WAVLD Symposium Handbook_V4.indd - csiro

Symposium Proceedings 

HOSTS GOLD SPONSOR 

13TH INTERNATIONAL WORLD ASSOCIATION OF 

VETERINARY LABORATORY DIAGNOSTICIANS SYMPOSIUM 

11–14 November 2007 

Crown Promenade Melbourne AUSTRALIA 

www.wavld2007.com

WELCOME 

It is our pleasure to welcome you to the 2007 World Association of Veterinary Laboratory Diagnosticians biennial symposium 

held in conjunction with the World Animal Health Organisation (OIE). The timing of this meeting could not be more 

appropriate given the challenges brought by Avian Infl uenza, Bluetongue and Foot and Mouth Disease in Europe, Africa and 

Asia and, here in Australia, Equine Infl uenza. Equally, the attention given by regulatory authorities to biosafety, biosecurity, 

bio-terrorism and select agent management issues continues to occupy us. 

The organising committee have brought together a wide array of internationally renowned speakers. We would like to thank 

our generous sponsors for enabling us to achieve this. 

The fi rst day focuses on trans-boundary animal diseases with specialised sessions on avian infl uenza, foot and mouth 

disease and bluetongue. Prompted by the current epidemic in Australia, there is also a special session on equine infl uenza. 

Day Two belongs to the OIE and, chaired by Professor Steve Edwards, provides an insight into a wide array of new approaches 

to disease diagnosis. On Day Three we focus on issues that are critical to current laboratory management, 

including the use of new and developing technologies. 

Of course no meeting of this size can proceed without a social program and we hope that you will be well entertained. 

We have great pleasure in inviting you to our conference dinner, highlighted by a presentation by the Nobel Laureate 

Professor Peter Doherty. But let’s not forget that Melbourne is a beautiful city, well known for its many attractions and vast 

range of restaurants for you to enjoy. 

Whether a visitor from overseas or Australia, we welcome you to Melbourne for what we hope will be a most memorable 

Scientifi c and Social Program. 

Martyn Jeggo Peter Kirkland 

Joint Chair WAVLD 2007 Joint Chair WAVLD 2007 

Director President 

CSIRO Livestock Industries AAVLD 

Australian Animal Health Laboratory 

CONTENTS 

WELCOME & CONTENTS ..............................................................................................................................................3 

SPONSOR ACKNOWLEDGEMENT & COMMITTEE..........................................................................5 

INVITED SPEAKERS ..................................................................................................................................................8 – 9 

PROGRAM .......................................................................................................................................................................10 – 13 

POSTER LISTING ....................................................................................................................................................16 – 17 

EXHIBITION FLOORPLAN ........................................................................................................................................18 

EXHIBITOR LISTING .......................................................................................................................................................19 

SOCIAL PROGRAM & DINING IN MELBOURNE .................................................................20 – 21 

WAVLD ORAL PRESENTATIONS ......................................................................................................22 – 122 

WAVLD POSTER PRESENTATIONS ...........................................................................................123 – 225 

WAVLD 2007, 11 – 14 November 2007 | 3 4

SPONSORSHIP 

SPONSORS 

WAVLD 2007 extends its appreciation to the following sponsors for their support: 

GOLD SPONSOR 

SILVER SPONSORS 

Includes Sponsorship of: 

SYMPOSIUM DINNER 

MORNING OR AFTERNOON TEAS 

DELEGATE SPONSORSHIP 

Welcome Reception 

ORGANISING COMMITTEE 

Dr Martyn Jeggo 

Co-Convenor 

Dr Peter Kirkland 

Co-Convenor 

Dr Peter Daniels 

Secretary 

Dr Russell Graydon 

Local Arrangements Committee Chair 

Delegate Name 

Badge & Lanyard 

Poster Area & 

Internet Cafe 

Symposium Cafe 

WAVLD 2007 SYMPOSIUM MANAGERS 

The Meeting Planners 

91–97 Islington Street 

Collingwood Victoria 3066 

tel: +61 3 9417 0888 

fax: +61 3 9417 0899 

email: wavld2007@meetingplanners.com.au 

W W W . M E E T I N G P L A 

N E R S . C O M . A U 

WAVLD 2007, 11 – 14 November 2007 | 5 

The pace of leadership. 

Institut Pourquier and IDEXX Laboratories are proud to join forces to sponsor 

the World Association of Veterinary Laboratory Diagnosticians. 

Renowned medical research and 

development since 1878. 

A wholly owned subsidiary 

of IDEXX Laboratories, Inc. 

© 2007 IDEXX Laboratories, Inc. All rights reserved. • 7406-00

The science of innovation. 

Institut Pourquier joined IDEXX Laboratories in March 2007 and together will 

continue unparalleled research, development and support of the most advanced 

animal health diagnostics, services and solutions in the world. 

Innovative production animal 

services since 1984. A worldwide 

leader in veterinary, food 

and water biotechnology. 

INVITED SPEAKERS 

Dr Tammy Beckham 

Dr Beckham received her Doctorate of Veterinary 

Medicine from Auburn University in 1998. While still 

at Auburn, she furthered her education through a 

Doctoral program, which allowed her to conduct 

research in support of her dissertation at the U.S. 

Army Medical Research Institute for Infectious 

Diseases (USAMRIID), in Frederick, MD. Dr Beckham received her 

Doctorate in 2001. Following completion of her Doctorate, 

Dr Beckham fostered her interest in diagnostic assay 

development and validation through positions with the 

Department of Homeland Security and the USDA Animal and 

Plant Health Inspection Service (APHIS), Foreign Animal Disease 

Diagnostic Laboratory (FADDL). Dr Beckham recently became 

the Head of the Profi ciency and Validation Services Section at 

FADDL. In this position, Dr Beckham coordinates all aspects of 

FADDL’s role as a reference laboratory for the National Animal 

Health Laboratory Network (NAHLN). This includes overseeing 

the validation of assays; identifying, evaluating, and developing 

new and emerging technologies; and developing and organizing 

training and profi ciency testing programs. 

Professor Corrie Brown 

Corrie Brown received her B.Sc. in Animal 

Behavior from McGill University and her DVM 

from Ontario Veterinary College at the University 

of Guelph (1981). She completed a combined 

residency/PhD in Comparative Pathology at 

the University of California at Davis. Board 

certifi cation (ACVP) and PhD were both attained in 1986. She was 

an assistant professor of pathology at Louisiana State University 

briefl y before joining the U.S. Department of Agriculture at Plum 

Island, where, as Head of the Pathology Section, she specialized 

in the diagnosis and pathogenesis of foreign animal diseases. 

In 1996, she joined the University of Georgia College of Veterinary 

Medicine as Professor and Head of the Department of Veterinary 

Pathology. She currently serves as Coordinator of International 

Veterinary Medicine for the College of Veterinary Medicine. In 

2003, she was honored with the university’s highest teaching 

award, being named a Josiah Meigs Distinguished Teaching 

Professor. Her professional interests are in infectious diseases 

of food-producing animals, emerging diseases, and international 

veterinary medicine. She has published or presented over 250 

scientifi c papers and has testifi ed to Congress on issues involving 

agroterrorism. She has served on many industrial and federal 

panels, and been a technical consultant to numerous foreign 

governments on issues involving infectious diseases and animal 

health infrastructure. 

8 | WAVLD 2007, 11 – 14 November 2007 

Dr Ilaria Capua 

Dr Ilaria Capua graduated in Veterinary Medicine 

with honours (110/110 e lode ), University of 

Perugia , in February 1989. Obtained post 

graduate qualifi cations as a specialist in Animal 

Health and hygiene from Pisa University in 1991 

and PhD from University of Padua. She is currently 

Head of the Virology Department at Istituto Zooprofi lattico 

Sperimentale delle Venezie, Padova, Italy and Head of the 

National, FAO and OIE Reference Laboratories for Avian Infl uenza 

and Newcastle disease. Between 1999 and 2006 she has been 

directly involved in managing several AI and ND epidemics and 

in 2000 developed the “DIVA”-Differentiating Vaccinated from 

Infected Animals strategy, based on heterologous vaccination, to 

combat AI. This strategy, the fi rst ever developed to combat AI by 

vaccination still enabling trade of products resulted in eradication 

of AI at that time in Italy and was approved by the EC and by OIE. 

During her career as a veterinary virologist her work has been 

recognized with her nomination as OIE and FAO expert for AI and 

ND. Since 1995 she has been involved with the EU Commission, 

participating in meetings and working groups on viral diseases of 

poultry and mammals, including AI, ND, FMD, CSF and Crimean- 

Congo Haemorrhagic Fever. In 2005 she has been nominated 

the Chairman of OFFLU- the newly established OIE/FAO network 

on Avian Infl uenza. This network has the role of supporting 

developing countries in managing the AI crisis and offering 

veterinary expertise to complement the international efforts of 

the medical community in managing the pandemic threat posed 

by AI. 

Laureate Professor Peter Doherty 

Laureate Professor Peter Doherty shared the 

Nobel Prize in Physiology or Medicine in 1996 

with Swiss colleague Rolf Zinkernagel, for their 

discovery of how the immune system recognises 

virus-infected cells. He was Australian of the Year 

in 1997, and has since been commuting between 

St Jude Children’s Research Hospital in Memphis and the 

Department of Microbiology and Immunology at the University 

of Melbourne. His research is mainly in the area of defence 

against viruses. He regularly devotes time to delivering public 

lectures, writing articles for newspapers and magazines and 

participating in radio discussions. Peter Doherty graduated from 

the University of Queensland in Veterinary Science and became a 

veterinary offi cer. Moving to Scotland, he received his PhD from 

the University of Edinburgh Medical School. He is the fi rst person 

with a veterinary qualifi cation to win a Nobel Prize.

INVITED SPEAKERS CONTINUED 

Professor Steve Edwards 

Steve qualifi ed as a veterinarian from Cambridge 

University, England, in 1972. He spent four years 

in clinical farm animal practice in the Welsh 

border country before returning to university 

at Edinburgh to study for an MSc in Tropical 

Veterinary Science. This stimulated his continuing 

passion for laboratory-based diagnostic investigation work. He 

then spent two years working in the UK Government’s overseas 

aid programme in El Salvador, Central America, working 

alongside local counterparts to identify the disease constraints 

to animal production. Steve joined the Central Veterinary 

Laboratory (now VLA) at Weybridge in 1980 working on virology 

research. From 1991 Steve brought his interest and expertise 

in laboratory diagnostics to the OIE Standards Commission, 

eventually becoming President of that group (now renamed 

Biological Standards Commission) in 2003, a position he still 

holds. He took over as Director and Chief Executive of the VLA in 

2000 on the retirement of his predecessor. He has led the Agency 

through a period of consolidation, with an expansion of its external 

collaborative links, as well as coping with an apparently neverending 

succession of animal disease issues, including classical 

swine fever, foot and mouth disease, tuberculosis, BSE, rabies, 

Newcastle disease, and avian infl uenza. 

Dr Luis Rodriguez 

Dr Rodriguez obtained his DVM in 1979 at the 

National University of Costa Rica. From 1980 to 

1985 he attended graduate school at the University 

of Wisconsin-Madison. In 1982 obtained a M.Sc. 

and in 1985 a Ph.D. in veterinary science with 

emphasis in Animal Virology working in molecular 

virology of bovine herpesvirus 1. From 1985 to 1995 worked a the 

School of Veterinary Medicine, National University of Costa Rica 

where he taught veterinary virology and carried out research 

focusing on vesicular stomatitis. He established the Tropical 

Disease Research Program and obtained several grants from 

international organizations to carry out research in pathogens of 

human and veterinary importance. From 1995 –1997 worked at 

the Special Pathogens Branch, Division of Viral and Rickettsial 

Diseases of the Centers for Disease Control and Prevention, in 

Atlanta Georgia. In 1997 joined the USDA – ARS Foot-and Mouth 

Disease Research Unit Plum Island as lead scientist in charge 

of vesicular stomatitis research working on genomics and 

pathogenesis of VSV and in 2002 Dr Rodriguez became Research 

Leader of the Foot and Mouth Disease Research Unit. In 2004 he 

also established the Foreign Animal Disease Research Unit. Dr 

Rodriguez personal current research focuses on studying the early 

phases of FMDV infection and pathogenesis and insecttransmission 

of VSV in cattle. 

Professor Mark Rweyemamu 

A Tanzanian veterinarian. Former Head of the 

Infectious Diseases Programme of the Food and 

Agriculture Organization (FAO) of the United 

Nations at its Headquarters in Rome. From 1994 

to his retirement from FAO in 2002, he was the 

inaugural Head of the FAO special programme on 

infectious diseases, known as the Emergency Prevention System 

for Animal and Plant Pests and Diseases (EMPRES) which 

included the coordination of the Global Rinderpest Eradication 

Programme (GREP). Before moving to FAO Headquarters, he 

had set up the Pan African Veterinary Vaccine Centre in Addis 

Ababa, on behalf of FAO and the Organisation of African Unity 

(now African Union). He has worked in both governmental 

and industrial settings. In government: as Virologist and Chief 

Veterinary Research Offi cer for the Tanzanian Government 

and as Head of the Virus Diseases at the then East African 

Veterinary Research Organisation, Muguga, Kenya. In industry 

he has been the Director of Veterinary Vaccine Research for 

Pfi zer International and Head of FMD Vaccine Research for 

the Wellcome Foundation. His area of interest is on the major 

infectious diseases of animals, known as transboundary animal 

diseases. He is now a private consultant and a Visiting Professor 

at the Royal Veterinary College, University of London. 

Dr Linfa Wang 

Dr Linfa (Lin-Fa) Wang is a Senior Principal 

Research Scientist at the CSIRO Australian Animal 

Health Laboratory (AAHL), and a project leader in 

the Australian Biosecurity Cooperative Research 

Centre (AB-CRC) for Emerging Infectious Diseases. 

Dr Wang is a member of the WHO SARS Scientifi c 

Research Advisory Committee and participated 

in the WHO-FAO-Chinese Government joint mission to China on 

animal reservoir of the SARS-CoV and potential transmission 

to humans in August 2003. His research group played key 

roles in the discovery and molecular analysis of Hendra and 

Nipah viruses, which led to the establishment of a new genus 

Henipavirus to accommodate the newly discovered highly lethal 

zoonotic paramyxoviruses of bat origin. Dr Wang completed his 

science degree in 1982 at the East China Normal University, 

Shanghai, followed by a PhD in Biochemistry (Molecular Biology) 

from the University of California, Davis, USA in 1986, where he 

went on to become a Postdoctoral Research Fellow with the 

Department of Biochemistry. After moving to Australia in 1989, 

Dr Wang spent 18 months working at Monash University and 

then joined CSIRO in 1990. Dr Wang has more than 140 scientifi c 

publications to his name along with four patents and numerous 

conference abstracts. He is currently serving on fi ve international 

editorial boards for publications in the areas of virology, 

biotechnology and immunotechnology. 

Crown Promenade, Melbourne, Australia | 9 

PROGRAM 

Monday 12 November 

0700 Registration Open 

0815 – 1030 Opening Session 

Room: Promenade 1 & 2 

Welcome Address 

Martyn Jeggo & Peter Kirkland 

Opening 

Minister Joe Helper 

Plenary Sessions – Global Risks and Challenges 

Chair: Peter Daniels 

Prof Mark Rweyemamu 

Future Risks from Infectious Disease of Animals 

Prof Corrie Brown 

New & Emerging Diseases 

Dr Ilaria Capua 

Avian Infl uenza – Challenges and Opportunities for the Veterinary Profession 

Dr Linfa Wang 

Zoonotic Viruses of Bat Origin – Discovery and Diagnosis 

1030 – 1100 Morning Tea & Exhibition/Poster Viewing 

Location: Exhibition Area 

1100 – 1230 Room: Promenade 1 & 2 Room: Promenade 3 

Concurrent Session 1.1 

New & Emerging Diseases/Wildlife 

Chair: Dr Linfa Wang Chair: Dr Simone Warner 

Dr Kim Halpin 

Experimental models for Henipavirus infection: bats, cats and 

pseudo-rats 

Prof Paul Gibbs 

Emergence of canine infl uenza in the USA: developments since 

discovery in 2004 and the diagnostic challenge 

Ms Deborah Finlaison 

Investigations of viral myocarditis in pigs associated with a novel 

pestivirus. 

Mrs Melinda Frost 

Characterisation of a novel pestivirus associated with an outbreak 

of stillbirths and pre-weaning in pigs due to myocarditis 

Prof Stefan Vilcek 

How many pestiviruses circulate in nature? Pestiviruses in 

free-living animals: present status and problems 

Dr Julia Ridpath 

Characterization and detection of BVDV-related reproductive 

disease in white tail deer 

1230 – 1330 Lunch 




FMD 


Molecular Diagnostic Assays – I (Bacterial diseases) 

Mrs Melissa Higgins 

Development of an improved identifi cation matrix for 

Aeromonas salmonicida 

Dr Ian Marsh 

An improved PCR-based test for QX disease confi rmation in 

Sydney Rock Oysters 

Dr Adrian Whatmore 

The development of SNP discrimination assays on a real-time 

PCR platform as a tool for the rapid identifi cation and speciation 

of Brucella. 

Dr Graeme Eamens 

Detection of Mycoplasma hyopneumoniae in pig samples using 

polymerase chain reaction tests 

Ms Kgomotso Sibeko 

Development and evaluation of a real-time PCR test for the 

detection of Theileria parva infections in cape buffalo 

(Syncerus caffer) and cattle 

Dr Wendy McDonald 

Detection and strain typing of Coxiella burnetii using Molecular 

Beacons in a real-time PCR 


Avian Infl uenza 

Chair: Prof Mark Rweyemamu Chair: Dr Ilaria Capua 

Dr Divakar Hemadri 

Changing faces of foot-and-mouth disease type O Pan Asia strain 

India 

Dr Paul Kitching 

The 2001 UK foot-and-mouth disease outbreak: 

an update 

Speaker TBA 

FMD in the UK, 2007 

Ms Janine Muller 

Development and evaluation of a recombinant antibody-based 

competitive ELISA for FMDV 

antibody detection 

Mr Chris Morrissy 

International validation of a new 3abc C-ELISA for FMD serology 


Mrs Janice Pedersen 

Results of 2006 wild bird surveillance for the detection of highly 

pathogenic avian infl uenza in the United States 

Dr Ian K. Barker 

Canada’s inter-agency wild bird infl uenza surveillance 

programme 2005 – 2007 

Dr Tze-Hoong Chua 

Performance evaluation of fi ve detection tests 

Dr Simone Warner 

Optimised sampling and processing for enhanced detection of 

avian infl uenza virus from fi eld samples 

Dr Michael Johnson 

Analysis of the sensitivity of H5N1 Isolates from the South East 

Asian region to Oseltamivir and Zanamivir

Monday 12 November (continued) 

1455 – 1525 Afternoon Tea 




Bluetongue & orbiviruses 


Zoonoses, Pox viruses & other TADS 

Chair: Dr Ian Gardner Chair: Prof Corrie Brown 

Dr Carrie Batten 

An update on bluetongue virus in Europe 

Dr Heather Elliott 

From testing to trade: the response to the outbreak of BTV 8 in 

NW Europe 

Gudrun Delbridge 

Evaluation of ELISAs to detect antibodies to bluetongue virus in 

individual and tank milk samples 

Dr Sushila Maan 

Molecular epidemiology of bluetongue virus type 8 from the 

Netherlands 2006 

Prof Peter Mertens 

Sequencing and RT-PCR assays for genome segment 2 of the 24 

bluetongue virus serotypes: identifi cation of exotic serotypes in 

the Southeastern USA (1999-2006) 

Ms Karin Darpel 

Replication of bluetongue virus in the skin of 

infected sheep 

Dr Hume Field 

Emerging zoonoses and wildlife – a multi-disciplinary challenge 

Prof. Tin Tin Myaing 

Wild life as a source of zoonotic diseases 

Mr Keith Jahans 

Surveillance of Mycobacterium bovis infection in cattle in Great 

Britain during 2006 

Mr Claude Sabeta 

Spread of canid rabies into the Free State province of South Africa 

Dr Tim Bowden 

Capripoxvirus tropism and shedding: a quantitative time-course 

study in experimentally infected sheep and goats 

Dr David Boyle 

An indirect ELISA, based upon recombinant capripoxvirus 

antigens, for serological detection of sheeppox, goatpox and 

lumpy skin disease 

Mrs Eva Veronesi 

Validation of a diagnostic technique for the detection and 

quantifi cation of bluetongue virus in adult biting midges 

(Culicoides spp: Diptera: Ceratopogonidae) 

1745 – 1915 Special Plenary Sessions – Equine Infl uenza 


Chair: Dr Bob Biddle 

Dr Peter Timoney 

Changing dynamics in the global distribution of equine diseases 

Richard Newton 

Global Overview 

Graeme Garner 

Australian Situation 

Dr Peter Daniels 

Diagnosis and Characterisation of Equine Infl uenza (EI) in Australia: A/equine/Sydney/2888-8/2007 H3N8 

Dr Peter Kirkland 

Equine infl uenza in NSW – challenges and highlights from a laboratory perspective 

1915 – 2115 Welcome Reception 



Tuesday 13 November 

0830-0945 OIE Biotechnology Symposium 


Co-Chairs: Prof Steve Edwards & Dr Gideon Brückner 

Welcome Address 

Prof Steve Edwards 

Dr Yi-Seok Joo 

Simple rapid, on-site (pen-side) detection of animal pathogens 

Dr Deborah Middleton 

Application of Biotechnology to Infections within Wildlife Hosts 

0945 – 1015 Morning Tea 


1015 – 1215 Dr Gideon Bruckner 

The OIE Concept of Twinning between Laboratories 

Dr Michael Macintosh 

Diagnostics of Emerging Infectious Diseases by Microarray 

Prof Noboru Inoue 

Development of Loop-Mediated Isothermal Amplifi cation (LAMP) Technique for Diagnosis of African Trypanosomosis 

Dr Alex Hyatt 

Diagnostic Electron Microscopy: Historical review and future 

1215 – 1315 Lunch 


1315-1445 Dr Norbert Bannert 

Overview of electron microscopy and its role in infectious disease diagnosis 

Dr Yves Robinson 

Telepathology: its role in disease diagnosis in meat hygiene 

Dr Paul Monaghan 

Understanding Host-Pathogen Interactions: Confocal and Live Cell Imaging in Veterinary Science 



1515-1645 Dr Brad J Marsh 

Multi-Resolution Spatio-Temporal Analysis of Mammalian Cells Reconstructed in 3D by Electron Microscope Tomography 

Dr Simon Carpenter 

Detecting and interpreting arboviral infections in insects 

Dr Hez Hird 

Molecular methods for speciation 

1900 – 2400 Symposium Dinner 

Location: RACV Club 

Wednesday 14 November 

0815 – 1000 Plenary Sessions – Preparing for the Future 


Chair: Dr Russell Graydon 

Dr Martyn Jeggo 

Labs of the Future 

Dr Luis Rodriguez 

Biosafety and Biosecurity Concerns Of High Security Animal Pathogen Laboratories 

Dr Tammy Beckman 

Diagnostic Technologies for Veterinary Laboratories of the Future 

Prof Steve Edwards 

Can we believe Laboratory Test Reports? 

1000 – 1030 Morning Tea 





New Technologies & Platforms 

Quality Assurance 

Chair: Dr Tammy Beckham Chair: Dr Luis Rodriguez 

Mrs Barbara Martin 

The United States National Animal Health Laboratory Network 

(NAHLN) 

Dr Bill Colston 

Developing an approach for rapid identifi cation of emerging 

biological threats 

Dr Juliet Dukes 

Viral identifi cation using microarrays 

Dr. Julia Ridpath 

Assay platforms for the rapid detection of viral pathogens by the 

ultrahigh sensitivity monitoring of antigen-antibody binding 

Prof Lawrence Wangh 

LATE-PCR with PrimeSafeTM – maximum diagnostic information 

from a closed-tube 

Dr Xingwang Fang 

A complete workfl ow for nucleic acid based high throughput 

pathogen detection 

Dr Carmelo Volpe 

An advanced fi eld deployable sample preparation and PCR system 

Dr Rod Reece 

The Australian Animal Pathology Standards program: 

preservation and digitisation of the collection, and access via 

‘new’ technologies 


Dr. Paul Kitching 

Labs of the future – a cultural shift in Canada for foreign animal 

disease (FAD) detection 

Dr Craig Carter 

Laboratory-based early animal disease detection utilizing a 

prospective scan statistic 

Dr Philip Wakeley 

Development, validation and implementation of molecular 

diagnostics tests for important pathogens of farmed animals and 

wildlife – a pragmatic approach 

Dr Jane Oakey 

Quality assurance and control issues with PCR as a diagnostic tool 

Mr Lindsay Pritchard 

A review of training in molecular diagnostic techniques for avian 

infl uenza in South East Asia 

Dr Kim Halpin 

Development and consolidation of an EQA programme for the 

molecular diagnosis of avian infl uenza 

Dr. Hermann Unger 

How useful are test kits when applied in different target 

population: producer and end-user responsibilities from a 

developing country perspective 

Dr Mark M Williamson 

Laboratory management techniques for responding to client 

demands: diagnosis of swine pneumonia.

Wednesday 14 November (continued) 

1230 – 1330 Lunch 


1330-1500 Room: Promenade 1 & 2 Room: Promenade 3 


Diagnostic assays – ELISA & molecular 


Biosecurity, IT, & LIMS 

Chair: Dr Lorna Melville Chair: Dr Michael Johnson 

Dr Simon Anthony 

Complete sequence analyses of the genome of epizootic 

haemorrhagic disease virus (EHDV): the design of 

diagnostic assays. 

Dr Jovita Fernández 

New advances in the molecular diagnosis of African horse 

sickness (AHS) 

Dr Carmina Gallardo 

New approaches in molecular and serological diagnosis of 

African swine fever (ASF) on new emerging variants 

Dr Karen Harmon 

Rapid high-throughput real-time RT-PCR testing for PRRSV: 

problems and solutions 

Dr Roger Ayling 

Development and initial evaluation of a lateral fl ow device for the 

rapid detection of contagious bovine pleuropneumonia. 





Molecular Diagnostic assys- II (Viral) 

Dr Scott Fitzgerald 

Benefi ts realized from the fi rst biosafety level 3 large animal 

necropsy facility in a state diagnostic laboratory in North America 

Dr Steve Weber 

Linking multiple veterinary laboratory information 

management systems to support the National Animal Health 

Laboratory Network 

Dr Paul Collery 

Implementation, function and benefi ts of a laboratory information 

management system in a national veterinary laboratory service 

Dr Peter Durr 

Beyond the laboratory gate – enhancing a laboratory information 

management system (LIMS) for exotic animal disease 

preparedness 

Dr Paul-Michael Agapow 

The ReLaIS project: an epi-informatics constellation 


Epidemiology & Surveillance 

Chair: Dr Gary Horner Chair: Dr Peter Daniels 

Mrs Katarzyna/Kasia Bachanek-Bankowska 

High throughput diagnostic PCR for bluetongue virus 

Dr William C. Wilson 

Nucleic acid diagnostic tools for early detection of 

arthropod-borne animal viral diseases. 

Dr Dennis Gomez 

Molecular detection of betanodaviruses from subclinically 

infected aquarium fi shes and invertebrates 

Dr Frank Wong 

Purifi cation and characterisation of a herpes-like virus infecting 

Australian populations of abalone, Haliotis spp. 

Dr Giovanni Cattoli 

Development of a real-time duplex TaqMan-PCR assay for the 

detection of equine rhinitis A and B viruses in clinical specimens 

1715 – 1730 Symposium Close 

Ms Kerri Tyrrell 

Effects of dynamic ‘communal’ interactions on disease processes 

and individual agent diagnosis where multiple infectious agents 

are present in sheep 

Dr Fraser Hill 

Use of molecular and epidemiological information for the costeffective 

diagnosis of BVD infection in New Zealand dairy cattle 

Eng Sandra Benevides 

Assessing the within herd prevalence of antibody positive cows to 

bovine herpevirus 1 using an Indirect ELISA on bulk tank milk 

Mr Ronald Coilparampil 

Evaluation of a commercially available ELISA for detection 

antibodies to liver fl uke (Fasciola hepatica) in pooled bovine serum. 

Dr Ashraf Ahmed 

Zoo animals as a potential reservoir of gram-negative bacteria 

harboring integrons and antimicrobial resistance genes 

Dr Nguyen Van Long 

Porcine reproductive & respiratory syndrome (PRRS) – 

a new challenge 

Crown Promenade, Melbourne, Australia | 13 14 

A new direction for animal health. 

Introducing animal health solutions from a proven technology leader. 

With traditional procedures, simplicity, speed and precision are often compromised. That’s why more labs 

are switching to superior PCR-based reagents for everyday veterinary and agricultural applications. 

PCR helps simplify procedures and accelerate time to results with unparalleled sensitivity and specifi city. 

Only Applied Biosystems, with over 25 years of experience, provides one source for a complete molecular 

solution. With automated sample prep, superior molecular reagents and master mixes, and easy-to-use 

instruments for PCR analysis, we’ve got you covered — from sample to signal. 

Go molecular. 

For a free AgPath-ID One-Step 

RT-PCR Reagent, go to 

appliedbiosystems.com/animalhealth. 

For research use only. Not for use in diagnostic procedures. Not licensed by the USDA. 

Applied Biosystems, and AB (Design) are registered trademarks and AgPath-ID is a trademark 

of Applera Corporation or its subsidiaries in the US and/or certain other countries. The 

AgPath-ID OneStep RT-PCR Kit is compatible with the 5’ nuclease detection and ds 

DNA-binding dye processes covered by patents owned or licensable by Applied Biosystems. 

No license under these patents is conveyed expressly, by implication, or by estoppel to the 

purchaser by the purchase of this product. Further information on purchasing licenses may 

be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre 

Drive, Foster City, California 94404, USA. © 2007 Applied Biosystems. All rights reserved.

WAVLD POSTER PRESENTATIONS 

Poster No. Author Poster Title 

1 Ann Nordengrahn Proximity ligation assay – detection of individual microbial pathogens 

2 Wayne Jorgensen Improved detection of bovine reproductive disease pathogens 

3 Marinda Oosthuizen Identifi cation of a novel Babesia species from sable, roan and giraffe by means of the Reverse Line Blot (RLB) 

hybridization assay 

4 Maria Jose Dus Santos Detection of BLA in frozen semen samples by PCR assay 

5 Ian Marsh A simple internal PCR control for Mycobacterium avium subsp. paratuberculosis constructed by PCR techniques 

6 Graeme Eamens Investigating shedding rates and the proportion of animals shedding Mycobacterium avium subsp paratuberculosis in 

cattle and goat herds 

7 Darcy Myers A streamlined workfl ow for rapid and sensitive detection of Mycobacterium avium subsp. paratuberculosis (MAP) in 

bovine faecal samples by real-time PCR 

8 Jose Blanco Automated DNA isolation: an advantageous tool in molecular diagnostic of dermatophytosis 

9 Sarah North Development of real time PCRs to detect important bacterial pathogens of the horse. 

10 Masoud Ghorbanpoor 

Najafabadi 

Enhanced cultural sensitivity of Staphylococcus aureus from bovine mastitis milk by sample freezing 

11 Lourdes Corpus Standardisation of PCR for identifi cation of Listeria monocytogenes in fresh cheese 

12 Lone Hoj Molecular ID of vibrio isolates 

13 Samantha Gibbs Indonesian veterinary laboratory capacity building project for highly pathogenic avian infl uenza 

14 Manuela Dalla Pozza Management of a DIVA vaccination programme for the control of low pathogenicity avian infl uenza in Italy 

15 Adam Foord Adaptation of real time PCR assays for detection of new and evolving avian infl uenza virus strains 

16 Hans Heine Identifi cation of a novel hemagglutinin cleavage site in a highly pathogenic avian infl uenza H7 from North Korea 

17 Anna Lecoq Preliminary validation of a commercial avian infl uenza N1 antibody competitive ELISA kit that can be used as part of a 

DIVA strategy 

18 Giovanni Cattoli Inactivation of avian infl uenza viruses 

19 Huaguang Lu A rapid laboratory diagnosis of H5N1 avian infl uenza in Saudi Arabia 

20 Masoud Hosseini Seroprevalence of H9N2 antibody in poultry farm and slaughter-house workers of Iran using HI test 

21 Ross Lunt Advancing the role of a regional reference laboratory for foot–and-mouth disease in South East Asia 

22 Melanie Chitray Heterogeneity in the outer capsid-coding region of foot-and-mouth disease virus A and O serotypes in Africa 

23 Claro Mingala Quantifi cation of water buffalo (Bubalus bubalis) cytokine expression in response to inactivated foot-and-mouth 

disease vaccine using real-time PCR assay 

24 Chris Morrissy Development of an improved capability in support of national biosecurity for the surveillance and control of foot & 

mouth disease in cattle and pigs in Vietnam. 

25 Simon Anthony Nucleotide sequence analyses of epizootic haemorrhagic disease virus genome segments encoding the outer capsid 

proteins: a serological and genetic re-evaluation of serotypes. 

26 Rahana Dwarka Phylogenetic analysis of African swine fever viruses from South Africa, Mozambique and Tanzania for the period 

2001 – 2007 

27 Scott Fitzgerald Efforts to control and eradicate bovine tuberculosis in a wildlife reservoir in Michigan, USA: a preliminary success story 

28 Ji-hyung Kim Detection of major bacterial and viral pathogens from trash fi sh for cultured fl ounder 

29 Amir Hamir Experimental transmission of transmissible spongiform encephalopathies 

30 Elizabeth Houston TSE surveillance in Australia: a regional laboratory perspective 

31 Francisco Blanco Viera BSE surveillance in Argentina 


WAVLD POSTER PRESENTATIONS (continued) 


32 Michael Zalunardo Complete automation of a BSE post mortem diagnostic test 

33 Sanjay Kapil Emergence of canine parvovirus 2c in North America: 2006 

34 Tin Tin Myaing Prevalence study of parasitic infestation in Myanmar timber elephants 

35 Hermann Unger The concept of early detection and rapid response to TAD’s by APH, IAEA 

36 Emma Stubberfi eld Brucellosis in marine mammals: Veterinary Laboratories Agency involvement 

37 Magdalena Dunowska Prevalence of methicillin resistant Staphylococcus aureus (MRSA) in a veterinary teaching hospital 

38 Ross Lunt A virus neutralization test for the detection of antibody to Australian bat lyssavirus 

39 Chris Morrissy Development of a porcine circovirus diagnostic capability at AAHL allowing the detection and nucleotide sequence 

analysis of PCV from disease outbreaks. 

40 Babak Asghari Study of brucellosis among abattoir workers in Isfahan,Iran 

41 Mihai Turcitu Genetic variability analysis of rabies virus serotype 1 on Romanian territory 

42 Jianning Wang Inter-laboratory evaluation of a real-time PCR assay for detection of bovine herpesvirus 1 in bovine semen 

43 Petrina Young The Australian National Quality Assurance Program 

44 James Watson LESTER: The use of a simulation tool to enable detailed evaluation of laboratory capacity to respond to an outbreak. 

45 Jacek Gwozdz Reproducibility of results in batches of three ELISA kits for the diagnosis of Johnes’s disease in cattle: 

recommendations for kit evaluation criteria 

46 Ann Nordengrahn Lateral fl ow technology – pen-side test for the detection of foot-and-mouth disease 

47 Kerri Tyrrell Development of a high throughput, robotics-based, ELISA for the detection of antibodies specifi c for parasitic worm 

species in sheep 

48 Rohit Mistry LATE-PCR detection of foot and mouth disease virus using the BioSeeq II 

49 Lawrence Wangh A highly multiplexed RT-LATE-PCR assay for detection of H5N1 and other subtypes of infl uenza virus 

50 Mikhayil Hakhverdyan One-step primer-probe energy transfer (PriProET) real-time RT-PCR detection of SVDV using Rotor-Gene 6000 

51 Giovanni Cattoli Development and validation of a real time PCR assay for the simultaneous detection of avian infl uenza viruses 

belonging to the H5, H7 and H9 subtypes 

52 John White An evaluation of commercially available nucleic acid extraction methods for the processing and subsequent qPCR 

analysis of samples infected with avian infl uenza virus. 

53 Angela Burrell High throughput isolation and detection of North American and European porcine reproductive and respiratory virus by 

qRT-PCR 

54 Songhua Shan Multiplex PCR for NDV & AI 

55 Songhua Shan Detection of CSFV in meat by qPCR 

56 Richard Hodgson Sample preparation methods for high quality nucleic acid isolation from a variety of veterinary samples 

57 Richard Hodgson Evaluation of real-time PCR based assays for the detection and quantitation of different diseases in animals 

58 Luis Samartino Advances in fl uorescence polarization for diagnosis of bovine brucellosis in milk 

59 Jing Zhang Effects of different populations on an assessment of the sensitivity and specifi city of an antigen ELISA for BVDV 

60 Michael Zalunardo Development of a new avian infl uenza antibody blocking ELISA 

61 Mirabos Aminjonov Diagnostics of parasitic diseases of agricultural animals in Uzbekistan 

62 Ann Nordengrahn Targeted selective treatment of Ostertagia ostertagi – the use of an ELISA as a diagnostic tool for the control of the 

parasite in cattle. 

63 Irene Alvarez Validation of an agar gel immunodiffusion and western blot assays for the diagnosis of equine infectious anaemia using 

a recombinant p26 protein 

64 Wayne Jorgensen New diagnostic assays for the detection and monitoring of coccidiosis in poultry. 

65 Gerónimo Gutiérrez Accurate detection of bovine leukaemia virus infection using recombinant P24-ELISA and PCR 

66 Annie Rodolakis Is the Coxiella burnetii Nine Mile strain a suitable antigen for detection of Q fever antibodies of ruminants by ELISA? 

67 Katsuhiko Fukai Differentiation of foot-and-mouth disease virus (FMDV) infected pigs from vaccinated pigs using a western blotting 

assay based on baculovirus expressed FMDV 2C and 3D antigens 

68 Ross Lunt Development of a commercial ELISA for the detection of serum antibody to Akabane virus 

69 Anna Lecoq Preliminary validation of a new multi-species competitive ELISA kit for the detection of antibodies directed against 

West Nile virus: ID Screen ® West Nile Competition 

70 Anna Lecoq Validation of a new commercial kit for the detection of antibodies directed against Leishmania infantum in canine sera: 

ID Screen ® Leishmaniasis indirect 

16 | WAVLD 2007, 11 – 14 November 2007

WAVLD POSTER PRESENTATIONS (continued) 


71 Maria Jose Dus Santos Development of an ELISA kit to detect and evaluate bovine viral diarrhoea virus antigen in the critical stages of 

vaccine production 

72 Hinrich Voges Fine-tuning a bulk milk EBL ELISA as primary screening tool for all EBL-free herds in New Zealand 

73 Hinrich Voges Adapting a DNA tissue sampler as an aid for effi cient BVDV antigen screening 

74 Hinrich Voges Validation of an indirect bulk milk BVDv antibody ELISA for sero-prevalence investigations amongst New Zealand 

dairy herds 

75 Hinrich Voges Preliminary evaluation of Neospora caninum ELISA kits for use with New Zealand milk samples 

76 Seong-in Lim ELISA based on recombinant Erns protein mixtures for serelogical diagnosis of classical swine fever 

77 Misako Konishi Development and evaluation of ELISA for detecting antibodies against CAEV 

78 Jody Hobson-Peters A diagnostically useful peptide to detect West Nile virus infection in horses 

79 Maria Virginia Meikle Novel antigens for the diagnosis of bovine tuberculosis 

80 Anna Lecoq Preliminary validation of a new commercial ELISA kit for the detection of antibodies directed against Chlamydia abortus 

81 Anna Lecoq Preliminary validation of a new commercial diagnostic test for the detection of anti-equine infectious anaemia virus 

antibodies in horse sera 

82 James Conland Application of immunomagnetic bead technology for improved diagnosis of classical swine fever virus in a low 

technology setting 

83 Oday Sami Beyon Laboratory evaluation of the appropriate vaccination programs against Newcastle disease in broiler chickens under 

fi eld conditions in Mosul province (Iraq). 

84 Xingnian Gu Australian strains of bovine herpesvirus 1 are genetically homogenous 

85 Richard Clough Interference in disease differentiation in pigs by pestivirus cross-reactions 

86 Rodney Davis Venereal disease and infertility in cattle due to bovine herpesvirus type 5. 

87 Bruce Corney An unusual case of infectious laryngotracheitis virus detection in a backyard poultry fl ock 

88 Georgina Ibata Detection of bovine lymphotropic herpesvirus in cases of non-responsive post partum metritis in dairy herds in the UK 

89 Andrew Cheung Reproduction of PMWS of high mortality with a porcine circovirus type 2-group 1 isolate 

90 Jasbir Singh Seroprevalence of porcine reproductive and respiratory syndrome in Malaysia 

91 Edla Arzey Investigations of nodavirus infections of Australian bass 

92 Masao Kamiya Diagnosis and countermeasure of alveolar echinococcosis in red foxes utilizing local resources in Japan 

93 Jose Trinipil Lagapa Smart fi eld sampling for diagnosis of Echinococcosis in wildlife defi nitive host using GIS-based maps 

94 Laura Hernández 

Andrade 

Mycoplasma mycoides subsp.capri associated with goat respiratory disease and high fl ock mortality 

95 Sandra Romero Reservoir of West Nile virus and another encephalitis virus in Mexican bats (Desmodus rotundus) 

96 Jianming Tan Purifi cation of a herpes-like virus in abalone 

97 Gian Mario De Mia Genetic heterogeneity of bovine viral diarrhoea virus isolates from Italy: identifi cation of new BVDV-1 genotypes 

98 Stefan Vilcek Genetic characterisation of border disease virus isolated from chamois 

99 Mihai Turcitu Molecular characterisation of Newcastle disease viruses isolated from recent outbreaks in Romania 

100 Claude Sabeta Molecular epidemiology of rabies in bat-eared foxes (Otocyon megalotis) in South Africa 

101 Claude Sabeta Identifi cation of a new dog rabies lineage in northern South Africa 


WAVLD 12 – 14 NOVEMBER 2007 

LEVEL 1, CROWN PROMENADE MELBOURNE 

18 | WAVLD 2007, 11 – 14 November 2007

WAVLD 2007 EXHIBITOR LIST 

Booth Company 

1 Enfer Diagnostics 

2 Corbett Life Science 

3 Laboratorios Hipra 

4 Lab Diagnostics 

5 Pathtech Pty Ltd 

6 Bio-X Diagnostics 

7 Department Primary Industries Research Victoria 

(DPI) Silver Sponsor 

8 National Association of 

Testing Authorities (NATA) 

9–10 Gribbles Vet Pathology 

11 InterAct 

12 Veterinary Laboratories Agency 

Silver Sponsor 

Booth Company 

13 QIAGEN Pty Ltd 

14 Smiths Detection Silver Sponsor 

15 Australian Biosecurity CRC 

16 Applied Biosytems 

Silver Sponsor 

17 Animal Genetics Inc 

18 Svanova 

19 Inverness Medical 

20 ID Vet 

21 CSIRO Livestock Industries 

22–23 The Department of Agriculture, Fisheries 

and Forestry (DAFF) Gold Sponsor 

24 IDEXX Laboratories 

25 Ai Scientifi c 


SOCIAL PROGRAM 

SYMPOSIUM WELCOME RECEPTION 

Proudly Sponsored by 

Date: Monday, 12th November 2007 

Time: 7.15pm – 9.15pm 

Venue: Crown Promenade, Pre Function and Exhibition Area 

Additional Tickets: A$80.00 per guest 

Inclusive of Symposium Full and Day Registration 

Delegates are invited to attend the WAVLD 2007 

Symposium Welcome Reception to be held at Crown 

Promenade. It will be a great chance to come together with 

old friends and colleagues and make new acquaintances, 

whilst enjoying canapés and drinks. Additional tickets are 

available for partners and work colleagues. 

