Casella et al. - 2013 - TILLING in European Rice Hunting Mutations for Cr

Published August 26, 2013
RESEARCH
TILLING in European Rice:
Hunting Mutations for Crop Improvement
Laura Casella, Raffaella Greco,* Gianluca Bruschi, Barbara Wozniak, Ludovico Dreni,
Martin Kater, Stefano Cavigiolo, Elisabetta Lupotto, and Pietro Piffanelli
ABSTRACT
Targeting induced local lesions in genomes
(TILLING) is a powerful technique that exploits
variation induced by classical mutagenesis
for gene discovery and functional studies as
well as crop improvement. Here we describe
the development and validation of the first rice
(Oryza sativa L.) TILLING platform of a European
temperate japonica accession. A total of 1860
M 2
ethyl methane sulfonate (EMS)-mutagenized
lines were generated in the variety ‘Volano’, one
of the most widely cultivated European rice
varieties representative of the traditional Italian
high quality rice. The validation of the TILLING
population was performed by screening the
M 2
lines for variation in four target genes
of relevance for the improvement of Volano
(SD1, Hd1, SNAC1, and BADH2, involved
in determining plant height, flowering time,
drought tolerance, and aroma, respectively).
Two independent mutations identified in the
Green Revolution gene SD1 (semidwarf 1) were
demonstrated to have a significant phenotypic
effect, resulting in semidwarf progenies with an
average height reduction of 21% in the plants
carrying the mutant allele in the homozygous
state. The density of one mutation every 373
kb estimated in the Volano TILLING population
was comparable to that previously obtained
in rice EMS-mutagenized populations and
confirmed the effectiveness of this approach for
targeted improvement of European temperate
rice germplasm. Besides the validation of the
TILLING platform, this work also provides
genetic material that can be directly exploited
for the improvement of the Volano variety.
L. Casella, G. Bruschi, S. Cavigiolo, and E. Lupotto, Consiglio per
la Ricerca e la Sperimentazione in Agricoltura- Rice Research Unit,
13100 Vercelli, Italy; R. Greco, B. Wozniak, and P. Piffanelli, Rice
Genomics Unit, Parco Tecnologico Padano, 26900 Lodi, Italy; L. Dreni
and M. Kater, Dep. of Biosciences, Università degli Studi di Milano,
via Celoria 26, 20133 Milan, Italy. The first two authors contributed
equally to this work. Received 18 Dec. 2012. *Corresponding author
(raffaella.greco@tecnoparco.org).
Abbreviations: 2-AP, 2-acetyl-1-pyrroline; BADH2, betaine aldehyde
dehydrogenase; DIOX_N, dioxygenase N-terminal; EMS, ethyl
methane sulfonate; GA, gibberellin; GA20, gibberellin 20; GA20ox,
gibberellin 20-oxidase; Hd1, Heading date-1; MNU, N-methyl-Nnitrosourea;
NAC, NAM, ATAF, and CUC; NAD, nicotinamide
adenine dinucleotide; NGS, next generation sequencing; PCR, polymerase
chain reaction; SD1, semidwarf 1; SIFT, sorting tolerant from
intolerant; SNAC1, Stress-responsive NAC 1; SNP, single nucleotide
polymorphism; TILLING, targeting induced local lesions in genomes.
Rice is the most important food crop in the world, representing
the main source of energy intake for more than one third of the
world’s population. Although the majority of the global rice production
comes from developing countries such as China, India, Indonesia,
and Bangladesh, northern Italy plays an important role providing
about 50% of the total European rice production (FAO, 2010). Most
of the rice varieties grown in Italy belong to the temperate japonica
phylogenetic subgroup (Spada et al., 2004; Mantegazza et al., 2008;
Faivre-Rampant et al., 2010; Courtois et al., 2012), characterized by
a lower genetic diversity compared to the tropical japonicas and the
most diverse indica group (Garris et al., 2005). Indica cultivars had a
limited influence in European and Italian breeding programs mainly
Published in Crop Sci. 53:2550–2562 (2013).
doi: 10.2135/cropsci2012.12.0693
© Crop Science Society of America | 5585 Guilford Rd., Madison, WI 53711 USA
All rights reserved. No part of this periodical may be reproduced or transmitted in any
form or by any means, electronic or mechanical, including photocopying, recording,
or any information storage and retrieval system, without permission in writing from
the publisher. Permission for printing and for reprinting the material contained herein
has been obtained by the publisher.
2550 www.crops.org crop science, vol. 53, november–december 2013

ecause of their failure to grow at northern latitudes, requiring
long-day adaptation and cold tolerance, as well as of sterility
barriers (Courtois et al., 2012). Due to environmental
constraints and consumer tradition, which favor traditional
risotto type rice, the Italian rice germplasm has a narrow
genetic basis, which may benefit from the introduction of
new sources of genetic variation.
The targeting induced local lesions in genomes (TILL-
ING) approach, combining classical mutagenesis (by chemical
or physical agents) with a high-throughput screening
method to detect the induced mutations, is a powerful technology
that can be used to induce and characterize genetic
variation. The TILLING approach was first developed in
Arabidopsis thaliana (L.) Heynh. (McCallum et al., 2000) and
since then has been successfully used in many other plant as
well as animal species (reviewed in Kurowska et al., 2011;
Rashid et al., 2011; Wang et al., 2012). Originally developed
for functional genomics studies, as an alternative to
transgenic approaches such as transfer DNA and transposon
insertional mutagenesis or ribonucleic acid interference (An
et al., 2005; Alonso and Ecker, 2006; Small, 2007; Krishnan
et al., 2009; Gilchrist and Haughn, 2010; Kuromori et
al., 2009), TILLING was shown to be also a valuable tool
in crop breeding (Kurowska et al., 2011; Rashid et al., 2011;
Wang et al., 2012). Among the various mutagenic agents,
ethyl methane sulfonate (EMS) is mainly used in TILL-
ING as it produces random mutations in genetic materials
at a very high density (Koornneef, 2002). Thanks to its
capability to create a wide spectrum of different mutations
(missense, nonsense, and splice site) resulting in a diverse
array of mutant alleles, EMS, in combination with a TILL-
ING approach, can provide a range of different phenotypes
that can be useful for breeding (Alonso and Ecker, 2006;
Gilchrist and Haughn, 2005; Henikoff and Comai, 2003).
Favorable mutations detected within a TILLING platform
can be rather easily introgressed into different genetic
backgrounds or TILLING itself can be developed into the
genetic material of interest, as classical mutagenesis can be
applied to any plant species (Henikoff and Comai, 2003).
Several examples of the successful use of TILLING
for crop improvement have been described in different
plant species. Combining TILLING mutation discovery
and conventional breeding, Slade et al. (2012) reported the
creation of novel nontransgenic wheat [Triticum aestivum L.
and Triticum turgidum L. subsp. durum (Desf.) Husn.] lines
with high levels of amylose and resistant starch content,
shown to have beneficial effects for the control of obesity
and diabetes. Two mutants with altered seed oligosaccharide
content (raffinose and stachyose in the first mutant and
oleic and linoleic acid in the second), a phenotype desirable
for cooking and industrial oils, were identified in a soybean
[Glycine max (L.) Merr.] TILLING collection (Dierking
and Bilyeu, 2009). The development of a TILLING platform
in melon (Cucumis melo L.) allowed the identification
of a mutant with a significantly improved shelf life due to
an induced alteration in an ethylene biosynthetic enzyme
(Dahmani-Mardas et al., 2010). In tomato (Solanum lycopersicum
L.), TILLING led to the identification of two allelic
mutations in an ethylene receptor gene, causing delayed
fruit ripening and prolonged shelf life (Okabe et al., 2011).
In addition, mutants for virus resistance in melon (Nieto et
al., 2007) and tomato (Piron et al., 2010), starch in potato
(Solanum tuberosum L.) (Muth et al., 2008), natural products
in sorghum [Sorghum bicolor (L.) Moench] (Blomstedt et al.,
2012), and nornicotine content in tobacco (Nicotiana tabacum
L.) (Julio et al., 2007) have been described.
The TILLING approach was also used to produce
mutant collections in rice. The first rice TILLING platform
was created in the indica variety IR64, the most widely
grown cultivar in Southeast Asia (Wu et al., 2005). This
large mutagenized M 2
population was obtained using different
mutagenic agents but a low mutation density (1/1000
kb) was observed. Improvements of both the mutagenesis
procedure and the screening method allowed a higher
mutation density (1/300 kb) in a TILLING population to be
achieved for the reference rice variety Nipponbare (Till et
al., 2007). An even higher mutation density was achieved in
the Taiwanese japonica rice cultivar Taichung 65 by treating
pollinated flowers with N-methyl-N-nitrosourea (MNU)
(Suzuki et al., 2008). However, so far no TILLING platform
has been developed using genetic material adapted to
grow in the temperate European pedoclimatic conditions.
