Casella et al. - 2013 - TILLING in European Rice Hunting Mutations for Cr

Table 1. Target genes and primers used for targeting induced local lesions in genomes (TILLING) analysis of the Volano ethyl
methane sulfonate–mutagenized population.
Gene Locus † Forward primer Reverse primer Amplicon size (bp)
SD1 Os01g66100 acacacgctctcaactcactcc agcagaggagaacagaggagag 1081
Hd1 Os06g16370 gtccatgtggtgcaagctaaag cgtggcatgtagtaacaactaac 972
SNAC1 Os03g60080 cagcgagaagcaagcaagaag agcatcgatcaccacctgttc 1142
BADH2 Os08g32870 tgagaatcatgttcgggatg acaaagtcccgcacttcaga 840
†
Referring to Michigan State University v.6.1 rice genome annotation (Ouyang et al., 2007).
MATERIALS AND METHODS
Mutagenesis and Plant Material
Pure seed samples of O. sativa subsp. japonica ‘Volano’ (Ente Nazionale
Risi, 2012b; Supplemental Table S1) were obtained by the
breeding company Società Italiana Sementi (Bologna, Italy).
Ethyl methane sulfonate mutagenesis was performed essentially
as described by Till et al. (2007) with the following
modifications. To evaluate the toxicity and/or lethality of the
EMS treatment in Volano, a range of doses from 0.25 to 1.0%
of EMS (liquid, product code M0880; Sigma-Aldrich) was first
tested on batches of 200 seeds. Seedling survival decreased
markedly at doses above 0.75%. The optimum dosage of 0.75%,
which gave germination rates averaging 59% (untreated control
displayed 95%), was hence applied.
A total of 20,000 seeds were then treated in batches of 5000
seeds in 1 L flasks. After a presoaking for 18 h in 400 mL of tap
water, seeds were treated with a solution of 0.75% EMS in 0.066
M phosphate buffer (Na 2
HPO 4
and KH 2
PO 4
) at pH 7 for 24 h.
After the EMS treatment, seeds were thoroughly washed over
a period of 24 h, first with deionized water (three times for 30
minutes each time) and then with tap water (refreshed every
hour for the first 5 h). All the 20,000 mutagenized seeds were
dried with wet blotting paper and directly sown in the open
field. The M 1
plants were grown according to standard paddy
rice agronomic practices and harvested at maturity. Twenty M 2
seeds from each M 1
fertile line (approximately 2000) were sown
in the field the following growing season. Of each M 2
line one
single healthy M 2
plant was chosen, leaf samples were taken for
DNA isolation, and the plants were bagged individually and
allowed to grow to maturity. The DNA extraction was performed
on a single fertile M 2
plant per line. From each selected
M 2
plant, M 3
seeds were collected and stored at 4°C with 7 to
10% relative humidity to ensure their long-term viability.
DNA Isolation and Pooling Strategy
The DNA was isolated from lyophilized leaf tissue in 96-well
plates with NucleoSpin Plant II (Macherey-Nagel GmbH &
Co. KG), using a Tecan Freedom EVO150 liquid handling
robot (Tecan Group Ltd.). Before pooling, the concentration
of each sample was determined using the PicoGreen dsDNA
(double-strand DNA) quantitation assay (Life Technologies
Corp.) and normalized at a standard concentration of 2 ng μL –1 ,
to ensure that each sample was equally represented in the pool.
Two-dimensional pooling (eightfold for columns and 12-fold
for rows) was performed by combining all samples in shared
rows and all samples in shared columns, so that each M 2
line
was represented both in the eightfold and in the 12-fold pool.
Primer Design
Primers for the amplification of the target genes were designed
from the Nipponbare genome sequence using CODDLE
(Codons Optimized to Discover Deleterious LEsions) (http://
www.proweb.org/coddle; accessed 18 Dec. 2012) and Primer3
(Rozen and Skaletsky, 2000). The target genes and the
selected primer sequences are listed in Table 1. Forward and
reverse primers were 5¢-end labeled with 6FAM and VIC,
respectively. Labeled and unlabeled oligonucleotides were purchased
from Applied Biosystems (Life Technologies Corp.).
TILLING Protocol
The screening of induced mutations by TILLING was performed
essentially as described by Till et al. (2006), with the
following modifications. Polymerase chain reactions (PCRs)
were performed in a final volume of 10 μL, using 2 μL of
pooled genomic DNA and HotStarTaq Master Mix (Qiagen).
Labeled and unlabeled primers were mixed in a 3:2 ratio, with
a final concentration of 0.4 μM. Cycling was performed on a
TProfessional thermocycler (Biometra GmbH) as follows: 95°C
for 15 min; 35 cycles of 94°C for 1 min, melting temperature
–5°C for 1 min, and 72°C for 1 min and 30 s; and 72°C for 10
min. For all the primer pairs an annealing temperature of 60°C
was used. After amplification, PCR products were denatured
and annealed to form heteroduplexes between complementary
strands as follows: 94°C for 10 min and 90 cycles of 1 min from
94 to 4°C, decreasing by 1°C per cycle. Heteroduplexes were
cleaved by digestion with the mismatch-specific endonuclease
ENDO1 (Serial Genetics, Evry, France) (Triques et al., 2008),
according to the manufacturer’s instructions. The reactions
were performed in a final volume of 30 μL and incubated at
45°C for 20 min. The samples were then ethanol (CH 3
CH 2
OH)
precipitated, rinsed with ethanol 70%, and resuspended in 12
μL of Hi-Di Formamide and 0.05 μL of GeneScan 1200 LIZ
Size Standard (Applied Biosystems, Life Technologies Corp.).
To identify the cleavage products resulting from heteroduplex
mismatches, ENDO1-digested samples were loaded on an
ABI3730 DNA sequencer (Applied Biosystems, Life Technologies
Corp.) using a 96-capillary array with POP7 polymer. The
output sequences were then analyzed using the software GeneMapper
4.0 (Applied Biosystems, Life Technologies Corp.).
Validation of Mutations
To confirm the mutations detected, PCR and conventional
sequencing were performed on the individual M 2
DNA samples
identified according to the two-dimensional pooling strategy.
Polymerase chain reaction amplification was performed in
a final volume of 10 μL, as previously described, except that
only unlabeled primers were used and the cycling program
2552 www.crops.org crop science, vol. 53, november–december 2013