DEPARTMENT OF 

PRIMARY INDUSTRIES 

Science 

SYMPOSIUM DINNER 

Proudly Sponsored by 

Date: Tuesday, 13th November 2007 

Time: 7.00pm – 12.00am 

Venue: RACV Club – Level 17, 501 Bourke Street, Melbourne 

Tickets: A$100.00 per guest 

The Symposium Dinner will be held at RAVC Club, level 

17 – offering spectacular views of Melbourne skylines and 

Port Phillip Bay . Come and enjoy an evening of delicious 

food, good wine and great company. You will be able to 

socialise and network with old and new friends alike. 

Please note: The Symposium Dinner is not included in 

the registration fee for delegates. If you wish to purchase 

tickets, please visit the registration desk. 

How to get to the venue: Directions have been provided in 

the delegate satchel and are posted on the message board. 

Directions are also available at the registration desk. 

DPI’s science assists 

Victoria’s primary 

industries to improve their 

productivity and respond 

to the challenges of climate 

change and drought. 

DPI employs more 

scientists than any other 

organisation in Victoria.

DINING IN MELBOURNE 

Melbourne’s melting pot of cultures is refl ected in its 

variety of restaurants, cafes, bistros and bars. Fashionable, 

eclectic and eccentric – Melbourne’s dining spots offer 

a dizzying spread of the world’s great cuisines, serving 

meals from the substantial and classic to the truly exotic. 

In the city, you can enjoy afternoon tea in the genteel 

surroundings of a nineteenth-century hotel, watch and be 

watched in buzzing laneway cafés and bars, or handpick 

a bottle of Yarra Valley chardonnay at the latest überchic 

hangout. Head out a little further and explore one of 

Melbourne’s specialist eating destinations – Carlton for 

Italian classics or Fitzroy for tantalising Spanish tapas. 

LYGON STREET, CARLTON 

Enticing aromas of Italy lead you along the footpaths of 

Carlton as you enjoy some of Australia’s’ best hospitality 

in one of the friendliest cities in the world. Lygon Street is 

a must-see part of Carlton, one of the favourite suburbs of 

inner Melbourne. Casual or otherwise, the choice is yours 

and the restaurateurs of Lygon Street are great at providing 

terrifi c food, quickly almost any time of the day or night. 

What’s attracting 

all the attention on 

stand 14? 

Maybe it’s the opportunity to see the worlds fi rst 

truly portable, veterinary diagnostic laboratory? 

Perhaps it’s the prospect of meeting the most 

innovative and advanced manufacturer 

of detection equipment? 

Or is it the chance to win the latest GPS 

Navigation system? 

Make sure you visit us on stand 14 and see for 

yourself how we may have the answer to the world’s 

fi ght against virulent diseases such as Avian Flu and 

Foot and Mouth. 

www.smithsdetection.com/vet 

BRUNSWICK STREET, FITZROY 

If you were after one area of Melbourne that best refl ects 

the city’s soul, it could be Brunswick Street, Fitzroy. This 

cafe and food precinct bordering on the CBD is very much 

like Melbourne in that it is tolerant and accommodating of 

all types of people. Here you can be Bohemian, poor, rich, 

alternative, trendy, young or old. Brunswick Street is art 

with a capital A; the people who live here ooze art. It’s the 

best selection of small, unpretentious cafes serving tasty 

food of any food precinct in Melbourne 

SOUTHGATE, MELBOURNE CITY 

Southgate is home to 17 of Melbourne’s favourite and 

most awarded restaurants, bars and cafes. Where better 

to sit and relax with world class food, wine and the most 

spectacular views of the Melbourne skyline and the Yarra 

River. We have more awards than any other precinct in 

Melbourne; making Southgate arguably Melbourne’s 

premier dining destination. 

21 

13th International World Association of Veterinary 

Laboratory Diagnosticians Syposium 

11 - 14 November 2007 

Monday 12 November

World Association of Veterinary Laboratory Diagnosticians – 13 th International Symposium, Melbourne, Australia, 11-14 November 2007 

0815 - 1030 Plenary Session - Global Risks and Challenges Mon 

FUTURE RISKS FROM INFECTIOUS DISEASES OF ANIMALS 

12 

Mark M. Rweyemamu - Tanzania and Former FAO 

Visiting Professor of Virology, Department of Pathology and Infectious Diseases, 

The Royal Veterinary College, Hawkshead Lane, North Mymms, Hatfield AL9 7TA, England, UK. mark.rweyemamu@btinternet.com 

November 

Abstract: 

During the last 2 decades there have been incidents of high profile epidemics of human and animal diseases. 

These reflect trends in the global distribution of the major infectious diseases. The UK driven Foresight 

global study 1 on infectious diseases of humans, animals and plants identified common underlying risk drivers 

as (i) Culture and governance, including legislation and systems of government; (ii) Technology and 

innovation; (iii) Conflict and law; (iv) Human activity and social pressures; (v) Economic factors – including 

globalisation; and (vi) Climate change. Probably the most acute human activity and social pressure with 

respect to animal agriculture is that which the study by FAO, IFPRI and ILRI had termed the livestock 

revolution. This is characterised by an unprecedented demand for livestock products, a rapid growth in the 

livestock sector and an increased risk for animal disease epidemics. Animal agriculture now represents 

the fastest growing component of agriculture. An aspect of social pressures is the increasing human 

settlement encroachment on previously separated wildlife habitats resulting in an increasing humanlivestock-wildlife 

interface. 

Several risk assessment studies lead to a conclusion that major infectious diseases are normally absent from 

highly industrialised countries while they remain endemic in developing countries. The pattern of disease 

spread is no longer limited to episodic spread in localities or to neighbouring countries but has also led to 

wider global dissemination. Thus the recent patterns of international spread of foot-and-mouth disease, 

classical swine fever, avian influenza and bluetongue have illustrated the importance of transboundary 

animal diseases to the global livestock industry and to trade in livestock commodities beyond their endemic 

settings. Another trend has been the association of the majority of emerging human diseases with the 

animal source. Most such diseases have also originated from developing countries. 

Thus the overall conclusion of the Foresight study was that: 

• Many existing diseases will remain important, but new diseases will emerge in the 

future – noting that in the last 25 to 30 years some 80% of new/emerging infectious 

diseases of humans had originated from animals; 

• Major infectious diseases are endemic in Africa and Asia; 

• Substantial advances in infectious disease prevention and management will be made 

through integration of research across sectors (human, animal, plant) and disciplines 

(natural and social science); 

• New technological systems for early detection, identification and monitoring of 

infectious diseases have the potential to transform our capabilities in managing future 

disease risks, especially if challenges of international development are met; 

• Societal contexts will be crucial in realising the benefits of the new technological 

systems. 

Therefore, future research on the Detection, Identification and Monitoring (DIM) of infectious diseases needs 

to have a special focus on developing countries, preferably through inter-institutional partnerships between 

those in highly industrialised countries, where expertise resides but major infectious diseases are not 

endemic and those in developing countries, where such diseases are endemic and thereby the risk to global 

animal agriculture and human health. This research should be viewed as a contribution to the international 

pubic good and essential to the concept of ONE WORLD, ONE HEALTH, ONE MEDICINE. 

1 Foresight DIID study www.foresight.gov.uk. Professor Rweyemamu was the Lead Coordinator for the African strand of the study 

Mon 12 November 


NEW AND EMERGING DISEASES 

Corrie Brown, DVM, PhD, University of Georgia, Athens, Georgia, USA 

Emerging disease has become almost a household term. Fully three-quarters of all the emerging diseases 

in the last decade came from animals. The world is averaging at least one new extensive emerging disease 

every year. Today, the unrelenting forces of globalization, fueled effectively by the expanding human 

population and the institution of the World Trade Organization, have ensured that pathogens can travel 

easily from one species to another and one continent to another. No health issue can remain local for long. 

The steady parade of new pathogens, beginning with HIV, moving from a primate reservoir into a few and 

then millions of humans globally, mobilized the field of infectious diseases in a massive way. The almost 

simultaneous emergence of Salmonella DT104 and E. coli O157:H7 underscored large gaps in 

understanding between human medicine and animal husbandry. Subsequently, the march of bovine 

spongiform encephalopathy through Europe in the Trojan cow of exported meat and bone meal further 

emphasized the need for connectedness between animal and human health. More recently, the emergence 

of Nipah virus and avian influenza, to the intense consternation of both agricultural and public health 

communities, has mobilized synergistic efforts in earnest. Ebola and SARS are two other headline agents 

that have sparked panic in humans after moving out of their animal reservoirs. 

Bioterror threats have received star billing recently with extensive funding provided to the biomedical 

community for directed study. Of the bioterror agents on the US Department of Health and Human Services 

List, almost all are pathogens of, or have their origins in, animals. One medicine reigns here as well. The list 

of emerging zoonotic disease and targeted bioterror pathogens has so many interconnections that 

classifying the two individually is a challenge. They are as connected as the figures in a Jackson 

Pollock drawing. 

Elucidating the pathogenesis of some of these emerging and bioterror pathogens will help greatly in devising 

effective control and intervention measures. Veterinarians have studied many of these diseases, e.g., 

anthrax, smallpox, Nipah, SARS, and avian influenza, using suitable animal models, with resulting expansion 

of available information. Findings from a few of these studies will be presented.


AVIAN INFLUENZA – CHALLENGES AND OPPORTUNITIES FOR THE VETERINARY PROFESSION 

I. Capua OIE, FAO and National Reference Laboratory for Newcastle Disease and Avian Influenza 

Istituto Zooprofilattico Sperimentale delle Venezie, Viale dell’Università 10 35020 – Legnaro, Padova, Italy 

D. Alexander Unaffiliated Consultant Virologist 

Notifiable Avian influenza is an OIE listed disease that has become a disease of great importance both for 

animal and human health. The increased relevance of AI in the fields of animal and human health, has 

highlighted the lack of scientific information on several aspects of the disease, which has hampered the 

adequate management of some of the recent crises. Millions of animals have died, and there is growing 

concern over the loss of human lives and over the management of the pandemic potential. 

Until 1999, Highly Pathogenic Avian Influenza (HPAI) was considered a rare disease, with only 18 primary 

outbreaks reported since 1959. At the turn of the millennium, HPAI initiated a series of outbreaks with 

different characteristics to what had been previously seen. The Italian H7N1 1999-2000, and Dutch H7N7 

2003 caused outbreaks of unprecedented magnitude were only a prelude to the ongoing H5N1 crisis. The 

latter appears to represent the possibly the greatest threat to animal health, with very serious implications for 

public health that the veterinary community has ever been called to face. 

Avian influenza has become widespread in vast areas including Asia, the Middle East, Europe and Africa. 

This opportunity given to the virus has greatly increased its potentials, affecting the health of wild and 

domestic animals and of humans. Currently, human health is affected both in terms of the reduction of food 

security and of the infection of humans as a prelude to the emergence of a new pandemic virus. 

Highly Pathogenic avian influenza is believed to originate from an H5 or H7 precursor of low pathogenicity 

harboured in wild birds, primarily Anseriformes. The introduction of this progenitor into domestic poultry has 

caused, on several occasions the mutation of the low pathogenicity virus to a highly pathogenic mutant 

containing multiple basic aminoacids at the cleavage site of the haemagglutinin molecule. This mutation 

enables the virus to become systemic, replicate in vital organs and bring about the death of the bird. 

Historically, highly pathogenic avian influenza caused a self-limiting disease as most birds affected died as a 

result of systemic infection. The virus infected poultry, did not infect wild birds and was apathogenic for 

waterfowl. The latter was only very rarely infected. 

In the Asian context, the persistence of a highly pathogenic H5N1 virus in mixed rural poultry, in an area with 

a high population density has generated a unique set of opportunities for the virus. It has closely 

encountered avian and mammalian species, to which it has been able to adapt and is in a continuous effort 

to be more efficient. The rural farming environment, typically developed in the open has determined the spillover 

of the virus to wild birds. So far, only few species have been shown to be infected but the 

epidemiological consequences of this unique situation are impossible to predict. 

The co-existence of susceptible species is inducing the development of mutations which often result in a 

greater capability of causing clinical disease resulting in death of the host. 

The virus is actively circulating in birds reared for agricultural purposes in Asia, the Middle East and Africa 

and in the Eurasian wild bird population. It is now able to cause a 50% fatality rate in humans and has 

acquired the capability of killing domestic and wild waterfowl. It has also affected other atypical hosts such 

as felines. 

The crucial issue in resolving this situation is to limit the circulation of the virus in the animal reservoir, as this 

represents a never-ending source of virus. Although specific tools are available, the infrastructure and 

economic conditions of most of the affected areas are insufficient to react to the emergency. At the rural 

level, basic hygienic measures are rarely respected in animal husbandry and no concept of disease control 

measures is known. The social behaviour of the rural human population includes habits which facilitate the 

spread of infection, within the same village and, through trade, to other villages. International interventions 

are therefore to be focused primarily on education programmes and on veterinary support to farmers. 

The scientific veterinary community has the duty and responsibility to address the complex issue of AI 

ecology and epidemiology in the countries it affects – which in turn is essential to the development of 

adequate control strategies. 

The medical, veterinary and agricultural scientific communities are challenged with a virus that is moving in a 

tri-dimensional fashion, modifying itself as it adapts to different species and reassorting with other influenza 

viruses of avian and potentially mammalian origin, as it infects new species. A significant collaborative and 

financial effort in a transparent scientific environment are required to generate data and ideas contributing to 

the eradication effort. 

Until the extensive circulation of the virus is limited in the avian reservoir, avian influenza will continue to 

remain an issue for food security and a global threat for animal and human health. 

The veterinary community should take ownership of this responsibility as it has the knowledge and 

understanding to offer sustainable solution for the management of this infection. 




ZOONOTIC VIRUSES OF BAT ORIGIN – DISCOVERY AND DIAGNOSIS 

Linfa Wang 

CSIRO Livestock Industries, Australian Animal Health Laboratory, Geelong, Victoria 3220 

Bats, probably the most abundant, diverse and geographically dispersed vertebrates on earth, have recently 

been shown to be the reservoir hosts of a variety of zoonotic viruses responsible for severe human and 

animal disease outbreaks, some with very high mortality. These include some of the most deadly viruses to 

emerge in recent history, such as Hendra and Nipah viruses, SARS coronaviruses and Ebola virus. For the 

last decade, our group has been working on bat zoonotic viruses belonging to three different virus families: 

Paramyxoviridae, Coronaviridae and Reoviridae. Examples will be given for each of the three groups of 

viruses, emphasizing on different technology platforms used in virus discovery and development of novel 

diagnostic strategies.


1100 - 1230 Concurrent Session 1.1 - New & Emerging Diseases/Wildlife Mon 

EXPERIMENTAL MODELS FOR HENIPAVIRUS INFECTION: BATS, CATS AND PSEUDO-RATS. 

12 

Bruce A. Mungall, Deborah J. Middleton, Kim Halpin, Peter Daniels, and John Bingham. 

Australian Animal Health Laboratory, CSIRO Livestock Industries, 5 Portarlington Rd, Geelong, Australia 

Introduction: 

November 

Hendra virus (HeV) and Nipah virus (NiV), comprising the genus Henipavirus, family Paramyxoviridae, have 

been responsible for numerous outbreaks of zoonotic disease in livestock and humans. Bats of the genus 

Pteropus have been identified as the reservoir hosts for these viruses. However, how virus spills over from 

the reservoir host has remained a mystery. Nipah virus has continued to re-emerge in Asia, specifically 

Bangladesh, since 2001, with case fatality rates as high as 92%. As there are no currently available vaccines 

or antivirals indicated for Henipavirus infection, possible therapeutic and prophylactic options in the treatment 

and prevention of Nipah virus disease has been seen as a priority in this field of research. In addition to 

novel emerging pathogens, Henipaviruses are also BSL4 agents that possess several biological features 

that make them highly adaptable for use as bioterror agents. Clearly, there is a high level of public health 

importance attributed to Henipaviruses, and by inference, a considerable risk associated with new 

emergence events by other unknown or as yet, uncharacterised paramyxoviruses. 

Material & methods: 

Understanding the amplifying host, the routes of transmission, the type of susceptible human hosts, and the 

epicentres for zoonotic and human transmissions is crucial in the control of zoonotic infections. There have 

been multiple recent paramyxovirus emergence events, many of these involving bats. Some of these newly 

emerged viruses are highly pathogenic (henipaviruses), some are moderately pathogenic (Menangle, PoRV, 

PPMV) while many are of unknown pathogenicity (Tioman, Mapuera, SalV, TPMV). The development or 

characterization of animal models to study these newly identified viral zoonoses is important for 

understanding their pathogenic features and in the development of therapeutics or vaccines. In order to 

address the different angles of Henipavirus research, we have developed a range of experimental animal 

models including bats, pigs, cats, guinea pigs and ferrets, all amenable to BSL4 conditions. This 

presentation describes these models. 

Results: 

While the human symptoms of NiV infection range from fever and headache to severe acute febrile 

encephalitis [1], the porcine disease is primarily a febrile respiratory illness with or without neurological signs 

[3]. In both humans and pigs, NIV pathogenesis appears to be related to a systemic vasculitis [3, 5] and 

experimental infection of cats, hamsters and ferrets has revealed a similar underlying pathology [3, 4, 6] 

(Middleton, unpublished data). While guinea pigs have also been experimentally infected with HeV [2] 

(Halpin et al., Manuscript in preparation) and NiV (Halpin et al., Manuscript in preparation), the pathology 

differed significantly in several respects from the human cases and from naturally and experimentally 

infected horses. NiV and HeV do not cause disease in mice even after subcutaneous administration, and 

there is no serological evidence for NiV in rodents in Malaysia. However, and not surprisingly, HeV and NiV 

will kill mice if administered intracranially but the lack of natural infection precludes the establishment of 

useful rodent models. 

Discussions & conclusions: 

While the cat represents the animal model in which the pathology most closely resembles the lethal disease 

course in humans, and will provide an excellent model for some studies, the ferret provides an excellent 

more economical model for preliminary therapeutic testing. The high level of similarity between the two 

viruses enables therapeutic studies to be carried out for both pathogens in parallel in ferrets followed by cats. 

References: 

1. Goh et al., Clinical features of Nipah virus encephalitis among pig farmers in Malaysia. N Engl J 

Med, 2000. 342(17): p. 1229-35. 

2. Hooper et al., Lesions of experimental equine morbillivirus pneumonia in horses. Veterinary 

Pathology, 1997. 34: p. p312-322. 

3. Middleton etal., Experimental Nipah virus infection in pigs and cats. J Comp Pathol, 2002. 126(2-3): 

p. 124-36. 

4. Mungall et al., Feline model of acute nipah virus infection and protection with a soluble glycoproteinbased 

subunit vaccine. J Virol, 2006. 80(24): p. 12293-302. 

5. Wong et al., Nipah virus infection: pathology and pathogenesis of an emerging paramyxoviral 

zoonosis. Am J Pathol, 2002. 161(6): p. 2153-67. 

6. Wong et al., A golden hamster model for human acute Nipah virus infection. Am J Pathol, 2003. 

163(5): p. 2127-37. 



THE EMERGENCE OF CANINE INFLUENZA IN THE USA: THE RELATIONSHIP TO 

EQUINE INFLUENZA AND DEVELOPMENTS SINCE DISCOVERY IN 2004. 

P.C. Crawford 1 , T.L. Anderson 1 , W.L. Castleman 1 , M.T. Long 1 , R.O. Donis 2 , T.E. Chambers 3 , 

E.P.J. Gibbs 1* . 

1 College of Veterinary Medicine, University of Florida, Gainesville, FL, USA. 

2 Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, Atlanta, GA, USA. 

3 OIE International Reference Laboratory for Equine Influenza, Gluck Equine Research Center, University of Kentucky, Lexington, KY, 

USA. 

In 2004, an influenza virus was isolated from an outbreak of severe respiratory diseases in racing 

greyhounds at a track in Florida. Several dogs died of pulmonary haemorrhage. An influenza virus was 

isolated and the entire genome was sequenced. It was concluded that all eight genes had originated from 

equine influenza virus (H3N8), consistent with cross-species transfer from horse to dog. The details of the 

discovery of canine influenza and the characterization of the virus have been published (Crawford et al. 

2005, Science 310, 482-485). This paper reviews the features of subsequent outbreaks of canine influenza 

in Florida and other states within the USA, and reports on the susceptibility of horses to the canine isolate. 

Since 2004, canine influenza has been confirmed in multiple outbreaks of respiratory disease at greyhound 

tracks throughout the USA and the virus has spread into the pet dog population, particularly those dogs 

housed in shelters. The disease has been confirmed by serology and virus isolation in pet dogs in 25 states 

in the contiguous USA. Molecular characterizations of recent isolates indicate that the virus is continuing to 

evolve. Horses experimentally inoculated with the canine virus were infected as evidenced by 

seroconversion and virus replication in pulmonary tissues, but clinical disease was mild. 

The paper will discuss the relevance of this discovery to the recent epidemic of equine influenza in Australia.


INVESTIGATIONS OF VIRAL MYOCARDITIS IN PIGS ASSOCIATED WITH A NOVEL PESTIVIRUS 

*D.S. Finlaison, P.D. Kirkland, R.W. Cook, M. Srivastava, K.R. King, M.J. Frost 

Virology Laboratory, Elizabeth Macarthur Agricultural Institute, NSW Department of Primary Industries 

Introduction 

In June 2003 a syndrome of sudden death in sucker pigs, elevated stillbirth percentages, increased 

preweaning losses and to a lesser extent increased mummification rates were recognised on a property in 

NSW, Australia 1 . Pathological changes included acute to subacute multifocal, nonsuppurative myocarditis 

and myonecrosis. In addition, elevated immunoglobulin G (IgG) was identified in almost 50% of stillborn 

piglets indicating an in utero infection of viral aetiology was the likely cause. The term porcine myocarditis 

syndrome (PMC) was used to describe this disease. A wide range of recognised viral and bacterial 

pathogens were excluded during diagnostic investigations and numerous attempts to isolate a virus in cell 

culture were unsuccessful. The aim of this study was to produce infected tissues suitable for identification 

and characterisation studies, to reproduce the lesions of the PMC, and to investigate the pathogenesis of the 

disease. 

Materials & methods 

Direct foetal inoculation following exposure of the uterus by laparotomy was used to inoculate a proportion of 

foetuses in each of 22 litters with tissue extracts collected from foetuses and stillborn piglets on the affected 

farm. Three gestational ages were chosen for inoculation and the effects of 6 different inocula were 

examined. Gilts were euthanased between 7 and 28 days post-inoculation. Foetuses were screened for 

evidence of exposure to an infectious agent by measurement of serum IgG and a section of heart was 

examined for histopathological lesions consistent with PMC. A peroxidase linked assay and real-time RT- 

PCR were used to examine the antibody response and quantify viral replication in the dam and foetus. 

Results 

Three inocula were identified as infectious on the basis of elevated IgG in inoculated foetuses. An increase 

in IgG was observed in those foetuses greater than 70 days of gestation at inoculation and euthanased at 

least 17 days post-inoculation. There was evidence of in utero spread of the agent based on IgG results. 

Virus-like crystalline arrays were observed in the tissues from which infectious inocula were derived and in 

the hearts of infected foetuses. Unequivocal lesions of PMC were not reproduced. Serum collected from 

foetuses in one infected litter was utilised for sequence independent single primer amplification and a novel 

pestivirus identified 2 . PCR results provide additional evidence of in utero viral transmission with most 

foetuses in litters inoculated with infectious inocula positive for Bungowannah virus RNA by 17 days postinoculation. 

Virus was still detected in foetuses at 28 days post-inoculation despite the presence of antibody. 

Viraemia in dams receiving infectious inocula resolved with the development of antibody. 

Discussion & conclusions 

Direct foetal inoculation proved to be a valuable method for amplification and identification of a novel 

pestivirus that had previously not been detected by cell culture systems. This study also provides preliminary 

information on the replication of this novel pestivirus in the porcine foetus. Further studies will be required to 

reproduce the disease. 

References 

1. McOrist, S., Thornton, E., Peake, A., Walker, R., Robson, S., Finlaison, D., Kirkland, K., Reece, R., Ross, 

A., Walker, K., Hyatt, A. and Morrissy, C., 2004. An Infectious myocarditis syndrome affecting late-term and 

neonatal piglets. Aust. Vet. J. 82, 509-511. 

2. Kirkland, P.D., Frost, M.J., Finlaison, D.S., King, K.R., Ridpath, J.F., Gu, X., 2007. Identification of a novel 

virus in pigs-Bungowannah virus: A possible new species of pestivirus. Virus Res. 129, 26-34. 




CHARACTERISATION OF A NOVEL PESTIVIRUS ASSOCIATED WITH AN OUTBREAK OF 

STILLBIRTHS AND PRE-WEANING DEATHS IN PIGS DUE TO MYOCARDITIS. 

*M.J. Frost 1 , D.S. Finlaison 1 , P.D. Kirkland 1 , R. Cook 1 , M. Srivastava 1 , K.R. King 1 , J.F. Ridpath 2 , X.Gu 1 . 

1 Virology Laboratory, Elizabeth Macarthur Agricultural Institute, Camden, NSW, Australia 

2 USDA, National Animal Disease Center, Ames, Iowa, USA. 

Introduction 

A syndrome of stillbirths and preweaning losses with myocarditis occurred on 2 Australian pig farms in 

2003 1 . While extensive investigations excluded a wide range of known agents, a foetal inoculation study 2 

confirmed an infectious agent was present and likely to be viral. This paper describes the 

identification/characterisation of this agent. 

Material & methods 

Sequence independent single primer amplification (SISPA) 3 was undertaken on nucleic acid extracted from 

a pool of foetal serum. PCR primers matching terminal sequences of RNA fragments detected by SISPA 

were used to amplify intervening RNA segments. PCR products were cloned, sequenced and compared with 

data in Genbank. Viral replication in PK-15A cells was detected by PCR and immunoperoxidase (IPX) 

staining using convalescent pig serum. Antigenic characterisation was undertaken by IPX using a large 

collection of monoclonal antibodies and polyclonal antisera. 

Results 

Viral RNA sequences identified by SISPA and PCR included the 5’UTR, N pro and E2 coding regions of a 

pestivirus 4 . There was also limited sequence from the p7, E rns , NS5A and NS5B regions of the genome. The 

entire genome was subsequently sequenced. Genetic analyses and the construction of dendrograms show 

that this novel virus is genetically distinct from all of the recognised pestiviruses. Sequence homology with 

the four currently defined pestivirus species ranges from 45% to 64.91%. In addition it does not cluster with 

other divergent viruses such as the giraffe, HoBi or pronghorn strains of pestivirus. Antigenic 

characterisation studies showed that this virus is also antigenically remote from pestiviruses in each of the 

recognised species. No IPX staining was observed with any of the pan-reactive monoclonal antibodies. 

There was, however, limited cross reactivity between Bungowannah virus antigens and polyclonal antisera 

against some strains of BVDV2 and CSFV in IPX and virus neutralisation assays. 


The viral RNA sequences identified are consistent with a novel pestivirus that has a low degree of genetic 

identity with recognised and proposed pestivirus species. This virus is also antigenically very different from 

most pestiviruses, showing no reactivity with any of the widely used pan-reactive monoclonal antibodies. 

Collectively these results suggest that this virus is the most divergent of the pestiviruses that has been 

described and warrants classification as a new species in the genus. The failure of this virus to react with 

commonly used monoclonal antibodies and its divergent nucleotide sequence have implications for the 

design and use of diagnostic assays for pestiviruses. At present it is probable that the virus would escape 

detection by existing diagnostic procedures. 

References 

1. McOrist S, Thornton E, Peake A, Walker R, Robson S, Finlaison D, Kirkland P, Reece R, Ross A, Walker 

K, Hyatt A, Morrissy C. An infectious myocarditis syndrome affecting late-term and neonatal piglets. Aust Vet 

J. 2004 Aug;82(8):448. 

2. Finlaison D.S, Kirkland P.D, Cook R.W, Sirastava M, King K.R, Frost M.J. Investigations of viral 

mycoarditis in pigs associated with a novel pestivirus. WAVLD 13 th International Symposium 2007 

3. Allander T, Emerson S.U, Engle R.E, Purcell R.H and Bukh J. A virus discovery method incorporating 

DNase treatment and its application to the identification of two bovine parvovirus species, Proc. Natl. Acad. 

Sci. 98 (2001), pp. 11609–11614. 

4. Kirkland P.D, Frost M.J, Finlaison D.S, King K.R, Ridpath J.F, Gu X., 2007 Identification of a novel virus in 

pigs—Bungowannah virus: A possible new species of pestivirus. Virus Research 129, 26–34


HOW MANY PESTIVIRUSES CIRCULATE IN NATURE? PESTIRUSES IN FREE-LIVING ANIMALS: 

PRESENT STATUS AND PROBLEMS 

S.Vilcek 1* , P.F. Nettleton 2 

1 University of Veterinary Medicine, Kosice, Slovakia; 2 Moredun Research Institute, Pentlands Science Park, Penicuik, Midlothian EH26 

0PZ, UK 

Four pestivirus species infect domestic animals. BVDV-1 and BVDV-2 mostly infect cattle, CSFV – swine, 

BDV – sheep. Pestiviruses are not strictly host specific because they can infect many other animals. Genetic 

analysis of pestiviruses by rapid sequencing of PCR products coupled with phylogenetic analysis revealed 

new viral genotypes, some of them in free-living animals. 

Mainly BVDV specific antibodies have been reported in captive and free-living animals. Pestivirus specific 

antibodies were detected in over 40 animal species but the isolation of viruses from wild animals is relatively 

rare. It is generally known that CSFV infects not only domestic pigs but also wild boars which are significant 

reservoirs of this virus. The BVDV-1 isolates were already detected for example in deer, roe deer, mouse 

deer, lama, yak, eland, buffalo, bison. Recently, a pestivirus isolated from reindeer has been typed as BDV-2 

genotype (Becher et al., 2003). Pestivirus identified in chamois has been typed as BDV-4 genotype causing 

significant problems in chamois population in Pyrenees (Arnal et al., 2004). The first giraffe pestivirus strain 

was identified in 60-ties, the second giraffe strain just several years ago. Both strains belong to the 

unclassified pestivirus species and in the phylogenetic analysis form a giraffe pestivirus genotype (Avalos- 

Raminez et al., 2001). Pestivirus isolated from a pronghorn antelope found dead in Wyoming (Vilcek et al., 

2005) as well as recently identified Bungowannah pestivirus in pig (Kirkland et al., 2007) are representants of 

two most distinct pestivirus genotypes so far. 

All together six pestivirus genotypes (CSFV, BVDV-1, BDV-2, BDV-4, giraffe and pronghorn antelope) have 

been identified in wild animal population. Viruses of BVDV-2, BDV-1 or BDV-3 genotype infecting mostly 

cattle and sheep have not been found in wild animals yet. 

Most data presented in scientific literature suggest that pestivruses are more likely transmitted from domestic 

animals to wildlife population. The transmission in opposite way is not exactly proved but theoretically it can 

not be excluded that transmission of highly virulent pestivirus strain from domestic to wild animals or vice 

versa could have a devastating effect on the eradication programmes as well as on wildlife population. 

There are potential problems with the identification of new pestiviruses: 

i/ selection of the correct virus for use in serological studies 

ii/ use of the correct cells for the isolation of new pestiviruses 

iii/ proper selection of RT-PCR primers for the detection of new pestivirus genomes 

All data suggest that pestiviruses are highly efficient viruses infecting domestic and many free-living animal 

species and they evolved well-adapted strategy to survive in nature. Taking into account present status with 

the identification of new pestiviruses we can conclude that wild animals may be infected with more 

pestiviruses than we have identified at present. No doubt that there is a need for more systematic research 

focused on the occurrence of pestiviruses in free-living animals. 

References 

Arnal, M., et al.: J. Gen. Virol., 85, 3653, 2004. 

Avalos-Raminez, R., et al.: Virology 286, 456, 2001. 

Becher, P., et al.: Virology 311, 96, 2003. 

Kirkland, P.D. et al. : Virus Res., 129, 26, 2007. 

Vilcek S., et al.: Virus Res., 108, 187, 2005. 




CHARACTERIZATION AND DETECTION OF BVDV RELATED 

REPRODUCTIVE DISEASE IN WHITE-TAILED DEER 

J.F. Ridpath 1* , E.A. Driskell 2 , C.C. Chase 3 , J.D. Neill 1 

1 NADC/ARS/USDA, Ames, IA, 2 University of Georgia, Athens, GA, 3 South Dakota State University, Brookings, SD 

Introduction 

Bovine viral diarrhea viruses (BVDV) are the causative agent of reproductive and respiratory disease in 

cattle resulting in significant economic loss to the beef and dairy industries. The primary consequences of 

reproductive infection are due to the direct infection of the fetus and the outcome depends on the stage of 

gestation in which the fetal infection occurs 1 . Although abortions and weak calves have been attributed to 

BVDV infection in late gestation 6 , infections occurring earlier in gestation generally have greater impact. 

Fetal infections in cattle, occurring during the first trimester, result in fetal reabsorption, mummification, 

abortion or the establishment of persistently infected (PI) animals. PI cattle are considered the main vector 

for introduction of the virus to naïve herds. 

BVDV also replicates in white-tailed deer (Odocoileus virginianus) 2-5 . Free ranging white-tailed deer 

populations are frequently in contact with domestic cattle in the U.S., therefore, possible transfer of BVDV 

between cattle and deer has significant implications for proposed BVDV control programs. The goal of this 

study was to examine the effects of BVDV infection in pregnant white-tailed deer 


Eleven white-tailed does were purchased from a commercial breeder and housed in BSL2 containment. 

Pregnancy status was confirmed and the calculated stage of pregnancy was based on date of contact with 

buck. Does were inoculated with one of two BVDV previously recovered from wild white-tailed deer. Levels 

of BVDV neutralizing serum antibodies were determined prior to inoculation and 21 or 35 days post 

inoculation. Virus isolation was performed on tissues from aborted fetuses, tissues from does that died and 

from blood samples from live fawns. Additionally, ear notches of live fawns were tested for BVDV antigen by 

antigen capture ELISA (ACE). 

Results 

Two of the does had serum antibody titers against BVDV (>512) prior to inoculation; the remaining 9 does 

were seronegative. Both seropositive animals gave birth to normal fawns. Of the remaining 9 seronegative 

animals, one was not pregnant at the start of the study, four died (death between 8 to 79 days post 

inoculation), one apparently readsorbed its fetus, two aborted and one gave birth to two probable PI fawns. 

BVDV was isolated from fetuses, maternal tissues and PI fawns. Ear notches of PI fawns were positive by 

ACE. 

Discussions & conclusions 

Following BVDV infection of deer we confirmed infection of fetal tissues within the first 7 – 8 days of 

infection. We observed abortion and mummification following infection and the birth of apparently 

persistently infected fawns. The fawns of does that had serum neutralizing antibodies against BVDV at the 

time of inoculation were protected. These observations are consistent with the clinical presentation of BVDV 

associated reproductive disease in cattle following exposure before 125 days gestation. Further research 

needs to be done to determine if the similarities between BVDV associated reproductive disease in whitetailed 

deer and cattle hold at later stages of gestation and to determine, more exactly, the window of fetal 

vulnerability for development of persistent BVDV infection in white-tailed deer. 

References 

1 Brock KV, Grooms DL, Givens MD: 2005, Reproductive disease and persistent infections. In: Bovine viral 

diarrhea virus: diagnossis, management and control, eds. Goyal SMRidpath JF, pp. 145-156. 

Blackwell Publishing, Ames, IA. 

2 Chase CCL, Braun LJ, Leslie-Steen P, et al.: 2007, Evidence of bovine viral diarrhea virus persistent 

infection in two white-tailed deer in southeastern South Dakota. Journal of Wildlife Diseases In 

press. 

3 Passler T, Walz PH, Ditchkoff SS, et al.: 2007, Experimental persistent infection with bovine viral diarrhea 

virus in white-tailed deer. Vet Microbiol 122:350-356. 

4 Ridpath JF, Mark CS, Chase CCL, et al.: 2007, Febrile response and decrease in circulating lymphocytes 

following acute infection of white tail deer fawns with either a BVDV1 or a BVDV2 strain Journal of 

Wildlife Diseases 43:In press. 

5 Van Campen H, Williams ES, Edwards J, et al.: 1997, Experimental infection of deer with bovine viral 

diarrhea virus. J Wildl Dis 33:567-573. 

6 Ward GM, Roberts SJ, McEntee K, Gillespie JH: 1969, A study of experimentally induced bovine viral 

diarrhea-mucosal disease in pregnant cows and their progeny. Cornell Vet 59:525-538.


1100 - 1230 Concurrent Session 2.2 - Molecular Diagnostic Assays - I (Bacterial disease) Mon 

DEVELOPMENT OF AN IMPROVED IDENTIFICATION MATRIX FOR AEROMONAS SALMONICIDA 

12 

*Melissa Higgins 

November 

1 , Jeremy Carson 1 , and Nick Gudkovs 2 

1 

Department of Primary Industries and Water, 

2 

Australian Animal Health Laboratory, CSIRO, Geelong 

Introduction 

Members of the genus Aeromonas are widely distributed in aquatic environments and have been described 

in association with disease in both aquatic animals and humans. The genus comprises 16 species and a 

number of subspecies and biovars. As the number of validly described Aeromonas species is increasing, 

more is being revealed about the importance of these bacteria as pathogens of aquatic animals. A number 

of Aeromonas species are capable of causing disease in fish. One of the more notable species is 

Aeromonas salmonicida, the aetiological agent of furunculosis in salmonids causing significant economic 

losses in aquaculture worldwide. It is essential that diagnostic laboratories have the capacity to identify the 

subspecies and biovars of A. salmonicida. The aim of this work was to phenotypically characterise A. 

salmonicida including subspecies and biovars and incorporate the information into the MicroSys A24 

miniaturised biochemical identification system developed by The Department of Primary Industries & Water, 

Tasmania. 


A library of 148 A. salmonicida isolates was complied and characterised for numerical taxonomy using 27 

tests in miniaturised format targeted for use on the Aeromonads. Phenotyping was undertaken at 25 °C for 

48 hours. Relationships based on similarities were assessed by cluster analysis using ClustanGraphics 

software. The phenotypic characteristics of each of the clusters was then used to construct a data matrix to 

be used in probabilistic identification using PIBWin software package 

Results 

The characterisation and subsequent analysis of the A. salmonicida library resulted in the generation of 12 

defined clusters. Aeromonas salmonicida ssp. salmonicida formed a discrete cluster that contained strains 

that were all PCR positive when tested with the Miyata primer set. The Tasmanian biovar Acheron also 

formed a very homogeneous cluster as did those of greenback flounder and goldfish ulcer disease strains, A. 

salmonicida spp achromogenes and A. salmonicida spp masoucida. The remaining five clusters 

represented distinct biovars of exotic atypical strains. 

Two identification matrices were developed from the data generated. A complete Aeromonas matrix , 

AeroMat-1 capable of identifying isolates to the species level and a second matrix, AsalMat-1 for the 

identification of A. salmonicida subspecies and biovars 


The MicroSys A24 identification panel and revised probability provide the means to identify potentially 

enzootic and exotic isolates of A. salmonicida and allocate them to defined biovars and subspecies. These 

matrices do not aim to replace the role of PCR in the primary identification of A. salmonicida rather provides 

a means of identifying biovars of relevance to Australia. 



AN IMPROVED PCR-BASED TEST FOR QX DISEASE CONFIRMATION IN SYDNEY ROCK OYSTERS 

I. Marsh 1 *, J. Go 2 , S. Austin 1 , S. Fell 1 , V. Saunders 1 and L. Reddacliff 1 

New South Wales Department of Primary Industries, Elizabeth Macarthur Agricultural Institute, Australia 1 

Faculty of Veterinary Science, University of Sydney, Camden, NSW, Australia 2 

Introduction 

Marteilia sydneyi (M. sydneyi) is the causative agent of QX disease, a parasitic disease of Sydney rock 

oysters (Saccostrea glomerata - SRO) that results in mass mortality events along the east coast of 

Australia 1 . QX disease can be diagnosed using a range of laboratory tests including: histology 2, 3 , indirect 

fluorescent antibody testing 4 and DNA hybridization with fluorochrome-labeled probes 5 . However, routine 

diagnosis is achieved using cytology 2, 3 and polymerase chain reaction (PCR) 5-7 . During recent surveillance 

studies of QX disease on the New South Wales coast we identified a number of issues with using a single M. 

sydneyi specific PCR. Firstly, without in vitro culture or experimental transmission techniques for M. sydneyi 

we are lacking a consistent source of positive control tissue to include in routine diagnostic testing for this 

disease. Secondly it is not possible to distinguish between true negative results and a reaction that has 

failed to amplify due to the presence of PCR inhibitory substances originating from the digestive gland or 

from neighboring tissues that have been included in the sample for DNA extraction. Finally, we wanted to 

introduce a third PCR assay to differentiate between SRO and Pacific oysters (Crassostrea gigas - PO) that 

may accidentally be included in a submission of SRO. Our aim was to develop a modified PCR-based QX 

disease testing regime to overcome these problems. 

Methods 

We developed two PCR assays that target the 16sRNA genes of the SRO and PO and examined these, plus 

the M. sydneyi PCR, on digestive glands of infected SRO and healthy PO. We also examined the effects of 

neighboring tissues, stomach and gonad, on these assays. 

