10 2 Full Volume (PDF) - Journal of Cell and Molecular Biology ...

More documents

Recommendations

Info

BM4621, BM121, LSCV36, TGLA122, OarJMP23, OarFCB304, OarAE133, ILSTS005, ILSTS022, ILSTS029, ILSTS033 and ILSTS034. Most of primers used were independent and belonged to different chromosomes. Typical polymerase chain reaction (PCR) testing was carried out under these conditions: 60 ng of target DNA was used in 25-μl PCR reaction containing 1×PCR buffer, 50 ng of each primer, 200 μM of dNTPs, 0.5 units of Taq DNA Polymerase and 1.5 mMMgCl2. A Common “Touchdown” PCR profile included 3 cycles of 45 sec at 95°C, 1 min at 60°C; 3 cycles of 45 sec at 95°C, 1 min at 57°C; 3 cycles of 45 sec at 95°C, 1 min at 54°C; 3 cycles of 45 sec at 95°C, 1 min at 51°C and 20 cycles of 45 sec at 92°C, 1 min at 48°C. In all cycles elongation temperature and time were 72°C and 1 min, respectively. Alleles were scored using unlabeled primers with products visualized by silver staining (Bassam et al., 1991). Genotype of individual animal at 13 microsatellite loci was recorded by direct counting.Genotypic data were analyzed using POPGENE (Yeh and Boyle, 1997) and GenAlex (Peakall and Smouse, 2006) to calculate the observed number of alleles, effective number of alleles, observed heterozygosity, expected heterozygosity, and to test for Hardy–Weinberg equilibrium (HWE).Allelic frequencies were utilized for assessing polymorphic information content (PIC), a measure of informativeness of a marker, calculated according to Botstein et al. (1980) using the given formula, Where k is the number of alleles and xi and xj are the frequencies of the ith and jth alleles respectively. Heterozygote deficiencies were estimated as Fis = (Ho −He)/He, where Ho and He are the observed and expected frequency of heterozygotes respectively. The bottlenecks program (Piry et al., 1999) was used as an alternative measure of genetic bottlenecks to test for excess gene diversity relative to that expected under mutation-drift equilibrium. The heterozygosity excess method exploits the fact that allele diversity is reduced faster than heterozygosity during a bottleneck, because rare alleles are lost rapidly and have little effect on Bottleneck analysis of KJH goats 63 heterozygosity, thus producing a transient excess in heterozygosity relative to that expected in a population of constant size with the same number of alleles (Cornuet and Luikart, 1996; Piry et al., 1999). To determine the population ‘‘genetic reduction signatures’’ characteristic of recent reductions in effective population size (Ne), the Wilcoxon’s heterozygosity excess test (Piry et al., 1999) , standard differential test, sign test and the allele frequency distribution mode shift analysis(Luikart et al., 1998) were performed using BOTTLENECK (Piry et al., 1999). The heterozygosity excess method was used to analyzed the population and the data for the heterozygosity excess test were examined under the two-phased model (TPM; 95%stepwise mutation model with 5% multi-step mutations and a variance among multiple steps of 12), which is considered best for microsatellite data (Piry et al., 1999; Di Rienzo et al., 1994). We also analyzed the allele frequency distribution for gaps. Aqualitative descriptor of allele frequency distribution (the mode-shift indicator),is reported to discriminate between bottlenecked and stable population (Luikart et al.,1998). Results In order to maintain genetic diversity, breeding strategies that increase effective population size minimizing genetic drift effect should be implemented. Microsatellite markers in combination with recent statistical methodologies represent a useful tool for the conservation and management of endangered breeds. In the present work, the actual situation concerning genetic diversity and population structure of this breed has been evaluated using the molecular information derived from 13 microsatellites loci and the use of clustering methods. 13 pairs of highly polymorphic microsatellite markers were chosen based on their genomic location (Table 1).Various measures of genetic variation are presented in the Table 2. The F-statistics estimates are presented in Table3. The number of alleles observed across the microsatellite loci
