Virginia Nurses Today - November 2020

The Official Publication of the Virginia Nurses Foundation 

November 2020 Quarterly publication distributed to approximately 111,000 Registered Nurses 

Volume 28 • No. 4 

We are pleased to provide every registered nurse in Virginia with a copy of Virginia Nurses Today. 

For more information on the benefits of membership in of the Virginia Nurses Association, 

please visit www.virginianurses.com! 

2020 Fall Conference Recap 2021 Lobby Days 

The Perfect Holiday Gift 

Page 8 Page 10 

Page 10 

Page 21 

Telehealth and the Covid 19 Pandemic: 

Expansion of Access to Care 

Joyce A. Hahn, PhD, RN, NEA-BC, FNAP, 

FAAN 

Associate Professor George Washington 

University School of Nursing 

The COVID-19 pandemic has changed lives for all 

Americans. We found ourselves social distancing, 

purchasing masks, and only leaving the house as 

essential workers, for a supermarket visit, or for 

emergencies. We began connecting with family 

members and workers via Zoom meetings. Hospitals 

were straining with coronavirus admissions and 

local healthcare access became almost nonexistent 

with closed clinics and offices. Telehealth moved to 

the forefront of patient access to care as government 

and payer resistance coupled with Health Insurance 

Portability and Accountability Act (HIPPAA) patient 

privacy restrictions shifted in acceptance and 

reimbursement. 

Federal legislative support and waivers for 

telehealth 

The three congressional stimulus bills together 

with the Centers for Medicare & Medicaid Services 

(CMS) issued waivers to ensure flexibility during 

the COVID-19 public health emergency for access 

to care and reimbursement parity between in 

person visits and telehealth. The U.S. Department 

of Health and Human Services (HHS) took the 

unprecedented step of relaxing HIPAA requirements 

during the pandemic allowing healthcare providers 

to communicate with patients via non-public facing 

remote communication products to include Apple 

FaceTime, Facebook Messenger video chat, Skype, 

Zoom, Whatsapp video chat, and Google Hangouts 

video (https://www.hhs.gov/sites/default/files/ 

telehealth-faqs-508.pdf). 

The CARES Act expanded telehealth coverage 

for Medicare, Federally Qualified Health Centers 

(FQHC) and the Veterans Administration (VA). The 

U.S. Department of Veteran Affairs has expanded 

SAVE the DATE! 

Virtual Gala 

December 5th 

its large telehealth program during the pandemic 

(https://telehealth.va.gov/ ). Tricare covers the use 

of videoconferencing via computer or smartphone 

after obtaining the necessary referral and 

authorization. Audio-only telemedicine visits are 

temporarily covered during the COVID-19 pandemic 

(https://tricare.mil/CoveredServices/IsItCovered/ 

Telemedicine). The Department of Veteran Affairs 

and the Department of Defense (DOD) have 

expanded telehealth services for veterans, active 

military and their families. 

CMS has issued telehealth policy waivers during 

the coronovaris pandemic. These temporary waivers 

allow Medicare, Medicaid, and the Children’s 

Health Insurance Program (CHIP) patients to utilize 

telehealth for medical care in their homes during 

the COVID- 19 public health emergency (https:// 

www.hhs.gov/coronavirus/telehealth/index.html). 

FQHCs and Rural Health Clinics (RHCs) are able 

to provide telehealth services for patients at home 

(https://www.hhs.gov/coronavirus/telehealth/index. 

html). 

Private insurance companies to include Aetna, 

Cigna, and Blue Cross Blue Shield are covering 

telehealth via phone or videoconferencing via phone 

during the pandemic (https://www.aetna.com/ 

individuals-families/member-rights-resources/ 

covid19.html, https://www.bcbs.com/coronavirusupdates, 

https://www.cigna.com/coronavirus/). 

Telehealth barriers for older patients 

The risk of becoming seriously ill with COVID-19 

is high for people 65 years and older. A recent 

Kaiser Family Foundation poll reported that only 

7 in 10 adults age 65 or older (68%) report having 

Virginia Nurse Jay 

Douglas Appointed 

President of NCSBN 

Board of Directors 

Jay Douglas, MSM, 

RN, CSAC, FRE, executive 

director of the Virginia 

Board of Nursing, is the 

new president of the 

National Council of State 

Boards of Nursing (NCSBN) 

Board of Directors (BOD). 

following the resignation 

of former president 

Jim Cleghorn. Douglas 

previously held the position 

of president-elect. She will serve as NCSBN BOD 

president for the remainder of Cleghorn’s term and 

will then serve her elected term. 

“I am humbled and honored to be serving as 

the president of NCSBN, an amazing organization 

leading in nursing regulatory excellence worldwide. 

I am sure that the next four years will fly by as the 

last two months have. Through the interactions and 

collaborative work with NCSBN nurse regulatory 

board colleagues, NCSBN staff, professional 

association, education and practice partners in 

the US and around the world there is a unique 

opportunity to be a part of advancing nursing and 

nursing regulation,” said Douglas. 

Douglas has been the executive director of 

the Virginia Board of Nursing since 2002. In 

this position, she oversees the regulation of 

approximately 225,000 license, certificate and 

Telehealth continued on page 9 Jay Douglas continued on page 6 

current resident or 

Non-Profit Org. 

U.S. Postage Paid 

Princeton, MN 

Permit No. 14

Page 2 | November, December 2020, January 2021 

VNF President's Message 

Virginia Nurses Today | www.VirginiaNurses.com 

Have You Considered Serving 

on a Board? 

As president of the Virginia Nurses Foundation 

(VNF), and a registered nurse, I have grown to 

understand the importance and value of serving 

on a board. An organization’s board determines 

the strategic direction and at times, the structure 

of the organization. In this time of such medical 

and healthcare uncertainty, we as nurses and 

the nursing profession must ask what else can 

we do to ensure that decisions are being made 

that will promote the health of our communities 

and the nation as a whole, especially considering 

the challenges of the COVID-19 pandemic. This 

is an excellent time for nurses to pursue and be 

considered for service on boards and any other 

bodies that are involved and engaged in healthcare 

decisions or delivery. 

In 2010 the Institute of Medicine (IOM) released 

the report “The Future of Nursing: Leading Change, 

Advancing Health,” which was the result of a twoyear 

study IOM completed with the Robert Wood 

Johnson Foundation to “assess and transform 

the nursing profession.” A key message of the IOM 

report was “Nurses should be full partners, with 

physicians and other healthcare professionals 

in redesigning healthcare in the United States” 

(IOM 2010). When put into layman’s terms, 

that key message is encouraging nurses to be 

actively involved with healthcare partners in the 

development and evolution of healthcare policy, not 

sitting back and waiting to be told the direction of 

the newly developed policy. The reality is nursing 

is the largest healthcare profession and has 

been consistently identified as the most trusted 

profession by the Gallup poll (Brenan 2018). It 

makes perfect sense for nurses to have a voice 

in this arena and they should be encouraged to 

actively seek opportunities to serve on boards, 

commissions, and advisory panels where decisions 

are made to advance healthcare policy and 

direction. 

A direct response to the IOM report was the 

evolution of the “Nurses on Boards Coalition 

(NOBC)” with initial generous funding support from 

the Robert Wood Johnson Foundation. As NOBC 

promotes and encourages nurses to actively pursue 

engagement on boards, they also emphasize it is 

important to recognize that being asked to serve 

on a board is truly a responsibility and an honor. It 

may not necessarily be about your clinical practice, 

but rather about your knowledge, skills, abilities, 

and experience to help shape strategic influence, 

direction, and policies in healthcare and healthcare 

delivery. 

There are not only many opportunities for 

nurses to serve, but there is a broad range of 

boards that would benefit from the nurse’s 

perspective. Currently, not only do I serve on the 

VNF Foundation Board of Trustees, but I am also 

the nurse representative serving on the board of the 

Society for Disaster Medicine and Public Health. I 

also serve on the Eastern 

Shore of Virginia (ESVA) 

Chamber of Commerce 

Board, where I previously 

held the role of Chair. 

Terris Kennedy, 

PhD, RN 

Sharing a personal experience and perspective as 

a hospital Chief Nursing Officer and subsequently a 

healthcare system Chief Nursing Officer, I attended 

and served on both boards and was considered 

not only a resource, but an active participant in 

the boards’ activities for strategic planning for the 

development and pursuit of optimal health and 

patient care delivery. This was also an opportunity 

for me to demonstrate and highlight the importance 

and value nursing brings to the healthcare team. 

Nursing had a voice in the boardroom, which is 

essential amid the complexities of healthcare 

delivery today. 

There is not an organization that can articulate 

the importance and value nurses bring to boards 

better than the Nurses on Boards Coalition. They 

are at the forefront and are an excellent resource 

for nurses interested in serving. Their article in 

Nursing Economics “The Importance and Impact of 

Nurses Serving on Boards,” is a must read (Harper, 

Benson 2019). It is their goal to have 10,000 board 

seats filled by nurses by the end of 2020. 

I would like to share the summary of the “The 

Importance and Impact of Nurses Serving on 

Boards:” 

“Regardless of the level of education, background, 

or experience, there is a place on a board, 

commission, or appointment for every nurse. 

NOBC’s work does not end until the right nurse is 

serving on the right board where it creates strategic 

value to do so. Each appointment brings America 

one step closer to our collective goal of healthier 

communities and nation. Where will you choose to 

serve?” 

“Together, across America, nurses are leading 

change and making a difference by serving on 

all types of boards, commissions, panels, and 

appointments as we collectively improve the quality 

of life and health for all. Please join this important 

work.” 

I encourage each of you to register in the NOBC 

database located on the NOBC website www. 

nursesonboardscoalition.org to report your board 

service and/or indicate your interest in serving 

on your first board or an additional board. NOBC 

is eager to help you along your journey in board 

service. We also have a volunteer leadership position 

available for a nurse to serve as the Virginia liaison 

for the Nurses on Boards Coalition. Email VNA/ 

VNF CEO Janet Wall at jwall@virginianurses.com to 

learn more. 

References 

Harper, K. J., & Benson, L. S. (2019, August). The 

importance and impact of nurses serving on 

boards. Nursing Economics, 37(4), 209-212. 

is the official publication of the Virginia Nurses 

Foundation: 2819 N. Parham Road, Suite 230, 

Richmond, Virginia 23294, VNF’s affiliate, the 

Virginia Nurses Association, is a constituent of 

the American Nurses Association. 

www.VirginiaNurses.com 

admin@virginianurses.com 

Phone: 804-282-1808 

The opinions contained herein are those of the 

individual authors and do not necessarily 

reflect the views of the Foundation. 

Virginia Nurses Today reserves the 

right to edit all materials to its style 

and space requirements and to 

clarify presentations. 

VNF Mission Statement 

To support the advancement of nursing 

through recognition, research, and 

innovation. 

VNT Staff 

Janet Wall, Editor-in-Chief 

Kristin Jimison, Director of Engagement 

Elle Buck, Managing Editor 

Virginia Nurses Today is published quarterly 

every February, May, August and November 

by the Arthur L. Davis Publishing Agency, 

Inc. 

Copyright © 2020, ISSN #1084-4740 

Subscriber rates are available, 804-282- 

1808. 

For advertising rates and information, please 

contact Arthur L. Davis Publishing Agency, 

Inc., PO Box 216, Cedar Falls, Iowa 50613. 

(800) 626-4081, sales@aldpub.com. 

VNF and the Arthur L. Davis Publishing 

Agency, Inc. reserve the right to reject any 

advertisement. Responsibility for errors in 

advertising is limited to corrections in the 

next issue or refund of price of advertisement. 

Acceptance of advertising does not imply 

endorsement or approval by the Virginia 

Nurses Foundation of the products advertised, 

the advertisers or the claims made. Rejection 

of an advertisement does not imply that a 

product offered for advertising is without 

merit, or that the manufacturer lacks 

integrity, or that this association disapproves 

of the product or its use. VNF and the Arthur 

L. Davis Publishing Agency, Inc. shall not be 

held liable for any consequences resulting 

from purchase or use of advertisers’ products. 

Articles appearing in this publication express 

the opinions of the authors; they do not 

necessarily reflect views of the staff, board, or 

membership of VNF, or those of the national 

or local chapters. 

ADVANCE. LEAD. SERVE. 

It takes the best people to 

}} 

RN-BSN (online) 

}} 

MSN (hybrid) 

oo 

oo 

oo 

Family Nurse Practitioner 

Leadership/Education 

Psychiatric Mental Health Nurse Practitioner 

Post-graduate certificates also available in the above 

listed specializations. 

bluefield.edu/school-of-nursing 

myPotential at home is doing something fantastic! We are creating an amazing, genuine, and caring culture. 

Would you like to be a part of our We CARE team? We value our team members and strive to ensure they 

experience the same genuine CARE that we provide to our customers. Our team members embody the word 

CARE in every way—from serving seniors and families to interactions with one another. 

Our home care and home health Virginia clients are served in the following counties: Winchester, Clarke, 

Frederick, Shenandoah, Warren and Augusta. Our Maryland clients are served in Montgomery County. 

Registered Nurse (PRN) • Licensed Practical Nurse (PRN) • Certified Nursing Assistant (PRN) 

Personal Care Aide (Caregiver) (PRN) • Home Health Social Worker (PRN) • Physical Therapy (PRN) 

Physical Therapy Assistant (PRN) • Speech Therapist (PRN) 

EEO employer 

If you are interested in applying for a position, go to careers-nationallutheran.icims.com

www.VirginiaNurses.com | Virginia Nurses Today November, December 2020, January 2021 | Page 3 

President's Message 

A Look Back at 2020: The Year of the Nurse 

The year 2020 is a time that we will not soon forget. Challenged with civil 

strife, racial inequities and injustices, and the COVID-19 pandemic, all of these 

events are impacting our lives in ways we could never have imagined. Each of 

these events has been heart wrenching, noting there is much work left to do 

relative to each of these challenges. The demands of the pandemic have been 

overwhelming in and of itself. From the first moments when we watched other 

parts of the world struggle to control the spread and outputs of COVID-19, to 

watching it begin to unfold in the US, we were faced with the harsh reality of 

what we would experience. No one could have fathomed the impact of COVID-19 

and the ways in which it would change our lives. And while society came to a 

screeching halt with unemployment skyrocketing and businesses closing as 

people were forced to stay home due to the pandemic, healthcare rose to the 

forefront of society. 

