 day acquisition period on an infected plant;
acq 1, 10, 21 d + tr: reimmigrants tested after 1(or 2), 10 or 21 day acquisition period on an
infected plant followed by a 20 day period of transmission on a healthy plant.
- 82 -
Ri21af 2-4
Ri21af 2-7
Ri21af 2-10
Ri1b 1-3
Ri1b 2-1
Ri1b 2-4
Ri2b 1-2
Ri10b 1-1
Ri10b 1-4
Ri10b 2-2
Ri10b 2-5
Ri20b 1b-3
Ri20b 2a-1
Ri20b 2a-4

V. Bilan sur le fonctionnement de la vection
Ce travail apporte un double éclairage sur l’épidémiologie de l’ESFY. Concernant la
biologie de C. pruni, son cycle hypothétique a été vérifié expérimentalement : C. pruni est
donc bien un insecte univoltin passant le printemps sur des Prunus et le reste de l’année sur
des conifères ; de plus, la quasi-synchronicité observée entre la brusque disparition du vecteur
en plaine et sa brusque apparition dans les zones d’hivernage accrédite l’hypothèse de
migrations entre ces deux types de zones.
Concernant les modalités de la vection, les expérimentations en conditions contrôlées
permettent de mieux comprendre les observations réalisées en conditions naturelles, en
accédant à une échelle inférieure dans la description des mécanismes biologiques sousjacents.
On peut ainsi affiner le scénario décrit précédemment. En effet, 8 des 10 individus
infectés expérimentalement puis maintenus en captivité sur conifères pendant plus de 8 mois
sont très infectés, ce qui démontre définitivement la rétention longue de ce phytoplasme. Tous
les stades multiplient efficacement le phytoplasme. Cependant, rares sont les vecteurs qui, en
une durée compatible avec leur présence sur les Prunus en conditions naturelles, accumulent
le phytoplasme à un niveau équivalent à celui atteint chez les adultes réimmigrants (jusqu’à
20 millions par insecte). Si l’on suppose que ce haut niveau d’infection est nécessaire à la
transmission, alors on comprend mieux la forte corrélation entre le taux de détection et le taux
de transmission pour les premiers psylles réimmigrants, ainsi que le faible taux de
transmission des vecteurs émergents par rapport à leur taux d’infection. Tout indique que
l’essentiel des transmissions se fait environ 9 mois après l’acquisition, par les adultes
réimmigrants ayant acquis le phytoplasme dans leur jeunesse, même s’il manque encore une
démonstration directe de ce résultat majeur aux conséquences multiples. Ainsi, la
complémentarité et la cohérence des résultats obtenus en conditions naturelles et
expérimentales permettent de lever certaines inconnues du cycle épidémique de l’ESFY, et
d’en présenter une version actualisée (Figure 15), à comparer avec la Figure 13, page 23.
Epicéa,
pin, sapin
en moyenne
montagne
Rétention du
phytoplasme
Octobre
Janvier
Juillet
Départ
des Prunus
Retour sur
les Prunus
Adultes
réimmigrants
(vieux)
- 83 -
Œufs
Avril
Larves
Adultes
émergents
(jeunes)
Acquisition du
phytoplasme
Transmission
du phytoplasme
Acquisition du
phytoplasme
Transmission du
phytoplasme
Prunus
en plaine
Figure 15. Connaissances acquises sur le cycle de C. pruni et sur la vection de l’ESFY. Les transmissions
se font surtout à une échelle interannuelle. L’acquisition puis la transmission par les adultes réimmigrants
(flèche en pointillés) reste incertaine ; si elle est possible, il s’agit d’un événement rare. (Photo : N. Sauvion)

A partir des connaissances acquises sur la vection et sur l’interaction vecteur-abricotier,
on peut émettre des hypothèses simples sur le développement spatio-temporel attendu de la
maladie dans un verger d’abricotier. La partie suivante décrit la construction de tests
d’indépendance relativement génériques, utilisés ici pour identifier les hypothèses biologiques
les plus cohérentes avec les propriétés statistiques des motifs spatio-temporels observés dans
les vergers.
- 84 -

Partie III : Tester des
hypothèses sur le
développement de l’ESFY
en verger
« Quand vous avez éliminé l’impossible, ce qui reste,
même improbable, doit être la vérité »
(Conan Doyle)
- 85 -

Lors de l’émergence d’une maladie, la localisation spatio-temporelle des individus
malades est souvent le premier indice – et parfois le seul – susceptible de guider le chercheur
vers les processus biologiques qui en sont responsables. Dans le cas de l’ESFY, la découverte
du vecteur (Carraro et al., 1998b) a permis de réaliser des avancées sur les propriétés de
l’acquisition et de la transmission du phytoplasme par une approche expérimentale.
Cependant, il est nettement plus difficile de mettre en œuvre des expérimentations pour
identifier les déplacements du vecteur dans des vergers d’abricotier où il est très peu
abondant. La solution choisie repose donc sur l’étude indirecte des déplacements des vecteurs
infectieux via la marque qu’ils peuvent laisser sur les arbres où ils se sont nourris : l’ESFY.
En effet, quand un vecteur est le seul responsable de la transmission d’une maladie, les
motifs spatio-temporels dessinés par les plantes inoculées (de coordonnées x, y et t) sont le
fruit de trois phénomènes : les variations d’abondance du vecteur, ses comportements de
dispersion à l’échelle considérée, et les propriétés de la vection sensu stricto (c’est-à-dire
l’acquisition, la latence et la transmission). Il faut également tenir compte de la durée
d’incubation dans la plante car, en conditions naturelles, la donnée observée n’est pas la date
d’inoculation mais une date plus tardive à laquelle la méthode de détection choisie (la
symptomatologie, dans notre cas) est efficace. Aux phénomènes précédemment mentionnés
s’ajoute donc la réaction de la plante au pathogène, qui peut être binaire (réussite ou échec de
la transmission) ou quantitative (durée avant la détection ; en cas de détection basée sur les
symptômes, il s’agit de la durée d’incubation). Dans un premier temps (et tant que rien ne
démontre le contraire), on se basera sur les résultats d’inoculation expérimentale pour faire
l’hypothèse d’une incubation relativement courte pour tous les arbres infectés, de l’ordre d’un
an ou deux. Les propriétés de la vection sont dans ce cas le principal déterminant des motifs
spatio-temporels observés mais, lors des interprétations, on conservera à l’esprit la possibilité
d’une incubation plus longue dans la plante.
La démarche retenue consiste à éliminer progressivement les hypothèses explicatives les
moins vraisemblables compte tenu des éléments acquis expérimentalement et des motifs
spatio-temporels observés, afin de cerner peu à peu les hypothèses les plus probables pour
expliquer le développement spatio-temporel de la maladie dans les vergers d’abricotier.
Concrètement, il s’agit de tester la compatibilité entre les scénarios de vection élaborés dans
la partie précédente et les coordonnées des plantes malades. La première étape de cette
approche indirecte est donc d’élaborer une série d’hypothèses testables sur les motifs spatiotemporels
à partir des scénarios biologiques retenus.
I. Traduction des hypothèses biologiques en hypothèses d’indépendance
Pour qu’un psylle émergent réalise des transmissions dans un verger d’abricotier, il
semble nécessaire qu’il soit pondu sur une plante source, et il doit être présent sur un
abricotier sain entre le moment où il peut transmettre la maladie (après la fin de la latence) et
celui où il quitte les Prunus. Or, l’abricotier n’est pas un hôte très apprécié par C. pruni : on
trouve très peu le vecteur dans les vergers d’abricotier, et dans ce cas, principalement sur des
“pruniers” (P. domestica et P. cerasifera) utilisés comme porte-greffes (Labonne & Lichou,
2004). On peut observer des pontes sur les abricotiers en conditions naturelles (Schaub &
Monneron, 2003), mais la longévité et la fécondité du psylle sur l’abricotier étant réduites sur
cet hôte (Carraro et al., 2004a), on constate qu’en situation de choix entre des abricotiers et
des Prunus plus favorables, les pontes et les larves sont peu nombreuses sur les abricotiers
(Labonne & Lichou, 2004). Comme les transmissions expériementales indiquent que seule
une faible proportion de ces rares vecteurs émergents présents sur les abricotiers est capable
de transmettre le phytoplasme avant de quitter les Prunus, il est très peu probable que les
psylles émergents contribuent à transmettre la maladie entre abricotiers au sein d’un même
verger. Ils ne seront donc pas considérés par la suite. On supposera que les vecteurs
- 86 -

émergents migrent dans des massifs forestiers éloignés et qu’à leur retour, ils se redistribuent
sur une large zone, indépendamment de l’endroit d’où ils proviennent (et où ils ont acquis le
phytoplasme).
Il reste les transmissions et les comportements des vecteurs réimmigrants. On supposera
(au vu des résultats de PCR quantitative) qu’ils ne sont pas capables d’acquérir puis de
transmettre le phytoplasme au cours du même printemps. Il n’est pas exclu que C. pruni se
déplace en groupes de quelques individus dans les vergers pendant sa période de
reproduction. Cependant, étant donné son manque d’affinité pour l’abricotier et la faible
proportion de vecteurs réimmigrants infectieux, il est improbable que plusieurs vecteurs
infectieux se déplacent dans un même groupe, car cela impliquerait la présence dans le verger
de groupes d’une taille incompatible avec les observations de terrain. On considérera donc
que les vecteurs infectieux sont indépendants. On peut d’ailleurs vérifier cette hypothèse sur
les motifs spatiaux des arbres malades observés dans les vergers en testant l’hypothèse
d’indépendance spatiale entre les différentes “taches” d’arbres malades, ce qui est l’objet d’un
article présenté en Annexe 4.
Bien que l’on ait déjà éliminé les scénarios les moins probables, il en reste de nombreux
autres à tester sur la base des motifs spatiaux attendus. Ces différents cas de figure
correspondent à tous les croisements possibles de trois comportements élémentaires : le choix
du premier arbre inoculé (SCENARIO A : aléatoire ; SCENARIO B : près d’un bord ; SCENARIO
C : dans certaines zones plus favorables), le nombre d’arbres inoculés par chaque vecteur
infectieux (SCENARIO 1 : un au plus ; SCENARIO 2 : plus de un), et l’attraction exercée par les
plantes malades, par exemple du fait d’un débourrement précoce (SCENARIO a : attraction ;
SCENARIO i : indifférence). Ainsi, le scénario le plus simple concernant le comportement d’un
vecteur infectieux dans un verger d’abricotier (SCENARIO A1i) consiste à considérer qu’il
arrive seul, par erreur et aléatoirement, puis se nourrit sur un arbre au plus avant de repartir en
terres plus hospitalières à la recherche de ses congénères. Dans ce cas, les contaminations
observées chaque année devraient être indépendantes (entre elles et par rapport aux
contaminations précédentes) et identiquement distribuées (réparties complètement au hasard
sur la surface du verger). Dans les autres scénarios, les psylles peuvent effectuer plusieurs
piqûres de nutrition sur des arbres proches ou arriver préférentiellement dans une partie
localisée du verger. Les motifs spatio-temporels attendus sous les différents scénarios sont
regroupés dans le Tableau 4. Tous ces scénarios sont simplifiés car ils n’explicitent pas
l’impact de la réaction de la plante, ni la possibilité que du matériel infecté ait été planté à la
création du verger.
Il apparaît que certains des scénarios envisagés (A2a, C1a, C1i, C2a et C2i) ne peuvent
pas être départagés sur la base de ces seuls critères. Il faudrait alors s’intéresser à la forme des
agrégats ou à l’intensité de l’agrégation. En théorie, on peut différencier les autres
comportements, mais en pratique, la puissance des tests statistiques nécessaires peut être un
facteur limitant. Leur disponibilité aussi ; d’où la présentation dans la partie suivante d’un
programme permettant de tester des hypothèses d’indépendance sur une grille (les arbres sont
plantés sur les nœuds d’une grille), puis son utilisation dans le cadre d’une étude exploratoire
(par des tests d’hypothèses) des motifs spatiaux et temporels observés dans des vergers.
- 87 -

Tableau 4. Propriétés attendues des motifs spatio-temporels selon les comportements du vecteur.
Motif initial des
Relation entre les plantes
malades à des dates
Motif final des
Scénario plantes malades
successives
plantes malades
A1a Aléatoire Agrégation Agrégé
A1i Aléatoire Indépendance Aléatoire
A2a Agrégé Agrégation Agrégé
A2i Agrégé Indépendance Agrégé
B1a
Aléatoire, sachant
l’effet de bord
Agrégation, sachant
l’effet de bord
Agrégé, sachant
l’effet de bord
B1i
Aléatoire, sachant
l’effet de bord
Indépendance, sachant
l’effet de bord
Aléatoire, sachant
l’effet de bord
B2a
Agrégé, sachant
l’effet de bord
Agrégation, sachant
l’effet de bord
Agrégé, sachant
l’effet de bord
B2i
Agrégé, sachant
l’effet de bord
Indépendance, sachant
l’effet de bord
Agrégé, sachant
l’effet de bord
C1a Agrégé Agrégation Agrégé
C1i Agrégé Agrégation Agrégé
C2a Agrégé Agrégation Agrégé
C2i Agrégé Agrégation Agrégé
II. Analyse exploratoire des motifs spatiaux et temporels
On peut parfois souhaiter tester autre chose que les hypothèses d’indépendance présentées
dans le paragraphe précédent mais, en général, ces hypothèses peuvent être testées dans tout
verger ayant fait l’objet d’un suivi systématique : on cherchera donc le plus souvent à savoir
si un groupe de points est réparti de façon aléatoire dans le verger, ou si plusieurs groupes de
points sont indépendants entre eux. Par conséquent, à l’instar de l’étude expérimentale de la
vection exposée dans la partie précédente, la première étape pour analyser le développement
spatio-temporel de la maladie consiste à créer un outil permettant de réaliser avec fiabilité des
analyses classiques “en routine”, c’est-à-dire en minimisant la nécessité de réadapter tout test
statistique aux particularités de chaque verger étudié.
A. Un programme générique pour tester des hypothèses d’indépendance
Le programme réalisé regroupe dans un ensemble cohérent plusieurs modules destinés à
effectuer de manière flexible différents tests d’indépendance spatiale basés sur des
permutations. La flexibilité introduite concerne le type de test, la forme des données (arbres
sains ou malades, date des premiers symptômes), la statistique de test et le choix des
permutations. Ainsi, ce programme est un outil d’analyse pour la plupart des cartes de
maladie car il permet en général de gérer les plantes manquantes, les vergers de forme variée,
les plantations non régulières et les structures sous-jacentes connues. Pour explorer les
propriétés des jeux de données disponibles, la statistique de test la plus utilisée par la suite est
basée sur la distribution (cumulée) des distances entre tous les points :
Qc(d) = ∑ N( δ ) ∑ Nsim
( δ ) = Nc(d) / N csim(
d ) ,
δ ≤d δ ≤d
où Nc(d) est le nombre de couples de plantes symptomatiques plus proches qu’une distance d,
et N csim(
d ) est le nombre moyen simulé de couples de plantes symptomatiques plus proches
qu’une distance d. Une variante de cette statistique de test, Vc(d), est utilisée en complément
pour ses propriétés légèrement différentes (plus sensible que Qc(d) pour détecter de
l’agrégation sauf pour les fortes proportions de plantes malades). Cette statistique de test est
- 88 -

identique à Qc(d) sauf qu’elle est basée sur la distribution des distances entre chaque point et
son plus proche voisin, uniquement. Enfin, une autre variante de ce test est utilisée pour
identifier un éventuel effet de bord, qui est la forme d’hétérogénéité spatiale la plus
fréquemment rencontrée lors de l’étude d’une maladie dans des parcelles agricoles en
conditions de production. La statistique Bc,i(d) repose sur les distances entre chaque plante
symptomatique et les différents bords i du verger, et Bc(d) repose sur la distance entre chaque
plante symptomatique et le bord le plus proche. En première approximation, les distances aux
bords simulées sont obtenues par la redistribution aléatoire des positions des arbres malades
parmi l’ensemble des arbres sains ou malades. Par défaut, les statistiques de test choisies
n’apportent pas d’information directionnelle, mais une option permet de les calculer
uniquement sur le rang ou perpendiculairement au rang.
Un aperçu 1 du programme R obtenu et enrichi au fur et à mesure des analyses, figure en
Annexe 2. Dans l’article présenté ci-dessous, il a été utilisé pour analyser les distributions
spatiales des arbres malades dans 4 vergers adjacents plantés la même année et suivis pendant
17 ans. Les analyses exploratoires présentées dans cet article sont destinées à tirer profit des
différentes combinaisons variété/porte-greffe pour suggérer des hypothèses sur les processus
intervenant dans l’introduction et le développement de l’ESFY au cours du temps.
B. Article V : “Spatio-Temporal Analysis of Disease Spread Provides Insights into
the Epidemiology of European Stone Fruit Yellows”
Gaël Thébaud, Gérard Labonne, Claude Castelain et Joël Chadœuf
Acta Horticulturae (2004) 657 : 471-476
1 L’intégration au mémoire des 1400 lignes de la version actuelle de ce programme aurait présenté peu d’intérêt,
donc seules les principales fonctions sont brièvement décrites, dont l’une un peu plus en détail, comme exemple.
- 89 -

Spatio-temporal Analysis of Disease Spread Provides Insights into the
Epidemiology of European Stone Fruit Yellows
Gaël Thébaud, Claude Castelain, Joël Chadœuf
and Gérard Labonne
UMR BGPI
Institut National de la
Recherche Agronomique
Montpellier, France
Station de Pathologie Végétale
INRA
Domaine Saint-Maurice
Montfavet, France
- 90 -
Unité de Biométrie
INRA, Domaine Saint-Paul
Site Agroparc
Avignon, France
Keywords: incidence curve, disease map, simulation, permutation, ESFY, apricot chlorotic
leaf roll, statistics.
ABSTRACT
European stone fruit yellows (ESFY) is caused by a phytoplasma and transmitted by
Cacopsylla pruni. As it is becoming a major threat in Europe for Prunus orchards, we need
more knowledge on many fundamental epidemiological processes of this disease. Up to now,
the spread of ESFY in an orchard has not been analysed on a statistical basis, and the
underlying mechanisms are poorly documented: How is the pathogen introduced into an
orchard? How long are the incubation, latent and infectious periods for the infected trees?
What is the current range of the dissemination? Can we estimate transmission parameters
from the observed patterns? To begin addressing these questions, we adopted a hypothesis
testing approach to the spatio-temporal correlations between the symptomatic trees. The case
study presented here is based on a long-term (17 years) survey and mapping of symptomatic
trees in a group of 4 adjacent apricot orchards. After a description of the temporal dynamics
of the disease and of its spatio-temporal pattern, we tested hypotheses on the proximity
between symptomatic trees. Our results show the unevenness of disease introduction and/or
symptom expression within this group of orchards. We also demonstrate that the infected
trees are too close from one to another to be the result of independent infections. The
epidemiological significance of the results is discussed.
INTRODUCTION
The European stone fruit yellows (ESFY) phytoplasma is the causal agent of apricot
chlorotic leaf roll and other decline diseases affecting trees of the Genus Prunus (Lorenz et
al., 1994). Symptoms of ESFY have been reported for a long time in French orchards
(Chabrolin, 1924), but the intensity of recent outbreaks highlights that this disease is a major
threat for the new cultivars of apricot (Prunus armeniaca L.) and for Japanese plum (P.
salicina Lindl.). Recently, significant epidemiological results have been produced:
identification of the vector Cacopsylla pruni Scopoli (Carraro et al., 1998), detection of wild
plant hosts for the phytoplasma (Jarausch et al., 2001b), and characterisation of vector
transmission in controlled conditions (Carraro et al., 2001). At present, one of the major
challenges is to understand the biological processes that are responsible for the spread of the
disease at the scale of an orchard, and at a regional scale.
Although an increasing number of spatial or spatio-temporal data sets are being collected,
few of them (Labonne et al., 2000; Jarausch et al., 2001a) have been used to analyse the
spread of ESFY. This work aims at (i) illustrating how a clear visual summary of the data can
suggest hypotheses and (ii) showing that a framework based on statistical tests of these
hypotheses is useful to gain insights into the epidemiology of a disease.

MATERIALS AND METHODS
Characteristics of the Group of Orchards
The 4 contiguous plots, planted in 1982, are located in the Rhone Valley near the city of
Valréas (Vaucluse, France). They are quite isolated from other orchards (the closest one is
about 3 km away). Their size ranges from 68 to 596 trees, and the planting distance is 5 m
within and across rows. Each orchard was planted with a different combination
rootstock/cultivar. Three apricot cultivars (‘Polonais’, ‘Rouge de Fournès’ and ‘Modesto’),
and four rootstocks were used: myrobalan (P. cerasifera), GF 8-1 (P. marianna), GF 31
(P. cerasifera × P. salicina) and P. armeniaca ‘Manicot’ (for more details, see Fig. 1A).
Symptomatic trees were not removed. Most of them died within about 2 years. Before 1993,
dead trees were replaced; after this year, they were just cut.
Disease Assessment
From March 1984 to March 2000, this group of orchards was inspected twice a year (in
March and October). The trees with typical ESFY symptoms (early bud break, paper-like
rolled leaves, off-season growth) were located on a map. The trees with new symptoms in
March were pooled with those recorded in October the year before, because the vectors live
on Prunus from March to July (Labonne and Lichou, 2003). Replanted trees were not taken
into account in the analyses in order to avoid additional uncontrolled variability because of
age or cultivar differences.
Statistical Methods
1. Temporal Analysis. We depicted both annual disease incidence and cumulative
disease incidence. Incidence is defined as the ratio of the number of new symptomatic trees to
the number of susceptible trees (living trees that never showed symptoms).
2. Spatio-temporal Analysis. The data set was cut into 4 distinct periods (1983-85; 1986-
89; 1990-95; 1996-99) based on the temporal evolution of disease incidence. We first tested
the evenness of disease introduction between the 4 orchards during the years 1983-85 and
1986-89, so we calculated the likelihood to see no symptomatic tree inside 2 plots out of 4,
under the assumption of a random introduction of the disease.
In a second test, we inspected the spatial randomness of diseased trees for each period and
also for the whole duration of the epidemic. We used a method based on distances between all
possible pairs of points and related to 2DCLASS (Gray et al., 1986; Nelson et al., 1992). For
each possible pair of symptomatic trees, the distance between the two points was computed
and assigned to a distance class (noted d). Then we performed 1000 simulations under the
spatial randomness hypothesis by reallocating (randomly) an equal number of diseased trees
within each orchard (thus conserving the structure of the group of orchards). For each
simulation (noted s), the number of pairs of symptomatic trees in the distance class d, noted
Nsim(s,d), was counted. Then for each of the 21 distance classes, we calculated R(d) which is
the ratio between the number of observed pairs Nobs(d), and the mean number of simulated
pairs Nsim (d) . Each R(d), mathematically defined below, was then plotted with its 95%
confidence interval.
1000
N
∑
s=
sim(s,
d)
Nobs(d)
1
R(d) = , with Nsim (d) =
Nsim(d)
1000
For the first test, the likelihood was straightforward to obtain, whereas for distance class
tests the statistic R(d) was compared to an empirical 95% confidence interval (Diggle,1983)
estimated after 1000 simulations of the null hypothesis (the 25 th and 975 th smallest values of
the simulated statistic were used). The points lying outside the confidence interval indicate
distance classes that depart from the null hypothesis.
- 91 -