Results 

The 16sRNA assays were successfully used, individually and multiplexed, to confirm the DNA extraction and 

differentiate between SRO and PO. We also found that the inclusion of neighboring tissues has no adverse 

effect on all three assays. 

Conclusions 

Here we recommend a modified PCR-based QX disease testing regime for when PCR confirmation is 

required to determine the presence of M. sydneyi in SRO. This testing regime overcomes much of the 

ambiguity of a negative PCR result when the M. sydneyi specific PCR assay is used on its own. 

Furthermore, it can also differentiate between SRO and PO thus increasing the overall quality control of this 

diagnostic test. We have attempted to multiplex the M. sydneyi and 16sRNA assays but the results indicated 

that the reaction was biased towards the amplification of the 16sRNA products even when M. sydneyi was 

present. Therefore, these assays are currently run separately until further research can be undertaken to 

overcome the stoichiometry conditions of the combined assay. Future work includes modifying this PCR test 

to a real-time PCR format. 

References 

1. Wolf, P.H. 1979. Life Cycle and Ecology of Marteilia sydneyi in the Australian Oyster, Crassostrea 

commercialis. Marine Fisheries Review. 41: 70 – 72. 

2. Bower, S.M. and Kleeman, S.N. 2003. Synopsis of Infectious Diseases and Parasites of Commercially 

Exploited Shellfish: Marteilia sydneyi of oysters. (www.pac.dfompo.gc.ca/sci/shelldis/pages/marsydoy) 

3. ProMed. 2003. Fisheries investigate Sydney rock oyster parasite. Hoover News. 

4. Newton, K., Peters, R. and Raftos, D. 2004. Phenoloxidase and QX disease resistance in Sydney rock 

oysters (Saccostrea glomerata). Developmental and Comparative Immunology. 28: 565 – 569. 2004. 

5. Kleeman, S.N., Le Roux, F., Berthe, F. et. al. 2002. Specificity of PCR and in situ hybridisation assays 

designed for detection of Marteilia sydneyi and M. refringens. Parasitology. 125: 131 – 141. 

6. Nell, J.A. and Hand, R.E. 2003. Evaluation of the progeny of second-generation Sydney rock oyster 

Saccostrea glomerate (Gould, 1850) breeding lines for resistance of QX disease Marteilia sydneyi. 

Aquaculture. 228: 27 – 35. 

7. Wesche, S. J., Adlard, R.D. and Lester, R.J.G. 1999. Survival of spores of the oyster pathogen Marteilia 

sydneyi (Protozoa, Paramyxea) as assessed using fluorogenic dyes. Disease of Aquatic Organisms. 

36: 221 – 226.


THE DEVELOPMENT OF SNP DISCRIMINATION ASSAYS ON A REAL-TIME PCR PLATFORM AS A 

TOOL FOR THE RAPID IDENTIFICATION AND SPECIATION OF BRUCELLA. 

K.K. Gopaul, C.J. Smith and A.M. Whatmore* 

Department of Statutory and Exotic Bacterial Disease, Veterinary Laboratories Agency, Woodham Lane, Addlestone, Surrey, United 

Kingdom, KT15 3NB. [a.whatmore@vla.defra.gsi.gov.uk] 

Introduction. Brucellosis, caused by members of the genus Brucella, remains a major zoonotic problem in 

much of the world. Six distinct species are identified within the genus; B. abortus (bovine), B. melitensis 

(caprine, ovine), B. suis (porcine, rangiferine, leporine), B. canis (canine), B. ovis (ovine) and B. neotomae 

(desert wood rat) with evidence of additional species, yet to be formally named, associated with various 

marine mammal species [1]. Currently the most widely recognised tool for Brucella speciation is biotyping but 

this method is slow, can be very subjective and involves hazardous culture of a pathogen readily acquired by 

laboratory workers. The aim of this work is therefore to develop a rapid molecular alternative that can initially 

identify to species level but will ultimately be extended, if possible, to include markers for subgroups (e.g. 

biovars) and live vaccine strains. 

Materials & Methods. Single nucleotide polymorphisms (SNPs) specific for each Brucella species were 

identified on the basis of an extension of multilocus sequencing studies previously described by us [2]. Some 

21 distinct genomic fragments, representing >10 Kb of sequence, were sequenced from >300 Brucella 

isolates representing the known diversity of the group. Based on this work, that comprises the most 

extensive study of the population structure of the genus undertaken to date, pairs of MGB allele 

discrimination probes were designed and tested. Probes corresponded to species-specific SNPs and the 

alternative ‘common’ allelic state, and were designed for use in real-time PCR reactions to discriminate each 

of the six Brucella species and the marine mammal Brucella. 

Results. The performance of various probe pairs designed to interrogate SNP sites with a change specific 

for each of the individual species was assessed and those that provided most promising discrimination were 

selected. Probe pairs were all optimised to function under identical PCR conditions allowing development of 

a multiplex assay. Once optimised the performance of the resulting ‘speciation’ assay was assessed by 

testing over 300 field and reference isolates of Brucella. Sensitivity of the assay was determined by testing 

serial dilutions of purified genomic DNA while specificity was assessed by testing organisms phylogenetically 

related to Brucella. 

Discussion and Conclusions. Use of multilocus sequence data from several hundred strains facilitated the 

confident design of a diagnostic assay based on a robust phylogenetic framework. The assay can ‘speciate’ 

an isolate in around 2 hours and has many advantages over biotyping being much easier to perform, less 

labour intensive, less subjective and avoiding extensive culturing of this hazardous agent. Furthermore, the 

principle of the assay can now be extended to further subtype beyond the species level by incorporating 

additional markers to identify subgroups, such as biovars, and live vaccine strains. The assay will also be 

amenable to future expansion should additional Brucella species be identified – suitable markers for 

inclusion should readily be identified by undertaking the same multilocus sequencing approach. 

References. 

[1] Groussaud, P., Shankster, S.J., Koylass, M.S., and Whatmore, A.M. 2007. Molecular typing divides 

marine mammal strains of Brucella into at least three groups with distinct host preferences. Journal of 

Medical Microbiology. In press. 

[2] Whatmore, A.M., Perrett, L.L., and Macmillan, A.P. 2007. Characterisation of the genetic diversity of 

Brucella by multilocus sequencing. BMC Microbiology 7:34. 




DETECTION OF MYCOPLASMA HYOPNEUMONIAE IN PIG SAMPLES 

USING POLYMERASE CHAIN REACTION TESTS 

G. J. Eamens, NSW Department of Primary Industries 

Introduction 

Mycoplasma hyopneumoniae (Mhp) is a major respiratory pathogen of pigs with worldwide distribution. It is 

responsible for lost production through its ability to induce pneumonia but particularly to predispose pigs to 

secondary respiratory infections with other bacterial and viral pathogens. As Mhp is difficult to culture from 

field material, diagnostic testing has relied on serological and PCR-based assays to indicate herd infection. 

Numerous reports describe PCR tests for the specific and sensitive detection of Mhp, varying from 

conventional one step and two step (nested) assays to real time PCR, and targeting numerous DNA 

sequences considered specific for Mhp. Few have been examined concurrently, and thus diagnostic 

laboratories tend to rely on data collected with limited head-to-head evaluation. 


This study reviewed 25 PCR assays reported in the literature since 1993. It targeted conventional PCR 

assays reported with sufficient information to score the features of each. The factors considered of interest 

were: sensitivity < 10 fg, prior evaluation in lung tissue, nasal swabs and other tissues, as well as a proven 

ability to detect M. hyopneumoniae in nasal swabs, and prior evaluation with commercial extraction kits. In 

the initial phase, issues affecting test evaluation in “beta testing” assays were identified. Cultures of Mhp and 

related mycoplasmas (M. flocculare, M. hyorhinis) were also obtained to assist in test optimisation prior to 

application to field samples from several herds with high and low disease status for mycoplasmal pneumonia 

(nasal swabs from weaner and finisher pigs, lung samples from affected slaughter pigs). 

Results and discussion 

Among nine conventional PCR assays which were well described and for which analytical sensitivity and 

application data was available, five assays with reported high sensitivity were able to be selected for 

concurrent evaluation (Table 1). Among nine commercial DNA capture kits applied to M. hyopneumoniae 

PCR tests on tissues, two currently used in Australian diagnostic laboratories (Instagene matrix, BioRad; 

DNeasy, Qiagen) were selected for comparative evaluation. Optimisation studies using DNA from previously 

characterised mycoplasmal strains showed some published protocols required adjustment of annealing 

temperatures and some assays showed cross-reactivity or failure to detect some Mhp strains. Efforts to 

clone some cultured strains and apply multiplex assays were also required to validate the source strains. 

Table 1. Comparative literature evaluation of conventional PCR for M. hyopneumoniae 

Type Test Analytical 

sensitivity 

PCR 

nested 

PCR 

Artiushin 1 1-10 pg 1 ;1-10 pg 7 

Mattsson 8 

6 fg 8 ; 100 fg 7 

Blanchard 3 

0.5 pg 3 ; 10 pg 7 

Baumeister 2 5-18.5 fg 5 

Caron 6 50 pg 6 ; 1 pg 7 

Stark 9 1.2 fg 9 ; 2.5 fg 7 

Calsamiglia 4 96 fg 4 ; 1 fg 7 

Verdin 10 1 fg 10 , 1 fg 7 

Kurth 7 0.5 – 1 fg 7 

High 

sensitivity 

< 10 fg 

Tested 

on lung 

tissue 

Tested on 

nasal 

swabs 

Tested 

on other 

tissue 

Detects in 

nasal 

swabs 

DNA kit 

used 

- - - - - - 

- + + + + - 

- - - + - - 

+/- + + + - + 

- + - + - + 

+ + + + + + 

+ + + + + + 

+ + - + - - 

+ + + + + + 

Conclusions 

A significant investment can be required in the laboratory introduction of diagnostic Mhp PCR, and may 

require extensive in-house validation to optimise the assay and confirm specificity. 

References 

1. Artiushin S, Stipkovits L, Minion FC (1993). Molec Cel Probes 7, 381-385. 

2. Baumeister AK, et al H (1998) J Clinical Microbiol 36, 1984-1988. 

3. Blanchard B, et al (1996). Molec Cell Probes 10, 15-22. 

4. Calsamiglia M, Pijoan C, Trigo A (1999). J Vet Diag Invest 11, 246-251. 

5. Carew D (2004). PhD thesis, Swinburne Univ of Technology 56-63; 97-111. 

6. Caron J, Ouardani M, Dea S (2000). J Clin Microbiol 38, 1390-1396. 

7. Kurth KT, et al (2002). J Vet Diag Invest 14, 463-469. 

8. Mattsson JG, et al (1995). J Clin Microbiol 33, 893-897. 

9. Stark KDC, Nicolet J, Frey J (1998). Appl Environ Microbiol 64, 543-548. 

10. Verdin E, et al (2000). Vet Microbiol 76, 31-40. 

Supported by Australian Pork Limited


DEVELOPMENT AND EVALUATION OF A REAL-TIME PCR TEST FOR THE DETECTION OF 

THEILERIA PARVA INFECTIONS IN CAPE BUFFALO (SYNCERUS CAFFER) AND CATTLE 

*1 KP Sibeko, 1 MC Oosthuizen, 1 NE Collins, 2 D Geysen, 3 A Latif, 4 HT Groeneveld, 1 JAW Coetzer, 

3 F Potgieter 

1 Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Private Bag X04, Onderstepoort, 

0110, South Africa 

2 Department of Animal Health, Institute of Tropical Medicine, 155 Nationalestraat, Antwerp B-2000, Belgium 

3 Agricultural Research Council-Onderstepoort Veterinary Institute, Private Bag X5, Onderstepoort, 0110, South Africa 

4 Department of Statistics, School of Mathematical Science, University of Pretoria, Pretoria, 0002, South Africa 

Introduction 

Corridor disease, caused by the tick-borne protozoan parasite Theileria parva, is a controlled disease in 

South Africa. The Cape buffalo is the reservoir host and uninfected buffalo have become sought-after by the 

game industry in South Africa, particularly for introduction into Corridor disease-free areas. A real-time PCR 

test for detection of T. parva DNA was developed to improve the sensitivity and specificity of the official 

diagnostic tests. 


A set of Theileria genus-specific primers was designed to amplify a 230 bp region of the 18S ribosomal RNA 

(rRNA) gene and a hybridization probe set was designed for specific detection of T. parva. Furthermore, a 

T. parva-specific forward primer was designed, to increase the specificity of the assay. DNA extracted from 

cattle and buffalo blood samples collected from different areas in South Africa was used in the evaluation of 

the real-time PCR test. These included T. parva positive, negative and field samples. 

Results 

The two sets of primers designed for the real-time PCR assay successfully amplified T. parva DNA under the 

conditions optimised for this assay. In addition to T. parva amplicons, the T. parva-specific hybridization 

probes recognised T. taurotragi and T. annulata PCR products generated by the Theileria-genus specific 

primers. These amplicons could be distinguished by melting curve analysis, with the T. parva Tm at 63 

±0.62°C, T. annulata Tm at 48 ±0.09°C and T. taurotragi at 45 ±0.19°C. The use of the T. parva-specific 

forward primer eliminated amplification of all other Theileria species, except for Theileria sp. (buffalo). In 

samples infected with both of these species, only the T. parva amplicon was detected by the T. parva probe 

set. No amplification was observed from any of the other Theileria species or other blood parasites and 

bacterial DNA samples tested. The real-time PCR assay was ~27% more sensitive than the conventional 

PCR/probe and RLB assays and 16% more sensitive than the coxI assay in detecting T. parva in field 

samples. 


The T. parva-specific probe set also detected T. taurotragi and T. annulata when the Theileria genus-specific 

primers were used, because of the similarities in the 18S rDNA sequence of these species in the region from 

which the probe sequence was derived. However, this did not influence the specificity of the assay because 

the different products were easily discriminated by melting curve analysis. The sensitivity of the test was 

improved by designing a T. parva-specific forward primer. Although the Theileria sp. (buffalo) DNA could still 

be amplified when the T. parva-specific forward primer because of the high similarity of the Theileria sp. 

(buffalo) 18S rRNA gene sequence with that of T. parva, the test still remains specific in detecting only T. 

parva as the T. parva-specific hybridization probe set only detects T. parva amplicons. In conclusion, the 

real-time PCR assay reported here is specific for T. parva and more sensitive and faster than other 

molecular assays currently used in T. parva diagnostics. The assay is highly reproducible and has been 

shown to be reliable in the detection of T. parva at piroplasm parasitaemia levels as low as 8.79x10 -4 %. 

Acknowledgements 

The authors are grateful to the FAO-EMPRES for the funding granted to attend the Symposium. 




DETECTION AND STRAIN TYPING OF COXIELLA BURNETII USING MOLECULAR BEACONS IN A 

REAL-TIME PCR 

W.L. McDonald* 1 , S. Humphrey 1 , K. Fernando 1 , J. Fitzmaurice 1 , A.M.J. McFadden 1 , J. E. Samuel 2 , K.E. Russell-Lodrigue 2 

and J. O’Keefe 1 

1. Investigation and Diagnostic Centre, MAF Biosecurity New Zealand, Upper Hutt, NEW ZEALAND, 2. Department of Veterinary 

Pathobiology, Texas A&M University System Health Science Center, College Station, USA. 

Introduction 

Q fever is an exotic disease to New Zealand (NZ), but is endemic in the livestock of all of our trading partners 

and is a significant zoonotic disease. In humans Q fever manifests in two forms; acute, which is 

characterised by flu-like symptoms, pneumoniae or hepatitis and chronic, which is characterised by 

prolonged fever and endocarditis. In animals Q fever is usually asymptomatic, but in some cases can cause 

abortions and reproductive disorders. Transmission of C. burnetii is primarily by inhalation of infectious 

aerosols; ingestion, skin trauma and sexual contact are secondary routes. Q fever has a world-wide 

distribution, except for NZ with freedom being established by serological surveys (1). The NZ Import Health 

Standards require importers to serologically test donor animals of germplasm. The use of a validated 

sensitive PCR assay to screen germplasm would reduce the risk of a border incursion. Furthermore, it is 

hypothesised that cattle may harbour different strains of C. burnetii to that of goats and sheep. Strain 

differentiation is also important in further understanding the pathogenesis and epidemiology of C. burnetii. 

The presentation will provide background information on Q fever and describe the development of a rapid, 

real-time PCR employing molecular beacons for the detection and strain differentiation of C. burnetii. 


Oligonucleotide primers and molecular beacons were designed to discriminate a SNP at position 745 in the 

icd gene of C. burnetii. Strains of C. burnetii that cause persistent Q fever in cattle, ‘acute’ Q fever in 

humans and isolated from ticks contain a guanine nucleotide at the SNP site (probe AP). Strains of 

C. burnetii that cause abortions in goats and sheep, ‘chronic’ Q fever in humans and isolated from rodents 

have an adenine nucleotide (probe C). The analytical sensitivity was evaluated by testing reference strains of 

C. burnetii, replicates of ten-fold dilutions of purified C. burnetii DNA and replicates of ten-fold dilutions of 

irradiated C. burnetii spiked in extended bovine semen. Preliminary diagnostic sensitivity was conducted by 

testing a range of samples from sheep experimentally-infected with C. burnetti at the Texas A&M University. 

The analytical specificity was evaluated by testing other bacteria and viruses that may be present in semen 

or cause similar disease syndromes. Diagnostic specificity testing was conducted on extended semen from 

NZ bulls. 

Results 

Probe AP detected 100% (8/8) of C. burnetii isolates from ticks, chiggers, cows, and humans with acute 

symptoms of Q fever. Probe C detected 100% (10/10) of isolates from rodents, a goat and humans with 

chronic symptoms of Q fever. The analytical sensitivity using purified DNA was 100 ag of strain RSA329 with 

probe AP and 10 fg of strain Q177 with probe C. The analytical sensitivity for detection of non-viable, whole 

cell C. burnetii in semen was 4.2 ± 0.7 CFU/mL. Preliminary diagnostic sensitivity was 100% (12/12) for 

placenta, 60% (3/5) for vaginal swabs and 25% (1/4) for milk samples from sheep experimentally-infected 

with C. burnetii. The PCR had an analytical specificity of 100% for 50 non-target microorganisms and a 

diagnostic specificity of 100% (95% CI: 97 – 100%) when tested against negative controls consisting of 145 

semen straws from NZ bulls. 


The real-time PCR is sensitive and specific, and whilst it was developed for use in screening animal 

germplasm for C. burnetii, it also has application in investigation of exotic disease notifications and for 

surveillance testing in NZ. In countries with Q fever the PCR could provide a tool for the identification of 

infected animals facilitating control programs. The icd gene was targeted for the design of the molecular 

beacons as it has been previously described to differentiate strains of C. burnetii (2). The animal host range 

of strains of C. burnetii has not been conclusively determined and the real-time PCR could be used as a tool 

for testing large numbers of samples from infected animals to explore this question. The PCR could be used 

as an aid for diagnosis of Q fever in humans and to explore causes of the different disease manifestations. 

References 

1.. Hillbink, F. 1993. Surveillance. 20:39-40. 

2. Van Nguyen, S. and K. Hirai. (1999). FEMS Microbiol: 180:249-254.


1330 - 1455 Concurrent Session 1.2 - FMD Mon 12 

CHANGING FACES OF FOOT-AND-MOUTH DISEASE TYPE O PANASIA STRAIN IN INDIA 

D. Hemadri, A. Sanyal, C.Tosh, R. P. Tamilselvan, J. K. Mohapatra, S. Saravanan T. J. Rasool, S. K. Bandyopadhyay and B. Pattnaik 

Project Directorate on Foot-and-Mouth Disease, 

IVRI Campus, Mukteswar-Kumaon, Nainital 263 138, (Uttarakhand) India 

November 

Foot and mouth disease (FMD) is an acute vesicular disease of wild and domestic ungulates. The causative 

agent, foot and mouth disease virus (FMDV, family Picornaviridae, genus Aphthovirus) exists in seven 

serologically and genetically distinct types, viz., O, A, C, Asia 1, South African Territories (SAT) 1-3. In India, 

the disease is endemic and outbreaks are recorded due to O, A and Asia 1 every year with type O 

accounting for nearly 75-80% of total outbreaks. Our earlier studies have shown that a particular lineage, 

named PanAsia strain (Knowles et al., 2000) to be predominantly involved in type O outbreaks in India 

(Hemadri et al., 2000). Notably, this strain was responsible for an explosive pandemic in Asia, parts of Africa 

and Europe during 2000-01 (Knowles et al., 2000). Surprisingly, this strain was overtaken by a strain (new 

strain/Ind 2001strain; Knowles et al., 2005) that emerged in 2001 (Hemadri et al., 2002). In this study we 

have analyzed type O FMD situation in the aftermath of the emergence of this strain. 

Field viruses, collected during 2000-05, either in the form of infected cell culture supernantant or infected 

tongue epithelium were used for RNA extraction using RNAeasy (qiagen) mini kit. Genomic region was 

successfully amplified by RT and PCR as described previously (Hemadri et al., 2000). A minimum of 450 nt 

bases from each of these isolates were used for phylogenetic reconstruction using the programme MEGA 4. 

The sequences generated in this study were also compared to the previously published sequences. 

The neighbour-joining tree constructed from these isolates showed four major clusters: Cluster I represented 

isolates of PanAsia strain. Cluster II was represented by isolates of the recent origin and the sublineage, 

new train (NS)/Ind 2001, that caused maximum oubreaks during 2001-02 formed cluster III. Fourth cluster 

was represented by fewer isolates recovered during 2000-05. 

The study shows following interesting epidemiological patterns; for example there was an upsurge of type A 

outbreaks which started in the later part of 1999, continued till mid 2000. Type A outbreaks rose from an 

average 10-12% to 33.0% and that of type O fell from an average 75% to 55%. Curiously, despite decrease 

in type O outbreaks, there was no change in predominance of PanAsia strains. They caused nearly 50% of 

total type O outbreaks (11 of 22 sequences belonged to PanAsia strain). Interestingly, year 2001 saw 

outbreak patterns returning to normal with type O being responsible nearly 75% of the outbreaks, but not 

with out the emergence of NS/Ind 2001 strain. That year NS/Ind 2001 strain caused nearly 63% of type O 

outbreaks, while PanAsia caused 31%. 

In the year 2002, outbreaks due to NS/Ind 2001 strain declined sharply (19%), and PanAsia regained 

supremacy causing 57% of the type O outbreaks. In 2003, outbreaks due to strain Ind 2001/NS declined 

further and we could find only one sequence out of the 30 sequences to be of this strain. Interestingly, the 

PanAsia strain, which regained predominance in the previous year, could not hold its position (13.3%) and 

was overtaken by strain (PanAsia II?) that originated from it. Year 2004 saw continued dominance of 

these strains. 

Thus the study shows the continuous evolution of PanAsia strain, which appear to be driven not only by the 

multiple rounds of replication, which normally happens in the endemic settings, but also by the competition 

among the strains and the serotypes. 


Indian Council of Agricultural Research for infrastructural facilities and financial support to carry out this work. 

Participation of DH in WAVLD symposium is supported by FAO, Rome and CSIRO, AAHL, Australia. 

References 

Hemadri et al. (2000), Epidemiology and infection, 125: 729-736. 

Hemadri et al., (2002) Virus genes, 25:23-34. 

Knowles et al. (2000) Report of EUFMD, Borovets, Bulgaria, Appendix 1. p. 20–31. 

Knowles et al. (2005), Emerging infectious diseases, 11:1887-1893 



THE 2001 UK FOOT-AND-MOUTH DISEASE OUTBREAK: AN UPDATE 

R. Paul Kitching, Canadian Food Inspection Agency, *presenting author 

Following the outbreak of foot-and-mouth disease (FMD) in the United Kingdom (UK) in 2001, the official 

inquiry which reported the following year on the lessons to be learned (1) made 80 recommendations, in 

addition to the central recommendation that the Government should develop a national strategy for animal 

health and disease control. The 80 recommendations were under three headings; a strategy for disease 

avoidance and control, appropriate contingency plans and effective preparedness, and managing an 

outbreak of disease. 

Most of these recommendations are self evident to anyone who has been involved with disease control, and 

almost all had appeared in previous reports from previous outbreaks, not only related to FMD. Therefore the 

first question could be, why had so little been adopted from previous experience with major disease 

outbreaks? Over time husbandry methods change, farming becomes more intensive, species become more 

productive and possibly more susceptible to disease, but the basic fundamentals of disease transmission 

remain the same. And the obvious statement that if transmission is prevented, the disease will disappear 

remains valid. 

At an early stage in the outbreak, before the true extent of the spread had been ascertained, a group of 

modellers were brought together to interpret the available evidence and produce predictions as to the likely 

outcome. Since the outbreak there have been numerous publications showing the flaws in the modellers’ 

assumptions and consequent predictions (see 2 and 3 for review). Regrettably, because many of the models 

were published at the time in reputable scientific journals, these papers are quoted as foundation to support 

further propositions, like building on sand. That the outbreak was brought under control and FMD virus 

eliminated was inevitable, but at considerable cost. The level of slaughter that took place in the UK outbreak 

would no longer be tolerated by the public and consequently by the politicians. Whether this slaughter was 

actually necessary is almost now irrelevant. Policies have now been changed in Europe to make vaccination 

more acceptable (4). What was a standard and reasonable response to control an outbreak of disease was 

distorted by a policy driven by unvalidated models, so as to make this option no longer acceptable, but 

without a credible alternative being created. 

1. Anderson I. (2002). Foot and mouth disease 2001: lessons to be learned, inquiry. The Stationary 

Office, London. 

2. Kitching R.P., Thrusfield M.V. and Taylor N.M. (2006). Use and abuse of mathematical models; an 

illustration from the 2001 foot and mouth disease epidemic in the United Kingdom. Rev. Sci. Tech. 

Off. Int. Epiz., 25, 293-311. 

3. Haydon D.T., Kao R.R. and Kitching R.P. (2004). The UK foot-and-mouth disease outbreak - the 

aftermath. Nat. Rev. Microbiol., 2, 675-681. 

4. European Union (EU) (2003) - Council Directive 2003/85/EC of 29 September 2003 on Community 

measures for the control of foot-and-mouth disease repealing Directive 85/511/EEC and Decisions 

89/531/EEC and 91/665/EEC and amending Directive 92/46/EEC. Off. J. Eur. Union, L 306 of 

22.11.2003, 1-87.


PRODUCTION OF FMDV DIAGNOSTIC REAGENTS TO IMPROVE 

OUTBREAK PREPAREDNESS - RECOMBINANT AGS 

Jef Hammond 

Not available at time of printing. 




DEVELOPMENT AND EVALUATION OF A RECOMBINANT ANTIBODY-BASED COMPETITIVE ELISA 

FOR FMD 

Introduction 

J.D. Muller 1, 2, * , A.J. Foord 1 , H.G. Heine 1 , M. Yu 1 , C.R. Wilks 2 , and L-F. Wang 1 

1 Australian Biosecurity CRC, CSIRO Livestock Industries, Australian Animal Health Laboratory, Geelong Victoria. 

2 The University of Melbourne, School of Veterinary Science, Parkville Victoria 

The ability to respond to an outbreak of foot and mouth disease (FMD) relies heavily on our capacity to make 

a confident and timely diagnosis. The detection of antibodies to FMD virus (FMDV) is not a definitive 

diagnostic tool because it may not differentiate those antibodies generated during a natural infection from 

those due to vaccination. FMDV vaccines are composed of whole inactivated virus and hence primarily 

induce antibodies to viral structural proteins whereas replicating virus stimulates host antibodies specific for 

both structural and non-structural proteins. The availability of quality diagnostic tests that can differentiate 

infected from vaccinated animals (DIVA) is a challenge for serological diagnosis. Such tests are crucial for 

proving freedom from disease after an outbreak and allowing resumption of trade in livestock products. All 

current FMDV DIVA tests rely on polyclonal or monoclonal hybridoma derived antibody reagents, which can 

be difficult to prepare and maintain in a quality-assured manner and in the quantities required for postoutbreak 

surveillance. The current preferred DIVA test is a competitive ELISA (C-ELISA) designed to detect 

antibodies to the non-structural protein 3ABC. The principle of the C-ELISA involves competition between a 

known 3ABC-binding antibody and antibodies present in test sera. If 3ABC specific antibodies are present in 

the test serum inhibition will be detected. We have improved this assay by the adoption of entirely 

recombinant detecting antibody and coating antigen that can be produced in large quantities in E. coli, 

making them safe, consistent and more economical to produce without the requirement for infectious virus or 

animals. 


Chickens were immunised with 3ABC produced in E. coli. Spleens were harvested and libraries were 

constructed for phage display. Libraries were panned against the E. coli produced 3ABC and positive clones 

were identified, characterized and organised into three distinctive genetic sequences known as recombinant 

antibodies (RecAb) 26, 27 and 29 1 . 

Western blot and ELISA were used to characterize and define binding specificities. 

Two antibodies were further engineered to incorporate different epitope tags for simple and more economical 

production and were applied in the FMDV C-ELISA. 

Results 

The recombinant antibodies bound a specific and well defined epitope region of the non-structural protein 

3B. When evaluated in the C-ELISA using sera derived from cattle, sheep and pigs representing either 

naïve, FMDV-vaccinated or FMDV-infected animals; RecAb-27 performed the best and was an ideal 

replacement for the monoclonal antibodies and FMDV-specific serum currently used. 

The generation of different epitope tags for detection has improved the C-ELISA by removing extra 

incubation steps; a one-step direct detection can now be performed due to the direct conjugation of alkaline 

phosphatase to the RecAb. 


The generation of recombinant antibodies to FMDV-3ABC and the application of these reagents in a C- 

ELISA to differentiate infected from vaccinated animals represents the first FMDV DIVA assay in which the 

detecting antibody and the coating antigen are recombinant and derived from in vitro expression platforms. 

Through engineering of these RecAb we have refined this technology and significantly reduced the time 

needed for DIVA C-ELISA. 

References 

1. Foord, A.J., Muller, J.D., Yu, M., Wang, L.F., Heine, H.G. 2007. Production and application of recombinant 

antibodies to foot-and-mouth disease virus non-structural protein 3ABC. J. Immunol. Methods. 

321(1-2),142-51.


INTERNATIONAL VALIDATION OF A NEW 3 ABC COMPETITIVE ELISA FOR FMD SEROLOGY 

C. J. Morrissy 1 , J. McEachern 1 , A. Colling 1 , L. Wright 1 , Ngo Thanh Long 3 , W. Goff 1 , J. Hammond 1 , M. Johnson 1 , J. Crowther 2 , 3 Dong 

Manh Hoa 3 and P. Daniels 1 

1 CSIRO Livestock Industries, Australian Animal Health Laboratory (AAHL), Geelong, Victoria, Australia. 

2 International Atomic Energy Agency (IAEA), Vienna, Austria 

3 Regional Animal Health Centre, Ho Chi Minh City (RAH0 - 6, HCMC), South Vietnam 

Introduction 

Foot and Mouth Disease (FMD) is an economically important disease of cloven-hoofed species. It is 

prevalent throughout Asia and Africa and is present in South America. North America, Japan, Australasia, 

Indonesia and Europe are considered free. FMD virus occurs as seven main serotypes; O, A, Asia 1, C, and 

SAT 1, 2 and 3. The disease is usually controlled by vaccination against the prevailing serotypes where it is 

endemic, or by stamping out where introduced into disease free areas. Infected animals produce antibodies 

to both the serotype specific structural proteins and also the non-structural (NS) proteins of the virus, which 

are conserved among the serotypes. Vaccinated animals will produce antibodies predominantly to structural 

proteins, depending on the purity of the vaccine. A diagnostic assay based on the non-structural polyprotein, 

3ABC, was developed to differentiate animals infected with FMDV from vaccinates, the DIVA strategy. 

Routine FMD ELISAs measure antibodies to virus structural proteins, and if positive do not indicate whether 

serum is from an animal that has been infected or vaccinated. Another disadvantage of these ELISAs is that 

a separate assay is required to measure antibody to each of the seven serotypes of FMD virus. The assay 

described here is a competitive ELISA (c-ELISA) that detects antibody to 3ABC regardless of the infecting 

serotype. The use of DIVA tests will be important in FMD free countries such as Australia if vaccines are 

used to control any future FMD outbreaks. 


Recombinant 3ABC protein was produced in both a baculovirus expression system and an E. coli expression 

system. Although the baculovirus system is considered to yield a protein with a more natural conformation 

than the E coli expressed protein, the E.coli expressed 3ABC was easier and quicker to grow up in large 

amounts than the baculovirus expressed protein, and was more easily purified. Laying chickens were 

inoculated with the purified E. coli expressed 3ABC to obtain antibodies from the egg yolk. The more purified 

protein was chosen for immunisation to help reduce non-specific reactions in the ELISA. The unpurified 

baculovirus expressed 3ABC protein was used as the antigen to coat ELISA plates. The polyclonal antibody 

obtained from the chickens egg yolk was used as the competing antibody in the assay. A buffer containing 

skim milk powder and normal horse serum was also used to reduce non-specific reactions in the ELISA. 

Field sera from FMD disease cases necessary to validate FMD diagnostics were obtained from international 

projects and collaborations. The FMD CARD AusAID project has been valuable in improving AAHL 

diagnostic capability for detection of antibody and antigen. This project in Vietnam has used the NS c-ELISA 

for serosurveillance. 

Results 

The assay has been validated using a panel of experimental and field sera derived from naïve, vaccinated 

and post-infected animals of various species. All vaccinated and naïve animals tested thus far are negative 

for antibodies to 3ABC and antibodies to 3ABC have been detected as early as seven days in experimentally 

infected animals. The preliminary results indicate that the c-ELISA is sensitive and highly specific. 

Conclusions 

Validation of new FMD tests such as this C-ELISA for detection of NS antibodies is difficult in Australia 

without access to live virus. Samples required for validation of serology tests are obtained through a number 

of international collaborations This ELISA is simple to perform and can differentiate post-vaccination sera 

from post-infection sera. The current validation data suggests that this c-ELISA will prove to be a reliable 

diagnostic assay for post-FMD outbreak surveillance and the assay also offers an additional advantage for 

such surveillance in that antibodies to all seven serotypes can be detected in the one test. Hence it can be 

used as a simple sero-surveillance tool in FMD free countries. More importantly, because of its DIVA 

potential, it could also allow vaccination to be used to control the disease in traditionally disease free areas 

to avoid mass slaughtering of animals during an outbreak. 




1330 - 1455 Concurrent Session 2.2 - Avian Influenza 

RESULTS OF 2006 WILD BIRD SURVEILLANCE FOR THE DETECTION OF HIGHLY PATHOGENIC 

AVIAN INFLUENZA IN THE UNITED STATES 

Janice Pedersen 1 , Dennis Senne 1 , Mary Lea Killian 1 , Nichole Hines 1 , Brundaban Panigrahy 1 , Seth Swafford 2 , Tom Deliberto 2 , Hon Ip 3 

1 U. S. Department of Agriculture, Animal and Plant Health Inspection Service, Veterinary Services, 

National Veterinary Services Laboratories, Ames, IA, USA 

2 U.S. Department of Agriculture, Animal and Plant Health Inspection Service, Wildlife Services, 

National Wildlife Disease Program, Fort Collins, CO, USA 

3 U.S. Geological Survey, National Wildlife Health Center, Madison, WI, USA 

The potential role played by migratory waterfowl and water birds in the spread of H5N1 highly pathogenic 

avian influenza (HPAI) virus from Asia to Europe, the Middle East, and Africa prompted a large-scale 

surveillance to detect HPAI H5N1 in wild aquatic birds in the United States. The program was a cooperative 

effort between the U.S. Departments of Agriculture (USDA) and Interior (DOI) and State Wildlife Agencies. 

Between April 2006 and March 2007, more than 148,000 cloacal (CL) and fecal swabs were collected from 

dead birds as well as apparently healthy and hunter-killed birds in all 50 states and tested for presence of 

avian influenza virus (AIV) by the real-time reverse transcriptase-polymerase chain reaction (rRT-PCR) 

assay at National Animal Health Laboratory Network (NAHLN) laboratories, the National Wildlife Research 

Center, and the National Wildlife Health Center. Cloacal swab pools were screened for AI virus by the matrix 

rRT-PCR assay. Positive matrix pools were subsequently tested by the H5 and H7 rRT-PCR subtyping 

assays, and individual specimens from H5 and H7 positive pools were shipped to the National Veterinary 

Services Laboratories (NVSL) for confirmatory testing, virus isolation (VI), and characterization. 

A total of 2210 specimens were submitted to the NVSL for rRT-PCR screening or confirmatory testing. Of 

these 1413 specimens, 340 CL pools and 21 fecal pools were H5 presumptive positive (PP), 745 were 

surveillance and mortality event swabs, and 31 were viral isolates. Of the 340 H5 PP pools, 250 were 

confirmed as H5 rRT-PCR positive, giving the H5 subtyping assay a diagnostic sensitivity and specificity of 

74% and 100%, respectively for wild bird CL swab specimens when compared to the AI matrix rRT-PCR 

assay. When compared to VI, the H5 assay showed a diagnostic sensitivity and specificity of 79% and 89%, 

respectively (64/304 H5 rRT-PCR positive specimens yielded H5 virus and 17 H5 rRT-PCR negative 

specimens yielded H5 virus). A total of 97 H5 subtype AI viruses, including 5 H5N1, were isolated and 

characterized as low pathogenicity AI (LPAI) of North American lineage by nucleotide sequence analysis. 

The H5 subtypes identified were H5N2 (80), H5N1 (5), H5N3 (5), H5N8 (3), H5N9 (3), and H5N4 (1). Other 

subtypes isolated included H1-H6, as well as H10 and H11. No highly pathogenic viruses were found and 

no H7 rRT-PCR positive specimens were detected, although H7 AI subtype viruses have subsequently been 

isolated from rRT-PCR negative swabs. 

Diagnostic challenges posed by the surveillance included presence of PCR inhibitors, low virus recovery rate 

from rRT-PCR positive specimens, mixed viral infections and the 0% detection rate of H7 wild bird North 

American lineage viruses by the USDA H7 rRT-PCR assay.


CANADA’S INTER-AGENCY WILD BIRD INFLUENZA SURVEILLANCE PROGRAMME 2005-2007 

*I.K. Barker, Canadian Cooperative Wildlife Health Centre, University of Guelph, Guelph, ON; S. Lair, Centre canadien coopératif de la 

santé de la faune, Faculté de médecine vétérinaire, Université de Montréal, Saint-Hyacinthe, QC; P.-Y. Daoust, Canadian Cooperative 

Wildlife Health Centre, University of Prince Edward Island, Charlottetown PEI; J. Pasick, National Centre for Foreign Animal Diseases, 

Canadian Food Inspection Agency, Winnipeg MB; P.A. Buck, Foodborne, Waterborne and Zoonotic Infections Division, Public Health 

Agency of Canada, Ottawa, ON; E.J. Parmley, Centre for Coastal Health, Nanaimo, BC; E.J. Jenkins, Science and Technology Branch, 

Environment Canada, Saskatoon, SK; C. Soos, Science and Technology Branch, Environment Canada, Saskatoon; F.A. Leighton, 

Canadian Cooperative Wildlife Health Centre, University of Saskatchewan, Saskatoon, SK. 

Introduction 

Stimulated by a major outbreak of avian influenza (AI) in British Columbia poultry in 2004, and by the 

dissemination of H5N1 highly pathogenic avian influenza virus from Asia to Europe and Africa in 2005, 

Canada initiated an avian influenza surveillance programme in wild birds in 2005. Organized, under the 

oversight of a federal-provincial inter-agency committee, by the Canadian Cooperative Wildlife Health Centre 

(CCWHC), it initially involved active surveillance for influenza A viruses in populations of wild birds, mainly 

waterfowl, supplemented by scanning surveillance in dead wild birds beginning in September 2005. Active 

surveillance was to determine the influenza A viruses circulating in wild bird populations; monitor for those of 

animal or human health concern; and establish in Canada an integrated multiagency field, laboratory, 

regulatory and communications capacity to carry out Influenza A virus sampling, identification, and molecular 

characterization on many specimens under emergency conditions, from any species. Formally initiated in 

2006, passive surveillance for highly pathogenic avian influenza in dead wild birds was aimed mainly at 

detection of H5N1 influenza virus, but it also contributes to monitoring its global and continental 

dissemination, and to the science base for risk assessment. 


Oropharyngeal and/or cloacal swabs were collected into transport medium from live and hunter-harvested 

waterfowl and selected other species, sampled at multiple regional sites across Canada in 2005, 2006 and 

2007, and in Iceland in 2006. For scanning surveillance oropharyngeal and cloacal swabs were collected at 

necropsy from birds of a wide array of species found dead across Canada, emphasizing those using wetland 

or aquatic habitat, or involved in mortality events unusual in their circumstances, size or species composition. 

In one of seven collaborating regional veterinary laboratories, swabs were initially tested by real-time reverse 

transcriptase PCR (RRT-PCR) for Influenza M1 (matrix protein) gene sequences; positive samples were 

then tested by RRT-PCR for H5 and H7 protein gene sequences, and any samples positive for these were 

forwarded immediately to the National Centre for Foreign Animal Disease, CFIA for further identification, 

characterization and virulence testing. In 2005 and 2006, samples testing matrix protein positive and H5/H7 

negative were cultured in regional laboratories to attempt virus isolation; in 2007 they were retained frozen. 

Isolates were deposited in a national influenza strain archive at NCFAD CFIA. Data of all types were 

recorded in the CCWHC national Internet web-interfaced relational database, for rapid communication of 

results among laboratories and agencies and to decision-makers. 

Results 

Through Canada’s Inter-agency Wild Bird Influenza Survey, over 15,000 live wild birds have been sampled 

and tested for avian influenza since the fall of 2005. Of these, over 3,000 (>20%) have tested positive for 

avian influenza by RRT-PCR. About 3% of over 5400 dead wild birds have been AI matrix protein sequence 

positive. The survey results have revealed wide variation in detection of AI viruses among regions and 

between species sampled in different years. To date all AI viruses detected have been of low pathogenicity 

North American strains. In addition to the Canadian birds tested, over 700 trans-Atlantic migrants (Eastern 

High Arctic Brant and Red Knot) were sampled in Iceland and tested in Canada for the presence of avian 

influenza in 2006/07. Only 1 has been positive for avian influenza by RRT-PCR. 


The infrastructure and laboratory capacity-building objectives of the programme largely have been met. A 

firm base for understanding the species in which AI viruses predominantly circulate has been established, 

though highly pathogenic AI viruses have yet to be identified in wild birds in Canada. 

References 

Parmley, E.J., et al. Influenza viruses in wild ducks in Canada: PCR results from the 2005 Wild Bird 

Influenza Survey. Emerging Infectious Diseases. Accepted for publication, 2007. 