Although healthcare has always required flexibility, never has it been more 

apparent than throughout the pandemic. Challenged by the constant changes 

imposed as we navigated, and continue to navigate, new norms at work as well 

as within our personal lives, to the cumulative impact it has taken on our wellbeing, 

to the way we deliver healthcare, life will never be the same. But the one 

thing that has not changed is the way nurses have rallied to overcome these 

obstacles through innovation to provide ongoing compassionate, high quality 

care to their patients, patient families and the communities they serve. 

The degree of innovation exercised in all areas of nursing is nothing short of 

amazing! Healthcare organizations attempted to prepare for the arrival of the 

pandemic by anticipating its potential magnitude and recognizing how each 

state experienced similarities and relative nuances Understanding the need for 

nursing resources, the Virginia Board of Nursing worked diligently to implement 

waivers expediting nurse entry and reentry into the workforce. In addition, the 

board worked with nursing programs within the state to make accommodations 

for clinicals and online learning. Even with these accommodations and the 

addition of contract labor, nurse leaders were challenged to continually increase 

the nursing workforce amidst a nursing shortage. Leaders identified internal 

nursing personnel for deployment, aligned skill sets with staffing needs based 

on individual backgrounds, supplemented education, and evaluated competency 

levels as new staffing models were implemented to support patient and staffing 

needs. The result was stronger collaboration among nursing and further birth 

of innovation as nurses worked diligently to bundle patient care, engage in 

further safety practices by observing donning and doffing practices of coworkers, 

and taking the lead alongside physicians in developing safety protocols 

around certain procedures and code blue events, all aimed protecting staff while 

continuing to deliver high quality healthcare. 

In addition, the need to increase physical bed capacity through the 

expansion of COVID-19 units required thinking outside the box. Previously 

unused areas, conversion of existing space to patient rooms, installation of 

negative pressure on entire units, and construction of hot and cold zones with 

nurses volunteering to care for PUIs (Persons Under Investigation) and Positive 

COVID patients served to expand physical beds as well as formulate expertise 

among nurses caring for this patient population. Yet, patient isolation and the 

separation of patients from their families culminated in increased stress levels 

for all involved, including nursing, especially during end of life. Frontline nurses 

turned to technology to connect patients and families through platforms such 

as Zoom or FaceTime during this critical time. This use of technology then 

expanded to allow for routine visitation of not just COVID-19 patients, but all 

patients. Telemedicine usage expanded and then exploded as a means to allow 

medical care delivery while protecting the patient, staff, and other individuals 

seeking healthcare. 

Other practices such as drive-through testing, facility screening practices, 

tracing by organizations and health departments, access to ongoing data 

at accelerated rates, interpretation of the data by multiple entities, and 

ongoing changes issued by the CDC ignited the 

need for ongoing communications and modes of 

communication to flex and meet the changing 

demands. The new practices pivotally changed often 

from minute to minute, hour to hour and day to day. 

Outside of the acute environment, areas such as 

academia, home health, long term care, and public 

Linda Shepherd, 

MBA, BSN, RN 

health were all faced with their own challenges. As clinicals and classes were 

cancelled, academia moved to expanding the use of virtual learning platforms 

thus navigating waters previously untapped in order to assure nursing students 

obtained the required hours and experiences needed to meet established 

standards. Home health institutions worked to create safe environments for 

their patients and their teams as community spread exploded. Long term care 

teams were challenged with their highly vulnerable populations and were faced 

with how they would isolate their clients, protect their teams, and handle the 

post hospitalized patients who experienced positive COVID-19 results. Public 

health with its intimate involvement with the pandemic served as a beacon to 

many across the healthcare continuum. 

Nursing again marched to the forefront, providing education on the use of 

masks and educating the public on ways to keep themselves and their families 

well. From videos on YouTube to organizational campaigns, nurses used creative 

avenues to help reach the public. While nurses advocated for patients, nurse 

leaders and organizations, and especially spoke with members of Congress 

and the Virginia General Assembly, relaying the realities nurses faced within 

the pandemic; these leaders and organizations were busy advocating for 

presumptive worker’s compensation for those who have fallen ill to COVID, 

more nurses in schools, expanded telehealth, and greater access to healthcare 

through increased autonomy of APRNs as well as funding for APRN preceptors. 

And as the ongoing uncertainty remains exacerbated by the approach of 

the winter months and flu season, the revelations experienced through the 

opening of universities and colleges across the state and the surmounting loss 

of life nationwide to COVID-19, there remains much work to be done. ,Each of 

you, Virginia’s 112,000+ registered nurses, regardless of your role or area of 

nursing, have either known someone or experienced a family member, friend, 

or co-worker who has succumbed to COVID-19. Although we cannot forget the 

challenges this pandemic has brought and continues to bring, the innovative 

aspects of nursing and healthcare will also be remembered. It is truly the Year 

of the Nurse. Thank you for all you do. 

Visit nursingALD.com today! 

Search job listings 

in all 50 states, and filter by location and credentials. 

Browse our online database 

of articles and content. 

Find events 

for nursing professionals in your area. 

Your always-on resource for 

nursing jobs, research, and events.


CEO Reflections 


Is a Twindemic Imminent? 

The last thing we need this winter, with COVID-19 

cases on the rise throughout the country, and 

hospitals and healthcare professionals already 

stretched to the limit, is to compound the effects of 

the pandemic with a surge of the flu. While experts 

anticipate less of a flu outbreak this year because of 

the precautions people are already taking to prevent 

the spread of COVID, it’s imperative that we not get 

too comfortable with this notion. 

As the most trusted profession in America for the 

18th consecutive year, nurses are in an excellent 

position to leverage the confidence of the public to 

encourage their patients, clients, family, friends 

and neighbors to get their flu shot. The American 

Nurses Association and Sanofi Pasteur, the vaccines 

division of the French multinational pharmaceutical 

company Sanofi, are partnering on a national public 

education campaign called The Race to 200M 

encouraging Americans to do just that. 

Why 200M? Each year, less than half of the 

nearly 330 million eligible Americans get a flu 

vaccine. For those who are most at risk for flu and 

its complications – Americans 50 years of age or 

older, as well as people living with chronic diseases, 

such as heart disease, respiratory disease, and 

diabetes – no less than 200 million Americans 

should be getting the flu vaccine annually. According 

to the Centers for Disease Control and Prevention 

(CDC), everyone getting a flu vaccine is more 

important than ever during 2020-2021. 

Check out TheRaceto200M.com and the Facebook 

page (search “The Race to 200M”) to see the 

campaign in action and access great resources for 

sharing. The website includes tips for individuals 

to stay safe as they plan their flu vaccination, plus 

FAQs that serve to dispel myths like getting the flu 

shot can cause you to fall ill from the flu, and much 

more. 

The Race to 200M campaign, which includes 

paid (advertising) and earned (PR) media, in addition 

to your outreach efforts, will reinforce: 

• The need for increased urgency around flu 

vaccination as this upcoming flu season may 

coincide with the COVID-19 pandemic. 

• The seriousness of 

flu for adults 50 

years of age and 

older, particularly 

those with chronic Janet Wall, MS 

medical conditions. 

• That flu can lead to serious complications, 

hospitalizations and sometimes even death. 

Vaccination is the best way to help protect 

against the flu. 

Together we can reduce the burden a twindemic 

would have on our communities, nurses, and other 

healthcare professionals, and ensure that we 

maintain our needed medical resources for the care 

of people afflicted with COVID. 

The message is getting out! We’ve witnessed a 

significant jump in the number of people getting 

their flu shots early this season. Help us keep that 

momentum going!


Jay Douglas continued from page 1 

registration holders including registered nurses, 

licensed practical nurses, advanced practice nurses, 

massage therapists, nurse aides, and medication 

aides. She also has responsibility for oversight of 

150 pre-licensure nursing education programs. 

Additionally, Douglas serves as a Commissioner 

for the Nurse Licensure Compact (NLC). Previously, 

she served as a member of the NCSBN Board of 

Directors for Area III, which includes Virginia and 

surrounding states. 

Prior to assuming her current position, she served 

as deputy executive director for discipline at the 

Virginia Board of Nursing. Immediately prior to the 

Board of Nursing, Douglas served in a variety of 

roles including administrator for Medshares Home 

Care. She is a registered nurse with a master’s 

degree in management, holds a certification in 

substance abuse counseling, and is a Fellow of the 

National Council of State Boards of Nursing Institute 

of Regulatory Excellence. 

“We are in unprecedented times which bring 

challenges and opportunities to not only rely on our 

solid foundation but to be innovative and to make 

adjustments that may become best practices for the 

future. I am grateful for the role models who came 

before me at NCSBN and for a staff and a board 

here in Virginia that exercise their responsibilities 

towards public protection in a competent, forward 

thinking and realistic manner,” said Douglas. 

Come join our caring team of professionals in a Five Star 

rated, CARF accredited community, located in the beautiful 

Shenandoah Valley. We offer a competitive salary and benefits 

package, sign on bonuses and excellent resident to staff ratios, 

and are currently recruiting for CNA, LPN and RN positions. 

For more information and to apply, 

please visit our website at www.svwc.org 


New 2020 VNA Board Members 

The Virginia Nurses Association (VNA), the 

professional association representing the interests of 

the more than 112,000 nurses in the Commonwealth 

of Virginia, announced the election of new board and 

nominating committee members. 

“The impressive accomplishments and leadership 

expertise of our newly-elected leaders will serve our 

membership well as we work to advance the voice of 

nursing in Virginia. I know the talent, energy, and 

experience they bring to the table will strengthen 

our organization,” said Janet Wall, VNA chief 

executive officer. 

Newly sworn-in board members include: 

2nd term as VNA President 

Linda Shepherd 

Linda currently serves 

as the Chief Nursing 

Officer at Ballad Health 

Johnston Memorial Hospital 

in Abingdon, VA where 

she is responsible for the 

overall quality of nursing 

care including surgical, 

orthopedic, rehabilitation 

and stroke services, as 

well as the emergency department and family 

birth center. Before joining Ballad Health, her 

accomplishments in patient care and nursing 

administration led to the achievement of a Pathway 

to Excellence designation from the American Nurses 

Credentialing Center, as well as significant gains in 

Press Ganey scores and reductions in fall rates in 

those facilities. 

Linda was instrumental in developing the 

Southwestern Virginia chapter of the Virginia Nurses 

Association. For the past three years, she has served 

on the boards of directors for the Virginia Nurses 

Association; in the role of president since 2018. has 

also served as a VNA voting representative to the 

American Nurses Association Membership Assembly. 

Secretary 

Tiffany Lyttle, 

BS, BSN, RN, PCCN 

Tiffany currently serves 

her community as a pool 

nurse where she has had 

the opportunity to cultivate 

a wide knowledge base 

and various skill sets. She 

is also cross-trained in 

supervision and currently 

serves on the Research 

Council and PI for cost saving projects to decrease 

infection rates. Tiffany is active with the American 

Red Cross: Pillowcase Project, a program that 

teaches children in grades 3-5 how to respond in 

different emergencies and cope with their feelings 

afterward. She has served on the VNA Committee 

on Nominations for two terms and remains an active 

volunteer with the Near Southwest Medical Reserve 

Corps 

Re-elected Commissioner on 

Nursing Education 

Catherine Cox, 

PhD, RN, CEN, CNE 

Catherine is currently 

an associate professor in 

the School of Nursing at 

George Washington (GW) 

University in Ashburn, 

VA and Washington, DC. 

Prior to GW, she was the 

Director of Programs at the 

American Association of Colleges of Nursing (AACN) 

in Washington, DC. Catherine is a retired navy 

nurse and is thrilled that in her current job, she gets


to mentor student veterans as they transition to a 

career in nursing. 

She is a member of the Virginia Medical 

Reserve Corps, a volunteer for the annual National 

Disabled Veterans Winter Sports Clinic, and a 

docent for Wreaths Across America at Arlington 

National Cemetery. From 2016-2018, Catherine 

was a committee member for VNA’s Commission 

on Nursing Education. She previously served on 

VNA’s Committee on Nominations and since 2018 

has served as VNA’s Commissioner on Nursing 

Education. 

Commissioner on Workforce 

Issues 

Richard Ridge, 

PhD, RN, NEA-BC, CENP 

Richard is an assistant 

professor at the UVA School 

of Nursing and his clinical 

background includes: spinal 

cord injury, psychiatric 

and mental health, and 

rehabilitation. Richard 

has served as a director of 

medical/surgical nursing, nursing education, and 

as CNO of a community hospital. He is regularly 

involved in the University of Virginia and the 

surrounding communities as an active member of 

the local UVA Alumni Club, the Raven Society, and 

the local Sigma Chapter, Beta Kappa. Richard is a 

current member of the VNA Government Relations 

Committee and has been active in several ANA 

state affiliates and with committee work related 

to fundraising, state convention planning, and 

education. He has also been involved in leadership 

roles for the regional and local chapters of the 

Association of Nursing Professional Development 

andSigma Theta Tau, and served as a member of the 

ANA Nurse Fatigue Panel, Advisory Committee from 

2013 to 2015. 

Re-elected Director-at-Large, 

Staff Nurse 

Melissa Earley, BSN, 

RN, QMHP-C, NHDP-BC 

Melissa is the Director 

of Community Outreach 

for The If You Could See 

Me Project, a nonprofit 

empowering individuals to 

find their voices and use 

them to change the way society talks about, thinks 

about, and treats mental health and related issues. 