RESULTS
Data Summary
Fig. 1B shows that a greyscale map (of common use to summarise topography, for
example) allows an intuitive overview of how the disease spreads in the orchards in space and
time. For the temporal patterns, Fig. 1A enhances the contrasting evolution of annual disease
incidence in the 4 adjacent orchards during the years 1983-1989.
Introduction of the Disease
During the years 1983-1985 (respectively 1986-1989), the probability to observe no
symptomatic tree in orchards 1 and 3 (resp. 3 and 4) under the hypothesis of a random
introduction of the disease over the 4 orchards (25 (resp. 41) random inoculations) is:
⎛ N1
+ N
25
3 ⎞
⎛ N 3 + N − 9
41
4 ⎞
P1 = ⎜1−
⎟ P2 = ⎜1
−
⎟
⎝ N1
+ N 2 + N 3 + N 4 ⎠
⎝ N1
+ N 2 + N 3 + N 4 − 25 ⎠
where Ni is the number of trees in the i th orchard (see Fig. 1A for the values of Ni). Both
probabilities are very low (P1 = 7.5×10 -11 and P2 = 4.4×10 -4 ), which indicates a very significant
uneven timing of expression of ESFY in the 4 adjacent orchards.
Spatial Characteristics within Each Period of the Epidemic
Whatever the period considered, there was always an excess (significant or not) of pairs
of points for the first two distance classes, and often up to 35 m (data not shown). Fig. 2 is
given as an example, because spatial aggregation (corresponding to an high R index) becomes
obvious when we consider the whole epidemic: the points for the first distance classes are
clearly outside their respective 95% confidence intervals.
DISCUSSION
Methodological Considerations
1. Data Summary. Although significant methodological work have been devoted to the
analysis of spatio-temporal binary data in plant epidemiology, more basic aspects have been
neglected, which could hamper the optimal analysis of data sets. For example, a plot of the
disease progress curve may not be the most meaningful representation for this kind of
epidemics, because its cumulative nature can hide temporal patterns (e.g. cyclic patterns).
Thus we chose to plot both annual incidence and cumulative incidence curves (which
corresponds to the classical disease progress curves). For the mapping, our visual display
contrasts with typical spatio-temporal maps (for example: Jarausch et al., 2001a; Pethybridge
and Madden, 2003) in that a single map allows a direct perception of disease spread in time
and space. As every summary, our representation has some limits: it is only made for binary
data and it is not appropriate when one wants to take account of changes in the sanitary status
of infected plants (recovery or replanting of healthy material).
2. Permutation Methods. These non-parametric tests are frequently used in the literature
and specific computer applications based on these methods have been dedicated to the
analysis of regularly spaced binary data, as 2DCLASS (Nelson et al., 1992) and STCLASS
(Nelson, 1995) which allow routine analysis of spatial patterns of plant diseases. In our study,
each plot was planted with a different combination of rootstock and cultivar, which had an
obvious impact on the temporal evolution of the disease in each orchard (Fig. 1A), so the
permutations were made inside each orchard. If spatial randomness is to be tested in a slightly
different context (e.g. irregularly spaced plants), this method can be adapted easily. Our first
approach also contrasts with two-dimensional distance class analyses in that the Euclidian
distance between points is the only criteria to define a distance class (i.e. no directional
information was used). This choice increases the number of pairs in each distance class and
- 92 -

allows summarising in one graph (i) R: the observed excess of points as a function of distance
and (ii) a 95% confidence interval for each distance class.
Epidemiological Interpretations
There are at least three assumptions that can account for the observed independent
evolution of symptom expression in the 4 orchards during the first years of the epidemic: (i)
ESFY has been introduced with the planting material, (ii) the rootstock and/or the cultivar
influence the incubation period, (iii) the vectors have been attracted by 2 cultivars and/or
rootstocks. The pattern for the years 1986-1989 suggests the secondary hypothesis of a
gradient of infectious vectors coming from outside into the upper orchards.
For the second test, we can give several interpretations of the spatial dependence
between the nearest neighbours within each group of years: (i) the vectors (progeny included)
infect several neighbouring trees, (ii) short-distance secondary spread and symptom
expression occurs within each group of years, (iii) attractiveness and/or symptom expression
are conditional to an underlying factor which acts at a short range.
As far as spatial randomness is concerned, each test provides a clear answer. However,
the matter in epidemiology is more often to determine the cause of a given non-randomness
than to simply reject randomness. Therefore, we gave for each test a set of plausible
explanatory assumptions, which are non-exclusive: a pattern can be the result of two
phenomena or more. In order to link the observations to their cause, it is necessary to keep in
mind that the whole survey relies on the visual detection of the first typical symptoms, so we
have to be aware of the potential role of the incubation period.
These results suggest three major explanatory hypotheses: (i) several neighbouring trees
are probably infected by each vector (or group of vectors), (ii) the combination
rootstock/cultivar could influence the length of the incubation period and (iii) the planting of
diseased material is suspected. These last two points remind us that the impact of the disease
on production can be decreased if the planting of highly susceptible cultivars is avoided and if
all the necessary steps are taken to guarantee the initial sanitary status of the material
(Labonne and Lichou, 2003).
Concluding remarks
Our preliminary results show that a case study, although limited in time and space, is a
way to gain insights into the epidemiology of a disease if one carries out a detailed analysis of
both spatial and temporal patterns (a detailed analysis of annual incidence could provide more
information, but this is out of the scope of this article). The flexible approach of hypothesis
testing is a first step towards modelling because it summarises and emphasizes the features of
disease spread. These statistical tests also foster the statement of explanatory assumptions,
which can then be included in the conceptual framework of a mechanistic model. Our future
work will be dedicated to design a model that explicitly takes the vectors into account.
ACKNOWLEDGEMENTS
We thank Dr. Sylvie Dallot for her critical analysis of the manuscript.
LITERATURE CITED
Carraro, L., Loi, N. and Ermacora, P. 2001. Transmission characteristics of the European
stone fruit yellows phytoplasma and its vector Cacopsylla pruni. Eur. J. Plant Pathol.
107:695-700.
Carraro, L., Osler, R., Loi, N., Ermacora, P. and Refatti, E. 1998. Transmission of European
stone fruit yellows phytoplasma by Cacopsylla pruni. J. Plant Pathol. 80:233-239.
Chabrolin, C. 1924. Quelques maladies des arbres fruitiers de la vallée du Rhône. Annales des
Epiphyties. 10:263-338.
- 93 -

Diggle, P.J. 1983. Statistical Analysis of Spatial Point Patterns. Mathematics in Biology
Series, R. Sibson and J.E. Cohen (eds.). Academic Press, London, UK.
Gray, S.M., Moyer, J.W. and Bloomfield, P. 1986. Two-dimensional distance class model for
quantitative description of virus-infected plant distribution lattices. Phytopathology.
76:243-248.
Jarausch, W., Danet, J.-L., Labonne, G., Dosba, F., Broquaire, J.-M., Saillard, C. and Garnier,
M. 2001a. Mapping the spread of apricot chlorotic leaf roll (ACLR) in southern France
and implication of Cacopsylla pruni as a vector of European stone fruit yellows (ESFY)
phytoplasmas. Plant Pathol. 50:782-790.
Jarausch, W., Jarausch Wehrheim, B., Danet, J.-L., Broquaire, J.-M., Dosba, F., Saillard, C.
and Garnier, M. 2001b. Detection and identification of European stone fruit yellows and
other phytoplasmas in wild plants in the surroundings of apricot chlorotic leaf rollaffected
orchards in southern France. Eur. J. Plant Pathol. 107:209-217.
Labonne, G., Broquaire, J.-M., Jarausch, W., Freydier, M. and Quiot, J.-B. 2000. Enroulement
chlorotique de l’abricotier : la base d'une stratégie de lutte en vergers d'abricotiers.
Phytoma. 530:32-35.
Labonne, G. and Lichou, J. 2003. Enroulement chlorotique de l’abricotier : le point sur le
vecteur Cacopsylla pruni et les implications relatives à la lutte contre la maladie.
L’Arboriculture Fruitière. 571:XXIX-XXXII.
Lorenz, K.H., Dosba, F., Poggi Pollini, C., Llacer, G. and Seemuller, E. 1994. Phytoplasma
diseases of Prunus species in Europe are caused by genetically similar organisms.
Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz. 101:567-575.
Nelson, S.C. 1995. STCLASS - spatiotemporal distance class analysis software for the
personal computer. Plant Dis. 79:643-648.
Nelson, S.C., Marsh, P.L. and Campbell, C.L. 1992. 2DCLASS, a two-dimensional distance
class analysis software for the personal computer. Plant Dis. 76:427-432.
Pethybridge, S.J. and Madden, L.V. 2003. Analysis of spatiotemporal dynamics of virus
spread in an Australian hop garden by stochastic modeling. Plant Dis. 87:56-62.
- 94 -

(A)
(B)
Fig. 1. Summary of the spatio-temporal spread of ESFY in 4 contiguous apricot orchards. The
order of the four graphics corresponds to their spatial disposition on the map. A: Annual and
cumulative incidence from March 1984 to March 2000. B: Spatio-temporal map of ESFY.
Each square symbolize one tree, darker squares denoting older symptom expression. The lines
symbolise the limits of each orchard. In the text, orchards are referred to by the number on
their left.
0 50 100 150 200
Distance (meters)
Fig. 2. Spatial dependence between trees that showed symptoms between 1983 and 1999. The
ratio R is plotted as a function of distance and is figured by points. The empirical 95%
confidence envelope for the null hypothesis (spatial randomness) is represented by two
dashed lines.
1
2
- 95 -
3
4

C. Bilan
Cet article indique que l’hypothèse la plus simple mentionnée en introduction (A1i) n’est
pas recevable : les motifs observés ne sont pas compatibles avec une seule transmission pour
chaque vecteur arrivant de façon aléatoire et indépendante des plantes malades, même si on
tient compte de l’hétérogénéité des variétés dans ce “méta-verger” ou si on ne regarde que les
contaminations finales (pour éluder la question du matériel initial potentiellement infecté). Ce
qui apparaît encore plus clairement, c’est que la combinaison porte-greffe/cultivar a un impact
crucial sur le développement temporel de la maladie, et plus particulièrement sur la durée
avant l’observation des premiers arbres malades (et non sur l’incidence cumulée finale,
puisque dans 3 des 4 vergers, l’incidence cumulée 17 ans après plantation est sensiblement la
même). Les explications les plus cohérentes avec ces caractéristiques sont l’effet de la
combinaison porte-greffe/cultivar sur la durée d’incubation, et/ou la plantation de matériel
contaminé dans 2 des 4 vergers.
Pour aller plus loin dans l’analyse, on a besoin de tester si la localisation des plantes
malades dépend des plantes symptomatiques aux dates précédentes. Il s’agit donc cette fois de
tester l’indépendance spatiale entre deux ensembles de points qui sont eux-mêmes
potentiellement structurés spatialement. Ce test existe déjà en milieu continu, mais pas sur des
grilles régulières comme les vergers, où il faut corriger la statistique de test pour qu’elle
prenne en compte la censure générée par les arbres manquants et par les arbres malades à la
première date (qui ne guérissent pas). L’article suivant présente la méthode qui a été
développée pour surmonter les difficultés propres à ce type de données.
III. Article VI : “Investigating Disease Spread Between Two Dates with
Permutation Tests on a Lattice”
Gaël Thébaud, Nathalie Peyrard, Sylvie Dallot, Agnès Calonnec et Gérard Labonne
(Phytopathology, sous presse)
- 96 -

Investigating Disease Spread between Two Assessment Dates with
Permutation Tests on a Lattice
Gaël Thébaud, Nathalie Peyrard, Sylvie Dallot, Agnès Calonnec, and Gérard Labonne
First, third, and fifth authors: Institut national de la recherche agronomique (INRA), UMR
BGPI, CIRAD TA 41/K, Campus international de Baillarguet, 34398 Montpellier Cedex 5,
France; first and second authors: INRA, Unité de Biométrie, Domaine Saint-Paul, Site
Agroparc, 84914 Avignon Cedex 9, France; and fourth author: INRA, UMR Santé Végétale,
71 avenue Edouard Bourlaux, BP 81, 33883 Villenave-d’Ornon Cedex, France.
Corresponding author: Gaël Thébaud; E-mail address: thebaud@ensam.inra.fr
ABSTRACT
Thébaud, G., Peyrard, N., Dallot, S., Calonnec, A., and Labonne, G. xxxx. Investigating
disease spread between two assessment dates with permutation tests on a lattice.
Phytopathology #:xxx-xxx.
Mapping and analyzing the disease status of individual plants within a study area at
successive dates can give insight into the processes involved in the spread of a disease. We
propose a permutation method to analyze such spatiotemporal maps of binary data (healthy or
diseased plants) in regularly spaced plantings. It requires little prior information on the causes
of disease spread and handles missing plants and censored data. A Monte Carlo test is used to
assess whether the location of newly diseased plants is independent of the location of
previously diseased plants. The test takes account of the significant spatial structures at each
date in order to separate nonrandomness caused by the structure at one date from
nonrandomness caused by the dependence between newly diseased plants and previously
diseased plants. If there is a nonrandom structure at both dates, independent patterns are
simulated by randomly shifting the entire pattern observed at the second date. Otherwise,
independent patterns are simulated by randomly reallocating the positions of one group of
diseased plants. Simulated and observed patterns of disease are then compared through
distance-based statistics. The performance of the method and its robustness are evaluated by
its ability to accurately identify simulated independent and dependent bivariate point patterns.
Additionally, two real-world spatiotemporal maps with contrasting disease progress illustrate
how the tests can provide valuable clues about the processes of disease spread. This method
can supplement biological investigations and be used as an exploratory step before developing
a specific mechanistic model.
Additional keywords: censoring, distance class, European stone fruit yellows,
nonparametric, Plum pox virus, toroidal shift.
One of the main goals of plant disease epidemiologists is to understand the underlying
processes of epidemics. When the epidemiology of a disease is poorly known, for example in
the case of an emerging disease (2,37), the initial questions often include the following: How
to summarize the progress of the disease in time and space? Is there secondary spread at the
scale considered, i.e., do previously diseased plants provide the inoculum that infects the
newly diseased plants? What are the biological processes responsible for disease spread?
Answering these questions can help identify control strategies, design sampling procedures
(21,23), or build mechanistic models (15).
Understanding plant disease epidemiology was initially based on the analysis of the
temporal progress of diseases (41), with the introduction of correction factors (basically, a
reduction of the rate of disease progress) to take into account the effect of disease clustering
- 97 -

on temporal dynamics (5,25,42). However, temporal analysis has limitations when it is used
to draw conclusions about the underlying processes of disease spread because many different
phenomena can generate the same temporal progress (4,5). Recently, the spatial patterns of
plant diseases have been investigated more systematically. Plant species whose health status
can be mapped individually are frequently grown in regular lattices (e.g., orchards, vineyards,
some vegetable crops, and commercial forest plots). This article focuses on the exploratory
analysis of such maps as an initial step in epidemiological studies. Because it requires few
assumptions and little prior knowledge of the processes of spread, the nonparametric
approach based on distances between mapped individuals (10,36,40) is well suited to such
preliminary epidemiological studies. It was popularized in plant disease epidemiology by
Gray et al. (19), who developed a specific two-dimensional method to identify the spatial
patterns of diseased individuals using multiple Monte Carlo tests. Subsequently, several
specific software packages have been developed, including 2DCLASS (29), STCLASS
(27,28), and 2DCORR (13), which have been used to analyze spatial patterns of plant diseases
(17,18,32,38). Spatial analyses not only identify disease clustering, but can also suggest
processes of disease spread (a directional effect along rows, for example, often indicates a
spread by way of cultural interventions or plant contacts). However, when disease is
significantly clustered, several explanations can be given: within-field spread from previously
diseased plants, of course, but also proximity to an external source of inoculum (e.g., along
field borders), local heterogeneity in plant susceptibility, successive inoculations (for vectorborne
diseases with persistent transmission), or planting of a batch of infected plants (19).
Multiple interpretations of clustering allow few deductions about the biological processes that
are responsible for the observed spatial pattern, mainly due to a possible confounding between
spatial and temporal effects (39). Therefore, additional information is necessary to gain
insight into the processes of disease spread.
The spatiotemporal pattern of diseased plants can be used to go one step further because it
provides a way to distinguish the basic spatial pattern of the disease from its temporal
progress. Then it becomes possible to test hypotheses that are more directly related to the
biological processes of spread: Are the newly diseased plants located at random? Is there a
spatial relationship between newly diseased plants and previously diseased plants? Nelson
(28) provided a technique to answer the first question using a permutation test in which the
positions of missing plants and previously diseased plants are fixed during the simulations of
the null hypothesis. However, in his approach to the second question, randomness of disease
increase is tested globally: nonrandomness caused by the spatial relationship between newly
diseased plants and previously diseased plants is not separated from nonrandomness caused
by the spatial structure within newly diseased plants. Mugglestone et al. (26) developed a test
of independence between diseased plants at two dates on a lattice, restricted to the situation
where diseased plants at the first assessment date are scarce and located at random.
The aim of the work presented here is to develop a nonparametric method to assess
whether the location of newly diseased plants depends on the location of previously diseased
plants within regular plantings. At each date, diseased plants can be clustered or not, and this
information is taken into account: the expected patterns under the null hypothesis are
simulated consistently with the observed spatial pattern within each group. Thus, the method
is based on a set of three Monte Carlo tests, corresponding to different combinations of
patterns at time 1 and time 2. After presenting these tests, their accuracy and robustness are
evaluated with computer-simulated data sets, and they are applied to real-world
spatiotemporal disease maps.
MATERIALS AND METHODS
Overview. The method described here is dedicated to the analysis of a common kind of
binary data sets that are collected when diseased and healthy plants are mapped over time, and
- 98 -

when some plants may be missing for a reason unrelated to the disease. The systems have the
following characteristics: (i) plants are regularly spaced along and across rows, but the
distance between two plants along rows can differ from the distance across rows; (ii) a plant
must be either missing, healthy, diseased at time 1, or diseased at time 2; and (iii) diseased
plants at time 1 are still diseased at time 2 (successive inoculations of the same plant cannot
be observed; roguing followed by replanting is not taken into account). These features
correspond primarily to systemic diseases (5) of vegetables, vines, fruit trees, and commercial
forest trees. However, our method can also be used in the analysis of other pathosystems that
can reasonably be reduced to a binary spatiotemporal data set (quantitative data transformed
into binary data, batch analyses, a field divided into a grid of contiguous diseased or healthy
quadrats).
The tested null hypothesis (H0) is: “the location of diseased plants at the second
assessment date is independent of the location of previously diseased plants”. The value of a
statistic measuring the spatial dependence between these two groups of plants is compared
with its distribution under H0. To this aim, a set of expected patterns is simulated by
randomizing the pattern observed at one date without altering its significant spatial structures.
A crucial rule in the simulations is that the probability for a given plant to be in a given status
must be the same in simulated data as it had been in the observed data (this implies, for
example, that a diseased plant in an expected pattern must not appear at the location of a
missing plant in the actual data).
Observed and simulated patterns are then compared through distance class analysis: in
both observed and simulated data, every pair of plants composed of one t1 case and one t2 case
is assigned to a distance class (‘t1 cases’ denoting diseased plants at time 1, and ‘t2 cases’
denoting healthy plants at time 1 that are diseased at time 2). This class is exclusively
determined by the distance between plants, regardless of orientation. The subsequent
statistical test is based on the radial cumulative frequency of distances between t1 - t2 pairs of
cases (i.e., the number of t1 - t2 pairs of cases within a circle of increasing radius): using this
cumulative function (13,22,36) instead of a non-cumulative function increases the power of
the test for the initial distance classes and reduces the variability of the curves. Then, a test
statistic is defined to provide a direct evaluation of the cumulative departure of the observed
pattern from H0. To assess the significance of this departure, we compute the same statistic on
the observed data and on 1000 Monte Carlo simulations of H0 (which preserves the identified
spatial structures – or their absence – within each group). For each distance class, once sorted,
the simulated values with a rank corresponding to the upper and lower significance thresholds
define a confidence interval for the statistic under H0. In addition, for this bilateral test, an
approximate P-value is computed, following Manly (24), as twice the proportion of simulated
values more extreme than or equal to the observed value.
For a given distance class (and a given significance level, e.g., 5%) the test can
provide three different results: (i) the number of pairs is too high to be compatible with the
independence between t1 cases and t2 cases; (ii) the number of pairs is too low to be
compatible with the independence between t1 cases and t2 cases; and (iii) we cannot exclude
the possibility that t1 cases and t2 cases result from independent causes. Here, we always
assume that nonrandomness can be caused either by an excessive aggregation or by an
excessive regularity, thus we use a two-sided test with a global 5% significance divided in
two symmetrical parts. Of course, if an excess of regularity is impossible, then a one-sided
test should be performed with a 5% significance level. We also applied these general
principles to implement directional tests along and across rows, the only difference being that
the computed distances only involve plants that are located within the same row (or interrow).
To test the independence conditional on the intra-group spatial structures, the most
general test preserves the pattern within both t1 cases and t2 cases. However, the systematic
inclusion of a spatial structure that may not exist can reduce the power of the test. To avoid
- 99 -

such a situation, we suggest taking into account the pattern of t1 cases or t2 cases only when
they are significantly structured (Table 1): when both patterns are structured, t2 cases are
randomly shifted relative to t1 cases (Test 3); when only one of the two patterns is
significantly structured, the non-structured pattern is randomized (Test 1 and Test 2); when
none of the two patterns is significantly structured, t2 cases are randomized (Test 1). Hence, in
the absence of prior knowledge of the expected spatial patterns, a preliminary analysis of the
spatial pattern at each date is required to decide which kind of randomization should be
applied (and to which set of points). This analysis should be carried out with a method that
correctly handles missing plants; if permutations are used, the location of t1 cases should be
fixed during the random permutations of t2 cases. Subsequent to this preliminary analysis, one
of the following three tests can be applied.
Random pattern at date 2 (Test 1). Test 1 is performed when the preliminary analysis
indicates that the spatial repartition of newly diseased plants (t2 cases) shows no significant
departure from randomness, whatever the spatial pattern of t1 cases. As in STCLASS (28), the
locations of both missing plants and t1 cases are fixed, and t2 cases are randomly reallocated
among the other plants. But instead of considering the distances between all diseased plants,
we compute a test statistic that is only based on the distances between t1 cases and t2 cases.
Since the representation of cumulative frequencies leads to graphical scaling effects that can
mask a significant departure from randomness in the first distance classes (3), counts are
standardized by the mean of simulated values, leading to:
Qc(d) = ∑ N( δ ) ∑ Nsim
( δ ) = Nc(d) / N csim(
d ) , (1)
δ ≤d δ ≤d
Nc(d) being the number of t1 - t2 pairs of cases closer than or equal to distance d, and
( d ) being the mean number of simulated t1 - t2 pairs of cases closer than or equal to
N csim
distance d.
If the observed value of Qc(d) in a given distance class is significantly different from the
simulated set of values (strictly higher than the 975 th value or strictly smaller than the 25 th , for
a bilateral test with a 5% significance level and 1000 simulations), we can conclude that the
location of t2 cases depends on the location of t1 cases, i.e., disease did not spread in a random
way.
Structured pattern at date 2 only (Test 2). Test 2 is performed when t2 cases are
significantly structured whereas no spatial structure could be identified within t1 cases. This
test involves random permutations (reallocations) of t1 cases among all plants except missing
plants. Thus, some simulated t1 cases can overlay t2 cases. This is impossible in real
spatiotemporal surveys where multiple infections of the same plant cannot be detected (t1
cases hide future potential t2 cases, thus no plant will belong both to t1 cases and t2 cases in
the observed data). The principles of permutation tests require dealing with the resultant
censoring. Hence, t2 cases on which t1 cases are reallocated after a simulation round must be
excluded, as demonstrated in the Appendix: such t2 cases are not taken into account in the
computation of the distances on both observed and simulated data. As each randomization
leads to the exclusion of different t2 cases, the test statistic has been adapted from usual
permutation tests (6,33). Let φ be a given permutation of t1 cases among all plants excluding
missing plants, let Y1 be the set of t1 cases in the actual data, Y1,i φ the set of t1 cases after the i th
permutation, and R2,i the subset of t2 cases in the actual data that are not censored by t1 cases
after the i th permutation. After each simulation, we compute the distances between noncensored
observed t2 cases and either the simulated t1 cases or the observed t1 cases. The
associated functions are Ci φ (d) = f (R2,i , Y1,i φ , d) and Ci(d) = f (R2,i , Y1 , d), respectively, where
f denotes the cumulative number of cases closer than or equal to distance d. The test is based
on the difference between these functions computed on simulated and observed data. As the
variability of Ci φ (d) – Ci(d) increases along with the distance d, it is divided by d to improve
- 100 -

the graphical display by an appropriate scaling (which does not affect the result of the test),
leading to: Sc,i(d) = [Ci φ (d) – Ci(d)] / d. (2)
If t1 cases and t2 cases are independent, the expected value of the test statistic Sc,i(d) is
equal to 0; thus for each distance class d, the whole set of values of Sc,i(d) is compared with 0.
For a bilateral test with a significance level α = 5%, if all of the lowest 97.5% values are
negative at a given distance, there is an excess of pairs of diseased plants in the observed data
for this distance class. Symmetrically, if the highest 97.5% values are all positive at a given
distance, there is a lack of pairs of diseased plants. Both situations indicate a spatial
relationship between t1 cases and t2 cases (either a positive or a negative association).
Structured patterns at both date 1 and date 2 (Test 3). Test 3 is performed when both
t1 cases and t2 cases are significantly structured, to test the independence between the whole
pattern of t1 cases and the whole pattern of t2 cases. This spatiotemporal test is based on
Lotwick and Silverman’s test (22), adapted following a method to cope with the censoring
(7,33) caused by missing plants and t1 cases. In order to preserve the existing spatial
structures, the permutations that are applied to t2 cases are restricted to shifts of the whole set
of t2 cases. As in the original paper by Lotwick and Silverman (22), the torus convention is
used to connect the opposite edges of the plot, with the result that all distances are measured
on this torus. Thus, for practical reasons, only rectangular plots can be used (excluding data
located beyond the largest rectangular subset from the spatiotemporal map). We show on a
hypothetical disease map (Fig. 1A) the initial steps for performing Test 3. A toroidal shift by a
number of plants along and across rows (denoted φ) can be applied to the whole map (Fig.
1B). In the test, the observed positions of t1 cases are preserved whereas the whole set of t2
cases is shifted on the torus. As in the previous test, some of the shifted t2 cases are censored
and some of the observed t2 cases (overlaid by the shifted censoring pattern) have to be
excluded in order to conserve the same distribution of distances in observed and simulated
patterns (see Appendix and Fig. 1C). Thus only the points that belong to R'2,i φ and to R'2,i are
used in the calculation of the number of t1 - t2 pairs of cases closer than or equal to distance d.
R'2,i φ denotes the subset of shifted t2 cases that are not censored (by observed t1 cases or
observed missing plants) after the i th shift (open triangles in Fig. 1D). R'2,i is symmetrically
defined as the subset of observed t2 cases that are not censored (by shifted t1 cases or shifted
missing plants) after the i th shift (filled triangles in Fig. 1D). The associated functions are
C'i φ (d) = f (Y1, R'2,i φ , d) and C'i(d) = f (Y1, R'2,i , d).
The remaining steps of this test are similar to what has been described above (repeated
computation of Sc,i(d) and comparison with 0) except for one detail: the maximum number of
different shifts is the product of the number of rows by the number of plants by row. Thus, the
total number of possible toroidal shifts is much less than the total number of possible
permutations, which can result in a lack of power for small lattices. When the number of
plants is lower or slightly above the predefined number (e.g., 1000) of expected patterns to
simulate, all possible shifts are performed one after another rather than performing random
toroidal shifts. Doing so leads to an exact test instead of an approximation and can also reduce
the computing time required. All the tests were programmed and performed using the
statistical R language (34). The source code is available upon request to the corresponding
author.
Numerical validation. A simulation study was performed to evaluate the type I error and
the power of the method, as well as its robustness to some deviation from key assumptions. In
this evaluation, the first four distance classes were considered. The proportion of 1000 virtual
patterns that is rejected by the test is an estimate of the true level of type I error when
independent patterns are simulated; it estimates the statistical power when dependent patterns
are simulated. These patterns were generated on a lattice as follows: (i) two independent
Poisson processes for the independence between two random patterns, which could
correspond to two waves of independently incoming vectors; (ii) two independent Neyman-
Scott processes for the independence between two clustered patterns, which could correspond
- 101 -