In this study we developed genetic variation in the temperate
Oryza sativa subsp. japonica cultivar Volano. This variety
was chosen as being representative of the traditional Italian
high quality rice. Volano is one of the most widely cultivated
and important Italian rice varieties, with a large internal market,
and is exported worldwide as it belongs to the Arborio
class, the most popular risotto type rice of the Long A grain
class. In 2011, Volano was cultivated on 20.230 ha (Ente Nazionale
Risi, 2011), representing 17% of the national growing
area of risotto type rice. Volano is a tall variety (110 cm), which
is a typical trait of traditional Italian rice varieties, and has a relatively
long life cycle, consisting of 155 d from sowing to seed
ripening. It has a moderate resistance to diseases, such as blast
and a poor yield performance when grown in water-limited
conditions (Ente Nazionale Risi, 2012b). Due to its valuable
grain quality characteristics, Volano is of strategic relevance
for ongoing breeding programs and surely will take advantage
from the improvement of several traits, including shortening of
the plant stature and of the growth cycle and improved resistance
to biotic and abiotic stress conditions.
A total of 1860 M 2
EMS mutagenized lines were generated
and used for TILLING screening of four agronomically
and quality relevant target genes. A mutation density
of 1/373 kb was estimated, showing the effectiveness of this
approach for targeted improvement of European temperate
rice germplasm.
crop science, vol. 53, november–december 2013 www.crops.org 2551

Table 1. Target genes and primers used for targeting induced local lesions in genomes (TILLING) analysis of the Volano ethyl
methane sulfonate–mutagenized population.
Gene Locus † Forward primer Reverse primer Amplicon size (bp)
SD1 Os01g66100 acacacgctctcaactcactcc agcagaggagaacagaggagag 1081
Hd1 Os06g16370 gtccatgtggtgcaagctaaag cgtggcatgtagtaacaactaac 972
SNAC1 Os03g60080 cagcgagaagcaagcaagaag agcatcgatcaccacctgttc 1142
BADH2 Os08g32870 tgagaatcatgttcgggatg acaaagtcccgcacttcaga 840
†
Referring to Michigan State University v.6.1 rice genome annotation (Ouyang et al., 2007).
MATERIALS AND METHODS
Mutagenesis and Plant Material
Pure seed samples of O. sativa subsp. japonica ‘Volano’ (Ente Nazionale
Risi, 2012b; Supplemental Table S1) were obtained by the
breeding company Società Italiana Sementi (Bologna, Italy).
Ethyl methane sulfonate mutagenesis was performed essentially
as described by Till et al. (2007) with the following
modifications. To evaluate the toxicity and/or lethality of the
EMS treatment in Volano, a range of doses from 0.25 to 1.0%
of EMS (liquid, product code M0880; Sigma-Aldrich) was first
tested on batches of 200 seeds. Seedling survival decreased
markedly at doses above 0.75%. The optimum dosage of 0.75%,
which gave germination rates averaging 59% (untreated control
displayed 95%), was hence applied.
A total of 20,000 seeds were then treated in batches of 5000
seeds in 1 L flasks. After a presoaking for 18 h in 400 mL of tap
water, seeds were treated with a solution of 0.75% EMS in 0.066
M phosphate buffer (Na 2
HPO 4
and KH 2
PO 4
) at pH 7 for 24 h.
After the EMS treatment, seeds were thoroughly washed over
a period of 24 h, first with deionized water (three times for 30
minutes each time) and then with tap water (refreshed every
hour for the first 5 h). All the 20,000 mutagenized seeds were
dried with wet blotting paper and directly sown in the open
field. The M 1
plants were grown according to standard paddy
rice agronomic practices and harvested at maturity. Twenty M 2
seeds from each M 1
fertile line (approximately 2000) were sown
in the field the following growing season. Of each M 2
line one
single healthy M 2
plant was chosen, leaf samples were taken for
DNA isolation, and the plants were bagged individually and
allowed to grow to maturity. The DNA extraction was performed
on a single fertile M 2
plant per line. From each selected
M 2
plant, M 3
seeds were collected and stored at 4°C with 7 to
10% relative humidity to ensure their long-term viability.
DNA Isolation and Pooling Strategy
The DNA was isolated from lyophilized leaf tissue in 96-well
plates with NucleoSpin Plant II (Macherey-Nagel GmbH &
Co. KG), using a Tecan Freedom EVO150 liquid handling
robot (Tecan Group Ltd.). Before pooling, the concentration
of each sample was determined using the PicoGreen dsDNA
(double-strand DNA) quantitation assay (Life Technologies
Corp.) and normalized at a standard concentration of 2 ng μL –1 ,
to ensure that each sample was equally represented in the pool.
Two-dimensional pooling (eightfold for columns and 12-fold
for rows) was performed by combining all samples in shared
rows and all samples in shared columns, so that each M 2
line
was represented both in the eightfold and in the 12-fold pool.
Primer Design
Primers for the amplification of the target genes were designed
from the Nipponbare genome sequence using CODDLE
(Codons Optimized to Discover Deleterious LEsions) (http://
www.proweb.org/coddle; accessed 18 Dec. 2012) and Primer3
(Rozen and Skaletsky, 2000). The target genes and the
selected primer sequences are listed in Table 1. Forward and
reverse primers were 5¢-end labeled with 6FAM and VIC,
respectively. Labeled and unlabeled oligonucleotides were purchased
from Applied Biosystems (Life Technologies Corp.).
TILLING Protocol
The screening of induced mutations by TILLING was performed
essentially as described by Till et al. (2006), with the
following modifications. Polymerase chain reactions (PCRs)
were performed in a final volume of 10 μL, using 2 μL of
pooled genomic DNA and HotStarTaq Master Mix (Qiagen).
Labeled and unlabeled primers were mixed in a 3:2 ratio, with
a final concentration of 0.4 μM. Cycling was performed on a
TProfessional thermocycler (Biometra GmbH) as follows: 95°C
for 15 min; 35 cycles of 94°C for 1 min, melting temperature
–5°C for 1 min, and 72°C for 1 min and 30 s; and 72°C for 10
min. For all the primer pairs an annealing temperature of 60°C
was used. After amplification, PCR products were denatured
and annealed to form heteroduplexes between complementary
strands as follows: 94°C for 10 min and 90 cycles of 1 min from
94 to 4°C, decreasing by 1°C per cycle. Heteroduplexes were
cleaved by digestion with the mismatch-specific endonuclease
ENDO1 (Serial Genetics, Evry, France) (Triques et al., 2008),
according to the manufacturer’s instructions. The reactions
were performed in a final volume of 30 μL and incubated at
45°C for 20 min. The samples were then ethanol (CH 3
CH 2
OH)
precipitated, rinsed with ethanol 70%, and resuspended in 12
μL of Hi-Di Formamide and 0.05 μL of GeneScan 1200 LIZ
Size Standard (Applied Biosystems, Life Technologies Corp.).
To identify the cleavage products resulting from heteroduplex
mismatches, ENDO1-digested samples were loaded on an
ABI3730 DNA sequencer (Applied Biosystems, Life Technologies
Corp.) using a 96-capillary array with POP7 polymer. The
output sequences were then analyzed using the software GeneMapper
4.0 (Applied Biosystems, Life Technologies Corp.).
Validation of Mutations
To confirm the mutations detected, PCR and conventional
sequencing were performed on the individual M 2
DNA samples
identified according to the two-dimensional pooling strategy.
Polymerase chain reaction amplification was performed in
a final volume of 10 μL, as previously described, except that
only unlabeled primers were used and the cycling program
2552 www.crops.org crop science, vol. 53, november–december 2013

was stopped after the extension step of 10 min at 72°C. Before
sequencing, the PCR products were purified from free primers
and nucleotides using ExoSAP-IT (GE Healthcare), following
the manufacturer’s instructions.
Sequencing reactions were set up in a final volume of 10 μL
with 10 to 40 ng of purified PCR product and a primer concentration
of 0.32 μM using the BigDye Terminator v3.1 Cycle
Sequencing Kit (Applied Biosystems, Life Technologies Corp.).
The following conditions were used: 96°C for 1 min and 25 cycles
of 96°C for 10 sec, 55°C for 5 sec, and 60°C for 4 min. Samples
were then ethanol and ethylenediaminetetraacetic acid precipitated
and analyzed on the ABI3730 DNA sequencer (Applied
Biosystems, Life Technologies Corp.). The output sequences
were analyzed with the software Mutation Surveyor (SoftGenetics,
2010) to identify and validate the mutations.
To predict whether a point mutation would have an effect at
the protein level, the target amino acid sequences (semidwarf 1
[SD1], Heading date-1 [Hd1], Stress-responsive NAC 1 [SNAC1],
and betaine aldehyde dehydrogenase [BADH2]) were analyzed
with SIFT (Sorting Tolerant From Intolerant) (Kumar et al.,
2009) to identify the regions that do not tolerate substitutions.
