Whipple's disease and Tropheryma whipplei

SUMMARY : Whipple’s disease and Tropheryma
whipplei
-Introduction.
-What about the micro-organism?
-Habitat, source and transmission of T. whipplei.
-Risk factors?
-Clinical signs and symptoms of Whipple’s disease.
-Samples for the diagnosis of Whipple’s disease.
-Non specific diagnosis.
-Specific diagnosis.
-Interpretation of results.
-Treatment of the disease?
-Counter-indications of treatment?
-Secondary effects of treatment?
-Evolution and prognosis of the disease?
-Follow-up of the treated patients?
-Follow-up of the patients after the end of the treatment?
-List of the publications of IFR 48 about Whipple’s disease.
-Interlocutors in IFR 48.
-Consultation at IFR 48.
-What kind of samples to send and how ?
-Sheet of clinical information.
-Information for the patients.

Introduction
Whipple’s disease is an infectious disease caused by a
bacterium, Tropheryma whipplei. The disease is rare (annual
incidence : one per million habitant) but its prevalence is not
really known.
The disease has been described for the first time in 1907
by an American physician, George Whipple.
The clinical manifestations are various and are not really
specific leading to a delay for the diagnosis.
The spontaneous evolution of the disease is long,
marked by remission and relapse episodes, that could be
evolved until the death in absence of specific treatment.
T. whipplei has been considered for a long time as
uncultivable. The first isolation and establishment of a strain of
T. whipplei has been performed in our laboratory in 1999 from a
cardiac valve of a patient with an endocarditis due to T.
whipplei.
This step has been determinant for new perspectives of
diagnosis and treatment of the disease.
References:
-Whipple’s disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.
-Whipple’s disease and “Tropheryma whippelii”. Dutly F, and M Altwegg.
Clin Microbiol Rev 2001: 14, 561-583.

What about the micro-organism?
The cell-culture of the bacterium on human fibroblasts
has allowed its characterization.
Phylogenetical analysis has classified the bacterium
among the Gram positive bacterium at high GC%, near 2
species pathogens for human, Actinomyces pyogenes and
Rothia dentocariosa and other bacteria from the environment.
The culture of this bacterium has also allowed the full
sequencing of the genome that has been performed in parallel
on 2 distinct strains.
The genome analysis has shown the presence of repeated
sequences which could allow genomic recombination of T.
whipplei and could modify the expression of membrane
protein.
A deficiency in the synthesis of amino-acids has been
also observed during the genome analysis. To compensate this
deficit, we have developed a medium culture supplemented with
all the amino-acids, that have allowed the growth of T. whipplei
in axenic conditions.
References :
-Tropheryma whipplei Twist: a human pathogenic Actinobacteria with a
reduced genome. Raoult et al. Genome Res 2003: 13:1800-9.
-Genome-based design of a cell-free culture medium for Tropheryma
whipplei. Renesto et al. Lancet 2003: 362:447-9.

Phylogeny of Tropheryma whipplei using the 16S
rRNA sequence
Eubacterium lentum
Gardnerella vaginalis
Mobiluncus spp.
Tropheryma whipplei
Rothia dentocariosa
Actinomyces spp.
Propionibacterium spp.
Corynebacterium spp.
Nocardia spp.
Rhodococcus spp.
Gordona spp.
Mycobacterium spp.

Habitat, source, and transmission of T. whipplei
The source of T. whipplei and its transmission are
presently unknown. The bacterium seems to be present in the
environment. A study based on PCR has shown the presence
of T. whipplei DNA in sewage water.
One hypothesis could be that the transmission was linked
to an oro-fecal route. Several points support this hypothesis :
the presence of the bacterium in sewage water, the possible
transmission of the bacterium in association with Giardia
intestinalis or by digestive fibroscopy.
The Whipple’s disease is ubiquitous. It seems however,
more frequent in some geographical area, mainly, for France
in Rhône-Alpes area, but also in Switzerland and Germany.
References:
-Whipple’s disease. Marth T, and D Raoult. Lancet 2003: 18,
239-46.
-Can Whipple’s disease be transmitted by gastroscopes? La
Scola et al. Infect Control Hosp Epidemiol 2003: 24, 191-4.
-Whipple’s disease associated with giardiasis. Fenollar et al. J
Infect Dis 2003: 188, 828-34.