to two independent waves of incoming vectors causing primary infections of the persistent
mode; (iii) a Poisson process giving rise to an eight-neighbor contact process for the
dependence between two random patterns, which could correspond to a short-distance
secondary transmission of the non-persistent mode after random primary infections; and (iv) a
Neyman-Scott process giving rise to a secondary Neyman-Scott process for the dependence
between two clustered patterns, which could correspond to multifocal epidemics.
To evaluate the robustness of the method to some deviation from its assumptions, we also
simulated: (i) t1 patterns dependent on missing plants by a Neyman-Scott process using
missing plants as centers, and (ii) a border effect by an inhomogeneous Neyman-Scott process
with the distance between each center and the left side of the lattice following an exponential
distribution with mean 1/3 of the lattice width.
For all patterns, the positions of missing plants were assigned at random. For random
patterns, the average number of t2 cases was half that of t1 cases; for clustered patterns, t2
cases were twice the number of t1 cases, on average. To avoid edge effects, a 10-plant-wide
outer margin was added to the observation window before simulating Neyman-Scott
processes. For each Neyman-Scott process, cluster centers were located at random (the
probability for each position to be a center being 0.013), and marked points were created
around these centers at a distance following an exponential law with mean 2.5. Unless
otherwise stated, the simulations were performed on a 50 × 20 observation window (1 × 1 unit
lattice) with a total of 20% disease incidence and with 2% missing plants.
Experimental data sets. To illustrate the method, we analyzed data sets from two
different vector-borne diseases showing contrasting spatiotemporal patterns. The first data set
(Fig. 2A) is a map of trees affected by European stone fruit yellows (ESFY) in an apricot
orchard of 720 trees (15 rows of 48 trees each), planted in 1977 on a 4 × 4 m lattice. Typical
symptoms of this phytoplasma disease (e.g., off-season growth, yellowing, and leaf roll) were
recorded twice a year, starting in 1983; by 1994, 91 trees had expressed symptoms and 21
were missing for reasons unrelated to ESFY (mainly after showing symptoms of bacterial
canker). To test the independence between early and late infections, we made two groups of
plants on the basis of the temporal evolution of annual incidence: t1 cases expressed
symptoms before 1988 and t2 cases expressed symptoms between 1989 and 1994.
The second data set (Fig. 2B) is from a peach orchard affected by Plum pox virus (PPV)
strain M. The 663 trees (13 rows of 51 trees each) were planted in 1989 on a 2 × 5 m lattice
(within rows and between rows, respectively). Each tree was inspected visually for specific
PPV symptoms (e.g., vein clearing and mosaic) from 1992 to 1994. By the end of 1994, 169
trees had shown symptoms. Symptomatic trees from the first two assessment dates were
pooled in the analyses because not all trees had been correctly examined for PPV symptoms
on the first assessment.
The preliminary identification of spatial patterns within each group of cases in the ESFY-
and PPV-infected orchards was performed using radial correlation analysis (13), which is
designed specifically for discrete data; for the analysis at the second assessment date, t1 cases
were encoded as missing plants. When using the tests presented in this article, we always
defined the size of the distance classes as the minimal distance between the trees.
RESULTS
Simulated data sets. More than 25,000 simulated patterns were tested to determine the
performance of the test in various situations. As shown in Table 2, for all the simulated
stationary patterns, the true level of type I error is approximately equal to the predefined 5%
level. Despite the censoring of some observations, the power of the test is very high (> 90%)
and increases at the second distance class because of the cumulative nature of the test. For
low disease incidence, the test has slightly less power and is somewhat conservative because
of ties (the risk to wrongly reject the hypothesis of independence is then < 5%). Table 3
- 102 -

shows that the proportion of missing plants has a minor impact on the power of the test (at
least up to 10%), whereas a decreasing lattice size reduces the power of the test, which
nevertheless remains high in a 12 × 30 lattice (approximately 90%). Concerning the
robustness of the test to violations of its two basic assumptions, the method is not robust to
the simulated border effect because the type I error grows from 5% to > 15%. Conversely, the
dependence between t1 cases and missing plants (2% located at random) has no major effect
(Table 4).
ESFY data set. The preliminary analysis using 2DCORR indicated that neither t1 cases
nor t2 cases significantly differed from a random pattern, even without applying the
conservative Bonferroni correction. The cumulative probability function almost perfectly
matched what would be expected if diseased plants were located at random (not shown).
Consequently, in order to analyze the dependence between early and late infections, we
performed Test 1. This bilateral test, with a global 5% significance level and 1,000
simulations of H0, indicated a trend toward intra-row aggregation between t1 cases and t2
cases: P = 0.084 within a distance of two trees (Fig. 3A).
PPV data set. The preliminary analysis indicated that both t1 cases and t2 cases were
significantly clustered (with a P-value below the Bonferroni threshold) for the first distance
class along rows for t1 cases, and for the first distance class along and across rows for t2 cases.
This was confirmed by a formal Kolmogorov-Smirnov test for t2 cases (significant at
P < 0.05). Hence, to analyze the dependence between early and late infections, we used Test
3. This bilateral test with a global 5% significance level and 663 simulations of H0 indicated
that t1 cases and t2 cases were tightly aggregated, with P-values ranging from P = 0.012 to
P = 0.045 up to a distance of 10 m (Fig. 3B).
DISCUSSION
The analysis of epidemics simultaneously in space and time can provide crucial
indications about the process of disease spread. Up to now, however, we were lacking a
nonparametric method to handle disease clustering at each date and disease censoring by t1
diseased plants and by missing plants. This has hampered the initial exploration of
spatiotemporal data when plants are regularly spaced and mapped individually. In this article,
we have presented a framework to test the hypothesis that the location of newly diseased
plants is independent of the location of previously diseased plants. In this permutation method
dedicated to the exploration of spatiotemporal data, the significant spatial structures at each
date and the censoring are taken into account. This method can provide indications on the role
of short-distance plant-to-plant transmission, which is fundamental for both epidemiological
studies and disease management.
The validation of our method on numerous simulated bivariate point patterns shows that it
is powerful in the detection of dependent patterns (even for a relatively small lattice size such
as 12 × 30). It also shows that, when independent patterns are simulated, the rate of rejection
of the hypothesis of independence is around the predefined 5% significance level, or slightly
below for small lattices. Of course, the accuracy and power of the method could be assessed
for other combinations of the parameters that define the processes; the properties of the test in
any specific situation can be studied numerically as exemplified in this article, by simulating
the appropriate patterns.
The analysis of data sets from ESFY and PPV epidemics demonstrates the practical
application of this method that allowed testing general spatiotemporal hypotheses related to
the processes of disease spread for both diseases. For example, as the epidemiology of ESFY
remains poorly characterized, secondary transmission at the orchard scale is still an open
question. The test of independence indicated a trend toward within-row aggregation between
the trees showing symptoms early in the epidemic and those developing disease later; this
trend is consistent with short-range intra-orchard transmission. However, the same analyses
- 103 -

should be performed on several representative orchards to confirm that this trend is, in fact, a
general feature of the spread of ESFY.
The second example addressed the spatiotemporal spread of PPV-M in a peach orchard.
Natural epidemics caused by the PPV-M strain frequently result in highly clustered patterns
of disease (9). However, when disease management is strict within the orchard (systematic
visual identification and roguing of symptomatic trees) and immediately effective, there
should be no spatial dependence between new (exogenous) infections and previously diseased
trees. Thus, analyzing the distances between diseased trees that have been rogued and trees
that showed symptoms the year following the removal can provide clues about the
effectiveness of this control method. As the aggregation between newly and previously
symptomatic plants was very strong, it appears clearly that the continuing progress of the
disease within this orchard was principally driven by internal processes, despite the
implemented control method.
The analysis of epidemiological data goes from an acute observation of disease patterns to
a comprehensive understanding of epidemiological processes. Among the corresponding
approaches that are currently used to study spatiotemporal data, our tests occupy an
intermediate position between methods that provide a detailed summary of the spatiotemporal
patterns (28) and methods for estimating parameters of disease spread (15). Testing
independence of diseased plants between two dates is attractive because this hypothesis is
linked to the process of disease spread, and it naturally associates spatial and temporal
patterns. Thus, such tests complement the approaches that provide precise descriptions of the
patterns through the empirical comparison of spatial analyses at successive dates (17) or
through the separate analysis of the temporal and spatial features of a disease (2,37,38). When
the plants are mapped individually as healthy or diseased, analyses based on point patterns
use more information than quadrat-based techniques and usually provide a more detailed
insight into the data. Conversely, if disease notation is quantitative or if the health status is
assessed for a group of plants, an analysis with other methods like spatio-temporal
autocorrelation analysis (8,35) or other quadrat-based methods (5) could be more appropriate.
Our method is suitable to analyze poorly known diseases, because it makes no assumption
about unknown proximity patterns or distribution functions. Hence, distribution-free
hypothesis tests can play a role in the construction of mechanistic models, as they can be used
in the initial steps of modeling, when one has to decide which basic mechanisms and
assumptions have to be included. The test statistic Qc(d) can also be used to assess the fit of a
stochastic model to a data set, through a Monte-Carlo test where the confidence envelopes are
defined by repeated realizations of the model and computation of the corresponding values of
Qc(d). When sufficient information is available on the basic processes of spread and on the
distribution of the associated parameters, parametric analysis and more specifically
mechanistic modeling is probably the most powerful approach to gain insights into disease
spread and to estimate epidemiological parameters.
In addition to its contribution to plant disease epidemiology, our method can also be
adapted to analyze spatiotemporal data or censored spatial data in ecology. A test using
random shifts to investigate the spatial dependence between two point patterns given the
spatial structure within each group of points has already been described in a continuous space
(10,22) and used in spatial ecology (1,11,14,16,31), mainly to study the interactions between
two populations (competition or facilitation). In continuous space, random shifts of points do
not generate censoring, because the probability of a point being shifted to the exact position of
another point is null. On the contrary, when plants are grown in a regular lattice, simulated
points can censor actual points so these events had to be taken into account. Despite this
fundamental difference, our tests might be applied to cope with censored data in the analysis
of ecological data in which no plant can grow in a portion of the region under study (e.g.,
rocky or flooded zones) while the remainder of the area is homogenous. In combination with
- 104 -

the approach developed by Pélissier and Goreaud (30) to determine the limits of such
inhospitable areas, the method could provide a way to test the interactions between two
populations. Moreover, Test 1 and Test 2 can be directly applied to irregular plantings, so
they can be used to analyze disease spread between two dates in natural landscapes and in
rows of heterogeneous density. Of course, the method can also be adapted if one is interested
in the proximity pattern between events that do not cause censoring, i.e., in which the two
events can be observed simultaneously (e.g., two diseases causing discernable symptoms on
the same plant, or two insect species). Besides these modifications that could broaden the
application of this method, we identified some limitations that can be the starting point for
future work, which could lead to more sophisticated analyses of spatiotemporal data.
In common with many methods of spatial analysis, the tests described in this paper
require a few assumptions; it is necessary to specify them and to point out their implications
for the interpretation of the results. First, we assume that missing plants are independent of
disease, so the demonstration of their spatial dependence modifies the interpretation. For
example, if missing plants are associated with t1 cases, depending on the objectives it might
be relevant to consider them as early diseased plants and to incorporate them into t1 cases.
However, at least when few missing plants are located at random, the dependence between t1
cases and missing plants has no major impact on the test (Table 4).
The second assumption is that the process is stationary (i.e., when shifted, its statistical
properties are invariant). When the preliminary analysis shows a significant border effect in
disease incidence, our tests would often detect a nonrandom association between the two
dates (Table 4). The observed border effect is an obvious cause to this association, which can
hide other potential sources of dependence that are more interesting in understanding disease
spread. Thus, for non-stationary processes, our test should not be used as is: the null
hypothesis should include any existing border effect, and more specific tests will be required.
Similarly, any underlying structure in the field that is related to the disease (e.g.,
heterogeneous soil, sowing date, cultivar, etc.) violates the assumption of stationarity. In these
situations, random permutations and shifts should be performed within each stationary subset;
afterwards, the distances can be combined in a global test.
Toroidal distances in Test 3 artificially group together distant points located near the two
vertical or horizontal edges of the plot. Thus, Test 3 is more suitable when the size of the
lattice widens, because the weight of these edge effects in the analysis decreases. It is
noteworthy that Test 3 computes all distances on a torus, with the result that observed and
simulated patterns are consistent: on a torus, the distribution of distances within a shifted
group of points does not differ from the distances within the same group before shift. Hence,
when we simulate independent patterns on a small lattice (12 × 30), the type I error is still
around 5% (Table 3). The way the censoring is handled in Test 2 and Test 3 induces a
drawback: the exclusion of part of the data slightly reduces the power of these tests. A
solution to both issues (the use of toroidal shifts and the handling of censored data) is to
identify the point process that generates the observed pattern of t2 cases and to simulate the
null hypothesis according to this point process (16). However, identifying a point process
from a unique censored realization is a difficult task because different processes can produce
the same pattern.
Further development could improve some aspects of the tests. For example, currently, we
only seek directional aggregation (or repulsion) along rows or across rows. Yet a major
benefit of two-dimensional distance class analysis comes from its ability to detect a
directional spread of diseases potentially driven by wind or by plant contacts (12,13,19). So,
additional work could intend to allow the detection of wind-driven spread or to incorporate
the tests in a two-dimensional framework. It is possible to generate a map-like output because
- 105 -

non-cumulative versions of Qc(d) and Sc(d) can be computed for each distance-orientation
class. However, when the phenomenon under study is isotropic, splitting distance classes into
distance-orientation classes lowers the statistical power because of the decrease in the number
of pairs of plants in each class. The resulting lack of statistical power, in combination with the
problem of multiple testing (12) restricts the use of such a two-dimensional analysis to
diagnostic purposes, in the exploratory phase of studies. As shown by Ferrandino (13), the
two approaches could be combined for providing both a two-dimensional insight into the
phenomenon (with limited statistical power) and a non-directional test based on plants less
than a distance apart from each plant (with better statistical properties), like Qc(d) and Sc(d).
Another feature of our method is that in contrast to other spatiotemporal methods (15,35),
generalizing the method to more than two dates implies a clear reassessment of the hypothesis
that one wants to test. In its present form, even when three or more dates are available, the test
of independence only uses two dates or two groups of dates. However, several assessment
dates can be combined, for example on the basis of the incubation period if it is longer than
the time interval between two successive visual assessments. Another possibility is that
several paired dates or groups of dates can be analyzed in an exploratory fashion. However,
such a choice reduces the statistical value of the tests if they are not corrected to take account
of multiple testing (12), because it increases the risk to detect a spurious significant
dependence. Thus, in order to limit the number of tests, the hypothesis should be clearly
stated (e.g., the pattern at each date is independent of the pattern at the date before) and
groups should be decided a priori. However, to detect a general trend in a spatiotemporal data
set, it should be possible to build a global test that synthesizes the distances computed on
several independent pairs of dates.
In this article, we have developed a versatile framework for testing hypotheses on the
independence of the positions of diseased plants at two dates, even when there is censoring
and spatial dependence within each group of plants. The method can be used as described, or
adapted to test the spatial dependence between two groups of points in other systems. By
testing hypotheses of independence, our aim is to make inferences about the biological
processes of disease spread, in the line of the position promoted by Hughes and Madden (20):
“Ultimately it will be desirable to forge links between statistical descriptions of spatial
patterns of plant disease and observations and theories about the dispersal of plant pathogens
and disease vectors”. However, such links are indirect: as we do not test the biological
mechanism itself but its consequence, we obtain clues rather than a definitive demonstration
of the biological processes (10). Thus, the demonstration of dependence between two dates
should not be interpreted in terms of direct transmission without considering the competing
explanations (e.g., in relation to the latent period, the infectious period, and the susceptibility
of the plants). Therefore, in order to unveil major features of spatiotemporal data sets and to
select the most likely explanatory processes, we suggest to use the method described here as
one element in a broader exploratory approach rather than as a unique ready-made tool.
Successive hypothesis tests can be used because their flexibility allows progressive
refinements of the initial hypothesis. Thus, testing independence between two disease
assessment dates becomes one step in a more general question-oriented strategy. It is also
possible to combine the results of several complementary methods dedicated to the analysis of
disease incidence data in time or space (18,37). These multiple analyses provide a nuanced
perception of disease progress: they allow testing of hypothetical processes and they are a
basis to envisage new hypotheses. Furthermore, the best way to get a comprehensive view of
an epidemic is to use an integrated approach including spatiotemporal data analyses alongside
experimental studies.
- 106 -

APPENDIX
Test 2. This section corresponds to the theory for the permutation test when the diseased
plants at date 2 show a spatial structure whereas the diseased plants at date 1 are not
structured. Z1 and Z2 denote the corresponding underlying point processes, which are partly
censored by an independent censoring point pattern X corresponding to missing plants. In this
situation, the positions of observed t1 cases ( Z ∩ X ) are independent and identically
distributed (i.e., at random). The tested hypothesis (H0) is: “The two point processes Z1 and Z2
are independent”.
Y1 = Z1
∩ X and Y2 = Z 2 ∩ X are the subsets of diseased plants that are not censored by
X at dates 1 and 2, respectively. Since Z1 and Z2 are independent (under H0) and are
independent of X, Z1|X is independent of Z2|X. This implies that Y1|X is independent of Y2|X.
Let Y be the result of a permutation φ of Y1 (on X ). If L denotes the probability law,
L
φ
1
φ
( Y1
1
X ) = L(
Y X ) . This fact, together with the independence between Y1|X and Y2|X, leads
φ
φ
( 1 1 2
1 1 2
to L Y , Y , Y X ) = L(
Y , Y , Y X ) .
Then, for any transformation f, L f ( Y , Y , Y ) X ] = L[
f ( Y , Y , Y ) X ].
The case f ( u,
v,
w)
= ( w ∩ u ∩ v,
u)
yields:
- 107 -
1
φ
φ
[ 1 1 2
1 1 2
φ
L(
Y2
∩ Y1
∩Y1
, Y1
X ) = L(
Y2
∩Y1
∩Y1
, Y1
X ) .
With the simplified notations used in the text, this can be written L(R2, Y1) = L(R2, Y1 φ ):
the distribution of the distances between observed t1 cases and observed t2 cases which are not
overlaid by a t1 case after permutation is the same as the distribution of distances between t1
cases after permutation and observed t2 cases which are not overlaid by a t1 case after
permutation.
Test 3. The demonstration corresponding to Test 3 (to be applied when there is a
significant spatial structure at both dates) is more straightforward. We assume that Z1 and Z2
are independent of the external censoring X (missing plants), that the point processes are
stationary and invariant by toroidal shifts. The tested hypothesis (H0) is: “The two point
processes Z1 and Z2 are independent”. Under these assumptions and for a given toroidal shift
φ, Z2 is independent of Z1, X, Z1∪Z1 φ and X∪X φ . Thus, their joint probability law is invariant
for any independent transformation of Z2.
Applying φ to Z2 leads to: L(Z2, Z1, X, Z1∪Z1 φ , X∪X φ ) = L(Z2 φ , Z1, X, Z1∪Z1 φ , X∪X φ ).
Hence, for any transformation f:
L[f(Z2, Z1, X, Z1∪Z1 φ , X∪X φ )]=L[f(Z2 φ , Z1, X, Z1∪Z1 φ , X∪X φ )].
The case f ( u,
v,
w,
x,
y)
= ( v ∩ w,
u ∩ x ∩ y)
leads to:
φ
φ
φ
L[ Z1
∩ X , Z 2 ∩ ( Z1
∪ Z1
) ∩ ( X ∪ X )] = L[
Z1
∩ X , Z 2 ∩ ( Z1
∪ Z1
) ∩ ( X ∪ X )] .
With the simplified notations used in the text, this can be written L(Y1, R'2) = L(Y1, R'2 φ ):
the distribution of the distances between observed t1 cases and observed t2 cases which are not
overlaid by a shifted t1 case or a shifted missing plant is the same as the distribution of
distances between observed t1 cases and shifted t2 cases which are not overlaid by a t1 case or
a missing plant.
ACKNOWLEDGMENTS
We wish to thank Etienne Klein for fruitful discussions during the preparation of the
manuscript and Clive Bock for correcting a previous version of the text. We are also grateful
to Claude Castelain and to the Fédération Régionale de Défense contre les Organismes
Nuisibles (FREDON) of Languedoc-Roussillon who kindly provided the two disease maps
used in this paper.
φ
φ
φ
φ

LITERATURE CITED
1. Barot, S., Gignoux, J., and Menaut, J. C. 1999. Demography of a savanna palm tree:
predictions from comprehensive spatial pattern analyses. Ecology 80:1987-2005.
2. Bassanezi, R. B., Bergamin, A., Amorim, L., Gimenes-Fernandes, N., Gottwald, T. R., and
Bové, J.-M. 2003. Spatial and temporal analyses of citrus sudden death as a tool to
generate hypotheses concerning its etiology. Phytopathology 93:502-512.
3. Besag, J. E. 1977. Discussion on Dr Ripley's paper. J. R. Stat. Soc. B 39:193-195.
4. Campbell, C. L. 1986. Interpretation and uses of disease progress curves for root diseases.
Pages 38-54 in: Plant Disease Epidemiology, vol 1: Population Dynamics and
Management, K. J. Leonard and W. E. Fry eds. Macmillan, New York.
5. Campbell, C. L., and Madden, L. V. 1990. Introduction to Plant Disease Epidemiology.
Wiley, New York.
6. Chadœuf, J., Brix, A., Pierret, A., and Allard, D. 2000. Testing local dependence of spatial
structures on images. J. Microsc. 200:32-41.
7. Chadœuf, J., Capowiez, Y., Kretzschmar, A., and Dessart, H. 1997. Testing interaction
between a random area process and another spatial process: the analysis of spatial patterns
of soil sections. Acta Stereol. 16:251-258.
8. Cliff, A. D., and Ord, J. K. 1981. Spatial Processes: Models and Applications. Pion Ltd.,
London.
9. Dallot, S., Gottwald, T., Labonne, G., and Quiot, J.-B. 2003. Spatial pattern analysis of
sharka disease (Plum pox virus strain M) in peach orchards of southern France.
Phytopathology 93: 1543-1552.
10. Diggle, P. J. 1983. Statistical Analysis of Spatial Point Patterns. Academic Press, London.
11. Duncan, R. P. 1991. Competition and the coexistence of species in a mixed podocarp
stand. J. Ecol. 79:1073-1084.
12. Ferrandino, F. J. 1996. Two-dimensional distance class analysis of disease-incidence
data: problems and possible solutions. Phytopathology 86:685-691.
13. Ferrandino, F. J. 1998. Past nonrandomness and aggregation to spatial correlation:
2DCORR, a new approach for discrete data. Phytopathology 88:84-91.
14. Forget, P. M., Mercier, F., and Collinet, F. 1999. Spatial patterns of two rodent-dispersed
rain forest trees Carapa procera (Meliaceae) and Vouacapoua americana
(Caesalpiniaceae) at Paracou, French Guiana. J. Trop. Ecol. 15:301-313.
15. Gibson, G. J., Kleczkowski, A., and Gilligan, C. A. 2004. Bayesian analysis of botanical
epidemics using stochastic compartmental models. Proc. Natl. Acad. Sci. USA 101:12120-
12124.
16. Goreaud, F., and Pélissier, R. 2003. Avoiding misinterpretation of biotic interactions with
the intertype K12-function: population independence vs. random labelling hypotheses. J.
Veg. Sci. 14:681-692.
17. Gottwald, T. R., Avinent, L., Llacer, G., Hermoso de Mendoza, A., and Cambra, M.
1995. Analysis of the spatial spread of sharka (plum pox virus) in apricot and peach
orchards in eastern Spain. Plant Dis. 79:266-278.
18. Gottwald, T. R., Cambra, M., Moreno, P., Camarasa, E., and Piquer, J. 1996. Spatial and
temporal analyses of citrus tristeza virus in eastern Spain. Phytopathology 86:45-55.
19. Gray, S. M., Moyer, J. W., and Bloomfield, P. 1986. Two-dimensional distance class
model for quantitative description of virus-infected plant distribution lattices.
Phytopathology 76:243-248.
20. Hughes, G., and Madden, L. V. 1992. Aggregation and incidence of disease. Plant Pathol.
41:657-660.
21. Hughes, G., McRoberts, N., Madden, L. V., and Gottwald, T. R. 1997. Relationships
between disease incidence at two levels in a spatial hierarchy. Phytopathology 87:542-550.
22. Lotwick, H. W., and Silverman, B. W. 1982. Methods for analysing spatial processes of
- 108 -

several types of points. J. R. Stat. Soc. B 44:406-413.
23. Madden, L. V., and Hughes, G. 1999. Sampling for plant disease incidence.
Phytopathology 89:1088-1103.
24. Manly, B. F. J. 1991. Randomization and Monte Carlo Methods in Biology. Chapman &
Hall, London.
25. McRoberts, N., Hughes, G., and Madden, L. V. 1996. Incorporating spatial variability
into simple disease progress models for crop pathogens. Aspects of Applied Biology
46:75-82.
26. Mugglestone, M. A., Lee, B. Y. Y., Roff, M. N. M., Jones, P., Plumb, R. T., and
Deadman, M. L. 1996. Point process modelling of BYMV incidence in lupins. Aspects of
Applied Biology 46:87-94.
27. Nelson, S. C. 1995. STCLASS - spatiotemporal distance class analysis software for the
personal computer. Plant Dis. 79:643-648.
28. Nelson, S. C. 1995. Spatiotemporal distance class analysis of plant disease epidemics.
Phytopathology 85:37-43.
29. Nelson, S. C., Marsh, P. L., and Campbell, C. L. 1992. 2DCLASS, a two-dimensional
distance class analysis software for the personal computer. Plant Dis. 76:427-432.
30. Pélissier, R., and Goreaud, F. 2001. A practical approach to the study of spatial structure
in simple cases of heterogeneous vegetation. J. Veg. Sci. 12:99-108.
31. Penttinen, A., Stoyan, D., and Henttonen, H. M. 1992. Marked point-processes in forest
statistics. Forest Sci. 38:806-824.
32. Pethybridge, S. J., Wilson, C. R., Ferrandino, F. J., and Leggett, G. W. 2000. Spatial
analyses of viral epidemics in Australian hop gardens: implications for mechanisms of
spread. Plant Dis. 84:513-515.
33. Peyrard, N., Calonnec, A., Bonnot, F., and Chadœuf, J. 2005. Explorer un jeu de données
sur grille par tests de permutation. Revue de Statistiques Appliquées LIII:59-78.
34. R Development Core Team. 2004. R: A Language and Environment for Statistical
Computing. R Foundation for Statistical Computing, Vienna, Austria.
35. Reynolds, K. M., and Madden, L. V. 1988. Analysis of epidemics using spatio-temporal
autocorrelation. Phytopathology 78:240-246.
36. Ripley, B. D. 1977. Modelling spatial patterns. J. R. Stat. Soc. B 39:172-212.
37. Roumagnac, P., Pruvost, O., Chiroleu, F., and Hughes, G. 2004. Spatial and temporal
analyses of bacterial blight of onion caused by Xanthomonas axonopodis pv. allii.
Phytopathology 94:138-146.
38. Smith, M. C., Page, W. W., Holt, J., and Kyetere, D. 2000. Spatial dynamics of maize
streak virus disease epidemic development in maize fields. Int. J. Pest Manage. 46:55-66.
39. Thébaud, G., Labonne, G., Castelain, C., and Chadœuf, J. 2004. Spatio-temporal analysis
of disease spread provides insights into the epidemiology of European stone fruit yellows.
Acta Hortic. 657:471-476.
40. Upton, G., and Fingleton, B. 1985. Spatial Data Analysis by Example. vol. 1: Point
Pattern and Quantitative Data. Wiley, Chichester.
41. Vanderplank, J. E. 1963. Plant Diseases: Epidemics and Control. Academic Press, New
York.
42. Waggoner, P. E., and Rich, S. 1981. Lesion distribution, multiple infection, and the
logistic increase of plant disease. Proc. Natl. Acad. Sci. USA 78:3292-3295.
- 109 -

