Casella et al. - 2013 - TILLING in European Rice Hunting Mutations for Cr

More documents

Recommendations

Info

ecause of their failure to grow at northern latitudes, requiring long-day adaptation and cold tolerance, as well as of sterility barriers (Courtois et al., 2012). Due to environmental constraints and consumer tradition, which favor traditional risotto type rice, the Italian rice germplasm has a narrow genetic basis, which may benefit from the introduction of new sources of genetic variation. The targeting induced local lesions in genomes (TILL- ING) approach, combining classical mutagenesis (by chemical or physical agents) with a high-throughput screening method to detect the induced mutations, is a powerful technology that can be used to induce and characterize genetic variation. The TILLING approach was first developed in Arabidopsis thaliana (L.) Heynh. (McCallum et al., 2000) and since then has been successfully used in many other plant as well as animal species (reviewed in Kurowska et al., 2011; Rashid et al., 2011; Wang et al., 2012). Originally developed for functional genomics studies, as an alternative to transgenic approaches such as transfer DNA and transposon insertional mutagenesis or ribonucleic acid interference (An et al., 2005; Alonso and Ecker, 2006; Small, 2007; Krishnan et al., 2009; Gilchrist and Haughn, 2010; Kuromori et al., 2009), TILLING was shown to be also a valuable tool in crop breeding (Kurowska et al., 2011; Rashid et al., 2011; Wang et al., 2012). Among the various mutagenic agents, ethyl methane sulfonate (EMS) is mainly used in TILL- ING as it produces random mutations in genetic materials at a very high density (Koornneef, 2002). Thanks to its capability to create a wide spectrum of different mutations (missense, nonsense, and splice site) resulting in a diverse array of mutant alleles, EMS, in combination with a TILL- ING approach, can provide a range of different phenotypes that can be useful for breeding (Alonso and Ecker, 2006; Gilchrist and Haughn, 2005; Henikoff and Comai, 2003). Favorable mutations detected within a TILLING platform can be rather easily introgressed into different genetic backgrounds or TILLING itself can be developed into the genetic material of interest, as classical mutagenesis can be applied to any plant species (Henikoff and Comai, 2003). Several examples of the successful use of TILLING for crop improvement have been described in different plant species. Combining TILLING mutation discovery and conventional breeding, Slade et al. (2012) reported the creation of novel nontransgenic wheat [Triticum aestivum L. and Triticum turgidum L. subsp. durum (Desf.) Husn.] lines with high levels of amylose and resistant starch content, shown to have beneficial effects for the control of obesity and diabetes. Two mutants with altered seed oligosaccharide content (raffinose and stachyose in the first mutant and oleic and linoleic acid in the second), a phenotype desirable for cooking and industrial oils, were identified in a soybean [Glycine max (L.) Merr.] TILLING collection (Dierking and Bilyeu, 2009). The development of a TILLING platform in melon (Cucumis melo L.) allowed the identification of a mutant with a significantly improved shelf life due to an induced alteration in an ethylene biosynthetic enzyme (Dahmani-Mardas et al., 2010). In tomato (Solanum lycopersicum L.), TILLING led to the identification of two allelic mutations in an ethylene receptor gene, causing delayed fruit ripening and prolonged shelf life (Okabe et al., 2011). In addition, mutants for virus resistance in melon (Nieto et al., 2007) and tomato (Piron et al., 2010), starch in potato (Solanum tuberosum L.) (Muth et al., 2008), natural products in sorghum [Sorghum bicolor (L.) Moench] (Blomstedt et al., 2012), and nornicotine content in tobacco (Nicotiana tabacum L.) (Julio et al., 2007) have been described. The TILLING approach was also used to produce mutant collections in rice. The first rice TILLING platform was created in the indica variety IR64, the most widely grown cultivar in Southeast Asia (Wu et al., 2005). This large mutagenized M 2 population was obtained using different mutagenic agents but a low mutation density (1/1000 kb) was observed. Improvements of