64 Bizhan MAHMOUDI et al. studied varied from 3(OarAE133) to 11 (TGLA122) with an overall mean of 7.54 (Table 2). The observed number of alleles across the loci was more than the effective number of alleles (2.355 to 6.973). The Shannon information index (I) and polymorphic Information Content (PIC) showed that most of the loci were highly informative indicating the high polymorphism across the loci with an overall mean of 1.759 and 0.76 Table 1. Details of the microsatellite used in the study Locus Primer sequence BM121 BM4621 ILSTS005 ILSTS022 ILSTS029 ILSTS033 ILSTS034 LSCV36 MAF64 OarAE133 OarFCB304 OarJMP23 TGLA122 respectively. The average observed heterozygosity was more than the expected (Table 3). The average expected gene diversity (Nei, 1973) ranged from 0.581 (OarAE133) to 0.865 (TGLA122) with an overall mean of 0.798. Nine out of total 13 loci studied showed significant deviations from Hardy Weinberg Equilibrium. Type of repeat Chromosome No. TGGCATTGTGAAAAGAAGTAAAA CTAGCACTATCTGGCAAGCA CAAATTGACTTATCCTTGGCTG (TC)18 16 TGTAACATATGGGCTGCATC GGAAGCAATGAAATCTATAGCC (CA)14 6 TGTTCTGTGAGTTTGTAAGC AGTCTGAAGGCCTGAGAACC (nn)39 10 CTTACAGTCCTTGGGGTTGC TGTTTTGATGGAACACAGCC (GT)21 3 TGGATTTAGACCAGGGTTGG TATTAGAGTGGCTCAGTGCC (CA)19 3 ATGCAGACAGTTTTAGAGGG AAGGGTCTAAGTCCACTGGC (CA)12 12 GACCTGGTTTAGCAGAGAGC GCACACACATACACAGAGATGCG (GT)29 5 AAAGAGGAAAGGGTTATGTCTGGA AATAGACCATTCAGAGAAACGTTGAC (CA)16 19 CTCATCGAATCAGACAAAAGGTAGG AGCCAGTAGGCCCTCACCAGG (TG)13 1 CCAACCATTGGCAGCGGGAGTGTGG CCCTAGGAGCTTTCAATAAAGAATCGG (TG)24 Ann CGCTGCTGTCAACTGGGTCAGGG GTATCTTGGGAGCCTGTGGTTTATC (CT)11(CA)15 19 GTCCCAGATGGGAATTGTCTCCAC AATCACATGGCAAATAAGTACATAC - 27 CCCTCCTCCAGGTAAATCAGC (CA)21 21
Page 1 and 2:
•Circadian rhythm genes in cancer
Page 3 and 4:
Haliç University Faculty of Arts a
Page 5:
Front cover image: “Cell division
Page 8 and 9:
2 Seema TRIVEDI the nucleation site
Page 10 and 11:
4 Seema TRIVEDI Table 2. Modificati
Page 12 and 13:
6 Seema TRIVEDI TACC1 may also be i
Page 14 and 15:
8 Seema TRIVEDI expression of all T
Page 16 and 17: 10 Seema TRIVEDI putative tumor sup
Page 18 and 19: 12 Yusuf ÖZŞENSOY ve Ercan KURAR
Page 26 and 27: Journal of Cell and Molecular Biolo
Page 28 and 29: Cu(A), probably the primary accepto
Page 30 and 31: Figure 1. Amplification plots for M
Page 32 and 33: Determination of changes in gene ex
Page 34 and 35: eported. Thus, an increase in cytoc
Page 38 and 39: then stained in haematoxylin and eo
Page 40 and 41: Discussion The management of infert
Page 42 and 43: Eigner D and Scholz D. Ferula asa-f
Page 46 and 47: extent of occurrence of the ESBL fe
Page 48 and 49: cefotaxime/clavulanate - 30/10 µg;
Page 50 and 51: K. K pneumonia issolates with ESBL
Page 52 and 53: TEM, SHHV and CTX-M amplificaation
Page 54 and 55: Figuree 8. Conserveed domain of int
Page 56 and 57: Barlow M and Hall BG. Predicting ev
Page 58 and 59: 54 Mohan KANNAN et al. çıkartmakt
Page 60 and 61: 56 Mohan KANNAN et al. Table 1. Eff
Page 62 and 63: 58 Mohan KANNAN et al. of flavonoid
Page 68 and 69: Within population inbreeding estima
Page 70 and 71: standardized difference test and Wi
Page 72 and 73: Sambrook J, Fritsch EF, Maniatis T.
Page 74 and 75: 72 Mohamed R. ENAN Introduction Mat
Page 76 and 77: 74 Mohamed R. ENAN Figure 2. Ethidi
Page 78 and 79: 76 Mohamed R. ENAN In the present s
Page 82 and 83: MegaBACE version 3.1 (Kumar et al.,
Page 84 and 85: 82 Sérgio Salla CHAGAS et al. Laur
Page 86 and 87: 84 Abstract: A brief, informative a
Page 88 and 89: 86 may ask one referee to comment o
show all

10 2 Full Volume (PDF) - Journal of Cell and Molecular Biology ...

Create successful ePaper yourself

Delete template?

Save as template?