TABLE 1. Three tests of independence to investigate disease spread on a lattice between two
assessment dates, with a decision rule depending on the pattern of diseased plants at each
assessment date.
Pattern of t1 cases a
Pattern of
t2 cases b Random Structured
Random Test 1
Structured Test 2
(permutation
(permutation of t2 cases)
of t1 cases)
a Diseased plants at the first assessment date.
b Diseased plants at the second assessment date.
Test 3
(toroidal shift
of t2 cases)
TABLE 2. Type I error and power (distance classes 1 to 4) of the tests of spatial independence
between diseased plants at two assessment dates on a lattice when the patterns at both dates
are either random or clustered, for three levels of disease incidence.
Disease Distance class 1 Distance class 2 Distance class 3 Distance class 4
incidence Independent a Dependent b Independent Dependent
Random
patterns
Independent Dependent Independent Dependent
3% 0.025 0.922 0.025 0.999 0.034 0.984 0.039 0.894
14% 0.037 0.999 0.052 1.000 0.038 0.991 0.049 0.880
25%
Clustered
patterns
0.039 0.997 0.046 1.000 0.047 0.977 0.046 0.815
3% 0.022 0.829 0.032 0.945 0.036 0.946 0.037 0.926
14% 0.030 0.999 0.039 1.000 0.051 0.999 0.046 0.997
25% 0.040 1.000 0.049 1.000 0.052 1.000 0.051 1.000
a
The level of type I error is the probability to wrongly reject the (null) hypothesis of independence when
independent patterns are simulated.
b
The power of the test is the probability to correctly reject the (null) hypothesis of independence when
dependent patterns are simulated.
TABLE 3. Type I error and power of the test of spatial independence between clusters of
diseased plants at two assessment dates on a lattice, in relation to the proportion of missing
plants and lattice size.
Distance class 1 Distance class 2 Distance class 3 Distance class 4
Independent a Dependent b Independent Dependent Independent Dependent Independent Dependent
Proportion of
missing plants
2% 0.049 1.000 0.056 1.000 0.063 1.000 0.059 0.998
6% 0.033 1.000 0.041 1.000 0.051 1.000 0.050 0.999
10% 0.034 0.999 0.037 1.000 0.046 1.000 0.040 0.999
Lattice size
12 × 30 0.026 0.818 0.044 0.893 0.041 0.796 0.027 0.631
20 × 50 0.049 1.000 0.056 1.000 0.063 1.000 0.059 0.998
30 × 75 0.051 1.000 0.049 1.000 0.058 1.000 0.041 1.000
a The level of type I error is the probability to wrongly reject the (null) hypothesis of independence when
independent patterns are simulated.
b The power of the test is the probability to correctly reject the (null) hypothesis of independence when
dependent patterns are simulated.
- 110 -

TABLE 4. Type I error and power of the test of spatial independence between clusters of
diseased plants at two assessment dates on a lattice, in relation to a departure from the
assumptions of stationarity and independence of missing plants.
Border
effect c
Aggregation
with missing
plants d
Distance class 1 Distance class 2 Distance class 3 Distance class 4
Independent a Dependent b Independent Dependent Independent Dependent Independent Dependent
0.135 1.000 0.146 1.000 0.161 1.000 0.151 1.000
0.035 0.994 0.052 0.998 0.048 1.000 0.044 0.996
a The level of type I error is the probability to wrongly reject the (null) hypothesis of independence when
independent patterns are simulated.
b The power of the test is the probability to correctly reject the (null) hypothesis of independence when
dependent patterns are simulated.
c The simulated patterns is inhomogeneous, with an excessive number of diseased plants near one border of the
plot.
d Missing plants are simulated at random locations, and diseased plants at time 1 are simulated around them.
- 111 -

Fig. 1. Handling censoring patterns caused on newly diseased plants (t2 cases) by missing
plants and previously diseased plants (t1 cases) in the test based on toroidal shifts (Test 3, see
text). The observed pattern (A) is randomly shifted (B) on a torus (1 unit to the bottom and 1
unit to the left, in this example). The superposition of observed and shifted patterns (C)
excludes some t2 cases and results in the final sets of selected points (D). The excluded points
are observed t2 cases censored by the shift of either a missing plant or a t1 case;
symmetrically, any shifted t2 case censored by an observed missing plant or t1 case is
excluded. The distances between all t1 cases and the subsets of observed and shifted t2 cases
that have not been censored during the shift are used to compute the test statistic Sc,i(d).
- 112 -

Fig. 2. Spatiotemporal pattern of diseased trees in two orchards affected by: A, European
stone fruit yellows; B, Plum pox virus. In both orchards, white, black, and gray squares
represent healthy trees, initial infections (t1 cases) and later infections (t2 cases), respectively.
The crosses symbolize missing trees.
- 113 -

Fig. 3. Bilateral permutation test (α = 5%) of independence between initial and later
infections on a lattice. The points represent the observed values of the distance-based test
statistic, and gray levels indicate the corresponding P-values. The dotted lines are the mean
values of the criteria and the dashed lines correspond to the upper and lower 2.5% thresholds
for each distance class under the hypothesis of independence. A, Trend toward aggregation
within row between the two groups of plants infected by the European stone fruit yellows
(confidence intervals are based on 1,000 random permutations; Test 1, see text). B,
Significant aggregation between newly diseased plants and previously diseased plants in the
orchard infected by Plum pox virus (confidence intervals are based on 663 toroidal shifts; Test
3, see text).
- 114 -

IV. Application à l’analyse de cartes pluriannuelles de l’ESFY en verger
L’objectif de l’analyse du développement spatial de la maladie dans un verger au cours de
plusieurs années successives est de tester l’existence d’une dépendance spatio-temporelle,
mais aussi, le cas échéant, de pouvoir distinguer les trois hypothèses explicatives résiduelles
(la transmission secondaire ayant été éliminée sur des bases biologiques) : l’existence dans le
verger de zones préférentielles pour le vecteur (bords compris), l’attraction par les plantes
malades et les contaminations multiples par un même vecteur suivies de durées d’incubation
variables selon les plantes. La première étape consiste donc à vérifier si on observe une
accumulation des cas à proximité des bords, ce qui est assez attendu si le vecteur provient du
proche environnement (haies ou vergers voisins). Ensuite, l’étude du niveau d’agrégation des
arbres malades dans chacun des vergers disponibles permettra (i) de confirmer ou d’infirmer
les conclusions obtenues à partir du seul méta-verger D1-4 (Article V), et (ii) de choisir le test
d’indépendance le plus approprié pour pouvoir ensuite étudier les relations spatiales entre les
arbres malades à des dates différentes.
A. Présentation des vergers étudiés
Les deux groupes de vergers étudiés, distants de 3 km, se situent dans la même zone du
sud-est de la France, à proximité de Valréas (Vaucluse). Les arbres y ont été suivis
individuellement pendant une quinzaine d’années par Claude Castelain (INRA, Avignon), et
les arbres avec des symptômes d’ESFY ont été repérés tous les ans. Le premier groupe de
vergers a déjà été présenté dans l’Article V ; le deuxième groupe est également constitué de 4
parcelles assez proches les unes des autres mais non jointives. Les caractéristiques des vergers
étudiés sont résumées dans le Tableau 5 et l’évolution temporelle de l’ESFY dans les vergers
BH1-4 est représentée sur la Figure 16. Les motifs temporels des vergers BH1-4 sont
visiblement bien plus concordants que ceux des vergers D1-4, indiquant un comportement
plus homogène vis-à-vis de la maladie, probablement dû à l’homogénéité génétique du
matériel végétal planté.
Incidence annuelle
Incidence annuelle
7%
6%
5%
4%
3%
2%
1%
0%
5%
4%
3%
2%
1%
0%
83
83
BH1 (125 arbres)
85
85
87
87
89
89
91
91
93
93
95
95
97
Années
Incidence annuelle Incidence cumulée
BH2 (565 arbres)
97
40%
30%
20%
10%
0%
Années
Incidence annuelle Incidence cumulée
40%
30%
20%
10%
0%
Incidence cumulée
Incidence cumulée
Incidence annuelle
Incidence annuelle
- 115 -
12%
10%
8%
6%
4%
2%
0%
3,0%
2,5%
2,0%
1,5%
1,0%
0,5%
0,0%
83
BH3 (50 arbres)
85
87
89
91
93
95
97
Années
Incidence annuelle Incidence cumulée
BH4 (720 arbres)
83
84
85
86
87
88
89
90
91
92
93
94
Années
Incidence annuelle Incidence cumulée
Figure 16. Evolution temporelle de l’ESFY dans 4 vergers d’abricotier (cv. Polonais) greffés sur
myrobolan.
40%
30%
20%
10%
0%
40%
30%
20%
10%
0%
Incidence cumulée
Incidence cumulée

Tableau 5. Caractéristiques des vergers analysés. Ces différents vergers sont situés dans la vallée du
Rhône, à proximité de Valréas.
Nom Date de Nombre Variété
Distance de
plantation d’arbres d’abricotier Porte-greffe (espèce) plantation
D1 1981-1982 596 Polonais Myrobolan (P. cerasifera) 5 × 5
D2 1981-1982 414 Polonais GF 8-1 (P. marianna) 5 × 5
D3 1981-1982 147
Rouge de
Fournès
GF 31
(P. cerasifera × P. salicina)
5 × 5
D4 1981-1982 68 Modesto Manicot (P. sources) 5 × 5
BH1 1977-1978 125 Polonais Myrobolan (P. cerasifera) 4 × 4
BH2 1977-1978 565 Polonais Myrobolan (P. cerasifera) 4 × 4
BH3 1977-1978 50 Polonais Myrobolan (P. cerasifera) 4 × 4
BH4 1976-1977 720 Polonais Myrobolan (P. cerasifera) 4 × 4
B. Résultats et interprétations
1) Analyse de la répartition de l’ensemble des arbres symptomatiques
La première colonne de la Figure 17 démontre que dans les vergers étudiés, les plantes
malades ne s’accumulent pas à proximité des bords, et apparaissent même parfois au centre
du verger, en particulier dans le méta-verger D1-4 qui est très isolé. Une étude plus détaillée
pour chacun des bords (non montré ici) ne fait pas non plus apparaître d’agrégation
significative le long d’un bord donné ; toutefois, les fonctions de distribution des distances
tendent souvent à avoir des comportements différents selon le bord considéré, ce qui n’est pas
surprenant car on effectue des tests multiples sur des motifs agrégés. Ces résultats nous
amènent à conclure que C. pruni n’entre pas dans les vergers étudiés par simple diffusion à
partir de l’environnement immédiat (haies, autres vergers). Dans le cas de D1-4, il semble
plutôt que les vecteurs sont attirés au centre du verger, à moins que l’effet observé ne soit que
la conséquence fortuite de la forte agrégation des arbres malades régnant dans ce verger
(identifiée dans l’Article V). Au vu de l’ensemble des résultats, on privilégiera l’hypothèse
d’une arrivée des vecteurs indépendante des bords du verger (il reste à déterminer si les arbres
malades – qui ne sont pas arrachés dans ces parcelles – sont attractifs pour les vecteurs).
La seconde colonne de la Figure 17 et la Figure 2 de l’Article V démontrent que sur
l’ensemble de la période considérée, les arbres malades sont soit significativement agrégés
(D1-4, BH1, BH2), soit tendent à l’être (BH3, BH4). Une analyse plus précise dans les trois
vergers où l’on dispose de la puissance statistique nécessaire (Figure 18) montre que
l’agrégation observée est relativement équilibrée entre le rang et l’inter-rang, même si
l’utilisation de la statistique de test Qc(d) indique que la portée de la dépendance tend
généralement à être un peu plus grande sur le rang (non montré ici). Pour l’instant, le scénario
retenu pour expliquer cette dépendance relativement isotrope à courte distance est que les
vecteurs se déplacent par des vols courts approximativement isotropes. Cependant, le Tableau
4 indique que de nombreux processus biologiques peuvent être à l’origine d’une agrégation
quand on considère l’ensemble des arbres malades depuis la plantation du verger. L’analyse
des dépendances spatiales entre des années successives est un moyen de trier ces différents
processus possibles en fonction de leur adéquation aux motifs spatio-temporels observés.
- 116 -

Verger
D1-4
Verger
BH1
Verger
BH2
Verger
BH3
Verger
BH4
B c = (Proportion cumulée d’arbres symptomatiques) / (Simulation moyenne)
Arbres symptomatiques
plus près d’un bord de la parcelle
qu'une distance donnée
0.8 0.9 1.0 1.1 1.2
0.6 0.8 1.0 1.2 1.4 1.6
0.6 0.8 1.0 1.2 1.4
0.6 0.7 0.8 0.9 1.0 1.1 1.2 1.3
0.6 0.8 1.0 1.2 1.4
0 10 20 30 40 50 60 70
0 2 4 6 8 10 12 14
0 5 10 15 20 25
0 1 2 3 4 5 6
0 5 10 15 20 25
Classes de distance en mètres
- 117 -
V c = (Proportion cumulée d’arbres symptomatiques) / (Simulation moyenne)
P-value
0.4 0.6 0.8 1.0 1.2 1.4
0.8 0.9 1.0 1.1 1.2 1.3
0.7 0.8 0.9 1.0 1.1 1.2
[0,0.001)
[0.001,0.01)
[0.01,0.05)
[0.05,0.1)
[0.1,0.2)
> 0.2
Arbres symptomatiques
plus près de leur plus proche
voisin qu'une distance donnée
0.7 0.8 0.9 1.0 1.1 1.2
0 1 2 3 4 5 6
0 5 10 15
0 1 2 3 4 5 6
0 5 10 15
Classes de distance en mètres
Figure 17. Caractéristiques spatiales des arbres symptomatiques sur l’ensemble de la période de
prospection. La colonne de gauche représente la distance entre les plantes malades et le bord du verger ;
la colonne de droite indique les résultats du test d’indépendance totale entre les localisations des arbres
symptomatiques (cf. Article V pour le méta-verger D1-4). Les cercles représentent la statistique de test
observée et les lignes pointillées forment une enveloppe de confiance (à 5 % pour la distance aux bords et
10 % pour les distances entre points) basée sur 1000 permutations.

Verger
D1-4
Verger
BH2
Verger
BH4
V c = (Proportion cumulée d’arbres symptomatiques) / (Simulation moyenne)
0.90 0.95 1.00 1.05 1.10 1.15
0.8 1.0 1.2 1.4
0.6 0.8 1.0 1.2 1.4
Arbres symptomatiques plus près de leur plus
proche voisin qu'une distance donnée
P -value :
(mesuré uniquement sur le rang)
0 20 40 60
(mesuré uniquement sur le rang)
0 20 40 60 80
(mesuré uniquement sur le rang)
0 10 20 30 40 50
Classes de distance
le long du rang (m)
[0,0.001)
[0.001,0.01)
- 118 -
0.9 1.0 1.1 1.2
0.8 1.0 1.2 1.4
0.6 0.8 1.0 1.2 1.4
0 20 40 60 80
[0.01,0.05)
[0.05,0.1)
(mesuré uniquement sur l'inter-rang)
(mesuré uniquement sur l'inter-rang)
0 10 20 30 40
(mesuré uniquement sur l'inter-rang)
0 10 20 30 40
Classes de distance
dans l’inter-rang (m)
[0.1,0.2)
> 0.2
Figure 18. Test d’indépendance totale entre les localisations des arbres symptomatiques sur l’ensemble de
la période de prospection. Agrégation directionnelle (colonne de gauche, le long du rang ; colonne de
droite, sur l’inter-rang). Les cercles représentent la statistique de test observée (Vc) et les lignes pointillées
forment une enveloppe de confiance à 10 % basée sur 1000 permutations.
2) Analyse des dépendances spatiales interannuelles
Pour des questions de puissance des tests statistiques, il est nécessaire de disposer de
suffisamment d’arbres malades dans les groupes dont on analyse la dépendance spatiale. La
plupart du temps, on regroupe donc les cas qui sont apparus au cours de 3 à 6 années
successives ; les vergers BH1 et BH3 ne sont pas analysés ici car ils comportent trop peu
d’arbres. Dans les autres vergers, les regroupements sont basés sur l’évolution de l’incidence

annuelle (Figure 1 de l’Article V et Figure 16). Il arrive que pour une année donnée, le
nombre d’arbres malades soit suffisamment élevé pour pouvoir tester la dépendance entre
cette année-là et les années précédentes ou suivantes. Sinon, la délimitation des groupes de
dates – nécessairement un peu arbitraire – a permis de former les ensembles suivants :
- cas initiaux : 1983 (1983-1985 pour BH2) ;
- début de la dynamique : 1983-1989 ;
- milieu de la dynamique : 1990-1995 ;
- fin de la dynamique : 1996-1999.
Dépendance intra-groupe
1996-1999 1990-1995
Dépendance entre groupes
(1996-1999 vs. 1990-1995)
Qc = (Proportion cumulée d’arbres
symptomatiques) / (Simulation moyenne)
Sc = Ecart cumulé entre les nombres
de couples simulés et observés
Verger D2
Paires d’arbres symptomatiques plus proches qu'une distance donnée
0.6 0.8 1.0 1.2 1.4 1.6 1.8
0.5 1.0 1.5 2.0
-3 -2 -1 0 1 2 3
0 10 20 30 40 50 60
0 10 20 30 40 50 60
0 10 20 30 40 50
Classes de distance
en mètres
P -value :
[0,0.001)
[0.001,0.01)
- 119 -
Q c = (Proportion cumulée d’arbres symptomatiques) / (Simulation moyenne)
0.6 0.8 1.0 1.2 1.4
0.0 0.5 1.0 1.5 2.0 2.5 3.0
[0.01,0.05)
[0.05,0.1)
Verger D3
0 10 20 30 40 50
0 10 20 30 40 50
g p q
Test 3 Test 1
(405 translations)
0.6 0.8 1.0 1.2 1.4 1.6
0 10 20 30 40 50
Classes de distance
en mètres
[0.1,0.2)
> 0.2
Figure 19. Deux exemples de tests d’indépendance spatio-temporelle entre la fin et le milieu de la
dynamique temporelle (1996-1999 vs. 1990-1995). Les deux premières lignes présentent le résultat des
tests effectués à l’intérieur de chacun des 2 groupes de dates, basés sur la statistique Qc(d). La dernière
ligne présente le résultat du test d’indépendance entre les 2 groupes (colonne de gauche : dépendance non
significative entre groupes de dates dans la sous-parcelle D2 ; colonne de droite : dépendance significative
entre groupes de dates dans la sous-parcelle adjacente, D3). Les cercles représentent la statistique de test
observée et les lignes pointillées forment une enveloppe de confiance à 10 % basée sur 1000 permutations,
sauf indication contraire.
Conformément à la démarche proposée dans l’Article VI, les motifs à l’intérieur de
chaque groupe de dates sont analysés préalablement au test d’indépendance entre groupes afin
de choisir le test le plus approprié (cf. Figure 19). On détecte une agrégation intra-groupe

significative pour 13 des 21 groupes de dates analysés, y compris pour 5 des 9 groupes ne
contenant qu’une ou deux années (D1 et D2 en 90-91 ; BH2 en 1986 ; BH4 en 1988 et 1993).
A la lumière des durées d’incubation attendues (environ 1 ou 2 ans), ce résultat pourrait
s’interpréter comme l’effet de transmissions successives réalisées par un seul vecteur sur des
arbres voisins. Dans ce cas, une durée d’incubation variable devrait suffire à induire un peu
d’agrégation interannuelle puisque des arbres voisins inoculés par un même vecteur
pourraient être répartis dans deux groupes successifs. Malgré cela, seul 1 test sur les 23
effectués avec la statistique Qc(d) – et même aucun avec Vc(d) – révèle une dépendance
interannuelle significative (Figure 19, seconde colonne : verger D3, dépendance entre la fin et
le milieu de la dynamique). Par ailleurs, seuls 4 autres tests réalisés avec l’une de ces deux
statistiques indiquent une tendance forte à l’agrégation (P-value ∈ [0,05 – 0,10]). La Figure
19 montre le test significatif et un exemple de résultat non significatif (obtenu en testant la
dépendance entre les mêmes dates au sein de la parcelle voisine appartenant au méta-verger
D1-4).
Le manque de puissance des tests ne paraît pas être le seul facteur à incriminer, dans la
mesure où on parvient à détecter de l’agrégation à l’intérieur de la plupart des groupes de
dates (les cas observés à une date donnée sont donc souvent plus proches entre eux que des
cas précédents ou suivants). Par conséquent, s’il existe un processus biologique qui génère de
la dépendance entre les groupes de points testés, il est peu marqué. Pour s’en assurer, il serait
donc nécessaire de développer des tests plus puissants pour poursuivre ces analyses plus en
profondeur. En particulier, on pourrait construire un test global en regroupant les distances
entre tous les groupes de points séparés par un nombre donné d’années dans un verger donné,
ou en regroupant pour l’ensemble des vergers les distances entre 2 groupes de dates
prédéfinis.
Si l’on se base sur le Tableau 4, le scénario A2i serait donc le plus probable au vu de
l’ensemble des motifs spatiaux et de leur évolution temporelle (agrégation sur l’ensemble des
dates, pas d’agrégation le long des bords, très peu de dépendance spatiale entre dates). Ainsi,
ces motifs pourraient être dus à des vecteurs infectieux qui arrivent indépendamment les uns
des autres et au hasard dans le verger (en particulier, ni à proximité des bords, ni à proximité
des arbres malades), puis qui se déplacent par quelques vols courts et isotropes entre lesquels
ils transmettent le phytoplasme, mais sans réaliser de transmissions secondaires. Le scénario
proposé n’est pas bâti sur des preuves, mais plutôt sur un faisceau d’interprétations
compatibles avec les phénomènes observés dans un échantillon relativement restreint de
vergers. Ce scénario est le “modèle nul” que l’on conservera tant qu’aucun élément nouveau
ne viendra le remettre sérieusement en cause.
V. Bilan sur les apports des tests d’hypothèses
Les tests d’hypothèses décrits et utilisés mettent en évidence certaines dépendances dans
la répartition spatio-temporelle des arbres malades de l’ESFY. Ils ont permis de proposer un
scénario explicatif simple et cohérent avec les motifs spatio-temporels observés. Ainsi, à
partir de suivis spatio-temporels détaillés, on peut avoir une idée plus précise sur les
processus biologiques impliqués dans la progression de l’ESFY dans les vergers ; en
particulier, les éléments du scénario qui concernent les comportements du vecteur en
conditions de production auraient été difficiles à déterminer expérimentalement.
La faiblesse de cette approche est liée au manque de connaissances sur la durée
d’incubation dans la plante en fonction de la combinaison porte-greffe/cultivar utilisée, et sur
sa variabilité et sa dépendance de conditions externes qui peuvent être hétérogènes dans
l’espace (stress hydrique) ou dans le temps (conditions climatiques). L’autre difficulté
- 120 -

consiste à disposer de vergers à la fois suffisamment uniformes (variétés et porte-greffes) et
initialement sains, afin de restreindre le domaine des explications possibles aux motifs
observés. Les données disponibles sont fréquemment issues de vergers commerciaux dont on
ne connaît pas l’état sanitaire initial ou de vergers de plants hybrides expérimentaux, issus de
noyaux – donc sains car la transmission naturelle des phytoplasmes requiert obligatoirement
un vecteur (Garnier et al., 2001) – mais issus de différents croisements donc génétiquement
hétérogènes et fréquemment regroupés spatialement par famille. Dans le premier cas, il est
préférable de n’apporter des conclusions sur les motifs spatiaux qu’à partir d’une durée
supérieure à la durée d’incubation des jeunes plants ; dans le deuxième cas, pourvu que
l’ascendance de chaque plant soit connue (et, dans l’idéal, que le dispositif soit randomisé par
rapport à cet effet génétique), on peut tenter de modéliser l’effet du génotype sur la proportion
de plantes malades et conditionner les tests spatiaux par cet effet.
On constate aussi que si les connaissances biologiques acquises sont trop restreintes pour
pouvoir éliminer a priori une partie des scénarios, il est très difficile d’analyser les motifs
spatio-temporels d’une maladie dans une démarche purement hypothético-déductive.
L’analyse des données repose alors plutôt sur l’exploration des grandes propriétés statistiques
des motifs spatio-temporels et la proposition de quelques interprétations vraisemblables. On
rencontre à cette occasion les défauts habituels des approches indirectes et exploratoires : le
domaine des possibles peut parfois être restreint mais les preuves n’abondent pas. Cette
approche contribue toutefois à l’exploration d’un système et au tri entre différents scénarios
explicatifs, en particulier dans le cas des maladies dont le mode de transmission n’a pas été
identifié.
Plus généralement, cette partie a montré comment on peut tester des hypothèses reliées
aux processus biologiques responsables de la dispersion d’une maladie dans une plantation
régulière. Les tests d’hypothèses développés ici peuvent d’ailleurs être utilisés pour répondre
à des questions complètement différentes, dont le point commun est de pouvoir être formulées
en termes d’hypothèses d’indépendance entre points sur des grilles régulières.
- 121 -

- 122 -

Partie IV : Synthétiser
l’information dans un
modèle de simulation des
épidémies d’ESFY
« On fait de la science avec des faits comme une
maison avec des pierres ; mais une accumulation
de faits n’est pas plus une science qu’un tas de
pierres n’est une maison »
(H. Poincaré)
- 123 -