both the mutagenesis procedure and the screening method allowed a higher mutation density (1/300 kb) in a TILLING population to be achieved for the reference rice variety Nipponbare (Till et al., 2007). An even higher mutation density was achieved in the Taiwanese japonica rice cultivar Taichung 65 by treating pollinated flowers with N-methyl-N-nitrosourea (MNU) (Suzuki et al., 2008). However, so far no TILLING platform has been developed using genetic material adapted to grow in the temperate European pedoclimatic conditions. In this study we developed genetic variation in the temperate Oryza sativa subsp. japonica cultivar Volano. This variety was chosen as being representative of the traditional Italian high quality rice. Volano is one of the most widely cultivated and important Italian rice varieties, with a large internal market, and is exported worldwide as it belongs to the Arborio class, the most popular risotto type rice of the Long A grain class. In 2011, Volano was cultivated on 20.230 ha (Ente Nazionale Risi, 2011), representing 17% of the national growing area of risotto type rice. Volano is a tall variety (110 cm), which is a typical trait of traditional Italian rice varieties, and has a relatively long life cycle, consisting of 155 d from sowing to seed ripening. It has a moderate resistance to diseases, such as blast and a poor yield performance when grown in water-limited conditions (Ente Nazionale Risi, 2012b). Due to its valuable grain quality characteristics, Volano is of strategic relevance for ongoing breeding programs and surely will take advantage from the improvement of several traits, including shortening of the plant stature and of the growth cycle and improved resistance to biotic and abiotic stress conditions. A total of 1860 M 2 EMS mutagenized lines were generated and used for TILLING screening of four agronomically and quality relevant target genes. A mutation density of 1/373 kb was estimated, showing the effectiveness of this approach for targeted improvement of European temperate rice germplasm. crop science, vol. 53, november–december 2013 www.crops.org 2551
Table 1. Target genes and primers used for targeting induced local lesions in genomes (TILLING) analysis of the Volano ethyl methane sulfonate–mutagenized population. Gene Locus † Forward primer Reverse primer Amplicon size (bp) SD1 Os01g66100 acacacgctctcaactcactcc agcagaggagaacagaggagag 1081 Hd1 Os06g16370 gtccatgtggtgcaagctaaag cgtggcatgtagtaacaactaac 972 SNAC1 Os03g60080 cagcgagaagcaagcaagaag agcatcgatcaccacctgttc 1142 BADH2 Os08g32870 tgagaatcatgttcgggatg acaaagtcccgcacttcaga 840 † Referring to Michigan State University v.6.1 rice genome annotation (Ouyang et al., 2007). MATERIALS AND METHODS Mutagenesis and Plant Material Pure seed samples of O. sativa subsp. japonica ‘Volano’ (Ente Nazionale Risi, 2012b; Supplemental Table S1) were obtained by the breeding company Società Italiana Sementi (Bologna, Italy). Ethyl methane sulfonate mutagenesis was performed essentially as described by Till et al. (2007) with the following modifications. To evaluate the toxicity and/or lethality of the EMS treatment in Volano, a range of doses from 0.25 to 1.0% of EMS (liquid, product code M0880; Sigma-Aldrich) was first tested on batches of 200 seeds. Seedling survival decreased markedly at doses above 0.75%. The optimum dosage of 0.75%, which gave germination rates averaging 59% (untreated control displayed 95%), was hence applied. A total of 20,000 seeds were then treated in batches of 5000 seeds in 1 L flasks. After a presoaking for 18 h in 400 mL of tap water, seeds were treated with a solution of 0.75% EMS in 0.066 M phosphate buffer (Na 2 HPO 4 and KH 2 PO 4 ) at pH 7 for 24 h. After the EMS treatment, seeds were thoroughly washed over a period of 24 h, first with deionized water (three times for 30 minutes each time) and then with tap water (refreshed every hour for the first 5 h). All the 20,000 mutagenized seeds were dried with wet blotting paper and directly sown in the open field. The M 1 plants were grown according to standard paddy rice agronomic practices and harvested at maturity. Twenty M 2 seeds from each M 1 fertile line (approximately 2000) were sown in the field the following growing season. Of each M 2 line