Phenotypic Field Evaluations
Rice plants were grown in the field at the Consiglio per la
Ricerca e la Sperimentazione in Agricoltura-Rice Research
Unit in Vercelli (Italy). Seeds were sown directly into dry soil
and conventional submersion was established at the third to
fourth leaf developmental stage until 1 mo before harvesting.
Standard fertilization was performed with 150 kg N ha –1 , 40
kg P 2
O 5
ha –1 , and 150 kg K 2
0 ha –1 . The total rate of N and
K was fractionated in two times (one-third before sowing and
two-thirds at panicle initiation stage) to improve the efficiency
of the two fertilizers. During the growing season the following
agronomical traits were assessed according to the International
Union for the Protection of New Varieties of Plants guidelines
(UPOV): total plant height (cm), measured at maturity on the
primary tiller, considering the distance from the soil to the tip of
the panicle (excluding the awn); panicle length (cm), measured at
maturity on the primary tiller, considering the distance from the
base to the tip of the panicle (excluding the awn); panicle type
and panicle attitude in relation to stem, both assessed after ripening;
grain characteristics (length, width, and weight), assessed
after ripening; and growth cycle, considering the days from seed
sowing till seed ripening. At maturity, paddy rice samples were
harvested by hand and stored in controlled conditions.
RESULTS
Development of the Volano TILLING Population
The Volano TILLING platform was developed using the
chemical mutagen EMS, shown to be effective for rice by
Till et al. (2007) using the japonica cultivar Nipponbare,
in which a density of induced mutations of 1/300 kb was
reported. However, EMS toxicity and efficiency is genotype
specific and can vary greatly within the same species and
subspecies, as shown by the lower mutation rate observed in
the EMS-mutagenized indica variety IR64 (1/1000 bp) (Wu
et al., 2005). A pilot test using different doses of EMS was
performed on small batches of Volano seeds to identify the
optimal quantity of EMS to be used for large-scale mutagenesis
(data not shown). Based on the results obtained, the
mutagenesis was performed using 0.75% EMS on 20,000
seeds of Volano. The mutagenized seeds were sown directly
in field conditions and the surviving M 1
plants were grown
to maturity and self-fertilized. Approximately 2000 fertile
M 1
lines were harvested and 20 seeds from each line
were planted to generate the M 2
generation. During the
growth of the M 2
population, several mutant phenotypes
were observed at different developmental stages, ranging
from seedling to maturity stage. The most common mutant
phenotypes were related to dwarfism, plant sterility, alteration
in plant architecture, growth cycle duration, and seed
morphology. Examples of the phenotypes observed are
shown in Fig. 1. A summary of the phenotypic data collected
for plant height, panicle length, growth cycle, and
grain size and shape is reported in Supplemental Table S2
and Supplemental Fig. S1. While the majority of the M 2
lines had an average plant height of 98.6 ± 9.7 cm typical of
Volano, 2.1% of the mutagenized lines showed a semidwarf
phenotype with a reduction in height >20 cm (Supplemental
Fig. S1). Similarly, 1.5% of the M 2
mutagenized plants
showed increased panicle length (>25 cm) with respect to
that of Volano (22 cm) (Supplemental Fig. S1). Variability in
growth cycle duration was also observed, with a range difference
of 40 d between the earliest and the latest M 2
lines.
Few “early” mutants showing a shortening of at least 20 d
between the sowing and the ripening time were recorded
(Supplemental Fig. S1).
From the 20 M 2
seeds sown for each M 1
line, one M 2
fertile and healthy-looking individual plant was chosen
for DNA isolation and for seed harvest. In total 1860 M 2
lines were selected to constitute the Volano mutagenized
TILLING collection.
Detection of Mutations in Candidate Genes
To estimate the efficiency of the EMS treatment and to
evaluate the mutation frequency in the Volano EMS-treated
population, TILLING was initially performed on DNA isolated
from 1152 M 2
lines organized using to a two-dimensional
pooling strategy. A similar strategy was successfully
used to screen another rice mutagenized population (Till et
al., 2007), where eightfold pools were used in both dimensions.
The advantage of using a 2D pooling strategy is that
the M 2
line containing the mutation can be directly identified
without sequencing all the samples in the pool.
For this pilot screening, four genes of relevance for agronomic
and quality traits were selected: SD1 (semidwarf 1),
involved in plant height determination (Sasaki et al., 2002),
Hd1 (Heading date-1), which plays a crucial role in determining
the flowering time (Yano et al., 2000), SNAC1 (Stressresponsive
NAC 1), which was shown to be a central player in
stomata guard cell closure under water stress conditions (Hu
crop science, vol. 53, november–december 2013 www.crops.org 2553

Figure 1. Examples of morphological mutant phenotypes observed in the M 2
generation of the Volano ethyl methane sulfonate–mutagenized
population. (a) Abnormal spikelet pigmentation, (b) altered grain shape (c and f) dwarfism, (d) early flowering, and (e) late flowering.
et al., 2006), and BADH2, which is responsible of the typical
aroma of fragrant rice (Bradbury et al., 2005).
The TILLING screening identified three mutations
in the SD1 gene, one in Hd1, four in SNAC1, and two in
BADH2 (Table 2). The mutations observed were predominantly
G/C to A/T transitions (90%), except for one T/C
transition detected in the SD1 gene. These results are in line
with other EMS mutagenesis studies reported in literature. In
Arabidopsis thaliana, maize (Zea mays L.), and wheat, G/C to
A/T transitions were shown to make up more than 99% of all
EMS-induced mutations (Greene et al., 2003; Henikoff and
Comai, 2003) whereas in other species such as tomato, barley
(Hordeum vulgare L.), and rice, these transitions represent
only 70% of the observed mutations (Caldwell et al., 2004;
Till et al., 2007; Minoia et al., 2010). The only T/C transition
detected was heterozygous and therefore is unlikely to
have been a naturally occurring mutation, considering the
low estimated rate of spontaneous mutations (10 –7 to 10 –8 bp
per generation) (Greene et al., 2003).
All but one of the mutations identified occurred in
exons (Table 2), which may be expected considering that
25% of the 4035 nucleotides used for the screening spanned
introns (Table 3). Based on the predicted effect on the
protein product, we found 70% missense, 20% silent, and
10% nonsense mutations. Besides the nonsense mutation,
the majority of the missense mutations detected (six out of
seven) were likely to generate nonfunctional protein products,
according to SIFT predictions (Kumar et al., 2009).
The SIFT algorithm predicts whether an amino acid substitution
in a protein will have a phenotypic effect based on its
degree of conservation in alignments derived from closely
related sequences. The assumption is that amino acid residues
at positions important for protein function should be
conserved throughout evolution among members of a protein
family (Kumar et al., 2009). All but one (the silent
base change in SNAC1 mentioned above) of the mutations
identified were found to be heterozygous (Table 3).
To estimate the mutation rate, 200 bp were subtracted
from the length of each screened amplicon according to
Greene et al. (2003), who reported the difficulty to reliably
detect mutations close to the TILLING primers.
The resulting estimated average mutation density in the
2554 www.crops.org crop science, vol. 53, november–december 2013

Table 2. Ethyl methane sulfonate–induced mutations identified in the Volano targeting induced local lesions in genomes (TILL-
ING) population.
Gene
Plant
identity †
Nucleotide
change
Position
from ATG ‡
Position
in CDS ‡
Amino acid
change SIFT score § Amino acid properties
SD1 860 G/A 144 exon1 W > STOP 0.00 –
1427 C/T 473 exon1 S158F 0.09 N and P ® N and NP
921 T/C 802 exon2 Y234H 0.00 N and P ® B and P
Hd1 782 G/A 242 exon1 C81Y 0.05 N and SP ® N and P
SNAC1 1213 C/T 262 exon1 R88C 0.00 B and P ® N and SP
951 C/T 316 exon1 P106S 0.03 N and NP ® N and P
1523 C/T 467 exon1 S156F 0.00 N and P ® N and NP
269 G/A 756 exon2 E > E – –
BADH2 1133 C/T 2690 exon6 L206F 0.00 N and NP ® N and NP
108 C/T 2829 intron6 – – –
†
M 2
line carrying the mutation.
‡
Positions refer to the genomic sequences (Michigan State University v.6.1 rice genome annotation [Ouyang et al., 2007]). CDS, coding DNA sequence.
§
Prediction based on SIFT (sorting tolerant from intolerant) algorithm (Kumar et al., 2009). An amino acid substitution predicted to impair the protein function has a score
≤0.05; if tolerated the score is >0.05.
N, neutral; P, polar; SP, slightly polar; NP, nonpolar; B, basic.
Table 3. Features of the observed mutations identified by the targeting induced local lesions in genomes (TILLING) screening
of the Volano ethyl methane sulfonate–mutagenized population.