Les approches complémentaires mises en œuvre dans les parties précédentes ont permis
d’identifier de façon progressive différentes propriétés de l’épidémiologie de l’ESFY. Ainsi,
on peut “se faire une idée” sur le développement attendu de la maladie dans un verger
d’abricotier. L’enjeu est alors de transformer ce modèle mental implicite en un modèle dont
les objectifs sont de synthétiser les informations acquises, d’évaluer l’adéquation entre
modèle et données et d’estimer certains paramètres et leur variabilité. Dans ce but, on a choisi
de concevoir un modèle de simulation explicite, mécaniste, individu-centré, spatialisé et
stochastique. Le choix d’une modélisation mécaniste est un moyen de veiller au réalisme du
modèle et au sens biologique de ses paramètres ; le choix d’un modèle individu-centré permet
de se placer à une échelle correspondant aux données observées et aux mécanismes modélisés
(comportements individuels des vecteurs). L’intégration des informations spatiales concernant
ces individus est nécessaire pour pouvoir simuler des méthodes de lutte potentielles ayant une
composante spatiale (arrachage préventif, pièges attractifs, traitements partiels) et pour juger
de l’adéquation des processus retenus avec les processus réels (via les motifs spatio-temporels
observés dans les vergers). La relative complexité des phénomènes en jeu à l’échelle
individuelle et la prise en compte explicite de l’espace impose alors d’avoir recours à la
simulation. Enfin, l’introduction d’une part de stochasticité dans le modèle traduit la nature
aléatoire des trajectoires des vecteurs, mais elle permet aussi d’estimer la variabilité des
paramètres, ce qui essentiel dans une perspective de prédiction.
I. Hypothèses du modèle
A partir d’un ensemble de possibilités initialement très vaste, les parties précédentes ont
permis de bâtir un scénario probable et relativement simple du cycle de la transmission de la
maladie dans les vergers d’abricotier (Figure 20), où les motifs spatio-temporels générés par
C. pruni ne dépendent que du nombre de vecteurs réimmigrants infectieux et de leurs
déplacements (fréquence, distance).
A B
R S
N S
E S
Vecteur Contacts Plante
hôte
R L
N L
E L
R I
N I
E I
- 124 -
S
L
I
M
Vecteur Contacts Plante
hôte
R S
N S
Acquisition
Transmission
Figure 20. Cycle de la transmission de l’ESFY. R et E, vecteurs adultes réimmigrants et émergents,
respectivement ; N, larves ; S, sain ; L, latent ; I, infectieux ; M : mort. (A) Cycle hypothétique initial. (B)
Cycle probable dans les vergers d’abricotier, pouvant être réduit à la partie grisée quand les vecteurs
émergents migrent loin du verger, le reste traduisant l’évolution interannuelle à grande échelle.
Le Tableau 6 présente les différentes hypothèses du modèle, ainsi que les moyens utilisés
pour s’assurer de leur vraisemblance.
R I
N I
E I
S
L
I
M

Tableau 6. Propriétés biologiques retenues pour construire un modèle stochastique simulant le
développement de l’ESFY dans un verger d’abricotier.
Phénomène
concerné Hypothèse retenue Motivation du choix
Acquisition /
Transmission
Résultats issus de la bibliographie ;
Les seules transmissions sont
méta-analyse, tests de transmission et
dues aux vecteurs réimmigrants
suivi expérimental de la multiplication du
ayant acquis le pathogène ailleurs
pathogène dans C. pruni, identification de
l’année précédente
sites d’hivernage
Hypothèse initiale vraisemblable si les
Les vecteurs infectieux
déplacements sont peu fréquents et si
transmettent le pathogène à
tous les arbres sont sensibles ; modifiable
chaque déplacement
si de futurs résultats la remettent en cause
Les vecteurs infectieux sont
indépendants entre eux
Résultat issu de la bibliographie
Les vecteurs infectieux arrivent
Tests d’hypothèses
complètement au hasard dans le (indépendance par rapport aux arbres
verger
malades et pas d’effets de bord)
Comportement Le vecteur se déplace par des vols
des vecteurs courts en nombre poissonnien
Tests d’hypothèses ;
hypothèse poissonnienne à valider
Les vols du vecteur sont isotropes Tests d’hypothèses
Nombre de
vecteurs
infectieux
Etat des
plantes
II. Description du modèle
La distance des vols suit une loi
exponentielle
Le vecteur ne s’arrête pas sur les
arbres morts (il fait un autre vol)
Le nombre de vecteurs infectieux
arrivant dans la parcelle suit une
loi de Poisson
- 125 -
Rien n’indique que ce choix classique
soit inadapté ici ; modifiable si nécessaire
Traduit l’ouverture du couvert végétal
Hypothèse initiale simplificatrice, à
remplacer par une loi de Poisson
surdispersée si le climat accentue la
variabilité ; la proportion de vecteurs
infectieux est probablement constante à
l’échelle de la durée d’un verger (inertie)
Le verger est initialement sain Situation idéale
L’incubation dans la plante dure
au moins 1 an et suit une loi
exponentielle
Hypothèse issue de la bibliographie, mais
à préciser expérimentalement
Le Tableau 6 suffit presque à décrire le modèle construit. Il s’agit d’un modèle individucentré
contenant deux types d’individus car chaque arbre du verger et chaque vecteur
infectieux est représenté. Les arbres sont fixes (évidemment) et peuvent être dans 4 états
(sains, en incubation, symptomatiques, manquants). Seuls les vecteurs infectieux sont
représentés ; ils sont mobiles et leur position peut évoluer plusieurs fois au cours d’une année.
L’état des individus peut être modifié lorsqu’ils interagissent (contact entre des vecteurs
infectieux et des arbres sains) ou lorsque le temps passe (réinitialisation de la population de
vecteurs chaque année, sortie d’incubation pour les plantes). Ainsi, ce modèle simule un
processus comportant deux pas de temps différents, car certaines modifications ont lieu au
cours du printemps et les autres se déroulent à une échelle pluriannuelle (Figure 21). Le
programme de simulation correspondant figure en Annexe 3.

Pas de temps inter-annuel
Arrivée aléatoire des vecteurs
Actualisation
de l’état
des plantes
en incubation
III. Perspectives
Transmission
Déplacements
Disparition (migration)
Pas de
temps
saisonnier
- 126 -
Figure 21. Schéma de l’algorithme de simulation
d’une épidémie d’ESFY dans un verger
d’abricotier. Le processus simulé implique deux
pas de temps différents : une évolution rapide de
la localisation des vecteurs infectieux (et de l’état
des arbres inoculés) au cours d’une année, et une
évolution interannuelle de l’état de tout le
système.
La construction de ce modèle simple met en lumière le nombre de processus à connaître
pour obtenir un modèle spatial réaliste. Cependant, même quand certaines propriétés du
système restent inconnues, on peut utiliser un modèle de ce type pour simuler un grand nombre
de réalisations d’un scénario potentiel (basé sur des “dires d’experts”, par exemple). De façon
similaire aux tests d’hypothèses présentés dans ce mémoire, on peut alors comparer les motifs
spatio-temporels simulés à ceux qu’on observe sur le terrain, par exemple sur la base de la
distribution temporelle des arbres malades, ou sur la base de la distribution des distances entre
arbres malades (ce qui revient alors à effectuer un test de Monte Carlo paramétrique plutôt que
non-paramétrique). Cependant, au lieu de définir a priori la valeur de tous les paramètres, on
peut utiliser ce modèle de simulation pour estimer les paramètres inconnus en minimisant
l’écart entre modèle et données, par exemple en se basant sur les statistiques Qc(d) et Vc(d). Ces
utilisations du modèle de simulation obtenu feront l’objet de travaux futurs.

Conclusion
- 127 -
« Il importe de penser globalement
et d’agir localement »
(R. Dubos)

L’objectif de ce travail était de parvenir à une meilleure compréhension du fonctionnement
épidémique de l’ESFY, par le biais d’un ensemble coordonné d’approches directes et
indirectes. Les connaissances relativement limitées initialement disponibles sur les processus
de dispersion du pathogène donnent à la démarche suivie et à la plupart des méthodes d’analyse
un caractère exploratoire mais également suffisamment générique pour qu’elles puissent être
transposées à l’étude d’autres maladies émergentes ou ré-émergentes, ou simplement mal
connues. Pour pouvoir identifier le mode de propagation de l’ESFY dans les vergers, il était
essentiel d’entreprendre un travail pluridisciplinaire combinant des démonstrations
expérimentales, des tests d’hypothèses sur les données de terrain et un modèle intégrant les
facteurs et les processus ainsi mis en évidence. S’il a fallu développer des méthodes
moléculaires de détection et de quantification spécifiquement destinées aux recherches sur
l’ESFY, il a également été nécessaire de mettre en œuvre des méthodes génériques d’analyse –
par des tests d’hypothèses – des motifs spatio-temporels résultant de l’expansion d’une maladie
dans une plantation régulière. D’autres méthodes d’analyse, pas ou peu employées
précédemment dans le domaine de l’épidémiologie végétale, ont été utilisées : analyse
multivariée et régression logistique surdispersée puis analyse spatiale des résidus du modèle,
bootstrap paramétrique, estimation et intervalles de confiance pour des tests par lots.
L’application de l’ensemble de ces méthodes au cas de l’ESFY a permis de mieux comprendre
le fonctionnement de ce système épidémique. Les résultats obtenus, replacés dans le contexte
de la gestion de l’ESFY, fournissent des éléments permettant d’optimiser la stratégie actuelle
de lutte contre cette maladie.
I. Conclusions sur l’épidémiologie de l’ESFY
A. Conséquences des résultats obtenus pour la gestion de la maladie
Pour ne pas déroger à la coutume (voir, par exemple, l’apologie du triangle rédigée par L.
J. Francl 1 en 2001), on peut représenter sous forme d’un tétraèdre les interactions ayant lieu
entre les protagonistes du système épidémique étudié (Figure 22).
Figure 22. Interrelations entre les différents
“acteurs” conditionnant l’épidémiologie d’une
maladie transmise par vecteur.
Gérer la maladie consiste à intervenir sur l’un des composants du pathosystème (sommet)
ou sur l’interaction entre deux composants (arrête). Les résultats obtenus au cours de ce travail
portent sur l’interaction plante-pathogène (susceptibilité ou sensibilité variétale, durée
d’incubation), sur l’interaction plante-vecteur (cycle biologique et déplacements du vecteur,
attraction variétale) et sur l’interaction vecteur-pathogène (cinétique de multiplication,
prévalence du pathogène dans la population vectrice et capacité de transmission). L’effet de
l’environnement n’a pas été étudié pour l’instant, bien qu’il agisse probablement sur le
1 Leonard J. Francl (2001) The disease triangle: a plant pathological paradigm revisited. The Plant Health
Instructor. http://www.apsnet.org/education/InstructorCommunication/TeachingArticles/Francl/
- 128 -

fonctionnement du système épidémique. En pratique, ce composant du système est celui sur
lequel les possibilités d’action sont les plus limitées (action sur le micro-environnement par
l’irrigation ou la fertilisation, par exemple). Cependant, la connaissance de l’impact du climat
sur le développement, voire sur les densités de C. pruni pourrait permettre d’optimiser les
traitements insecticides.
1) Apports sur l’effet de la génétique des arbres
L’analyse de l’enquête réalisée à l’échelle régionale et les tests d’hypothèses à l’échelle
d’un verger composite montrent de façon répétée – et cohérente avec les résultats
expérimentaux issus de la bibliographie – l’existence d’un effet majeur de la combinaison
variété/porte-greffe sur la dynamique de la maladie. Ces résultats indiquent qu’il existe une
variabilité génétique sous-jacente susceptible d’être exploitée dans des programmes
d’amélioration des Prunus pour créer des cultivars plus résistants (ou au moins plus tolérants).
Cette question est d’autant plus cruciale que le développement extrêmement rapide de l’ESFY
dans les vergers de prunier japonais remet sérieusement en cause leur rentabilité dans un
contexte de lutte par arrachage des arbres infectés. La résistance à l’ESFY peut donc être un
critère de rentabilité majeur dans certaines situations, susceptible de modifier les choix de
variétés.
2) Apports sur les transmissions primaires multiples
Les différentes parties du mémoire indiquent que les vecteurs inoculent fréquemment
plusieurs arbres relativement proches les uns des autres. La complémentarité des approches est
flagrante sur ce point car l’enquête régionale nous a conduit à soupçonner ce phénomène qui
peut expliquer la surdispersion et la dépendance spatiale entre vergers ; les tests d’hypothèses
ont ensuite identifié une agrégation spatiale souvent modérée (mais bien réelle) entre les arbres
malades ; enfin, tests d’hypothèses et résultats expérimentaux ont permis de privilégier les
transmissions primaires multiples par rapport aux interprétations alternatives de l’agrégation
observée entre les arbres malades (effets de bords, attractivité des arbres symptomatiques,
transmissions secondaires). L’hypothèse de transmissions successives réalisées par le même
individu est donc la plus probable pour expliquer la dépendance spatiale observée. Ce nouvel
élément signifie concrètement qu’une méthode de lutte efficace contre le vecteur devra
s’attacher à réduire le produit du nombre de vecteurs et du nombre de transmissions par
vecteur. Par exemple, un insecticide à effet lent qui augmenterait la fréquence des
déplacements et des piqûres d’alimentation de C. pruni pourrait être inefficace. Les deux
insecticides actuellement homologués ne posent probablement pas ce genre de problème car ils
sont à base de lambda-cyhalothrine, une matière active réputée pour son effet “choc” du fait de
son action par contact (ACTA, 2003).
3) Apports sur les transmissions interannuelles
La quantification de la cinétique de multiplication du phytoplasme dans le vecteur confirme
et explique les observations de terrain et les expérimentations indiquant que, dans les vergers
d’abricotier, l’essentiel des transmissions a lieu l’année suivant l’acquisition du phytoplasme.
Cette donnée nouvelle étaye les préconisations visant à focaliser la lutte sur les adultes
réimmigrants (Labonne et Lichou, 2003 et 2004). D’autre part, la majorité des transmissions
intervenant après une phase de migration (probablement à longue distance), on attend très peu
de transmissions secondaires dans les vergers d’abricotier. D’ailleurs, ni les transmissions
secondaires, ni l’attraction des vecteurs par les plantes malades ne semblent nécessaires pour
obtenir les motifs spatio-temporels observés : les nouveaux cas d’ESFY seraient donc
indépendants de la présence de plantes symptomatiques dans le verger. Or, l’un des objectifs de
l’arrachage des abricotiers malades dans la stratégie actuelle de lutte contre l’ESFY est de
- 129 -

éduire l’inoculum secondaire présent dans le verger. La pertinence à une échelle locale de cet
objectif de l’arrachage serait alors remise en question. En revanche, dans les vergers contenant
de nombreuses pousses de porte-greffe favorables à C. pruni (myrobolan, prunier), les vecteurs
restent et pondent plus fréquemment, donc les transmissions secondaires – même en faible
proportion – pourraient constituer un risque à cause du grand nombre de vecteurs présents ; ce
risque est encore plus manifeste dans les vergers de prunier japonais. Dans ces situations, la
suppression des arbres malades reste probablement un moyen de limiter la progression de la
maladie vers les arbres situés à proximité, à condition que les arbres asymptomatiques ne
constituent pas une source d’inoculum majeure et cachée.
Le deuxième objectif de la lutte contre la maladie par l’arrachage des plantes malades se
situe à l’échelle de la région de production. Il vise à limiter le nombre de plantes sources à
grande échelle, et ainsi à réduire la proportion de vecteurs infectieux l’année suivante. Cet
objectif ne peut être atteint que si les sources cachées d’inoculum (les plantes infectieuses mais
asymptomatiques, les Prunus sauvages, les vergers non prospectés) représentent une part
mineure des sources de phytoplasme. Or, les Prunus cultivés sensibles ne constituent peut-être
que la partie visible des populations sources d’ESFY, car on trouve des porteurs sains de ‘Ca.
P. prunorum’ à la fois parmi les Prunus cultivés et les Prunus sauvages. Il reste à quantifier la
fréquence et la valeur source de ces plantes ; si elles s’avéraient être importantes, la lutte contre
l’ESFY sur la base de l’arrachage des arbres symptomatiques serait remise en question dans les
vergers d’abricotier sur des porte-greffes peu favorables à C. pruni. Cette situation montre
l’intérêt d’utiliser plusieurs approches complémentaires permettant d’avoir une vision
suffisamment complète de l’épidémiologie de la maladie considérée, car on peut être confronté,
comme ici, à une conjonction de propriétés biologiques rendant inefficace une réponse
classique. Cette situation montre également l’intérêt de prévoir, dès la mise en place d’une
méthode de lutte, les moyens d’en évaluer l’efficacité.
Dans l’état actuel des connaissances, il semble nécessaire de continuer à combiner des
mesures destinées à réduire l’impact local de la maladie et des mesures visant à réduire la
quantité d’inoculum à une grande échelle correspondant aux distances de migration du vecteur.
Les mesures actuellement envisageables sont indiquées sur la Figure 23 ; le Tableau 7 présente
leurs limites respectives, ainsi que les composantes de l’épidémie visées par les méthodes de
lutte.
Réduction régionale de l’inoculum
Arrachage des plantes malades
Limitation de la plantation
d’espèces sources
Protection et contrôle
des pépinières
Réduction de l’attractivité
Suppression des drageons
et utilisation de plantes
peu attractives
Répulsifs
Régulation locale du vecteur
Traitements insecticides contre
les vecteurs réimmigrants
Pièges attractifs
- 130 -
Réduction des dégâts
Utilisation de plantes plus
résistantes ou tolérantes
Suppression des
charpentières malades
dès les 1ers symptômes
Prémunition par des
isolats atténués
Régulation régionale_
du vecteur
Traitements insecticides
Lutte biologique avec
un agent spécifique
Pièges attractifs ou
confusion sexuelle
Figure 23.
Différentes
méthodes de lutte
envisageables
contre l’ESFY dans
l’état actuel des
connaissances. Les
pointillés indiquent
les méthodes qui
risquent de n’être
que marginalement
efficaces ; les
caractères gris
indiquent les
méthodes reposant
sur des moyens qui
ne sont pas encore
disponibles.

Tableau 7. Avantages et inconvénients des principales méthodes de lutte envisageables contre l’ESFY en
verger d’abricotier.
Méthode de lutte Action Inconvénients
Arrachage des plantes
malades à grande échelle
Limitation de la plantation
d’espèces sources
Protection et contrôle
des pépinières
Suppression immédiate
des charpentières malades
Prémunition avec des
isolats atténués
Choix ou amélioration des
variétés (plantes plus
tolérantes au pathogène)
Choix ou amélioration des
variétés (plantes plus
résistantes au pathogène
ou répulsives pour le
vecteur)
Suppression des drageons
pendant tout le printemps
Traitements insecticides
dans les vergers
Pièges attractifs
Régulation régionale du
vecteur (insecticides, lutte
biologique, pièges
attractifs, confusion
sexuelle)
B. Perspectives
Réduction de
l’inoculum régional
Réduction de
l’inoculum régional
Réduction à grande
échelle des
infections initiales
Réduction des
dégâts sur les arbres
malades
Réduction des
dégâts sur les arbres
malades
Réduction des
dégâts sur les arbres
malades
Réduction durable
des transmissions
Réduction du
nombre de vecteurs
Réduction du
nombre de vecteurs
Réduction du
nombre de vecteurs
Réduction des
contaminations à
grande échelle
- 131 -
Coût de la prospection et de la
coordination ; inutile si les vergers sont des
sources négligeables d’inoculum
Peu réaliste si les espèces sources
sont rentables
Coût de la surveillance
Coût d’une surveillance permanente ;
inutile si le pathogène atteint le tronc de
l’arbre avant les premiers symptômes
Réduction de la productivité des arbres
sains prémunis ; coût de production et de
distribution du “vaccin” ; ignorance du
mécanisme en jeu
Augmentation du nombre de sources
cachées d’inoculum pour les arbres
sensibles de la région
Peu réaliste quand les critères sanitaires
sont secondaires ; durée nécessaire pour
identifier et introgresser des gènes de
résistance
Surcoût
Surcoût ; impacts sur l’environnement ;
perte de marchés
Surcoût ; coûts de R&D ; effet partiel
et incertain (élimination des vecteurs
présents ou attraction d’autres vecteurs)
Coût des produits et de la coordination de
leur utilisation ; difficulté pour couvrir
toute la zone ; risque d’apparition de
résistances à moyen terme ; risque de
déstabiliser l’écosystème associé à C.
pruni et de générer d’autres problèmes ;
coûts de R&D pour les solutions nouvelles
Nous avons obtenu un faisceau d’arguments plus ou moins directs qui indiquent de façon
concordante que les vecteurs arrivent dans les vergers et transmettent le phytoplasme
responsable de l’ESFY de façon indépendante de la position des arbres précédemment
malades. L’agrégation observée ne serait donc que le résultat du déplacement des psylles
initialement infectieux. La perspective la plus immédiate de ce travail consiste à prolonger
l’analyse des “cartes de maladie” disponibles à l’aide des outils développés, afin d’affiner les
conclusions obtenues et de vérifier leur généralité. Si l’absence de transmission secondaire est

confirmée par des études expérimentales directes, la modélisation précise des déplacements
du vecteur perdra une partie de ses justifications. En effet, cette étape resterait utile dans la
perspective lointaine de l’utilisation de pièges attractifs, mais l’objectif immédiat d’optimiser
la lutte locale basée sur l’arrachage deviendrait caduc.
La suite logique de ce travail est donc de quantifier directement les capacités de
transmission des différents stades du vecteur selon la date de l’acquisition, le préalable étant
de disposer d’une méthode d’élevage efficace et comparable avec les conditions naturelles.
Les comportements du vecteur (attraction par les plantes malades, par les autres vecteurs,
fréquence des déplacements) méritent également d’être étudiés avec attention, que ce soit
expérimentalement ou par des tests d’hypothèses sur d’autres vergers. Enfin, dans une optique
plus finalisée, la modélisation prédictive des dates de présence du vecteur et de son abondance
dans les vergers en fonction de paramètres climatiques peut permettre d’optimiser les
traitements insecticides ; cependant, dans un premier temps, une approche plus empirique
(impliquant par exemple des captures de C. pruni sur les prunelliers) peut jouer ce rôle.
Le deuxième axe à développer pour mieux comprendre la dynamique épidémique
concerne la période infectieuse des arbres (en particulier les liens entre durée de latence et
durée d’incubation) en fonction du climat et de leur âge lors de l’inoculation par les vecteurs.
En effet, la méconnaissance de ce paramètre démultiplie les interprétations possibles des
motifs spatio-temporels observés. De plus, ce phénomène introduit dans le système une inertie
à prendre en compte en théorie comme en pratique. Son évaluation directe pose de sérieux
problèmes expérimentaux faute de méthode fiable pour obtenir de grandes quantités
d’insectes infectieux mais elle mérite d’être entreprise au vu des enjeux. L’analyse de suivis
temporels dans des vergers issus de semis pourrait être un moyen indirect et complémentaire
d’estimer la durée d’incubation des jeunes arbres.
Enfin, un troisième aspect fondamental pour comprendre le fonctionnement du système a
été très peu abordé au cours de ce mémoire : il s’agit d’estimer précisément la contribution
relative des Prunus sauvages et domestiques à la dynamique épidémique. Si l’impact potentiel
des plantes sauvages infectieuses sur la gestion de la maladie a déjà été précisé au début de
cette conclusion, le thème des échanges entre les plantes sauvages et domestiques ouvre
également des perspectives intéressantes sur un plan plus théorique. En effet, l’étude d’une
éventuelle spécialisation des populations de C. pruni en fonction de la plante hôte et l’examen
des migrations du vecteur entre Prunus et conifères pourraient révéler des facettes inattendues
de l’épidémiologie de l’ESFY et témoigner des liens entre la génétique des populations et
l’épidémiologie. Les informations nouvelles ainsi obtenues pourraient être intégrées dans un
modèle dépassant l’échelle spatiale et temporelle du verger, destiné par exemple à analyser les
rétroactions potentielles sur le système épidémique en cas d’introduction massive d’une
espèce très sensible ou très résistante.
Sur le plan méthodologique, l’expérience acquise a permis de s’apercevoir que l’absence
de tests d’hypothèses génériques basés sur les motifs spatio-temporels dessinés par les plantes
malades peut ralentir la phase exploratoire des recherches sur l’épidémiologie d’une maladie.
Certains des articles présentés dans ce mémoire ont donc visé à combler partiellement cette
lacune en proposant des tests pour des hypothèses relativement classiques. Il apparaît
clairement que la préexistence d’un ensemble de tests regroupés dans un cadre flexible
permettrait d’accélérer les analyses, améliorant ainsi la réactivité face à une émergence. En ce
qui concerne l’organisation de cette phase exploratoire initiale, il semble d’ailleurs que l’une
des premières démarches à entreprendre suite à une émergence soit de mettre en place un
essai multilocal dans une zone contaminée, avec des parcelles de taille suffisante constituées
de plantes présentant toutes les garanties sanitaires et dont un lot témoin serait conservé dans
un local protégé pendant la durée de l’essai. La répartition spatio-temporelle des plantes
- 132 -

malades correspondrait alors uniquement à la propagation naturelle de la maladie : une partie
des motifs observés (et des hypothèses explicatives) serait ainsi avantageusement éliminée.
Une autre voie qui pourrait nécessiter le développement ou la transposition de méthodes
spécifiques concerne l’estimation des paramètres d’un modèle à partir de l’observation des
positions des plantes malades.
Ces différentes pistes de recherche s’inscrivent dans la démarche proposée et illustrée au
cours de ce mémoire, car elles s’appuient sur la complémentarité entre expérimentation et
modélisation afin de répondre à des questions épidémiologiques, tout en impliquant d’autres
disciplines.
II. Conclusions sur la démarche retenue
Pour conclure, on peut insister sur la stratégie de recherche qui a été choisie, car elle
constitue l’apport le plus générique de ce travail centré sur un pathosystème spécifique.
L’idée directrice est simple : l’efficacité de l’exploration initiale d’un système épidémique
mal connu repose sur la combinaison d’approches et de disciplines différentes. Ainsi, le
Tableau 8 résume les facteurs analysés par les différentes approches retenues.
Tableau 8. Apports des différentes approches dans l’analyse des facteurs impliqués dans le développement
spatio-temporel de l’ESFY.
Expéri- Enquête
Bibliographie mentation régionale
• cycle du • âge du verger
• identité du vecteur
vecteur • multiplication
puis rétention
• plantes hôtes du pathogène
principales
• potentiel
du pathogène
infectieux du
et du vecteur
vecteur selon
son âge
• une partie des
modalités de • proportion
la vection d’insectes
infectieux
• génétique du
greffon
• génétique du
porte-greffe
• structure du
parcellaire
• pratiques de
l’arboriculteur
• origine du
matériel
• agrégation des
transmissions
a
Apports attendus dans de futurs travaux.
- 133 -
Tests
d’hypothèses Modèle mécaniste a
• rôle des bords
• isotropie des
déplacements
• influence des
arbres avec des
symptômes
.
• effet des variétés
• nature des
transmissions
• nombre de vecteurs
infectieux par an
• distance et fréquence
des déplacements
des vecteurs
• durée d’incubation
Si l’on se réfère à la Figure 3 (p. 11) présentant un cadre d’étude pour les maladies mal
connues, cinq des huit voies d’étude mentionnées ont été abordées. En effet, la stratégie
choisie combine l’étude de l’association entre pratiques culturales et prévalence de la maladie,
l’identification expérimentale de propriétés de la vection, des tests d’hypothèses sur la
localisation spatio-temporelle des arbres malades et la modélisation des processus sousjacents
; notre approche implique également, mais de façon plus marginale, un investissement
dans le diagnostic et des suggestions sur la gestion de la maladie.
La gestion optimale d’une maladie prend en compte ses propriétés épidémiologiques
plutôt que d’apporter une réponse stéréotypée et maximaliste. Dans cette optique, il est
nécessaire de se baser sur une conjonction d’approches différentes, car chaque approche prise
individuellement peut être trompeuse. L’ESFY en est un bon exemple, puisque la
confrontation des différentes approches employées indique que la transmission se déroule

essentiellement à une échelle pluriannuelle, ce qui signifie que cette maladie est
fondamentalement de type monocyclique * alors qu’une étude préliminaire pouvait laisser
penser le contraire (Labonne et al., 2000). Cet élément nouveau remet partiellement en cause
la gestion de la maladie par l’arrachage des plantes malades car cette pratique est plutôt
destinée à lutter contre les maladies polycycliques * . Ainsi, la synergie qui découle du
dialogue entre observation, expérimentation et modélisation permet d’identifier rapidement,
parmi l’ensemble des fonctionnements possibles, les points cruciaux de l’épidémiologie d’une
maladie, les hypothèses les plus probables, les développements méthodologiques nécessaires
et les méthodes de lutte pertinentes. Cette démarche est résumée dans la Figure 24 qui
représente les interactions entre le système réel, les approches expérimentales, les différentes
formes de modélisation (allant du modèle implicite au modèle mathématique, en passant par
les tests d’hypothèses), et les méthodes de lutte contre la maladie.
Comme l’illustre le système biologique étudié, l’épidémiologie est une discipline à très
fort potentiel intégratif (largement sous-exploité), car la compréhension d’un système
épidémique peut reposer sur la conjonction d’approches et de disciplines différentes et
requiert souvent d’explorer plusieurs échelles (temporelles, spatiales, niveaux d’organisation
du vivant). L’intégration peut donc être transversale (par l’éclairage croisé de différentes
disciplines), mais aussi horizontale (par la nécessaire prise en compte des interactions ayant
lieu au sein du tétraèdre épidémique présenté en Figure 22), et verticale (en s’intéressant à la
dispersion du pathogène, mais aussi aux mécanismes biologiques sous-jacents, et à la fonction
des différents protagonistes du système). On peut donc espérer que le concept
d’épidémiologie intégrative passera un jour du statut de concept nouveau à celui de
pléonasme.
- 134 -