Melissa is a trained facilitator and instructor of 

the Trauma and Resilience Basics Course as well 

as a survivor expert in trauma informed care. She 

currently serves as an education consultant on a 

workgroup formed by the ANA to address Suicide 

Prevention and Crisis Response in Nursing. 

Melissa is a life member of the Lakeside Volunteer 

Rescue Squad and is a recipient of the President’s 

Lifetime Achievement Award for Volunteer Service 

by President Obama. Melissa serves on the SAARA 

of Central Virginia Board of Directors. She is a 

member of the Virginia DBHDS Disaster Behavior 

Response Team and is also REVIVE! instructor/ 

trainer for the agency. Melissa is very active with 

the Virginia Medical Reserve Corps, having deployed 

for federal and state declared disasters and public 

health emergencies, and is currently serving with 

the joint Richmond and Henrico area health districts 

COVID-19 Response Team. 

Newly sworn-in Committee on Nominations 

members include: 

Nominating Committee 

Mesha Jones, BSN, RN, 

CCRN, CWON 

Mesha currently works 

as a member of the wound 

ostomy continence team at 

UVA Health and before that, 

she worked in UVA’s surgical 

trauma intensive care unit. 

She is an active member of 

the Professional Nursing 

Staff Organization, vicechair 

for the professional development committee 

and coordinator of the RN to BSN mentorship 

program. Mesha is a member of the AACN, WOCN, 

and has certifications with both organizations. Her 

volunteer work includes serving as a member of the 

Community Health UVA Partnership. She is also a 

member of the American Association of Critical Care 

Nurses, the Wound Ostomy Continence Nurses, and 

the Virginia Medical Reserve Corps. As an active 

member of her church, she serves as the nursery 

leader and participates in several ministries. 

Mesha has been an ANA member since 2016 and 

a VNA member since 2018. As a representative of the 

VNA Piedmont chapter, she served as government 

relations chair from 2016 to 2018 and is currently 

serving as chapter president. She has also worked 

with ANA as a mentee in 2019 and as a mentor 

the subsequent year. Mesha currently sits on the 

Virginia Nurses Foundation’s Integrated Behavioral 

Health Workgroup. 


Patty Moore, MSN, MBA, 

RN, NE-BC 

Patty currently serves 

as a founder and principal 

consultant of Premier 

Healthcare Strategies where 

she focuses on clinical 

operations improvement, 

“lean” strategies and policy 

development. She is an active 

board member of central 

VA’s CASA, focusing on fundraising. Patty volunteers 

with a quilting group making cloth masks and with 

Elizabeth’s Early Learning Center. She also serves 

on the VNA Workforce Issues Commissionthe Ethics 

Committee, and the Research Workgroup. 

During her career, Patty has advocated for 

adequate staffing, worked with providers to 

elevate the role of the nurse in ambulatory clinics, 

and supported nursing in having a voice in 

healthcare decision making. She also led one of 

the first ambulatory magnet recognition and Joint 

Commission accreditation for ambulatory clinics. 

Her passion lies in nursing ethics and she has 

been fortunate to serve on ethics and research 

committees during her career. 


Michelle Wise, MSN, NNP, 

CPNP, IBCLC 

Michelle currently owns 

and operates the MBS Child 

Wellness Center LLC and is 

a COA board member. She 

has been a nurse for more 

than 30 years and has been 

a practicing APRN for 26 

years. 

Outgoing Board and Nominating 

Committee Members 

VNA would also like to recognize our outgoing board and nominating committee members, whose service 

to the association and dedication to advancing the nursing profession were exceptional: 

Campus RN Nurse 

Full Time Opportunity 

Timber Ridge School is a 12-month residential treatment center and accredited middle/high school 

for adolescent boys experiencing emotional difficulties and/or learning disabilities with varied 

backgrounds and diverse needs. We are located in the beautiful Shenandoah Valley mountains just 

northwest of Winchester, VA. 

Monday-Friday position mainly between the hours of 7am-3:30pm with some occasional weekend/ 

evenings. On-call rotation required. 

Minimum Requirements: 

License to practice as a Registered Nurse (RN). Psychiatric experience preferred but not required, 

ability to work with adolescent youth, strong medical skills, good computer skills. 

Timber Ridge offers all full-time employees an excellent benefits package to include generous leave, 

NO cost health/dental options, retirement match, life insurance, short- and long-term disability. Join 

the Timber Ridge family transforming the lives of these young boys with a goal of reuniting them 

successfully with their families and community. 

Visit our website: 

www.TimberRidgeSchool.org 

E-mail your resume to: recruit@trschool.org or Timber Ridge School, Human Resources, 

P.O. Box 3160, Winchester, VA 22604, Fax: (540) 888-4513 

We are a tobacco and drug-free environment. 

EOE 

Ronnette Langhorne, 

Secretary 

Jennifer Shepherd, 

Commissioner on Workforce 

Issues 

Caryn Brown, 

Commissioner on Nursing 

Practice 

Join our team of dedicated 

professionals as we brighten the journey of 

those with advanced illness. 

NOW HIRING: 

• RN, On Call 

• RN, Assessment Nurse 

Positions 

brhospice.org 

Sherri Wilson, 

Committee of Nominations 

Tiffany Lyttle, 

Committee of Nominations 

Yinka Majekodunmi, 

Committee of Nominations



A Look Back at VNA's 2020 Fall Conference, 

Ending Incivility, Bullying, & Workplace Violence 

VNA Commissioner on Nursing Education 

Catherine Cox, PhD, RN, CEN, CNE 

It is hard to believe that 

we are in the third season 

of a pandemic. Most of 

us have had to reimagine 

how to do our jobs whether 

we work in academia or 

practice but there is one 

constant that I am forever 

grateful for, and that is the 

Virginia Nurses Association 

(VNA) and its commitment 

to continuing education. 

Western State Hospital 

We’re Hiring! 

Opportunities available for RNs, 

LPNs, & Psychiatric Nursing Assistants 

• Psychiatric acute admissions units 

• Psychiatric longer term units 

• Med/Psych unit 

Conveniently located in the Shenandoah 

Valley, WSH affiliates with 9 Schools of 

Nursing and major universities. 

I recently attended VNA’s 2020 Fall Conference – 

Ending Incivility, Bullying, and Workplace Violence – 

but before the signature event many of us virtually 

joined the annual Membership Assembly where 

we heard about the great work VNA is doing via 

the support of its board members and multiple 

commissions, the Virginia Nurses Foundation and 

the Committee on Nominations. Next, we welcomed 

the new officers and bid farewell to past leaders. 

We concluded the Membership Assembly with a 

presentation from Virginia Department of Health 

Director of Public Health Nursing Jeannine Uzel 

and her colleagues who shared new information 

on COVID transmission, the impact on vulnerable 

populations, new testing options, case modeling 

Nursing at Western State Hospital 

Offers Excellent Benefits Including: 

• Up to $7500 RN Sign On Bonus for New Hires 

• $3500 LPN sign on bonus 

• $2000 CNA sign on bonus 

• Eligibility for Federal Loan 

Repayment Programs 

• Moving/Relocation Expenses 

Reimbursement will be considered 

• Unique Clinical Care Opportunities 

• Ongoing Training Opportunities 

• Educational Assistance 

• Comprehensive Healthcare Benefits 

• Group & Optional Life Insurance 

• VRS Retirement Benefits 

• Flexible Spending Account 

• Paid Holidays, Vacation, Sick Leave 

• Short & Long Term Disability Benefits 

• State Employee Discounts 

To submit your credentials for a career enhancing position, simply... 

Visit https://virginiajobs.peopleadmin.com/ 

projections for the fall, anticipated vaccines, and 

efforts to return to in-person school. 

Day One of the fall conference kicked off with 

our commitment to sign the VNA’s Civility Pledge 

(tinyurl.com/VNACivilityPledge) followed by Diane 

Salter’s presentation on “Cultivating a Healthy 

Workforce by Addressing Disruptive Behaviors.” 

Diane reminded us that bullies: 1) never apologize, 

2) target a subject, 3) are harmful, and/or 4) 

frequently repeat the behavior. Hence, we can 

cultivate a healthy working environment by setting 

behavioral expectations just as we do with clinical 

expectations in addition to building a healthy 

team by assuming noble intent and going directly 

to the source. All of this requires moral courage. 

Remember, “drama thrives where relationships 

are weak.” Later, VNA’s Commission on Workforce 

Issues shared its incivility survey findings and 

noted suggestions from the audience. The day 

concluded with Melissa Earley and Kelly Cannon 

talking about Melissa’s personal workplace violence 

(WPV) story and how impactful it was regarding 

passing legislation with the goal of ending WPV in 

Virginia. 

Day Two began with a heart-breaking account 

regarding “A Personal Story of WPV [workeron-worker] 

in the Healthcare Setting” by Katie 

Ann Blanchard. Katie disclosed that there are 

four types of WPV: 1) criminal intent (e.g., “rob a 

pharmacy”), 2) customer/client (e.g., the patient or 

family), 3) worker-on-worker, and/or 4) personal 

relationships. Nurses have a legal and ethical 

responsibility to prevent, react, and resolve WPV. 

Katie then talked about “Strategies to Prevent and 

Mitigate WPV,” giving us the tools and language 

to utilize when dealing with WPV including a plan 

of three “Rs”: research, report, and respond. All 

the while, participants used the chat box function 

of the virtual environment to share what they 

planned to change in their workplace in order to 

help prevent violence. After Katie’s talks, it was fun 

to learn about the sponsors and visit the exhibit 

halls virtually. Some of the participants even won 

Amazon.com gift certificates! 

During the closing afternoon, the audience 

was privileged to hear from Rose Sherman about 

“Coaching Strategies to Promote Nurse Resilience 

and Recovery.” It was interesting to learn that 

stress is different across generations and that 

bullies target young/anxious nurses when looking 

to inflict harm. Our job for anyone who has been 

bullied is to rebuild their confidence by offering 

trust, empathy, and stability – reminding them 

that they are not crazy and offering hope. Rose 

emphasized that resiliency is a muscle that you 

can work and the key to its success is mindset. 

Ultimately, nurses need to decide to stay or leave 

as well as think about how to grow from the 

experience. Rose concluded that good coaching can 

lead to transformation. 

The conference concluded with seven on-demand 

WPV concurrent presenters taking questions from 

the audience during “Happy Hour.” 

I left the fall conference feeling invigorated and 

thrilled to be participating in a virtual activity 

that was not work-related and focused on my own 

professional development. I feel recharged and 

cannot wait for the virtual 2020 VNA Legislative 

Summit (https://virginianurses.com/page/ 

LegislativeSummitProgram) on November 10! 

If you were unable to attend VNA’s Fall 

Conference, you can pay to access the content and 

earn CE through VNA’s On-Demand Online Library. 

Simply go to https://virginianurses.com/page/On- 

DemandContinuingEducation. 

Stafford County Public Schools is actively 

seeking qualified applicants for the 

following position: School Nurse 

Western State Hospital : State psychiatric hospital licensed and operated 

by the Virginia Department of Behavioral Health and Developmental Services. 

Under the supervision of the Building Administrator and/or other designated 

administrator, the school nurse provides health services and leadership in 

establishing a complete and effective program of school health. 

Qualifications: Must be a graduate of an accredited program of registered nursing 

and hold a current license to practice nursing in the Commonwealth of Virginia; 

Bachelor of Science in Nursing preferred. Current certification in First Aid, 

CPR, and AED required. 

Must have at least two years successful nursing experience. 

Pediatric and community health experience preferred. Salary $36,447-$76,092 

Please visit our website at www.staffordschools.net to learn more about the position 

and to submit our on line licensed application at www.staffordschools.net


Telehealth continued from page 1 

a computer, smart phone, or tablet with Internet 

access and only 11% answered they had used such a 

device to connect by video to a doctor or healthcare 

provider in the past two weeks (Cubanski, J. 2020). 

It could be there was no need to reach out to a 

healthcare provider or does it really address comfort 

with video technology. 

The benefits and value of telehealth during the 

pandemic 

• Utilizing telehealth reduces the possibility 

of spreading the coronavirus face to face 

while offering the opportunity to triage and 

direct patients to emergency care or selfmonitoring 

quarantine at home. 

• Telehealth does provide increased access to 

care to all patients in all geographic 

from the comfort of their home in an 

affordable manner. 

• Telehealth addresses the utilization of 

scarce healthcare resources to include 

healthcare personnel and protective 

equipment. 

• Telehealth extends the opportunity to 

increase patient engagement with their own 

healthcare with the possibility of obtaining 

better outcomes. 

• Telehealth has the ability to monitor chronic 

conditions such as hypertension, diabetes, 

asthma, etc. while providing coaching and 

counseling. 

• Telehealth can provide follow-up with 

patients after hospital discharge. 

• Telehealth affords patients mental health 

counseling and medication management in 

real time. 

• Telehealth provides the opportunity for 

education and training for healthcare 

providers. 

The future of telehealth 

The COVID-19 pandemic has served as a catalyst 

to bring telehealth delivery of healthcare services 

to a wide section of the american population. What 

we now have is the unprecedented opportunity 

to learn from the current telehealth experiences 

and outcomes moving forward. Data pertaining to 

patient outcomes, access to care, cost, and quality 

of care will provide the foundation moving forward. 

Will telehealth remain as a triage tool, a method to 

provide access to care for chronic disease, or remain 

useful for acute care delivery? Will the federal 

government continue the waivers for Medicare, 

Medicaid, VA and DOD to reimburse healthcare 

practitioners for services? Will this reimbursement 

expand to cover more healthcare providers? These 

are the unanswered questions. 

The reader is directed to the citations throughout 

this article to learn more about the current use and 

reimbursement available for telehealth during this 

pandemic. 

2021 Spring Conference 

The Virginia Nurses Association and Virginia 

Nurses Foundation invite you to join us VIRTUALLY 

for our Spring Conference, Creating a Multicultural 

Foundation for Nursing, on April 21, 2021. 