Gene
Amplicon
size (bp)
CDS † (bp) Total Silent Missense Nonsense HET ‡ HOM §
SD1 1081 879 3 0 2 1 3 0
Hd1 972 828 1 0 1 0 1 0
SNAC1 1142 951 4 1 3 0 3 1
BADH2 840 350 2 1 1 0 2 0
Total 4035 3008 10 2 7 1 9 1
% 20% 70% 10% 90% 10%
†
CDS, coding DNA sequence.
‡
HET, heterozygous.
§
HOM, homozygous.
Volano TILLING population observed in the pilot screen
was 1/373 kb.
TILLING for Crop Improvement
of European Temperate Rice
Four rice genes were selected to validate the Volano
TILLING population based on the agronomic impact of
the phenotypic effect expected from the alteration and/or
inactivation of the encoded polypeptides.
Reduction in plant height represents one of the most
important goals of the current breeding programs to
improve the field performance of the Volano variety. To
identify Volano lines with shorter stature, we screened for
EMS-induced mutations in the SD1 gene, which is the
most important gene of the rice Green Revolution (Sasaki
et al., 2002). SD1 encodes for a gibberellin 20-oxidase, a
key enzyme in the gibberellin (GA) biosynthetic pathway,
which plays a central role in determining plant height by
affecting cellular and internode elongation. Alterations in
the SD1 genomic sequence and encoded protein result in
decreased levels of GAs due to the defective gibberellin
20-oxidase (GA20ox) enzyme, which lead to plants with
shorter and thicker culms, improved lodging resistance,
and a greater harvest index (Monna et al., 2002; Sasaki et
al., 2002; Spielmeyer et al., 2002).
The SD1 gene consists of three exons encoding a
protein product of 389 amino acids with two predicted
conserved functional domains, a non-heme dioxygenase
N-terminal (DIOX_N) domain (IPR026992) spanning
residues 64 to 168 and a oxoglutarate- and iron-dependent
dioxygenase domain (IPR005123), typical of plant
dioxygenases involved in hormone and pigment synthesis,
spanning residues 224 to 324.
The TILLING screening of SD1 in the Volano mutagenized
population identified three independent point
mutations, of which two were predicted to generate missense
products and one a truncated protein (Table 2). The
C/T transition in line M2_1427 led to a nonsynonymous
change from a polar serine to a nonpolar phenylalanine at
amino acid position 158 of the DIOX_N domain, which
according to the SIFT prediction presumably does not
affect protein function (Kumar et al., 2009). Based on
sequence alignment, four residues other than serine were
found at a corresponding position 158 in orthologous
crop science, vol. 53, november–december 2013 www.crops.org 2555

dioxigenases from other plant species, among which are
phenylalanine, threonine (less polar than serine), and to
a lesser extent charged residues such as aspartic acid and
histidine (data not shown). This sequence diversity indicates
that this amino acid position may not be essential for
enzyme function.
In contrast, the T/C transition in line M2_921 caused
a tyrosine®histidine substitution at position 234 in the
oxoglutarate- and iron-dependent dioxygenase domain.
The hydrophobic Tyr234 is highly conserved among plant
dioxygenases and its replacement by any other residue is
expected to be highly deleterious for the SD1 protein
function (SIFT score: 0.00).
The G/A transition in the M2_860 line created a premature
stop codon at position 48 of the protein sequence,
generating a predicted nonfunctional product lacking the
majority of the polypeptide (341 amino acid residues),
including the two functional domains. All the M 2
identified
mutations in the SD1 gene were heterozygous.
To confirm the inheritance of the induced mutations
in the SD1 gene and to explore their phenotypic effect,
30 M 3
seeds derived from each M 2
mutant line were sown
in the field and grown to maturity. The DNA was isolated
from each M 3
plant and the single nucleotide polymorphism
(SNP) alterations confirmed by sequencing. For
the M 2
lines 921 and 860, M 3
progeny plants carrying the
corresponding mutation in the homozygous state showed a
statistically significant decrease in plant height when compared
to homozygous wild-type plants (Fig. 2) (Wilcoxon
signed-rank test: p < 0.01). An average height reduction
of 19.1 ± 2.2 cm was observed in case of M 3
homozygous
mutant progenies derived from M2_860 and 23.8 ± 4.7
cm in case of M2_921 (Fig. 3). Furthermore, the M 3
plants
heterozygous for the mutations showed an intermediate
stature between the homozygous mutant and the wild-type
(Fig. 3) (Wilcoxon signed-rank test: p > 0.05), supporting
the hypothesis that the observed phenotypes arose specifically
from the EMS-induced alterations in the SD1 gene.
In agreement with the predicted effect of the mutation on
the protein function, the M 3
mutant progeny plants derived
from the line M2_1427 did not differ significantly in plant
height from the mutagenized lines not carrying the mutation
(Fig. 3) (Wilcoxon signed-rank test: p > 0.05).
Hd1, a rice ortholog of the A. thaliana flowering time
gene CONSTANS (Putterill et al., 1995), encodes a transcriptional
activator that promotes heading under shortday
conditions and inhibits it under long-day conditions
(Yano et al., 2000). By acting in a complex network with
other flowering genes, such as Hd3a, Ehd1, and Gdh7, it
plays a crucial role in determining flowering time variation
in rice (Tsuji et al., 2011), which is a relevant trait in
case of growth at northern latitudes such as Europe. The
Hd1 protein contains an N-terminal zinc finger domain
involved in DNA-binding and a C-terminal CCT domain
Figure 2. Example of a “semidwarf” Volano mutant. A M 3
plant
from line M2_921 carrying the homozygous mutation is shown (on
the left) in comparison with a mutagenized plant not carrying the
mutation (on the right) at maturity stage.
Figure 3. Segregation of plant height among M 3
progenies of
the three identified sd1 mutants (lines M2_860, M2_921, and
M2_1427). For each M 2
line, the blue bars represent the average
height of the homozygous wild-type plants, red bars represent
plants carrying the mutation in the heterozygote state, and
green bars represent the homozygous mutant plants. Error bars
are indicated. Double asterisks (**) indicate significant differences
between homozygous mutants and wild-type (wt) (p < 0.01; Wilcoxon
signed-rank test). het, heterozygous.
that functions as nuclear localization signal (Yano et al.,
2000). Inactivation of the Hd1 gene results in earlier heading
under long days with a reduction of the growing cycle
(Yano et al., 2000). One missense mutation was identified
in the Volano TILLING population in this gene (Table
2). The mutation was located in the zinc finger domain
and caused the substitution of a conserved cysteine residue
2556 www.crops.org crop science, vol. 53, november–december 2013

at position 81 of the second B-box type domain with a
tyrosine, predicted to impair protein function (Table 2).
The assessment of M 3
progeny mutant plants for phenotypic
variation in life cycle length did not show significant
changes when compared to sister lines not carrying the
point mutation (data not shown).
SNAC1 is a NAM, ATAF, and CUC (NAC) transcription
factor expressed in guard cells of rice upon dehydration
and involved in regulating stomatal closure (Hu et
al., 2006). Its overexpression in transgenic rice plants was
shown to greatly enhance tolerance to drought and salt
stress while inactivation resulted in increased stomatal aperture
and sensitivity to dehydration (Hu et al., 2006; You et
al., 2013), suggesting that only gain-of-function mutations
in this gene would result in a desirable phenotype. All the
three missense mutations identified in the SNAC1 gene in
the Volano TILLING population were located within the
conserved NAC DNA-binding domain (Hu et al., 2006;
Chen et al., 2011) and they were all generating changes in
amino acid polarity (Table 2). The C/T transition at position
88 led to the substitution of a very conserved arginine
(very hydrophilic) with cysteine (hydrophobic) in a putative
nuclear localization signal within the NAC domain (Hu et
al., 2006). The other two missense mutations resulted in a
proline®serine and a serine®phenylalanine replacements
at amino acid positions 106 and 156, respectively. According
to the SIFT scores, all the three amino acid substitutions
are predicted to affect protein function (Table 2). The
progeny of the three M 2
lines carrying the missense mutations
are currently under investigation to assess the response
under water-limited conditions.
The BADH2 gene encodes the enzyme betaine aldehyde
dehydrogenase (BADH2) that catalyses the oxidation
of a precursor of 2-acetyl-1-pyrroline (2-AP). Inactivation of
this enzyme leads to accumulation of 2-AP, the compound
responsible of the typical aroma of fragrant rice (Bradbury et
al., 2005). The BADH2 enzyme belongs to the nicotinamide
adenine dinucleotide (NAD)-dependent aldehyde dehydrogenase
family and is predicted to contain three domains
based on its three-dimensional structure: a NAD binding, a
substrate binding, and an oligomerization domain (Chen et
al., 2008). While Volano is a nonfragrant variety carrying the
functional BADH2 gene, the missense mutation identified in
the TILLING population caused a leucine to phenylalanine
substitution at amino acid position 206 in the NAD binding
domain, likely to impair protein function according to SIFT
prediction (Table 2). Assessment of the M 3
progeny from the
missense M 2
mutant line did not reveal the appearance of the
fragrance phenotype (data not shown).