Expérimentations
expérimentales
Suggérer
Evaluer a
posteriori
Valider
Epidémies
naturelles
Estimer
Interpréter
Explorer Démontrer
Modèles du
système
épidémique
Stratégie
de lutte
contre la
maladie
- 135 -
Système
épidémique réel
Enrichir
Processus
sous-jacents
Explorer :
- tester des hypothèses
- établir des corrélations
- simuler des scénarios
Evaluer
a priori
Résumer
Organiser
Agir sur
Figure 24. Schéma général des relations entre le système épidémique étudié, l’expérimentation, la
modélisation et la stratégie de gestion de la maladie.

- 136 -

Références
bibliographiques
- 137 -

1. Abou Jawdah Y., Karakashian A., Sobh H., Martini M., and Lee I. M. (2002) An epidemic of almond
witches' broom in Lebanon: classification and phylogenetic relationships of the associated phytoplasma.
Plant Disease 86:477-484.
2. ACTA (2003) Index Phytosanitaire. Association de Coordination Technique Agricole, Paris.
3. Aegerter B. J., Nuñez J. J., and Davis R. M. (2003) Environmental factors affecting rose downy mildew
and development of a forecasting model for a nursery production system. Plant Disease 87:732-738.
4. AGRESTE (2003) Enquête sur la Structure des Vergers en 2002, Chiffres et Données Agriculture. SCEES,
Paris.
5. Ahrens W., and Pigeot I., eds. (2005) Handbook of Epidemiology. Edited by. Springer-Verlag, Berlin.
6. Anderson P. K., Cunningham A. A., Patel N. G., Morales F. J., Epstein P. R., and Daszak P. (2004)
Emerging infectious diseases of plants: pathogen pollution, climate change and agrotechnology drivers.
Trends in Ecology & Evolution 19:535-544.
7. Anfoka G. H., and Fattash I. (2004) Detection and identification of aster yellows (16SrI) phytoplasma in
peach trees in Jordan by RFLP analysis of PCR-amplified products (16S rDNAs). Journal of Phytopathology
152:210-214.
8. Baric S., and Dalla-Via J. (2004) A new approach to apple proliferation detection: a highly sensitive realtime
PCR assay. Journal of Microbiological Methods 57:135-145.
9. Barot S., Gignoux J., and Menaut J. C. (1999) Demography of a savanna palm tree: predictions from
comprehensive spatial pattern analyses. Ecology 80:1987-2005.
10. Bassanezi R. B., Bergamin A., Amorim L., Gimenes-Fernandes N., Gottwald T. R., and Bové J.-M.
(2003) Spatial and temporal analyses of citrus sudden death as a tool to generate hypotheses concerning its
etiology. Phytopathology 93:502-512.
11. Besag J. E. (1977) Discussion on Dr Ripley's paper. Journal of the Royal Statistical Society, series B
39:193-195.
12. Blomquist C. L., and Kirkpatrick B. C. (2002) Frequency and seasonal distribution of pear psylla infected
with the pear decline phytoplasma in California pear orchards. Phytopathology 92:1218-1226.
13. Brasier C. M., and Scott J. K. (1994) European oak declines and global warming: a theoretical assessment
with special reference to the activity of Phytophthora cinnamomi. EPPO Bulletin 24:221-232.
14. Breniaux D. (2000) Bilan phytosanitaire arboriculture fruitière 1999. Phytoma 525:14-18.
15. Brown K. (2001) Florida fights to stop citrus canker. Science 292:2275-2276.
16. Brzin J.et al. (2001) First results on laboratory analyses of phytoplasmas on fruit trees. 5 th Slovenian
Conference on Plant Protection, Catez ob Savi, Slovenia, 6-8 March 2001.
17. Burt C. (1950) The factorial analysis of qualitative data. British Journal of Statistical Psychology 3:166-185.
18. Byrne D. N., and Bellows T. S. J. (1991) Whitefly biology. Annu. Rev. Entomol. 36:431-457.
19. Campbell C. L. (1986) Interpretation and uses of disease progress curves for root diseases. Pages 38-54
in: Plant Disease Epidemiology, vol 1: Population Dynamics and Management, K. J. Leonard and W. E. Fry
eds. Macmillan, New York.
20. Campbell C. L., and Madden L. V. (1990) Introduction to Plant Disease Epidemiology. Wiley, New York.
21. Carraro L., Osler R., Refatti E., and Favali M. A. (1992) Natural diffusion and experimental transmission of
plum leptonecrosis. Acta Horticulturae 309:285-290.
22. Carraro L., Loi N., Ermacora P., and Osler R. (1998a) High tolerance of European plum varieties to plum
leptonecrosis. European Journal of Plant Pathology 104:141-145.
23. Carraro L., Osler R., Loi N., Ermacora P., and Refatti E. (1998b) Transmission of European stone fruit
yellows phytoplasma by Cacopsylla pruni. Journal of Plant Pathology 80:233-239.
24. Carraro L., Loi N., and Ermacora P. (2001) Transmission characteristics of the European stone fruit
yellows phytoplasma and its vector Cacopsylla pruni. European Journal of Plant Pathology 107:695-700.
25. Carraro L., Ferrini F., Ermacora P., and Loi N. (2002) Role of wild Prunus species in the epidemiology of
European stone fruit yellows. Plant Pathology 51:513-517.
26. Carraro L., Ferrini F., Ermacora P., and Loi N. (2004a) Transmission of European stone fruit yellows
phytoplasma to Prunus species by using vector and graft transmission. Acta Horticulturae 657:449-453.
27. Carraro L., Ferrini F., Ermacora P., Loi N., Martini M., and Osler R. (2004b) Macropsis mendax as a
vector of elm yellows phytoplasma of Ulmus species. Plant Pathology 53:90-95.
28. Carraro L., Ferrini F., Labonne G., Ermacora P., and Loi N. (2004c) Seasonal infectivity of Cacopsylla
pruni, vector of European stone fruit yellows phytoplasma. Annals of Applied Biology 144:191-195.
29. Castelain C., Chastelliere M. G., Jullian J. P., Morvan G., and Lemaire J. M. (1997) La prémunition
contre l'enroulement chlorotique de l'abricotier. Phytoma 493:39-44.
- 138 -

30. Chabrolin C. (1924) Quelques maladies des arbres fruitiers de la vallée du Rhône. Annales des Epiphyties
10:263-338.
31. Chadœuf J., Capowiez Y., Kretzschmar A., and Dessart H. (1997) Testing interaction between a random
area process and another spatial process: the analysis of spatial patterns of soil sections. Acta Stereologica
16:251-258.
32. Chadœuf J., Brix A., Pierret A., and Allard D. (2000) Testing local dependence of spatial structures on
images. Journal of Microscopy 200:32-41.
33. Christensen N. M., Nicolaisen M., Hansen M., and Schulz A. (2004) Distribution of phytoplasmas in
infected plants as revealed by real-time PCR and bioimaging. Molecular Plant-Microbe Interactions 17:1175-
1184.
34. Cliff A. D., and Ord J. K. (1981) Spatial Processes: Models and Applications. Pion Ltd., London.
35. Cocroft R. B. (2005) Vibrational communication facilitates cooperative foraging in a phloem-feeding insect.
Proceedings of the Royal Society B-Biological Sciences 272:1023-1029.
36. Collett D. (1991) Modelling Binary Data. Chapman and Hall, London, UK.
37. Conci C., Rapisarda C., and Tamanini L. (1992) Annotated catalogue of the Italian Psylloidea - First part
(Insecta Homoptera). Atti dell' Accademia Roveretana degli Agiati ser. VII, 2B:104-107.
38. Cook R. D., and Weisberg S. (1982) Residuals and Influence in Regression. Chapman and Hall, London.
39. Crowder M. J. (1978) Beta-binomial anova for proportions. Applied Statistics 27:34-37.
40. Dallot S., Gottwald T., Labonne G., and Quiot J.-B. (2003) Spatial pattern analysis of sharka disease
(Plum pox virus strain M) in peach orchards of southern France. Phytopathology 93: 1543-1552.
41. Dallot S., Gottwald T., Labonne G., and Quiot J.-B. (2004) Factors affecting the spread of Plum pox virus
strain M in peach orchards subjected to roguing in France. Phytopathology 94:1390-1398.
42. Davies D. L., Barbara D. J., and Clark M. F. (1995) The detection of MLOs associated with pear decline in
pear trees and pear psyllids by polymerase chain reaction. Acta Horticulturae 386:484-488.
43. Davies D. L., and Adams A. N. (2000) European stone fruit yellows phytoplasmas associated with a
decline disease of apricot in southern England. Plant Pathology 49:635-639.
44. De Wolf E. D., Madden L. V., and Lipps P. E. (2003) Risk assessment models for wheat Fusarium head
blight epidemics based on within-season weather data. Phytopathology 93:428-435.
45. Delgado M. (1997) Enroulement chlorotique de l'abricotier : des pistes de recherche. L'Arboriculture
Fruitière 507:25-27.
46. Delic D., Martini M., Ermacora P., Carraro L., and Myrta A. (2005) First report of fruit tree phytoplasmas
and their psyllid vectors in Bosnia and Herzegovina. Journal of Plant Pathology 87:150-150.
47. Desvignes J. C., and Cornaggia D. (1983) Observation on apricot chlorotic leaf roll (ACLR): sensitiveness
of different Prunus species, detection, spread in plum orchards. Acta Horticulturae 130:249-256.
48. Desvignes J. C. (1999) Maladies à virus des arbres fruitiers. CTIFL, Paris.
49. Diggle P. J. (1983) Statistical Analysis of Spatial Point Patterns, Mathematics in Biology. Academic Press,
London.
50. Duduk B., Botti S., Ivanovic M., Krstic B., Dukic N., and Bertaccini A. (2004) Identification of
phytoplasmas associated with grapevine yellows in Serbia. Journal of Phytopathology 152:575-579.
51. Duncan R. P. (1991) Competition and the coexistence of species in a mixed podocarp stand. Journal of
Ecology 79:1073-1084.
52. Duriez S. (2003) Caractérisation de facteurs influençant l'épidémiologie de l'ESFY (European stone fruit
yellows). Mémoire de stage de fin d’études, Ecole Nationale Supérieure Agronomique de Rennes.
53. Duval H. (1999) Prunes japonaises : un défi à relever. L'Arboriculture Fruitière 524:35-41.
54. Duval H., Jullian J. P., and Lemaire J. M. (1999) Enroulement chlorotique de l'abricotier : évaluation de la
sensibilité des principales variétés de prunier japonais... et du nouveau sur le vecteur. Phytoma 516:38-40.
55. Efron B., and Tibshirani R. J. (1993) An Introduction to the Bootstrap. Chapman and Hall, New York.
56. Ferrandino F. J. (1996) Two-dimensional distance class analysis of disease-incidence data: problems and
possible solutions. Phytopathology 86:685-691.
57. Ferrandino F. J. (1998) Past nonrandomness and aggregation to spatial correlation: 2DCORR, a new
approach for discrete data. Phytopathology 88:84-91.
58. Fialová R., Navrátil M., Válová P., Lauterer P., Kocourek F., and Poncarová-Vorácková Z. (2004)
Epidemiology of European stone fruit yellows phytoplasma in the Czech Republic. Acta Horticulturae
657:483-487.
59. Finlay B. B., See R. H., and Brunham R. C. (2004) Rapid response research to emerging infectious
diseases: lessons from SARS. Nature Reviews Microbiology 2:602-607.
- 139 -

60. Firrao G.et al. (2004) 'Candidatus Phytoplasma', a taxon for the wall-less, non-helical prokaryotes that
colonize plant phloem and insects. International Journal of Systematic and Evolutionary Microbiology
54:1243-1255.
61. Forget P. M., Mercier F., and Collinet F. (1999) Spatial patterns of two rodent-dispersed rain forest trees
Carapa procera (Meliaceae) and Vouacapoua americana (Caesalpiniaceae) at Paracou, French Guiana.
Journal of Tropical Ecology 15:301-313.
62. Fredricks D. N., and Relman D. A. (1996) Sequence-based identification of microbial pathogens: a
reconsideration of Koch's postulates. Clinical Microbiology Reviews 9:18-33.
63. Garnier M., Foissac X., Gaurivaud P., Laigret F., Renaudin J., Saillard C., and Bové J.-M. (2001)
Mycoplasmas, plants, insect vectors: a matrimonial triangle. Comptes Rendus de l'Academie des Sciences
324:923-928.
64. Garrett K. A., Madden L. V., Hughes G., and Pfender W. F. (2004) New applications of statistical tools in
plant pathology. Phytopathology 94:999-1003.
65. Gavrilovic M., and Paunovic S. (1963) Apoplexy of apricot grown in Yugoslavia and mesures to control it.
Annales des Epiphyties 14:144-150.
66. Genini M., and Ramel M. E. (2004) Distribution of European stone fruit yellows phytoplasma in apricot trees
in Western Switzerland. Acta Horticulturae 657:455-458.
67. Gibson G. J., Kleczkowski A., and Gilligan C. A. (2004) Bayesian analysis of botanical epidemics using
stochastic compartmental models. Proceedings of the National Academy of Sciences of the United States of
America 101:12120-12124.
68. Giunchedi L., Poggi-Pollini C., and Credi R. (1983) Susceptibility of stone fruit trees to the Japanese
plum-tree decline causal agent. Acta Horticulturae 130:285-290.
69. Goidanich G. (1933) Un deperimento dei susini. Bollettino della Stazione di Patologia Vegetale, Roma
13:160-173.
70. Goidanich G. (1934) La leptonecrosi dei ciliegi e degli albicocchi. Bollettino della Stazione di Patologia
Vegetale, Roma 14:531-540.
71. Goreaud F., and Pélissier R. (2003) Avoiding misinterpretation of biotic interactions with the intertype K12function:
population independence vs. random labelling hypotheses. Journal of Vegetation Science 14:681-
692.
72. Gottwald T. R., Avinent L., Llácer G., Hermoso de Mendoza A., and Cambra M. (1995) Analysis of the
spatial spread of sharka (plum pox virus) in apricot and peach orchards in eastern Spain. Plant Disease
79:266-278.
73. Gottwald T. R., Cambra M., Moreno P., Camarasa E., and Piquer J. (1996) Spatial and temporal analyses
of citrus tristeza virus in eastern Spain. Phytopathology 86:45-55.
74. Gottwald T. R., Sun X., Riley T., Graham J. H., Ferrandino F., and Taylor E. L. (2002) Geo-referenced
spatiotemporal analysis of the urban citrus canker epidemic in Florida. Phytopathology 92:361-377.
75. Gray S. M., Moyer J. W., and Bloomfield P. (1986) Two-dimensional distance class model for quantitative
description of virus-infected plant distribution lattices. Phytopathology 76:243-248.
76. Hamel C., Vujanovic V., Nakano-Hylander A., Jeannotte R., and St-Arnaud M. (2005) Factors
associated with fusarium crown and root rot of asparagus outbreaks in Quebec. Phytopathology 95:867-873.
77. Heinrich M., Botti S., Caprara L., Arthofer W., Strommer S., Hanzer V., Katinger H., Bertaccini A., and
Laimer Da Câmara Machado M. (2001) Improved detection methods for fruit tree phytoplasmas. Plant
Molecular Biology Reporter 19:169-179.
78. Higuchi R., Fockler C., Dollinger G., and Watson R. (1993) Kinetic PCR analysis - Real-time monitoring of
DNA amplification reactions. Bio-Technology 11:1026-1030.
79. Hill M. O., and Smith A. J. E. (1976) Principal component analysis of taxonomic data with multi-state
discrete characters. Taxon 25:249-255.
80. Hodkinson I. D., and White I. M. (1979) Homoptera Psylloidea. Handbooks for the identification of British
insects. Royal Entomological Society of London II.
81. Hotelling H. (1933) Analysis of a complex of statistical variables into principal components. Journal of
Educational Psychology 24:417-441.
82. Hughes G., and Madden L. V. (1992) Aggregation and incidence of disease. Plant Pathology 41:657-660.
83. Hughes G., and Madden L. V. (1993) Using the beta-binomial distribution to describe aggregated patterns
of disease incidence. Phytopathology 83:759-763.
84. Hughes G., and Madden L. V. (1995) Some methods allowing for aggregated patterns of disease incidence
in the analysis of data from designed experiments. Plant Pathology 44:927-943.
85. Hughes G., McRoberts N., Madden L. V., and Gottwald T. R. (1997) Relationships between disease
incidence at two levels in a spatial hierarchy. Phytopathology 87:542-550.
- 140 -

86. Institute of Medicine (1992) Emerging Infections: Microbial Threats to Health in the United States. National
Academy Press, Washington.
87. International Panel on Climate Change (2001) Bilan 2001 des Changements Climatiques : Rapport de
Synthèse. Cambridge University Press, New York.
88. Jarausch W., Lansac M., Saillard C., Broquaire J.-M., and Dosba F. (1998) PCR assay for specific
detection of European stone fruit yellows phytoplasmas and its use for epidemiological studies in France.
European Journal of Plant Pathology 104:17-27.
89. Jarausch W., Eyquard J. P., Mazy K., Lansac M., and Dosba F. (1999) High level of resistance of sweet
cherry (Prunus avium L.) towards European stone fruit yellows phytoplasmas. Advances in Horticultural
Science 13:108-112.
90. Jarausch W., Eyquard J. P., Lansac M., Mohns M., and Dosba F. (2000a) Susceptibility and tolerance of
new French Prunus domestica cultivars to European stone fruit yellows phytoplasmas. Journal of
Phytopathology 148:489-493.
91. Jarausch W., Saillard C., Broquaire J.-M., Garnier M., and Dosba F. (2000b) PCR-RFLP and sequence
analysis of a non-ribosomal fragment for genetic characterization of European stone fruit yellows
phytoplasmas infecting various Prunus species. Molecular and Cellular Probes 14:171-179.
92. Jarausch W., Danet J.-L., Labonne G., Dosba F., Broquaire J.-M., Saillard C., and Garnier M. (2001a)
Mapping the spread of apricot chlorotic leaf roll (ACLR) in southern France and implication of Cacopsylla
pruni as a vector of European stone fruit yellows (ESFY) phytoplasmas. Plant Pathology 50:782-790.
93. Jarausch W., Jarausch Wehrheim B., Danet J.-L., Broquaire J.-M., Dosba F., Saillard C., and Garnier
M. (2001b) Detection and identification of European stone fruit yellows and other phytoplasmas in wild
plants in the surroundings of apricot chlorotic leaf roll-affected orchards in southern France. European
Journal of Plant Pathology 107:209-217.
94. Jarausch W., Peccerella T., Schwind N., Jarausch B., and Krczal G. (2004a) Establishment of a
quantitative real-time PCR assay for the quantification of apple proliferation phytoplasmas in plants and
insects. Acta Horticulturae 657:415-420.
95. Jarausch B., Schwind N., Jarausch W., and Krczal G. (2004b) Overwintering adults and springtime
generation of Cacopsylla picta (synonym C. costalis) can transmit apple proliferation phytoplasmas. Acta
Horticulturae 657:409-413.
96. Kison H., Kirkpatrick B. C., and Seemüller E. (1997) Genetic comparison of the peach yellow leaf roll
agent with European fruit tree phytoplasmas of the apple proliferation group. Plant Pathology 46:538-544.
97. Kison H., and Seemüller E. (2001) Differences in strain virulence of the European stone fruit yellows
phytoplasma and susceptibility of stone fruit trees on various rootstocks to this pathogen. Journal of
Phytopathology 149:533-541.
98. Labonne G., Broquaire J.-M., Jarausch W., Freydier M., and Quiot J.-B. (2000) Enroulement chlorotique
de l'abricotier : la base d'une stratégie de lutte en vergers d'abricotiers. Phytoma 530:32-35.
99. Labonne G., and Lichou J. (2003) Enroulement chlorotique de l'abricotier : le point sur le vecteur
Cacopsylla pruni et les implications relatives à la lutte contre la maladie. L'Arboriculture Fruitière 571:XXIX-
XXXII.
100. Labonne G., and Lichou J. (2004) Data on the life cycle of Cacopsylla pruni, Psyllidae vector of European
stone fruit yellows (ESFY) phytoplasma, in France. Acta Horticulturae 657:465-470.
101. Laimer Da Câmara Machado M., Paltrinieri S., Hanzer V., Arthofer W., Strommer S., Martini M.,
Pondrelli M., and Bertaccini A. (2001) Presence of European stone fruit yellows (ESFY or 16SrX-B)
phytoplasmas in apricots in Austria. Plant Pathology 50:130-135.
102. Lauterer P. (1999) Results of the investigations on Hemiptera in Moravia, made by the Moravian Museum
(Psylloidea 2). Acta Musei Moraviae, Scientiae biologicae 84:71-151.
103. Laviña A., Sabaté J., García-Chapa M., Batlle A., and Torres E. (2004) Occurrence and epidemiology of
European stone fruit yellows phytoplasma in Spain. Acta Horticulturae 657:489-494.
104. Lederer W., and Seemüller E. (1992) Demonstration of mycoplasmas in Prunus species in Germany.
Journal of Phytopathology 134:89-96.
105. Lee I. M., Bertaccini A., Vibio M., and Gundersen D. E. (1995) Detection of multiple phytoplasmas in
perennial fruit trees with decline symptoms in Italy. Phytopathology 85:728-735.
106. Lemaire J.-M., Jullian J.-P., Audergon J.-M., and Castelain C. (1998) Enroulement chlorotique de
l'abricotier : symptomatologie et gamme d'hôtes. L'Arboriculture Fruitière 520:21-24.
107. Lichou J., and Audubert A. (1989) L'abricotier. CTIFL, Paris.
108. Lindsey J. K. (1999) On the use of corrections for overdispersion. Applied Statistics 48:553-561.
109. Llácer G., Sanchez-Capuchino J. A., Forner J. B., Bono R., and Casanova R. (1976) Tetracycline
treatments of stone fruit trees affected by apricot chlorotic leaf roll. Acta Horticulturae 67:141-148.
- 141 -