During this program, we will take a deep dive into 

our responsibilities as nurses to be culturally 

responsible and informed. We will examine our 

own implicit biases and discuss how to create a 

multicultural nursing foundation where all races, 

ethnicities, religions, sexual orientation, and 

genders are respected. The 2020 pandemic has shed 

light on health inequities in our country and work 

environments and we will provide you with tools to 

make change. 

With your health and safety in mind, we will be 

presenting our 2021 Spring Conference as a live 

virtual event! We’ve slashed our Spring Conference 

prices to $59 for members and $79 for non-members! 

The Virginia Nurses Association’s new website 

launches this month! Our new site is designed to 

be user friendly, intuitive, and completely mobile 

responsive, with dedicated members-only content. 

We’ve created comprehensive online toolkits for use 

in doing research, learning practice strategies, and 

These exceptional prices are in recognition of nurses 

and their employers for all they (and you!) do to 

support VNA, as well as our appreciation for the 

financial hardships that some may be experiencing 

as a result of the pandemic. 

The conference will be professionally produced 

and live streamed directly to your computer, tablet, 

or phone. We’re still providing the same high 

quality and informative content and we’re using 

other strategies to interact and engage with all 

participants. When you register for the live Spring 

Conference, you will also receive access to the 

conference recording on demand for six months! This 

gives you the flexibility to view the program at your 

convenience. 

To register for the 2021 Spring Conference, go to 

https://tinyurl.com/yyurf7ae. 

VNA Launches New Website in November! 

more! In addition, we will be launching a new online 

community that will enable nurses across Virginia to 

share ideas, information, and even socialize virtually! 

Be sure to bookmark www.virginianurses.com 

and check mid-November for the new site’s official 

launch! 

References 

Aetna (2020). Coronavirus: We’re here to help. https:// 

www.aetna.com/individuals-families/member-rightsresources/covid19.html 

BlueCross BlueShield (2020). Coronavirus (Covid-19) 

Updates. https://www.bcbs.com/coronavirus-updates 

Cigna (2020). Coronavirus (COVID-19) Resource Center. 

https://www.cigna.com/coronavirus/ 

Coronavirus Aid, Relief, and Economic Security 

(CARES) Act, P.L. 116-136 (2020). https://www. 

congress.gov/bill/116th-congress/house-bill/748 

Coronavirus Preparedness and Response Supplemental 

Appropriations Act, 2020, P.L. No. 116-123. https:// 

www.congress.gov/116/plaws/publ123/PLAW- 

116publ123.pdf 

Cubanski, J. (April 13, 2020). Possibilities and limits 

of telehealth for older adults during the COVID-19 

emergency. https://www.kff.org/policy-watch/ 

possibilities-and-limits-of-telehealth-for-olderadults-during-the-covid-19-emergency 

Department of Defense (2020). Tricare What’s Covered? 

https://tricare.mil/CoveredServices/IsItCovered/ 

Telemedicine 

Families First Coronavirus Response Act, P.L. 116- 

127. (2020). https://www.congress.gov/116/plaws/ 

publ127/PLAW-116publ127.pdf 

U.S. Department of Health and Human Services (2020). 

Telehealth: Delivering Care Safely During COVID-19. 

https://www.hhs.gov/coronavirus/telehealth/index. 

html. 

U.S. Department of Veterans Affairs (2020). Welcome to 

VA Telehealth Services. https://telehealth.va.gov 

NursingALD.com 

can point you right to that perfect 

NURSING JOB! 

NursingALD.com 

Free to Nurses 

Privacy Assured 

Easy to Use 

E-mailed Job Leads



VNF Pivots to December 5 

Virtual Gala Due to 

Pandemic 

During 2020 - the Year of the Nurse - nurses have been essential 

to fighting the COVID-19 pandemic in so many ways. They have 

not only been on the frontline of providing care to the sick, but also 

working to keep their communities and patients safe, and providing 

support with innovative ideas and compassion. 

Please plan to join us at 7 p.m., December 5 for this wonderful 

celebration of nursing! This year, VNF has modified their regular 

awards program to focus on recognizing the contributions of 20 

registered nurses from throughout Virginia during the COVID-19 

pandemic. 

The Year of the Nurse awards are an extension of our annual 

VNF Leadership Excellence awards, which were created to honor 

outstanding nurses throughout the commonwealth who have made 

exceptional contributions to the nursing profession. 

The Year of the Nurse Awards are based on the premise that 

during the COVID-19 pandemic, the nominee enhanced the image 

of professional nursing and rose to the unprecedented challenges 

facing the nursing profession with compassion and respect. 

VNF is proud to partner with Riverside Health System for this 

virtual event. 

You can find more information on our Virtual Gala at https:// 

virginianurses.com/page/AnnualGala. 

Our 2021 Lobby Days 

are Going Virtual! 

It’s easier now more than ever to talk with your legislators about the issues 

that matter to you. VNA’s Lobby Days are a great opportunity for nurses to 

advocate for themselves and the nursing profession! We will meet virtually 

with legislators to discuss 2021 legislation and issues including the need for a 

registered nurse in every public school, the necessity of worker’s compensation 

language that presumes on-the-job-infection for nurses who fall ill wall 

working on the front lines of the pandemic, restoration of funding for recently 

passed APRN preceptor legislation and much more. You’ll also potentially 

have the opportunity to virtually sit in on a healthcare committee meeting and 

observe the legislature in session. 

Participants will receive nursing contact hours for participation in the 

advance training seminar and VNA Lobby Day, including meeting with 

a legislative representative. Attendees will receive 0.6 contact hours for 

the advance training seminar and 3.75 contact hours for Lobby Day after 

completion of an evaluation.* 

During our virtual Lobby Days, we will review our 2021 Public Policy 

Platform, examine the best communication tools to engage with your 

legislators, and answer all your questions about the Virginia 2021 General 

Assembly session! 

You do not have to be a VNA member to join us for our virtual Lobby Days! 

We encourage ALL nurses to join us. Please share this information with 

anyone who might be interested! 

For more information on our Lobby Days including the dates, times, and 

registration links, visit our webpage at https://virginianurses.com/page/ 

LobbyDays. Please direct any related questions to VNA Communications 

Coordinator Elle Buck at ebuck@virginianurses.com. 

*The Virginia Nurses Association is accredited as a provider of nursing 

continuing professional development by the American Nurses Credentialing 

Center’s Commission on Accreditation. There are no conflicts of Interest for any 

individual in a position to control the content.


Nursing’s Public Policy Platform - 2021 Session 

In recent years, VNA developed what is now 

called the Virginia Legislative Nursing Alliance. It’s 

composed of leaders from nursing organizations 

throughout the commonwealth and continues to 

grow in size and engagement. The purpose of the 

group is two-fold: 

• It’s a great opportunity for all participating 

organizations discuss their legislative priorities 

and 

• This group identifies the 4-6 priorities that will 

be included on Nursing’s Public Policy Platform 

Nursing Legislative Alliance Organization Members 

• Academy of Medical-Surgical Nurses 

• American Association of Legal Nurse 

Consultants 

• American Holistic Nurses Association 

• Assn. of Women’s Health, Obstetric and 

Neonatal Nurses 

• Central VA Black Nurses Association 

• International Association of Forensic Nurses 

• National Association of Hispanic Nurses 

• National Association of Pediatric Nurse 

Practitioners 

• Philippine Nurses Association, VA Chapter 

• Society of American Nepalese Nurses, Virginia 

Chapter 

• Society of Urologic Nurses and Associates, 

Central VA Chapter 

• VA Affiliate of the American College of Nurse 

Midwives 

• VA Association of Clinical Nurses Specialists 

• VA Association of Colleges of Nursing 

• VA Association of Community Psych Nurses 

• VA Association of Nurse Anesthetists 

• VA Association of School Nurses 

• VA Council of Nurse Practitioners 

• VA League for Nursing 

You can download the 2021 VNA Public Policy 

Platform online at https://virginianurses.com/ 

page/NursingsPublicPolicyPlatform. For questions 

about the Public Policy Platform, email VNA 

Communications Coordinator Elle Buck at ebuck@ 

virginianurses.com. 

1. Funding the Virginia Preceptor Incentive Program 

Virginia’s nursing schools are experiencing 

a growing shortage of clinical education 

opportunities, forcing a reduction in enrollment 

at a time when we need to be graduating more 

nurses. As was originally adopted during the 

2020 session, by providing financial incentives 

for healthcare professionals who serve as 

uncompensated preceptors (hands-on clinical 

instructors) for advanced practice registered 

nurse students, Virginia can significantly 

increase student enrollment, especially in fields 

such as psychiatric and primary care. The 

program will increase access to care, address 

the primary care shortage, handle mental health 

crises, and manage chronic diseases. All of these 

factors are crucial in improving the health and 

wellness of all Virginians. The incentive would be 

available for uncompensated preceptors, including 

APRNs, physicians, and physicians’ assistants. 

2. COVID-19 Presumption for Healthcare Workers 

Nurses and other healthcare professionals are 

exposed to COVID-19 patients on the job and 

are at risk of contracting the virus in the line of 

duty. Current workers’ compensation laws do not 

guarantee any protections for these workers who 

are injured on the job when they contract the virus. 

Legislation should be adopted to at a minimum 

provide a presumption of work-related infection for 

healthcare professionals who work with confirmed 

or suspected COVID-19 patients at work. 

3. Reducing Unnecessary Practice Restrictions 

Consistent with Governor’s Order 

In order to ensure access to care for Virginia 

patients, Governor Northam issued an executive 

order reducing the current requirement that a 

nurse practitioner practice under a physician’s 

practice agreement from 5 years to 2 years before 

transitioning to autonomous practice. Virginia 

should codify the governor’s reduced timeframe, 

as there is no negative impact on patient safety, 

access to care is improved, and this timeframe is 

more in line with other states who have similar 

transition period requirements. Similarly, the 

governor’s order included language removing 

the requirement for a nurse-midwife to maintain 

a consultation agreement, and the removal of 

this requirement should be codified for the same 

reasons. It is an unnecessary requirement that 

has no impact on patient safety and may impede 

access to maternal health care in rural and other 

under-served areas. 

4. Registered Nurses in Public Schools 

School nurses are front line health care providers, 

serving as the bridge between the health care 

and education systems, and they serve as public 

health sentinels, overseeing the physical and 

mental health of all students. For many children 

living in or near poverty, the school nurse 

may be the only health care professional they 

access regularly. School nurses are essential in 

communicable disease surveillance, identification, 

and intervention. As we navigate COVID-19, 

it is the registered nurse with their skillset in 

assessing, triaging, isolating, and contact tracing, 

who can make all the difference in keeping our 

schools safe and healthy. Above all else, access 

to a school nurse is a student equity issue, and 

we must work towards ensuring there is one 

registered nurse in every school across Virginia. 

5. Allow Prescriptive Authority for Clinical Nurse 

Specialists 

Clinical nurse specialists are advanced practice 

registered nurses currently registered under the 

Board of Nursing, and as such, they are unable to 

provide services to their full scope of practice. This 

creates unnecessary barriers to patient access to 

care. Clinical nurse specialists seek joint licensure 

under the Boards of Medicine and Nursing for 

prescriptive authority, within a practice agreement 

with a collaborating physician, to improve access 

to care and provide comprehensive patient care in 

their practice specialties.



Reflections from Virginia Members of the 

Phillipine Nurses Association 

A September article from Business Insider stated 

that, “Nurses of Filipino descent comprise just 4 percent 

of the US workforce, but nearly a third of registered 

nurse deaths due to COVID-19, according to a new 

report from National Nurses United.” 

To learn more about this 

community and the impact 

of COVID-19, we interviewed 

five nurses from the Filipino 

Nurses Association of Virginia. 

Below you will find their 

stories and their responses 

related to nursing and the 

COVID-19 pandemic. 

Peregrin Francisco, BSN, 

RN was born, raised and 

Bachelor of Science 

in Nursing (RN to BSN) 

[6 

For practicing RNs who 

wish to obtain their BSN 

Finish in 5 semesters 

part-time 

Financial aid available 

for those who qualify 

Among the state's 

most economically 

priced programs 

educated in the Philippines. She is the only daughter 

of five siblings born to her parents, Lorenza and 

Felizardo. 

As the only girl among four brothers, Francisco’s 

mother, a high school graduate, guided her to 

serve her church and community. She encouraged 

Francisco to further her education as it was the only 

legacy that she thought she could give her daughter, 

being that they were poor. Seeing the poverty around 

them, Francisco’s mother drilled into her the idea of 

service to humanity or the goal of “giving back.” She 

followed her mother’s wishes and got accepted to the 

State University of the Philippines and earned her 

BSN on a full scholarship. 

After earning her degree, she immigrated to the 

United States in support of her husband’s pursuit for 

an advanced medical degree and specialty training. 

Clinical Nurse 

Leader (MSN) 

For RNs with their BSN who wish 

to become advanced practitioners 

✓ 

Accreditations & Certifications: 

Two starts per year 

(Jan., Aug.) 

Online format with 

two clinical courses 

Part-time curriculum 

for busy RNs 

Certified by SCH EV to operate in Virginia, 

accredited by ABHES & approved by NC-SARA. 

In the latter part of her career, she served as a 

nurse educator at Sentara Healthcare. In her role, 

she established the Sentara Healthcare systemwide 

Department of Physician Education. The support she 

received from Sentara Healthcare afforded her the 

opportunity to serve on the Virginia Board of Nursing 

for four years, as appointed by former Governor Tim 

Kaine. 

Francisco reflects that, “The most rewarding part 

of my career is being the first woman in my family 

to finish college, from the best university in the 

Philippines. Most especially, nursing, as a career 

changed the trajectory of my whole life. It gave me the 

opportunity to immigrate and have a new life in the 

United States. It truly opened limitless opportunities 

for me to serve my local community, my state and 

internationally, through various organizations that I 

have been part of and continue to do so. My nursing 

career has also afforded me success and security in 

my profession and my family life.” 