DISCUSSION
Volano is one of the most widely cultivated and important
European rice varieties. In Italy, it is the most cultivated
variety of the Long A grain group and the second most
cultivated variety at national level (Ente Nazionale Risi,
2012a). Volano is representative of those temperate japonica
genotypes that are adapted to south European pedoclimatic
conditions above the 45th parallel, requiring early maturation
and low photoperiod sensitivity (Okumoto et al., 1996;
Ichitani et al., 1997). Europe is one of the most northern
areas where rice is grown extensively as a crop, together
with northern China and Japan (Lu and Chang, 1980).
Belonging to the Arborio class, which is the most popular
rice for risotto, Volano is considered representative
of the traditional Italian high quality rice and is exported
worldwide. Due to its strategic relevance for Italian and
European breeding programs, this traditional variety was
chosen for the development of the first rice TILLING
platform of a European temperate japonica accession. The
Volano variety has various agronomic traits that may benefit
to be improved, including plant height, the duration of
the growth cycle, and the resistance to biotic (blast disease)
and abiotic (growth in water-limited conditions) stresses.
To create the TILLING population EMS was chosen
as a mutagenic agent, which has been used to create mutant
collections of rice and other cereal species. Different
mutagens can produce a different spectrum of mutations
and therefore different series of alleles. Gamma and fast
neutron irradiation have been shown to induce small (few
base pairs) and large (hundreds to thousands of base pairs)
deletions, respectively, and mainly result in gene knockout
(Li et al., 2001; Sato et al., 2006; Morita et al., 2009).
On the other hand, chemical mutagens such as EMS and
MNU typically induce SNPs randomly throughout the
genome (Henikoff and Comai, 2003; Cooper et al., 2008;
Suzuki et al., 2008). These point mutations lead to the
generation of a series of polymorphic alleles, including loss
of function, that provides a range of different phenotypes
with a potential use in crop improvement (Gilchrist and
Haughn, 2005). In rice, MNU-induced mutations have
been shown to occur at a rate two times higher (1/135 kb)
(Suzuki et al., 2008) than those obtained with EMS (1/300
kb) (Till et al., 2007). However, to obtain such a high
mutation frequency, the treatment with MNU requires
that the flowers are exposed to the mutagen rather than
the seeds (as for EMS), making the experimental procedure
less amenable to large-scale mutagenesis.
The density of one mutation every 373 kb estimated
in the Volano TILLING population described here, based
on a pilot screening of four target genes in 1152 M 2
lines,
was comparable to what has previously been obtained in
other rice EMS-mutagenized populations. This observed
rate is higher than that reported for the indica rice variety
IR64 (1/1000 kb) (Wu et al., 2005) and slightly lower
than that obtained in Nipponbare (1/300 kb) (Till et al.,
2007). However, this difference is likely to be due to the
higher dose of EMS (1.5%) used by Till et al. (2007) compared
to that used in this study (0.75%). Overall, the results
crop science, vol. 53, november–december 2013 www.crops.org 2557

obtained confirmed the efficiency of the mutagenic treatment
and the suitability of the Volano TILLING platform
as a source of new genetic variation in temperate japonica.
Besides the validation of the TILLING platform, the
present work provides genetic material that can be directly
exploited for the agronomic improvement of Volano.
Currently, one of the main objectives of the breeding programs
is the reduction in plant stature. Reduction in total
height has been shown to increase plant responses to N
inputs, resulting in a higher yield without culm elongation
and lodging problems (Ashikari et al., 2002). Moreover,
a shorter stature can be beneficial for the plant in terms
of tolerance to water-limited conditions, as reduced plant
height leads to a significant reduction of the area involved
in loss of water by transpiration, which represents one of
the main strategies of drought escape (Levitt, 1980).
In this study we identified three independent mutations
in the SD1 (semidwarf 1) gene, which in rice plays
a crucial role in determining plant height (Sasaki et al.,
2002). SD1 encodes a GA20-oxidase (GA20ox), a key
enzyme in the biosynthesis of gibberellins. In particular, it
catalyzes the sequential oxidation and elimination of C-20
in the GA biosynthetic pathway, providing a substrate for
the GA3b-hydroxylase (GA3ox) that catalyzes the last
step of the synthesis of active GAs (Hedden and Phillips,
2000). Two GA20ox genes (GA20ox-1 and GA20ox-2)
have been shown to be present in the rice genome (Monna
et al., 2002; Sasaki et al., 2002). GA20ox-1 is predominantly
expressed in unopened flowers and is necessary for
flowers to develop and fertilize normally (hence ensuring
yield) while GA20ox-2 (corresponding to SD1) is highly
expressed in the leaf blade and stems. This functional
redundancy explains why loss of SD1 function (and consequently
GA deficiency) can result in reduction of plant
height without seed yield being affected (Monna et al.,
2002; Sasaki et al., 2002).
Two of the three mutations in the SD1 gene identified
in this study displayed a strong phenotypic effect, resulting
in a significant reduction (about 21% on average) of plant
height. The level of reduction in height is correlated with
the allelic status of the mutation, with a stronger effect
associated with the homozygous state when compared to
the heterozygote. Both the mutations were predicted to
affect protein activity: in the line M2_860, the premature
insertion of a stop codon generates an inactive truncated
GA20ox enzyme and therefore leaf- and stem-specific
reduced GA biosynthesis while the line M2_921 carried
a substitution of a highly conserved tyrosine, likely
to generate a loss of protein function. Unexpectedly, the
phenotypic effect on plant stature associated to the missense
mutation appeared to be slightly stronger than that
observed for the nonsense mutant. This observation would
deserve a thorough investigation to unravel the underlying
cellular and regulatory mechanisms.
Several sd1 alleles that cause semidwarfism in rice have
been described and used in breeding programs worldwide
to improve the agronomic performance of local varieties
(Asano et al., 2007). Dee-geo-woo-gen, the Chinese
semidwarf rice cultivar in which sd1 was first identified
and the derived high-yielding cultivar IR8 (IRRI, 1967),
the first Green Revolution rice variety, carry the same sd1
allele harboring a 383-bp deletion from exon 1 to exon 2
that originates a stop codon (Monna et al., 2002, Sasaki et
al., 2002). An independent deletion of 280 bp was found
in the coding region of SD1 in the indica semidwarf variety
Doongara (Spielmeyer et al., 2002). In addition, several
point mutations occurring at different positions in the
SD1 coding sequence were shown to cause single amino
acid substitutions resulting in semidwarfism, as found in the
japonica semidwarf varieties Jikkoku, Reimei, and Calrose
76 (Spielmeyer et al., 2002). The two sd1 mutants identified
in the Volano TILLING population described here represent
valuable genetic material for breeding programs to
enhancing yield performance and adaptation to changing
climatic conditions (water scarcity during the plant maturation
stage) of European temperate japonica rice varieties.
Rice is a short day plant exhibiting a high level of
natural variation in flowering time that contributed to
its adaptation to grow in a wide range of different environments
while maintaining yield production. The Hd1
(Heading date-1) gene targeted for TILLING screening in
this study plays a key role in rice by determining flowering
time (Yano et al., 2000; Tsuji et al., 2011) and hence
represents a good candidate to study the genetic components
involved in controlling growth cycle duration in
European temperate japonica rice. A short basic vegetative
growth phase, together with a low sensitivity to photoperiod,
are the most important traits determining the adaptability
of rice varieties to cultivation at high latitudes,
such as Italy and south Europe in general (Okumoto et al.,
1996; Ichitani et al., 1997). Moreover, as with plant height
reduction, reducing the growth cycle also represents an
effective strategy for drought escaping (Levitt, 1980). In
wheat and barley, shortening the crop life-cycle duration
has been shown to be an effective breeding strategy to
reduce water consumption (Cattivelli et al., 2008).
Allelic diversity at the Hd1 locus was demonstrated
to be one of the major determinants of flowering time
variation in cultivated rice (Takahashi et al., 2009). The
TILLING screening of the Volano population yielded one
missense mutation in the Hd1 coding sequence that was
predicted to affect protein function although no significant
phenotypic variation in growth cycle duration was revealed
in the progeny. These preliminary results may indicate that
the missense mutation does not affect the protein function
or that Hd1 is not the most relevant gene involved in controlling
the life cycle duration in European temperate japonica
germplasm. The photoperiodic control of flowering in
2558 www.crops.org crop science, vol. 53, november–december 2013

ice involves a complex network of genes (reviewed in Tsuji
et al., 2011) and variation at other important regulators is
expected also to contribute at determining adaptation of
rice cultivars to high-latitude climate regions (Xue et al.,
2008; Takahashi et al., 2009). The isolation of additional
natural or induced Hd1 mutants from European rice accessions
will clarify the role of Hd1 in regulating the growth
cycle in temperate areas.