110. Loi N., Carraro L., Musetti R., Pertot I., and Osler R. (1995) Dodder transmission of two different MLOs
from plum trees affected by "leptonecrosis". Acta Horticulturae 386:465-470.
111. Lorenz K.-H., Dosba F., Poggi Pollini C., Llácer G., and Seemüller E. (1994) Phytoplasma diseases of
Prunus species in Europe are caused by genetically similar organisms. Zeitschrift fur Pflanzenkrankheiten
und Pflanzenschutz 101:567-575.
112. Lorenz K.-H., Schneider B., Ahrens U., and Seemüller E. (1995) Detection of the apple proliferation and
pear decline phytoplasmas by PCR amplification of ribosomal and nonribosomal DNA. Phytopathology
85:771-776.
113. Lotwick H. W., and Silverman B. W. (1982) Methods for analysing spatial processes of several types of
points. Journal of the Royal Statistical Society, series B 44:406-413.
114. Loxdale H. D., and Lushai G. (1999) Slaves of the environment: the movement of herbivorous insects in
relation to their ecology and genotype. Philosophical Transactions of the Royal Society of London Series B-
Biological Sciences 354:1479-1495.
115. Madden L. V., and Hughes G. (1999) Sampling for plant disease incidence. Phytopathology 89:1088-1103.
116. Maixner M., Ahrens U., and Seemüller E. (1995) Detection of the German grapevine yellows
(Vergilbungskrankheit) MLO in grapevine, alternative hosts and a vector by a specific PCR procedure.
European Journal of Plant Pathology 101:241-250.
117. Malisano G., Firrao G., and Locci R. (1996) 16S rDNA-derived oligonucleotide probes for the differential
diagnosis of plum leptonecrosis and apple proliferation phytoplasmas. Bulletin OEPP 26:421-428.
118. Manly B. F. J. (1991) Randomization and Monte Carlo Methods in Biology. Chapman & Hall, London.
119. Marcone C., Ragozzino A., and Seemüller E. (1996) Association of phytoplasmas with the decline of
European hazel in southern Italy. Plant Pathology 45:857-863.
120. Marcone C., and Seemüller E. (2001) A chromosome map of the European stone fruit yellows
phytoplasma. Microbiology Reading 147:1213-1221.
121. Mark M. S., and Hoddle S. (2004) The potential adventive geographic range of glassy-winged
sharpshooter, Homalodisca coagulata and the grape pathogen Xylella fastidiosa: implications for California
and other grape growing regions of the world. Crop Protection 23:691-699.
122. Marzachi C., Veratti F., and Bosco D. (1998) Direct PCR detection of phytoplasmas in experimentally
infected insects. Annals of Applied Biology 133:45-54.
123. Mascherpa A.-L. (1996) Enroulement chlorotique de l'abricotier : état des lieux des vergers gardois.
L'Exploitant Agricole 807:3-4.
124. Matheron G. (1965) Les Variables Régionalisées et leur Estimation. Masson, Paris.
125. McCullagh P., and Nelder J. (1989) Generalized Linear Model. Chapman and Hall, London.
126. McRoberts N., Hughes G., and Madden L. V. (1996) Incorporating spatial variability into simple disease
progress models for crop pathogens. Pages 75-82 in: Modelling in Applied Biology: Spatial Aspects. The
Association of Applied Biologists, Wellesbourne.
127. Mila A. L., Carriquiry A. L., and Yang X. B. (2004) Logistic regression modeling of prevalence of soybean
Sclerotinia stem rot in the north-central region of the United States. Phytopathology 94:102-110.
128. Miquelis A., Martin J.-F., Carson E. W., Brun G., and Gilles A. (2000) Performance of 18S rDNA helix
E23 for phylogenetic relationships within and between the Rotifera-Acanthocephala clades. Comptes
Rendus de l'Academie des Sciences, Série III 323:925-941.
129. Moffat A. S. (2001) Finding new ways to fight plant diseases. Science 292:2270-2273.
130. Morens D. M., Folkers G. K., and Fauci A. S. (2004) The challenge of emerging and re-emerging
infectious diseases. Nature 430:242-249.
131. Morse S. S., and Schluederberg A. (1990) Emerging viruses: the evolution of viruses and viral diseases.
Journal of Infectious Diseases 162:1-7.
132. Morse S. S. (1995) Factors in the Emergence of Infectious-Diseases. Emerging Infectious Diseases 1:7-15.
133. Morvan G. (1957) Mise en évidence de l'action d'un virus dans le dépérissement de l'abricotier. Comptes
Rendus de l'Academie d'Agriculture de France 43:13-14.
134. Morvan G., and Castelain C. (1965) Recherche d'indicateurs pour les virus liés à l'Enroulement chlorotique
de l'Abricotier. Zastita Bilja 85:419-425.
135. Morvan G., and Castelain C. (1968) L'enroulement chlorotique de l'abricotier et la nécrose du liber.
Annales des Epiphyties 19:247-268.
136. Morvan G., and Castelain C. (1972) Induction d'une résistance de l'abricotier à l'enroulement chlorotique
par le greffage sur Prunus spinosa L. Annales de Phytopathologie 4:418 (abstr.).
137. Morvan G., Giannotti J., and Marchoux G. (1973) Untersuchungen über die Ätiologie des chlorotischen
Blattrolls des Aprikosenbaums: Nachweis von Mykoplasmen. Phytopathologische Zeitschrift 76:33-38.
- 142 -

138. Morvan G. (1977) Apricot chlorotic leaf roll. EPPO Bulletin 7:37-55.
139. Mugglestone M. A., Lee B. Y. Y., Roff M. N. M., Jones P., Plumb R. T., and Deadman M. L. (1996) Point
process modelling of BYMV incidence in lupins. Pages 87-94 in: Modelling in Applied Biology: Spatial
Aspects. The Association of Applied Biologists, Wellesbourne.
140. Musetti R., di Toppi L. S., Martini M., Ferrini F., Loschi A., Favali M. A., and Osler R. (2005) Hydrogen
peroxide localization and antioxidant status in the recovery of apricot plants from European Stone Fruit
Yellows. European Journal of Plant Pathology 112:53-61.
141. Myrta A., Ermacora P., Stamo B., and Osler R. (2003) First report of phytoplasma infections in fruit trees
and grapevine in Albania. Journal of Plant Pathology 85:64-64.
142. Navrátil M., Válová P., Fialová R., Petrová K., Fránová J., Nebesárová J., Poncarová Vorácková Z.,
and Karesová R. (2001) Survey for stone fruit phytoplasmas in the Czech Republic. Acta Horticulturae
550:377-382.
143. Nelson S. C., Marsh P. L., and Campbell C. L. (1992) 2DCLASS, a two-dimensional distance class
analysis software for the personal computer. Plant Disease 76:427-432.
144. Nelson S. C. (1995a) STCLASS - spatiotemporal distance class analysis software for the personal
computer. Plant Disease 79:643-648.
145. Nelson S. C. (1995b) Spatiotemporal distance class analysis of plant disease epidemics. Phytopathology
85:37-43.
146. Nicot P. C., and Rouse D. I. (1987) Relationship between soil inoculum density of Verticillium dahliae and
systemic colonization of potato stems in commercial fields over time. Phytopathology 77.
147. Olivier T., Kummert J., and Steyer S. (2004) First detection of European stone fruit yellows phytoplasma
(ESFY) in Belgium. Acta Horticulturae 657:519-521.
148. Ossiannilsson F. (1992) The Psylloidea (Homoptera) of Fennoscandia and Denmark. vol. 26, Fauna
Entomologica Scandinavica. Brill E. J., Leiden.
149. Parmesan C., and Yohe G. (2003) A globally coherent fingerprint of climate change impacts across natural
systems. Nature 421:37-42.
150. Penner J., Griggs D., Lister D., Dokken D. J., and McFarland M. (1999) Aviation and the Global
Atmosphere. Cambridge University Press, New York.
151. Penttinen A., Stoyan D., and Henttonen H. M. (1992) Marked point-processes in forest statistics. Forest
Science 38:806-824.
152. Pethybridge S. J., Wilson C. R., Ferrandino F. J., and Leggett G. W. (2000) Spatial analyses of viral
epidemics in Australian hop gardens: implications for mechanisms of spread. Plant Disease 84:513-515.
153. Pethybridge S. J., and Madden L. V. (2003) Analysis of spatiotemporal dynamics of virus spread in an
Australian hop garden by stochastic modeling. Plant Disease 87:56-62.
154. Peyrard N., Calonnec A., Bonnot F., and Chadœuf J. (2005) Explorer un jeu de données sur grille par
tests de permutation. Revue de Statistiques Appliquées LIII:59-78.
155. Pélissier R., and Goreaud F. (2001) A practical approach to the study of spatial structure in simple cases of
heterogeneous vegetation. Journal of Vegetation Science 12:99-108.
156. Pivonia S., and Yang X. B. (2004) Assessment of the potential year-round establishment of soybean rust
throughout the world. Plant Disease 88:523-529.
157. Ploaie P. G. (1980) Dovezi experimentale privind prezenta micoplasmelor (Mollicutes-mycoplasmatales) in
caisii cu simptome de declin si rolul acestora in procesul de pieire a caisului. Analele Institutului de Cercetari
pentru Protectia Plantelor 16:29-34.
158. Poggi Pollini C., Giunchedi L., and Gambin E. (1993) Presence of mycoplasma-like organisms in peach
trees in northern-central Italy. Phytopathologia Mediterranea 32:188-192.
159. Poggi Pollini C., Bissani R., Giunchedi L., Mori N., Dradi D., and Visigalli T. (2004) Detection of
European stone fruit yellows phytoplasma (ESFYP) in Homoptera insects and in wild stone fruit trees
collected in peach orchards in Northern Italy. Acta Horticulturae 657:513-518.
160. Ramel M.-E., Gugerli P., Bourquin L., de Meyer J., and Schaub L. (2001) Caractérisation de
l'enroulement chlorotique de l'abricotier et détection du phytoplasme ESFY en Suisse romande. Revue
Suisse de Viticulture, Arboriculture et Horticulture 33:279-286.
161. Ramel M.-E., and Gugerli P. (2004) Epidemiological survey of European stone fruit yellows phytoplasma in
two orchards in Western Switzerland. Acta Horticulturae 657:459-463.
162. Reynolds K. M., and Madden L. V. (1988) Analysis of epidemics using spatio-temporal autocorrelation.
Phytopathology 78:240-246.
163. Ribeiro P. J. J., Christensen O. F., and Diggle P. J. (2003) geoR and geoRglm: software for model-based
geostatistics. 3 rd International Workshop on Distributed Statistical Computing, March 20–22, Vienna, Austria.
164. Ripley B. D. (1977) Modelling spatial patterns. Journal of the Royal Statistical Society, series B 39:172-212.
- 143 -

165. Root T. L., Price J. T., Hall K. R., Schneider S. H., Rosenzweig C., and Pounds J. A. (2003) Fingerprints
of global warming on wild animals and plants. Nature 421:57-60.
166. Rosso P. H., and Hansen E. M. (2003) Predicting Swiss needle cast disease distribution and severity in
young Douglas-fir plantations in coastal Oregon. Phytopathology 93:790-798.
167. Roumagnac P., Pruvost O., Chiroleu F., and Hughes G. (2004) Spatial and temporal analyses of bacterial
blight of onion caused by Xanthomonas axonopodis pv. allii. Phytopathology 94:138-146.
168. Rumbos I. C., and Bosabalidis A. M. (1985) Mycoplasmalike organisms associated with declined plum
trees in Greece. Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz 92:47-54.
169. R Development Core Team (2004) R: A Language and Environment for Statistical Computing. R
Foundation for Statistical Computing, Vienna, Austria.
170. Saporta G. (1990) Probabilités, Analyse de Données et Statistiques. Technip, Paris.
171. Schaub L., and Monneron A. (2003) Phénologie de Cacopsylla pruni, vecteur de l'enroulement chlorotique
de l'abricotier. Revue Suisse de Viticulture, Arboriculture et Horticulture 35:123-125.
172. Scherm H., and Yang X. B. (1999) Risk assessment for sudden death syndrome of soybean in the northcentral
United States. Agricultural Systems 59:301-310.
173. Schneider B., Seemüller E., Smart C. D., and Kirkpatrick B. C. (1995) Phylogenetic classification of plant
pathogenic mycoplasma-like organisms or phytoplasma. Pages 369-380 in: Molecular and Diagnostic
Procedures in Mycoplasmology, R. Razin and J. G. Tully eds. Academic Press, San Diego.
174. Seemüller E., Marcone C., Lauer U., Ragozzino A., and Goschl M. (1998) Current status of molecular
classification of the phytoplasmas. Journal of Plant Pathology 80:3-26.
175. Seemüller E., and Schneider B. (2004) 'Candidatus Phytoplasma mali', 'Candidatus Phytoplasma pyri' and
'Candidatus phytoplasma prunorum', the causal agents of apple proliferation, pear decline and European
stone fruit yellows, respectively. International Journal of Systematic and Evolutionary Microbiology 54:1217-
1226.
176. Seljak G., and Petrovic N. (2001) An overview of the presence and research of the phytoplasma diseases
on grapevine and fruit trees in Slovenia. Sodobno Kmetijstvo 34:466-471.
177. Shtienberg D. (1996) Variables associated with intensity of Alternaria leaf spot in Pima cotton.
Phytopathology 86:123-128.
178. Skrzeczkowski L. J., Howell W. E., Eastwell K. C., and Cavileer T. D. (2001) Bacterial sequences
interfering in detection of phytoplasma by PCR using primers derived from the ribosomal RNA operon. Acta
Horticulturae:417-424.
179. Smart C. D., Schneider B., Blomquist C. L., Guerra L. J., Harrison N. A., Ahrens U., Lorenz K.-H.,
Seemüller E., and Kirkpatrick B. C. (1996) Phytoplasma-specific PCR primers based on sequences of the
16S-23S rRNA spacer region. Applied and Environmental Microbiology 62:2988-2993.
180. Smith M. C., Page W. W., Holt J., and Kyetere D. (2000) Spatial dynamics of maize streak virus disease
epidemic development in maize fields. International Journal of Pest Management 46:55-66.
181. Soroker V., Talebaev S., Harari A. R., and Wesley S. D. (2004) The role of chemical cues in host and
mate location in the pear psylla Cacopsylla bidens (Homoptera : Psyllidae). Journal of Insect Behavior
17:613-626.
182. Sutherst R. W. (2001) The vulnerability of animal and human health to parasites under global change.
International Journal for Parasitology 31:933-948.
183. Taylor L. H., Latham S. M., and Woolhouse M. E. J. (2001) Risk factors for human disease emergence.
Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 356:983-989.
184. Tedeschi R., Visentin C., Alma A., and Bosco D. (2003) Epidemiology of apple proliferation (AP) in
northwestern Italy: evaluation of the frequency of AP-positive psyllids in naturally infected populations of
Cacopsylla melanoneura (Homoptera : Psyllidae). Annals of Applied Biology 142:285-290.
185. Thébaud G., Labonne G., Castelain C., and Chadœuf J. (2004) Spatio-temporal analysis of disease
spread provides insights into the epidemiology of European stone fruit yellows. Acta Horticulturae 657:471-
476.
186. Thébaud G., Peyrard N., Dallot S., Calonnec A., and Labonne G. (2005) Investigating disease spread
between two assessment dates with permutation tests on a lattice. Phytopathology In Press.
187. Thioulouse J., Chessel D., Dolédec S., and Olivier J. M. (1997) ADE-4: a multivariate analysis and
graphical display software. Statistics and Computing 7:75-83.
188. Thompson D., Muriel P., Russell D., Osborne P., Bromley A., Rowland M., Creigh-Tyte S., and Brown
C. (2002) Economic costs of the foot and mouth disease outbreak in the United Kingdom in 2001. Revue
Scientifique et Technique de l'Office International des Epizooties 21:675-687.
189. Topchiiska M., Marcone C., and Seemüller E. (2000) Detection of pear decline and European stone fruit
yellows in Bulgaria. Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz 107:658-663.
- 144 -

190. Torres E., Martin M. P., Paltrinieri S., Vila A., Masalles R., and Bertaccini A. (2004) Spreading of ESFY
phytoplasmas in stone fruit in Catalonia (Spain). Journal of Phytopathology 152:432-437.
191. Torres E., Bertolini E., Cambra M., Monton C., and Martin M. P. (2005) Real-time PCR for simultaneous
and quantitative detection of quarantine phytoplasmas from apple proliferation (16SrX) group. Molecular and
Cellular Probes 19:334-340.
192. Tully J. G., Whitcomb R. F., Rose D. L., Bové J.-M., Carle P., Somerson N. L., Williamson D. L., and
Edengreen S. (1994) Acholeplasma brassicae sp. nov. and Acholeplasma palmae sp. nov., 2 non-sterolrequiring
mollicutes from plant surfaces. International Journal of Systematic Bacteriology 44:680-684.
193. UNAIDS (2004) AIDS epidemic update. UNAIDS, Geneva.
194. Upton G., and Fingleton B. (1985) Spatial Data Analysis by Example. Volume 1: Point Pattern and
Quantitative Data. John Wiley & Sons, Chichester.
195. Vanderplank J. E. (1963) Plant Diseases: Epidemics and Control. Academic Press, New York.
196. Waggoner P. E., and Rich S. (1981) Lesion distribution, multiple infection, and the logistic increase of plant
disease. Proceedings of the National Academy of Sciences of the United States of America 78:3292-3295.
197. Weber A., and Maixner M. (1998) Survey of populations of the planthopper Hyalesthes obsoletus Sign.
(Auchenorrhyncha, Cixiidae) for infection with the phytoplasma causing grapevine yellows in Germany.
Journal of Applied Entomology 122:375-381.
198. Wei W.et al. (2004) In planta dynamic analysis of onion yellows phytoplasma using localized inoculation by
insect transmission. Phytopathology 94:244-250.
199. Weiss R. A., and McLean A. R. (2004) What have we learnt from SARS? Philosophical Transactions of the
Royal Society of London Series B-Biological Sciences 359:1137-1140.
200. Welham S. J., Turner J. A., Gladders P., Fitt B. D. L., Evans N., and Baierl A. (2004) Predicting light leaf
spot (Pyrenopeziza brassicae) risk on winter oilseed rape (Brassica napus) in England and Wales, using
survey, weather and crop information. Plant Pathology 53:713-724.
201. WHO (2003) Severe Acute Respiratory Syndrome (SARS): Status of the Outbreak and Lessons for the
Immediate Future. World Health Organization, Geneva, 20 May 2003.
202. Williams D. A. (1982) Extra-binomial variation in logistic linear models. Applied Statistics 31:144-148.
203. Woolhouse M. E. J. (2002) Population biology of emerging and re-emerging pathogens. Trends in
Microbiology 10:S3-S7.
204. Woolhouse M. E. J., Haydon D. T., and Antia R. (2005) Emerging pathogens: the epidemiology and
evolution of species jumps. Trends in Ecology & Evolution 20:238-244.
205. Yonow T., Kriticos D. J., and Medd R. W. (2004) The potential geographic range of Pyrenophora
semeniperda. Phytopathology 94:805-812.
206. Yvon M., Labonne G., and Thébaud G. (2004) Survival of European stone fruit yellows phytoplasma
outside fruit crop production areas: a case study in southeastern France. Acta Horticulturae 657:477-481.
Sources Internet citées :
Program for Monitoring Emerging Diseases : http://www.fas.org/promed/
Food and Agriculture Organization of the United Nations : http://faostat.fao.org/
Diana M. Percy (20/01/2005) Song, sex and psyllid systematics : http://www.psyllids.org/psyllidsSOUND.htm
Leonard J. Francl (2001) The disease triangle: a plant pathological paradigm revisited. The Plant Health
Instructor: http://www.apsnet.org/education/InstructorCommunication/TeachingArticles/Francl/
- 145 -

- 146 -

Annexes
- 147 -

I. Annexe 1 : Programme R pour estimer une proportion à partir de tests
groupés
#------------------------------------------------------------------------#
# Du fait des bornes choisies pour l’intervalle (1e-8 ; 1-1e-8), ce #
# ce programme n’est pas adapté pour estimer des proportions d’individus #
# très faibles ou très élevées. #
#------------------------------------------------------------------------#
EntreDon

if (estim!=1) W2.99) text(B2,0,paste("1 -",signif(1-B2,3)),adj=c(1,1))
else text(B2,0,signif(B2,3),adj=c(1,1))
}
cat("\n") ; cat("Matrice des effectifs observés : \n")
names(jDon)

II. Annexe 2 : Programme R pour tester des hypothèses d’indépendance
par permutation
#######################################################################################
# Fonction de calcul des classes de distances entre cas dans toutes les directions. #
# #
# Pour chaque classe de distance, on représente un intervalle de confiance sous H0 #
# et éventuellement un code pour la P-value. #
# A est le tableau fourni par l’utilisateur contenant les informations nécessaires #
# sur chaque arbre. #
# Les paramètres d'entrée de la fonction sont les colonnes de A où se trouvent les #
# coordonnées X et Y, ainsi que la condition qui désigne les cas. Il y a aussi les #
# distances inter- et intra-rang ainsi qu'un booléen indiquant si on souhaite ramener #
# les distances réelles à des distances en nombre d'arbres. #
# Le paramètre "trq" représente la proportion de la diagonale au-delà de laquelle #
# on souhaite arrêter la représentation des classes de distance. #
# Dans tout le programme, les arbres manquants doivent avoir pour valeur -1. #
# Quand il existe des sous-groupes, les permutations sont réalisées indépendamment #
# dans chaque sous-groupe, mais les distances sont calculées globalement. #
# Lors d'une analyse, on doit choisir entre des statistiques de test calculées dans #
# toutes les directions [do1D=c(F,F)], dans le sens du rang [do1D=c(T,F)], dans le #
# sens de l'inter-rang [do1D=c(F,T)]. Plusieurs statistiques de distance peuvent être #
# choisies simultanément : EP, distribution des d entre points ; EPcum, idem cumulé #
# PPV, distribution des d au plus proche voisin ; Bd, d aux bords ; Var, variogramme. #
# Pour tracer un variogramme à partir de variables continues, attribuer n'importe #
# quelle valeur à valCas et utiliser conti=T. #
#######################################################################################
GenDClass

if ((sum(Do[1:4])!=0)&(sum(do1D)==0)) dCas

#######################################################################################
# Test 1 : Indépendance entre 2 groupes de points quand le groupe censuré est CSR. #
# #
# Fonction de calcul des classes de distance dans toutes les directions, entre les #
# cas appartenant à deux groupes distincts. Cette fonction est initialement prévue pr #
# des situations où la censure (Cas1, manquants) est fixée lors des permutations. #
# Calculer ces distances est donc valable quand les cas censurés (Cas2) ne présentent #
# pas de différence significative par rapport à une répartition spatiale aléatoire. #
# Les classes de distance calculées sont comparées à leur intervalle de confiance #
# sous H0 impliquant une redistribution partielle mais pas de censure à gérer. #
# Les paramètres d'entrée de la fonction sont les colonnes de A où se trouvent les #
# coordonnées X et Y, ainsi que la condition qui désigne les cas. Il y a aussi les #
# distances inter- et intra-rang ainsi qu'un booléen indiquant si on souhaite ramener #
# les distances réelles à des distances en nombre d'arbres. #
# Le paramètre "trq" représente la proportion de la diagonale au-delà de laquelle on #
# souhaite arrêter la représentation des classes de distance. #
# Quand on souhaite redistribuer les Cas2 avec une probabilité différente selon les #
# plantes il faut entrer ces probabilités dans une colonne supplémentaire et indiquer #
# lors de l'appel de la fonction le numéro de colP. Il faut aussi renseigner valCas. #
# Quand il existe des sous-groupes, les permutations sont réalisées indépendamment #
# dans chaque sous-groupe, mais les distances sont calculées globalement. #
#######################################################################################
Gen12permNC

III. Annexe 3 : Programme R pour simuler le développement spatiotemporel
de l’ESFY dans un verger d’abricotier
# Fonction de création d’un verger
# (N ligne, N colonne, d inter-rang, d intra-rg, manquant
InitArbres

dst

IV. Annexe 4 : “Testing Boolean Assumption in the Non Convex Case When
a Bounded Grain can be Assumed”
Joël Chadœuf, Jean-Noël Bacro et Gaël Thébaud
(En préparation)
- 155 -

- 156 -

Testing boolean assumption in the non convex
case when a bounded grain can be assumed
Chadœuf J, Bacro JN & Thébaud G
October 29, 2005
Abstract
Spatial independence of objects is a strong assumption when using
Boolean models. Methods to test it have then been developed,
but only when the objects are convex. We propose here to replace
this assumption by a bound assumption of the objects, which can be
more easily assumed when modeling spatial patterns in ecology and
agricultural science. A test is then proposed, based on the length of
the voids of the intersection between transect lines and a dilation of
the original process by a disk whose diameter is the bound of the object.
Its application is shown to several examples, together with its
extension to an epidemiological case on orchards, where this problem
comes from.

1 introduction
Boolean models are used in spatial statistics to model the spatial
repartition of objects. They assume that these objects, generally
called grains, are independently located and have independent shapes.
The boolean model is then obtained as the union of all these objects.
Boolean models are used in very different fields as for example in
ecology where they can be used to describe the spatial repartition of
plants when these plants cannot be assumed punctual (Diggle 1981),
or in soil science when modeling the soil surface roughness (Bertuzzi
et al 1995, Kamphorst et al 2005), this surface being considered as the
union of independent 3D shapes, the easiest one being the half-sphere.
A less classical case can be encountered in spatial epidemiology
when looking at illnesses transmitted by insects on regularly planted
plots. In illnesses like ESFY, which develop on orchards, insects spend
only a short time of their life cycle on the orchard and spend the other
part of their life cycle on pine trees several kilometers away. The
phytoplasm which is transmitted by the insect can be transmitted
only after spending part of its life cycle inside the insect. Therefore
it is admitted that the ESFY cases are generated by insects already
carrying a phytoplasma when they arrived on the orchard. Moreover,
once this large fly from pine trees to the orchard is done, the insects
perform only a few flies at short distance (to the nearest trees or the
next ones), unless it is disturbed and will perform a very large one.
Assuming independence of insects, i.e. that they arrive independently
to each other and independently to trees already carrying ESFY, the
pattern of ESFY trees can be considered as the sampling of a boolean
process, where each object is formed by the union of the surfaces
formed by meshes centered on the successive insect positions on the
canopy, supposed to cover all the orchard area. For young trees whose
canopies do not connect, the same applies if one can assume that the
arrival point process is Poisson on the area formed by the union of the
tree canopies.
In all these cases, independence assumption is a crucial assumption
as it influences all statistical properties of the model. Testing it is then
a preliminary step before going to spatial modeling when only global
statistical properties are of interest, or an important step for itself
in cases like plant epidemiology as it can give some insight in insect

ehavior, which is difficult to observe directly.
Such a test has been developed by Laslett( Laslett 1985, Cressie
1991, Molchanov 1997). It reposes on the analysis of the spatial pattern
of observed extrema. It remains then very general, the only
needed assumption being that of convexity. On the other side, this
assumption is seldom fulfilled in agricultural science and ecology where
convexity assumption can be more easily replaced by other assumptions
as for example boundedness of the grain, on the basis of biological
knowledge. In the ESFY example given above, a grain is the
union of plants contaminated by one insect and will not generally be
convex. Field observation on insect behavior can lead to a maximum
number of short distance fly and a maximum distance of fly, and the
bound will be given as the product of the two parameters. In ecology,
boolean models can be used to describe the spatial repartition of
plants whose canopy can be observed. Underlying assumption is then
that seedlings are independently spread and grow independently, a
bush being an isolated plant or the union of several plants with intercepted
canopies. The canopy of one plant will not be convex, except
on some species with very regular growth.
As mentioned by Molchanov (1997), testing the boolean assumption
without any hypothesis on the grain is impossible, and we propose
here to replace the convexity assumption by a boundedness condition.
The principle of the test, presented in the first section, is first to dilate
the process in one dimension, then sample transect lines parallel to
that direction and compare the length distribution of voids conditionally
to the total void length with the expected distribution of voids
under the assumption of total randomness. In a second section we
show on three simulated examples, one where the typical point process
is Poisson one where the typical point process is a Strauss process
and one where the typical point process is an aggregated point process,
how the test works. In a third section we apply the test on two
examples, one issued from soil surfaces description, the second issued
from ecology and interested in buxus distribution. In a fourth section,
we show how the test can be adapted in the ESFY epidemiological
example, and how finiteness of the orchards can be dealt with. Limits
of the method will be discussed in a last section.