Risk factors?
Certain studies underlined the possible existence of
specific factors to develop Whipple’s disease. Indeed, men of
50 years olds are the more frequently involved. The disease
seems also to be more frequent among farmers.
Different immunological abnormalities have been
reported during Whipple’s disease in treated patients but the
data have been contradictory.
Recently, a diminution of production of Interleukine-12
and IFN-γ by periphereal monocytes has been shown for
patients with Whipple’s disease in comparison to control people,
not only in acute phase but also in remission. It is necessary
now to confirm these data.
References :
-Defects of monocyte interleukin-12 production and humoral
immunity in Whipple’s disease. Gastroenterology 1997 : 113 :
442-448.
-Whipple’s disease. Marth T, and D Raoult. Lancet 2003: 18,
239-246.

Clinical manifestations of Whipple’s disease
For a long time, the Whipple’s disease has been
considered as a digestive disease. In reality, the clinical
manifestations are various and non specific. Approximately
15% of the patients do not present digestive signs. The disease
begins most often, by arthralgia. Presently, we could distinguish
3 clinical presentations :
-The classic Whipple’s disease is multivisceral. Patient
present digestive symptoms (mainly diarrhea), arthralgia and/ or
adenopathies eventually associated to brain or cardiac
involvement. The digestive biopsy is PAS-positive.
-The blood-culture negative endocarditis, without
digestive involvement, for which the diagnosis is particularly
difficult, as in most documented cases, it has been performed
on cardiac valves analysis.
-The isolate neurological infection, without digestive
involvement, for which the diagnosis is particularly difficult. A lot
of neurological signs could be observed such as cognitive
impairment, ocular paralysis, abnormal ocular movements,
myoclonus, and/or hypothalamic involvement.
References:
-Whipple’s disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.
-Whipple’s disease. Fenollar F, and D Raoult. Clin Diagn Lab Immunol 2001 : 8, 1-7.

Samples for the diagnosis of Whipple’s disease
In case of suspicion of Whipple’s disease, saliva, stools,
blood and cerebrospinal fluid (CSF) could be easily sampled
for PCR and culture. Small-bowel biopsies must be performed
even of case of lack of digestive signs. In function of the
symptoms, other biopsies could be performed for PAS-staining
immunohistochemistry and PCR. Finally, if a final diagnosis of
Whipple’s disease is performed, a CSF should be
systematically sampled for a PCR because an asymptomatic
neurological involvement has been described.
-Specimen depending of the clinical manifestations :
Classic WD Endocarditis Neuro-Whipple
Saliva Systematic (S) S S
Stools S S S
Blood S S S
CSF
To perform in case To perform in case S
Small-bowel
of definite diagnosis of definite
of WD
diagnosis of WD
S S S
biopsy
Cardiac valve Not necessary (NN) 2 2
Adenopathy, Second intention 2 2
synovial biopsy exam (2)
Brain biopsy NN NN Third intention
References:
-Whipple’s disease. Marth T, and D Raoult. Lancet 2003: 18, 239-46.
exam (3)
-Molecular techniques in Whipple’s disease. Expert Rev Mol Diagn 2001: 1, 299-309.
Non specific diagnosis

The hemogram could show an anemia. An eosinophilia
could be also observed as ESR or CRP increasing. Biological
signs of digestive malabsorption could be present.
The analysis using Periodic Acid Schiff (=PAS)
staining could be performed on various biopsies (classically
on small-bowel biopsies) and also in body fluid to look for the
presence of macrophages with positive PAS material.
Positive PAS-staining from a duodenal biopsy. (x 100).
References:
-Whipple’s disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.
-Whipple’s disease: immunospecific and quantitative immunohistochemical study of
intestinal biopsy specimen. Lepidi et al. Human Pathol 2003: 34: 589-96..

Specific diagnosisThe specific diagnosis includes :
Immunohistochemistry
Genomic amplification by PCR
Culture
The immunohistochemistry with polyclonal rabbit
antibodies specifically directed against the bacterium could be
performed on different samples (small-bowel, cardiac valve,
brain, adenopathy), as body fluids (articular fluid, aqueous
humor) and blood. This technique should be retrospectively
performed on formalin-fixed samples.
Positive immunohistochemistry of a duodenal biopsy. (x 100).
-References :
-Diagnosis of Whipple disease by immunohistochemical analysis: a sensitive and
specific method for the detection of T. whipplei in paraffin-embedded tissue. Baisden
et al. Am J Clin Pathol 2002: 118, 742-8.
-T. whipplei circulating in blood monocytes. Raoult et al. N Engl J Med 2001: 345,
548.
-Immunohistological detection of T. whipplei in lymph nodes. Lepidi et al. Am J Med
2002:118, 742-8.
-Immunodetection of T. whipplei in intestinal tissues from Dr Whipple’s 1907 patient.
Dumler et al. N Engl J Med 2003: 348:1411-2.