Justine Reyes-Ford, 

BSN, RN is a clinical nurse 

specialist at the Naval 

Medical Center Portsmouth 

for the heart and vascular 

department. She has a 

specialization in nuclear 

cardiology, cardiac MRI 

stress, and outpatient 

cardiac procedures. Justine 

has a background in cardiac 

intensive care and has been 

a cardiovascular nurse for 24 years. 

She received the Navy Medical Center, Portsmouth, 

Certificate of Excellence from 2016 to 2020. Justine 

was featured as a 2014 Cardiac Top Nurse in the 

2014 edition of Worldwide Leaders in Healthcare by 

the International Nurses Association. Reyes-Ford was 

also a recipient of the Philipine Nurses Association of 

America Presidential Award of Service in 2014. 

Reyes-Ford is active in volunteering health 

screening services for different parishes such as St. 

Gregory the Great, St. Lukes and for the Council of 

United Filipino of Tidewater (CUFOT). She has also 

volunteered first aid services for Asian Fest and Fil- 

Am Friendship Day. Reyes-Ford has been active in 

the Phillipine Nurses Association of Virginia (PNAVA) 

since 2009 and has been treasurer of the Philippine 

Nurses Association Eastern Region since 2014. 

Since 2020, Reyes-Ford has served as the health 

advisor for the City of Virginia Beach. Since 2017, she 

has served as the 2nd vice chairman for the Council 

of United Filipino Organizations of Tidewater. Reyes- 

Ford earned her BSN from Norfolk State University 

and her BA in mass communications from William 

Paterson University. She is certified in advanced 

cardiac life support. 

She notes that, “In today’s unprecedented time, 

having balance in your life is very important. We have 

to take care of our mind, body, soul and spirit. My 

day starts off with a prayer of thankfulness. Eating 

right and exercising is part of my lifestyle. I walk, 

run and teach Zumba classes. I offered free virtual 

Zumba classes to my family and friends weekly and 

teach live classes at the Jewish Community Center in 

Virginia Beach. Mental health plays an important role 

in taking care of yourself, therefore exercise is very 

important as is seeing others, whether through Zoom, 

Facebook, Instagram or even interacting physically by 

maintaining social distances. My family and spiritual 

guidance is an important part of my life. I make time 

to have balance because all of these are important to 

keep you healthy not only physically, but mentally.” 

Teresa Ignacio Gonzalvo, 

MPA, BSN, ACM-RN, 

LNC retired in 2017 after 

serving 45 years in the 

nursing profession. She was 

previously employed as the 

system vice president and 

nurse executive of integrated 

care management at Sentara 

Healthcare. While there, 

she established a model 

with a centralized Resource 

Management Center for the utilization management 

functions for consistency of processes. Previous 

to that, she was the director of integrated care 

management at Good Samaritan Hospital in Dayton, 

Ohio. 

Reflections... continued on page 18


Continuing Education 

Oh No, Not Another Patient with Chronic Pain! 

What is my Ethical Obligation? 

Disclosures 

• Nurses can earn 1 nursing contact hour 

for reading Oh No Not Another Patient 

with Chronic Pain! What is my Ethical 

Obligation? Participants must also 

complete the continuing education posttest 

found at: https://virginianurses.com/ 

page/On-DemandContinuingEducation 

• This continuing education activity is 

FREE for members and $15 for nonmembers! 

• The Virginia Nurses Association is 

accredited as a provider of nursing 

continuing professional development 

by the American Nurses Credentialing 

Center’s Commission on Accreditation. 

• No individual in a position to control 

content for this activity has any relevant 

financial relationships to declare. 

• Contact hours will be awarded for this 

activity until November 15, 2023. 

Phyllis Whitehead, PhD, APRN/CNS, ACHPN, 

RN-BC, FNAP 

Dr. Phyllis Whitehead is a 

clinical ethicist and clinical 

nurse specialist with the 

Carilion Roanoke Memorial 

Hospital (CRMH) Palliative 

Care Service and associate 

professor at the Virginia Tech 

Carilion School of Medicine. 

She initiated the Moral 

Distress Consult Service at 

CRMH. She is certified in 

pain management and as an 

advanced practice hospice and palliative care nurse. 

Dr. Whitehead has done numerous presentations 

on pain and symptom management, opioid induced 

sedation, moral distress, and patients’ end of life 

preferences locally, regionally, nationally and 

internationally. Her research interests include moral 

distress and improving communication with seriously 

ill patients. She is a board of director member of the 

National Association of Clinical Nurse Specialists 

and co-lead of the Virginia Nurses Foundation’s 

(VNF’s) Virginia Action Coalition. Dr. Whitehead is 

also a member of the VNF Board of Trustees. She 

was a member of the ANA Moral Resilience Advisory 

Committee. She is a founding member and board 

member of the Virginia Association of Clinical Nurse 

Specialists. She was selected for Governor Ralph 

Northam’s Policy Council on Opioid and Substance 

Abuse this year. In 2020 she was elected as a 

Distinguished Practitioner Fellow in the National 

Academy of Practice in Nursing. Dr. Whitehead earned 

her BSN and MSN at Radford University and her 

doctorate degree at Virginia Tech. 

I must admit that I have been guilty of silently 

taking a deep breath and sighing when I learned 

that one of my patients suffered with chronic 

pain. But why? For me, I knew that I wasn’t going 

to be successful in stopping the pain. It is just too 

complicated a process to expect that. So I needed 

to reframe how I viewed and approached patients 

suffering with chronic pain. 

First, I tried to imagine myself in constant pain 

from the moment I awakened until I could possibly 

have a little sleep. How would my personality 

change? Would I be able to work or care for my 

children? Once I began to view chronic pain as 

a chronic disease with the many psychosocial 

complications, it helped me be more open and see 

that if I didn’t advocate for these patients who 

would? 

In this article, I will discuss the challenges and 

opportunities of caring for the patient with chronic 

pain and explore ethical principles that can provide 

guidance in caring for these patients. 

Over the last several years, efforts have been 

taken to address opioid abuse, Opioid Use Disorder 

(OUD), and overdoses, while balancing appropriate 

prescribing of opioids for patients with both acute 

and chronic pain. There is confusion, fear and 

uncertainty among nurses, patients and other 

providers as to the right course of action. No one 

wants to contribute to these problems, but how do 

we advocate for our patients suffering with chronic 

pain?1 

Chronic pain is defined by the International 

Association for the Study of Pain as persistent or 

recurrent pain lasting longer than three months.2 In 

the United States, the prevalence of chronic pain in 

older adults has been found to be 42.5%2, so there’s 

no escaping the need to understand how to care 

for these patients. Nurses can assist with learning 

effective coping mechanisms to teach patients with 

persistent pain. Chronic pain includes physical, 

psychological, social and spiritual factors. Physical 

factors include loss of functionality, immobility, 

obesity, and leg ulcers. Psychological factors involve 

anxiety, depression and emotional distress, while 

social factors may involve social isolation or loss of 

relationships resulting in questioning of one’s selfworth 

as a person.2 

The first principle in the Code of Ethics for Nurses 

is respect for human dignity. This principle urges 

nurses to provide and advocate for humane and 

appropriate care for our patients. The following are 

a few strategies. Chronic pain impacts the ‘whole’ 

person. When nurses understand this “Total Pain” 

of their patients, they can work with patients to 

teach effective coping.3 Nurses should include 

the antecedents and consequences of coping with 

chronic pain in their assessments. By discussing 

with your patients possible strategies for making 

modifications in their attitudes and potentially in 

their functionality, nurses can foster better and 

more positive consequences for their patients. 

Additionally, advocating for opioid therapy when 

medically and ethically appropriate is another way of 

respecting human dignity. 

Non-pharmacological interventions are crucial 

pain management interventions. What happens 

when our patients don’t have access to them? 

Based upon the principle of justice, nurses 

provide care that is compassionate, unrestricted 

by personal attributes, economic status or the 

nature of the health problem.4 Pain management 

is a fundamental human right. Nurses must work 

with their case management and social work 

colleagues to always explore non-pharmacological 

interventions and to devise innovative ways to get 

patients what they need to better manage their 

pain. Nursing documentation of pain assessments 

and reassessments that paint clear clinical pictures 

can provide the needed support in justifying these 

interventions. 

The ethical principles of beneficence (the duty 

to help/benefit) and nonmaleficence (the duty to do 

no harm) oblige nurses to understand the evidence 

and to apply it appropriately in their practices. But 

what do we do when we are uncertain of what is 

the ethically right course of action? It is imperative 

that we educate ourselves of what is evidence based 

practice (EBP) and what is expert opinion. Did you 

know that the Centers for Disease Control’s (CDC) 

Pain Management Guidelines for Chronic Pain is 

based upon expert opinion not EBP? More research 

is needed to fully understand chronic pain and 

pain interventions. For example, we do not have an 

accurate estimate of the prevalence of OUD in our 

patients as the literature speculates somewhere 

between 0-31%.4 More pain research is needed and 

nurses should be leading the way. The more we 

understand, the better we can care for our patients 

with chronic pain and OUD. 

So even though we may take a deep breath when 

we see that we will be caring for patients with 

chronic pain and OUD, we must challenge ourselves 

and others to advocate for them and to provide the 

best care possible while minimizing their suffering. 

Our next upcoming article in the ethics series 

will be “Opioid Prescribing and Opioid Use Disorders 

(OUD): How Can I Safely and Ethically Address 

These Challenges as a Prescriber?” Prior to the 

COVID-19 pandemic, you couldn’t watch the news 

or read a journal without seeing something about 

the opioid crisis. Am I contributing to this opioid 

crisis? What are my obligations to my patients as 

a prescriber? This coming article will focus on the 

ethical challenges of opioid prescribing and OUD 

faced by APRNs. 

References 

1. Stanton M, McClughen DC. Three steps forward and 

two steps back: Impacts of government action on people 

with pain and those who treat them. Pain Manag Nurs. 

2020;21:3-6. 

2. Ho LYW. A Concept Analysis of Coping with Chronic 

Pain in Older Adults. Pain Manag Nurs. 2019;20(6):563- 

571. doi:10.1016/j.pmn.2019.03.002 

3. Ashkenazy S, DeKeyser Ganz F. The Differentiation 

Between Pain and Discomfort: A Concept Analysis of 

Discomfort. Pain Manag Nurs. 2019;20(6):556-562. 

doi:10.1016/j.pmn.2019.05.003 

4. St. Marie B, Broglio K. Managing pain in the setting of 

Opioid Use Disorder. Pain Manag Nurs. 2020;21:26-34. 

Under investigation 

by the Virginia 

Board of Nursing? 

Eileen M. Talamante, Esq., R.N. 

Eileen is a nurse and an attorney, and is 

here to help you with licensing issues, 

investigations, and disciplinary matters 

before the Virginia Board of Nursing. 

2020 Outstanding 

Advocate Award 

goodmanallen.com 

ETalamante@goodmanallen.com 

(804) 565-3526 

DEDICATED TO SERVING THE LEGAL 

NEEDS OF VIRGINIA NURSES.



A Statewide Survey of Barriers and Supports for RN-BSN 

Program Enrollment 

Author names and affiliations 

Vivian Lisa Wilson, BSN, RN, CCRP 

Ellen Rachel Lockhart, MS 

Kimberly Ferren Carter, PhD, RN, NEA-BC 

Carilion Clinic, Roanoke, Virginia 

Corresponding author 

Vivian Lisa Wilson, BSN, RN, CCRP 

Funding 

This research did not receive any specific grant from 

funding agencies in the public, commercial, or not-forprofit 

sectors 

Acknowledgements 

The authors gratefully acknowledge the contributions 

of Stephanie DeFilippis BSN, RN, OCN, Diedre (Dee) 

Myers BS, Martha (Mattie) Tenzer BA, and the Magnet® 

Programs Directors of the Virginia Magnet Consortium for 

their assistance with the study. Cathy Jennings DNP, RN, 

ACNS-BC, FNAP and Cindy Ward DNP, RN-BC, CMSRN, 

ACNS-BC are acknowledged with appreciation for their 

proof-reading assistance. 

Based on strong evidence of improved patient 

outcomes, the Institute of Medicine (IOM, 2011) 

established an ambitious ten-year goal for organizations 

to have 80% of their nursing workforce to have a 

minimum of a BSN by 2020. Embracing this goal, 

the American Nurses Credentialing Center included 

standards within the Magnet Recognition Program® for 

organizations to document progress toward this goal 

(American Nurses Credentialing Center [ANCC], 2019). 

Despite expansion of RN-BSN programs (American 

Association of Colleges of Nursing, 2015), the 80% target 

was not achieved by 2020 (Spetz, 2018). 

A more educated nursing workforce would be 

better equipped to meet the demands of an evolving 

healthcare system, and meeting this need has been 

correlated to increasing the percentage of nurses 

with a BSN (ANCC, 2019; Committee on the Robert 

Wood Johnson Foundation Initiative on the Future 

of Nursing at the Institute of Medicine, 2011). An 

increase in the proportion of nurses with a BSN also 

would create a workforce poised to pursue higher 

levels of education at the master’s and doctoral 

levels required for nurses to serve as primary care 

providers, nurse researchers, and nurse faculty 

(IOM, 2011)– positions currently in great demand 

across the profession and within healthcare systems. 

During the first decade of the millennium, there 

was an increase in BSN percentages from 40% 

to 49% (Committee on the Robert Wood Johnson 

Foundation Initiative, 2011). From 2010 to 2014, BSN 

percentages grew slightly from 49% to 51% and by 

2014, fewer than 5% of all associate degree prepared 

nurses in the United States were enrolled in a BSN 

program (Phillips & Titzer Evans, 2017; Altman, 

Butler, & Shern, 2016). According to projection 

modeling, Spetz (2018) anticipates that by 2025 

only about 66% of RNs will have a BSN or higher 

education level. 

