Whipple's disease and Tropheryma whipplei

More documents

Recommendations

Info

Primers targeting specifically Tropheryma whipplei published in the litterature. Primers Sens/ Sequences Sens/Antisens Targeted gene Antisens tws3,f/ tw1857r1 tw1662f/ tw1857r1 tws1,f/ tws2,r tws3,f/ tw1857r1 tws3,f/ tws4,r TW-23InsF/ TW-23InsR2 whipp-frw1/ whipp-rev whipp-frw2/ whipp-rev TwrpoB.F/ TwrpoB.R 53.3F/ 5’CCGGTGACTTAACCTTTTTGGAGA3’/ 5’TCCCGAGCCTTTCCGAG A3’ 5’ACTATTGGGTTTTGAGAGGC3’/ 5’TCCCGAGCCTTATCCGAG A3’ 5’ATCGCAAGGTGGAGCGAATCT3’/ 5’CGCATTCTGGCGCCCCAC3’ 5’CCGGTGACTTAACCTTTTTGGAGA3’/ 5’TCCCGAGCCTTATCCGAGA3’ 5’CCGGTGACTTAACCTTTTTGGGA3’/ 5’CTCCCGTGAGCTTGTGCCCAAAC3’ 5’GGTTGATATTCCCGTACCGGCAAAG3’/ 5’GCATAGGATCACCAATTTCGCGCC3’ 5’TGACGGGACCACAACATCTG3’/ 5’ACATCTTCAGCAATGATAAGAAGTT3’ 5’CGCGAAAGAGGTTGAGACTG3’ 5’ACATCTTCAGCAATGATAAGAAGTT3’ 5’AAAAAGGCCGCACGCGAGTT’/ 5’AAAGAGGCTCCAACGCCACG3’ 5’AGAGAGATGGGGTGCAGGAC3’/ ITS ITS ITS ITS ITS 23S rDNA hsp65 hsp65 rpoB Repeat 53.3R 5’AGCCTTTGCCAGACAGACAC3’ References: -Molecular genetic methods for the diagnosis of fastidious microorganisms. Fenollar F, and D Raoult. APMIS 2004; 112:785-807.
Interpretation of results ? When a patient presents a « classic » disease with digestive signs, adenopathies and/or arthralgia, the diagnosis is easy. In case of disease without digestive involvement (endocarditis, neurologic involvement…), the diagnostic is more difficult. One of the problems is to interpret an isolated positive PCR on blood or CSF. These results should always be confirmed. In these cases, the presence of PCR + on saliva or stools could be useful to confirm the diagnosis. -Strategy of interpretation of the results in function of samples and techniques : Specimen PAS IHC PCR Diagnostic + Small bowel + - or NE - or NE NO Adenopathy + NE + YES Cardiac Valve - or NE + + YES Brain - or NE - or NE + YES (?) Other biopsies - or NE + - or NE YES (?) CSF + - or NE - or NE NO Blood + - or NE + YES - or NE + + YES - or NE - or NE + ?* Saliva NE NE + Predictive value depending of the laboratory Stools * Necessity to confirm on a second specimen, eventually targeting a new DNA sequence ; NP: Not performed, -: negative; +: positive
Page 1 and 2: SUMMARY : Whipple’s disease and T
Page 3 and 4: What about the micro-organism? The
Page 5 and 6: Habitat, source, and transmission o
Page 7 and 8: Clinical manifestations of Whipple
Page 9 and 10: The hemogram could show an anemia.
Page 11: Genomic amplification by PCRPCR cou
Page 15 and 16: Treatment of Whipple’s disease? -
Page 17 and 18: Secondary effects of treatment? -Do
Page 19 and 20: Follow-up of the treated patients?
Page 21 and 22: Lists of the publications from IFR
Page 23 and 24: Interlocutors on IFR 48 Pr Didier R
Page 25 and 26: Sheet of clinical information
Page 27: The diagnosis could be performed by

Whipple's disease and Tropheryma whipplei

Create successful ePaper yourself

Delete template?

Save as template?