Genomic amplification by PCRPCR could be performed
on various biopsies, body fluids, blood, stools or saliva
using primers targeting various genes of the bacterium. The
analysis of complete genome of the bacterium has allowed a
rationalisation for the choice of primers. A real-time PCR
targeting repeated sequences of T. whipplei has allowed an
increasing of sensitivity without altering the specificity of the
technique.
T. whipplei DNA has been detected in saliva, small-bowel
biopsies, gastric fluid and stools of healthy people. However,
these data should be interpreted cautiously as they are based
on « home-made » PCR and have never been confirmed by
other teams. The exact prevalence of asymptomatic carriers
of T. whipplei need still to be determined. The problem with
PCR is the risk of contamination. To conclude to the positivity of
a sample, it is necessary to obtain 2 positive PCR targeting 2
different DNA sequences.
Culture
The culture from biopsies (duodenum, cardiac valve…),
body fluids (CSF) or blood could be performed using cell
culture technique or axenic medium supplemented with amino
acids.
References:
-Use of genome selected repeated sequences increases the sensitivity of PCR detection of T.
whipplei. Fenollar et al. J Clin Microbiol 2004: 42, 401-3.
-Culture of T. whipplei from human samples: a 3-year experience (1999 to 2002). J Clin Microbiol
2003: 41, 3816-22.

Primers targeting specifically Tropheryma whipplei published in the
litterature.
Primers
Sens/
Sequences
Sens/Antisens
Targeted
gene
Antisens
tws3,f/
tw1857r1
tw1662f/
tw1857r1
tws1,f/
tws2,r
tws3,f/
tw1857r1
tws3,f/
tws4,r
TW-23InsF/
TW-23InsR2
whipp-frw1/
whipp-rev
whipp-frw2/
whipp-rev
TwrpoB.F/
TwrpoB.R
53.3F/
5’CCGGTGACTTAACCTTTTTGGAGA3’/
5’TCCCGAGCCTTTCCGAG A3’
5’ACTATTGGGTTTTGAGAGGC3’/
5’TCCCGAGCCTTATCCGAG A3’
5’ATCGCAAGGTGGAGCGAATCT3’/
5’CGCATTCTGGCGCCCCAC3’
5’CCGGTGACTTAACCTTTTTGGAGA3’/
5’TCCCGAGCCTTATCCGAGA3’
5’CCGGTGACTTAACCTTTTTGGGA3’/
5’CTCCCGTGAGCTTGTGCCCAAAC3’
5’GGTTGATATTCCCGTACCGGCAAAG3’/
5’GCATAGGATCACCAATTTCGCGCC3’
5’TGACGGGACCACAACATCTG3’/
5’ACATCTTCAGCAATGATAAGAAGTT3’
5’CGCGAAAGAGGTTGAGACTG3’
5’ACATCTTCAGCAATGATAAGAAGTT3’
5’AAAAAGGCCGCACGCGAGTT’/
5’AAAGAGGCTCCAACGCCACG3’
5’AGAGAGATGGGGTGCAGGAC3’/
ITS
ITS
ITS
ITS
ITS
23S rDNA
hsp65
hsp65
rpoB
Repeat
53.3R 5’AGCCTTTGCCAGACAGACAC3’
References:
-Molecular genetic methods for the diagnosis of fastidious microorganisms. Fenollar
F, and D Raoult. APMIS 2004; 112:785-807.