one single healthy M 2 plant was chosen, leaf samples were taken for DNA isolation, and the plants were bagged individually and allowed to grow to maturity. The DNA extraction was performed on a single fertile M 2 plant per line. From each selected M 2 plant, M 3 seeds were collected and stored at 4°C with 7 to 10% relative humidity to ensure their long-term viability. DNA Isolation and Pooling Strategy The DNA was isolated from lyophilized leaf tissue in 96-well plates with NucleoSpin Plant II (Macherey-Nagel GmbH & Co. KG), using a Tecan Freedom EVO150 liquid handling robot (Tecan Group Ltd.). Before pooling, the concentration of each sample was determined using the PicoGreen dsDNA (double-strand DNA) quantitation assay (Life Technologies Corp.) and normalized at a standard concentration of 2 ng μL –1 , to ensure that each sample was equally represented in the pool. Two-dimensional pooling (eightfold for columns and 12-fold for rows) was performed by combining all samples in shared rows and all samples in shared columns, so that each M 2 line was represented both in the eightfold and in the 12-fold pool. Primer Design Primers for the amplification of the target genes were designed from the Nipponbare genome sequence using CODDLE (Codons Optimized to Discover Deleterious LEsions) (http:// www.proweb.org/coddle; accessed 18 Dec. 2012) and Primer3 (Rozen and Skaletsky, 2000). The target genes and the selected primer sequences are listed in Table 1. Forward and reverse primers were 5¢-end labeled with 6FAM and VIC, respectively. Labeled and unlabeled oligonucleotides were purchased from Applied Biosystems (Life Technologies Corp.). TILLING Protocol The screening of induced mutations by TILLING was performed essentially as described by Till et al. (2006), with the following modifications. Polymerase chain reactions (PCRs) were performed in a final volume of 10 μL, using 2 μL of pooled genomic DNA and HotStarTaq Master Mix (Qiagen). Labeled and unlabeled primers were mixed in a 3:2 ratio, with a final concentration of 0.4 μM. Cycling was performed on a TProfessional thermocycler (Biometra GmbH) as follows: 95°C for 15 min; 35 cycles of 94°C for 1 min, melting temperature –5°C for 1 min, and 72°C for 1 min and 30 s; and 72°C for 10 min. For all the primer pairs an annealing temperature of 60°C was used. After amplification, PCR products were denatured and annealed to form heteroduplexes between complementary strands as follows: 94°C for 10 min and 90 cycles of 1 min from 94 to 4°C, decreasing by 1°C per cycle. Heteroduplexes were cleaved by digestion with the mismatch-specific endonuclease ENDO1 (Serial Genetics, Evry, France) (Triques et al., 2008), according to the manufacturer’s instructions. The reactions were performed in a final volume of 30 μL and incubated at 45°C for 20 min. The samples were then ethanol (CH 3 CH 2 OH) precipitated, rinsed with ethanol 70%, and resuspended in 12 μL of Hi-Di Formamide and 0.05 μL of GeneScan 1200 LIZ Size Standard (Applied Biosystems, Life Technologies Corp.). To identify the cleavage products resulting from heteroduplex mismatches, ENDO1-digested samples were loaded on an ABI3730 DNA sequencer (Applied Biosystems, Life Technologies Corp.) using a 96-capillary array with POP7 polymer. The output sequences were then analyzed using the software GeneMapper 4.0 (Applied Biosystems, Life Technologies Corp.). Validation of Mutations To confirm the mutations detected, PCR and conventional sequencing were performed on the individual M 2 DNA samples identified according to the two-dimensional pooling strategy. Polymerase chain reaction amplification was performed in a final volume of 10 μL, as previously described, except that only unlabeled primers were used and the cycling program 2552 www.crops.org crop science, vol. 53, november–december 2013
Page 1: Published August 26, 2013 RESEARCH
Page 5 and 6: Figure 1. Examples of morphological
Page 7 and 8: dioxigenases from other plant speci
Page 9 and 10: obtained confirmed the efficiency o
Page 11 and 12: Sorghum bicolor L. Moench resulting
Page 13: Till, B.J., J. Cooper, T.H. Tai, P.

Casella et al. - 2013 - TILLING in European Rice Hunting Mutations for Cr

Create successful ePaper yourself

Delete template?

Save as template?