A rapid and effective stomatal closure in a crop is considered
a positive trait for the improvement of water use
efficiency in drought conditions (Sinclair and Muchow,
2001). A previous study in A. thaliana reported the cloning
of a quantitative trait locus regulating transpiration
efficiency while maintaining biomass production, hence
uncoupling the usually negative association between transpiration
efficiency and both stomatal conductance and
biomass production (Masle et al., 2005). Based on this
finding the SNAC1 gene, which has been shown to be
involved in stomatal closure mechanisms in the early stages
of drought stress (Hu et al., 2006), was selected as a target
for TILLING screening of the Volano mutagenized population.
Three independent M 2
lines carrying missense
mutations in the NAC domain of the SNAC1 gene were
identified and the M 3
progeny plants will be evaluated
in water-limited conditions in the next growing season.
A “positive” phenotypic effect would be predicted only
in case a gain-of-function mutation occurred, causing an
altered expression of the gene that constitutively activates
it. However, those kinds of mutations are expected to
occur more frequently in regulatory rather than coding
regions, where loss of function mutations are more probable
to take place. In this sense, the next experiment to be
undertaken would be the screening for mutations in the
regulatory sequence of SNAC1.
A quality trait of rice that is highly appreciated both
in Asian and European countries is the presence of aromatic
compounds leading to scented rice grains. The
major gene for grain fragrance ( fgr) encodes the enzyme
BADH2, inactivation of which leads to the accumulation
of the precursor 2-AP that releases the typical “basmatilike”
perfume (Bradbury et al., 2005). One single base
substitution in the BADH2 gene was identified in the
Volano TILLING population causing a missense mutation.
The point mutation identified differs from all the
polymorphisms described so far that have been shown to
impair the enzymatic function, leading to the fragrant
phenotype (Kovach et al., 2009), and does not affect the
functional NAD-binding domain.
In this work we have shown that TILLING, based on
classical mutagenesis to create new genetic variation without
the use of transgenic technologies, represents a powerful
technique for crop improvement that can be applied to
temperate japonica rice grown in European areas. The initial
screening of the EMS-mutagenized Volano collection
identified a number of mutations in agronomically and
quality relevant genes that can provide genetic material of
direct use in marker-assisted breeding programs.
The validated Volano TILLING EMS-mutagenized
population represents a valuable tool to assess the function
of candidate genes in controlling target traits of high
relevance for cultivation of rice in temperate areas, such as
disease resistance, abiotic stress tolerance, and nutritional
properties of the rice seeds. The use of next generation
sequencing (NGS) approaches will facilitate the discovery
of mutants in a large set of candidate genes (Rigola et
al., 2009; Tsai et al., 2011). In the future, NGS technologies
will also facilitate the resequencing of mutagenized
lines showing phenotypes of relevance in agronomic and
quality traits (forward genetics) to identify novel but yet
unknown genetic components.
Supplemental Information Available
Supplemental material is available at http://www.crops.
org/publications/cs.
Acknowledgments
We would like to thank Prof. Chun-Ming Liu for sharing the EMS
mutagenesis protocol and Dr. Laura Rossini and Dr. John Williams
for critical reading of the manuscript. This work was financially
supported by the Italian Ministry of Agriculture, Food and Forestry
Policies within the framework of the project VALORYZA (D.M.
301/7303/2006), by the CARIPLO Foundation within the
DRYRICE project (2008-3179) and by the AGER Foundation
within the RISINNOVA project (2010-2369). Laura Casella was
supported by a fellowship from the Consiglio per la Ricerca e la
Sperimentazione in Agricoltura within a PhD program on Plant
Biology and Crop Production (University of Milano, Italy).
References
Alonso, J.M., and J.R. Ecker. 2006. Moving forward in reverse:
Genetic technologies to enable genome-wide phenomic
screens in Arabidopsis. Nat. Rev. Genet. 7(7):524–536.
doi:10.1038/nrg1893
An, G., D.H. Jeong, K.H. Jung, and S. Lee. 2005. Reverse genetic
approaches for functional genomics of rice. Plant Mol. Biol.
59(1):111–123. doi:10.1007/s11103-004-4037-y
Asano, K., T. Takashi, K. Miura, Q. Qian, H. Kitano, M. Matsuoka,
and M. Ashikari. 2007. Genetic and molecular analysis
of utility of sd1 alleles in rice breeding. Breed. Sci. 57:53–58.
doi:10.1270/jsbbs.57.53
Ashikari, M., A. Sasaki, M. Ueguchi-Tanaka, H. Itoh, A.
Nishimura, S. Datta, K. Ishiyama, T. Saito, M. Kobayashi,
G.S. Khush, H. Kitano, and M. Matsuoka. 2002. Loss-offunction
of a rice gibberellin biosynthetic gene, GA20 oxidase
(GA20ox-2), led to the rice “Green Revolution.” Breed.
Sci. 52:143–150. doi:10.1270/jsbbs.52.143
Blomstedt, C.K., R.M. Gleadow, N. O’Donnell, P. Naur, K.
Jensen, T. Laursen, C.E. Olsen, P. Stuart, J.D. Hamill,
B.L. Møller, and A.D. Neale. 2012. A combined biochemical
screen and TILLING approach identifies mutations in
crop science, vol. 53, november–december 2013 www.crops.org 2559

Sorghum bicolor L. Moench resulting in acyanogenic forage
production. Plant Biotechnol. J. 10:54–66. doi:10.1111/j.1467-
7652.2011.00646.x
Bradbury, L.M.T., T.L. Fitzgerald, R.J. Henry, Q. Jin, and D.L.E.
Waters. 2005. The gene for fragrance in rice. Plant Biotechnol.
J. 3:363–370. doi:10.1111/j.1467-7652.2005.00131.x
Caldwell, D.G., N. McCallum, P. Shaw, G.J. Muehlbauer,
D.F. Marshall, and R. Waugh. 2004. A structured mutant
population for forward and reverse genetics in barley
(Hordeum vulgare L.). Plant J. 40:143–150. doi:10.1111/j.1365-
313X.2004.02190.x
Cattivelli, L., F. Rizza, F.-W. Badeck, E. Mazzucotelli, A.M. Mastrangelo,
E. Francia, C. Marè, A. Tondelli, and A.M. Stanca.
2008. Drought tolerance improvement in crop plants: An
integrated view from breeding to genomics. Field Crops Res.
105:1–14. doi:10.1016/j.fcr.2007.07.004
Chen, S., Y. Yang, W. Shi, Q. Ji, F. He, Z. Zhang, Z. Cheng,
X. Liu, and M. Xu. 2008. Badh2, encoding betaine aldehyde
dehydrogenase, inhibits the biosynthesis of 2-acetyl-
1-pyrroline, a major component in rice fragrance. Plant Cell
20:1850–1861. doi:10.1105/tpc.108.058917
Chen, Q., Q. Wang, L. Xiong, and Z. Lou. 2011. A structural
view of the conserved domain of rice stress-responsive NAC1.
Protein Cell 2:55–63. doi:10.1007/s13238-011-1010-9
Cooper, J.L., B.J. Till, R.G. Laport, M.C. Darlow, J.M. Kleffner,
A. Jamai, T. El-Mellouki, S. Liu, R. Ritchie, N. Nielsen,
K.D. Bilyeu, K. Meksem, L. Comai, and S. Henikoff. 2008.
TILLING to detect induced mutations in soybean. BMC
Plant Biol. 8:9. doi:10.1186/1471-2229-8-9
Courtois, B., J. Frouin, R. Greco, G. Bruschi, G. Droc, C. Hamelin,
M. Ruiz, G. Clément, J.-C. Evrard, S. van Coppenole,
D. Katsantonis, M. Oliveira, S. Negrão, C. Matos, S. Cavigiolo,
E. Lupotto, P. Piffanelli, and N. Ahmadi. 2012. Genetic
diversity and population structure in a European collection
of rice. Crop Sci. 52:1663. doi:10.2135/cropsci2011.11.0588
Dahmani-Mardas, F., C. Troadec, A. Boualem, S. Lévêque, A.A.
Alsadon, A.A. Aldoss, C. Dogimont, and A. Bendahmane.
2010. Engineering melon plants with improved fruit shelf
life using the TILLING approach. PLoS ONE 5(12):E15776.
doi:10.1371/journal.pone.0015776
Dierking, E.C., and K.D. Bilyeu. 2009. New sources of soybean
seed meal and oil composition traits identified through TILL-
ING. BMC Plant Biol. 9:89. doi:10.1186/1471-2229-9-89
Ente Nazionale Risi. 2011. Rice statistics. Ente Nazionale Risi,
Milan, Italy. http://www.enterisi.it/upload/enterisi/bilanci/
ST1BIS%202011%20provvisorio_15916_74.pdf (accessed 30
Mar. 2013).