Interpretation of results ? When a patient presents a
« classic » disease with digestive signs, adenopathies and/or
arthralgia, the diagnosis is easy. In case of disease without
digestive involvement (endocarditis, neurologic
involvement…), the diagnostic is more difficult. One of the
problems is to interpret an isolated positive PCR on blood or
CSF. These results should always be confirmed. In these cases,
the presence of PCR + on saliva or stools could be useful to
confirm the diagnosis.
-Strategy of interpretation of the results in function of samples and
techniques :
Specimen PAS IHC PCR Diagnostic +
Small bowel + - or NE - or NE NO
Adenopathy + NE + YES
Cardiac Valve - or NE + + YES
Brain - or NE - or NE + YES (?)
Other biopsies - or NE + - or NE YES (?)
CSF + - or NE - or NE NO
Blood + - or NE + YES
- or NE + +
YES - or NE - or NE
+ ?*
Saliva NE NE + Predictive value
depending of the laboratory
Stools
* Necessity to confirm on a second specimen, eventually targeting a new DNA
sequence ; NP: Not performed, -: negative; +: positive

-References: Molecular genetic methods for the diagnosis of fastidious
microorganisms. Fenollar F, and D Raoult. APMIS 2004; 112:785-807.

Treatment of Whipple’s disease? -Whipple’s disease
without neurologic involvement (Negative PCR on CSF and
absence of neurologic symptoms)
Doxycycline, 100 mg, twice per day.
In association with
Hydroxychloroquine, 200 mg, three times per day.
This association is administered for a length of 18 months at
least.
-Whipple’s disease with neurologic involvement
Doxycycline, 100 mg, twice per day.
In association with
Hydroxychloroquine, 200 mg, three times per day In
association with
Sulfamethoxazole and Trimethoprim, 1,600 mg and 320 mg,
three times per day OR Sulfadiazine, 1,500 mg, four times per
day
This association is administered for a length of 18 months at
least.
Moreover : Add folic acid: 10 mg per day for the patients > 65
years and patients with deprive.
References:
-Antibiotic susceptibility of Tropheryma whipplei in MRC5 cells. Boulos et al.
Antimicrob Agents Chemoter 2004: 48, 747-752.
-Molecular evaluation of antibiotic susceptibility against Tropheryma whipplei in
axenic medium. Boulos et al. J Antimicrob Chem 2005: 2, 178-181.

Counter-indications of treatment ?
-Doxycycline
Allergy to tetracyclines.
Child of less than 8 years.
Pregnant woman or woman who nurses.
-Hydroxychloroquine
Allergy to hydroxychloroquine.
Retinopathy.
-Cotrimoxazole and Sulfadiazine
Allergy to sulfamides.
Deficit in Glucose-6-phosphate Dehydrogenase.

Secondary effects of treatment?
-Doxycycline
Photosensitization (It is necessary to protect the face and the
hands of sun, mainly the summer).
Digestive troubles, allergy, hematological troubles, cutaneous
pigmentation.
-Hydroxychloroquine
Photosensitization, acouphene, giddiness, digestive troubles,
cutaneous reaction, headache, hematological troubles,
retinopathy, psychoses.
-Cotrimoxazole and Sulfadiazine
Allergy, hematological troubles, digestive troubles, hepatitis,
pseudo-membranous colitis, alteration of kidney function,
urinary lithiasis, aseptic meningitis.

Evolution and prognosis of the disease?
In lack of adapted antibiotic treatment, the evolution of
Whipple’s disease is fatal.
For the patients treated adequately, the diarrhea
disappeared quickly, in less of one week. The arthralgia
regress between 2 to 3 weeks. For neurological signs, their
regression is generally observed, more than 3 weeks after the
beginning of the adapted antibiotic treatment. Moreover,
neurological sequellaes are frequently observed.
After the end of the antibiotic treatment, relapses are
observed, mainly, in the brain. Their frequency has been
diversely estimated between 2 and 35%.
After the end of the antibiotic treatment, it is better to
follow the patients during his entire life.
References:
-Whipple’s disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.

Follow-up of the treated patients?
-Monthly :
Hemogram, transaminases, gammaglutamyltranspeptidase and
creatinine blood levels.
Immunohistochemistry of monocytes, saliva, blood and stools
for PCR.
Plasmatic levels of prescribed antibiotics to check for the
presence of therapeutic levels:
Hydroxychloroquine : 1 µg/ml
Doxycycline : 4 µg/ml
Sulfamethoxazole or sulfadiazine : 100 µg/ml
Necessity to perform, 2 months after the beginning of
antibiotic therapy for patients with neurological
involvement :
Lumbar puncture for PCR and antibiotics levels
(doxycycline, sulfamethoxazole or sulfadiazine) in CSF.
-Semi-annual :
Consultation of ophthalmology.