There is limited literature that addresses 

barriers and success factors for nurses to enroll 

and complete an RN-BSN program, and most of 

what has been published has been qualitative and 

thematic. In a study of 101 RNs in Connecticut, 

Delaney & Piscopo (2004) proposed a conceptual 

map based on study themes that included family 

barriers and competing demands, recognition 

(employers making it worthwhile), personal growth 

benefits, and academic flexibility. Lillibridge 

The Village at Orchard Ridge is creating an amazing, genuine and caring culture team. 

join our We CARE team! 

Now hiring for: 

RNs - FT 12 hr night shift & PRN • LPNs - PRN 

• CNAs - FT, PT and PRN • CMA (PRN) • MDS/QAPI Manager (FT) 

Our full time team members enjoy: 

Generous PTO plan • Medical, Dental, Vision insurance • 403(b) with 

discretionary employer match 

Now offering a Sign-On Bonus for all nursing positions!!! 

If you are interested in applying for a position, go to 

careers-nationallutheran.icims.com 

EOE 

& Fox (2005) identified themes among six RNs 

who completed an RN-BSN program: having an 

edge, not fitting in, need for support, looking at 

things differently, growth of knowledge, gaining a 

more global perspective, and feelings of personal 

accomplishment. A phenomenological inquiry of six 

RN-BSN students identified the incentives (right time 

in life, working with options, achieving a personal 

goal, credible professional identity, encouragement 

from contemporaries, and user-friendly programs) 

and barriers (time, fear, lack of recognition for 

past educational and life accomplishments, equal 

treatment of RNs regardless of education, and 

negative school experience) (Megginson, 2008). 

Winokur, Rutledge, & Hayes’ (2016) study of 191 

nurses at a Magnet® organization most often 

identified encouragement from other nurses as 

a factor to encourage enrollment, and age and 

family responsibilities were identified as barriers. 

Phillips and Titzer Evans’ (2017) concept analysis 

identified antecedents (personal and external), 

critical attributes (motivation, program flexibility 

and accessibility, and organizational support), 

consequences, and empirical referents to RN-BSN 

transition. Another phenomenological focus group 

study identified exhaustion, “fluffy” curricula, and 

cost as barriers to entering an RN-BSN program and 

online programs and affordability would encourage 

nurses to consider an RN-BSN (Sabio & Petges, 

2020). More work is needed to build upon what is 

known from qualitative studies to understand and 

quantify specifically what motivates and inhibits 

nurses from seeking a BSN after completing an 

entry to practice program. 

Although not identified by RN-BSN students or 

potential students in the aforementioned studies, 

Nininger, Abbott, & Shaw (2019) identified a possible 

barrier of earning an ADN from an institution 

without national nursing accreditation, noting that 

these students took longer to complete their RN- 

BSN programs. A retrospective predictive analysis of 

9,567 RN-BSN students found that younger students 

who received financial aid and had a previous 

baccalaureate degree were most likely to graduate 

and graduate sooner (Cipher, Mancini, & Shrestha, 

2017). 

The RN-BSN achievement is important to “elevate 

nurses’ individually and the profession of nursing 

collectively” (Delaney & Piscopo, 2004, p. 161). The 

purposes of this study were to quantify barriers to 

enrolling in an RN-BSN program and to identify 

ways to support prospective RN-BSN students to 

enter a program of study. 

Methodology 

This descriptive, multi-organizational survey 

study was determined to be research that is exempt 

NOW HIRING!! 

• Certified Nursing Assistant 

(Evening or Night Shift) Full 

Time with $1,000 Sign-On 

Bonus 

• Certified Nursing Assistant 

Part-Time/PRN 

• Licensed Practical Nurse Full Time 

and Part Time positions available 

For more information, call 804-524-7300. 

To learn more and apply, please visit 

https://virginiajobs.peopleadmin.com/ 

HIRAM W. DAVIS MEDICAL CENTER 

26317 WEST WASHINGTON STREET 

PETERSBURG, VA 23803


from Institutional Review Board (IRB) review under 

DHHS regulatory category 2. Emails were sent to the 

Magnet® Program Directors from the 28-member 

Virginia Magnet Consortium with a study 

explanation and request that those individuals 

forward the survey to licensed RNs within their 

organizations. The forwarded survey included 

additional information about the study and a link 

to the electronic survey. The first page of this link 

provided informed consent information approved 

by the IRB and a statement that completion of the 

survey implied consent. Study data were collected 

and managed using REDCap electronic data 

capture tools hosted at BLINDED (Harris, Taylor, 

Thielke, Payne, Gonzalez, & Conde, 2009). REDCap 

(Research Electronic Data Capture) is a secure, 

web-based application designed to support data 

management and collection for research studies. 

The sample included 599 respondents representing 6 

hospitals; however, all but 23 nurses were from two 

hospitals. Of the 599 respondents, 246 had already 

completed an RN-BSN program, and 353 had not. 

To ensure that only nurses who had their initial 

licensure as a diploma or associate prepared nurse 

were surveyed, a question was asked to screen out 

those who took their NCLEX exam with a BSN. 

For those remaining, smart-logic questions were 

administered depending on whether participants 

had or had not completed an RN-BSN program. 

Nurses who already had completed an RN-BSN 

program were asked to recall their barriers and 

success factors, and nurses who had not completed 

an RN-BSN program were asked about their 

current or perceived barriers and success factors. 

Respondents were asked to label each possible 

influence as: a significant barrier, somewhat a 

barrier, somewhat not a barrier, or not a barrier. For 

comparisons between study groups, a significant 

barrier and somewhat a barrier were combined 

into one analysis category, as were significant 

success factor and somewhat a success factor. 

Data was analyzed using SAS Enterprise Guide 7.1. 

Descriptive and Chi-square statistics were used 

with a pre-set alpha = 0.05. Commonalities among 

qualitative responses were analyzed to understand 

further the statistical findings. 

Findings 

Comparing the group who had completed an RN- 

BSN program to those who have not, there was no 

difference between the groups in gender, race, or 

number of children. A higher percentage of the BSN 

group was older (17% vs. 7%, age > 60), and the No- 

BSN group was younger (15% vs. 7%, age 20-30, p < 

0.0001). A higher percentage of the BSN group was 

married (71% vs. 58%), and the No-BSN group was 

more often single (18% vs. 10%, p < 0.0226). The 

BSN group reported a greater percentage of family 

income in the $125,000 or higher range (11% vs. 4%), 

while the No-BSN group had more family incomes in 

the $35,000-$74,000 range (14% vs. 7%, p < 0.0001). 

The perceived barriers to education for those 

who had earned an RN-BSN were compared to the 

perceived barriers of those who were either currently 

enrolled or not enrolled. None of the barriers for the 

BSN group was significantly more of a barrier than 

was perceived by the No-BSN group. Cost, no pay 

incentive, time away from work, time to complete 

the program, being out of school a long time, lack 

of tutoring support, fear of failure, and previous 

educational debt were all significantly higher for 

those who did not currently have a BSN (Table 1). 

Shared barriers between the groups reported by 

more than half of the respondents included: cost, 

no pay incentive, time away from family, and time to 

complete the program. 

Financial support was a somewhat or very 

important factor for both groups (BSN = 88%; No- 

BSN = 91%). Although high for both groups, family 

support was the only significantly higher success 

factor for the BSN group (BSN = 89%; No BSN = 75%, 

p< 0.001). Job support was identified as a success 

factor by 86% of the respondents in both groups. 

Significantly more in the No-BSN group identified 

tuition assistance from employers as a success factor 

(BSN = 70%; No BSN = 82%, p< 0.001). 

Although tuition assistance was an important 

success factor for the No-BSN group, nearly 19% 

of nurses without a BSN did not know if their 

institution had a tuition assistance program, 1% 

stated that their organization did not provide such 

a program, and the remaining 80% noted that 

their organization had tuition assistance. Nearly 

50% of nurses without a BSN who reported their 

organization had a tuition assistance program did 

not know how their organization’s program worked. 

Further, nurses from some organizations were not 

necessarily accurate in their understanding of what 

reimbursement was available for them. 

Of those without a BSN who provided additional 

feedback, 29% identified improvements they 

would like to see regarding tuition assistance and 

reimbursement. Many in this group stated that 

salary increases are not significant enough to incur 

the debt associated with advanced education and 

that more upfront, incremental reimbursements 

would be helpful in alleviating the financial strain 

of an advanced degree. Similarly, 31% in the BSN 

group indicated that loan forgiveness is important. 

This group had life situations that introduced 

specific challenges such as workplace or geography 

constraints and children needing college tuition 

assistance at the same time nurses were ready 

to further their own education. Additionally, 

respondents did not feel the employer’s list of colleges 

for which tuition assistance was offered provided a 

good fit for their learning needs (Table 2). 

Beyond tuition assistance from employers, the No- 

BSN group was significantly different from the BSN 

group in additional success factors to complete an 

RN-BSN program. Having a program partner (BSN 

= 18%, No BSN = 33%, p


Statewide Survey continued from page 15 

for RN licensure, the No-BSN group had practiced 0-1 years (13.3%), 2-10 years 

(32.3%), 11-20 years (24.2%), and more than 20 years (30.2%). 

Discussion and Recommendations 

Findings are consistent with earlier qualitative work, especially the 

incentives and barriers identified by Delaney & Piscopo (2004), Megginson 

(2008), and Phillips and Titzer Evans (2017). Differences in demographics, as 

well as barriers and success factors were apparent between the group that 

had previously completed an RN-BSN program (BSN) and the group that was 

considering or was currently enrolled (No-BSN). As would be expected, the 

BSN group was older (significantly more over age 60). The BSN group’s family 

income of greater than $125,000 increases the likelihood that they may be able 

to afford retirement when they reach traditional retirement age, if not before. As 

these BSN prepared nurses retire, and as fewer nurses enter RN-BSN programs 

(Phillips & Titzer Evans, 2017; Altman, Butler, & Shern, 2016), employers (at 

least those represented in this study) can anticipate a reduction in the overall 

percentage of nurses with a BSN in the workforce. The No-BSN group was 

younger, more often single, with lower incomes. In today’s economy, nurses 

indicated that their current life stages of new career, early marriage years, 

and young children made them reluctant to take on additional debt and time 

commitments. Traditional incentives used previously to encourage nurses to 

complete their BSN are less enticing, as the nurses in this study perceive more 

barriers and different support needed for their success in completing an RN- 

BSN program. 

Both the BSN and the No-BSN nurses identified financial concerns when 

considering entry into an RN-BSN program. The differences found in monetary 

concerns (cost, no pay incentive, and previous debt) between groups may 

be explained by the significant disparity in family income between the two 

groups and differences in marital status. Lack of dual income due to higher 

singleness in the No-BSN nurses likely influences how much expendable 

income is available to finance another degree especially while still contending 

with previous educational debt, how much work time can be missed to pursue 

education, and how much time can be devoted to studying outside of work. 

The findings indicate an opportunity for organizations to support nurses 

to enter RN-BSN programs by clarifying and publicizing the details of the 

reimbursement offered through employer sponsored tuition assistance 

programs. Current pay differentials for completion of a BSN, when known, 

were perceived as inadequate incentive for enrollment in an RN-BSN program. 

Respondents noted that more substantial and frequent contributions toward 

tuition assistance and increased flexibility in reducing the number of work 

years required to stay within a company or geographic region would encourage 

nurses who may be uncertain about where life events might take them in the 

years following their education. Additionally, employers should reconsider the 

amount of compensation given for achievement of a BSN to incentivize more 

nurses to seek the credential. If employers would promote additional education 

as a means to earn significantly more money or open leadership opportunities, 

more than one-third of nurses indicated they would be incentivized to earn an 

RN-BSN. 

Employer expectations were not a strong motivator for nurses in the No-BSN 

group, indicating an opportunity for employers to consider workplace-specific 

ways to make continuing education more attractive to nurses. For example, 

support with work-life balance and scheduling were perceived as important. 

Employers and academic institutions can collaborate to provide opportunities 

for support for nurses to complete the enrollment and pre-requisite processes, 

as well as to navigate successfully through the program. Job-sharing, regularly 

reviewing and mentoring individual nurse goals, providing paid work time 

to study, and designing study lounges equipped with technical support and 

computer assistance were suggested as ways that would support nurses to 

obtain their BSN or advanced degrees. 

Innovative collaborations between employers and academic institutions 

offering RN-BSN programs are needed to address the differences in the current 


potential applicant pool, including strategies to support development of program 

partners, technical/computer support, assistance with writing and test-taking, 

and the ability to study at work. Respondents suggested study labs offered 

during paid work time to provide this support. Support is a factor that has been 

identified as important by others (Winokur, Rutledge, & Hayes, 2016). 

Many respondents with bachelor’s degrees in other fields expressed 

frustration that BSN programs did not acknowledge prior academic credit or 

learning demonstrated by other degrees or experience (work or life). They noted 

that more recognition of their prior education and life/work experience would 

be a greater motivator for them to pursue a BSN degree. Their frustration was 

expressed in comments, such as: 

“More credits for work experience. For example, why should I be required to take 

a public health nursing class when I have previously been employed for several 

years as a public health nurse. I have been a nurse for over 30 years. Does that 

not count for something?” 

Many respondents with bachelor’s degrees in other fields expressed 

dissatisfaction with the expectation of obtaining another baccalaureate rather 

than advancing into a master’s degree: 

“I already have a bachelor’s degree in an unrelated field plus ADN. I think it’s 

ridiculous that I’m forced to get a second bachelor’s degree and take the time 

away from my family just to meet a requirement. I could understand if I didn’t 

have a bachelor’s degree at all, but who needs two bachelor’s degrees?!” 

“A second bachelor’s degree doesn’t make sense at this point in my life. A 

master’s or higher with bridge course work is ideal.” 

“I love learning and would enjoy pursuing other topics that would benefit me 

more as a nurse than the typical BSN curriculum. I am currently enrolled in a 

BSN program… which feels like a step backwards, but if I want to keep working 

at [institution identity withheld], I have to complete a BSN. With the nursing 

shortage in specialty areas and nursing burnout, I feel our nursing profession 

has again taken a wrong turn by creating a “cookie cutter” culture of what a 

nursing education should be.” 