PERFORMANCE EVALUATION OF FIVE DETECTION TESTS FOR AVIAN 

INFLUENZA ANTIGEN WITH VARIOUS AVIAN SAMPLES 

Tze-Hoong Chua, AB* Trevor M. Ellis, AC Chun W. Wong, D Yi Guan, EF Sheng Xiang Ge, F Geng Peng, F 

Chinta Lamichhane, G Con Maliadis, H Sze-Wee Tan, I Paul Selleck, J and John Parkinson K 

(A)School of Veterinary and Biomedical Sciences, Murdoch University, South Street, Murdoch, Western Australia, 6150, Australia 

(B) Agri-Food and Veterinary Authority, 5 Maxwell Road, Singapore 069110 

(C) Senior author 

(D)Tai Lung Veterinary Laboratory, Agriculture Fisheries and Conservation Department, Lin Tong Mei, Sheung Shui, 

Hong Kong SAR, China 

(E) Department of Microbiology, The University of Hong Kong, Hong Kong SAR, China 

(F) National Institute of Diagnostics and Vaccine Development in Infectious Disease, Xiamen University, Xiamen, Fujian, China 

(G) Synbiotics Corporation, 11011 Via Frontera, San Diego, CA 92127 

(H) Bio-Mediq DPC (Diagnostic Products Corporation) Pty. Ltd., 1 Williamson Road, Doncaster, Victoria, 3108, Australia 

(I) Rockeby Biomed (Singapore) Pte. Ltd., 350 Orchard Road, Shaw House, Singapore 238868 

(J) CSIRO Australian Animal Health Laboratory, 5 Portarlington Road, Geelong, 3220, Australia 

(K) Department of Agriculture and Food, 3 Baron Hay Court, South Perth, Western Australia, 6151, Australia 

INTRODUCTION. In this paper, we report on the evaluation of five influenza antigen detection tests by avian 

influenza H5N1 virus–positive swab samples to estimate their diagnostic sensitivity. The tests included two 

chromatographic immunoassays, an H5 avian influenza–specific antigen detection enzyme-linked 

immunosorbent assay (ELISA), an influenza antigen detection ELISA, and anH5 rapid immunoblot assay. 

METHODS & RESULTS. The results showed that the overall sensitivities of these tests ranged from 36.3% 

to 51.4% (95% confidence interval ranging from 31.0% to 57.0%), which were comparable to Directigen_Flu 

A antigen detection tests but substantially lower than genome detection methods. Diagnostic sensitivity 

performance is a function of the concentration of antigens in samples and the analytical sensitivity of the 

individual test. The test sensitivities were significantly higher for sick and dead birds by cloacal, tracheal, or 

tissue swabs than for fecal swabs from apparently healthy birds, and these tests would not be suitable for 

surveillance testing of clinically healthy birds. Furthermore, the sensitivity for testing tracheal and cloacal 

swabs from waterfowl and wild birds was not as good as for chickens. This was most likely to be associated 

with variation in virus titers between specimens from different bird species. However, the tests showed good 

sensitivities for testing brain swabs from clinically affected waterfowl species. 

CONCLUSION. The results indicate that these antigen detection tests could be used for preliminary 

investigations of H5N1 outbreaks as a low-cost, simple flock test in sick and dead birds for the rapid 

detection of H5N1 infection. However, the relatively low sensitivity of the tests as individual bird tests means 

that they should be used on optimal clinical specimens from diseased birds, testing birds on a flock basis, or 

testing samples as close to the onset of disease as possible before viral titers diminish. They should be 

followed up by confirmatory tests, such as reverse transcription polymerase chain reaction or viral culture, 

wherever possible but could assist in facilitating rapid investigations and control interventions. 

*Presenting author email: T.Chua@murdoch.edu.au


OPTIMISED SAMPLING AND PROCESSING FOR ENHANCED DETECTION 

OF AVIAN INFLUENZA VIRUS FROM FIELD SAMPLES 

S. Warner*, K. O’Riley, A. Welch & D. Grix 

Department of Primary Industries, 

475 Mickleham Rd, Attwood,VIC 3049, Australia 

Introduction 

Critical in the expeditious diagnosis of any disease is the ability to collect good clinical specimens and to 

transport them to the laboratory in a timely manner. This is particularly important in the diagnosis of an 

exotic or emergency disease, and when viable organisms are required for culture. In addition, the 

introduction of molecular-based tests has significantly increased the detection of viruses in field samples, 

however it is not always possible to grow virus from the same sample in order to confirm the result. 


This project was designed to optimise the sampling procedure for enhanced detection of live virus from field 

samples. This included the investigation of three viral transport media based on glycerol, Hanks or Brain 

Heart Infusion broth, and six storage temperatures including room temperature (approx 20 o C), chilled with 

ice packs, 4 o C, –20 o C, dry ice and liquid nitrogen. All three media were inoculated with either high or low 

concentrations of AIV, and then assayed by culture in embryonated eggs and by Real time PCR. 

Another factor considered in this project was the time delay between collection of field samples and 

processing by PCR. This component was made possible since DPI Victoria owns a powered, mobile 

diagnostic van fitted with laboratory equipment that can be driven to the site of choice. Fresh faecal samples 

were collected from birds and RNA extracted without delay using individual columns in the mobile laboratory. 

Samples were also extracted and tested back at the laboratory on days 1, 3, 7 and 14 after storage of the 

viral transport media sample at 4 o C. Samples were assayed for the presence of AIV genetic material using 

the DPI Type A PCR test. 

Results 

Overall, the transport media study showed that either the BHI-based or the Hanks-based media can be 

considered good transport media when stored at a range of temperatures for the optimal detection of AIV by 

culture or PCR. 

The mobile van experiment showed that whilst there may be an advantage to processing samples 

immediately for viral culture, a delay in the setup time does not have a deleterious effect on PCR results, and 

even samples that were stored for two weeks at 4 o C still had strongly detectable PCR results at low dilutions 

of virus. These results were also encouraging in the fact that there was no significant decline in sensitivity of 

PCR when performing a technique such as RNA extraction in the field. 


Diagnostic samples are often assessed for the presence of both genetic material and live virus. These 

experiments were designed to test the ability to detect both genetic material and live virus by using three VTM at 

six different temperatures. When all factors were considered, the BHI VTM would be the transport media of 

choice for the detection of virus by culture and PCR. The use the mobile diagnostic van is recommended in 

situations where rapid results are required and there is an advantage to performing the work on site, such as in 

the event of an exotic outbreak index case investigation. 




ANALYSIS OF THE SENSITIVITY OF H5N1 ISOLATES FROM THE SOUTH EAST ASIAN REGION TO 

OSELTAMIVIR AND ZANAMIVIR 

JL McKimm-Breschkin 1 , P Selleck 2 , T Usman 3 , M Johnson 2 

1 CSIRO Molecular and Health Technologies, Parkville, Australia; 2 CSIRO Livestock Industries, The Australian Animal Health Laboratory 

Geelong, Australia; 3 Disease Investigation Centre, Yogjakarta, Indonesia 

Introduction Two different strains of highly pathogenic H5N1 avian influenza have been circulating since 

2003. Clade 1 has been fou 

nd in Vietnam, Thailand, Cambodia, Lao People’s Democratic Republic, and Malaysia. Clade 2 subsequently 

emerged and spread from China to Indonesia, Europe and Africa in 2004-2005. Two influenza specific drugs 

oseltamivir and zanamivir are available for the treatment and prevention of influenza. Due to its systemic 

availability oseltamivir is the drug of choice for treating humans infected with H5N1 viruses. 

Materials and Methods Clade 1 viruses were isolated from chickens, ducks, geese and quail from Vietnam 

(2004), Malaysia (2004), Cambodia (2004, 2005) and clade 2 2005 viruses were isolated from Indonesia. 

Samples were irradiated and their NAs were tested for sensitivity to zanamivir and oseltamivir. In the 

absence of a validated cell culture assay, the 50% inhibitory concentration was measured in the MUNANA 

fluorescent based enzyme inhibition assay (1). 

Results Despite their origins from different countries and different avian species, all clade 1 and clade 2 

isolates had a similar sensitivity to zanamivir, with IC50’s ranging from 1.2 to 1.96 nM, compared to the 

human reference strain, mean IC50 of 1.3 nM. Sensitivities of the NAs to oseltamivir fell into three groups 

compared to the human H1N1 control. The 2004 clade 1 viruses from Vietnam, Cambodia, and Malaysia 

were all more sensitive to oseltamivir, with a mean IC50 of 0.5 nM, compared to 2.2 nM for the human H1N1 

control. This is consistent with the findings of Rameix-Welti et al . (2). However, the 2005 Cambodian 

isolates were all specifically less sensitive to oseltamivir than the2004 isolates, with a mean IC50 of 2.9 nM, 

around 6- fold higher. Of more concern was the third group. The NAs from the clade 2 Indonesian isolates 

demonstrated a 15-30-fold increase in IC50, specifically to oseltamivir, with a mean IC50 of 11.5 nM. 

Zanamivir and oseltamivir differ by substitutions at the equivalent of the 4 and 6 positions on the sugar ring, 

with oseltamivir having a bulky hydrophobic pentyl ether group at the 6’ position. Reorientation of E276 in 

the active site is required to accommodate oseltamivir. We therefore tested the sensitivities of a subset of 

viruses from each group to 4’ aminoNeu5Ac2en, which is similar to oseltamivir at the 4’ position, but 

zanamivir at the 6’ position. All viruses had a similar sensitivity to this inhibitor, with a mean IC50 of 2.5 WM. 

This means that the decreased binding to oseltamivir was specifically due to altered interactions around the 

6-pentyl ether group, thus explaining why no altered interaction to zanamivir was seen. We have recently 

analysed more isolates from Indonesia from 2005, and shown that all have a similar shift in sensitivity, again 

specifically only to oseltamivir. Consistent with our earlier findings all viruses had a similar sensitivity to 

zanamivir as the control H1N1 virus. 

Discussions and Conclusions Analysis of sequences of H5N1 NAs in the public data bases shows that 

there is 1 mutation at position 252 in the globular head which varies between all clade 1 and clade 2 NAs 

which may decrease oseltamivir binding(2,3). There are also a further 3 amino acid differences between 

most clade 1 and clade 2 NAs, and the Indonesian clade 2 isolates have a further amino acid change. Since 

none of the sequence variations correlates with any mutation known to confer oseltamivir resistance (3) this 

suggests that the decrease in sensitivities may be due to drift mutations rather than from exposure to 

oseltamivir. While H5N1 infection remains primarily an infection of birds, the emergence of resistant viruses 

in clade 1 infected, H5N1 patients treated with oseltamivir has been suggested to be due to suboptimal 

dosing. Since the clade 2 Indonesian isolates have a further decrease in sensitivity compared to the clade 1 

isolates, this suggests the standard dosing of oseltamivir may be even less effective. These findings stress 

the importance of phenotypic testing of drug sensitivities of avian isolates, since the changes in sensitivities 

would not have been detected by genotypic analysis. 

References 

1 Wetherall NT, Trivedi T, Zeller J, Hodges-Savola C, McKimm-Breschkin JL, Zambon M et al. Evaluation 

of Neuraminidase Enzyme Assays Using Different Substrates To Measure Susceptibility of Influenza 

Virus Clinical Isolates to Neuraminidase Inhibitors: Report of the Neuraminidase Inhibitor Susceptibility 

Network. J Clin Microbiol 2003; 41: 742-50. 

2 Rameix-Welti MA , Agou F, Buchy P, Mardy S, Aubin JT, Veron M et al. Natural variation can 

significantly alter sensitivity to oseltamivir of Influenza A(H5N1) viruses. Antimicrob Agents Chemother 

2006; 50: 3809-15. 

3 Russell RJ, Haire LF, Stevens DJ, Collins PJ, Lin YP, Blackburn GM et al. The structure of H5N1 avian 

influenza neuraminidase suggests new opportunities for drug design. Nature 2006; 443: 45-9.


1525 - 1720 Concurrent Session 1.3 - Bluetongue & orbiviruses Mon 

AN UPDATE ON BLUETONGUE VIRUS IN EUROPE 

12 

Carrie A. Batten*, Kasia Bankowska, Andrew Shaw, Anna Swain, Abid Bin-Tarif, Narender Maan, Simon Anthony, Chris Oura and 

Peter P. C. Mertens 

Institute for Animal Health, Ash Road, Pirbright, UK, GU24 0NF. 

Bluetongue virus (BTV) is the ‘type species’ of the genus Orbivirus, within the family Reoviridae. BTVs are 

November 

transmitted between their vertebrate hosts almost exclusively by adult females of certain Culicoides species 

(biting midges). They can infect most ruminants, but cause economically important disease (known as 

‘bluetongue’ (BT)) primarily in sheep. Clinical signs include fever, hyperaemia, coronitis, oedema, 

haemorrhage, erosions and ulcerations of the dermis, and death may occur after 8-10 days. Significant 

clinical signs have also been observed in cattle, although these are usually milder, and are seen in a smaller 

percentage of animals, particularly after introductions into naive populations (Darpel et al 2007). 

Between 1998 and 2005, seven strains of BTV (from five different serotypes: 1, 2, 4, 9 &16) invaded 

southern and central Europe. The virus appeared for the first time in northern Europe during August 2006, 

with the recognition of typical clinical signs of BT in sheep in the Netherlands, 5 degrees further north within 

Europe than ever before. Antibodies to BTV were detected in sera by C-ELISA, and BTV RNA was identified 

(at IAH Pirbright) in blood samples from infected animals, using an RT-PCR assay targeting genome 

segment 1 (Shaw et al 2007). This confirmed the identification of the BT outbreak by the Netherlands 

authorities. The virus was subsequently identified as BTV-8 by serotype-specific RT-PCR (Mertens et al 

2007) and sequence analysis of genome segment 2 (Maan et al 2007), showing that it was an entirely new 

incursion into Europe. During 2006 the outbreak spread across the Netherlands, Belgium, Germany, 

Luxemburg and north-east France, indicating that the whole of Europe is now at risk from this disease. 

New cases of BT were reported in Northern Europe up to December 2006. At this time the colder weather 

had almost completely removed the population of adult Culicoides in the region, making transmission of the 

virus almost impossible. However, BTV has been known to overwinter under similar conditions in other parts 

of the world, reappearing when the adult vectors re-emerge in the following spring/summer. On the 6 th July 

2007 new cases of BTV started to re-appear in Germany, and subsequently on the 17 th July in Belgium, then 

France (19 th July), Netherlands (25 th July) and on 17 th August in Luxemburg. Sequence analyses of genome 

segment 2 from German and Netherlands isolates, confirmed that this was a re-emergence of the 2006 

strain of BTV-8. These data also demonstrate that the virus had managed to overwinter successfully in 

many different locations across Northern Europe. 

Until 2007 BT had never been seen in the field within the UK. However, on the 21 st of September 2007 

samples from a Highland cow (born in the UK) showing excessive salivation and lameness, were submitted 

to the European Community Reference Laboratory for BTV, at Pirbright, UK (IAH reference collection 

number: UKG2007/01). The animal was shown to have antibodies to BTV by C-ELISA and BTV RNA was 

detected in blood samples by RT-PCR (Shaw et al 2007). The virus was identified as BTV-8 by serotype 

specific RT-PCR (Mertens et al 2007). Sequence comparisons to the 24 reference strains of BTV (Maan et al 

2007) showed a close relationship with other strains of BTV-8. Detailed comparison with these BTV-8 

strains showed that UKG2007/01 clusters with the other isolates of BTV-8 from northern Europe (with ~99% 

identity in Seg-2 with strains from Belgium and the Netherlands from 2006 or 2007), confirming that the virus 

was derived directly from the continuing outbreaks of disease in northern Europe. 

Further testing identified a second infected cow on the same farm, and another infected cow was found ~ 50 

kilometres away on a farm at Lowestoft on the east-coast, in the same region of England (both also identified 

as BTV-8). Studies of the regional weather patterns in northern Europe, in collaboration with the UK Met 

Office, show that a plume of air from the near continent travelled across East Anglia on the 2-4 August. This 

plume is likely to have brought the BTV-infected midges. On the 27 th of September The UK Department of 

Food and Rural Affairs (Defra) concluded that the virus was being transmitted locally within the UK and 

officially declared an outbreak of disease, imposing movement restrictions up to 150km from the infected 

premises. Currently, surveillance into the extent of this outbreak is underway within a 10km zone of the 

infected premises. Further information will be presented 

References 

IAH Reference Collection: www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/BTV-isolates.htm 

Darpel, KE, Batten, CA, Veronesi, E, & 11 other authors (2007) Clinical signs and pathology shown by British sheep and cattle infected 

with bluetongue virus serotype 8 derived from the 2006 outbreak in northern Europe Vet Rec.161: 253 - 26 

Maan S, Maan NS, Samuel AR, Rao S, Attoui H, Mertens PP. (2007) Analysis and phylogenetic comparisons of full-length VP2 genes 

of the 24 bluetongue virus serotypes. J Gen Virol. 88, 621-630. 

Shaw AE, Monaghan, P, Alpar, HO, & 10 other authors (2007). Development and validation of a real-time RT-PCR assay to detect 

genome bluetongue virus segment 1. J Virol Methods (in press) doi:10.1016/j.jviromet.2007.05.014. 

Mertens, P.P.C. Maan N. S., Prasad, G.,& 5 other authors (2007). The design of primers and use of RT-PCR assays for typing 

European BTV isolates: Differentiation of field and vaccine strains. J Gen Virol 88, 2811-2823. 



RESPONSE TO THE OUTBREAK OF BTV 8 IN NW EUROPE - TESTING AND TRADE WITHIN THE EU 

H. Elliott*, S. Hall, L. Raw, M.Sabirovic 

International Trade Department of Environment, Food and Resources, 1A Page St. London. SW1 4PQ 

Introduction 

NW Europe has experienced an outbreak of bluetongue virus serotype 8 (BTV 8) since 17 August 2006. This 

commenced in the Maastricht region and extended over Belgium, The Netherlands, Luxemburg, Germany 

and Northern France throughout 2006 and 2007 and on 22 nd September reached Great Britain. 

The EU response to the outbreak of bluetongue has been balanced between “control” of the disease and the 

economic penalties of restricted movement of animals on trade within and between Member State (MSs). As 

bluetongue is a vector born pathogen, the traditional approaches to disease control are limited in 

effectiveness. The Council Directive 2000/75/EC of laying down specific provisions for the control and 

eradication of bluetongue and the Decision 2005/393/EC on protection and surveillance zones in relation to 

bluetongue and conditions applying to movements from or through these zones provided clear guidance but 

additional measures were undertaken by the UK in order to prevent bluetongue entering the UK. 


The UK identified the pathways by which BTV could enter the country – wind born incursion of infected 

midges and by movement of animals and genetic material. Within the provisions of the Decision 

2005/393/EC and domestic legislation, the UK would not accept ruminants from the BTV restricted zones. 

Through monitoring of the outbreak on the Continent from test results provided by MSs to Commission on 

the Animal Diseases Notification System (ADNS) , the UK was able to undertake risk assessments, which 

underpinned a compliance based testing regime. Thus post-import testing was implemented on all ruminants 

from outside the non-BTV restricted zones. ELISA and PCR tests were carried 7-10 days post arrival and the 

animals were restricted to the first destination holding until results were known. Prior advice of the arrival of 

an animal to the Division Animal Health Office was provided electronically through the TRAde Control and 

Expert System (TRACES. Route plans were checked if transit of a restricted zone has occurred. 

Measures to detect bluetongue through the wind born incursion of midges in the UK were based on a 

combination of passive and active surveillance. Clinical investigations and testing was undertaken when 

there was a suspicion of disease. Sentinel herds were not set up. 

Active surveillance of the weather conditions and midge population was undertaken. Meteorological 

assessment of weather patterns and conditions favourable to the incursion of midges from the continent 

were provided daily in the form of plume maps (Gloster et al, 2007). If a high alert state arose, Defra would 

advise the Animal Health Office which would cascade information to local veterinary surgeons and farmers. 

Midge traps had been set up and were sampled regularly as part of an ongoing national midge monitoring 

project (S Carpenter, personal communication) 

A public awareness campaign on the clinical signs of bluetongue was conducted by Defra through the 

stakeholders and veterinary profession and to farmers directly through web-based information sites. 


The UK successfully remained free of BTV 8 during 2006 and until September 2007. This was potentially 

achieved through a combination of the banning of import of ruminants from BTV restriction zones and 

application of a 100% testing regime. It provided not only assurance that animals were virus-free, but 

encouraged compliance by importers. Over 4000 animals were tested. The testing strategy was robust but 

costly in trade but enabled the UK to remain free of BTV for over 1year. 

References 

1. Council Directive 2000/75/EC 

http://eur lex.europa.eu/pri/en/oj/dat/2000/l_327/l_32720001222en00740083.pdf ; 

2. Commission Décision 2005/393/EC 

http://eur-lex.europa.eu/LexUriServ/site/en/oj/2005/l_130/l_13020050524en00220028.pdf; 

3. Gloster J, Mellor PS, Manning AJ, Webster HN and Hort MC, Assessing the risk of windborne spread of 

bluetongue in the 2006 outbreak of disease in northern Europe Vet Rec. 2007 Jan 13;160(2):54-6


EVALUATION OF ELISAS TO DETECT ANTIBODIES TO BLUETONGUE VIRUS IN 

INDIVIDUAL AND TANK MILK SAMPLES. 

G Delbridge* 1 , RA Hawkes 1 , A Jugow 1 , B Hoffmann 2 and PD Kirkland 1 

1 Virology Laboratory, Elizabeth Macarthur Agricultural Institute, NSW DPI, Menangle, NSW Australia 

2 Friederick Loeffler Institute, Insel Reims, Germany 

Introduction 

Milk samples have been used for the identification of individual animals that have been infected with viruses, 

either by the detection of antibodies or direct agent detection. Further, testing of tank (bulk) milk samples has 

been used as a very efficient and cost effective method for the identification of infected herds and may be 

used to define the geographical distribution of an agent. This study describes the evaluation of ELISAs to 

detect antibodies to bluetongue virus (BTV) in both individual and tank milk samples and the subsequent use 

to map geographical areas where there has been BTV infection. 


BTV group reactive ELISAs using monoclonal antibodies (mAbs) in either competitive or blocking formats 

have been used for the detection of antibodies to viruses from the BTV serogroup for many years 1 . In this 

project, a range of antigens derived from different BTV serotypes and different monoclonal antibodies were 

compared to establish a combination that would provide an assay with optimal sensitivity and specificity. A 

limited number of reagent combinations were later compared by testing a panel of serum samples from cattle 

and sheep infected with one of the 23 serotypes of BTV. Several thousand samples from naturally infected 

cattle, sheep and goats from Australia, China, Italy and Germany and sheep and cattle sera from a BTV free 

country were tested to confirm the sensitivity and specificity of the preferred reagent combination. An indirect 

ELISA was also developed using cell culture derived antigen and a peroxidase conjugated antibovine IgG. 

Matching individual serum and milk samples from naturally infected cattle were tested in both the blocking 

and indirect ELISAs. Positive milk samples were titrated to determine the limits of detection and as a means 

of estimating herd prevalence. The performance of the blocking ELISA was also compared with all of the 

commercial ELISA kits available. Finally, tank milk samples from dairy herds in NSW were tested to evaluate 

the use of these assays to map the distribution of BTV. 

Results 

A blocking assay employing antigen purified BTV23 infected cell cultures was found to provide optimal 

sensitivity and specificity and was shown to reliably detect antibodies to each serotype of BTV, both soon 

after the onset of infection and also after several years in the absence of re-infection with another serotype. 

This blocking ELISA gave superior results in correctly identifying naturally infected cattle, sheep and goats 

from Australia, China, Italy and Germany to any of the commercially available assays and also had higher 

analytical sensitivity. There was a very high level of agreement between the results for matching serum and 

milk samples from individual animals. The indirect ELISA also had good diagnostic performance and was 

able to reliably identify BTV infected cattle with any of the serotypes. Both assays could detect antibodies in 

tank milk samples from herds where there was a moderate to low prevalence of infection, usually giving 

positive results with a prevalence of 5-10%. There was a high specificity when testing either individual or 

tank milk samples. 


The results of this study show that these assays are suitable for the detection of BTV antibodies in both milk 

and serum samples from individual animals and can detect antibodies to any of the 23 serotypes of BTV. In 

regions where there are dairy cattle, the capacity to be able to detect antibodies in tank milk samples 

provides a useful tool to define areas in which there has been BTV transmission and to identify BTV free 

areas. These should be valuable assays for surveillance in regions where the distribution of BTV is 

expanding. Both assays provide advantages. A blocking assay can be used to test specimens from any 

animal species while the indirect ELISA can be used in combination with the blocking ELISA when testing 

cattle as a confirmatory assay. Further, because of the inclusion of a control antigen, the indirect assay can 

be used to clarify the BTV status of suspicious reactors in the blocking ELISA. 

References 

1. Jeggo, M., Wright, P., Anderson, J., Eaton, B., Afshar, A., Pearson, J., Kirkland, P., and Ozawa, Y. 1992. 

Standardization of the competitive ELISA test and reagents for the diagnosis of Bluetongue. In: Bluetongue, 

African Horse Sickness, and Related Orbiviruses, Eds Walton, T.E. and Osborne, B.I., CRC, Boca Raton, pp 

547-560. 




MOLECULAR EPIDEMIOLOGY OF BLUETONGUE VIRUS TYPE 8 FROM THE NETHERLANDS 2006 

S. Maan*, N.S. Maan, S.J. Anthony, K.E. Darpel, A.E. Shaw, C.A. Batten, H. Attoui & P.P.C. Mertens 

Arbovirology Dept., Institute for Animal Health, Ash Road, Pirbright, Woking, Surrey, GU24 0NF (UK) 

Introduction: Bluetongue virus (BTV) (genus Orbivirus, family Reoviridae) is an ‘arbovirus’ with a ten 

segmented dsRNA genome that is transmitted between its ruminant hosts by Culicoides biting midges. Since 

1998, eight strains of six BTV serotypes (types-1, 2, 4, 8, 9 and 16) have invaded Europe, collectively 

representing the largest outbreak of the disease on record, with the deaths of > 2 million animals. Since 

1998, the virus has spread further west and north into Europe, initially reflecting changes in the distribution of 

Culicoides imicola, the major vector species for BTV in southern Europe and the influence of climate change 

[9]. In the summer of 2006, BTV-8 caused a major outbreak of disease in northern Europe, which was 

transmitted by novel vector species (C. obsoletus and C. pulicaris groups) [3, 5, 8]. The virus arrived in the 

UK (for the first time ever) in September 2007, infecting a Highland cow at a rare-breeds farm in Great 

Blakenham, Near Ipswich, in the East Anglian region of England. 

BTV serotype is controlled primarily by the outer coat protein VP2 (encoded by genome segment 2 (Seg-2). 

Sequencing studies of Seg-2 from different BTV strains, were used to create a sequence database for 

molecular epidemiology studies [4, 5, 6, 7, 8], which showed that most serotypes can be divided in eastern 

and western strains (topotypes). Live attenuated ‘vaccine’ strains of BTV-2, 4, 9 (western topotype) and 

BTV-16 (eastern topotype) were used in attempts to minimise the circulation of BTV in Europe. The South 

African ‘Group B’ vaccine strains (types 3, 8, 9, 10 and 11) were also used briefly, in Bulgaria. The release of 

these ‘attenuated’ strains, has added genetic diversity to the pool of field strains circulating in southern 

Europe, generating an unprecedented mix of eastern and western viruses, leading to reassortment [2]. 

RT-PCR assays were developed for identification of the 24 BTV serotypes [7, 8] and used to identify the 

strains circulating in Europe, including the most recent isolates from the UK (UKG2007/01). The entire 

genome (segments 1-10) of BTV-8 from the Netherlands 2006 (NET2006/04) was sequenced and compared 

to other European field and vaccine strains, to help determine the origin of the outbreak. This is the first 

report of the full genome sequence of the BTV-8 strain from northern Europe. 

Material & methods: RNA was extracted from cell-free supernatants, or EDTA treated blood samples, using 

the QIAamp Viral RNA Mini Kit (QIAGEN), for serogroup or serotype specific RT-PCR assays [1, 7]. RNA for 

synthesis of full length cDNAs and sequencing was purified from cell cultures using Trizol® (Invitrogen), [5, 

6]. Sequences were aligned and subjected to phylogenetic analysis. 

Results: Phylogenetic analyses of nucleotide (nt) sequence data for all ten genome segments of 

NET2006/04 showed up to 98% identity with other viruses derived from a western origin (from the reference 

collection at IAH Pirbright), although the most closely related strain varied for each segment. Seg-2 from 

NET2006/04 showed >93% sequence identity with the reference strain of BTV-8 (identifying its serotype) 

and was most closely related (> 97%) to BTV-8, from Nigeria 1982 (NIG1982/07) showing that it originated in 

sub-Saharan Africa. None of the genome segments of NET2006/04 was identical to corresponding segments 

of other field or vaccine strains, indicating that it had not exchanged genome segments (reassorted) with 

other European viruses. The most recent BTV-8 strain from the UK (UKG2007/01) clusters with other BTV- 

8s from northern Europe (~99% nt identity in Seg-2, with strains from Belgium or the Netherlands, 

2006/2007), confirming that the UK strain was derived from the northern European outbreak. 

Discussions & conclusions: The BTV-8 strain from northern European (2006) was not derived either 

directly or by reassortment, from field or vaccine strains already present in the Mediterranean region, but 

represents a new introduction to the region. Although its route of entry to northern Europe has not been 

established, it originated in Sub-Saharan Africa and is distinct from the BTV-8 vaccine strain. The most 

recent strain of BTV-8 from the UK (UKG2007/01) is derived from the outbreak in Belgium or the Netherlands 

(2006-2007). 

References 

1. Anthony S, Jones H, Darpel KE, Elliott H, Maan S, Samuel A, Mellor PS & Mertens PPC (2007). J Virol Methods 141, 188- 

197. 

2. Batten CA, Shaw AE, Maan S, Maan NS and Mertens PPC (2007). J Gen Virol (Submitted). 

3. Darpel KE, Batten CA, Veronesi E, and 11 other authors (2007). Vet Rec 161, 253-261. 

4. IAH reference collection: http://www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/BTV-isolates.htm 

5. Maan S, Maan NS, Samuel AR, Rao S, Attoui H, Mertens PPC. (2007a). J Gen Virol 88, 621-630. 

6. Maan S, Rao S, Maan NS, Anthony SJ, Attoui H, Samuel AR & Mertens PPC (2007b). J Virol Methods 143,132-139. 

7. Mertens PPC Maan NS, Prasad G, Samuel AR, Shaw AE, Potgieter AC, Anthony SJ & Maan S (2007a). J Gen Virol 88, 

2811–2823. 

8. Mertens PPC, Maan S, Maan NS, Bankowska K, Swain A, Batten C, Carpenter S, Gloster J, Mellor PS & Oura C (2007b). 

Promed report Archive Number 20070926.3196, 26-SEP-2007. 

9. Purse BV, Mellor PS, Rogers DJ, Samuel AR, Mertens PPC & Baylis M (2005). Nat Rev Microbiol 3, 171–181.


SEQUENCING AND RT-PCR ASSAYS FOR GENOME SEGMENT 2 OF THE 24 BLUETONGUE VIRUS 

SEROTYPES: IDENTIFICATION OF EXOTIC SEROTYPES IN THE SOUTHEASTERN USA (1999-2006) 

P. P.C. Mertens* 1 , N. S. Maan 1 , D. J. Johnson 2 , E. N. Ostlund 2 , and S. Maan 1 

1 Arbovirology Dept., Institute for Animal Health, Ash Road, Pirbright, Woking, Surrey, GU24 0NF (UK) 

2 USDA, Animal and Plant Health Inspection Service, Veterinary Services Laboratories (NVSL), Ames, IA 

Introduction: Bluetongue (BT) is non-contagious arthropod-borne viral-disease of ruminants that occurs 

almost worldwide between latitudes 35 o S and 50 o N. The bluetongue virus (BTV) is transmitted by adult 

females of certain species of Culicoides midge (Diptera: Ceratopogonidae). The BTV genome is composed 

of ten linear segments of dsRNA, which code for ten distinct viral proteins (VP1-VP7 and NS1-NS3). Twentyfour 

BTV serotypes of have been identified world-wide, that can be distinguished in serum neutralisation 

assays based on the specificity of reactions between the neutralising antibodies generated during BTV 

infection of the mammalian host, and outer-capsid protein VP2 (encoded by Seg-2) [3, 5]. In an area where 

multiple strains of different BTV types are co-circulating (e.g. the USA, Australia, Africa, India and Europesince 

1998) a full understanding of the epidemiological situation depends on assays that rapidly and reliably 

detect and identify the different virus types and strains involved. 

Material & methods: RNA for RT-PCR assays was extracted from BTV infected tissue-culture supernatants 

or EDTA blood samples, using QIAamp Viral RNA Mini Kit (QIAGEN). Serogroup-specific RT-PCR assays 

were as described previously [1, 7]. Details of serotype-specific RT-PCR assays are described by Mertens 

et al [5 and in preparation]. Sequencing methods and data for phylogenetic comparisons of BTV genome 

segment 2 (Seg-2) from the 24 BTV reference strains have been reported by Maan et al [3, 4]. 

Results: A nucleotide (nt) sequence database has been developed for Seg-2 of multiple isolates of the 24 

BTV serotypes, showing that variations in Seg-2 correlate perfectly with virus type (see link to phylogenetic 

trees) [3]. These assays can detect and ‘type’ any of the BTV isolates that were tested from different BTV 

serotypes or different geographical origins (i.e. different Seg-2 topotypes within the individual serotypes). 

These serotype specific assays (and primers) showed no cross-amplification when evaluated with multiple 

isolates of the most closely related BTV types (same nucleotype [3]), or with reference strains of the 

remaining 24 BTV serotypes [5]. These ‘type’ specific primers are listed on the internet and will be 

periodically updated to maintain their relevance to current BTV distribution and epidemiology. These RT- 

PCR assays have been used at IAH Pirbright to identify BTV-8 in northern Europe (2006-2007) (e.g. 

UKG2007/01), and BTV-4 / 15 in Israel 2006, BTV-1 in North Africa in 2006 (see link to phylogenetic trees). 

Isolations and identification of BTV in the USA are routinely performed at the National Veterinary Services 

Laboratories (NVSL), Ames, IA. Prior to 1999, five BTV serotypes (BTV-2, BTV-10, BTV-11, BTV-13, and 

BTV-17) were considered endemic in the USA. However, several isolates from Florida (1999-2005), failed to 

‘type’ as members of these existing U.S. The serotypes of these isolates were subsequently identified by RT- 

PCR assays and sequence analysis of Seg-2. These include: BTV-3 (multiple isolates from Florida 1999- 

2003); BTV-5 (USA2003/05); BTV-6: from Florida 2006. BTV-14 (USA2003/03): BTV-19 (USA2003/04): 

BTV-22 (USA2002/02). More details concerning each isolate can be obtained from links at: 

www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/virus-nos-by-country.htm#USA 

Discussions & conclusions: Oligonucleotide primers and RT-PCR assays, targeting Seg-2, have been 

developed for the rapid identification (within 24h) of the 24 BTV types. These assays have been used to 

identify the 6 current European types (1, 2, 4, 8, 9 & 16) [5]. These assays have also been used to identify 6 

BTV types that are new introductions / exotic to USA (type- 3, 5, 6, 14, 19 and 22). The assays are fast, 

sensitive and specific, showing perfect agreement with results of conventional virus neutralisation assays. 

They can also positively identify BTV serotype, even if the animal has been infected with several different 

BTV virus types, leading to a non-specific serological response [2]. BTV serotype and virus strain (topotype) 

can be confirmed by sequence analyses and phylogenetic comparisons of the Seg-2 cDNA products. Since 

1998, several exotic BTV serotypes (types have spread into the USA and Europe at approximately the same 

time. These events in Europe have been linked to changes in climate and their effects on vector insect [6]. 

References: 

Global distribution of BTV types: www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/btv-serotype-distribution.htm 

Phylogenetic trees for Seg-2 of BTV types: www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/btv-seg-2.htm 

Seg-2 specific primers: www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/rt-pcr-primers.htm 

BTV accession numbers: www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/orbivirus-accession-numbers.htm 

Reports concerning recent BTV outbreaks www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/outbreaks.htm#top 

BTV reference collection: http://www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/BTV-isolates.htm 

1. Anthony S, Jones H, Darpel KE, & 5 other authors (2007). J Virol Methods 141, 188-197. 

2. Jeggo MH, Gumm ID, & Taylor WP. (1983) Res Vet Sci. 34, 205-211. 

3. Maan S, Maan NS, Samuel AR, Rao S, Attoui H, Mertens PP. (2007a).J Gen Virol. 88, 621-630. 

4. Maan S, Rao S, Maan NS, & 4 other authors (2007b). J Virol Methods 143,132-139. 

5. Mertens, P.P.C. Maan N. S., Prasad, G.,& 5 other authors (2007). J Gen Virol 88, 2811-2823. 

6. Purse BV, Mellor PS, Rogers DJ, & 3 other authors (2005). Nat Rev Microbiol 3, 171–181. 

7. Shaw AE, Monaghan, P, Alpar, HO, & 10 other authors (2007). J Virol Methods 145,115-126. 




REPLICATION OF BLUETONGUE VIEUS IN THE SKIN OF INFECTED SHEEP 

Karin E. Darpel 1 , Paul Mongahan 1 , Jennifer Simpson 1 , Harriet W. Brooks 2 , Simon J. Anthony 1 , Eva Veronesi 1 , Joe Brownlie 2 , Natalie 

Ross-Smith 1 , Haru H. Takamatsu 1 , Philip Mellor 1 and Peter P.C. Mertens 1 

1 

Institute for Animal Health, Pirbright Laboratory, Ash Road, Woking, Surrey, GU24 0NF (UK) 

2 

Royal Veterinary College, Hawkshead Lane, North Mymms, Hatfield, Herts, AL9 7TA 

Introduction: 

Previous studies of BTV pathogenesis and tissue tropism in the infected mammalian host have been 

primarily based on pathology and the time course of virus isolation, targeting different organs (Pini 1976; 

Lawman 1979; MacLachlan et. al. 1990). However, these methods are unable to identify which cell types 

within each organ are infected and do not differentiate infectious virus present in the bloodstream, from virus 

which is actively replicating in the cellular components of the organs itself. 

The separation between active virus replication and the simple physical presence of virus in infected animal 

cells can be achieved using immunolabelling and confocal microscopy. Detection of BTV NS proteins, which 

are not carried into the cell by the infecting virus particles, represents a clear indication of virus replication. 

However, earlier immunofluoresence microscopy studies of BTV infection in ruminants gave relatively poor 

detection of viral proteins and therefore often also gave inconclusive or unsatisfactory results (Mahrt and 

Osburn 1986; MacLachlan et.al. 1990). Here the replication of BTV in ruminants was further investigated, 

successfully using modern confocal-microscopy to detect viral proteins in different organs. 

Material and Methods: 

Tissues were collected during the necropsy of BTV-2 (RSA1971/03) infected sheep (at 3,4,6,8,and 9 d.p.i.), 

BTV-8 (IAH reference collection number NET2006/01) infected sheep (8 d.p.i.) and cattle (10 d.p.i.), 

processed as described previously by Mongahan et. al. (2005). BTV proteins were stained using anti-NS2 

antibodies (ORAB 01 and ORAB0268) that had been generated using bacterially expressed and purified 

NS2 protein from BTV-1 (RSArrrr/01), the A3 monoclonal antibody against VP7 (ORAB036) and antibodies 

raised against purified BTV-1 core particles (ORAB06). Antibody binding was detected with species-specific 

fluorescent conjugate. Skin samples from other BTV infected sheep (several serotypes) were investigated for 

BTV persistence by establishing primary fibroblast cultures, which showed cytopathic effect (CPE) if BTV 

was present (confirmed by RT-PCR – Anthony et.al. 2007/ Maan 2004) 

Results: 

Viral antigens were found in two major cell populations: micro-vascular endothelial cells and leukocytes 

(lymphocytes, dendritic cells and monocytes). Infected endothelial cell were detected very early postinfection 

(3 dpi), in the head lymph-nodes, tonsils, tongue, lips and skin. A time-course study of sheep 

infected with BTV-2 (RSA1971/03) suggested that leukocytes and endothelial cells are infected 

simultaneously. Early manifestation of BTV replication (and clinical signs) may depend on the susceptibility 

and damage to endothelial cells in different organs. Viral proteins were found in local foci within certain 

organs, suggesting local spread, possibly within the capillary bed of the organs themselves. 

Infection and replication of BTV was observed in sheep skin, soon after infection (3 dpi), particularly in 

endothelial cells of the smaller blood-vessels. Infection of the skin intensified, peaking at 6-8 dpi. At this 

stage some skin-glands contained BTV proteins. The virus occasionally persisted in the skin, even after the 

viraemia had subsided. 

Conclusion: 

The skin is the ‘transmission-organ’ for BTV, in both directions between the ruminant-host and insect-vector. 

It was demonstrated that BTV replicates in the vascular endothelial cells (and to a lesser extend in 

leukocytes) of the skin. The skin was also one of the organs (along with head lymph nodes and tonsil) were 

viral proteins were detected in the largest amounts. The skin is the largest single organ of the body, 

suggesting that it may also be the major organ involved in BTV replication. 

BTV isolation from skin samples of BTV infected sheep does not appear to correlate with the detected levels 

of systemic viraemia. It may therefore be possible that feeding midges (Culicoides vectors) can take up and 

become infected by virus produced locally in the skin, even if the level of circulating viraemia is low or 

absent. Ruminants with a low viraemia may still be important for virus transmission. Lymphatic organs like 

head lymph nodes and tonsil not only contained viral proteins in infected leukocytes but endothelial cells of 

capillaries and small blood vessels were also strongly infected. 

References: 

BTV reference collection: http://www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/BTV-isolates.htm 

Anthony et.al. 2007 J.Virol.Methods 141, 188-197. 

Lawman 1979 Thesis University of Surrey. 

Maan 2004 Thesis University of London. 

MacLachlan et.al. 1990 Vet.Path. 27, 233-229. 

Mahrt and Osburn 1986 Am. J. Vet.Res. 47,1198-1203. 

Mongahan et. al. 2005 J.Virol. 79, 6410-6418. 

Pini 1976 Oond.J.Vet.Res. 43,159-164.


VALIDATION OF A DIAGNOSTIC METHOD FOR THE DETECTION AND QUANTIFICATION OF 

BLUETONGUE VIRUS IN ADULT CULICOIDES BITING MIDGES (DIPTERA: CERATOPOGONIDAE). 

