sequencing gap - Rice Genome Annotation Project

More documents

Recommendations

Info

Celera Assembler• creates high confidence “uniquelyassembleable contigs” = unitigs• marks those that appear repetitive w.r.t.arrival-rate statistics (surrogates anddegenerates)• uses insert (clone-mate) information tobuild contigs & mark ambiguous unitigs(surrogates)TIGRTHE INSTITUTE FOR GENOMIC RESEARCH
Merging two sequencesoverlap (19 bases)overhang (6 bases)…AGCCTAGACCTACAGGATGCGCGGACACGTAGCCAGGACCAGTACTTGGATGCGCTGACACGTAGCTTATCCGGT…TIGRoverhangoverlap - region of similarity between regionsoverhang - un-aligned ends of the sequencesThe assembler screens merges based on:• length of overlap• % identity in overlap region• maximum overhang size.THE INSTITUTE FOR GENOMIC RESEARCH% identity = 18/19 % = 94.7%
Page 4 and 5: Library Construction• Break the g
Page 6: DNA Shearing with HydroShearHydroSh
Page 9 and 10: Design Features of the BstXI Adapto
Page 11 and 12: Template Production• Transform cl
Page 13 and 14: Template Production LaboratoryCurre
Page 15 and 16: Sequence Production LaboratoryCurre
Page 17 and 18: Sample ElectropherogramTIGRTHE INST
Page 19 and 20: What are phred quality values?The q
Page 21 and 22: TIGRTHE INSTITUTE FOR GENOMIC RESEA
Page 23: Assembling the fragmentsTIGRTHE INS
Page 27 and 28: Forward-reverse constraints• The
Page 29 and 30: Degenerate contigs• Too deep• T
Page 31 and 32: Scaffolding• Given a set of non-o
Page 33 and 34: Linking information• Overlaps•
Page 35 and 36: Assembly gapsphysical gapgroup Agro
Page 37 and 38: Problems with the data• Incorrect
Page 39 and 40: Unifying view of assemblyAssemblySc
Page 41 and 42: BAC-by-BAC Sequencing and Closure
Page 43 and 44: BAC Shotgun SequencingBAC DNASequen
Page 45 and 46: Why Completeness is Important• Im
Page 47 and 48: Levels of Genome ClosureTIGRTHE INS
Page 51 and 52: Sequencing GapsContig AUnderlyingse
Page 53 and 54: Repetitive Areas• Repetitive area
Page 55 and 56: Mis-assembled repeatClones link dif
Page 57 and 58: Sequence editor• In this example
Page 59 and 60: Resultingcontig afterrepeatresoluti
Page 61 and 62: Collapsed Repeat-5.5 CE DipReadCove
Page 63 and 64: Sequence Validation: Editing• Fin
Page 65 and 66: Sequence Validation:Sequence covera
Page 67 and 68: Sequence Coverage in CloeTIGRTHE IN
Page 69 and 70: Clone Coverage ExampleCATCCGAAGACGA
Page 71 and 72: Finished BAC Ready for Annotation!B
Page 75 and 76:
HT TemplateLibraryConstructionHT Se
Page 77 and 78:
Schematic View of 3 Typical Scaffol
Page 79 and 80:
Short Tandem RepeatsTIGRTHE INSTITU
Page 81 and 82:
Inverted RepeatsTIGRTHE INSTITUTE F
Page 83 and 84:
Use of Transposon-mediated librarie
Page 85 and 86:
Closure Challenges: SequencingThrou
Page 87 and 88:
Homopolymeric tractsTIGRTHE INSTITU
Page 89 and 90:
• Apply different sequencing chem
Page 91 and 92:
Automated Finishing (cont’d)• L
Page 93 and 94:
• Dead EndsBAC Project Challenges
Page 95 and 96:
Filling small gaps in a chromosome
Page 97:
Project Organization• Database to
show all

sequencing gap - Rice Genome Annotation Project

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?