Ente Nazionale Risi. 2012a. Rice provisional statistics. Ente
Nazionale Risi, Milan, Italy. http://www.enterisi.it/upload/
enterisi/documentiallegati/St1bis_13660_59.pdf (accessed 30
Mar. 2013).
Ente Nazionale Risi. 2012b. Volano. Ente Nazionale Risi, Milan, Italy.
http://www.enterisi.it/upload/enterisi/gestionedocumentale/
volano_784_2283.pdf (accessed 30 Mar. 2013).
Faivre-Rampant, O., G. Bruschi, P. Abbruscato, S. Cavigiolo, A.M.
Picco, L. Borgo, E. Lupotto, and P. Piffanelli. 2010. Assessment
of genetic diversity in Italian rice germplasm related to
agronomic traits and blast resistance (Magnaporthe oryzae). Mol.
Breed. 27:233–246. doi:10.1007/s11032-010-9426-0
FAO. 2010. FAOSTAT – Crops. FAO, Rome, Italy. http://faostat.
fao.org/site/567/default.aspx#ancor (accessed 18 Dec. 2012).
Garris, A.J., T.H. Tai, J. Coburn, S. Kresovich, and S. McCouch.
2005. Genetic structure and diversity in Oryza sativa L.
Genetics 169:1631–1638. doi:10.1534/genetics.104.035642
Gilchrist, E.J., and G.W. Haughn. 2005. TILLING without
a plough: A new method with applications for reverse
genetics. Curr. Opin. Plant Biol. 8:211–215. doi:10.1016/j.
pbi.2005.01.004
Gilchrist, E.J., and G.W. Haughn. 2010. Reverse genetics techniques:
Engineering loss and gain of gene function in plants.
Briefings Funct. Genomics 9:103–110. doi:10.1093/bfgp/elp059
Greene, E.A., C.A. Codomo, N.E. Taylor, J.G. Henikoff, B.J. Till,
S.H. Reynolds, L.C. Enns, C. Burtner, J.E. Johnson, A.R.
Odden, L. Comai, and S. Henikoff. 2003. Spectrum of chemically
induced mutations from a large-scale reverse-genetic
screen in Arabidopsis. Genetics 164:731–740.
Hedden, P., and A.L. Phillips. 2000. Gibberellin metabolism: New
insights revealed by the genes. Trends Plant Sci. 5:523–530.
doi:10.1016/S1360-1385(00)01790-8
Henikoff, S., and L. Comai. 2003. Single-nucleotide mutations for
plant functional genomics. Annu. Rev. Plant Biol. 54:375–
401. doi:10.1146/annurev.arplant.54.031902.135009
Hu, H., M. Dai, J. Yao, B. Xiao, X. Li, Q. Zhang, and L. Xiong.
2006. Overexpressing a NAM, ATAF, and CUC (NAC) transcription
factor enhances drought resistance and salt tolerance
in rice. Proc. Natl. Acad. Sci. USA 103(35):12987–12992.
Ichitani, K., Y. Okumoto, and T. Tanisaka. 1997. Photoperiod
sensitivity gene of Se-1 locus found in photoperiod insensitive
rice cultivars of the northern limit region of rice cultivation.
Breed. Sci. 47:145–152.
IRRI. 1967. Annual report 1966. International Rice Research
Institute, Los Baños, Philippines. p. 59–82.
Julio, E., F. Laporte, S. Reis, C. Rothan, and F. Dorlhac de
Borne. 2007. Reducing the content of nornicotine in tobacco
via targeted mutation breeding. Mol. Breed. 21:369–381.
doi:10.1007/s11032-007-9138-2
Koornneef, M. 2002. Classical mutagenesis in higher plants. In:
P.M. Gilmartin and C. Bowler, editors, Molecular plant biology.
Vol. 1. Oxford Univ. Press, Oxford, UK. p. 1–11.
Kovach, M.J., M.N. Calingacion, M.A. Fitzgerald, and S.R.
McCouch. 2009. The origin and evolution of fragrance in rice
(Oryza sativa L.). Proc. Natl. Acad. Sci. USA 106(34):14444–
14449. doi:10.1073/pnas.0904077106
Krishnan, A., E. Guiderdoni, G. An, Y.C. Hsing, C. Han, M.C.
Lee, S.-M. Yu, N. Upadhyaya, S. Ramachandran, Q. Zhang,
V. Sundaresan, H. Hirochika, H. Leung, and A. Pereira. 2009.
Mutant resources in rice for functional genomics of the grasses.
Plant Physiol. 149:165–170. doi:10.1104/pp.108.128918
Kumar, P., S. Henikoff, and P.C. Ng. 2009. Predicting the effects
of coding non-synonymous variants on protein function using
the SIFT algorithm. Nat. Protoc. 4:1073–1081. doi:10.1038/
nprot.2009.86
Kuromori, T., S. Takahashi, Y. Kondou, K. Shinozaki, and M.
Matsui. 2009. Phenome analysis in plant species using lossof-function
and gain-of-function mutants. Plant Cell Physiol.
50(7):1215–1231. doi:10.1093/pcp/pcp078
Kurowska, M., A. Daszkowska-Golec, D. Gruszka, M. Marzec,
M. Szurman, I. Szarejko, and M. Maluszynski. 2011. TILL-
ING: A shortcut in functional genomics. J. Appl. Genet.
52(4):371–390. doi:10.1007/s13353-011-0061-1
Levitt, J. 1980. Responses of plants to environmental stresses, Vol.
2. Water, radiation, salt and other stresses. Academic Press,
New York, NY. p. 93–128.
2560 www.crops.org crop science, vol. 53, november–december 2013

Li, X., Y. Song, K. Century, S. Straight, P. Ronald, X. Dong,
M. Lassner, and Y. Zhang. 2001. A fast neutron deletion
mutagenesis-based reverse genetics system for plants. Plant J.
27:235–242. doi:10.1046/j.1365-313x.2001.01084.x
Lu, J.J., and T.T. Chang. 1980. Rice in its temporal and spatial
perspectives. In: B.S. Luh, editor, Rice: Production and utilization.
AVI Publishing Co., Westport, CT. p. 1–74.
Masle, J., S.R. Gilmore, and G.D. Farquhar. 2005. The ERECTA
gene regulates plant transpiration efficiency in Arabidopsis.
Nature 436(7052):866–870. doi:10.1038/nature03835
McCallum, C.M., L. Comai, E.A. Greene, and S. Henikoff. 2000.
Targeting induced local lesions in genomes (TILLING) for
plant functional genomics. Plant Physiol. 123:439–442.
doi:10.1104/pp.123.2.439
Mantegazza, R., M. Biloni, F. Grassi, B. Basso, B.-R. Lu, X.X.
Cai, F. Sala, and A. Spada. 2008. Temporal trends of variation
in Italian rice germplasm over the past two centuries
revealed by AFLP and SSR markers. Crop Sci. 48:1832–1840.
doi:10.2135/cropsci2007.09.0532
Minoia, S., A. Petrozza, O. D’Onofrio, F. Piron, G. Mosca, G.
Sozio, F. Cellini, A. Bendahmane, and F. Carriero. 2010.
A new mutant genetic resource for tomato crop improvement
by TILLING technology. BMC Res. Notes 3:69.
doi:10.1186/1756-0500-3-69
Monna, L., N. Kitazawa, R. Yoshino, J. Suzuki, H. Masuda, Y.
Maehara, M. Tanji, M. Sato, S. Nasu, and Y. Minobe. 2002.
Positional cloning of rice semidwarfing gene, sd-1: Rice
“green revolution gene” encodes a mutant enzyme involved
in gibberellin synthesis. DNA Res. 9:11–17. doi:10.1093/
dnares/9.1.11
Morita, R., M. Kusaba, S. Iida, H. Yamaguchi, T. Nishio, and
M. Nishimura. 2009. Molecular characterization of mutations
induced by gamma irradiation in rice. Genes Genet. Syst.
84:361–370. doi:10.1266/ggs.84.361
Muth, J., S. Hartje, R.M. Twyman, H.-R. Hofferbert, E. Tacke,
and D. Prüfer. 2008. Precision breeding for novel starch variants
in potato. Plant Biotechnol. J. 6:576–584. doi:10.1111/
j.1467-7652.2008.00340.x
Nieto, C., F. Piron, M. Dalmais, C.F. Marco, E. Moriones, M.L.
Gómez-Guillamón, V. Truniger, P. Gómez, J. Garcia-Mas,
M.A. Aranda, and A. Bendahmane. 2007. EcoTILLING for
the identification of allelic variants of melon eIF4E, a factor
that controls virus susceptibility. BMC Plant Biol. 7:34.
doi:10.1186/1471-2229-7-34
Okabe, Y., E. Asamizu, T. Saito, C. Matsukura, T. Ariizumi, C. Brès,
C. Rothan, T. Mizoguchi, and H. Ezura. 2011. Tomato TILL-
ING technology: Development of a reverse genetics tool for the
efficient isolation of mutants from Micro-Tom mutant libraries.