*Eva Veronesi , Peter P.C. Mertens, Philip S. Mellor and Simon Carpenter 

Institute for Animal Health, Ash Road, Pirbright, Surrey, GU24 ONF, UK. 

Introduction: Bluetongue (BT) is a non-contagious arthropod-borne viral disease of domesticated and wild 

ruminants that is transmitted by the bite of adult females, from certain species of Culicoides biting midge 

(Diptera: Ceratopogonidae). Screening of field caught midges for the presence of bluetongue virus (BTV) 

can provide valuable information concerning BTV transmission during an outbreak of the disease. 

In this study we describe the validation of an efficient method to quantify BTV from adult midges. We present 

results for virus isolation from adult C. sonorensis (derived from the colony at IAH Pirbright) that were 

intrathoracically infected with BTV, then homogenised using a conventional mortar and pestle method. 

These data were compared with results obtained using a TissueLyser® machine (Qiagen), which 

homogenises samples by high frequency shaking in the presence of a ball-bearing. This machine has 

already been used in several laboratories to extract viral DNA or RNA from infected tissues or insects (e.g. to 

isolate West Nile Virus from wild caught mosquitoes) but has not previously been validated for quantification 

of virus in an arboviral/vector system. A quantitative assessment of viral load in the vector is thought to be 

particularly important for BTV, since a titre of ≥3.0 log10TCID50/midge represents a fully disseminated 

infection (Fu et al. 1999) and is required for virus transmission to the ruminant host during a blood meal. 

Material & Methods: In order to ensure the presence of the virus, adult C. sonorensis were individually 

inoculated (intrathoracically) with BTV serotype 9 (BTV-9, IAH reference collection number KOS2001/03). 

Immediately after inoculation, equal numbers of these insects were homogenised (individually) using either a 

mortar pestle, or TissueLyser® method. The TissueLyser® homogenisation parameters that were optimised, 

include: 1) Duration of shaking; 2) Frequency of shaking; 3) Material of the ball-bearing (polyethylene / 

stainless steel); and 4) Size of ball-bearing (1, 2, 3, 4, 5 mm diameter). The efficiency of virus recovery was 

assessed by titrating a ten fold dilution series of each homogenised insect on BHK-21 cells. Adult C. 

sonorensis were also infected via an oral route, then incubated at ±25ºC for 10 days to allow virus 

replication. Equal numbers of these midges were individually homogenised using either a mortar and pestle 

or optimised TissueLyser® method, and virus isolation was carried out as before. Real time RT-PCR (Shaw 

et al 2007) was used to confirm the identity of BTV infected insects. 

Results: The optimum TissueLyser® homogenization program, involved shaking insects in 100 µl of 

Glasgow MEM for 1 min at 25 Hz with a 2 or 3 mm stainless steel ball bearing. The virus titres obtained 

using oral or intrathoracic infection techniques and the optimised program, did not differ significantly from 

those obtained using a polypropylene motor-driven pestle (a method that is currently in common use for 

studies of vector competence). Although a significant difference in the amount of virus obtained was 

observed between different homogenisation programs (H = 57.73; df = 7; P


WILD LIFE AS A SOURCE OF ZOONOTIC DISEASES 

Tin Tin Myaing and Tay Zar Aye Cho 

Despite the discovery of cooking last 1.9 million years ago, the risk of zoonotic diseases emerging from 

hunting and eating wildlife is still of global importance. World landscape and habitat of the wild animals has a 

kaleidoscope of niches, leading to the diseases transmitted from animals to man. Infectious pathogens of 

wild animals'origin have become increasingly important on substantial impacts of human health, agricultural 

production, international trade, wildlife-based economies, native wildlife populations, wildlife conservation, 

and the health of ecosystems. Expanded demand for bush meat will likely lead to changes in the exposure of 

humans to potentially zoonotic microbes.The ancient wild life epidemic zoonotic disease was bubonic 

plague, emerged in 14 th century, killed approximately one third of Europe’s population transmitted by fleas 

and the reservoir was Ratus ratus. Rabies was described in Mesopotamia in hunting dogs as early as 

2,300BC. Alexander the Great passed in 323 BC, died of encephalitis caused by West Nile Virus of a wild 

bird reservoir as the modern hypotheses suggestion. HIV/AIDs, SARs, Nipah virus, Rabies and Avian 

Influenza H5N1 are some zoonotic diseases of interest, originated from wild life reservoir. House rat (Rattus 

rattus robustulus), fruit bats and flying fox (Pteropus vampyrus) and Civet cat(Paguma larvata) were the 

source of some zoonotic diseases originated from wild animals, populated in Asian countries and Myanmar. 

There were evidences of warble fly larvae from Asian Elephant (Elephas maximus) transmitted to mahout’s 

skin at arm and legs, in Myanmar. A 2/50(4%) cases of warble fly transmitted to mahout's skin ( palm and 

toe) was observed in 2005. Mechanical removal of the embedded larva under the skin had been observed. 

There was no further systematic treatment as well as no clinical signs except slight itching. Transmission of 

Anthrax disease 1% (1/100) (cutaneous form) to a worker who cut off the internal organs of the elephant’s 

dead body was investigated in 2006 but infected person took antibiotic therapy and saved. Tuberculosis 

infected in persons closed contact with elephants have been observed but not yet been identified. Civet cat 

(Paguma larvata) was valuable in Myanmar due to its perfume like smell produced from anal gland. Civet cat 

was said to be the reservoir of SARs disease. Understandings the emergence of zoonotic agents requires 

knowledge of pathogen biodiversity in wildlife, human-wildlife interactions, anthropogenic pressures on 

wildlife populations, human behavior and demographic factors. To reduce risk for emerging zoonoses, the 

public should be educated about the risks associated with wildlife, bush meat, and exotic pet trades, better 

understanding of how deforestation and associated hunting leads to the emergence of novel zoonotic 

pathogens. Control of emerging zoonotic diseases of wild life origin should be relies on national, 

international, regional and cross sectional networks, public health and veterinary services should be more 

strengthened, especially the services can become more prepared to respond to endemic and epidemic 

diseases. Veterinarian diagnosticians should have wide knowledge and skillful in their field of interest. On the 

other hand wild life conservation and animal welfare should also be considered as an important theme. 

Key words: wild life based economy, emerging zoonoses, bush meat hunting, 

public health, animal welfare 

corresponding author: tintinmyaing@mail4u.com.mm 




SURVEILLANCE OF MYCOBACTERIUM BOVIS INFECTION IN CATTLE 

IN GREAT BRITAIN DURING 2006 

K.L.Jahans*, D.R.Worth, J.Brown, J.M.Gunn, M.Okker, E. Wood and L. Potts 

Veterinary Laboratories Agency, New Haw, Addlestone, Surrey KT15 3NB. 

Introduction 

Despite an intensive test and slaughter programme to prevent cattle-to-cattle transmission, Great Britain has 

one of the highest animal and herd incidences of bovine TB in Europe. The Veterinary Laboratories Agency 

has seen an increase in isolates submitted for TB diagnosis since 2002 following the occurrence of Foot and 

Mouth Disease in 2001. During most of that year (mid February to November) routine testing of cattle for 

bovine tuberculosis was suspended. Up to 2005, the number of incidents in Great Britain has increased by 

an average of 16% each year since the mid 1980s. 

Cattle and other bovine species, such as buffaloes and bison, are the natural hosts but nearly all warmblooded 

animals, including humans can be affected. Species are not all equally susceptible or share the 

same ability to act as reservoirs of infection for other species: some are considered spill-over hosts, whereas 

others (e.g. cattle and badgers) act as true maintenance hosts. 


Bovine tissue samples (approx 20g) were received in sterile plastic pots with a standard form. Samples from 

other species were also received but tended to be smaller and arrived with a similar form or letter. Details 

from both submission types were entered on a database. Lesioned tissue was selected over 

non-lesioned material. 

Approximately 1cm 3 of tissue containing lesions was placed in 50ml buffered formaldehyde solution for 

histopathology. The remainder was homogenized with a solution of 5% oxalic acid in order to destroy any 

contaminating organisms, centrifuged at 1100g for 10 minutes and the resulting deposit washed and resuspended 

in 0.85% sterile saline. Then approximately 300 µl were sown onto selective media and 

incubated for 6 weeks at 37 o C. 

Identification of M. bovis was usually made by its appearance on solid media slopes. PCR and spoligotyping 

was used in addition for more accurate differentiation using the methods of Wilton and Cousins (1992) and 

Kamerbeek et al (1997). Molecular typing of Mycobacterium species other than members of the TB 

complex, M. avium or M. intracellulare was carried out using a kit produced by Hain Lifescience 

(http://www.hain-lifescience.com). 

Results 

In 2006 the TB Diagnosis Section at the Veterinary Laboratories Agency - Weybridge received 13,907 

bovine tissue submissions for confirmation of diagnosis by culture. The number of submissions from other 

species (excluding badgers) was 690 and consisted mainly of a non-random sample of deer, cat, dog, pig, 

sheep, goat and camelids. 4,710 (34%) of the cattle submissions and 83 (12%) of submissions from these 

other species were found to be positive for M. bovis. There has been no significant increase in the number 

of confirmed bovine tuberculosis incidents in Great Britain in 2006 compared to 2005 (2.49% and 

2.45% respectively). 


Spoligotypes have become more widspread and some of this may have been due to the restocking of herds 

with cattle from areas of high TB prevalence. Veterinarians are gradually making more use of molecular 

typing data, in conjunction with cattle movement data, as an aid to tracing the origins of infection because 

spoligotypes are generally found in geographical clusters. The available evidence suggests that cases in 

farmed and companion animals were the result of infection spill-over from a cattle or wildlife reservoir. 

References 

Kamerbeek J, Schouls L ,Kolk A, van Agterveld M, van Soolingen D, Kuijper S, BunschoteA, Molhuizen H, Shaw R, Goyal M and van 

Embden J (1997). Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. 

Journal of Clinical Microbiology, Apr 1997, 907-914, Vol 35, No. 4. 

Wilton S and Cousins D (1992). Detection and identification of multiple mycobacterial pathogens by DNA amplification in a single tube. 

PCR Methods Appl. 1992 May;1(4):269-73.


CANINE RABIES IN SOUTH AFRICA: IDENTIFICATION OF A NEW LINEAGE IN LIMPOPO AND A 

RECENT SPREAD INTO THE FREE STATE PROVINCE 

Introduction 

Chuene Ernest Ngoepe a, * , Gugulethu Zulu a , Claude Sabeta a , Louis Nel b 

a Rabies Unit, Onderstepoort Veterinary Institute, Private Bag X05, Onderstepoort, 0110 

b University of Pretoria, Microbiology and Plant Pathology, 0002 Pretoria, South Africa 

In 2005, there was a drastic and unexpected increase of dog rabies cases in the Limpopo province. 

Laboratory confirmed cases increased from 5 in 2004 to 35 in 2005 and to 100 in 2006. The outbreak of 

rabies in domestic dogs was followed by a human rabies outbreak in which at least 30 human deaths were 

confirmed between 2005 and 2006. In contrast, the Free State province has been historically associated with 

endemic rabies in the yellow mongoose Cynictis penicillata (Snyman, 1940; Swanepoel et al. 1993). Due to 

spillover events, rabies viruses of the mongoose biotype were recovered from domestic dogs. More recently, 

there has been increased number of rabies cases of the canid biotype reported in domestic dogs in this 

province. The objectives of this study were; 1. to establish the exact source of infection in the human rabies 

cases and the origin of the rabies virus lineage responsible for the recent rabies outbreak in Limpopo, and 2. 

to trace the origin of canid rabies and assess the public health threat of mongoose rabies (in dogs) in the 

Free State province. 


A molecular epidemiological study was therefore performed on a cohort of 98 rabies viruses recovered from 

domestic dogs between 1995 and 2007 from the Free State province and 52 rabies viruses recovered from 

domestic dogs, jackals and humans from Limpopo and southern Zimbabwe. The cytoplasmic domain of the 

glycoprotein and the G-L intergenic region of the rabies viruses in this study sample were amplified and 

sequenced. Phylogenetic trees were reconstructed from an alignment of a 592-bp region of the genome 

under investigation. 

Results 

Case 1: Phylogenetic analysis revealed that human rabies viruses were closely related to those obtained 

from domestic dogs in the same locality and the rabies viruses from Limpopo were closely related to viruses 

obtained from southern Zimbabwe. 

Case 2: The phylogenetic analyses segregated the rabies viruses in this study sample into two main 

clusters; the genetically compact canid rabies biotype and a second group of heterogeneous viruses of the 

mongoose rabies biotype. From the data, it could be demonstrated that viruses of the canid rabies group 

were recently introduced into this part of South Africa. 


The reasons for the emergence and rapid dissemination of the new dog rabies strain in Limpopo are not very 

clear. It appears that common rabies infection cycles persist between domestic dogs and jackals in southern 

Zimbabwe and northern South Africa. It is evident that the new canid group belongs to the same 

epidemiological cycle circulating in dogs in both the Free State province and across the international border 

with Lesotho. Our results confirm that spillover of the mongoose biotype into domestic dogs lead to dead-end 

infections. In comparison to mongoose rabies that is endemic here, canid rabies has emerged to become of 

much greater importance to the public and veterinary health sectors of this region. 

References 

1. Swanepoel, R., Barnard, B. J. H., Meredith, C. D., Bishop, G. C., Bruckner, G. K., Fogging, C. M., 

Hubschle, O. J. B., 1993. Rabies in Southern Africa. Onderstepoort Journal of Veterinary Research, 60: pp. 

325-346. 

2. Snyman, P.S., 1940. The study and control of vectors of rabies in South Africa. Onderstepoort Journal of 

Veterinary Science Animal Husbandry, 66: pp. 296-307 




CAPRIPOXVIRUS TROPISM AND SHEDDING: A QUANTITATIVE TIME-COURSE STUDY IN 

EXPERIMENTALLY INFECTED SHEEP AND GOATS 

T R Bowden 1,* , S L Babiuk 2,3 , M P Anderson 1 , G R Parkyn 2 , R P Kitching 2 , J S Copps 2 and D B Boyle 1 

1 CSIRO Livestock Industries, Australian Animal Health Laboratory, Private Bag 24, Geelong, Victoria 3220, Australia 

2 Canadian Food Inspection Agency, National Centre for Foreign Animal Disease, 1015 Arlington Street, Winnipeg, 

Manitoba R3E 3M4, Canada 

3 University of Manitoba, Department of Immunology, Basic Medical Sciences Building 730 William Avenue, Winnipeg, 

Manitoba R3E 0W3, Canada. 

Introduction 

Sheeppox virus (SPPV) and goatpox virus (GTPV), which are members of the genus Capripoxvirus in the 

family Poxviridae, cause systemic disease in sheep and goats that is characterized by fever, generalized 

skin nodules, lesions in the respiratory and gastrointestinal tracts and lymph node enlargement. SPPV and 

GTPV are endemic in north and central Africa, the Middle East, central Asia and the Indian subcontinent, 

where they are a cause of significant morbidity and mortality in susceptible sheep and goats. Despite the 

considerable threat that these viruses pose to small ruminant production and to global trade in sheep, goats 

and their products, knowledge of the underlying pathogenesis of sheeppox and goatpox has long been 

deficient. To increase understanding of the pathogenesis of these diseases, we undertook quantitative timecourse 

studies in sheep and goats, utilizing real-time PCR and traditional virological assays, following 

intradermal inoculation of Nigerian SPPV or Indian GTPV in their respective homologous hosts. 


Nine sheep and nine goats were inoculated intradermally with either 10 4.9 TCID50 of Nigerian SPPV (sheep) 

or 10 4.4 TCID50 of Indian GTPV (goats). To enable absolute quantitation of viral DNA concentrations in blood, 

swabs and tissue samples, we developed a quantitative real-time PCR TaqMan assay to amplify and detect 

a short product from within ORF074 of capripoxvirus genomes. Multiplexed detection of either an 

endogenous or exogenous control, depending on the sample type, provided a means of verifying the 

absence of PCR inhibitors in samples tested. Isolation of infectious virus from clinical materials was routinely 

attempted by inoculation of samples, in duplicate, onto 80-90% confluent ovine testis cell monolayers. 

Capripoxvirus-positive specimens were subsequently titrated on replicate cell monolayers to determine 

sample infectivity. 

Results 

Viral DNA concentrations in blood, swabs, urine, faeces and solid tissues varied by as many as six orders of 

magnitude. Viraemia, determined by real-time PCR and virus isolation, cleared within two to three weeks 

post inoculation. Peak shedding of viral DNA and infectious virus in nasal, conjunctival and oral secretions 

occurred between days 10 and 14 post inoculation, and persisted at low levels for up to an additional three to 

six weeks. The highest infectious titres in nasal, conjunctival and oral swabs were observed in goats, and 

correlated with the greater severity of disease observed in these animals. Although gross lesions were 

evident in multiple organs at necropsy, highest viral titres were detected in skin as well as in lung and 

discrete sites within oronasal tissues and gastrointestinal tract. Of all tissues tested, skin was consistently 

positive throughout the sampling period. 


Our studies have provided novel insights regarding replication, dissemination and shedding of 

capripoxviruses in their natural hosts, the pathogenesis of which is similar to smallpox and monkeypox 

where greatest viral replication occurs in the skin. The consistently high concentrations of viral DNA in skin, 

along with its high infectivity, suggest that mechanical transmission by biting insects might occur more 

frequently than previously thought. Furthermore, long term shedding of virus from mucosal surfaces 

illustrates the potential for some animals to remain infectious for up to two months after the onset of fever. 

These findings should facilitate development of improved strategies for detection and control of capripoxvirus 

infections in sheep and goats.


An indirect ELISA, based upon recombinant capripoxvirus antigens, for serological detection of 

sheeppox, goatpox and lumpy skin disease 

David B Boyle 1 , Timothy R Bowden 1 , Vicky Boyd 1 , Christine J Duch 1 , Mary-Ann P Anderson 1 , Vicky Stevens 1 , John R White 1 , Barbara E. 

Coupar 1 , Shawn L Babiuk 2,3 , Geoff R Parkyn 2 , R Paul Kitching 2 and John S Copps 2 

1 CSIRO Livestock Industries, Australian Animal Health Laboratory, Private Bag 24, Geelong, Victoria 3220, Australia 

2 Canadian Food Inspection Agency, National Centre for Foreign Animal Disease, 1015 Arlington Street, Winnipeg, Manitoba, 

Canada R3E 3M4 

3 University of Manitoba, Department of Immunology, Basic Medical Sciences Building 730 William Avenue, Winnipeg MB, 

Canada. R3E 0W3 

Background: 

Sheeppox, goatpox and lumpy skin disease are the most serious poxvirus diseases of production animals, 

and are caused by viruses that comprise the genus Capripoxvirus in the family Poxviridae. Australia’s 

livestock export industries would face major restrictions should an outbreak of capripoxvirus disease occur. 

Furthermore, our ability to respond to such an outbreak would be seriously compromised by the lack of 

modern serological surveillance capabilities for these diseases. 

Aim: 

To develop an indirect ELISA, based on recombinant antigens, suitable for detection of antibodies to 

sheeppox, goatpox and lumpy skin disease viruses. 

Methods: 

Selected open reading frames were amplified from the genome of a Nigerian sheeppox isolate and 

expressed in Escherichia coli as N-terminal His-tagged fusion proteins. Recombinant proteins were 

characterised initially by Western blot to confirm the presence of full-length His-tagged constructs and 

subsequently by ELISA for reactivity to sera from sheep, goats and cattle experimentally infected with 

capripoxvirus or parapoxvirus isolates. 

Results: 

By screening approximately 40 candidate virus antigens, we have identified two that are readily purified 

using affinity chromatography and which react with sequential sera from capripoxvirus-infected animals. Most 

sheep and goats vaccinated with an attenuated vaccine isolate did not develop detectable antibodies to 

either antigen. 

Conclusion: 

We have established reliable methods for large scale expression and purification of two recombinant 

proteins for use as antigens in an indirect ELISA. Our data using sera from experimentally infected sheep 

and goats suggest that these antigens will facilitate capripoxvirus serosurveillance in countries that can not 

work with live virus. 




NEW ADVANCES IN THE MOLECULAR DIAGNOSIS OF AFRICAN HORSE SICKNESS (AHS) 

J Fernández 1* , P Fernández 1 , B Rodríguez 2 , E Sotelo 1 , A Robles 1 , M Arias 1 , JM Sánchez-Vizcaíno 2 

1 CISA-INIA, Valdeolmos, Madrid, Spain 

2 Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Spain 

OIE Reference Laboratory for African Horse Sickness 

Introduction 

African Horse Sickness (AHS) is a non-contagious artropod-borne infectious disease that afects equidae, 

caused by a double-stranded RNA orbivirus. It is a notifiable disease, and it is endemic in many sub-Saharan 

countries. Previously, our laboratory developed rapid and sensitive ELISA tests for AHS virus (AHSV) 

antigen and antibody detection, as well as a conventional RT-PCR method, that are included in the OIE 

Terrestrial Manual 5 . Our objective was the development of new RT-PCR systems for the improved diagnosis 

of AHS using novel technologies. A real-time RT-PCR format using a TaqMan-MGB probe, but also a highly 

sensitive conventional RT-PCR to assist laboratories with limited resources 2 , have been standardised. 

Material and methods 

The nine serotypes of AHSV were used in the study. For specificity assays, a collection of spleen 

homogenates from horses proceeding from Spanish AHS outbreaks (1987-1990), as well as Bluetongue 

Virus (BTV), Vesicular Stomatitis Virus (VSV), West Nile Virus (WNV), Equine Influenza Virus (EIV), and 

non-infected Vero and BHK-21 cell lines cultures, were also employed. Total RNA was extracted from 

samples using commercial High Pure Viral Nucleic Acid Kit, following manufacturer’s instructions (Roche). 

Genome sequences from all viral serotypes were compared. A specific primer set and a TaqMan-MGB probe 

were designed from conserved regions of the VP7 viral genome region using the Primer Express TM 2.0 

program (Applied Biosystems) to amplify the different viral serotypes, delimiting an amplicon of 102 bp. 

One-step RT-PCR kit and QuantiTect Probe RT-PCR kit (Qiagen) were used for AHSV conventional and 

real-time amplification assays, respectively. The real-time RT-PCR was adapted for its use both in capillary 

(LightCycler, Roche) and 96-well plate (MX3005, Stratagene) thermocyclers. 

Results 

The analytical sensitivity of conventional and real-time RT-PCR assays was determined using three 

replicates of 10-fold dilutions of viral suspensions of AHSV-3, AHSV-4 and AHSV-5 with known titres, grown 

in Vero cell line cultures. The detection limit of the real-time method was 0.008 TCID , 0.001 TCID , and 

50 50 

0.007 TCID for each of the mentioned serotypes. Standard curves were then constructed based on the 

50 

observed Ct values for each viral dilution, showing a linear relationship of six-seven orders of magnitude for 

each serotype. The sensitivity of the developed conventional RT-PCR using the same primer set was also 

established applying the same approach, and showed to be 0.8 TCID for AHSV-3, 0.01 TCID for AHSV-4, 

50 50 

and 0.07 TCID for AHSV-5. In comparative studies, the sensitivity of the real-time and conventional RT- 

50 

PCR methods showed to be in a range from 10 1 

to 10 3 

-fold higher than that obtained when performing 

conventional RT-PCR using the primer set recommended in OIE Terrestrial Manual. Similar analytical 

sensitivity testing were further performed with all the other AHSV serotypes: 1, 2, 6, 7, 8, and 9, obtaining a 

detection limit ranging from 0.001 to 0.15 TCID50 per reaction in all of them using the two presented assays. 

Specificity of the RT-PCR tests was also evaluated using a collection of spleen homogenates from field 

AHSV-infected and non-infected horses, VSV, BTV, WNV, EIV, and non infected Vero and BHK-21 cell lines. 

Specific amplified product was observed only in AHSV positive field samples. 

Discussion and Conclusions 

Several RT-PCR methods have been reported in the past for the AHSV detection, though all of them are gelbased 

assays 1,3-7 . This work presents the development and standardisation of two new RT-PCR methods for 

the improved AHSV detection to be used in Animal Health Laboratories 2 . One system is a simple and robust 

conventional RT-PCR test, that improves the existing diagnostic one described in the OIE Terrestrial 

Manual 5 . The other method is a real-time RT-PCR assay, described for the first time for AHS diagnosis. Both 

procedures have proved to be rapid, highly sensitive and specific tools for the detection of all the nine AHSV 

serotypes. Furthermore, the real-time protocol has shown as a versatile and reproducible assay that can be 

used in any format of real-time equipment. 

References 

1. Díaz-Laviada, M; Sánchez-Vizcaíno, JM; Roy, P; Sobrino, F. (1997) Invest. Agr. SA., 12: 97–102. 

2. Fernández, J; Fernández, P; Rodríguez, B; Sotelo, E; Robles, A; Arias, M; Sánchez-Vizcaíno, JM. (2007), submitted. 

3. Koekemoer, JJ; Dijk, AA. (2004) J Virol Methods., 122 (1): 49-56. 

4. Sailleau, C; Hamblin, C; Paweska, JT; Zientara S. (2000) J Gen Virol., 81 (Pt 3): 831-837. 

5. Sánchez-Vizcaíno, J.M. (2004) OIE Terrestrial Manual, chapter 2.1.11. 

6. Stone-Marschat, M; Carville, A; Skowronek, A; Laegreid, WW. (1994) J Clin Microbiol., 32: 697-700. 

7. Zientara, S; Sailleau, C; Moulay, S; Cruciere, C. (1994) J Virol Methods., 46 (2): 179-188. 

This work has been funded by INIA project OT01-002 and EU project SSPE-CT2004-513645.


1745 - 1915 Special Plenary Sessions - Equine Influenza Mon 

CHANGING DYNAMICS IN THE GLOBAL DISTRIBUTION OF EQUINE DISEASES 

12 

P.J. Timoney* Department of Veterinary Science 108 Gluck Equine Research Center Lexington, KY 40546-0099 

In an era of ever increasing globalization both with respect to travel and trade, the risk of spread of infectious 

diseases of humans and animals has never been greater. Countries historically free of certain diseases of 

public health or veterinary importance can no longer consider themselves remote from the risk of incursion of 

November 

those diseases. The frequency with which diseases are disseminated either within or between countries 

continues to escalate. As a consequence, fewer and fewer diseases can be considered geographically 

restricted as was formerly the case. 

Apart from humans, equids best exemplify the ease with which infectious diseases can be spread through 

international movement. Horses are unique not only because of the longevity of the species, considerable 

financial value of individual animals, but perhaps most importantly because of the frequency with which they 

are shipped between countries for commercial and other reasons. Various industry initiatives over the past 

30 to 40 years have contributed very significantly to the evolving nature of international trade in equids and 

equine germplasm (semen and embryos), with the inevitable consequence of increasing the risk of global 

spread of various diseases. These include continued proliferation in the number of prestigious and lucrative 

racing and competition events, dual-hemisphere breeding of stallions, acceptance of artificial insemination by 

the vast majority of breed registries, and the growing popularity of embryo transfer in certain horse breeds. 

The objectives of this presentation are twofold: firstly, to increase awareness of what has been responsible 

for the unprecedented growth in international trade in equids and equine germplasm and the resultant 

enhanced risk of dissemination of certain diseases and secondly, to identify the major factors that can 

influence the geographic distribution of those diseases. 

Movement of equids has been confirmed as the single most important factor responsible for the spread of 

equine diseases. This has been borne out by the numerous times specific diseases have been introduced or 

re-introduced into countries or regions of the world through the importation of equids either incubating, 

acutely infected, or persistently infected with particular pathogens. The countries at greatest risk of such 

incursions are those with a significant import trade in equids and equine germplasm. Of the various modes 

of disease transmission, spread by the respiratory route is widely accepted as the most rapid and efficient 

means of dissemination of a pathogen. Spread of respiratory-borne diseases such as equine influenza, 

equine rhinopneumonitis and strangles between countries through international movement has been 

extensively documented. Equine influenza is the most important of these and the one that has resulted in 

widespread epidemics of disease in naïve or inadequately protected horses. Over the past 40 to 50 years, 

equine influenza virus has been responsible for a greater number of epidemics in equine populations 

worldwide than any other pathogen, some of which have had a highly significant economic impact on the 

affected country or countries. In individual instances, this has totaled many millions of dollars and caused 

major disruption, especially of the racing and performance sectors of the industry. Aside from short-term 

financial losses, the introduction of certain diseases into a country’s resident equine population can have a 

considerable and sometimes long-term effect on international trade. This is exemplified by the restrictions 

many countries impose on the importation of equids and equine germplasm from countries known to be 

affected with African horse sickness. 

Apart from international movement of equids and trade in equine germplasm, multi-national trade 

agreements, emergent diseases, mutation of recognized equine pathogens, climate-related phenomena, 

migration of amplifying/reservoir hosts or vectors of specific pathogens, availability of new vectors, vaccine 

contamination and agroterrorism, have all been shown to affect or have the potential to alter the global 

distribution of a wide range of equine infectious diseases. 

While historically, countries have responded to the threat of introduction of infectious diseases by formulating 

import controls that maximize disease exclusion measures, such overly restrictive policies are no longer 

tenable in today’s global economic climate. This is especially pertinent to the equine industry worldwide, the 

economic viability and success of which is critically dependant on the ability to ship horses within and 

between countries without excessive restrictions on movement. Import policies should be based on the 

principal control standards for preventing the international spread of equine diseases specified in the 

Terrestrial Animal Health Code of the OIE. In view of the risks inherent in international trade in horses and 

semen, countries need to ensure the adequacy of their post-entry disease containment and riskmanagement 

control measures. 

Disease surveillance and reporting at a national level and the timely exchange of accurate up-to-date 

information on specific disease outbreaks at an international level are critical to reducing the risks of global 

spread of the more important equine infectious diseases in the future. 

Timoney PJ: Factors influencing the international spread of equine diseases. Vet Clin N Am Equine Pract 16:536-551, 2000. 



EQUINE INFLUENZA: LEARNING LESSONS FROM OUTBREAKS 

J R Newton, Animal Health Trust, Lanwades Park, Newmarket, Suffolk, United Kingdom, CB8 7UU 

Among naïve horses equine influenza is a highly contagious respiratory disease which is characterized by 

pyrexia, associated depression and anorexia, harsh dry cough, nasal discharge and secondary bacterial 

respiratory infection. A novel H3N8 equine influenza A virus subtype, which first emerged in Miami, Florida in 

1963, initiated a worldwide pandemic of equine respiratory disease and was the stimulus for development of 

multivalent, adjuvanted influenza vaccines for horses. This early work, based on experience from human 

vaccines, led to development of the now broadly standardized schedules for equine influenza vaccination. 

These schedules recommend that a primary course of two doses of vaccines be given approximately four to 

six weeks apart, followed by a booster vaccination six months after the end of the primary course and annual 

boosters thereafter. The same schedules are still adopted today for the product datasheet recommendations 

for the latest vaccines and are the basis for the regulatory rules for most international equine competitions. 

It was recognized during several influenza outbreaks in the United Kingdom during the 1970’s especially in 

the 1979 outbreak, that vaccinated horses generally suffered less severe disease than those that were 

unvaccinated. Influenza vaccination of Thoroughbred racehorses in Great Britain became mandatory under 

the Jockey Club Rules of Racing at the start of the flat racing season in March 1981 and was implemented 

soon after in Ireland and France. Since 1981, British racing has not been cancelled because of equine 

influenza but there have been continued seasonal peaks of infection among unvaccinated non- 

Thoroughbred horses associated with increased mixing at shows in the summer months. Due to the absence 

of systematic, consistent and long term surveillance data it is not possible to provide absolutely conclusive 

evidence of the true impact of mandatory influenza vaccination on reducing the incidence of influenza virus 

infection and associated disease. However, it is the widely held belief of many that this is indeed the case 

and the markedly differing financial and welfare consequences of significant influenza outbreaks in 

Thoroughbreds in 2003 in Great Britain and South Africa in which mandatory vaccination was and was not 

respectively adopted, serve to highlight the benefits of vaccination in horses at risk of exposure to this highly 

contagious disease agent. The outbreaks in Japan and Australia in 2007 perhaps provide a similar contrast. 

With changes in equine H3N8 influenza A viruses due to antigenic drift, influenza outbreaks have, however, 

caused periodic disruption to the training schedules of vaccinated Thoroughbreds in individual yards or 

training centres in the UK, thereby bringing mandatory vaccination under periodic scrutiny. However, 

investigations of these largely clinically mild and geographically limited outbreaks have permitted closer 

assessment of factors associated with disease occurrence in vaccinated populations. Outbreaks of influenza 

virus infection among racehorses vaccinated according to Jockey Club Rules, were investigated in 

Newmarket in 1995 and 1998 to establish reasons for vaccine failure. Investigations showed that in 1995 

horses with antibody levels above a threshold equivalent to that observed in previous experimental challenge 

infections using nebulised aerosol, were protected from infection. Investigations in 1998 demonstrated no 

such protective threshold. Subsequent characterization showed that the 1998 H3N8 virus was antigenically 

distinct from the 1995 virus and those in available vaccines. These outbreaks highlighted the need for potent 

vaccines to maintain protective antibody and inclusion of epidemiologically relevant viral strains in vaccines. 

A more recent outbreak in racehorses in the UK in 2003 did, however, serve to confound some of the widely 

held beliefs regarding vaccine breakdown in young horses and again highlighted the benefits of detailed 

epidemiological and microbiological investigation. Between March and May 2003, equine influenza virus 

infection was confirmed as the cause of clinical respiratory disease among both vaccinated and nonvaccinated 

horses in at least 12 locations in the UK. In the largest outbreak, at least 21 training yards in 

Newmarket, comprising more than 1300 racehorses, were variously affected with horses showing signs of 

coughing and nasal discharge during a 9-week period. An American sub-lineage H3N8 equine influenza 

virus, previously not identified in the UK, was responsible for the outbreak. On the basis of accepted criteria 

there did not appear to be significant antigenic differences between the infecting virus and Newmarket/1/93, 

the American lineage virus representative in the most widely used vaccine, to explain the vaccine failure. 

Two-year-old horses were apparently less susceptible to infection than three-year-olds and older animals, 

despite broadly equivalent antibody levels. However, multivariable analyses comparing infected and noninfected 

animals showed that the apparently counter intuitive inverse age effect was explained by elements 

in the vaccine history of these animals. Among factors in the vaccine history associated with influenza 

infection, there was significantly increased risk of infection associated with male gender, and a period >3 

months since the last vaccination. There was a significantly reduced risk of infection associated with an 

increasing pre-infection antibody level and being first vaccinated after 6 months of age. There was also 

significant variation in risk according to the last type of vaccine administered. Findings highlight the benefits 

of relating vaccine history with risk of infection among vaccinated horses suffering influenza infection.


EQUINE INFLUENZA: THE AUSTRALIAN SITUATION 

Graeme Garner, Office of the Chief Veterinary Officer, Dept Agriculture, Fisheries and Forestry, Canberra, Australia 

Australia is currently experiencing a major outbreak of equine influenza. This presentation will review the 

epidemiology of the infection in Australia and the management of the outbreak. 

From 17 to 20 August, several horses in Eastern Creek Quarantine Station (ECQS) developed mild fever 

and some respiratory symptoms. Results of initial laboratory tests suggested the possibility of EI, which was 

supported by polymerase chain reaction (PCR) test results on 23 August. On 22 August, two horses at 

Centennial Park Equestrian Centre (CPEC) in the Sydney metropolitan area were noticed to be ill. Samples 

were taken and tested positive to EI by PCR on 24 August. The diagnosis of an exotic disease (EI) was 

confirmed by Australia’s Consultative Committee on Emergency Animal Disease (CCEAD) on 25 August. 

During the ensuing days a number of other horses in the CPEC facility became ill and cases were identified 

in a number of locations in NSW and at Warwick in Qld, many of them linked to a two-day horse event held 

near Maitland, over the weekend of 18–19 August. Both the Maitland event and CPEC were subsequently 

identified as key locations from which EI was disseminated to many sites in NSW and Qld. Although initially 

confined to the recreational sector, the infection soon spread to the racing sector with racing precincts in 

Sydney and Brisbane affected despite stringent biosecurity protocols being in place. 

In response to the finding of EI, Animal health authorities held an emergency meeting on 25 August and a 

range of actions were implemented in accordance with AUSVETPLAN, including declaration of Restricted 

and Control Areas around the infected premises (IPs), tracing of horse movements and establishment of a 

Local Disease Control Centre, State Disease Control Headquarters and a National Disease Control Centre in 

Canberra. All horse racing was cancelled in NSW and Qld and a national 72-hour movement standstill on 

horses instituted. Governments and industry agreed to implementation of cost sharing under Australia’s 

Emergency Animal Disease Response Agreement. An extensive public awareness and communications 

program was undertaken and contingency arrangements for the supply and registration of vaccines for 

emergency use commenced. 

In the next few weeks EI was confirmed in horses at a range of locations in NSW and Qld and there was a 

rapid increase in the areas affected. On 17 September, there was national agreement to the use of 

vaccination to assist containment and revised NSW and QLD response plans to establish buffer zones 

based on natural barriers, horse-free areas and vaccination were endorsed. Subsequently, wider user of 

vaccination for mitigation of impact in infected areas and for business risk mitigation in infected and noninfected 

areas, was approved. The only vaccine being used is the canary pox recombinant vaccine as it 

rapidly induces immunity and enables DIVA methods to be used. It has been recognised that use of other 

vaccines will significantly compromise the ability to demonstrate freedom from EI infection. 

By 22 October, EI had been reported on more than 6000 premises (4919 in NSW and 1384 in Qld). Despite 

a substantial increase in the number of IPs, infection has largely remained contained, with relatively little 

increase in the number of clusters of infection and the total area affected, especially since 30 August. 

Although the disease has continued to spread most of this has been in-filling of already infected areas, 

associated with ‘local spread’. The outbreak has had a major impact on both the racing and recreational 

horse sectors. 

The national goal has been, and remains, to eliminate the disease. The agreed process is to progressively 

eliminate infection within declared areas whilst protecting non-infected areas. A range of strategies are being 

used to reduce disease transmission and to alleviate the financial and social cost of the outbreak by 

facilitating return to some normal activities. These include: 

1. Multiple barriers to spread, including biosecurity measures in infected areas, zoning and vaccination 

buffers, movement restrictions between States and awareness/biosecurity in non-infected 

jurisdictions. 

2. Strategic vaccination in infected areas. 

3. Risk-based approach to movements, with progressive freeing up of movements within defined 

infected areas, authorisation for the aggregation of horses and development of protocols and 

timelines with industry to restore normal business operations. 

4. Risk-based movements between areas and jurisdictions, movement between non-infected 

jurisdictions, development of protocols for movement between zones in infected jurisdictions and 

protocols for movement from infected to non-infected jurisdictions. 

5. Strategic vaccination in non-infected areas as a business risk insurance. 




DIAGNOSIS AND CHARACTERIZATION OF EQUINE INFLUENZA (EI) IN AUSTRALIA: 

A/EQUINE/SYDNEY/2888-8/2007 H3N8 

Peter Daniels and all Staff, CSIRO Australian Animal Health Laboratory, Geelong, Australia 

The index case of equine influenza (EI) in Australia in 2007, at the AQIS Eastern Creek Quarantine Station, 

Sydney, New South Wales (NSW), was confirmed on the 22 August, followed quickly by diagnosis of 

infected horses at Centennial Park in metropolitan Sydney. The emergency response in NSW to EI 

commenced 24 August with declaration of a Control Area which prohibited movement of horses, horse 

products, fittings and vehicles except under permit. Shortly after this, the disease was confirmed in southern 

Queensland, where it had already been moved in infected horses. Through the rapid application of 

movement restrictions, linked to a range of other control measures, the disease has been restricted to NSW 

and Queensland. The objective has been containment leading to eradication. 

In an outbreak of an exotic disease in Australia the initial diagnosis, isolation and characterisation of the 

agent are undertaken by the Australian Animal Health Laboratory (AAHL). In its role as the national 

reference laboratory for foreign animal diseases, AAHL has transferred diagnostic tests for some of the main 

transboundary animal diseases to the network of State Laboratories around the country. This is particularly 

the case with newer technologies such as real time PCR (qPCR). A test for influenza A viruses developed in 

support of avian influenza preparedness and targeting the matrix gene has proved particularly useful in the 

current outbreak. 

Whilst the initial confirmatory diagnosis at the Eastern Creek Quarantine Station was made at AAHL, the 

provisional diagnosis at Centennial Park was made at the NSW State Veterinary Laboratories at EMAI, using 

the influenza A qPCR test developed at AAHL. Samples were submitted to AAHL for confirmation, but 

action in terms of a standstill on horse movement was made on the basis of these initial qPCR results. Much 

of the rapid testing following identification of suspect premises has been conducted in the State Laboratories 

using the same qPCR assay. Confirmatory testing is done at AAHL, particularly in cases of epidemiologically 

significant cases outside the current restricted (infected) area. 

At AAHL the qPCR for influenza A is used as a rapid test and is backed up by conventional PCR which 

detects a segment of the EI H3N8 haemagglutinin gene. This confirms the H type of the agent and sequence 

analysis allows preliminary assessment of the lineage of the strain. Samples are processed for virus isolation 

in either embryonated chicken eggs or MDCK cells. Several isolates of the outbreak virus have been made, 

from the main epidemiologically significant infected properties in NSW and Qld. Sequence analysis shows it 

to be closely aligned with A/Equine/Wisconsin/1/2003. 

Serology has been used as an integral part of diagnosis and management of the outbreak. A 

haemagglutination inhibition (HI) test is available and detected a seroconversion in the horses at the Eastern 

Creek Quarantine Station. A C-ELISA detecting antibodies to influenza A nucleoprotein (NP) had been 

validated in Australia for avian influenza antibody detection. AAHL rapidly undertook an exercise to validate 

this test for EI. Standard reagents have been prepared for distribution to State laboratories for routine use. 

The C-ELISA will allow differentiation of infected from vaccinated animals since the vaccine chosen for use 

in the control program is the canarypox vectored vaccine that does not induce antibodies to NP. 

Apart from providing confirmatory testing for suspect and new infected premises, a significant effort at AAHL 

has gone into generating and analysing data for further test validation, for both the q PCR and the C-ELISA. 

These tests were validated for avian influenza and so dossiers for assessment of performance 

characteristics of the tests with equine samples have been prepared. 

AAHL has also conducted experimental reproduction of the disease using clinical material from Sydney. 

Infected animals showed clinical signs two days post exposure, and were sampled to allow further 

assessment of agent detection tests such as the PCR tests and virus isolation.