Although ADN to BSN/master’s degree articulation programs exist (Moody, 

Teel, & Pelzer, 2018), more of these programs, and communication of their 

existence, is needed to support meaningful growth for nurses as they consider 

the best next steps in their education. 

More than half (52%) of the BSN group did not enroll in an RN-BSN program 

until having been an RN for more than 5 years. Another 34% enrolled between 1 

and 5 years. In other words, 86% of those who completed an RN-BSN program did 

so within the first 5 years after graduation from their initial licensure program. 

However, more nurses in the No-BSN group had been out of school longer. 

As a result, the No-BSN group reported a more significant fear of failure. They 

perceived more needs for academic support and resources than had been offered 

in the past. To enhance BSN rates, strategies to shift the percentage of enrollment 

sooner would help to alleviate the barriers of fear of failure and being out of 

school a long time that were significantly reported by nurses without a BSN. 

Schools of nursing play a key role in providing strong messaging about 

continuing BSN education soon after graduation and can impact proactive 

career path planning (Jeffreys, 2020). Creative models such as dual enrollment 

programs (achieving baccalaureate credits while completing associate degree 

education) are also promising to support associate’s to BSN transitions (Bopp & 

Einhellig, 2017). Additionally, effective advising of the implications of obtaining 

an associate level preparation rather than an accelerated BSN or RN-MSN for 

those choosing to become a nurse after earning an initial baccalaureate degree 

in another field is important. Further, providing affordable accelerated BSN 

degree programs for second degree students would help the profession to grow 

more BSN prepared nurses from second degree RNs. 

This study was limited by a non-interventional descriptive design. Also, 

although this was a statewide survey, sampling was limited to ANCC Magnet® 

hospitals in Virginia. Nurses at other hospitals may differ. Most respondents 

were from two of the Magnet hospitals sampled, resulting in limited 

interpretation of findings. 

Conclusion 

This study showed that a decreasing percentage of BSNs can be expected in 

the organizations represented in the study. Educational mobility of ADN and 

diploma RNs to the BSN level is crucial to positive patient outcomes, creation of 

a credible professional identity, and cohesion among nurses (Megginson. 2008). 

Innovation and collaboration between schools of nursing and employers are 

needed to overcome barriers and provide support for nurses to achieve a BSN. 

Communication about existing and new programs, as well as advising and career 

coaching, are important strategies to achieve a higher percentage of BSNs in the 

workforce. As academic and healthcare organizations sort out how best to address 

workforce needs and severe shortages, especially with new challenges introduced 

by the COVID-19 pandemic (Spurlock, 2020), it is important to be ever vigilant to 

the importance of BSN preparation for best patient outcomes,to not lose sight of 

the 80% BSN goal and to support nurses to achieve their RN-BSN degree. 

www.radford.edu/gradapply 

References 

Altman, S. H., Butler, A. S., Shern, L., (Eds). (2016). Assessing progress on the future of 

nursing. Washington, DC: National Academies Press. 

American Association of Colleges of Nursing. (2015, March 09). New AACN Data confirm 

enrollment surge in schools of nursing. Press release available at: https://www. 

aacnnursing.org/News-Information/Press-Releases/View/ArticleId/21556/enrollment 

American Nurses Credentialing Center. (2019). Magnet® Application Manual. Silver 

Spring, MD: Author. 

Bopp, A. & Einhellig, K. (2017). Dual enrollment nursing partnerships: Steps to 

successful implementation. Nursing Education Perspectives, 38(2), 106-107. DOI: 

10.1097/01/NEP.0000000000000119 

Cipher, D., Mancini, M., & Shrestha, S. (2017). Predictors of persistence and success in an 

accelerated online RN-to-BSN program. Journal of Nursing Education, 56(9), 522-526. 

https://doi.org/10.3928/01484834-20170817-02 

Committee on the Robert Wood Johnson Foundation Initiative on the Future of Nursing 

at the Institute of Medicine. (2011). The future of nursing: Leading change, advancing 

health. Washington, DC: National Academies Press. 

Delaney, C. & Piscopo, B. (2004). RN–BSN programs: Associate degree and diploma 

nurses’ perceptions of the benefits and barriers to returning to school. J Nurses Prof 

Dev, 20(4), 157–161.


Harris, P., Taylor, R., Thielke, R., Payne, J., Gonzalez, N., Conde, J. (2009). Research 

electronic data capture (REDCap - A metadata-driven methodology and workflow 

process for providing translational research informatics support. Journal of Biomedical 

Information, 42(2), 377-381. 

Jeffreys, M. (2020). AND-BSN articulation, academic progression, and transition: A 

proactive, holistic approach. Nurse Educator, 45(3), 155-159. Doi: 10.1097/NNE. 

0000000000000708. 

Lillibridge, J. and Fox, S. (2005). RN to BSN education: What do RNs think? Nurse 

Educator, 30(1), 12-16. 

Megginson, L. (2008). RN-BSN education: 21st century barriers and incentives. Journal of 

Nursing Management, 16, 47–55. 

Moody, L., Teel, C., & Peltzer, J. (2018). Advancing nursing education: BSN completion 

messaging materials for associate degree program nursing faculty. Nursing Education 

Perspectives, 39(6), E21-E25. Doi: 10.1097/01.NEP.0000000000000342 

Nininger, J., Abbott, M., & Shaw, P. (2019). Eradicating barriers to advancement from RN 

to BSN: An exploratory study. Journal of Continuing Education in Nursing, 50(1), 15-19. 

https://doi.org/10.3928/00220124-20190102-05 

Phillips, T., Titzer Evans, J. (2017). RN to BSN transition: A concept analysis. J Nurses 

Prof Dev, 33(2), 79-85. 

Sabio, C. & Petges, N. (2020). Understanding the barriers to BSN education among ADN 

students: A qualitative study. Teaching and Learning in Nursing, 15, 45-52. ODOI: 

10.1016. j.teln.2019.08.007. 

Spetz, J. (2018). Projections of progress toward the 80% Bachelor of Science in Nursing 

recommendation and strategies to accelerate change. Nursing Outlook, 66, 394-400. 

https://doi.org/10.1016. j.outlook.2018.04.012. 

Spurlock, D. (2020). The nursing shortage and the future of nursing education is in 

our hands (Editorial). Journal of Nursing Education, 59(6), 303-304. https://doi. 

org/10.3928/01484834-20200520-01 

Winokur, E., Rutledge, D., & Hayes, A. (2016). Magnet® facility nurses: Pursuing a 

baccalaureate degree in nursing. Journal of Professional Nursing, 32(4), 283-291, 

https://doi.org/10.1016/j.profnurs.2015.11.003 

Table 1. Perceived Barriers to Completing an RN-BSN Program 

Barriers 

(Somewhat or Significant) BSN Group % No BSN Group % p-value 

Cost 67 85


Reflections... continued from page 12 

As the spouse of an air force officer, Gonzalvo’s nursing leadership career has 

spanned seven states, with various roles in case management and transitions of 

care, quality improvement, risk management, regulatory, education, maternal and 

child health, medical surgical nursing, intermediate care, pediatrics, community 

health and long term care across the healthcare continuum. 

She reflects that, “While life has its ups and downs, my biggest challenge 

was transplanting my career from the Philippines to the United States in 1977. 

Together with my best friend, arriving in the United States aboard Pan Am with 

two suitcases, bright eyed and bushy tailed, ready to heal mankind, attend 

graduate school and spread my wings, not fully realizing that clinical experience, 

a BSN education and a great desire to professionally practice nursing were not 

enough to succeed in this field. Being asked if we lived in trees, had TVs, spoke 

English, walked a few steps behind spouses, plus many more prejudices and 

stereotypical questions truly shocked me.” 

Post retirement, she continues her volunteer work, representing the city of 

Virginia Beach with the Senior Services of Southeastern Virginia, serving as its 

chair of the Strategic Planning Committee. She also serves in a similar capacity 

with the Access Partnership Board of Directors. Her passion for nursing is reflected 

in her commitment to the Philippine Nurses Association of Virginia. She was the 

previous chair of the Health and Wellness Committee and is now the president 

elect with the incoming executive board, as well as chair of the Constitution and 

Bylaws Committee. At the national level, with the Philippine Nurses Association of 

America, she has been appointed as the chair of the Ethics Committee. 

In 1974, Gonzalvo graduated with a BSN with honors, at St. Paul College of 

Manila. That same year, she was selected as one of Manila’s Outstanding Coeds. 

Prior to her leaving for the United States, she started her master’s in education at 

the De La Salle University in Manila. In 1989, she earned her master’s in public 

administration, with a major in health services management from the Golden 

Gate University in California. 

Throughout the years, Gonzalvo has been active in several professional 

organizations. She was the chair of the National Board for Case Management, 

spearheading the ACM certification process, and president of the Ohio Association 

for Healthcare Quality to name a couple. In her college years, she was the vice 

president of the national Philippine Nursing Students Association. 

Catherine Paler, MSN, RN, PCCN holds a BSN from 

Old Dominion University in Norfolk, and a master’s in 

nursing education and faculty from Drexel University 

in Philadelphia, Pennsylvania. She is also certified 

in progressive and critical care nursing through the 

American Association of Critical Care Nurses. Paler 

actively works as a bedside nurse in the oncology 

department at Sentara Princess Anne Hospital (SPAH) 

and part time as an adjunct nursing professor for Old 

Dominion University and South University’s bachelor’s 

of science programs. In addition to her full time work, 

she chairs the Evidence-based Practice Council at 

SPAH. Paler is an active member of the American Nurses Association, the Virginia 

Nurses Association, the National League of Nurses, and the Philippine Nurses 


Association of Virginia (PNAVA). She is actively involved in the Filipino community 

and is the incoming president for PNAVA for the 2020-2022 term. 

When asked how COVID-19 has impacted her career and view of being a nurse, 

Paler replied that, “Being a nurse requires us to be prepared for the unexpected 

whether it be drastic changes in our patient’s condition or a disaster drill. I once 

believed that I was prepared for anything, but nothing could have prepared me 

for a pandemic. We could not celebrate 2020 “The Year of the Nurse and Midwife” 

as we would traditionally. The acts of kindness, the generosity and outpouring of 

food and supplies from random citizens and community groups were enough to 

recognize us as a noble profession. Nursing is still and always will be my duty to 

serve.” 

Angel E. Deguzman, BSN, RN is a retired captain US 

army nurse. He has a diverse academic background and 

has attended the following institutions: Mapua Institute 

of Technology majoring in Mechanical Engineering, 

the University of the East majoring in accounting, the 

Philippine Maritime Institute majoring in navigation, the 

University of Santo Tomas majoring in advertising and 

fine arts, and the University of New York majoring in 

nursing. Deguzman also completed the AMEDD Officer 

Basic Course for the US army in San Antonio Texas 

and the Emergency Medical Response to Agents and 

Weapons of Mass Destruction with the US army 63rd 

Regional with Support Command California. 

Deguzman is a lifetime member of the Philippine American Veterans of 

Hampton Roads and is a member of the Batangas Association and the American 

Legion. His major accomplishments include receiving the Vietnam Service Medal, 

receiving four Army Commendation Medals for outstanding performance as an 

army nurse, and receiving the Meritorious Service Medal after retiring from the 

US army for exceptional service of 24 years. Angel also orchestrated the opening 

of the Crisis Stabilization Unit as the director of nursing, a unit that specializes 

in nursing care of mental health and substance abuse in the city of Virginia 

Beach. From 2016 to 2018, Deguzman was the president elect of the Phillipine 

Nurses Association of Virginia and also served as the chairperson for the PNAVA 

Bylaws Committee. From 2019 to 2020, he served as president of PNAVA. 

Deguzman relays that, “A common misconception about nursing is that people 

often minimize the role because they do not truly understand how much nurses 

do for and contribute to patient care. This has never been more prominent than 

now with COVID-19 pandemic. Many people are more uneducated about this 

virus and how it is spread. Many times, nurses are harassed and even blamed 

for the spread of this virus in the hospitals and facilities. What people do not 

understand is that the nursing profession is one of selflessness. We often put the 

needs of others before our own needs, even the needs of our families. In my role as 

a psychiatric nurse, I am very aware of the hierarchy of need and the importance 

of having these needs met. But when the needs of a patient arise… they become 

priority. Many people don’t realize the number of hours a nurse may go without 

going to the bathroom or how many meals a nurse may skip in order to take care 

of a patient and their families. I believe that if people truly understood this they 

would have a different view of the nursing field.” 

To read the full interview transcript, go to https://tinyurl.com/y3x9rxje. For more 

information on the Phillipine Nurses Association of Virginia, visit https://pnava.org/. 

To read the Business Insider article, “Filipinos make up 4% of nurses in the US, but 

31.5% of nurse deaths from COVID-19,” go to https://tinyurl.com/y585eo6a.


2020 Special Legislative Session Recap 

Governor Ralph Northam called the Virginia 

General Assembly into a special session on August 

18, to make changes to the biennial budget, 

address matters related to COVID-19, and to 

advance criminal and social justice reforms. The 

World Health Organization declared a pandemic 

on March 11, just one day before the 2020 regular 

session adjourned, and legislative leaders worked 

with the governor in March and April to freeze new 

spending and take a wait-and-see approach to the 

budget. The intent was then to call this special 

session and amend the commonwealth budget 

based on an updated revenue forecast and changing 

priorities related to the pandemic. Tragic events 

during the summer, including the death of George 

Floyd, brought social and criminal justice reforms to 

the forefront of matters to be taken up during the 

special session, as well. 

Technically speaking, the legislature is still in 

special session but their work has been completed, 

including action on legislation and the amended 

biennial budget. Now the governor will have an 

opportunity to review these items and sign them, 

recommend amendments, or veto items with a 

deadline to act shortly after Election Day. Members 

will then reconvene again to consider the 

governor’s recommendations and formally adjourn 

the session in November. 