Plant Cell Physiol. 52:1994–2005. doi:10.1093/pcp/pcr134
Okumoto, Y., K. Ichitani, H. Inoue, and T. Tanisaka. 1996. Photoperiod
insensitivity gene essential to the varieties grown in
the northern limit region of paddy rice (Oryza sativa L.) cultivation.
Euphytica 92:63–66. doi:10.1007/BF00022829
Ouyang, S., W. Zhu, J. Hamilton, H. Lin, M. Campbell, K.
Childs, F. Thibaud-Nissen, R.L. Malek, Y. Lee, L. Zheng,
J. Orvis, B. Haas, J. Wortman, and C.R. Buell. 2007. The
TIGR rice genome annotation resource: Improvements and
new features. Nucleic Acid Res. 35(Database Issue):D846–
D851. doi:10.1093/nar/gkl976
Piron, F., M. Nicolaï, S. Minoïa, E. Piednoir, A. Moretti, A. Salgues,
D. Zamir, C. Caranta, and A. Bendahmane. 2010. An
induced mutation in tomato eIF4E leads to immunity to two
potyviruses. PLoS ONE 5(6):E11313. doi:10.1371/journal.
pone.0011313
Putterill, J., F. Robson, K. Lee, R. Simon, and G. Coupland. 1995.
The CONSTANS gene of Arabidopsis promotes flowering
and encodes a protein showing similarities to zinc finger
transcription factors. Cell 80:847–857. doi:10.1016/0092-
8674(95)90288-0
Rashid, M., G. He, Y. Guanxiao, and Z. Khurram. 2011. Relevance
of tilling in plant genomics. Aust. J. Crop Sci. 5:411–420.
Rigola, D., J. van Oeveren, A. Janssen, A. Bonné, H. Schneiders,
H.J. a van der Poel, N.J. van Orsouw, R.C.J. Hogers,
M.T.J. de Both, and M.J.T. van Eijk. 2009. High-throughput
detection of induced mutations and natural variation using
KeyPoint technology. PLoS ONE 4(3):E4761. doi:10.1371/
journal.pone.0004761
Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for
general users and for biologist programmers. Methods Mol.
Biol. 132:365–386.
Sasaki, A., M. Ashikari, M. Ueguchi-Tanaka, H. Itoh, A.
Nishimura, D. Swapan, K. Ishiyama, T. Saito, M. Kobayashi,
G.S. Khush, H. Kitano, and M. Matsuoka. 2002. Green Revolution:
A mutant gibberellin-synthesis gene in rice. Nature
416(6882):701–702. doi:10.1038/416701a
Sato, Y., K. Shirasawa, Y. Takahashi, M. Nishimura, and T. Nishio.
2006. Mutant selection from progeny of gamma-ray-irradiated
rice by DNA heteroduplex cleavage using Brassica petiole
extract. Breed. Sci. 56:179–183. doi:10.1270/jsbbs.56.179
Sinclair, T.R., and R.C. Muchow. 2001. System analysis of plant
traits to increase grain yield on limited water supplies. Agron.
J. 93:263. doi:10.2134/agronj2001.932263x
Slade, A.J., C. McGuire, D. Loeffler, J. Mullenberg, W. Skinner,
G. Fazio, A. Holm, K.M. Brandt, M.N. Steine, J.F. Goodstal,
and V.C. Knauf. 2012. Development of high amylose wheat
through TILLING. BMC Plant Biol. 12:69. doi:10.1186/1471-
2229-12-69
Small, I. 2007. RNAi for revealing and engineering plant gene
functions. Curr. Opin. Biotechnol. 18:148–153. doi:10.1016/j.
copbio.2007.01.012
SoftGenetics. 2010. Mutation Surveyor. DNA variant analysis
software. SoftGenetics LLC, State College, PA.
Spada, A., R. Mantegazza, M. Biloni, E. Caporali, and F. Sala.
2004. Italian rice varieties: Historical data, molecular markers
and pedigrees to reveal their genetic relationships. Plant
Breed. 123:105–111. doi:10.1046/j.1439-0523.2003.00950.x
Spielmeyer, W., M.H. Ellis, and P.M. Chandler. 2002. Semidwarf
(sd-1), “green revolution” rice, contains a defective gibberellin
20-oxidase gene. Proc. Natl. Acad. Sci. USA 99:9043–
9048. doi:10.1073/pnas.132266399
Suzuki, T., M. Eiguchi, T. Kumamaru, H. Satoh, H. Matsusaka, K.
Moriguchi, Y. Nagato, and N. Kurata. 2008. MNU-induced
mutant pools and high performance TILLING enable finding
of any gene mutation in rice. Mol. Genet. Genomics 279:213–
223. doi:10.1007/s00438-007-0293-2
Takahashi, Y., K.M. Teshima, S. Yokoi, H. Innan, and K. Shimamoto.
2009. Variations in Hd1 proteins, Hd3a promoters, and
Ehd1 expression levels contribute to diversity of flowering
time in cultivated rice. Proc. Natl. Acad. Sci. USA 106:4555–
4560. doi:10.1073/pnas.0812092106
Till, B.J., T. Colbert, C. Codomo, L. Enns, J. Johnson, S.H. Reynolds,
J.G. Henikoff, E.A. Greene, M.N. Steine, L. Comai,
and S. Henikoff. 2006. High-throughput TILLING for Arabidopsis.
Methods Mol. Biol. 323:127–135.
crop science, vol. 53, november–december 2013 www.crops.org 2561

Till, B.J., J. Cooper, T.H. Tai, P. Colowit, E.A. Greene, S.
Henikoff, and L. Comai. 2007. Discovery of chemically
induced mutations in rice by TILLING. BMC Plant Biol.
7:19. doi:10.1186/1471-2229-7-19
Triques, K., E. Piednoir, M. Dalmais, J. Schmidt, C. Le Signor,
M. Sharkey, M. Caboche, B. Sturbois, and A. Bendahmane.
2008. Mutation detection using ENDO1: Application to disease
diagnostics in humans and TILLING and Eco-TILLING
in plants. BMC Mol. Biol. 9:42. doi:10.1186/1471-2199-9-42
Tsai, H., T. Howell, R. Nitcher, V. Missirian, B. Watson, K.J. Ngo,
M. Lieberman, J. Fass, C. Uauy, R.K. Tran, A.A. Khan, V.
Filkov, T.H. Tai, J. Dubcovsky, and L. Comai. 2011. Discovery
of rare mutations in populations: TILLING by sequencing.
Plant Physiol. 156:1257–1268. doi:10.1104/pp.110.169748
Tsuji, H., K. Taoka, and K. Shimamoto. 2011. Regulation of flowering
in rice: Two florigen genes, a complex gene network,
and natural variation. Curr. Opin. Plant Biol. 14:45–52.
doi:10.1016/j.pbi.2010.08.016
Wang, T.L., C. Uauy, F. Robson, and B. Till. 2012. TILLING
in extremis. Plant Biotechnol. J. 10(7):761–772. doi:10.1111/
j.1467-7652.2012.00708.x
Wu, J.-L., C. Wu, C. Lei, M. Baraoidan, A. Bordeos, M.R.S.
Madamba, M. Ramos-Pamplona, R. Mauleon, A. Portugal,
V.J. Ulat, R. Bruskiewich, G. Wang, J. Leach, G. Khush, and
H. Leung. 2005. Chemical- and irradiation-induced mutants
of indica rice IR64 for forward and reverse genetics. Plant
Mol. Biol. 59:85–97. doi:10.1007/s11103-004-5112-0
Xue, W., Y. Xing, X. Weng, Y. Zhao, W. Tang, L. Wang, et al.
2008. Natural variation in Ghd7 is an important regulator of
heading date and yield potential in rice. Nat. Genet. 40:761–
767. doi:10.1038/ng.143
Yano, M., Y. Katayose, M. Ashikari, U. Yamanouchi, L. Monna, T.
Fuse, T. Baba, K. Yamamoto, Y. Umehara, Y. Nagamura, and
T. Sasaki. 2000. Hd1, a major photoperiod sensitivity quantitative
trait locus in rice, is closely related to the Arabidopsis
flowering time gene CONSTANS. Plant Cell 12:2473–2484.
You, J., W. Zong, X. Li, J. Ning, H. Hu, X. Li, J. Xiao, and L.
Xiong. 2013. The SNAC1-targeted gene OsSRO1c modulates
stomatal closure and oxidative stress tolerance by regulating
hydrogen peroxide in rice. J. Exp. Bot. 64:569–583.
doi:10.1093/jxb/ers349
2562 www.crops.org crop science, vol. 53, november–december 2013