EQUINE INFLUENZA IN AUSTRALIA – A HIGH THROUGHPUT LABORATORY RESPONSE: 

ACHIEVEMENTS AND CHALLENGES. 

PD Kirkland* 1 , 


On 24 August 2007, the Chief Veterinary Officer of New South Wales was advised of clinical signs that were 

consistent with influenza in horses in a large equestrian centre. Over the next 2 days, a multi-focal outbreak 

was identified on properties scattered over a 700 km range extending from the Sydney region through the 

Central Coast and Hunter Valley regions and north along the NSW northern tablelands and slopes into 

southern Queensland. The Virology Laboratory at EMAI provided the laboratory support for NSW during this 

outbreak with confirmatory testing of selected samples at the Australian Animal Health Laboratory (AAHL) at 

Geelong, Victoria. 

Nasal swabs collected into viral transport medium and clotted blood were submitted to the laboratory for the 

confirmation of influenza virus infection in horses with suggestive clinical signs or from those that had had 

possible contact with clinical cases. Samples were also collected from horses during surveillance in buffer 

zones at the time of vaccination and for movement testing once the initial standstill/movement restrictions 

were eased. Influenza A group reactive assays previously developed at AAHL were used for both the 

detection of viral RNA and antibodies to the virus. The viral transport medium was tested in an Influenza A 

group reactive real time reverse transcriptase PCR (qPCR) assay to detect a sequence of the matrix gene 

while serum samples were tested in an Influenza A group reactive blocking ELISA (bELISA) and in a 

haemagglutination inhibition (HI) assay to detect antibodies specific to the H3 subtype. 

The qPCR assay had been established as a broadly reactive test for influenza viruses in birds but had not 

been applied to testing of equine samples. Similarly, the bELISA had not been validated for testing of horse 

sera. Nevertheless, these assays were successfully applied to testing of equine samples with parallel testing 

taking place to support validation of the assays. The existing high throughput PCR capability in the EMAI 

Virology Laboratory was further refined during this rapidly evolving outbreak in response to variable but 

increasing workloads driven by a rapidly changing field situation. The test procedures were streamlined to 

minimise repetitive tasks and maximise reproducibility from day to day. The system being employed is based 

on a 96 well plate format utilising magnetic bead based total nucleic acid extraction chemistry (MagMAx 

Viral, Ambion) in conjunction with a magnetic particle processing system (Kingfisher 96, Thermo). The qPCR 

chemistry consisted of a complete master-mix to which the primers and probe had been previously been 

added. The only component added at the time of set-up of the assay was the enzyme mix and the sample 

RNA. Assays were run on either an ABI 7500 Fast or an ABI 7900HT Fast thermocycler, both run in standard 

mode. This combination of RNA extraction and qPCR equipment allowed a throughput of more than 1,000 

samples per day and a “turn-around” time of about 3 hours for a batch of samples. Urgent samples could be 

completed in about 2 hours. Over the first 2 months of the outbreak the assay system has proven to have 

extremely high sensitivity and specificity, combined with ‘same day’ completion of testing. 

While sample test procedures were streamlined and a large number of samples could be tested with a 

relatively small number of staff, numerous challenges arose in other areas. These rarely involved complex 

technical issues and usually were associated with the timely delivery and receipt of specimens. Due to the 

diverse nature of the horse industry, there were many small properties and hence individual laboratory 

accessions, resulting in an extremely heavy workload and delays in specimen receival and cataloguing. 

From time to time, delays in specimen delivery also caused frustration. Similarly, sub-optimally collected or 

packaged specimens had a major impact on throughput, sometimes doubling the number of specimens to be 

handled and resulting in significant additional processing in the laboratory. Availability of consumables for 

specimen collection (eg swabs and sample vials) often caused problems and the high throughput placed the 

manufacturers of PCR reagents under pressure on occasions. 

While the need for a sustained output placed demands on staff, additional pressure arose when investigating 

sites with a high public profile (eg thoroughbred racing stables) due to the intense media interest. At times 

there was public monitoring of progress with specimen receival and anticipated times for release of results. 

At the scientific level, the application of new assays also raised other questions. In particular, the application 

of qPCR and the inevitable detection of residual virus and RNA at times longer than previously described 

generated concern when a property was due for release from quarantine. Finally, the detection of infection in 

dogs, questions about the role that birds might play and the potential for human infections all added extra 

dimensions to providing laboratory support for this outbreak. And, of course, the test needs for the influenza 

outbreak have been fully met on a daily basis in a virology laboratory that routinely has a high workload 

which has been maintained throughout this outbreak 




11 - 14 November 2007 

Tuesday 13 November

Tues 13 November 


0830 - 1645 OIE Biotechnology Symposium 

OIE BIOTECHNOLOGY SYMPOSIUM: INTRODUCTORY REMARKS 

Steven Edwards, President of the OIE Biological Standards Commission 

The OIE (World Organisation for Animal Health) was established in 1924 in order to facilitate an 

internationally harmonised approach to animal disease control and reporting, particularly for transboundary 

diseases. Since then the organisation has expanded both its remit and its membership to include all 

countries with a significant livestock sector (current 170 Member Countries). The OIE is an 

intergovernmental organisation in its own right, with responsibility for improving animal health worldwide. 

The key missions of the OIE are: 

• To ensure transparency on animal diseases and zoonoses 

• To collect, analyse and disseminate veterinary scientific information 

• To provide expertise and encourage international solidarity on animal disease control 

• To publish animal health standards for international trade in animals and their products 

(this underpins OIE’s official mandate under the sanitary and phytosanitary agreement of the WTO) 

• To improve the legal framework and resources of national veterinary services 

• To promote safety for foods of animal origin and to promote science-based animal welfare 

As part of its science-based approach the OIE has a long tradition of developing standards for laboratory 

procedures used in animal disease diagnosis. The responsible bodies for this activity within OIE are the 

Biological Standards Commission (dealing with terrestrial animal diseases) and the Aquatic Animal Health 

Standards Commission. Among their other activities, these two commissions advise the OIE on the 

designation of Reference Laboratories for specified diseases, and produce laboratory manuals giving details 

of recognised and validated diagnostic tests. 

These commissions are supported by a variety of working and ad hoc groups, including the Biotechnology 

Ad hoc Group. It has been a tradition for some years now for the OIE to sponsor and organise a one day 

Biotechnology Symposium within the International Symposia of the WAVLD. This gives the opportunity for 

OIE to bring to the diagnosticians’ community a persective on emerging technologies with a potential for 

future application in laboratory-based diagnosis. Some of these are novel developments within established 

methodologies, while others present totally new approaches. Some are “near market” in that they are already 

or soon will be appearing in the armoury of tests offered by diagnostic laboratories. Others remain 

speculative and of uncertain potential, but we certainly should not ignore the developments happening in the 

research community. 

It is my pleasure to introduce the 2007 OIE Biotechnology Symposium, and I hope you find the presenations 

stimulating and informative. 

Introduction: 


Simple rapid, on-site detection for diagnosis of animal disease 

K.N. Lee, Y. J. Lee, J. W. Kim, J. H. Park, J. G. Choi, Y. J. Kim, 1 J. S. Oh, 2 C. H. Kim, Y. S. Joo 

National Veterinary Research and Quarantine Service, Anyang, Korea, 

1 Animal Genetics, Inc., Suwon, Korea, 

2 Princeton BioMeditech Cooperation, NJ, USA 

An immunochromatographic assay is a representative pen-side test relevant to simple, rapid and on-site 

detection of etiological agents or antibodies in economically important animal diseases[1]. We developed six 

rapid tests using this principle for the diagnosis of foot-and-mouth disease(FMD), avian influenza(AI) and 

canine and bovine Brucellosis. 

Material & methods: 

Two different combinatorial monoclonal antibody pairs, targeting structural protein(SP) and non-structural 

protein(NSP) of FMDV respectively, were selected and used as key components for the FMD antigen kit. 

Recombinant proteins of 2C and 3ABC of serotype O FMDV were used as captured antigens for detecting 

FMDV antibodies in the sera of infected animals. For AI, type A(H1~H16) or subtype(H5) specific monoclonal 

antibodies were selected and used respectively for two different pen-side tests to detect viral antigens. For 

the serodiagnosis of bovine and canine Brucellosis, the purified antigen containing lipopolysaccharide of B. 

canis or B. abortus origin was used as a capture probe for the respective pen-side test. 

Results: 

The FMD antigen kit could detect viral antigens of four serotype(O, A, Asia 1, C) on SP detection line in 

epithelial samples, and the FMD antibody kit showed diagnostic sensitivity comparable to conventional 3ABC 

ELISA and could differentiate the infected from the vaccinated. H5 HA antigen was detected specifically with 

subtype(H5) specific pen-side kit, while type A specific kit detected all subtypes of type A virus in avian 

cloaca swab or feces with the detection limit of 10 5.6 EID50/ 0.1ml approximately. In case of Brucellosis 

antibody kits, they showed accuracies comparable to or higher than other conventional serological or 

bacteriological tests. 


The rapid and self-performing immunochromatographic assay has been established for the routine diagnosis 

of many viral or bacterial diseases worldwide. These tools have a potential to play important role in rapid 

confirmation of infection on infected farms or in the laboratory in case of epidemic. During the recent 

outbreaks of FMD or AI by a pandemic strain or a highly pathogenic virus in chicken, the development and 

use of these pen-side tests enabled the early diagnosis and prompt stamping out of infected farms, which is 

regarded as the key factor in limiting the number of cases. 

References : 

[1]Reid SM, Ferris NP, Bruning A, Hutchings GH, Kowalska Z, Akerblom L. Development of a rapid 

chromatographic strip test for the pen-side detection of foot-and-mouth disease virus antigen. Journal of 

virological methods 2001 Aug;96(2):189-202. 

Tues 13 November



APPLICATION OF BIOTECHNOLOGY TO INFECTIONS WITHIN WILDLIFE HOSTS 

D J Middleton 

CSIRO Australian Animal Health Laboratory, PB24 Geelong 3220 

“Wildlife enters the frame” 

Wildlife health is complicated and essentially unexplored, while intervention strategies are even less clear. 

This is the case even for infectious diseases that affect wildlife hosts although they are of special 

significance for diverse reasons. Firstly, their control is necessary for the protection of human health: of the 

1415 recognised human pathogens, 61% are zoonotic and wildlife is often a link in the chain of emergence. 

Secondly, wildlife pathogens influence domestic animal health and by association the human food supply, 

with spillover of known emergency animal diseases providing particular political, conservation and 

commercial challenges. Thirdly, they may be the sign of a stressed ecosystem and represent a risk to 

biodiversity, especially where keystone species such as a top predator are affected leading, for example, to 

a population explosion of herbivores and overexploitation of plants. Ultimately, the casualties of this process 

will be loss of ecosystem services such as tourism and “existence value”. Climate change, with the potential 

for emergence of new diseases as well as changed wildlife and vector competencies and distribution, 

generates additional levels of complexity. Finally, infectious disease control is essential across the broader 

national canvas to safeguard trade, the wider economy and for national security. 

Deployment of late 20 th C to 21 st C biotechnology is essential for the purpose of enhancing the assessment 

and management of infectious disease threats in wildlife. Specific applications include the discovery of 

elusive wildlife reservoirs using high sensitivity, high throughput testing systems, such as those employed in 

the discovery of fruit bats as the reservoir of Ebola virus. Contemporary biotechnology also has enabled 

incidence and prevalence studies, on which epidemiologic data effective disease management relies, to be 

carried out in reservoir animals, including surveillance and diagnosis for serious zoonotic diseases such as 

Nipah virus infections in Pteropus lylei where Biosafety Level 3 and 4 laboratories are not available. Modern 

technologies have contributed greatly to our understanding of the mechanism of host-switching by 

pathogens and post-spillover host adaptation, most notably for viral agents such as SARS-CoV from 

Rhinolophus spp. to civet cats to people, but also for bacteria including M.bovis in badgers to cattle to 

people. They will increasingly be employed in pathogenesis research of intra-reservoir transmission to 

provide decision support tools for preventing spillover to humans or livestock through discovery of novel 

targets for diagnosis or control. In particular, new whole genome sequencing technologies will lead to rapid 

sequencing of novel emerging microorganisms. Optimisation of in silico design of detection tests or 

countermeasures will depend upon the availability of accurate genomic surveys of the natural microbiota 

within the reservoirs from which they have emerged. Although currently limited, primarily due to lack of 

definition of critical intervention points, there are also examples of biotechnology applications to disease 

control in wildlife. The most notable of these is the live recombinant oral rabies vaccine targeting wild 

carnivores that has been used extensively and effectively in both Europe and the United States. 

There is developing acceptance within certain governments of a level of responsibility for the identification 

and management of risks from wildlife to human and livestock health as well as on wildlife populations, 

although it is less clear who should share ownership of this. Also unclear is the optimum mechanism for 

robust collection, amalgamation, and assessment of surveillance data. The notion that detection of an 

unusual event may be the first sign of a major epidemic should always be towards the front of our minds. It is 

almost certain that modern laboratory methods will play a central role in characterization, assessment and 

management of the next such event. 

One world, one health, one medicine 

Introduction 


THE OIE CONCEPT OF TWINNING BETWEEN LABORATORIES 

G.K. Brückner, World Organisation for Animal Health (OIE) 

The OIE acknowledge that the most effective way to effectively detect, diagnose, control and respond to 

animal disease and zoonotic incursions, is to ensure good veterinary governance in Member Countries and 

by assisting and enabling them to move towards compliance with the international standards of the OIE. 

The OIE has in response to this need secured substantial donor support to embark on a unique strategic 

initiative for the assessment and evaluation of the veterinary services of developing and transitional countries 

by identifying weaknesses in their system that hinders compliance, prevent the early detection and diagnosis 

of diseases and limiting access to expertise to provide scientific justification for certification of animals and 

animal products for trade. 

A critical prerequisite in achieving this ideal would also be to facilitate and encourage a more even global 

geographical spread and access to available scientific expertise and veterinary diagnostics. 

Discussion 

There are currently 170 OIE Reference Laboratories in 30 countries with 146 designated experts covering 93 

diseases. The total number of OIE Collaborating Centres is 24 in 14 countries covering 22 functional aspects 

related to diseases and OIE activities. More than 70% of the 170 Member Countries of the OIE are from 

developing countries whilst the majority of OIE Reference Laboratories and Collaborating Centres are 

clustered within developed countries within the northern hemisphere. During the First International 

Conference for OIE Reference Laboratories and Collaborating Centres held in Florianopolis, Brazil in 

December 2006, delegates unanimously supported a recommendation to establish closer relationships 

between OIE Reference Laboratories and Collaborating Centres and candidate laboratories in developing 

and transitional countries. The main thrust would be to encourage a more even global geographical spread 

of diagnostic expertise and by that, giving developing and transitional countries more ready access to 

scientific expertise enable them to become scientifically competent and to debate on equal footing on the 

scientific justification of standards. 

To enhance this request for a closer relationship between OIE Reference Laboratories and laboratories such 

as national laboratories with a potential of eventually becoming a Reference Laboratory on their own, the 

concept of twinning between laboratories was initiated. The main objective of twinning is to assist 

laboratories in developing or in-transition countries to build their capacity and scientific expertise with the 

eventual aim that some of them could become OIE Reference Laboratories in their own right. To practically 

apply this concept, a link between an existing OIE Reference Laboratory with another laboratory in a 

developing or in- transition country must be established in a medium to long-term relationship for exchange 

of scientific expertise and capacity building. Taking into consideration the current geographical spread and 

actual localities of OIE Reference Laboratories and Collaborating Centres, the twinning concept could imply 

a transfer of knowledge, training and expertise from the ‘North’ to the ‘South’ or from an existing OIE 

Reference Laboratory or Collaborating Centre of the South to another less advanced laboratory in the South 

applying for such assistance. 

References 

1. OIE, Performance, Vision and Strategy: A tool for governance of Veterinary Services, OIE 2007 

(World Organisation for Animal Health), 12, rue de Prony, 75017, Paris, France. 

2. E. Erlacher-Vindel, G.K. Brückner, B. Vallat. The OIE Concept of Laboratory Twinning in 

Lombard M, Dodet B (eds): First International Conference of the OIE Reference Laboratories 

and Collaborating Centres. Dev Biol (basel). Basel, Karger, 2007, vol 128, pp 115-119. 

Tues 13 November



DIAGNOSTICS OF EMERGING INFECTIOUS DISEASES BY MICROARRAY. 

R. W. Barrette, S. A. Metwally, and M. T. McIntosh* 

Foreign Animal Disease Diagnostic Laboratory, Animal and Plant Health Inspection Services, United States Department of Agriculture, 

Plum Island Animal Disease Center, P.O. Box 848, Greenport, NY 11944, USA. 

Introduction 

Foreign animal and emerging infectious diseases represent threats to public and animal health and present a 

significant challenge to the diagnosis of disease. A classical diagnostic approach is to assess 

epidemiological findings to limit the differential list of suspect diseases and then run specific diagnostic tests 

for those pathogens. Such an approach relies heavily on previously identified disease manifestations and 

antigenic or genetic properties of known pathogens. In emerging diseases, pathogens have diverged 

significantly from known agents such that they may manifest different pathologies and/or may no longer be 

recognized by antigen detection assays, PCR primers, or serological tests. This is likewise true for foreign 

animal disease pathogens which may not be recognized by traditional methods used to detect domestic 

strains. While such instances are rare, they are quite confounding, and there exists a need for broader 

methods of detection in order to identify divergent or emerging pathogens. To aid in such complex animal 

disease investigations, we have designed pan-viral DNA microarrays capable of detecting emerging viruses 

and foreign animal disease viruses. 


A multi-tiered bioinformatics search of the more than 540,000 viral nucleotide sequences present in 

GenBank was used to design a comprehensive pan-viral microarray consisting of approximately 12,000 

different virus family, genus or species specific oligonucleotide features. The pan-viral microarray (FADDL 

PanVira4) was then commercially synthesized by Combimatrix Co. or Agilent Technologies Inc. A variety of 

samples infected with known or unknown viral agents were randomly amplified by RT-PCR, indirectly 

labelled with Cy3 and Cy5 dyes and microarrays were hybridized using modifications to previously described 

methods (Wang et al., 2002). Microarrays were scanned and results recorded using a GenPix 4200AL 

scanner and GenPix Pro software. 

Results 

Probing of microarrays with randomly amplified cDNA from infected (Cy5 labelled) and uninfected (Cy3 

labelled) samples revealed differential hybridization patterns as seen in the simulated scatter plot (Fig. 1). 

Using a simple analysis, preliminary identification of the infecting agent could often be achieved by checking 

the identity of the features that differentially hybridized to the Cy5 or “infected sample” (Fig. 1 List of Selected 

Identities). For example, Figure 1 lists some of the selected 

identities of hybridized features from a vesicular case of unknown 

etiology used to probe FADDL PanVira1. Using a more 

complex analysis that compares the theoretical or expected 

hybridization pattern for each candidate viral genome to the 

observed hybridization pattern, we were able to accurately 

discriminate between closely related species of foot-and-mouth 

disease virus using a FMDV array. More than 5,000 viral taxaspecific 

domains were identified in the design of FADDL 

PanVira4 which consisted of 12,000 different olignoucleotide 

features theoretically capable of detecting all animal, human, 

avian, and marine viruses with sequence representation 

in GenBank. 

Cy5 Infected Fluorescence 

Selected Identities 

Bovine viral diarrhea virus 2 




Border disease virus 

Bovine viral diarrhea virus 



Ovine pestivirus 





Cy3 Uninfected Fluorescence 

Discussions and conclusions 

Genomic approaches to pathogen detection represent a powerful new trend in diagnostics and broadspecificity 

techniques such as microarrays have the potential to significantly simplify otherwise complex and 

lengthy diagnostic analyses. These methods have the further potential to aid in discovery of previously 

unknown pathogens, identify contaminating or endogenous viruses in vaccines and cell lines, and when 

applied to a specific genus, can be valuable tools for rapid genotyping. 

References 

Wang D, Coscoy L, Zylberberg M, Avila PC, Boushey HA, et al. (2002) Microarray-based detection and genotyping of viral pathogens. Proc Natl 

Acad Sci USA 99: 15687–15692. 


DEVELOPMENT OF LOOP-MEDIATED ISOTHERMAL AMPLIFICATION (LAMP) TECHNIQUE FOR 

DIAGNOSIS OF AFRICAN TRYPANOSOMOSIS 

N. Inoue and O. M. M. Thekisoe 

National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Obihiro, Hokkaido 080- 

8555, Japan 

Introduction 

The low levels of parasitemia usually hamper parasitological diagnosis of trypanosomes in humans or 

animals. Although antibody detection tests are useful for screening purposes, they do not distinguish 

between past and present infections, and the current reliability of antigen detection tests is limited. 

Polymerase Chain Reaction (PCR) has developed as one of the most specific and sensitive molecular 

methods for diagnosis of infectious diseases and has been widely applied for detection of pathogenic 

microorganisms. However, in spite of the excellent specificity and sensitivity, these molecular biology 

techniques are not commonly used in the diagnosis of trypanosomosis in countries lacking resources where 

the disease is endemic. This is due to lack of skilled personnel and expensive automated thermal cyclers for 

PCR that are not easily available in these countries. Loop-mediated isothermal amplification (LAMP) is a 

new DNA amplification method that is performed under isothermal conditions. This unique characteristic of 

LAMP allows us to use simple and inexpensive heating device for incubating LAMP reaction mixture. In 

addition, LAMP is a rapid and simple technique since it can be carried out within 30 min. Therefore, LAMP 

has great potential of being used for diagnosis of trypanosomosis in the laboratory and the field, especially in 

countries that lack sufficient resources needed for application of molecular diagnostic techniques. To further 

enhance specific trypanosome detection by LAMP, the current study aimed at developing LAMP for 

specifically detecting African trypanosome species and sub-species including T. brucei gambiense, T. b. 

rhodesiense, T. congolense, and T. evansi. 


The LAMP primer sets were designed from 18S rRNA gene for T. congolense, the TgsGP gene for T. b. 

gambiense, SRA gene for T. b. rhodesiense, and VSG RoTat1.2 gene for T. evansi. All the primer 

sequences were designed using the software program Primer Explorer V4 (Fujitsu, Japan). LAMP reaction 

was conducted such that each reaction mixture (25 μl total volume) contained 12.5 μl of the reaction buffer 

(40 mM Tris-HCl (pH 8.8), 20 mM KCl, 16 mM MgSO4, 20 mM (NH4)2SO4, 0.2% Tween 20, 1.6 M Betaine, 

2.8 mM of each dNTP), 1 μl (8 units) of Bst DNA polymerase, 0.9 μl primer mix with FIP and BIP at 40 pmol 

each and F3 and B3 at 5 pmol each), 2 μl of template DNA and 8.6 μl of distilled water. 

Results 

The LAMP primer sets for T. b. gambiense, T. b. rhodesiense, T. congolense, and T. evansi were tested for 

their species specificity, and they showed high specificity. The genomic DNA of T. b. gambiense, T. b. 

rhodesiense, T. congolense, and T. evansi was quantified from 100 ng down to 1 fg by serial dilution and 

used to assess the sensitivity of the LAMP primers. The primers showed high sensitivity while detecting 

trypanosome DNA range from 1 fg to 1 pg. A volume of 10 pg of DNA represents approximately 100 

trypanosomes, implying that 1 fg is equivalent to 0.01 trypanosome. 


LAMP primer sets developed in this study are highly sensitive, and are capable of detecting as little as 100 fg 

to 1 pg of trypanosomal DNA, which is equivalent to 1 to 10 trypanosomes. Although our LAMP system 

should be further improved and standardized for field application, we will discuss possibility and rationale of 

LAMP as a field molecular diagnostic technique. 

References 

Thekisoe, O. M. M. et al. (2007) Acta Tropica, 102: 182-189. 

Kuboki, N. et al. (2003) J. Clin. Microbiol., 41: 5517-5524. 

Tues 13 November



DIAGNOSTIC ELECTRON MICROSCOPY: Historical review and future. 

Alex D. Hyatt BSc(Hons), DipEd, PhD. 

Senior Principal Research Scientist, Projec Leader. 

President Australian Microscopy and Microanalysis Society (AMMS). 

CSIRO, Livestock Industries, Australian Animal Health Laboratory, 5 Portarlington Road, Geelong Vic 3220. 

Email: alex.hyatt@csiro.au 

Historical perspective. 

Electron microscopy (EM) emerged in the mid 1930s and the ability to magnify images far beyond that of the 

light microscope with improved resolution made this instrument popular amongst virologists who were 

working in an exciting era of virus discovery and characterization. The ability to observe the actual size and 

shape of these filterable and previously invisible agents together with the development of specialized 

techniques (e.g. negative contrast staining, the preparation of ultrathin sections from infected tissues and the 

use of antibodies) led to the development of new criteria for virus classification (Tyrrell and Almeida, 1967). 

Development of specialized techniques. Ultramicrotomy evolved from the histological microtome in the late 

1930s. Advances came in the 1950s and from there thermal- and mechanical-advance, in addition to 

automated instruments, appeared. Today ultramicrotomes offer reliability in terms of routinely cutting ultrathin 

sections (refer to Dykstra and Reuss, 1992). These instruments were used together with classical techniques 

such as negative contrast electron microscopy (Brenner and Horne, 1959) to identify, differentiate and 

ultrastructurally characterize viruses and their morphogenesis (Biel and Gelderblom, 1999). 

Identification of new viruses. During the early years the use of known antibodies were also introduced to 

specifically identify infectious agents (e.g. Anderson and Stanely, 1941). The early techniques involved the 

forming of antibody mediated clumps, virus decoration and then progressed to the use of ferritin and gold 

probes to confirm the presence of antibodies. As per other techniques immuno-electron microscopy has 

evolved further to become a critical tool in virus identification, study of virus morphogenesis and 

pathogenesis of specific diseases. 

Current applications 

The classical techniques (refer above) continue to be used in major international diagnostic laboratories. 

They are still used to quickly differentiate between putative viruses responsible for diseases where vesicular 

fluids are present and to identify new viruses that are emerging into our modern society. Of the latter, in 

Australia and South East Asia viruses such as Hendra virus, Nipah virus, bat lyssavirus, Menangle virus, 

Pulau virus, Melaka virus, Tioman virus, Pilchard herpesvirus and a range of yet unclassified arboviruses 

(e.g. orbiviruses, bunyaviruses and rhabdoviruses) have been identified by transmission electron 

microscopy. The above viruses are of varying importance to human, veterinary, aquatic and wildlife health 

and arguably until comprehensive viral identification arrays are developed and used routinely and easily (i.e. 

user friendly) in major laboratories, EM will continue to be a front-line diagnostic tool. 

Future applications 

It is apparent that diagnostic electron microscopy, when used in accordance with associated quality 

assurance programs, is an important tool in the rapid and accurate identification of viruses, particularly those 

which have not been previously identified and associated reagents generated. It is also apparent that skill 

bases and academic knowledge in this important area of diagnostics is declining. There is therefore a critical 

need to form national and international networks whereby these resources and databases can co-exist in 

real time. Activities into forming these networks have begun. 

References 

Anderson TF and Stanley WM. J. Biol. Chem. 139:339-44. 

Tyrrell DAJ and Almeida J, 1967. Arch Gesamte Virusforsch.;22(3):417-25 

Dykstra and Reuss, 1992. Biological electron microscopy : theory, techniques, and troubleshooting (Plenum Press) 

Brenner S and Horne RW. 1959. Biochim Biophys Acta. Jul;34:103-10. 

Biel SS and Gelderblom HR. 1999. J Clin Virol. Jun;13(1-2):105-19. Review. 


OVERVIEW OF ELECTRON MICROSCOPY AND ITS ROLE IN INFECTIOUS DISEASE DIAGNOSIS 

Norbert Bannert, Centre for Biological Security 4, Robert Koch Institute, Berlin, Germany 

Michael Laue, Centre for Biological Security 4, Robert Koch Institute, Berlin, Germany 

Introduction 

Electron microscopy (EM) is well suited to directly visualize virus particles at high magnification. The first 

images showing the size and morphology of viruses were published in the late 1930s (von Borries et al. 

1938). In the following decades EM was used to characterize a variety of viruses at the ultrastructural level 

and for routine diagnosis of human and non-human viruses. The introduction of the negative staining method 

in 1959 increased the diagnostic speed and throughput of the application. Today routine diagnostic EM is 

predominantly used in cases of suspected skin associated viral infections and viral gastroenteritis. The open 

view and the fact that no sequence or protein information are require for a diagnosis, makes the method 

indispensable in emergent situation where the etiologic agent is difficult to identify with standard methods or 

a new infectious agent appears. EM has also been adopted in many countries as a front line method in the 

examination of samples from suspected bioterroristic (BT) attacks with relevant viral and bacterial 

pathogens. With improved negative staining protocols and rapid embedding techniques, the impact of EM in 

the diagnostic arsenal increased significantly. Moreover, EM is still an attractive tool in viral research. In our 

laboratory it is applied for the characterization of ancient human endogenous retroviral particles (HERV) and 

the recently identified Koala Retrovirus (KoRV). 

Material and Methods 

Before regular negative staining EM, all samples are inactivated with 2% paraformaldehyde. BT-suspected 

samples are treated with 10% paraformaldehyde, 0.05% glutaraldehyde in 0.05 M Hepes buffer (pH 7.2) for 

2 hours in a BSL3 laboratory, to inactivate potentially present bacterial spores. Hydrophilic carbon reinforced 

support grids are placed on top of a drop with the agent containing suspension to allow adhesion of particles. 

Following short washing steps in deionised water, the particles on the grid are stained with uranyl acetate or 

related solutions of heavy metal salts. Following this simple contrasting method, the grids can be inspected 

in the EM. For rapid embedding, a microwave-assisted chemical fixation followed by LR White embedding 

has been developed (Laue et al. 2007). Cell lines producing retroviral particles are processed using 

conventional fixation and epon embedding protocols. 

Results 

EM can be used for rapid identification of causative agents of infectious diseases in humans and animals. 

Although the routine screening application of EM decreased in recent years in many laboratories, its value 

for the inspection of new or emerging zoonotic diseases did increase. This was very well demonstrated in 

critical diagnostic situations including the SARS epidemics and cases of monkeypox virus in the USA when 

diagnostic EM gave the first indications of the causative virus (Ksiasek et al. 2003). 

Regarding the diagnosis of bacterial spores and other pathogens in BT-suspected samples, the development 

and introduction of rapid embedding techniques and immuno EM complement the quick and simple negative 

staining techniques. It increases the reliability and specificity of the diagnosis by providing ultrastructural 

information and allows differentiation of morphologically identical pathogens with specific antibodies for 

internal antigens. 

Besides diagnostic applications, electron microscopy is indispensable in ongoing own research projects 

including those investigating aspects of the recently described endogenous Koala Retrovirus (KoRV) and 

related retroviruses. KoRV has been identified by EM in specimens from Koala bears suffering from 

lymphomas and leukaemia. Analogous to human endogenous Retroviruses it is suspected to play a role in 

the induction or progression of malignancies. Recently we have shown that it is able to infect human cells. 

Discussion 

Based on its inherent features, including the simple and rapid preparation (less than 15 min), the direct “open 

view” allowing the visualisation and potential identification of all viruses and bacteria in the clinical or 

environmental specimen, diagnostics negative stain EM has its advantages over routinely used PCR and 

antibody techniques in clinically or epidemiologically critical situations. Together with rapid embedding 

protocols it should be considered as a front line method in such cases. 

References 

1. von Borries et al. Klin. Wochenschr. 17 (1938) 

2. Ksiasek et al. New Engl. J. of Med. 348 (2003) 

3. Laue et al. J. of Microbiol. Methods 70 (2007) 

Tues 13 November



TELEPATHOLOGY: ITS ROLE IN DISEASE DIAGNOSIS IN MEAT HYGIENE. 

Y. Robinson 

Saint-Hyacinthe Laboratory, Canadian Food Inspection Agency 

Saint-Hyacinthe, Québec, Canada 

Introduction 

Telepathology is defined as a branch of telemedicine and pathology based on the exchange of patient’s data 

and images through means of telecommunications for diagnosis, consultation, education and research (1). 

Static telepatholoy is of low cost and simple method with capture of digital images and their electronic 

transmission (2). It allows quick and timely access to an expert opinion at a distance. 

The first publication of this new field appeared in 1986 (3) and until today a variety of modifications has 

developed, including those with a simple offline transmission of images for second opinion or educational 

purposes. The availability of digital cameras at reasonable prices created new training and teaching tools for 

meat inspection veterinarians and plant employees. 


This is a study of static telepathology in which gross pathology images were taken in 10 federally inspected 

slaughter houses in Canada, sent electronically to the pathologist along with a case history. In the majority of 

cases formalin fixed tissues were submitted to the laboratory for histopathology. Three hundred seventeen 

cases in a period of 4 years (August 2003 – July 2007) were evaluated with this system. All images were 

submitted through the Internet to the pathologist using a Canon PowerShot A80, 4.0 Megapixels with a 3x 

Optical Zoom Lens. For some cases in this study, representative microscopic hematoxilin-phloxine-safran 

(HPS) digital images along with other special technique images such as special staining were sent to 1 or 2 

pathologists for a second opinion. Images for histopathology were taken using a Leica DM4000 B 

microscope with HC Fluotar lenses and a Leica 490 digital camera. 

Results 

The number of images per case ranged from 3 to 19. The optimal time for that type of consultation was 

usually within one hour. Such fastest diagnosis insured an early initiation of specific processes regarding the 

disposition of carcasses or a more extensive investigation on the case. The use of telemicroscopy facilitated 

a more accurate diagnosis in some cases. Images linked to explanatory texts were added to pathology 

reports.The images from six cases are presented at this conference. 


The long-distance transmission of digitised images was used in a pilot project in 10 Canadian 

slaughterhouses to evaluate the feasibility of creating rapid communication pathways with an expert 

pathologist. Our experience, based on over 300 cases, suggests that static telepathology is useful in 

simplifying and expanding access to specific remote pathology expertise, rapid intervention as well as 

improving continuous education in pathology. . Pathology reports which featured images linked to 

explanatory text had greater clarity, greater teaching value, and held more useful information than traditional 

text only reports. Another application for the teletransmission is the generation of a database of 

reference material specifically for teaching purposes. 

References 

1. La Rosa F (2000). TelePathology Consultants. 6 th Internet World Congress for Biomedical Sciences 

2. Weinstein RS (1996). Static image telepathology in perspective. Hum Pathol 27:99-101. 

3. Weinstein RS (1986). Prospects for telepathology. Hum Pathol 17:433-434. 


UNDERSTANDING HOST-PATHOGEN INTERACTIONS: CONFOCAL AND LIVE CELL IMAGING IN 

VETERINARY SCIENCE 

P. Monaghan, P. Hawes, J. Simpson, E. Brooks, A. Banyard, T. Jackson 

Institute for Animal Health, Ash Road, Pirbright, Surrey, GU24 0NF, UK 

Introduction 

At the Institute for Animal Health we are using multiple microscopy approaches to study host-pathogen 

interactions. These include receptor binding, internalisation and intracellular replication. The combination of 

molecular techniques including in vitro transfection, fluorescent proteins and siRNA with confocal and livecell 

microscopy is proving particularly effective in these studies. Pathogens under investigation include 

parasites, such as Eimeria tenella, and bacterial and virus pathogens of farmed animals. Examples from 

these studies will be used to illustrate how these techniques give new insights into the cell biology of these 

economically important pathogens. 

Materials and methods 

Samples of cells and tissues were prepared for imaging by a variety of techniques including confocal, livecell 

and electron microscopy. 

Results and Discussion 

We have improved our understanding of several stages in the replication cycle of Foot-and-Mouth Disease 

Virus (FMDV). In vitro evidence suggests that the virus can use a number of receptors for binding and 

internalisation, but that in vivo, the virus uses the integrin αvβ6. We have mapped for the first time, the 

expression of the integrin αvβ6 in epithelia from susceptible animals and confirmed that it is expressed in 

epithelial tissues known to be infected by the virus (Monaghan et al, 2005a). Further verification was gained 

from localisation of viral proteins in tissues from infected animals by confocal microscopy and this data was 

supported by quantitative information on viral RNA copy numbers by RT-PCR (Monaghan et al, 2005b). 

Using a tissue culture model, we have shown that the virus uses this integrin receptor and gains entry to the 

cell via clathrin-mediated endocytosis (Berryman et al, 2005). 

Many viruses interact with the cytoskeleton (eg Jouvenet et al 2006) and we have highlighted the role of the 

cytoskeleton in the cytopathic effect induced by FMDV infection. We have investigated this interaction by 

transfecting individual FMDV non-structural proteins into uninfected cells and identified the viral nonstructural 

protein responsible. FMDV is a member of the picornaviridae – a group of viruses which includes 

poliovirus (PV) and whilst all viruses of this group require cytoplasmic membranes on which to replicate, the 

source of these membranes is not clear. We have investigated the possible involvement of cytoplasmic 

components including ER, Golgi or lysosomes as well a possible role for autophagy, in FMDV infection. 

Autophagy is a normal cellular process initiated in response to nutrient deprivation and recent reports of the 

replication strategy of PV (Suhy et al, 2000 ) indicate that this virus may use the autophagy pathway as an 

aid to replication and cell exit. 

Incorporating GFP into a pathogen genome enables the replication of the virus to be studied in real-time 

using live-cell imaging giving new insights into the dynamics of infection. A GFP-Rinderpest virus is currently 

under development for both in vitro and in vivo experiments. 

These microscopical techniques are not only improving our understanding of the complex cell biological 

interactions between host and pathogen at the cellular and sub-cellular level but will also open new avenues 

for the development of novel control measures. 

References 

Berryman S, Clark S, Monaghan P, Jackson T. The early events in αvβ6-mediated cell entry of foot-and- mouth disease virus. J Virol 

79: 8519-8534 2005 

Jouvenet N, Windsor M, Rietdorf J, Hawes P, Monaghan P, Way M, Wileman T. African swine fever virus induces filopodia-like 

projections at the plasma membrane. Cell Microbiol 8:1803-1811 2006 

Monaghan P, Gold S, Simpson J, Zhang Z, Alexandersen S, Jackson T. The αvβ6 integrin receptor for foot-and-mouth disease virus is 

constitutively expressed on the epithelial cells targeted in a natural infection of cattle. J Gen Virol 86: 2769-2780 2005a 

Monaghan P, Simpson J, Murphy C, Durand S, Quan M Alexandersen S Localisation of Viral Non-Structural Proteins and Potential 

Sites of Replication by Confocal Immuno-Fluorescence Microscopy in Pigs Experimentally Infected with Foot-and-Mouth Disease Virus. 

J Virol. 79: 6410-6418 2005b 

Suhy DA, Giddings TH Jr, Kirkegaard K. Remodeling the endoplasmic reticulum by poliovirus infection and by individual viral proteins: 

an autophagy-like origin for virus-induced vesicles. 

J Virol. 74:8953-8965. 2000 

Tues 13 November



MULTI-RESOLUTION SPATIO-TEMPORAL ANALYSIS OF MAMMALIAN CELLS RECONSTRUCTED IN 

3D BY ELECTRON MICROSCOPE TOMOGRAPHY 

Brad J Marsh W Group Leader/Senior Research Fellow, Institute for Molecular Bioscience, Centre for Microscopy & Microanalysis and 

School of Molecular & Microbial Sciences, The University of Queensland, St Lucia, QLD 4072, AUSTRALIA 

SUMMARY 

The beta cell - the sole source of the hormone insulin in mammals - resides within the islets of Langerhans in 

the pancreas. We are focused on understanding the basic mechanisms that underpin normal beta cell 

function, so that we can elucidate the steps that lead to beta cell/islet dysfunction and ultimately, diabetes. 

To this end, we combine fast-freezing techniques with electron microscope tomography (ET) to conduct 

comparative structure-function studies of pancreatic islets isolated from mice and humans. To complement 

insights from these high-resolution 3D reconstructions (“tomograms”) of parts of cells, and to move toward a 

more integrated or “holistic” approach to understanding the mammalian cell as a unitary example of an 

ordered complex system, we have undertaken a multi-scale/multi-resolution approach to reconstructing 

mammalian (beta) cells in toto in 3D by ET at both high (≤5nm) and intermediate (15-20nm) resolutions. By 

providing complete sets of 3D spatio-temporal coordinates for cells at a range of resolutions that will uniquely 

inform advanced in silico studies of 3D cell and molecular organization, we are working to develop the 

world's first navigable ‘Visible Cell atlas’ within the broader framework of the Visible Cell project 

(http://www.visiblecell.com/). Such an interactive high-resolution map of the 3D landscape of an entire 

mammalian cell imaged and reconstructed by ET at the EM level will serve as a unique international 

resource for protein and organelle annotation, database integration and 3D visualization, and as a framework 

for 4D animations and computational simulations of cells at pseudo-molecular resolution. 

KEY REFERENCES (IN CHRONOLOGICAL ORDER) 

2001 Marsh BJ, Mastronarde DN, Buttle KF, Howell KE, McIntosh JR. Organellar relationships in the Golgi 

region of the pancreatic beta cell line, HIT-T15, visualized by high resolution electron tomography. Proc 

Natl Acad Sci USA. 98:2399-2406 

2001 Marsh BJ, Mastronarde DN, McIntosh JR, Howell KE. Structural evidence for multiple transport 

mechanisms through the Golgi complex in the pancreatic beta cell line, HIT-T15. Biochem Soc Trans. 

29:461-467 

2002 Marsh BJ, Howell KE. Timeline: The mammalian Golgi - complex debates. Nat Rev Mol Cell Biol. 

3:789-795 

2004 Marsh BJ, Volkmann N, McIntosh JR, Howell KE. Direct continuities between cisternae at different 

levels of the Golgi complex in glucose-stimulated mouse islet beta cells. Proc Natl Acad Sci USA. 