Follow-up of the patients after the end of the
treatment?
-Every month for 3 months :
Hemogram, transaminases, gammaglutamyltranspeptidase and
creatinine blood levels. Immunohistochemistry of monocytes,
saliva, blood and stools for PCR.
Necessity to perform one month after the end of treatment :
Small-bowel biopsy for immunohistochemistry and PCR, lumbar
puncture for PCR in the CSF for all patients with Whipple’s
disease.
-Every 3 months for 5 years :
Hemogram, transaminases, gammaglutamyltranspeptidase and
creatinine blood levels. Immunohistochemistry of monocytes,
saliva, blood and stools for PCR.
Besides, necessity to perform one time per year :
Small-bowel biopsy for immunohistochemistry and PCR, lumbar
puncture for PCR in the CSF for all patients with Whipple’s
disease.
-One time per year :
Hemogram, transaminases, gammaglutamyltranspeptidase and
creatinine blood levels. Immunohistochemistry of monocytes,
saliva, blood and stools for PCR.
Small-bowel biopsy for immunohistochemistry and PCR, lumbar
puncture for PCR in the CSF for all patients with Whipple’s
disease.

Lists of the publications from IFR 48
[1] B. L. Baisden, H. Lepidi, D. Raoult, P. Argani, J. H. Yardley and J. S. Dumler (2002) Diagnosis of
Wihipple disease by immunohistochemical analysis: a sensitive and specific method for the detection of
Tropheryma whipplei (the Whipple bacillus) in paraffin-embedded tissue. Am.J.Clin.Pathol., 118,
742-748.
[2] A. Boulos, J. M. Rolain, M. N. Mallet and D. Raoult (2005) Molecular evaluation of antibiotic
susceptibility of Tropheryma whipplei in axenic medium. J.Antimicrob.Chemother., 55, 178-181.
[3] A. Boulos, J. M. Rolain and D. Raoult (2004) Antibiotic susceptibility of Tropheryma whipplei in MRC5
cells. Antimicrob.Agents Chemother., 48, 747-752.
[4] M. Drancourt, A. Carlioz and D. Raoult (2001) rpoB sequence analysis of cultured Tropheryma whippelii.
J.Clin.Microbiol., 39, 2425-2430.
[5] J. S. Dumler, B. L. Baisden, J. H. Yardley and D. Raoult (2003) Immunodetection of Tropheryma whipplei
in intestinal tissues from Dr. Whipple's 1907 patient. N.Engl.J.Med., 348, 1411-1412.
[6] F. Fenollar, M. L. Birg, V. Gauduchon and D. Raoult (2003) Culture of Tropheryma whipplei from human
samples: a 3-year experience (1999 to 2002). J.Clin.Microbiol., 41, 3816-3822.
[7] F. Fenollar, M. L. Birg, V. Gauduchon and D. Raoult (2003) Culture of Tropheryma whipplei from human
samples: a 3-year experience (1999 to 2002). J.Clin.Microbiol., 41, 3816-3822.
[8] F. Fenollar, P. E. Fournier, D. Raoult, R. Gerolami, H. Lepidi and C. Poyart (2002) Quantitative detection
of Tropheryma whipplei DNA by real-time PCR. J.Clin.Microbiol., 40, 1119-1120.
[9] F. Fenollar, P. E. Fournier, C. Robert and D. Raoult (2004) Use of genome selected repeated sequences
increases the sensitivity of PCR detection of Tropheryma whipplei. J.Clin.Microbiol., 42, 401-403.
[10] F. Fenollar, H. Lepidi, R. Gerolami, M. Drancourt and D. Raoult (2003) Whipple disease associated with
giardiasis. J.Infect.Dis., 188, 828-834.
[11] F. Fenollar, H. Lepidi and D. Raoult (2001) Whipple's endocarditis: review of the literature and
comparisons with Q fever, Bartonella infection, and blood culture-positive endocarditis. Clin.Infect.Dis.,
33, 1309-1316.
[12] F. Fenollar and D. Raoult (2001) Molecular techniques in Whipple's disease. Expert.Rev.Mol.Diagn., 1,
299-309.
[13] F. Fenollar and D. Raoult (2001) Molecular techniques in Whipple's disease. Expert.Rev.Mol.Diagn., 1,
299-309.
[14] F. Fenollar and D. Raoult (2001) Whipple's disease. Clin.Diagn.Lab Immunol., 8, 1-8.
[15] F. Fenollar and D. Raoult (2003) Whipple's disease. Curr.Gastroenterol.Rep., 5, 379-385.
[16] F. Fenollar and D. Raoult (2004) Molecular genetic methods for the diagnosis of fastidious
microorganisms. APMIS, 112, 785-807.
[17] E. Ghigo, C. Capo, M. Aurouze, C. H. Tung, J. P. Gorvel, D. Raoult and J. L. Mege (2002) Survival of
Tropheryma whipplei, the agent of Whipple's disease, requires phagosome acidification. Infect.Immun.,
70, 1501-1506.
[18] B. La Scola, F. Fenollar, P. E. Fournier, M. Altwegg, M. N. Mallet and D. Raoult (2001) Description of
Tropheryma whipplei gen. nov., sp. nov., the Whipple's disease bacillus. Int.J.Syst.Evol.Microbiol., 51,
1471-1479.

