Bartonella quintana
Bartonella quintana
Bartonella quintana
- No tags were found...
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
References1. Raoult D, Roux V. The body louse as a vector of reemerginghuman diseases. Clin Infect Dis 1999; 29:888-911.17. References of genes available forPCRTable 3 List of sequences available for <strong>Bartonella</strong> sp.Amplification.MicroorganiReGene primer SequencesmfB .ribCclarridgeiaeF PBC5 TACATAACGAGCCAATT 2B .ribCclarridgeiaeRPBC15 TAGCTTTAGAACAATATGGT 2B. henselae ribC F PBH-L1 GATATCGGTTGTGTTGAAGA 2B. henselae ribC RPBH-R1 AATAAAAGGTATAAAACGCT 2B .ribCbacilliformisF PBH-L1 GATATCGGTTGTGTTGAAGA 2B .ribCbacilliformisRPBB-R1 AAAGGCGCTAACTGTTC 2B. <strong>quintana</strong> ribC F PBH-L1 GATATCGGTTGTGTTGAAGA 2B. <strong>quintana</strong> ribC RPBQ-R1 AAAGGGCGTGAATTTTG 2All <strong>Bartonella</strong> ribC F PBH3 CCAAGTGCTACATAACCATC 2All <strong>Bartonella</strong> ribC RPBH4 CGGGTTGTTATTGCTCTTAC 216s-2All (except B. 3 sF 16SFbacilliformis) spaceAGAGGCAGGCAACCACGGTA 3r16s-2All (except B. 3 sR23S1bacilliformis) spaceGCCAAGGCATCCACC 3r