101:5565-5570 

2005 Marsh BJ. Lessons from tomographic studies of the mammalian Golgi. Biochimica et Biophysica 

Acta. 1744:273-29 

2006 Marsh BJ. Toward a “Visible Cell”…and beyond. Australian Biochemist. 37:5-10 

2007 LR Brunham, JK Kruit, TD Pape, JM Timmins, AQ Reuwer, Z Vasanji, BJ Marsh, B Rodrigues, JD 

Johnson, JS Parks, CB Verchere and MR Hayden. Beta-cell ABCA1 influences insulin secretion, glucose 

homeostasis and response to thiazolidinedione treatment. Nature Medicine. 13:340-347 

2007 P van der Heide, X Xu, BJ Marsh, D Hanein and N Volkmann. Efficient automatic noise reduction of 

electron tomographic reconstructions based on iterative median filtering. J Struct Biol. 158:196-204 

2007 BJ Marsh, C Soden, C Alarcón, BL Wicksteed, K Yaekura, AJ Costin, GP Morgan and CJ Rhodes. 

Regulated autophagy controls hormone content in secretory-deficient pancreatic endocrine beta-cells. Mol 

Endocrinol. 21:2255-2269 

2007 BJ Marsh. Reconstructing mammalian membrane architecture by large area cellular tomography. 

Methods in Cell Biology. 79C:193-220 

2007 AB Noske, AJ Costin, GP Morgan and BJ Marsh. Expedited approaches to whole cell electron 

tomography and organelle mark-up in situ in high-pressure frozen pancreatic islets. J Struct Biol. In press 

ACKNOWLEDGEMENTS 

This work has been supported by grants from the Juvenile Diabetes Research Foundation International (2- 

2004-275) and the National Institutes of Health (DK-71236) in the USA. BJM is a Senior Research Affiliate 

of the ARC Special Research Centre for Functional and Applied Genomics, and is a Chief Investigator of the 

ARC Centre of Excellence in Bioinformatics. 


DETECTING AND INTERPRETING ARBOVIRAL INFECTIONS IN INSECTS. 

Dr Simon Carpenter 

Arbovirology programme, Institute for Animal Health, Pirbright Laboratory, Ash Road, Woking, Surrey. GU24 0BN. UK. 

simon.carpenter@bbsrc.ac.uk 

Vector-borne arboviruses have a significant detrimental impact on both human health and animal health and 

production world wide. A vital key to understanding the epidemiology of the diseases caused by these 

viruses lies in the correct identification of the insect vectors responsible for their spread. While this appears 

at first sight to be a relatively simple task, the complexities of virus-vector interactions commonly lead to 

results that are difficult to interpret. In this talk I will examine the ways in which vectors have traditionally 

been implicated, including studies of their ecology, the presence of virus in field collected samples, PCR 

positives and laboratory-based infection trials. 

I will begin by distinguishing between different modes of arboviral transmission and their implications for 

studying the epidemiology of each particular virus. I will then examine the process by which vectors become 

infected when taking a blood-meal from a viraemic host. This will include a discussion of the various barriers 

that may inhibit dissemination of the virus through the body of the insect vector, with examples drawn from 

work carried out upon biting flies. I will then briefly describe the influence of environmental factors upon this 

process and examine the evidence for likely impacts with regard to climate change. 

The commonly used techniques of arbovirus detection in insects will then be described in detail and their 

advantages and disadvantages examined. I will critically explore a case study of ongoing bluetongue virus 

outbreaks in Europe, (spread via Culicoides midges, which are true biological vectors), to illustrate how 

these techniques are commonly implemented in practice. This will include a discussion of where vector 

diagnostics can be integrated into other diagnostic methods to monitor arboviral circulation, and suggestions 

as to how these can be easily expanded into standard laboratory set-ups. 

Finally, I will discuss the application of novel and high-throughput diagnostic techniques to virus-vector 

systems and some of the methodological difficulties that need to be addressed to ensure their correct 

application. I will discuss the problems intrinsic in attempting to combine entomological and molecular 

expertise emphasising that input is required from all parties to facilitate the incorporation of new technologies 

into mainstream diagnostics. 

Tues 13 November



MOLECULAR METHODS FOR SPECIATION 

Dr Hez Hird, Senior Molecular Biologist 

Biotechnology and Molecular Genetics 

Central Science Laboratory 

Sand Hutton 

York 

YO41 1LZ 

United Kingdom 

E-mail h.hird@csl.gov.uk 

The advent of the polymerase chain reaction (PCR) has revolutionised the diagnosis of diseases over the 

last 2 decades. The challenge though has been to develop practical routine methods, which could be used 

in diagnostic laboratories, where reliable and simple amplicon detection would allow the objective analysis of 

results. The main breakthrough in achieving this aim came at the end of the 1990s with the development of 

real-time PCR using TaqMan technology. In TaqMan PCR, the exponential amplification of target specific 

DNA is measured by the use of an oligonucleotide probe complementary to sequence internal to the PCR 

primers and labelled at each end with fluorescence reporter and quencher molecules. When the probe is 

intact, the reporter dye fluorescence is absorbed by the quencher molecule by fluorescence resonance 

energy transfer (FRET). During amplification, the 5’ nuclease activity of Taq polymerase causes the probe to 

be cleaved and a signal is generated from the free fluorescence reporter dye. The increase in fluorescence 

is related to the amount of template amplified and can be measured using a fluorimeter. TaqMan PCR offers 

a number of advantages over conventional PCR, including closed tube assay format with no need for post- 

PCR manipulations, increased sensitivity, capacity for high throughput and the objective analysis of results. 

This presentation will focus on the application of real-time PCR based methods for the detection and 

identification of zoonotic diseases and will be illustrated using Mycobacterium bovis and Bacillus anthracis. 

M. bovis is a problem in the UK where eradication of the disease from the national cattle heard has been 

unsuccessful. This is probably due to the presence of M. bovis in wildlife reservoirs, primarily in the badger, 

which is highly susceptible to the disease. One strategy to eradicate the disease is the vaccination of both 

badgers and cattle using M. bovis BCG, however differentiation between M. bovis shed by infected animals 

and M. bovis BCG shed by vaccinated animals is impossible using current PCR based assays. Ongoing 

work at the Central Science Laboratory, to develop a rapid, robust real-time PCR based assay, to 

differentiate M. bovis and M. bovis BCG, will be discussed. 

Bacillus anthracis is an example of a zoonotic disease which causes the rapid death of humans after 

inhalation exposure and as such, is a possible biological warfare agent. This powerful driver has led to the 

development of real-time PCR assays for the rapid identification of B. anthracis in the field, and which has 

necessitated the development of robust portable real-time PCR equipment. There are a number of portable 

real-time PCR machines available, however the Cephaid Smart cycler appears to be currently the most 

popular for non-military uses. The Smart cycler has sixteen cycling modules which can be independently 

programmed, via a controlling computer, to perform four colour, real-time fluorometric detection. The system 

software enables one or more operators to define and simultaneously carry out separate experiments, each 

with a unique set of cycling protocols, threshold criteria and data analysis. The data can be viewed in realtime 

and when used with assays optimised to return results in 30-40 minutes, the time to positive 

identification for a sample can be kept to a minimum. An additional advantage of the Smart cycler over the 

laboratory based real-time machines is the much reduced price: making real-time PCR more accessible. 

The application of field based portable real-time PCR methods for disease diagnosis will also be discussed. 

In summary, this presentation will demonstrate the use of real-time PCR for the identification of zoonotic 

diseases, which for the first time offers the opportunity for field-based PCR testing. 



11 - 14 November 2007 

Wednesday 14 November


0815 - 1000 Plenary Sessions - Preparing for the Future 

LABS OF THE FUTURE 

Dr. Martyn Jeggo 

Director, Australian Animal Health Laboratory, Geelong, Victoria, 

Australia 

Today, veterinary laboratories are faced with a range of challenges that constantly threaten their resource 

base, yet globally the need for veterinary diagnostic services and the underpinning research activities has 

never been greater. The occurrence and risks from infectious diseases has steadily been increasing during 

the past 20 years. Whilst many endemic production diseases have been on the wane, infectious disease e.g. 

avian influenza, foot and mouth disease, West Nile, bluetongue continues to threaten livestock and in a 

growing number of cases, man. 

How best can veterinary laboratories utilize current and new technologies to provide an effective diagnostic 

service and do so in a growing regulatory environment that makes the delivery of these services evermore 

complex and resource hungry? 

During the past few years, the development of molecular technologies based around the polymerase chain 

reaction (PCR) offer a quantum leap in diagnostic levels of sensitivity and specificity, in a timely and 

increasingly, quality assured manner. But where will this take us in the next ten years and can we genuinely 

equate the presence of genetic material with that of an infectious agent? Can the laboratory of the future 

dispense with causative agent isolation and characterization and rely on these newer gene based 

approaches? On the one hand, the promises of multiplex assays for multiple agent detection in a single test 

provides an opportunity to check for an enormously wide range of potential pathogens, whilst at the other 

end of the spectrum, the development of pen-side assays offers the opportunity to dispense with the need to 

even submit samples to a laboratory. How will these contrasting approaches impinge on activities 

undertaken by a veterinary laboratory in ten year time? 

In considering the regulatory and operating environment that laboratories now find themselves, a wide range 

of health, safety and environmental priorities must be taken into account for every activity undertaken. 

Invariably processes involving gene based technologies are now carefully regulated and activities involving 

the use of animals overseen by welfare and ethic committees. But beyond this, a new biosecurity regulatory 

environment is being created for anyone working with a range of pathogens, and increasingly this deals not 

only with biosafety and bio-containment but the potential element of bioterrorism. This increasing regulation 

of the operational environment of a veterinary laboratory must lead to changes in the way they operate, but 

what is the likely outcome? 

The biggest challenge though, maybe in the area of bio-informatics, information exchange and the decision 

making processes that this will underpin. The technologies embraced today have an ability to generate large 

amounts of data, that need to be collated, processed and re-organized to assist the veterinary diagnostician 

and the disease management services he supports. What will be the impact of the continuing information 

technology explosion on the activities of the veterinary laboratory in the future? 

This paper attempts to answer the questions posed above, taking examples from a number of recent disease 

outbreaks both in Australia and elsewhere, illustrating trends taking place today, that are likely to shape the 

veterinary laboratory of the future. 

Wed 14 November 



Biosafety and Biosecurity Concerns Of High Security Animal Pathogen Laboratories 

Luis L. Rodriguez, D.V.M., Ph.D. 

Overview: 

In response to the global spread of emerging infectious diseases and the threat of bioterrorism, highcontainment 

biosafety laboratories (BSL)--specifically biosafety level (BSL)-3 and BSL-4--have been 

proliferating in the United States as well as throughout the world. Specific incidents such as the anthrax 

terrorist attacks in the USA in 2001; the emergence of SARS and the infection of humans with H5N1 Avian 

influenza in Asia generated great concern and interest in around the world and in particular in the USA. A 

new industry; biodefense has emerged with academia, government and industry adapting and responding to 

this new niche for biodefense-related research, diagnostics, laboratory equipment, high-containment 

construction and pharmaceuticals. This multi-billion dollar industry ($5.24 billion in 2007 in the US alone) 

places great demand for BL3 and BL4 labs in government, academia and private sector. 

High-consequence human and animal pathogens, which traditionally have been studied in Public Health or 

Agriculture government laboratories, have become potential targets for bioterrorists. For example, foreign 

animal diseases such as Foot-and-Mouth Disease were determined to be high threats for US agriculture and 

food security. This increased concern for protecting an infrastructure critical to national security resulted in 

the transfer of the Administration and Operations of the Plum Island Animal Disease Center facility from the 

US Department of Agriculture (USDA) to the newly created Department of Homeland Security (DHS) in 

2003, while maintaining the research and diagnostics mission in USDA. Laws were revised and or created 

in 2002 to ensure the proper handling, storage and tracking of high consequence agents for both human and 

animal health. 

Although investment in biodefense research has been significant over the last 5 years, particularly in the 

area of human health, some of the critical infrastructure in animal health has lagged behind and only recently 

have plans been made to replace or renovate high-containment laboratories such as the Pirbright laboratory 

in the UK and the Plum Island laboratory in the US. These aging facilities have come under close scrutiny 

after a recent FMD outbreak was linked to the Pirbright site. This incident as well as recent incidents in US 

labs handling select agents motivated ongoing investigations at the congressional level. Similar inquiries are 

likely to follow in the UK as well as other countries with high-security laboratories. 

This lecture will present an overview of the current biosafety and biosecurity concerns, including the real as 

well as perceived risks from the construction and operation of high-security animal disease laboratories.


DIAGNOSTIC TECHNOLOGIES FOR VETERINARY LABORATORIES OF THE FUTURE 

T. R. Beckham 

Foreign Animal Disease Diagnostic Laboratory, Animal and Plant Health Inspection Services, United States Department of Agriculture, 

Plum Island Animal Disease Center, P.O. Box 848, Greenport, NY 11944, USA. 

Veterinary diagnostic laboratories of the future will be challenged to provide rapid, accurate diagnostics that 

are capable of detecting and identifying emerging and re-emerging diseases. There will be an emphasis on 

rapid identification and subsequent characterization of high consequence agricultural and/or zoonotic agents. 

Over the past two decades, there has been a substantial growth in molecular diagnostic capabilities within 

these laboratories. More specifically, conventional PCR, real time PCR and sequence analysis have 

become routine tools used to detect and characterize isolates from diseased animals. Although these tools 

are capable of providing a rapid and accurate diagnosis, each has their limitations. First, the conventional 

and real time PCR assays are typically designed to detect a specific agent and therefore, their design 

requires a readily available source of sequence information. In addition, multiplexing capabilities (the 

simultaneous testing of multiple agents) of the real time based PCR method is limited. 

Recently, other more sophisticated technologies have begun to be developed. These new technologies 

(Luminex bead based assays, Triangulation Genetic Evaluation of Risk (TIGER, Ibis Therapeutics), and 

microarrays) offer additional capabilities that will enhance surveillance programs and the ability to detect and 

identify an unknown or emerging pathogen. 

The Luminex xMap technology is a bead-based system that allows for deep multiplexing of diagnostic 

signatures. This technology is extremely versatile in that it can be utilized for detection of antibody and/or 

nucleic acids. Current efforts to utilize this technology include the development of multiplexed “syndromic 

panels” (i.e. vesicular, swine fever and swine respiratory) and serological panels designed to differentiate 

vaccinated and infected animals. 

The TIGER biosensor and microarray are both unique in that they enable identification of an unknown agent 

from a clinical and/or environmental sample. The TIGER system utilizes both PCR and mass spectrometry 

to detect and identify known and/or unknown agents from a sample. Unlike the microarray and other 

detection devices (PCR, rRT-PCR and Luminex), the TIGER system does not rely on previous knowledge of 

sequence information for design of oligonucleotides, primers and probes. The powerful bioinformatics 

package that accompanies this tool allows for sophisticated differentiation and identification of multiple 

known and/or unknown pathogens in a single sample. 

As demonstrated in 1999, with the introduction of West Nile virus into North America and more recently with 

outbreak of monkeypox virus in the U.S. (2003), veterinarians and veterinary diagnostic laboratories of the 

future must and will play a central role in the early detection and identification of emerging and/or zoonotic 

pathogens. Veterinary laboratories (both state and federal) will be expected to be prepared for and respond 

to animal and public health issues. Preparation for these animal/public health emergencies will involve 

building on newly available technologies (expanding our diagnostic arsenal with assays that are “fit for 

purpose’), developing high throughput sample processing capabilities and maintaining and evaluating the 

current portfolio of diagnostic tests. Although each laboratory will face significant challenges in implementing 

many of the new, more sophisticated molecular techniques (identifying and training qualified staff, start-up 

costs, cost to maintain equipment, reagents, etc), it is the implementation of these tools, that can be utilized 

along side of the “gold-standard” assays, that will define veterinary diagnostics and its’ role in animal and 

public health issues in the future. 

References 

Perkins J, Clavijo A, Hindson BJ, Lenhoff RJ, McBride MT. (2006) Multiplexed detection of antibodies to 

nonstructural proteins of foot-and-mouth disease virus. Anal Chem. Aug 1;78(15):5462-8. 




OIE BIOTECHNOLOGY SYMPOSIUM: INTRODUCTORY REMARKS 

Steven Edwards, President of the OIE Biological Standards Commission 

The OIE (World Organisation for Animal Health) was established in 1924 in order to facilitate an 

internationally harmonised approach to animal disease control and reporting, particularly for transboundary 

diseases. Since then the organisation has expanded both its remit and its membership to include all 

countries with a significant livestock sector (current 170 Member Countries). The OIE is an 

intergovernmental organisation in its own right, with responsibility for improving animal health worldwide. 

The key missions of the OIE are: 

• To ensure transparency on animal diseases and zoonoses 

• To collect, analyse and disseminate veterinary scientific information 

• To provide expertise and encourage international solidarity on animal disease control 

• To publish animal health standards for international trade in animals and their products 

(this underpins OIE’s official mandate under the sanitary and phytosanitary agreement of the WTO) 

• To improve the legal framework and resources of national veterinary services 

• To promote safety for foods of animal origin and to promote science-based animal welfare 

As part of its science-based approach the OIE has a long tradition of developing standards for laboratory 

procedures used in animal disease diagnosis. The responsible bodies for this activity within OIE are the 

Biological Standards Commission (dealing with terrestrial animal diseases) and the Aquatic Animal Health 

Standards Commission. Among their other activities, these two commissions advise the OIE on the 

designation of Reference Laboratories for specified diseases, and produce laboratory manuals giving details 

of recognised and validated diagnostic tests. 

These commissions are supported by a variety of working and ad hoc groups, including the Biotechnology 

Ad hoc Group. It has been a tradition for some years now for the OIE to sponsor and organise a one day 

Biotechnology Symposium within the International Symposia of the WAVLD. This gives the opportunity for 

OIE to bring to the diagnosticians’ community a persective on emerging technologies with a potential for 

future application in laboratory-based diagnosis. Some of these are novel developments within established 

methodologies, while others present totally new approaches. Some are “near market” in that they are already 

or soon will be appearing in the armoury of tests offered by diagnostic laboratories. Others remain 

speculative and of uncertain potential, but we certainly should not ignore the developments happening in the 

research community. 

It is my pleasure to introduce the 2007 OIE Biotechnology Symposium, and I hope you find the presenations 

stimulating and informative.


1030 - 1230 Concurrent Session 1.4 - New Technologies & Platforms 

The United States National Animal Health Laboratory Network (NAHLN) 

B. M. Martin*, United States Department of Agriculture, Animal and Plant Health Inspection Service, Veterinary Services, National 

Veterinary Services Laboratories, 

1800 Dayton Ave., Ames, Iowa, 50010, USA; 

T. F. McElwain, Washington Animal Disease Diagnostic Laboratory and Animal Health Research Center, College of Veterinary 

Medicine, Washington State University, 

155N Bustad Hall, Pullman, Washington 99164, USA 

Introduction 

The United States National Animal Health Laboratory Network (NAHLN) was established in 2002 to enhance 

the early detection of, response to, and recovery from animal health emergencies, including bioterrorist 

events, newly emerging diseases, and foreign animal disease outbreaks that threaten the Nation’s food 

supply and public health. The NAHLN is a collaborative effort between the United States Department of 

Agriculture (USDA) and the American Association of Veterinary Laboratory Diagnosticians (AAVLD). From 

an initial group of 12 laboratories the NAHLN has expanded to 54 laboratories in 45 states. 

Elements upon which the NAHLN was founded included: 

• Standardized, rapid diagnostic techniques 

• A secure communications, alert mechanism, and reporting system 

• Modern equipment and trained personnel 

• Training, proficiency testing, and quality assurance programs 

• Facilities that meet biocontainment and security requirements 

• Scenario testing in support of regional and national training exercises 


A program review of the NAHLN was initiated in 2007 to identify stakeholder perspectives concerning the 

objectives of the network, how well those objectives were being met, and whether changes in objectives are 

needed. The report indicates that the original objectives are appropriate and valid and that the NAHLN has 

made significant progress. Key accomplishments are summarized below. 

• Standardized, rapid diagnostic assays have been validated and deployed to NAHLN laboratories for 

avian influenza (AI), exotic Newcastle disease (END), and classical swine fever (CSF). NAHLN laboratories 

are also participating in USDA supported surveillance efforts for bovine spongiform encephalopathy (BSE), 

chronic wasting disease (CWD), and scrapie. 

• A centralized national data system has been developed that receives standardized data sets from 

participating NAHLN laboratories and supports automated transmission of data via Health Level Seven (HL7) 

messaging. Efforts are now focused on ensuring that NAHLN laboratories routinely transmit electronic test 

result messages. 

• A “Train the Trainer” program for foot and mouth disease (FMD), CSF, AI, and END rapid assays was 

developed and implemented. Not only has the program increased the number of laboratory personnel 

prepared to respond to a national animal health emergency, but it provides a cadre of trainers available to 

teach others. Successful implementation of this program was a significant step for the NAHLN and its 

mission of ensuring sufficient diagnostic capability and capacity to address an animal health emergency. 

• USDA’s National Veterinary Services Laboratories (NVSL) serves as the reference laboratory for NAHLN 

and has provided training and proficiency testing programs for NAHLN laboratory personnel. The NVSL also 

provides support through production and distribution of reagent standards and quality control panels. 

• One of the major successes of the NAHLN has been the collaboration with other Federal and state 

organizations to achieve common goals. The NAHLN has become the animal health laboratory backbone of 

the United States emergency response and recovery program, and has enabled implementation of national, 

standardized surveillance for high priority diseases. 

References 

1. American Association of Veterinary Laboratory Diagnosticians Website: 

http://www.aavld.org/mc/page.do 

National Animal Health Laboratory Network Website: http://aphis.usda.gov/animal_health/nahln 




DEVELOPING AN APPROACH FOR RAPID IDENTIFICATION OF EMERGING BIOLOGICAL THREATS 

Bill Colston, Ray Mariella, Reginald Beer, Klint Rose, Kevin Ness, Elizabeth Wheeler, Tom Slezak, Shea Gardner, Peter Williams, Amy 

Hiddessen, Monica Borucki, Ben Hindson, Chris Bailey, and Crystal Jaing (UC Lawrence Livermore National Laboratory) 

In our era of rapid, easy world wide travel, infectious diseases, both naturally occurring and 

intentionally introduced, hold increasing potential to cause disease, disability and death. Their 

prevention and control is fundamental to individual, national and global health and security. 

Lessons learned from the recent SARS outbreak teach us that without the ability to rapidly identify 

and characterize a previously unknown or emerging pathogen, our country’s ability to mount a 

timely and effective response to a nationwide bioterrorism event is unlikely. In recent years the 

biodefense community has focused on short-term production of assays for the specific 

identification of a short list of known pathogens. While necessary, this focus has created a gap in 

our defensive and public health arsenal. We are currently ill-prepared to deal with novel pathogens 

(natural or engineered), complex mixtures of organisms, or detection of virulence regardless of the 

organism conferring it. Particularly in the case of viral agents, persistent technology gaps exist in 

this process, including sample handling and preparation and highly-multiplexed assays that can 

detect and identify both known and unknown viruses. Also, in the case of viral infectious agents, 

this problem is compounded by our near-total lack of knowledge of “normal” viral backgrounds in 

environmental, human, and agricultural samples. 

To address this challenge, we have begun developing an approach to create a translational 

measurement capability that will allow rapid, high-throughput viral screening. This approach 

includes (1) Sample preparation capabilities to isolate virus particles from the numerous other 

inter- and intra-cellular materials present in a nasopharyngeal sample. Viruses, by their very 

nature, cannot live and replicate by themselves, and must rely on the complex biochemical 

machinery of the host cells. Thus, detection of viral signatures will rely on removing the great 

number of interfering cellular components of the host cells, including proteins, organelles, and the 

cells’ own genetic materials. (2) A long-term detection capability to isolate and individually test 

every viral particle in a sample in a high-throughput, massively parallel microfluidic system. This 

will be done by isolating each virus particle in its own picoliter size ‘individual biochemical 

laboratory’ or microdroplet for sensitive PCR analysis. (3) Development of comprehensive, specific 

multiplex PCR assays of known organisms that can be carried out in a microdroplet and will be 

capable of family level identification following amplicon analyisis. The goal is to ultimately be able 

to screen all known viral genomes to develop a minimum set of signatures that can be used to 

characterize an unknown virus. 

We will present new developments in microfluidic engineering, highly multiplexed biological assays 

and advances in bioinformatics aimed at providing a broad capability for identification and 

characterization of previously known and unknown viruses. Specifically, we have currently 

demonstrated: 

• Application of acoustic, electrophoretic and electrophoretic techniques to demonstrate a 

continuous size selective sorting of particles in a flowing microfluidic stream. We have 

developed a 3D theoretical simulation for a multi-field separator that combines acoustic 

focusing capability with electrophoresis, and have used this simulation to design and test a 

physical prototype. 

• Development of preliminary viral discovery assays using theoretical calculations coupled 

with wet-bench validation. To accomplish this, we designed novel algorithms and built 

software to select highly conserved primer sets, optimized to work in multiplex format. We 

have demonstrated reproducible, specific PCR amplification of predicted fragments from a 

viral DNA genome (vaccinia virus, lister strain) using 10 bp primer sets. 

• 

Demonstration of Real-time, Taq-man-based sub-nanoliter PCR using digital microfluidics. Our 

system detected a single copy of viral genomic DNA encapsulated in ten-picoliter droplets, with a 

much earlier cycle threshold than conventional devices.


VIRAL IDENTIFICATION USING MICROARRAYS 

J.P. Dukes 1 , A. Abu-Median 2 , M. Watson 2 , R. Card 3 , D. Stone 4 , M. Banks 3 , 

P. Britton 2 and D.P. King 1 

1 Institute for Animal Health, Pirbright Laboratory, Ash Road, Pirbright, Woking, Surrey, UK; 2 Institute for Animal Health, Compton 

Laboratory, Newbury, Berkshire, UK; 3 Veterinary Laboratories Agency, New Haw, Addlestone, Surrey, United Kingdom, 4 Cefas 

Weymouth Laboratory, The Nothe, Barrack Road, Weymouth, Dorset 

Key words: Virus; characterisation; detection; microarray 

The identification of viruses using standard molecular techniques is often obfuscated by the existence of 

closely related isolates. The capacity of microarrays to perform numerous assays on the same sample 

increases experimental range by many orders of magnitude. Microarrays enable both broad-spectrum 

detection, and finer resolution fingerprinting. A microarray consisting of probes covering 300+ viral ‘species’ 

has been developed. The array is being validated to serotype and subtype veterinary viruses using Foot and 

Mouth Disease Virus (FMDV), Infectious Bronchitis Coronavirus (IBV), and other livestock and fish diseases 

as models to optimise protocols for probe design, sample labelling, hybridisation and analysis. 

Using sequence data available both in the public domain and generated in-house, we have designed 70base 

oligonucleotide probes covering 35 virus families. Oligo probes were synthesised commercially and 

arrays spotted in-house using a previously published protocol. Nucleic acid is isolated, amplified, labelled 

and hybridised by established methods, but we have developed bespoke software to analyse the 

fluorescence data generated (‘DetectiV’) providing statistical support for viral identification. 

The microarray is capable of discriminating different viruses (IBV, FMDV). Furthermore, different serotypes 

of FMDV and different topotypes within a serotype also give different ‘signatures’. Viral signatures are also 

detectable in ‘real’ samples from infected animals, and normalisation to an uninfected control reduces the 

majority of noise. Current work at IAH Pirbright is focused on validating this array and determining the 

resolution that can be achieved using further topotypes of FMDV, related picornaviruses, and other vesicular 

viruses. 




ASSAY PLATFORMS FOR THE RAPID DETECTION OF VIRAL PATHOGENS BY THE ULTRAHIGH 

SENSITIVITY MONITORING OF ANTIGEN-ANTIBODY BINDING 

A Fabricate capture antibody chip 

Au 

B Expose chip to sample, capturing antigens 

Au 

Antibodies Antigens Reporters 

Figure 1. Chip design and assay 

scheme. A) Immobilize capture 

antibodies on smooth gold surface. B) 

Expose chip to sample. C) Expose 

chip to SERS reagent, i.e., gold 

nanoparticle coated with Raman 

reporter molecules and antibodies. 

Lastly, read chip by acquiring Raman 

spectrum. 

Au 

Au 

J. Uhlenkamp, K. Kwarta, and B. Yakes 

Center for Combinatorial Sciences and Department of Chemistry and Biochemistry 

Arizona State University, Tempe, AZ USA 

R. J. Lipert 

Institute for Combinatorial Discovery and Ames Laboratory-USDOE, Iowa State University, Ames, IA USA 

J. Ridpath and J. Neill 

USAD/ARS/National Animal Disease Center, P.O. Box 70, Ames, IA USA 

M. D. Porter* 

Departments of Chemistry and of Chemical Engineering, University of Utah, Salt Lake City, UT USA 

Introduction 

The drive for early disease detection and growing threat of bioterrorism has markedly amplified the demand 

for ultrasensitive, high-speed diagnostic tests for viral pathogens. This presentation describes innovations in 

the development of platforms and readout methodologies that potentially address demands in this arena 

through a coupling of gold nanometric particle labelling, surface enhanced Raman spectroscopy (SERS), 

and high speed fluidics. 

Figure 1 briefly overviews our strategy, which uses gold nanoparticle labels and surface enhanced Raman 

spectroscopy (SERS) as a highly sensitive detection methodology that can be applied in a high throughput 

format by rapidly reading several pathogens from multiple addresses on a single biochip. As such, this 

strategy exploits the strong SERS signal for organic dyes (i.e., Raman reporter molecules) that are 

immobilized on gold nanoparticles and subsequently coupled to the appropriate biospecific species, thus 

acting as a label. Using a sandwich immunosorbent assay, the identity of each antigen is determined from 

the characteristic SERS spectrum of the nanoparticle-bound reporters linked to the tracer antibody, with 

each antigen then quantified by the spectral intensity of reporter species. 

Au 

The main advantage of our extrinsic Raman labels (ERLs) 

reflects the strength of the scattering intensity, which has enabled 

the detection of individual particles with only a few seconds of signal 

acquisition. This capability translates to the data exemplified by an 

assay of feline calici virus 

(FCV) in Figure 2. As 

evident, the spectral signature 

of the Raman reporter 

increases with FCV 

concentration, yielding a 

detection limit at low 

femtomolar levels. 

Figure 2. SERS-based immunoassay 

for FCV on gold film capture surface. 

SERS spectra (1-s integration and 

offset for visualization) as a function of 

FCV concentration: a) blank (cell 

culture media only), b) 5.0 x 10 5 , c) 5.0 

x 10 6 , d) 5.0 x 10 7 , e) 1.0 x 10 8 , f) 2.5 x 

10 8 viruses/mL. 

In extending this 

ability, this presentation 

details the fabrication, 

incubation, and rapid readout 

of chip-scale platforms that 

realize virus detection limits at 

low femtomolar levels at total 

development times of 10 min 

or less. Examples will focus 

on the use of protein arrays 

as platforms targeted for virus 

immunoassays. Each 

example will also highlight 

issues related to sensitivity, 

non-specific adsorption, fluid 

manipulation, and assay 

speed.


LATE-PCR WITH PRIMESAFE - MAXIMUM DIAGNOSTIC INFORMATION FROM A CLOSED-TUBE 

L.J. Wangh, C. Hartshorn, K.E. Pierce, J.A. Sanchez, J.E. Rice, and A.H. Reis, Jr. 

Department of Biology, Brandeis University, Waltham MA, USA, 02454-9110 

(email: Wangh@brandeis.edu) 

Introduction: In veterinary and human medicine there is a growing need for diagnostic assays that can 

rapidly detect and analyze numerous species and strains of infectious organisms and viruses. RNA viruses 

are particularly challenging because they evolve rapidly. In the case of veterinary medicine, tests have to be 

done at pen-side or in the field and the findings can have great economic impact, including slaughter of 

many animals. Currently the use of RT-PCR is limited in scope and few, if any assays provide results from 

multiplex data in the field. We have overcome these limitations by constructing assays based on LATE-PCR 

and (RT)-LATE-PCR. We are collaborating with Smiths Detection to implement these assays on an 

automated “pen side” sample preparation and PCR system (see C.Volpe et. al. this volume). 

Materials & Methods: Linear-After-The-Exponential (LATE)-PCR, invented in our laboratory, is an advanced 

form of asymmetric PCR in which each amplicon is generated using a Limiting Primer whose initial, 

concentration-adjusted melting temperature (Tm L ) is at least as high as that of the Excess Primer (Tm X ). 

Under these conditions amplification begins with efficient exponential amplification of double-stranded DNA 

and then abruptly switches to linear amplification of one strand, as the limiting primer is depleted from the 

reaction. Each single-stranded amplicon can be quantitatively detected in real-time or at end-point using 

fluorescent probes of different color. Moreover, in LATE-PCR, product detection is carried out separately 

from primer annealing in the thermal cycle, thereby making it possible to use both sequence-specific and 

mis-match tolerant fluorescent probes that hybridize to their target strands over a broad temperature range 

below the annealing temperature of the reaction. In addition, each single-strand can be sequenced by a 

convenient Dilute-‘N’-Go procedure, even when multiple sequences are generated in the same reaction. 

PrimeSafe TM , also invented in our laboratory, is a PCR additive that suppresses mis-priming throughout all 

thermal cycles, thereby simplifying construction of multiplexed LATE-PCR assays. (RT)-LATE-PCR assays 

use random hexamers to generate cDNA molecules (two-step protocol), or use the LATE-PCR primers 

themselves (one-step protocol). In either case, cDNA synthesis and amplification can be carried out in the 

same tube. 

Results: Using LATE-PCR we are constructing assays that are quantitative for the number of target 

molecules present at the start over seven orders of magnitude and down to single DNA or cDNA molecules. 

In this conference we present new results using multiplexed LATE-PCR assays for Foot and Mouth Disease 

(see Pierce et al. ) or Avian Flu (see Hartshorn et al.) are described in this volume. These assays are being 

implemented on Smiths Detections “pen side” device . Conserved sequences characteristic of particular 

pathogens can be reliably detected with sequence-specific probes that form probe-target hybrids at 

characteristic temperatures. Alternatively, variable sequences that differ slightly from one pathogenic strain 

to another can be distinguished using mis-match tolerant probes that allow for probe-target hybridization 

over a range of low temperatures. In either case, the complete nucleotide-by-nucleotide sequence of the 

amplicon within which the probe sequence lies can be determined conveniently and cost effectively using the 

Dilute-‘N’-Go dideoxy sequencing protocol. Thus, when fully implemented, LATE-PCR assays installed in a 

Portable Veterinary PCR Laboratory currently under development by Smiths Detection, Inc. will generate 

sophisticated information in the field, as well as the amplicons needed for thorough sequence analysis in the 

laboratory. 

Discussion & Conclusions: LATE-PCR and its related novel technologies promise a new generation of 

highly informative diagnostic assays for use in the laboratory or in the field. Smiths Detections “pen side” 

system is the only portable instrument specifically designed to take full advantage of these improvements. 

References: 

All of our publications on LATE-PCR are available at: http://www.brandeis.edu/projects/wanghlab/ 




A COMPLETE WORKFLOW FOR NUCLEIC ACID BASED 

HIGH THROUGHPUT PATHOGEN DETECTION 

XW Fang*, A Burrell, R C Willis, Q Hoang, W Xu, M Bounpheng, W Ge and J El-Attrache 

Ambion, Inc. An Applied Biosystems Business. 2130 Woodward St., Austin, TX 78744 

Introduction 

Nucleic acid-based technology is increasingly used for pathogen detection and classification, as well as for 

differentiation of infected animals from vaccinated animals. Nucleic acid isolation is the crucial step for this 

technology. The variety of sample matrix and pathogen types poses great challenges in developing a 

method for universal sample preparation easily amendable for all applications. An additional challenge is to 

automate the sample preparation to minimize human exposure to the infectious pathogens and to reduce the 

variation of the process. Moreover, qRT-PCR buffer optimization and careful primer/probe design are critical 

to assure analytic sensitivity and detection sensitivity and specificity. 


Pathogen DNA/RNA is isolated using MagMAXTM kits on KingFisher Magnetic Particle Processors. RNA 

quality is evaluated for purity (by A260/A280 ratio and RT-PCR inhibition), intactness (with gelelectrophoresis). 

Pathogen detection is performed on ABI 7500 Fast and 7900HT real-time instruments 

using AgPath-IDTM Reagent Kits. 

Results 

High quality DNA/RNA can be isolated with MagMAX Kits from a variety of sample matrices, such as swabs, 

feces, growth media, serum, plasma, cultured cells, tissue and blood. The purified RNA/DNA is ready for 

quantification by real-time PCR and sequencing. Samples can be process in microfuge tubes and 96-well 

plates. The process can be easily automated. 

KingFisher Magnetic Particle Processors automate magnetic bead-based processes with the coordinated 

move of the permanent magnetic rods and disposable tip combs. This unique approach makes washing and 

elution more efficient, accelerates processing, and also makes walk-away automation feasible. The 

processors can do up to 15, 24 or 96 samples per run depending on the model of the instrument. A typical 

nucleic acid isolation on a KingFisher machine takes


AN ADVANCED FIELD DEPLOYABLE “PEN SIDE” SAMPLE PREPARATION AND PCR SYSTEM 

Doug Green 1 , C. Volpe 2 *, John Czajka 1 , Jason Betley 2 and Jay Lewington 2 

1 Smiths Detection, 2202 Lakeside Blvd. Edgewood, MD 21040, USA 

2 Smiths Detection, 459 Park Avenue, Bushey, Watford, WD23 2BW, United Kingdom. 

Introduction 

Exotic and Zoonotic diseases pose a threat to the world’s wildlife, commercial livestock and the population in 

general. Efforts to control the spread of naturally occurring highly infectious pathogens, for example Highly 

Pathogenic Avian Influenza, have been complicated by the need to transport samples to the lab for ultimate 

identification. This is especially problematic in remote locations. This abstract describes a briefcase sized 

portable sample preparation and PCR system, which has been designed, from the outset, with the field 

veterinarians needs and mode of operation in mind, including the ability to sanitise the unit with disinfectant. 

The system automatically purifies nucleic acids from a wide range of sample types and carries out PCR 

analysis, reporting either a positive or negative result or a strain level identification where applicable. The 

system uses a number of novel technologies and approaches to provide a fully automated portable on-site 

identification capability in a wide range of weather conditions, by a person with no knowledge of PCR. 


Operation of the device is extremely simple. A veterinarian suspecting the presence of disease takes a 

sample from the animal. The nature of the sample is dependant on the disease under suspicion and is not 

limited by the instrument. For example they may take blood samples or vesicular tissue as appropriate. The 

veterinarian then places that sample in to a single use sample preparation device and places the device on 

the instrument. At this point the assay to be performed is automatically selected and the automated sample 

preparation process begins. The purified nucleic acid is automatically mixed with PCR reagents and the PCR 

process begins. The instrument then performs the appropriate data analysis and reports the result as a 

positive and negative test result for the test carried out, and reports the strain level identification of the 

pathogen where applicable. This entire process is performed with no user intervention and is designed to be 

performed by a person with no knowledge of molecular biology techniques. 

Results 

The overall performance of the system depends on the individual performance of the instrument, sample 

preparation and assays. Recent analysis of the performance of the PCR instrument has shown a good 

correlation with selected lab based PCR instruments, indicating a similar level of performance can be 

expected in the field. The sample preparation device was designed to take the lab based process into the 

field and automate it. Initial results indicate that the device performs as well as the original bench process. 

There are currently 2 assays being developed and validated on this platform, one to detect all seven 

serotypes of Foot and Mouth Viruses in a single tube, and one to differentiate high and low pathogenic H5N1 

Avian Influenza Virus. These assays are in development/validation using real samples in collaborating labs 

to determine their efficiency in a lab setting prior to their transfer to our field deployable platform (see 

abstracts in this volume). The platform uses a novel PCR chemistry called LATE-PCR which is able to 

identify many pathogens or strains of a pathogen in a single tube. The highly multiplexable nature of LATE- 

PCR means that a wide range of pathogens can be tested for simultaneously resulting in a simplified mode 

of operation. The system is currently being prepared for field based trials. 


“Pen side” detection systems offer the promise of rapid detection of disease allowing a more resilient 

response and more effective outbreak management. The challenge in deploying PCR based analysis 

systems in the field is the requirement for a simple, sample preparation system capable of producing good 

quality nucleic acid from a wide range of animal samples. Systems such as Smiths Detection’s “Pen Side” 

testing system may provide the means to rapidly detection disease outbreaks. 

References 

For more information please visit www.smithsdetection.com/vets 

or e-mail vets@smithsdetection.com 




THE AUSTRALIAN ANIMAL PATHOLOGY STANDARDS PROGRAM: PRESERVATION AND 

DIGITISATION OF THE COLLECTION, AND ACCESS VIA ‘NEW’ TECHNOLOGIES 

WAVLD SYMPOSIUM 2007 

C. Lenghaus, Australian Animal Pathology Standards Program; R.L. Reece*, L. Simmons NSW Department of Primary Industries. 

BACKGROUND 

The Australian Animal Pathology Standards Program (AAPSP) is managed and maintained by Animal Health 

Australia. It encompasses the former National Registry of Domestic Animal Pathology of approximately 

20,000 glass slides from 4,000 indexed cases. 

AIMS 

AAPSP is creating an immortalised library of veterinary pathology digitised images; with readily accessible 

subsets focused on particular species, tissues and lesions; and annotated individual images for selfteaching. 

RESTORATION 

A subset has been selected for digitisation but many chosen slides require renovation and repair: others 

need to be replaced. 

OUTCOMES 

CURRENT 

ROLE IN CONTINUING PROFESSIONAL DEVELOPMENT 

It is mandatory for veterinarians to undertake Continuing Professional Development, and NATA requires 

participation in professional competency assessments. For veterinary pathologists in Australia this is 

provided by AAPAP via: 

ANNUAL TRAINING COURSES prepared and delivered by Australian veterinary pathologists, and by USA 

specialists with financial assistance from the C.L.Davis Foundation for Comparative Veterinary Pathology. 

They take the format of a 2-3 days intensive workshop held in several accessible locations and deal with a 

particular subject such as dermatopathology or neuropathology. 

COMPETENCY. A quarterly Histopathology Proficiency test is available through the AAPSP. For one round, 

unstained histological slides are distributed, these slides are stained HE, examined and described, and then 

the slides and a standardised report returned for evaluation; on the alternate round a cases is scanned onto 

a DVD at multiple magnifications and it is examined and reported on. 

THE FUTURE 

Due to dispersal of veterinary pathologists around Australia and their reduced numbers and relative paucity 

of ‘free’ diagnostic cases for teaching and learning, especially by trainees, a web based system allowing 

access from office or laboratory is crucial. For NATA purposes, trainees are required to document their 

training. Options are: 

Individual cases for QA. A few digitised slides examined remotely by many sites and users. The best 

answers to judicious questions can be selected from proffered options and the answers stored and collated 

centrally. 

Teaching modules with self-instruction. Expressions of interest to prepare these have been made and some 

are in process: one on-line module prepared for a post-graduate degree course has been purchased 

already. They require enormous time and materials for preparation. It is hoped that recently retired or near to 

retirement veterinary pathologists can prepare these based on their experience and personal or employer 

archives. 

Continuing Professional Development and Help. Access to a collection of indexed digitised images of a 

particular species, disease or syndrome, so that help is obtained for a current case requiring further 

elucidation, or knowledge base is expanded.