[19] B. La Scola, J. M. Rolain, M. Maurin and D. Raoult (2003) Can Whipple's disease be transmitted by
gastroscopes? Infect.Control Hosp.Epidemiol., 24, 191-194.
[20] H. Lepidi, N. Costedoat, J. C. Piette, J. R. Harle and D. Raoult (2002) Immunohistological detection of
Tropheryma whipplei (Whipple bacillus) in lymph nodes. Am.J.Med., 113, 334-336.
[21] H. Lepidi, F. Fenollar, J. S. Dumler, V. Gauduchon, L. Chalabreysse, A. Bammert, M. F. Bonzi, F.
Thivolet-Bejui, F. Vandenesch and D. Raoult (2004) Cardiac valves in patients with Whipple endocarditis:
microbiological, molecular, quantitative histologic, and immunohistochemical studies of 5 patients.
J.Infect.Dis., 190, 935-945.
[22] H. Lepidi, F. Fenollar, R. Gerolami, J. L. Mege, M. F. Bonzi, M. Chappuis, J. Sahel and D. Raoult (2003)
Whipple's disease: immunospecific and quantitative immunohistochemical study of intestinal biopsy
specimens. Hum.Pathol., 34, 589-596.
[23] Z. Liang, B. La Scola and D. Raoult (2002) Monoclonal antibodies to immunodominant epitope of
Tropheryma whipplei. Clin.Diagn.Lab Immunol., 9, 156-159.
[24] T. Marth and D. Raoult (2003) Whipple's disease. Lancet, 361, 239-246.
[25] F. Masselot, A. Boulos, M. Maurin, J. M. Rolain and D. Raoult (2003) Molecular evaluation of antibiotic
susceptibility: Tropheryma whipplei paradigm. Antimicrob.Agents Chemother., 47, 1658-1664.
[26] D. Raoult (1999) Afebrile blood culture-negative endocarditis. Ann.Intern.Med., 131, 144-146.
[27] D. Raoult (2000) Culture of the bacterium responsible for Whipple's disease]. Rev.Prat., 50, 2093-2094.
[28] D. Raoult, M. L. Birg, B. La Scola, P. E. Fournier, M. Enea, H. Lepidi, V. Roux, J. C. Piette, F.
Vandenesch, D. Vital-Durand and T. J. Marrie (2000) Cultivation of the bacillus of Whipple's disease.
N.Engl.J.Med., 342, 620-625.
[29] D. Raoult, B. La Scola, P. Lecocq, H. Lepidi and P. E. Fournier (2001) Culture and immunological
detection of Tropheryma whippelii from the duodenum of a patient with Whipple disease. JAMA, 285,
1039-1043.
[30] D. Raoult, H. Lepidi and J. R. Harle (2001) Tropheryma whipplei circulating in blood monocytes.
N.Engl.J.Med., 345, 548.
[31] D. Raoult, H. Ogata, S. Audic, C. Robert, K. Suhre, M. Drancourt and J. M. Claverie (2003) Tropheryma
whipplei Twist: a human pathogenic Actinobacteria with a reduced genome. Genome Res., 13, 1800-1809.
[32] P. Renesto, N. Crapoulet, H. Ogata, B. La Scola, G. Vestris, J. M. Claverie and D. Raoult (2003) Genomebased
design of a cell-free culture medium for Tropheryma whipplei. Lancet, 362, 447-449.