A Virtual Session 

While both chambers began the session in 

person, the Senate at the Science Museum of 

Virginia and the House at VCU’s Siegel Center, the 

House of Delegates would quickly transition into 

the legislature’s first ever fully virtual session. In 

order to prevent the spread of COVID-19 among 

House members, the body opted for video conference 

committee meetings and floor sessions. The Senate 

instead opted to meet socially distanced, but in 

person, and take public comment in committee 

meetings via video conference. So far at least three 

delegates and one senator have contracted the virus, 

but fortunately all have recovered. 

The Virginia Nurses Association prepared to 

offer virtual testimony in each committee meeting 

on legislation related to nursing’s public policy 

platform. VNA Commissioner on Government 

Relations Mary Kay Goldschmidt led this effort and 

did a fantastic job representing VNA on important 

legislation when possible. Unfortunately, committees 

did not always take public comment on bills and on 

occasion did not call on members of the public who 

had signed up to speak. This reality has made direct 

contact from nurses to their legislators even more 

important as we navigate the pandemic and virtual 

legislative sessions, likely into the 2021 regular 

session. VNA led several action campaigns related 

to legislation, and through these, nurses across 

the commonwealth sent more than 7500 emails to 

legislators during this special session. 

VNA Public Policy Platform 

Working with the Virginia Legislative Nursing 

Alliance (read more about the VLNA in our 

Public Policy Platform article!), VNA led efforts to 

unite nurses around a single platform. Leaders 

from nursing organizations throughout the 

commonwealth This was a similar effort to recent 

years, but we saw more input and participation than 

ever before. Nurses focused in on five key areas for 

the special session: 

1. Restoring funding for the Nursing Preceptor 

Incentive Program 

2. Establishing a COVID-19 Workers’ 

Compensation Presumption for Healthcare 

Workers 

3. Reducing Unnecessary Practice Restrictions 

for Nurses Consistent with Governor’s 

Executive Order 

4. Ensuring Registered Nurses in Public Schools 

5. Increasing Access to Telehealth in Virginia 

Due to ongoing budgetary constraints and a 

desire to limit the focus of the special session, many 

of these priorities were defeated and deferred by 

the legislature to the 2021 regular session. Limited 

resources precluded restoring preceptor funding and 

school nurses at this point, as did the fiscal impact 

to local governments for the workers’ compensation 

presumption. The workers’ compensation 

presumption legislation was an omnibus approach 

that included a variety of professions, many of 

which are local government employees, and while 

the House of Delegates approved and funded the 

legislation, the Senate Finance Committee defeated 

the measure. 

The legislature also declined to advance 

legislation to make permanent the governor’s 

executive order reducing the timeframe for a nurse 

practitioner to practice without a practice agreement 

from five years to two years. However, they did 

include language (https://tinyurl.com/y487q2k5) in 

the budget that extended this policy through the life 

of the emergency declaration since the governor’s 

order expired in September. 

Delegate Dawn Adams and Senator George 

Barker successfully advanced legislation to expand 

access to telehealth. Specifically, their legislation 

provides reimbursement for telehealth services 

regardless of the originating site, including at home. 

That was a significant reform that had previously 

been defeated due to anticipated costs. The bill also 

prohibits requiring the use of proprietary technology 

or applications in order to be reimbursed for 

services rendered and requires DMAS to continue 

reimbursement for telemedicine via audio only for 

covered services through July 1, 2021. Governor 

Northam has since given the legislation his approval 

but recommended an amendment to make the 

legislation effective immediately. The legislature will 

vote on this change in early November. 

For the full list of bills we followed during the 

special session, including their summary and 

status, visit https://tinyurl.com/y4bykpwb. 

2021 Regular Session 

The next regular legislative session is set to begin 

at noon on Wednesday, January 13. This will be a 

“short session” of 45 days, as is customary in oddnumbered 

years. The legislature will again make 

adjustments to the state budget and take up other 

legislation, though it is anticipated that members 

will be limited in the number of bills they may 

introduce. While nothing has been announced thus 

far, most observers expect a virtual session similar 

to the special session. Many legislators will have the 

next election on their mind as all 100 House seats 

will be on the ballot in November of 2021 as well as 

the election for Governor, Lieutenant Governor, and 

Attorney General. Numerous Delegates and Senators 

have declared their intent to run for statewide office. 

As most issues from the nursing agenda were 

deferred to the 2021 regular session, the public 

policy platform will remain largely intact. Additional 

measures to be included in the agenda will likely 

include prescriptive authority for clinical nurse 

specialists and legislation to enable nurses to 

confidentially participate in a peer to peer wellness 

program, similar to what was enacted for physicians 

in 2020. 

Virtual Legislative Receptions and Lobby Days 

As we prepare for the 2021 Regular Session, our 

regional legislative receptions took place virtually! 

VNA held 12 virtual Advocacy Hours with legislators 

and their constituents from throughout Virginia. We 

will be continuing our virtual advocacy during the 

2021 session. Sign up for our action alerts to join 

our advocacy efforts, tinyurl.com/VAactionRN. 

For more information on VNA’s annual Lobby 

Days, visit https://virginianurses.com/page/ 

LobbyDays. 

NOW 

HIRING 

NURSES 

www.saintmaryshome.org


The Importance of Nurses Addressing Implicit Bias 

Ahnyel Jones-Burkes, DNP, RN-BC 

Director of Leadership and Professional Development 

Reprinted with permission from Louisiana State Nurses Association 

Pelican News July 2020 issue 

Implicit Bias functions in an unconscious or unintentional manner, and this 

type of bias does not necessitate the perceiver to approve it or dedicate attention 

to its expression (Blair, Steiner & Havranek, 2011) Research shows there is a 

correlation between implicit bias and healthcare disparities. Issues like Covid-19 

and maternal mortality have highlighted the impacts of health dipartites. The 

Center for Disease Control defines Health Disparities as preventable differences 

in the burden of disease, injury, violence or opportunities to achieve optimal 

health that are experienced by socially disadvantaged populations. (Centers 

for Disease Control and Prevention, 2018). We are in the perfect position as 

the most trusted profession to ensure we address healthcare disparities while 

guarding against implicit and explicit biases because it can negatively impact 

patient care. 

Health Disparities can be caused by poverty, environmental threats, 

inadequate access to health care, individual and behavioral factors, and 

educational inequalities (Centers for Disease Control and Prevention, 2018) In 

recent events we have seen just how important it is to understand the issues 

impacting the communities we serve. These events should strengthen our 

commitment as a profession to provide the best possible care for each patient 

every time. 

We must strive for health equity which is defined by Healthy People 2020 

as the “attainment of the highest level of health for all people” (Healthy People 

2020). To achieve health equity, we as healthcare providers must take an active 

role in examining the patient holistically while striving to eliminate all barriers 

and biases. 

The Institute for Healthcare Improvement recommends the below strategies to 

reduce Implicit Bias: 

• Stereotype replacement – identifying responses based on stereotypes and 

consciously changing the response. 

Counter-stereotypic imaging – Imaging the individual as the opposite of 

the stereotype 

• Individuation – Seeing the person as an individual rather than a 

stereotype (e.g., learning about their personal history and the context that 

brought them to the doctor’s office or health center) 

• Perspective taking – “Putting yourself in the other person’s shoes” 

• Increasing opportunities for contact with individuals from different groups 

– Expanding one’s network of friends and colleagues or attending events 

where people of other racial and ethnic groups, gender identities, sexual 

orientation, and other groups may be present 

• Partnership building – Reframing the interaction with the patient as one 

between collaborating equals, rather than between a high-status person 

and a low-status person 

(IHI Multimedia Team, 2017) 

The above recommendations also align with recommendations from the Joint 

Commission regarding overcoming implicit bias. If you would like to gauge your 

own implicit bias there is an assessment which is a free tool named the Implicit 

Association Test. 

References 

Blair, I. V., Steiner, J. F., & Havranek, E. P. (2011). Unconscious (implicit) bias and health 

disparities: where do we go from here?. The Permanente journal, 15(2), 71–78. 

Centers for Disease Control and Prevention. “Disparities.” Centers for Disease Control and 

Prevention, Centers for Disease Control and Prevention, 17 Aug. 2018, www.cdc.gov/ 

healthyyouth/disparities/index.htm 

“Disparities.” Disparities | Healthy People 2020, www.healthypeople.gov/2020/about/ 

foundation-health-measures/Disparities. 

IHI Multimedia Team. “How to Reduce Implicit Bias.” Institute for Healthcare 

Improvement, 26 Sept. 2017, www.ihi.org/communities/blogs/how-to-reduceimplicit-bias 

Red Cross Volunteers 

Needed 

The Virginia Region of the American Red Cross has an 

immediate and urgent need to support the areas of sheltering, 

health services, and blood donation support. The American 

Red Cross works to prevent and alleviate human suffering in 

the face of emergencies. The volunteer support of nurses is 

crucial to their success. 

The volunteer support of nurses is foundational in helping 

Red Cross chapters, as they hold a strong legacy with the 

American Red Cross. Currently, more than 20,000 nurse 

volunteers are involved in providing disaster services, 

teaching and developing courses, managing blood drives and 

other leadership roles throughout the Red Cross. Simply go to 

https://www.redcross.org/volunteer/become-a-volunteer.html to 

become a volunteer today.

2200022000 

NNNOOVEEEEEEMBEEEEEERRR 1000 

TTTUEEEEEESSDDDAAAY, 

LLEEGIIISSLLATTIIIVEE SSUMMMMIIITT 



RRREEEEEEGIIISSTTTRRRAAATTTIIIOONNN DDDEEEEEEAAADDDLIIINNNEEEEEE: 11/ 7

PRROGGRRAAAM AAAGGENDAAA 


VVVVVVDDDHHH CCCCCCCOOVVVVVVIIIIDDD-19 UUUppppppddddddddaaaaaaaatttttttteeeeeeee 

Maaaaaaaakkiiiiiiiinnnnnnnngggggggg Yoooooooouuuuuuuurrrrrrrr VVVVVVooooooooiiiiiiiicccccccceeeeeeee CCCCCCCoooooooouuuuuuuunnnnnnnntttttttt! 

SSeeeeeeeennnnnnnndddddddd quuuuuuuueeeeeeeessssssssttttttttiiiiiiiioooooooonnnnnnnnssssssss ffffoooooooorrrrrrrr VVVVVVDDDHHH ttttttttoooooooo 

eeeeeeeebbuuuuuuuucccccccckk@vvvviiiiiiiirrrrrrrrggggggggiiiiiiiinnnnnnnniiiiiiiiaaaaaaaannnnnnnnuuuuuuuurrrrrrrrsssssssseeeeeeeessssssss.ccccccccoooooooommmmmmmm 

Weeeeeeeellllllllccccccccoooooooommmmmmmmeeeeeeee & CCCCCCCoooooooommmmmmmmmmmmmmmmoooooooonnnnnnnnweeeeeeeeaaaaaaaalllllllltttttttthhhhhh UUUppppppddddddddaaaaaaaatttttttteeeeeeee 

LLeeeeeeeeaaaaaaaadddddddd TTTThhhhhhrrrrrrrroooooooouuuuuuuugggggggghhhhhh AAAddddddddvvvvooooooooccccccccaaaaaaaaccccccccyyyyy aaaaaaaannnnnnnndddddddd AAAccccccccttttttttiiiiiiiivvvviiiiiiiissssssssmmmmmmmm 

HHHeeeeeeeeaaaaaaaalllllllltttttttthhhhhh CCCCCCCaaaaaaaarrrrrrrreeeeeeee iiiiiiiinnnnnnnn VVVVVViiiiiiiirrrrrrrrggggggggiiiiiiiinnnnnnnniiiiiiiiaaaaaaaa:: PPPPPPeeeeeeeerrrrrrrrssssssssppppppeeeeeeeeccccccccttttttttiiiiiiiivvvveeeeeeeessssssss 

ffffrrrrrrrroooooooommmmmmmm oooooooouuuuuuuurrrrrrrr PPPPPPoooooooolllllllliiiiiiiiccccccccyyyyy LLeeeeeeeeaaaaaaaaddddddddeeeeeeeerrrrrrrrssssssss 

TTTThhhhhheeeeeeee PPPPPPoooooooolllllllliiiiiiiittttttttiiiiiiiiccccccccaaaaaaaallllllll CCCCCCClllllllliiiiiiiimmmmmmmmaaaaaaaatttttttteeeeeeee aaaaaaaannnnnnnndddddddd UUUnnnnnnnnddddddddeeeeeeeerrrrrrrrssssssssttttttttaaaaaaaannnnnnnnddddddddiiiiiiiinnnnnnnngggggggg 

IIIIttttttttssssssss IIIImmmmmmmmppppppaaaaaaaacccccccctttttttt oooooooonnnnnnnn VVVVVViiiiiiiirrrrrrrrggggggggiiiiiiiinnnnnnnniiiiiiiiaaaaaaaa PPPPPPoooooooolllllllliiiiiiiiccccccccyyyyy 

CCCCCCClllllllloooooooossssssssiiiiiiiinnnnnnnngggggggg SSeeeeeeeessssssssssssssssiiiiiiiioooooooonnnnnnnn:: AAA TTTTiiiiiiiimmmmmmmmeeeeeeee ooooooooffff CCCCCCChhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee 

aaaaaaaannnnnnnndddddddd aaaaaaaa TTTTiiiiiiiimmmmmmmmeeeeeeee ooooooooffff OOppppppppppppoooooooorrrrrrrrttttttttuuuuuuuunnnnnnnniiiiiiiittttttttyyyyy 

Nuuuuuuuurrrrrrrrssssssssiiiiiiiinnnnnnnngggggggg’ssssssss PPPPPPuuuuuuuubblllllllliiiiiiiicccccccc PPPPPPoooooooolllllllliiiiiiiiccccccccyyyyy IIIIssssssssssssssssuuuuuuuueeeeeeeessssssss

Virginia Nurses Today - November 2020

Create successful ePaper yourself

Delete template?

Save as template?