2 The boolean model in IR 2
2.1 the boolean model
Definition of the boolean model can be found in (Cressie 1991, Molchanov
1997, Stoyan 1995) together with an extensive description of its properties.
For the following, we just recall its definition.
Let X = (Xi) i∈IN , an homogeneous Poisson point process and M =
(Mi) i∈IN a set of measurable independent random sets. The boolean
model B = (X, M) is defined as B =
i Xi ⊕ Mi. In the following, we
assume that the grains are bounded, that is, there exists 0 < r < ∞
so that Mi ∈ B(0, r).
If b is a bounded set, if Sb = S ⊕ b denotes the dilation of S by b,
then Bb =
i Xi ⊕ (Mi ⊕ b) is a boolean process. Therefore, if B is a
boolean process with bounded grain, the process obtained by dilating
each grain by a disk of radius r (resp. by a an oriented segment of
length r) is a boolean process. In the first case, the intersection of
any dilated grain by a given line D is a segment. In the second case,
the intersection of any dilated grain by a given line D parallel to the
dilating segment is also a segment.
2.2 the intersection of a boolean model by a
straight line
If D is a given straight line, the intersection B ∩ D of the boolean
process B by D is a boolean process. This can be easily understood
in the case of bounded grains: grains Xi⊕Mi intersecting D have their
typical point Xi in a cylinder C of width 2r and axe parallel to D.
B ∩ D is then equal to P (Xi) ⊕ Mi ∩ D where P is the orthogonal
projection of C onto D. Therefore, the intersection by a line D of
the dilation of the bounded boolean process by a segment of length
r parallel to D is a boolean process of segments. If Di is a series
of parallel lines separated by more than r, the boolean processes Bi
defined as the intersections with the lines Di of the dilation of B by
the segment of length r parallel to D0 are independent.
If B0 is a boolean segment process on the lines, let us denote Vi
the void segments, that is the largest segments not intercepting B0.
The length li of the void segments are independent and exponentially

distributed. So, the length distribution of the n segments Vi, knowing
that n i=1 li = L, is the distribution of segments obtained by throwing
n − 1 points uniformly independently on a segment of length L.
2.3 The proposed test
Let B ∩ W the observation of the boolean process B through a rectangular
sampling window W = [0, a] × [0, b]. Suppose that the grains
of the boolean process are bounded by a positive bound r.
We propose in a first step to dilate the observed process by the segment
[0, r] parallel to one of the sides of W , say the first one, then restrict
the observation of the dilated process to the window Wr = [r, a]×[0, b]
so as to avoid border effect.
In a second step, we consider a series of N parallel transects Di,
parallel to the first side of W , and separated by r. The K intersections
Di∩Br ∩Wr are then K independent realizations of a boolean segment
process on the line observed through a segment of length a − r.
In a third step, we consider the length of the void segments li,j,
j ≤ Ji of Di ∩ Br ∩ Wr which do not intercept the border of Wr.
Under the boolean assumption, the distribution of the (li,j) lengths
knowing the total length of Ji uncensored void segments per transect
Li = Ji
j=1 li,j > 0 is the distribution of length of the consecutive segments
obtained by throwing Ji − 1 points randomly uniformly on the
segments Li.
The statistics we propose to use is then the length distribution of
1 Ni=1 Ji void segments g(x, (li,j)) = N
j=1 1I {li,j≤x}
i=1 Ji
The test can be performed by either:
• comparing the observed statistics to its individual confidence
band, obtained by simulation,
• computing the p-value of the observed segment length variance.
A detailed description of such procedure can be found for example in
Diggle (1981) in the case of mapped point pattern exploration.

2.4 grid approximation
In practice, one very often does not observe the area process in W ,
but observe its realization on a regular grid, the realization at the
center of each cell being 1 or 0 whether the cell intersects the boolean
process or not. Let U = (us)s∈S be the intersection of the grid with
W , vs = {x ∈ W ; || x − us ||= mins
′(|| x − us ′ ||)}
This is for example the case when mapping bush coverage by using
aerial photography, as presented in the following. The observed
process is then X = (xs)s∈S, where xs = 1I {vs∩B=∅}
This can be also the case when looking at a plant disease transmitted
by insects in orchards. Suppose that the trees are old enough
so that their canopies form a continuous surface. Orchard trees being
of the same age, species and variety, the canopies of all trees are more
or less similar, and equal to v0, the area of the cell centered at 0, as
soon as they do not overlap. If insects arrive and move independently
in the canopy, let us denote Y = (Yi) the process of first insect arrival,
Zi = ∪j∈Ji uij the set of the successive relative positions of insect i
from Yi. The sets Yi + Zi are independent from each other. If insects
arrive in independent identically distributed small groups, let Yi be
the center of a group, Zi the relative positions of insects of group i
around Yi. Then, one gets also that the sets Yi + Zi are independent
from each other. Suppose that these insects feed on trees and transmit
an illness observed at the tree level when feeding. The observed
process of tree illness X is then the intersection of us with the boolean
process Y + Z + v0.
In all these cases, if the value of Xs1 , .., Xsn on n consecutive points
of the grid is null, then the intersection of the original boolean process
with the segment [Xs1 , Xsn] is empty, and two consecutive empty segments
on the grid are of independent length. The same tests as above
can be applied by replacing randomness of segment limits on [0, Li]
by randomness of segment limits on [0, Li]∩IN and conditioning of the
number of segments.
2.5 testing with an assumption as general as
possible
There are only few methods for testing the boolean model (see for
example Molchanov 1997) and the convexity of the grain is essential
for all the methods. The most popular approach comes from Laslett’s

ule which transforms the tangent points of the boolean model to
an homogeneous Poisson process with the same intensity as the underlying
boolean model (Stoyan et al. 1995, Molchanov 1997). The
test is then based on a Poisson test of the transformed process. But
Laslett’s transformation explicitely uses the positions of the extrema
of the grains and in practice these are often unknown. Moreover, when
these positions are available it is only with an error. How such errors
will affect the transformation is unknown but clearly errors add up and
may seriously affect the conclusion of the test. Indeed, in practice, the
convexity assumption of the grain appears as a serious limitation. To
get around this problem, one idea is to dilate the grain, but dilation
allows to tend towards the convexity without any garantee to reach
it. As an example, a regular star will need a large dilation before nonconvexity
becomes negligeable. As shown before, our test approach
only needs a bounded grain assumption and as a consequence allows
to work in more general contexts.
3 simulation examples
Two simulated examples were performed in order to check the procedure.
In the first one, we used a boolean model with non-convex
grain to see if the boolean assumption was well detected when taking
into account the non-convexity as proposed above, and rejected if not
taken into account. In the second one, we considered a Strauss point
process, on which we attached the same non-convex grains, in order to
test if the boolean assumption was rejected when taking into account
the non-convexity.
3.1 boolean model
Figure 1(a) presents the boolean model realization. The Poisson process
intensity is λ = 24.3 whereas each grain is formed of 3 discs of
radius r = 0.044 disposed on an horizontal line and separated by a
distance d = 0.066. Observation is made on a 5×5 window.
Bound was chosen equal to b = 0.244, distance between consecutive
horizontal transects was equal to b. Figure 1(b) illustrates the result
of the dilation on the original process observed on the intersection
with the transects and Wr.
Figure 1(c) presents the result of the test when no dilation of the

original process is performed. The observed segment length distribution
remains generally outside the interval confidence band, leading
to a rejection of the boolean assumption. Similarly, the thick line
representing the p-value p(x) remains below 5%.
Figure 1(d) presents the result of the test after dilation. The observed
segment length distribution is presented in thin plain line with
its 95% individual confidence band in broken line. The observed curve
lies inside its individual confidence band under the boolean assumption.
The thick broken line presents the changes of the p-value p(x).
This last function is never below 0.42, corresponding to no rejection
of the boolean assumption.
In this case, not taking into account the non-convexity may lead
to falsely reject the boolean assumption.
3.2 Strauss model of typical points
The Strauss model used was defined with the following parameters.
Point process intensity was λ = 24.3, inhibition parameter c = 0.5
and inhibition distance r = 0.44. Same grains as above are attached
to each point. Observation window was a 5×5 square. For testing, the
bound was chosen equal to b = 0.244, distance between consecutive
horizontal transects was equal to b.
Figure 2(a) presents a realization of the process, figure 2(b) the
result of the dilation of this realization observed on the intersection
with the transects.
Figure 2(c) presents the result of the test when no dilation is performed.
The observed segment length distribution lies outside the
individual confidence band build under H0, its p-value function being
always near 0, so that the boolean assumption is rejected. However,
rejection is not so much due to a lack of short length segments as
expected from the Strauss process, but to an excess due to the grain
non-convexity. Not taking into account the grain shape but just looking
at such curves may then lead to misinterpretations, as for example
concluding the typical point process is not Poisson but an aggregative
process instead of a regular one.
Figure 2(d) presents the result of the test after dilation of the original
process. The observed segment length lies outside the confidence
bound for short lengths, leading to rejection of the boolean assumption,
but the curve lies near the limits of the confidence bound.
From the test procedure itself, in the case of a regular process,

large void segments will clearly appear less often as expected under
the boolean assumption. The same result seems to be also true for
small segments too but, because of the non-convexity, a grain could
give several small void segments. In other words, ignorance of the nonconvexity
of the grain could then introduce a balancing of the small
segments distribution and thus lead to a false conclusion regarding
to the underlying process. In such a case, taking into account the
non-convexity of the grain is essential.
3.3 test power
Two series of tests were conducted in order to look at the test power
changes. A first series is based on a Poisson distribution of typical
points, a second one on a Strauss distribution. For each of them,
point process characteristics are the same as above: λ = 24.3 in both
cases and c = 0.5, r = 0.44 for the Strauss process.
We made vary the window area (5 × 5, 10 × 10, 15 × 15) in order
to look at how the mixing property well applied on the tests results,
and the distance between circles, i.e. the non-convexity of the grain
(d = k ∗ 0.066 with k = 1 . . . 4). Bound used in the test varied consequently.
100 simulations were performed in each case. Statistic used
is the p-value of the segment length variance, which follows a uniform
distribution under boolean assumption.
Figure 3 presents the results in Q-Q plots. Curves corresponding
to the boolean process are given in red, those for the area process
based on Strauss distribution in black. The thicker the line, the larger
the distance between consecutive circles in one grain, the more the
non convexity.
Under boolean assumption, Q-Q plot curves (in red) stay well
around the diagonal curve. The larger the window, the closer the
set of curves corresponding to a lower variability in the test. Under
Strauss assumption, the larger the window, the better the test power
for all distances d between consecutive circles. For the smaller window,
the test is not powerful for the largest d (d = 0.198 and d = 0.264).
In fact, for such d, the bound used becomes large and the coverage
by the dilated grain is high, so that the number of segments at our
disposal to perform the test drops.

4 data set examples
4.1 soil surface modeling
An experiment was conducted in INRA to study small scale roughness
measurement techniques and modeling. Roughness is an important
factor in soil surface as it greatly influences water storage and runoff.
Several models have been proposed to model this roughness, among
them boolean processes which offer the advantage of taking explicitly
the notion of clods, these one being represented as union of grains.
In this case, soil clods were arranged on two 1 square meter areas,
one in a seemingly random manner, the other one in rows of
about 25cm. Surface height was measured on a squared grid of 2mm
lag by a automated laser equipment. Figure 4a and 4b present the
area processes obtained by looking at part of the process above 10cm
height, after removal of the trend due to rows in the second case. Under
boolean 3-D surface assumption, this area process is a boolean
process.
Bound was taken as equal to 0.08m. Figures 4a and 4b present the
two process areas, Figures 5a and 5b the cumulative distribution function
of the segment length of the intersection of the dilated process by
the horizontal transects. One may notice an excess of small segments
with respect to the boolean assumption in the isotropic case, a lack of
such segments for the anisotropic case. Interestingly, the test based on
the variance of the segment length rejects boolean assumption in the
anisotropic case (p-value=0.018), whereas it does not in the isotropic
one (p-value=0.16), due to the distribution of large segments.
4.2 bushes spatial repartition
Buxus bushes develop on former pasture areas unused for several years
in regions like Causse Méjean in France, from where the picture presented
in figure 4c is taken. Buxus is a slow growing plant which is
invading these pastures since 50 years due to changes in agricultural
practices. Invasion is done by both bush expansion and seed spread.
In this picture, bushes larger than 30cm thickness are present and
constitute the initial source of seeds on which dispersion models are
applied. For a given buxus coverage, invasion speed will then depend
on seed source spatial repartition. Bush mapping on large scales is
not possible, and one as to rely on bush spatial repartition models,

together with local measurements at several places to take into account
possible large scale intensity variations. Knowing whether a
boolean model is an acceptable model or whether an more specific
one is necessary is a preliminary step to invasion prediction before
deciding which kinds of measurements have to be done.
The observed pasture field figure 4c is a 130m×160m area. The
bound was taken as equal to 9m, largely above the increase in thickness
of buxus during 50 years. Estimated annual growth of buxus in this
region is 1cm/year in each direction. Such a large bound allowed for
presence of some large bushes 50 years ago for agricultural practices
as for example field delimitation or litter for sheep.
Figure 5b presents the segment length distribution curve. The
curve lies inside the confidence band, near the upper limit. The test
based on variance of these lengths rejects the boolean assumption with
a p-value of 0.001.
4.3 vegetal epidemiology
Figure 6a presents the health status of apricot trees in five young
orchards, planted in 1999, where ESFY is present in southeastern
France. Total amount of trees is 5794, total number of diseased trees
is 231. Distance between consecutive planting lines is 6m, distance
between consecutive trees is 3m. ESFY observation was made in XXX
Figure 6b illustrates the inter-event distance computed on diseased
trees, together with its confidence band at level 95% under independence
assumption, conditionally to the number of diseased trees in
each orchard. Independence assumption is rejected in favour of an
aggregative pattern of diseased trees.
The vector of ESFY is an insect 2mm long, cacopsylla pruni, who
does not stay in orchards nor their neighborhood during winter, but
has been found in pine forests during this period. After a long fly it
arrives on orchard trees at very low densities. Then they tend to stay
on the same tree, except maybe for mating, several males being then
on the same tree as a female or nearby, or some small movements,
whereas females do not interact. ESFY is then transmitted during
feeding. Under these assumptions, one may then assume that ESFY
pattern is the result of the addition of individual independent patches.
To test it, we performed the proposed test, assuming that the
diameter is less than 4 consecutive trees (12m). Result of the test is
shown in Figure 6c. The observed curve lies well inside the confidence

and and the assumption is not rejected.
5 conclusion
Testing for boolean assumption can be done in the case of non-convex
grains. However if one does not want an asymptotic approach as
the one proposed by Molchanov, one has to rely on boundedness of
the grain. From that point of view it can be noted that the same
assumption is necessary for its intensity estimation (Schmitt 1991).
The proposed method relies on the completion of the empty spaces
inside a grain along horizontal lines, so as to obtain a classical convex
boolean model on the line. Molchanov’s proposal, dilation of the
boolean model, then applying Laslett transform and checking for Poisson
assumption of the translated tangence points relies through the
dilation on the same idea : completing the empty spaces inside the
grain. However, the dilation being then done in all directions, the
proportion of points covered by the dilated process is heavier, as one
has to ensure that all the dilated grains are more or less convex. Moreover,
even if a bound of the grain is known, no insurance is given how
much the final grain is near convexity. Dilating a star with five long
branches is a typical example in this case.
More and more data sets are acquired by automatic equipments,
where data are given as images. In such cases and for convex grains, it
can be very difficult to locate a tangence point if the convexity radius
is large. Therefore applying Laslett transform on dilated images of
the original process needs to find an acceptable compromize between
a large dilation, necessary to approach convexity, and a small dilation,
to keep a convexity radius small enough with respect to the pixel size.
The method we propose avoids the necessity of such a compromize,
which is difficult to accept in practice.
References
Bertuzzi P., Garcia-Sanchez L., Chadœuf J., Guerif J., Goulard
M. & Monestiez P. 1995. Modelling surface roughness by a boolean
approach. EJSS 46, 215-220.
Cressie N. 1991. Statistics for Spatial Data. Wiley, New-York.
Diggle P. 1981 Binary mosaics and the spatial pattern of heather.
Biometrics, 37, 531-539.

Kamphorst E.C. , Chadøeuf J. , Jetten V. & and Guérif J.
2005. Generating 3D soil surfaces from 2D height measurements to
determine depression storage. Catena 62, 2-3, 189-205.
Laslett GM, Cressie N & Liow S. 1985. Intensity estimation
in a spatial model of overlapping particles. Unpublished manuscript,
Division of Mathematics and Statistics, CSIRO, Melbourne.
Molchanov I. 1997. Statistics of the Boolean Model for Practionners
and Mathematicians. Wiley, New-York.
Schmitt 1991. Estimation of the density in a stationary Boolean
model. J. Appl. Proba., 28,, 702-708.
Stoyan D, Kendall WS & Mecke J 1995. Stochastic geometry
and its applications Wiley, New-York.

List of Figures
• Figure 1: (a) realization of a boolean process with Poisson intensity
24.3, each grain being the union of three discs of radius
0.044 lying on an horizontal axis separated by d = 0.066 (b)
observation on the transect lines of the dilation of Figure 1(a).
Bound is equal to 0.244. (c) length distribution of the void segments
of Figure 1(a), computed on the same transect lines as on
Figure 1(b), together with its confidence band under independence
assumption. In red : p-value of the length distribution at
each distance. (d) length distibution of the void segments of Figure
1(b), together with its confidence band under independence
assumption. In red : p-value of the length distribution at each
distance.
• Figure 2: (a) realization of a Strauss process with intensity
24.3, inhibition parameter c=0.5 and inhibition distance 0.44.
Same grains are attached as in Figure 1(a) (b), (c), (d) similar
to Figure 1(b,c,d) with bound 0.244.
• Figure 3: p-values of the test based on void segment variance
against p-values under independence assumption. Same typical
point processes are used as in Figures 1(a) and 2(a). Same grains
as in Figures 1(a) and 2(a) are used, but with disks separating
distances varying regularly from 0.066 (thin lines) to 0.264(thick
lines). Three observed window sizes were considered: (a) 450 x
450, (b) 900 x 900, (c) 1350 x 1350.
• Figure 4: Data examples. (a) isotropic soil surface (0.5m x
0.5m) intersection at 10cm height from the lowest point. (b)
isotropic soil surface (0.5m x 0.5m) intersection at 10cm height
from the lowest point. (c) buxus repartition on a 130m x 160m
area.
• Figure 5: segment length distribution of the void segments computed
on examples 4(a,b,c) with bounds equal to 80mm, 80mm
and 9m respectively.
• Figure 6: (a) health status of apricot trees in 4 orchards. Diseased
trees are in red. (b) inter-event distance distribution of
diseased trees and confidence band under independence assumption.
(c) length distribution of void segments, chosen bound is
equal to 12m.

c.d.f
0.0 0.2 0.4 0.6 0.8 1.0
0 1 2 3 4 5
0 1 2 3 4 5
initial
0 0.22 0.44 0.66 0.88 1.1
length
c.d.f.
0.0 0.2 0.4 0.6 0.8 1.0
0 1 2 3 4 5
0 1 2 3 4 5
dilate
0 0.22 0.44 0.66 0.88 1.1
length

c.d.f.
0.0 0.2 0.4 0.6 0.8 1.0
0 1 2 3 4 5
0 1 2 3 4 5
initial
0 0.22 0.44 0.66 0.88 1.1
length
c.d.f.
0.0 0.2 0.4 0.6 0.8
0 1 2 3 4 5
0 1 2 3 4 5
dilate
0 0.22 0.44 0.66 0.88 1.1
length

0.0 0.2 0.4 0.6 0.8 1.0
0.0 0.2 0.4 0.6 0.8 1.0
0.0 0.2 0.4 0.6 0.8 1.0
taille de la fenetre 450
Poisson
Strauss
0.0 0.2 0.4 0.6 0.8 1.0
taille de la fenetre 900
Poisson
Strauss
0.0 0.2 0.4 0.6 0.8 1.0
taille de la fenetre 1350
Poisson
Strauss
0.0 0.2 0.4 0.6 0.8 1.0

200 400 600 800 1000
200 400 600 800 1000
30 60 90 120 150
200 400 600 800 1000
200 400 600 800 1000
30 60 90 120
18

c.d.f.
c.d.f.
c.d.f.
0.0 0.2 0.4 0.6 0.8 1.0
0.0 0.2 0.4 0.6 0.8 1.0
0.0 0.2 0.4 0.6 0.8
0 0.04 0.08 0.12 0.16 0.2
length
0 0.04 0.08 0.12 0.16 0.2
length
0 20 40 60 80 100
length

0 100 200 300 400
inter−event distance distribution
0.000 0.004 0.008 0.012
psupdilat[1, ]
0.0 0.2 0.4 0.6 0.8
0 100 200 300 400
5 10
distance
15 20
dilate
2 4 6 8 10
Index

RESUME
Les maladies (ré-)émergentes peuvent être à l’origine de graves crises économiques, voire
sociales. L’enjeu immédiat dans ce champ de recherche est d’acquérir les connaissances
épidémiologiques permettant de gérer ces maladies. Une démarche visant à répondre à cet enjeu est
présentée et appliquée à une maladie des Prunus ré-émergente en Europe : l’ESFY (European stone
fruit yellows). Cette maladie provoque un dépérissement incurable touchant surtout les abricotiers et
les pruniers japonais. Elle est due à un phytoplasme (‘Candidatus Phytoplasma prunorum’)
spécifiquement transmis par Cacopsylla pruni sur le mode persistant. Nous avons analysé les facteurs
de risque et les processus épidémiques de l’ESFY en intégrant plusieurs approches : un modèle
statistique à l’échelle régionale pour analyser les facteurs corrélés à la prévalence de l’ESFY, des
expérimentations sur le cycle du vecteur et sur le potentiel infectieux de ses différents stades, et des
tests d’hypothèses basés sur la localisation des arbres malades. Les approches statistiques soulignent
l’impact majeur de la combinaison variété/porte-greffe sur la dynamique de l’ESFY. Les expériences
prouvent que C. pruni est un vecteur univoltin dont les jeunes stades acquièrent le phytoplasme, le
multiplient, puis le conservent pendant la période d’estivage et d’hivernage qu’ils passent sur des
conifères (hôtes alternatifs). Selon le scénario le plus probable issu de la confrontation des différentes
approches, seuls les vecteurs réimmigrants infectés depuis l’année précédente transmettraient l’ESFY
dans les vergers d’abricotier ; ils y arriveraient au hasard et indépendamment les uns des autres, puis
ils réaliseraient souvent des inoculations primaires successives à courte distance : la maladie serait
donc monocyclique dans les vergers d’abricotier. Ce scénario a été inclus dans un modèle de
simulation à l’échelle du verger, exploitable par la suite pour estimer les paramètres liés aux
comportements locaux du vecteur.
TITLE
Studying the spatio-temporal spread of a vector-borne disease by the integration of statistical
modelling and experimentation: the case of ESFY (European stone fruit yellows)
ABSTRACT
Emerging and re-emerging diseases can give rise to serious economical – and even social – crises.
Improving the knowledge that allows coping with such diseases is an immediate stake in this field of
research. An approach to this issue is proposed and applied to European stone fruit yellows (ESFY), a
disease of Prunus trees that re-emerges in Europe. This disease is responsible for an incurable decline,
mainly on apricot and Japanese plum. It is caused by a phytoplasma (‘Candidatus Phytoplasma
prunorum’) specifically transmitted by Cacopsylla pruni on the persistent mode. We analysed the risk
factors and the processes of ESFY epidemics through integrating several approaches: a statistical
model at a regional scale for analysing the factors correlated to ESFY prevalence, experiments on the
cycle of the vector and on the potential infectivity of its different stages, and hypothesis tests based on
the location of diseased trees. The statistical approaches highlight the major impact on disease
dynamics of the cultivar/rootstock combination. The experiments demonstrate that C. pruni is a
univoltine vector whose young stages acquire the phytoplasma, multiply it, and then conserve it during
their summering and overwintering on conifers (alternative hosts). In the most probable scenario
arising from the comparison of the different approaches, the reimmigrants infected since the year
before would be the only efficient vectors of ESFY in apricot orchards, where they would land at
random and independently; then, they would often perform several short-distance primary
inoculations: therefore, this disease would be monocyclic in apricot orchards. This scenario was
incorporated into a simulation model at the orchard scale, which, in the future, will unable estimating
the parameters linked to the local behaviour of the vector.
DISCIPLINE : Biologie des Populations et Ecologie
MOTS-CLES : Enquête, épidémiologie, insecte, PCR quantitative, permutation, plante
pérenne, Prunus armeniaca, Prunus salicina, spatial, stochastique, vection.
LABORATOIRES D’ACCUEIL
UMR BGPI INRA, Unité de Biométrie
CIRAD TA 41/K Domaine S t Paul
Campus international de Baillarguet Site Agroparc
34 398 MONTPELLIER cedex 5 84 914 AVIGNON cedex 9
- 157 -