Interlocutors on IFR 48
Pr Didier Raoult
E-mail : didier.raoult@medecine.univ-mrs.fr
Dr Florence Fenollar
E-mail : florence.fenollar@medecine.univ-mrs.fr
Telephone. 33. 4.91.38.55.14 (or 19 or 17)
Clinical consultation on IFR 48
Consultation of Pr D. Raoult
Wednesday morning
Fédération de Microbiologie Clinique
Hôpital de la Timone
264, Rue Saint-Pierre
13385 Marseille
Tél. 33. 4.91.38.55.14 (or 19)

What specimens to send and how ?
- Small-bowel biopsies (and other kinds biopsies) in
10% formalin. Transport at room temperature. Samples
fixed on formaline even several years before are also
available for diagnosis.
- Small-bowel biopsies (and other kinds biopsies),
frozen at – 80°C. Transport in dry ice.
-Saliva : 1 ml at least, frozen at –80°C. Transport in
dry ice.
-Stools frozen at –80°C. Transport in dry ice.
-Urine frozen at –80°C. Transport in dry ice.
-Blood sampled on one dry tube. Transport at room
temperature.
-Blood sampled on one EDTA tube. Transport at room
temperature.
-Blood sampled on one heparinized tube. Transport at
room temperature.
-In case of neurological signs or confirmed Whipple’s
disease : 5 ml of LCR frozen at –80°C. Transport in dry ice.
Address for sending the samples :
Unité des Rickettsies, Faculté de Médecine
27, Boulevard Jean Moulin
13385 Marseille, France

Sheet of clinical information

Informations for the patients
Professeur Didier RAOULT
HOPITAL DE LA TIMONE
Phone. 33. 4.91.38.55.14/19
Mail : didier.raoult@medecine.univ-mrs.fr
The Whipple’s disease is caused by a bacterium called Tropheryma
whipplei. The bacterium lives probably in the environment, maybe water,
but we do not really know the source of the infection. The disease seems
to be more frequent in some geographical area, mainly, for France in
Rhône-Alpes area, but also in Switzerland and Germany.
The presentations of the disease are diverse. The most frequent
and classical form is those with digestive signs including a chronic
diarrhea, associated with a weight loss and a skin which become more
dark. This form is often associated to the presence of adenopathies or
arthralgia, which could be the first clinical signs of the disease.
Sometimes, this disease is misdiagnosed with rheumatoid polyarthritis.
In the classical from, the localization of the bacterium on the small-bowel
is systematic. This fact explains why we perform a digestive fibroscopy
with a biopsy to check for the presence of the bacterium at the beginning
and in the follow-up of the disease. Besides, the bacterium could also
infects different sites such as the brain or the cardiac valves.
Without treatment, the evolution of Whipple’s disease is always
fatale. The treatment is long (always superior to 1 year) and after the end
of the treatment, sometimes even after very long treatment, relapses are
possible, mainly in the brain. A regular follow-up of patients with
Whipple’s disease is thus necessary.
The bacterium has been cultivated for the first time in our
laboratory in Marseille (France), in 1999, allowing new perspectives for
the diagnosis and the management of this disease.

The diagnosis could be performed by the detection of the
bacterium or its genes, by molecular techniques. We look for the
presence of the bacterium in blood, saliva and stools, for all the patients.
For the patients with a digestive localization, we look for the presence of
the bacterium in the small-bowel digestive, one time per year. For the
patients who present a brain localization, we look for the bacterium on
cerebrospinal fluid obtained by lumbar puncture. The lumbar puncture is
first performed for the diagnosis, and 2 months after the beginning of the
treatment, to check the disappearance of the bacterium. After the end of
the treatment, a lumber puncture should be proposed annually, to allow
the detection of a relapse. Some radiological brain exploration could be
also justified in this context.
For the treatment, the knowledge has progressed quickly these
last years, with the culture of the bacterium. For classic Whipple’s
disease, it seems that the treatment the more efficiency is the
association of doxycycline and hydroxychloroquine. Hydroxychloroquine
allows doxycycline to be efficient in the cells. For the neurological form,
the reference treatment includes cotrimoxazole. Unfortunately, relapses
have been reported even with these approaches. The treatment should
never been less than 1 year, and after a follow-up during all the life is
required to detect a relapse.
The results of your sampling, for the diagnosis, the treatment and
the follow-up (whatever the documentation) are susceptible to be used
(anonymously) for reports about your disease in the context of a
scientific publication.