1030 - 1230 Concurrent Session 2.4 - Quality Assurance 

LABS OF THE FUTURE 

A CULTURAL SHIFT IN CANADA FOR FOREIGN ANIMAL DISEASE (FAD) DETECTION 

D. Ridd & A. Copps, National Centre for Foreign Animal Disease, Canadian Food Inspection Agency (CFIA) 

Presenter: Dr. R.P. Kitching, Director, National Centre for Foreign Animal Disease, CFIA 

The success of a country’s capability for rapid detection of potentially epidemic animal diseases depends on 

many factors, one of which is laboratory diagnostic capacity and capability. Canada’s lab strategy under the 

Avian Influenza (AI) Pandemic Preparedness Plan brought forward the priority in 2006 to accelerate the 

plans and timelines for laboratory interoperability and to establish a national early warning system for 

perceived risks of Avian Influenza. Within 6 months, 4 federal and 7 provincial laboratories in the Canadian 

Animal Health Surveillance Network (CAHSN) were trained, equipped and approved for testing the presence 

of AI virus. The CAHSN was developed to consolidate the efforts across provincial, territorial and federal 

jurisdictions to respond to animal disease threats that could affect animal health, the food supply, or public 

health. 

Laboratory interoperability is a means towards meeting Canada’s requirements of an early warning system 

for outbreak management and emergency preparedness, planning for breaches of biosecurity and threats of 

bioterrorism. Quality Assurance (QA) Support and Laboratory Support although separate programs within 

CAHSN, are working together in achieving these goals and objectives. These programs’ are designed to 

deliver and harmonize quality assurance and laboratory systems through collaborations between 

federal/provincial animal health laboratories across Canada. The provincial laboratories as first responder 

laboratories will have the capacity and capability to rapidly diagnose foreign animal diseases, having been 

trained in FAD test methods and receiving the necessary supports towards lab infrastructure. 

The CAHSN Quality Assurance Support Program delivers support to the development of internal quality 

systems for FAD within the network laboratories with the goal of the labs achieving ISO/IEC 17025 

accreditation. Based on site evaluations, funding has been allocated to establish and aid the implementation 

and maintenance of a standardized quality management program and to support the achievement of 

ISO/IEC 17025 accreditation. Resources were provided for QA Officers, ISO training, and ongoing 

accreditation costs. The CAHSN QA Support Program Manager liaises with the Network Laboratory 

Directors, Laboratory Managers/Supervisors and Quality Assurance Officers in a consulting, advisory 

capacity and provides oversight regarding all QA aspects in network laboratories relating to FAD testing. 

The CAHSN Laboratory Support Program ensures the animal health laboratories sharebest diagnostic 

practice, particularly for the major animal diseases such as Foot-and-Mouth Disease, Classical Swine Fever, 

Avian Influenza and Newcastle Disease, and establishes common diagnostic protocols and reagents, while 

ensuring diagnostic competence is maintained by the regular distribution and evaluation of proficiency 

panels. Where necessary, new equipment is provided to allow all network laboratories to make use of the 

most sensitive and specific diagnostic tests available. The CAHSN Laboratory Support Manager liaises with 

the Network Laboratory Directors and Laboratory Managers/Supervisors in a consulting, advisory capacity 

regarding all aspects of training/certification for network labs, encompassing the areas of equipment advice 

and purchases, reagents/supplies, surge capacity issues and is directly involved in training and certification 

of analysts. 

Conclusion: 

Canada’s jurisdictional requirements for diagnostic surge capacity are being achieved through harmonization 

and standardization of quality assurance and lab interoperability. The CAHSN Quality Assurance Support 

Program and the Laboratory Support Program are integral in aiding the network laboratories in the detection 

of emerging animal disease threats which could have zoonotic potential. This capability of early diagnosis 

and control is essential to minimizing the human health and economic consequences to the country. 

Ann Copps, CAHSN QA Support Manager coppsa@inspection.gc.ca 

Deidre Ridd, CAHSN Lab Support Manager dridd@inspection.gc.ca 




LABORATORY-BASED EARLY ANIMAL DISEASE DETECTION UTILIZING A 

PROSPECTIVE SPACE-TIME PERMUTATION SCAN STATISTIC 

*C.N. Carter, University of Kentucky; A. Odoi, University of Tennessee; J. Riley, Hensley and Associates, Lexington, Kentucky; J. Smith, 

University of Kentucky; R. Stepusin, University of Kentucky; 

T. Cattoi, University of Kentucky; S. McCollum, University of Kentucky 

Introduction 

Veterinary diagnostic laboratories are in a unique position to analyze data from large numbers of clinical 

cases and to help with the early detection of health problems. The aim of this study is to develop a system 

for early detection of clusters of health events in animal populations using diagnostic laboratory data. The 

system provides near-real-time cluster alarms/alerts and medical situational awareness. Thus, it aids in the 

decision-making process related to conducting field investigations and/or mounting appropriate and timely 

medical responses. The system could, as well, be used to detect clusters of animal health events of public 

health significance (e.g. bioterrorist attacks). 


Kulldorff’s prospective space-time permutation scan statistic was utilized in this project. The method uses a 

cylindrical window of varying size to scan for potential clusters in space and time. The statistic only requires 

case health events (e.g. confirmed diagnoses, deaths), thereby eliminating the need for population-at-risk 

data. We developed an engine that automatically performs statistical analysis at the close of business each 

day. A likelihood ratio test is used to test statistical significance of potential clusters. Identified clusters are 

automatically mapped for daily epidemiological decision-making. Here we present the methodology that was 

used to detect outbreaks of bovine blackleg and equine leptospirosis which occurred in 2006-2007. 

Results 

The system successfully detected significant clusters of bovine blackleg and equine leptospirosis cases 

during the 2006-2007 outbreaks. The detection of these clusters allowed the laboratory epidemiology 

section to mount a timely awareness campaign that included email alerts, field investigations, and direct 

consults with practicing veterinarians. Although not verifiable, this campaign likely led to enhanced 

vaccination efforts against bovine blackleg and aggressive MAT titer screening of horse farms for possible 

prophylactic treatment of mares. Blackleg losses for the 2006-2007 season are estimated at over $500,000 

USD for eastern Kentucky alone. In addition, economic losses reported by 13 horse farms that experienced 

equine leptospiral abortion amounted to over $3 million USD for the 2006-2007 season alone. Earlier 

medical responses to outbreaks should result in reducing economic losses. 


The appropriate analysis of laboratory-detected animal health events can be successfully used to generate 

medical alerts which can lead to timely and appropriate responses that can improve overall health outcomes 

and reduced economic losses. Further studies will be conducted to assess the sensitivity and specificity of 

medical alerts generated by this system. 

References 

Carter CN, Odoi A: Diagnostic Laboratory Surveillance and Epidemiology: Serving Agriculture and Public 

Health, Proceed 143 rd AVMA Convention, CD-ROM, July, 2006. 

Carter CN: Equine Disease Surveillance in Kentucky, Equine Disease Quarterly, Oct, 2005, Vol. 14, No. 4, 

pp 5-6. 

Bradley CA, Rolka H, et al. BioSense: implementation of a national early event detection and situational 

awareness system. MMWR Morb Mortal Wkly Rep. 2005 Aug 26; 54 Suppl: 11-9. 

Kulldorff M, Heffernan R, Hartman J, Assuncao R, Mostashari F. A space-time permutation scan statistic for 

disease outbreak detection. PLoS Medicine 2005 March; 2(3): 216-224. 

Norström M, Pfeiffer DU, Jarp J. A space-time cluster investigation of an outbreak of acute respiratory 

disease in Norwegian cattle herds. Preventive Veterinary Medicine, 47: 107-119, 2000. 

Perez AM, Ward MP, Torres P, Ritacco V. Use of spatial statistics and monitoring data to identify clustering 

of bovine tuberculosis in Argentina. Preventive Veterinary Medicine, 56: 63-74, 2002.


DEVELOPMENT, VALIDATION AND IMPLEMENTATION OF MOLECULAR DIAGNOSTIC TESTS FOR 

IMPORTANT PATHOGENS OF FARMED ANIMALS AND WILDLIFE – A PRAGMATIC APPROACH 

*P.R. Wakeley, J. Errington, N. Johnson, C. Fearnley, M. J. Slomka, F. Yong and J. Sawyer 

Veterinary Laboratories Agency – United Kingdom 

Introduction 

We have developed a panel of molecular diagnostic tests for the detection of pathogens of farmed animals 

and wildlife to support diagnosis and surveillance activities. The tests developed include those to detect 

pathogens of farmed food animals such as a bovine viral diarrhoea virus/border disease virus (BVDV/BDV) 

and an assay to detect pathogenic leptospires. We have also developed and validated assays for the 

detection of pathogens of wildlife with zoonotic potential such as lyssavirus 1 and avian influenza, as well as 

assays to support the horse industry e.g. for the detection of Taylorella equigenitalis 2 the causative agent of 

contagious equine metritis (CEM). Molecular diagnostics offer the advantage over traditional “gold standard” 

technologies of viral or bacterial culture in that they are rapid, allow differentiation of closely related species 

and are not reliant on the presence of viable pathogen. 


The tests developed make use of real-time polymerase chain reactions using fluorescence detection, either 

TaqMan or FRET. Where possible the assays have been validated against the accepted “gold standard” test 

which generally involves culture methods. However, we have found that culture techniques are either 

expensive to perform and can be substituted by inexpensive tests such as antigen ELISA e.g. for BVDV, or 

the confirmatory test is extremely lengthy to perform such as culture of leptospires (36 weeks) requiring other 

confirmatory tests of positive PCRs e.g. nucleic acid sequencing. Assays have been characterised with 

respect to analytical and diagnostic sensitivity and specificity as well as repeatability and robustness in 

comparison to the standard assays and have also been field trialled. In most instances we have taken a 

pragmatic approach to field validation as sufficient positive samples have not been available. One of the key 

limitations to successful performance of a PCR test is the efficient extraction of nucleic acids. Control assays 

have been developed to detect either RNA transcripts from the host, based on β-actin expression or for 

bacterial pathogens, such as leptospires and T.equigenitalis, real time detection assays based on the 

generic 16S rDNA of eubacteria. These controls are crucial for assays where the specimen cannot be resampled 

e.g. cloacal swabs from live captured wild birds for avian influenza surveillance, and provide 

confidence that the extraction component of the assay is performing optimally. Automated extraction of 

nucleic acids has been implemented to reduce contamination and “hands on time” for both the BVDV/BDV 

assay where we have used the lower throughput MagNApure (Roche) and avian influenza virus assays 

where we have used the higher throughput BioRobot 96 (QIAGEN). 

Results 

Field validation of several assays has led to novel and interesting findings. The first BVDV genotype 2 in the 

UK, BVDV in alpaca in the UK and the first border disease virus in cattle were discovered during the 

validation process of the BVDV/BDV TaqMan assay. Using the lyssavirus assay a number of European bat 

lyssavirus genotype 2 have been found in bats in the UK, including in an urban area close to the VLA. 

Implementation of the CEM assay has not only allowed detection of the reportable bacteria in infected 

horses in transit but due to the ability of the assay to discriminate T.equigenitalis from a closely related 

Taylorella species has led to changes in the controls used for culture purposes in our laboratories. The 

leptospire PCR has been successfully used to detect and trace pathogenic leptospire in a human case of 

leptospirosis and has also led to discussion of the impact of these bacteria on bovine abortion in the UK due 

to the low numbers of positives detected using the PCR. 


The design and development of molecular tests for animal pathogens is not time consuming and costly; the 

validation of such tests most definitely is. Due to time constraints, the non-availability of appropriate 

confirmatory tests and the lack of suitable field samples, a pragmatic approach must be adopted to 

validation. Wherever possible internal controls should be implemented for not only the control of the 

amplification process but also the extraction. Validation processes in our experience can frequently lead to 

the discovery of novel scientific findings. 

References 

(1) Wakeley et al. J. Clin. Microbiol. 2005. 43 (6):2786-2792 

(2) Wakeley et al. Vet. Microbiol. 2006. 118 (3-4):247-254 




QUALITY ASSURANCE AND CONTROL ISSUES WITH PCR AS A DIAGNOSTIC TOOL 

J. Oakey, Biosecurity Queensland, Tropical and Aquatic Animal Health Laboratory, Department of Primary Industries and Fisheries 

This aims to be a discussion of the quality assurance principles and current issues with the use of molecular 

biology techniques as tools for veterinary diagnosis. 

Detection of identifiable nucleic acid rapidly has become commonplace in veterinary diagnostic laboratories, 

presenting a number of significant advantages over conventional techniques. These methods are often 

faster, and more sensitive and specific. However, the routine use of what were so recently considered as 

research tools may be prone to over-reliance and lack of adequate quality management, quality control and 

overall quality assurance. It is essential that such techniques are demonstrated to be at least as reliable and 

“fit-for-purpose” as conventional methods if the test results are to be universally accepted. 

Standard regulations, manuals and official guidelines are increasingly being implemented. These will greatly 

assist in ensuring the reliability of the test results through standardisation of procedures, techniques, level of 

facilities and control of this powerful technology. It is thought that these guidelines will continue to form the 

basis for accreditation, validation and demonstration of proficiency of testing laboratories. 

This presentation will describe some of the current and draft guidelines in the context of using nucleic acid 

amplification (in the form of polymerase chain reaction) as diagnostic tools in veterinary laboratories and as 

prescribed tests for international trade. Practical issues that may affect quality assurance, application and 

standardisation of these techniques, and are yet to be addressed by standard documentation, will be 

identified from a laboratory implementation perspective. These concerns include availability of reagents and 

equipment on an international basis, inter-changeability of reagents and equipment, interpretation of 

methodology, geographical variations in target organisms and reactivity, and variations in accreditation 

standards. 

The processes of PCR will be discussed with application of a HACCP-like approach to identifying critical QA 

points affecting accuracy, reproducibility, and contamination control. Critical control points will be identified 

that may contribute to problematic standardisation between laboratories. In this context PCR will be split into 

pre-processing; sample processing / nucleic acid extraction; reaction mix preparation; adding template 

material to reaction mix; running a reaction; post-amplification processes; and post-amplification analyses. 

Each of these stages will be discussed with identification of perceived critical control points that may 

contribute towards reproducibility and standardisation concerns between laboratories.

Introduction 


A REVIEW OF TRAINING IN MOLECULAR DIAGNOSTIC TECHNIQUES 

FOR AVIAN INFLUENZA IN SOUTH EAST ASIA 

L. I. Pritchard 1 , A. Foord 1 , T. Taylor 1 , A. Axel 1 , R. Lunt 1 , J. Hammond 1 , 

C. Groocock 3 , L.H. Lauerman 2 and P.W. Daniels 1 

1 CSIRO Livestock Industries, Australian Animal Health Laboratory (AAHL) Geelong, Australia 

2 P.O. Box 189 East Olympia, WA 98540-0189, USA 

3 1030 West Creek Ave Cutchogue NY 11935, USA 

The ability to control avian influenza (AI) is critically dependant on the speed and accuracy of both 

epidemiology and diagnosis. For this reason AusAid and APHIS/USDA funded projects were initiated to 

provide training for diagnosis and epidemiology to scientists from South East Asian countries. Starting in 

early 2006, training courses for molecular diagnosis of AI were developed and conducted in Australia, 

Indonesia, Philippines and Taiwan. Under these projects diagnostic staff were trained in epidemiological, 

serological and molecular techniques (including real-time qRT-PCR and conventional RT-PCR). The 

scientific participants involved came from Indonesia, Cambodia, Thailand, Philippines, Vietnam, Sri Lanka, 

India and Taiwan. 

Methods 

The setup and workflows for real-time PCR laboratories were the major focus of the technology transfer and 

training, however advice was also given with regards to other procedures such as biosecurity. The training 

was both in-house and multiple visits to each Indonesian DIC lab. The real-time RT-PCR techniques were 

designed at AAHL and run on Applied Biosystems 7500 real-time machines as described by Heine et al, 

2007. 

Results 

During this short period we were able to; 

1. Provide training to about 80 scientific staff from South East Asian countries, including Indonesia, 

Cambodia, Thailand, Philippines, Vietnam, Sri Lanka, India and Taiwan. 

2. Develop a proficiency test program in AI real-time RT-PCR for use in Indonesian labs. 

3. Implement a novel purchasing system for Indonesian labs to enable them to access reagents 

for molecular diagnosis of AI. 

4. Evaluate different real-time PCR methodologies and machines for AI diagnosis. 


This AusAid/USDA-funded project for the technology transfer of Avian Influenza (AI) real-time PCR tests was 

developed at the Australian Animal Health laboratory (AAHL). The project involved; an initial gap analysis of 

the facilities at eight laboratories in Indonesia, and training of South East Asian scientific staff at AAHL, in 

Indonesia and in Taiwan. 

Training for scientific staff from other South East Asian countries was also sponsored by the USDA – FAS, - 

APHIS, American Institute in Taiwan (AIT), AAHL/CSIRO and Animal Health Research Institute in Taiwan. In 

Indonesia a program was carried out between February and June 2007 for the diagnosis by real-time PCR of 

AI Type A, H5 and H7 viruses. Initially training was done at AAHL for scientific staff from Indonesia and 

proficiency test programs were developed and dispatched. Many factors were shown to affect the accuracy 

of molecular diagnosis with laboratory setup, workflows, quality controls, difficulties with reagents and the 

competency of the staff being the major focus areas. We also undertook a limited evaluation of the methods 

used for AI training carried out in Taiwan between May and June 2007. Scientists from Indonesia, India, Sri 

Lanka, Vietnam, Cambodia, Thailand, Philippines and Taiwan undertook an intensive, two week course 

which involved both real-time and conventional RT-PCR, serology and virus isolation. 

Findings revealed that the accuracy of molecular diagnosis can be significantly affected by a number of 

factors including sample workflows and storage conditions, but especially the methods used for nucleic acid 

extraction, cDNA synthesis and PCR amplification. We present the results of this evaluation and training. 




DEVELOPMENT AND CONSOLIDATION OF AN EQA PROGRAMME FOR THE MOLECULAR 

DIAGNOSIS OF AVIAN INFLUENZA 

Halpin, K., Heine, H., Johnson M., Stevens, V., Trinidad, L., Davies, K. and Selleck, P. 

CSIRO 

Australian Animal Health Laboratory 

Background: In 2006, avian influenza (AI) TaqMan RT-PCR assays which were developed at the Australian 

Animal Health Laboratory were transferred from AAHL to several international and state veterinary 

diagnostic laboratories. In order to support the implementation of these assays and provide the laboratories 

with the ability to assess their capability to perform the assay to an outcome consistent with other 

laboratories performing the same test, a proficiency testing program was established. 

Methods: Participating laboratories were provided with protocols, technical information and support to 

implement the AI TaqMan assays. All laboratories implemented the Influenza Type A TaqMan assay and the 

H5 TaqMan assay. Over the next 8 months, four proficiency testing panels were distributed to ten 

laboratories, including state, national and international laboratories. Each panel contained blind coded 

samples representing a range of concentrations of the pathogen, as well as material derived from an 

uninfected source for test evaluation. Test results were analysed and critical parameters from the different 

instrument platforms were identified in consultation with the participating laboratories. 

Results: A national proficiency testing program containing high and low positive, negative and replicate 

samples has been implemented to monitor the performance of AI TaqMan RT-PCR. Management of this 

proficiency program has been transferred to the Australian National Quality Assurance Program (ANQAP). 

Standard operating procedures for these assays and test validation data collected from this program have 

been submitted to the Australian Subcommittee on Animal Health Laboratory Standards (SCAHLS).


HOW USEFUL ARE TEST KITS WHEN APPLIED IN DIFFERENT TARGET POPULATION: PRODUCER 

AND END-USER RESPONSIBILITIES FROM A DEVELOPING COUNTRY PERSPECTIVE 

Diagnostic kits provide the advantage of quality assured reagents combined in a package with proper quality 

assurance and result evaluation tools. Their defined fitness for purpose and diagnostic sensitivity/specificity 

help to design appropriate (field) studies and to calculate a predictive value for an individual result. 

In order to obtain valid results several prerequisites have to be met. It is the obligation of the producer to 

design the assay in a robust and rugged way, i.e. taking transport and storage problems, but as well 

laboratory and equipment conditions into account. Manuals must be suitable for proper test performance and 

include background information to help trouble shouting. The result interpretation strategy should be decided 

before the final test design, should be validated in the field and data made available and must compensate 

for intrinsic variations. 

The end user has to define the needed fitness parameters before selecting a kit, check whether he can 

collect specimen as required, is technically capable to perform accurately all steps, monitors continuously the 

performance and finally evaluate the results by statistic means to verify the validity of results. 

Unfortunately it is not easy for end users to obtain the necessary information and for producers to meet all 

requirements. 




LABORATORY MANAGEMENT TECHNIQUES FOR RESPONDING TO CLIENT DEMANDS: 

DIAGNOSIS OF SWINE PNEUMONIA 

Mark M Williamson 

Gribbles Veterinary Pathology, 

1868 Dandenong Rd, Clayton, Victoria, Australia, 3168 

Clients require value from all diagnostic laboratory submissions. Accordingly, the two most important 

objectives of a diagnostic laboratory should be to provide accurate repeatable results and written reports that 

can be interpreted, understood and valued by the client. This talk discusses biosafety, biosecurity, education 

and communication techniques to improve sample quality and client satisfaction using examples of swine 

pneumonias as a case study. 

Clients submitting samples for Hemophilus parasuis, Actinobacillus pleuropneumonia (APP), Mycoplasma 

hyopneumoniae and viral pneumonias, from field necropsies, need clear instructions on the criteria for good 

quality sample collection, packaging, transportation and if transported by air, IATA regulations. Submitters 

are counselled in collection of potential zoonotic agents, such as Streptococcus suis type 2, which should be 

handled with care. Submitters are encouraged to contact the laboratory before submitting urgent samples or 

to discuss specific requirements for difficult cases. There needs to be discussion between the client and the 

laboratory about the purpose of the diagnostic submission: disease investigation, specific disease exclusion 

or disease surveillance. Communication between laboratory and client is essential to generate realistic 

expectations and understanding of the test requirements, purpose and test limitations. In particular, 

difficulties in communicating issues such as sensitivity, specificity, disease prevalence and measurement of 

uncertainty must be addressed. In swine pneumonias, examples of these differences include Mycoplasma 

hyopneumoniae antibody ELISA has a sensitivity of 47-60% and specificity of 97-100% and APP antibody 

ELISA, approximate sensitivity of 95% and specificity of 99%. 

Diagnostic laboratories should be able to provide the following: 1. The single and most important objective of 

a laboratory is to make a rapid and accurate diagnosis of pneumonia. 2. The ability to investigate cases of 

atypical or unusual clinical presentations of pneumonia beyond the initial diagnosis. Possibly identifying new 

agents or disease processes. 3. A prime objective of laboratories is to provide technical and strategic advice 

to clients, professional colleagues in other laboratories and to Government regulatory bodies. 4. Classical 

swine fever can cause an interstitial pneumonia, but has lesions in other organs. It is essential to consider 

that pneumonia cases should not be considered in isolation alone and that important systemic diseases can 

lead result in lung lesions. 5. A laboratory needs to be continually adopting new diagnostic methods and 

tests for the diagnosis of swine pneumonias. 6. Longevity and retention of staff should be an aim of the 

laboratory and is often a barometer of staff morale. Therefore recruitment of staff with the appropriate 

qualifications and with the attitude of working in a co-operative team environment is essential. A high 

caseload of swine pneumonia cases allows staff to develop and maintain their diagnostic skills. The 

provision of continuing professional development can be used to provide non-salary rewards to professional 

staff. 7. Laboratories should where applicable contribute to national surveillance programs that provide 

market assurance, export testing certification, and swine meat product integrity. 8. Laboratories need to hold 

accreditation by national and, where appropriate, international accreditation schemes, working with good 

laboratory practice and participating in external proficiency testing programs. These key management 

objectives can and should be assessed by external stakeholders surveys. Laboratories need to be 

continually improving their management and efficiency to provide the best possible advice to their clients or 

risk being 'out of touch' and underutilised.


1330 - 1500 Concurrent Session 1.5 - Diagnostic assays - ELISA & molecular 

COMPLETE SEQUENCE ANALYSES OF THE GENOME OF EPIZOOTIC HAEMORRHAGIC DISEASE 

VIRUS (EHDV): THE DESIGN OF DIAGNOSTIC ASSAYS. 

Anthony, SJ*; Maan, N; Maan, S; Attoui, H; Darpel, K; Mertens, P.P.C 

Introduction: 

EHDV is an infectious, non-contagious arbovirus. It is transmitted between domestic and wild ruminants via 

heamatophagus midges of the Culicoides spp and can cause clinical disease in both wild and domestic 

species. The objective of this study was to generate a sequence database for all ten genome segments of 

EHDV for molecular epidemiology studies, and for the design of improved methods of diagnosis. 

Methods: 

Full length sequences were generated for all 10 genome segments using the anchor-primer method 

developed by Maan, Rao et al (2007). Initial sequence was achieved using the anchor primer, and 

completed by gene-walking. 

Results: 

Full-length nucleotide sequence analyses and phylogenetic comparisons were completed for the entire 

genome of eleven EHDV reference strains. These included isolates from each known serotype, and different 

geographic origins (: www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ ReoID/EHDV-isolates.htm ). This 

represents the first complete sequence database for EHDV for molecular epidemiology studies. The 

sequences of genome-segments 2 and 6 (encoding outer-capsid protein VP2 and VP5) are discussed in 

another abstract. The level of variation and phylogeny in each genome segment was assessed. In many 

cases the results mirror groupings seen in the bluetongue viruses. 

Conserved sequences within specific genome segments were used to design EHDV species/serogroupspecific 

diagnostic assays (RT-PCR based). The assays targeting genome-segment 7 (encoding VP7, the 

outer core protein and major EHDV species/serogroup specific antigen) were used to identify EHDV from 

disease outbreaks in domestic cattle over the past 2-3 years, caused by EHDV-6 in Morocco, Algeria, and 

EHDV-7 in Israel. These diagnostic assays were evaluated for detection of diverse strains of EHDV, and for 

specificity using strains of other closely related Orbivirus species. 

Conclusion: 

RT-PCR assays targeting conserved genome segments were developed to detect and identify EHDV. 

Sequence analyses can also be used to indicate the geographic origins of an isolate. 

*Presenting author 




NEW APPROACHES IN MOLECULAR AND SEROLOGICAL DIAGNOSIS OF AFRICAN SWINE FEVER 

(ASF) ON NEW EMERGING VARIANTS. 

C. Gallardo 1, 2 , R. Bishop 2, D. M. Mwaengo 3 , E. Martin 1 , J. M. Macharia 4 , and M. Arias 1 . 

1 OIE Reference Laboratory for African Swine Fever, CISA-INIA, Valdeolmos, Madrid, Spain; 

2 International Livestock Research Institute (ILRI), Kabete, Nairobi (Kenya) 

3 Dep. Of Medical Microbiology, College of Health Sciences, University of Nairobi (Kenya). 

4 Central Veterinary Laboratory, Kangemi, Nairobi (Kenya) 

1. Introduction and Objectives 

African swine fever (ASF) is a highly contagious swine viral disease with very high mortality. ASF is prevalent in more than 20 sub- 

Saharan African countries, and since 1999, Italy was the only European country with reported outbreaks in Sardinia. However, on June 

2007, ASF outbreaks were described throughout Georgia and Armenia with a significant mortality. The source of infection seems to be 

from Eastern of Southern Africa. From this situation one of our main objectives has been focused on molecular characterization of 

emerging variants of ASFV, as well as to study the suitability of current serological diagnostic tools that enable the detection of 

antibodies to a wider range of ASF viruses. We report the molecular characterization on ASF isolates collected from last outbreaks in 

Kenya by a first genotyping sequencing of the gene encoding VP72 (Bastos et al., 2003) and VP54 antigenic proteins to place isolates 

into major subgroups, following by sub-typing analysing three variable regions of the ASFV genome marked by the presence of tandem 

repeats sequences (TRS). These dates were correlated with the serological results obtained from sera collected in the same outbreaks 

using the current serological ELISA tests. 

2. Material and methods 

ASF antibody detection; For the detection of antibodies the indirect ELISA and IB test described in the OIE Manual of diagnosis (OIE, 

2004) were used. The INGENASA ELISA commercial kit Ingezim PPA Compac (11.PPA k3) and the recombinant ELISAs previously 

described by Gallardo et al 2006, were also used for comparison. 

ASF virus detection; DNA was extracted from tissue, ticks samples homogenates and sera using a nucleic acid extraction kit 

(Nucleospin/ Machery-Nagel –Cultek) following the manufactures procedures. A PCR assay using the ASF diagnosis primers 

PPA1/PPA2 was used to confirm the presence of ASFV DNA (Agüero et al., 2003; Chapter 2.1.12 OIE 2004). 25 Kenyan ASFV isolates 

from domestic pigs and 10 Kenyan ASFV isolates from ticks were isolated, prior to characterization, after three passages in leukocytes 

as described previously (Malquimst W.A. et al., 1960). 

DNA sequencing and molecular characterization; p72 genotyping was achieved by PCR as described Bastos et al 2003. The complete 

gene encoding VP54 protein was amplifying by PCR using the primer set PPA89-PPA722 (Gallardo et al p.c). For amplifying the TRS 

by PCR, different set of primers were selected (Nix et al 2006). PCR products were excised and purified by Quiaex gel extraction 

(QUIAGEN) and sequenced using an automated sequencer 3730 DNA analyzer” (Applied Biosystems). Sequence alignment was 

performed with the CLUSTAL W package and the phylogenetic and molecular evolutionary analyses were conducted using MEGA 4.0. 

More than 100 ASF viruses available in our institute and in GENBANK of the XXII previously identified p72 genotypes were included for 

phylogenetic analysis purposes. 

3. Results. 

ASF antibody detection; a total of 105 sera collected in Kenya were analyzed, 86 obtained from healthy domestic pigs in a surveillance 

programme performed in Nairobi’s slaughterhouse (2005) and 19 from the last outbreaks occurred in 2006-2007. The results obtained 

analyzing 105 serum samples have been negative on antibody detection for all techniques. 

ASF molecular characterization; ASFV Kenyan isolates were first genotyped by partial p72 gene characterization. 13 ASFV Kenyan 

isolates collected in the last outbreaks occurred in 2006-2007 were classified into genotype IX which comprises exclusively domestic pig 

strains. However, ASFV Kenyan viruses from ticks (10) and from sera (12) collected in a surveillance programme performed in Nairobi’s 

slaughterhouse (2005) were placed into genotype X associated with a sylvatic cycle. The same result was obtained sequencing the 

complete gene that encodes the p54 protein. Although the p72 and p54 genes are useful for identifying the major genotypes, higher 

resolution of virus relationships is required to uncover epidemiological links. To this end, sequences of three variables regions 

characterized by the presence of TRS were generated from Kenyan isolates. The results obtained from ASFV Kenyan isolates 

collected in the outbreaks occurred in 2006-2007 showing a high degree of homology with the last viruses characterized in Uganda in 

2003 placing in the same group. However between the ASFV isolates characterized in this study associated to p72 genotype X, a high 

variability was found, revealing different groups between Kenyan isolates due to the absence of TRS. 

4. Discussion and Conclusions 

ASF serological surveillance performing in Kenya has shown low seroprevalence of seropositive pigs in parallel to the high incidence of 

ASF virus-positive animals. These findings seems to be related with the results obtained typing the Kenyan isolates reflecting the cocirculation 

of different variants of ASFV in Kenya with a significant variability in antigenic proteins used as antigens in ELISA tests like 

VP72 or VP54. The molecular characterization on ASFV Kenyan isolates may suggest the presence of two different epidemiological 

patterns. The first one is associated with the last outbreaks occurred in Kenya where pig-to-pig cycle is present exemplified by p72 

genotype IX with a high degree of homology with Ugandan isolates. This fact suggests that the disease may have been introduced 

recently in Kenya-Uganda border district either through swill from boat or plane, through pork products, or through live pigs. A genetic 

feature of a domestic pig cycle appears to be a pronounced lack of genetic variation analysing the TRS with most isolates being 

identical to each other. The other epidemiological pattern is related with the ASFV Kenyan isolates obtained from healthy pigs and ticks 

placed into a p72 genotype associated with a sylvatic cycle. In this genotype a high intragenetic variability has been demonstrated 

analysing TRS suggesting that the disease has been maintained in Kenya in an endemic form between argasid ticks, wild or domestic 

pigs. Both the sylvatic and domestic pig cycles appear to play an important role in the epidemiology of ASF in Kenya with multiple 

genotypes within country that must be considered to develop a robust ASF antibody detection method. 

5.References 

1. Bastos A.D.S. et al., (2003). Arch Virol 148 (4), 693-706. 

2. Agüero M. et al, (2003). J Clin Microbiol, Sept p. 4431-4434. 

3. Malmquist and Hay (1960). Am. J. Vet. Res. 21, 104-108. 

4. Nix et al., (2006). Arch Virology Dec; 151(12):2475-94.


RAPID HIGH-THROUGHPUT REAL-TIME RT-PCR TESTING FOR PRRSV: 

PROBLEMS AND SOLUTIONS 

*K. Harmon, A. Chriswell, K. Behrens, R. Hansell, K-J. Yoon, Veterinary Diagnostic Laboratory, 

Iowa State University, Ames, IA 

Introduction 

Use of real-time PCR has escalated due its sensitivity, specificity and rapidity. At ISU-VDL, porcine 

reproductive and respiratory syndrome virus (PRRSV) RT-PCR increased from 1685 tests in 1999 to almost 

30,000 in 2006. Increasing sample throughput without sacrificing test quality has been a major goal. 

Another objective has been improving our PRRSV RT-PCR test, as we encounter strains that are not 

recognized by our primer/probe set, resulting in false negatives, due to a high viral mutation rate. To 

address these issues, we have assessed different extraction methods for higher test capacity, and have 

evaluated a commercially available kit for real-time RT-PCR (rRT-PCR) testing for PRRSV. 


RNA extractions were performed using the QIAamp ® Viral RNA mini kit (Qiagen) or the Applied 

Biosystems/Ambion MagMAX ® Viral RNA kit, manually and in conjunction with the Kingfisher 96 ® Magnetic 

Particle Processor (Thermo Scientific). The rRT-PCR was performed with ISU’s in-house ORF7 assay, 

using TaqMan Fast PCR Universal Mastermix coupled with Multiscribe Reverse Transcriptase and RNase 

inhibitor (all from Applied Biosystems) or with the AgPath-ID ® NA/EU PRRSV Multiplex Reagent kit (AB 

Ambion). Reactions were run on the Cepheid ® SmartCycler or Applied Biosystems 7500 Fast ® instrument. 

Confirmatory gel-based RT-PCR was performed using the first-stage of the gel-based assay (ORF7 target) 

described by Christopher-Hennings et al (1995). 

Results 

Comparison between column and magnetic bead extraction on serum, lung and nasal swab for PRRSV virus 

indicated that the latter method consistently performed as well as, or better than, single column extraction, 

yielding comparable or, in most cases, lower Ct values. We also evaluated use of the Kingfisher ® Magnetic 

Particle Processor in conjunction with the magnetic bead kit (n=89). Ct values were, in the majority of cases, 

equivalent or lower with the extracts obtained with the use of the magnetic particle processor, and RNA 

extraction time for 96 samples decreased to less than 1.5 hours. 

Results from the AgPath-ID ® kit were compared to those from our in-house PRRSV rRT-PCR test and a 

previously published gel-based PRRSV RT-PCR test. Initially, all samples (n = 175) were tested with both 

real-time assays. Samples yielding discrepant results were subjected to gel-based RT-PCR. All samples 

that were positive with the ISU rRT-PCR were also positive by the AgPath-ID ® kit (n = 66). However, ISU 

rRT-PCR was negative on some samples which were positive by the AgPath-ID ® kit (n=38). In all clinical 

cases where the AgPath-ID ® kit detected PRRS viral RNA but the ISU real-time assay did not (n = 12), 

PRRSV RNA was confirmed with the gel-based RT-PCR assay. 


A purported benefit of real-time PCR is its high degree of specificity, which may be an advantage but can be 

a drawback to rRT-PCR testing for certain agents. In the case of RNA viruses, which undergo a high 

mutation rate, targets that were chosen because of their highly conserved nature can also undergo changes 

and fail to be recognized by the primer/probe set. Several times since implementing rRT-PCR testing for 

PRRSV, our laboratory has needed to redesign the primer/probe set to compensate for the genetic changes 

we have observed in PRRSV field strains. In this study, we evaluated the AgPath-ID ® NA/EU PRRSV 

Multiplex Reagent kit (Applied Biosystems Ambion), which detects both North American and European 

PRRSV strains simultaneously. This kit contains 2 different primer/probe sets for each of the PRRSV 

genotypes, enhancing detection of viral field strains. 

Coupling this kit with a 96-well magnetic bead extraction and magnetic particle robot allows our laboratory to 

increase sample capacity, decrease sample preparation time (total time required for testing 96 samples is 

less than three hours) and maintain test integrity. Use of this technology has enabled our laboratory to meet 

the demands of our clients, generating rapid, high quality results from large sample numbers. 

References 

Christopher-Hennings, J. et al., 1995. Detection of Porcine Reproductive and Respiratory Syndrome Virus in 

Boar Semen by PCR. J Clin Microbiol. 33(7): 1730-1734. 




DEVELOPMENT AND INITIAL EVALUATION OF A LATERAL FLOW DEVICE FOR THE RAPID 

DETECTION OF CONTAGIOUS BOVINE PLEUROPNEUMONIA. 

R. D. Ayling 1* , C. P. Churchward 1 , J. Flint 2 , C. Danks 2 , I. Humbert 2 , E. Hashem 2 , R. A. J. Nicholas 1 . 

1 Mycoplasma Group, Statutory and Exotic Bacterial Diseases Department, Veterinary Laboratories Agency, Woodham Lane, 

Addlestone, Surrey. KT15 3NB. 

2 Foresite diagnostics, Central Science Laboratory, Sand Hutton, York YO41 1LZ. 

Introduction 

Mycoplasma mycoides subspecies mycoides small colony type (MmmSC) is the causative organism of 

contagious bovine pleuropneumonia (CBPP), which is an economically important disease that is endemic to 

many sub-Saharan African countries. In Africa mortality rates of cattle affected by CBPP are typically 

between 10-70% and it is highest in newly affected regions (Egwu et al., 1996). Many factors affect the 

failure to control the disease. Nomadism and the trekking of trade cattle together with economic weakness 

and political and military disturbances have made movement restrictions and other control measures difficult. 

Vaccination campaigns have generally been unsuccessful (Rweyemamu and Benkirane, 1996). There are 

also a lack of diagnostic tools and an epidemiological surveillance network. Currently diagnosis is based on 

a complement fixation test (CFT) or a cELISA, both of which are known to have reasonable specificity but 

low sensitivity. These tests also need to be performed by skilled technicians in a laboratory that can often be 

hundreds of kilometres away from an outbreak. Serological diagnostic tests that can be performed near to 

the animal would help with the diagnosis of CBPP thus facilitating action that may help towards controlling 

the spread of CBPP. We report on the development of a lateral flow device (LFD) that will support the rapid 

diagnosis of CBPP in ‘the field’. 


Earlier and ongoing work has focussed on the production of a rapid latex agglutination test (LAT) (Ayling et 

al., 1999). The LAT was developed using a carbohydrate extract from MmmSC and has been successfully 

used in ‘the field’ and in the laboratory on whole blood and serum. A further development of this test using a 

similar antigen is the LFD. The test utilises similar latex technology but includes the test and control within 

one slide. Serum or blood samples are diluted in a prepared buffer and 75 µl is added to the slide. Within a 

few minutes a single line develops if the sample is negative and two lines if the sample is positive. These 

lines can easily be seen but the LFD can also be read using a handheld battery operated device that will give 

an unambiguous reading. The test has been optimised using CBPP positive and negative samples as well 

as potentially cross-reacting Mycoplasma bovis positive serum. This test has been evaluated in the 

laboratory and is currently being tested in Africa. 

Results 

Using a bank of CBPP positive and negative control serum, the LFD has given comparable results to those 

obtained using other serological tests. In some cases detecting infection earlier and for longer periods in 

experimentally infected animals than the CFT and cELISA. Tests on whole blood have also been 

successful, giving the same results to those obtained from serum. 


The LFD test is easy to perform, stable, relatively cheap and quick with results being obtained within a few 

minutes. Use of the electronic reader gives a % titre in comparison with the anti-species control line, thereby 

giving further opportunity to quantify the test to give defined cut-off points. This LFD rapid pen-side test has 

the potential to resolve the problems of diagnosing CBPP in remote areas of Africa. 

References 

Ayling, R. D., Regalla, J., Nicholas, R. (1999). A field test for detecting antibodies to Mycoplasma mycoides 

subsp. mycoides small colony type using the latex slide agglutination test. In: COST 826 Agriculture and 

biotechnology. Mycoplasmas of ruminants: pathogenicity, diagnostics, epidemiology and molecular genetics. 

(Stipkovits, L., Rosengarten, R., Frey, J. eds.) Vol III pp.155-158 European Commission, Brussels. 

Egwu, G. O., Nicholas, R. A. J., Ameh, J. A., Bashiruddin, J. B. (1996). Contagious Bovine 

Pleuropneumoniae: An Update. Veterinary Bulletin. 66: 9, 875-888. 

Rweyemamu, M. M., Benkirane, A. (1996). Global impact of infections with organisms of the “Mycoplasma 

mycoides cluster” in ruminants. In: COST 826 Agriculture and biotechnology. Mycoplasmas of ruminants: 

pathogenicity, diagnostics, epidemiology and molecular genetics. (Frey, J. Sarris, K. eds) pp. 1-11. European 

Commission, Brussels.


1330 - 1500 Concurrent Session 2.5 - Biosecurity, IT, & LIMS 

BENEFITS REALIZED FROM THE FIRST BIOSAFETY LEVEL 3 LARGE ANIMAL NECROPSY FACILITY 

IN A STATE DIAGNOSTIC LABORATORY IN NORTH AMERICA 

S. D. Fitzgerald 1 and W. M. Reed 2 

1 Diagnostic Center for Population & Animal Health, Department of Pathobiology & Diagnostic Investigation, Michigan State University, 

Lansing, MI 48910 USA 

2 School of Veterinary Medicine, Purdue University, West Lafayette, IN 47907 USA 

Our objective is to illustrate the benefits realized from opening the first Biosafety Level 3 (BL3) large animal 

necropsy facility in any state diagnostic laboratory in North America. In the spring of 2004 the DCPAH was 

completed with $58 million funding from the state legislature of Michigan. The need for this facility grew out 

of the recognition of the increasing importance of zoonotic and emerging diseases in animals. Specifically 

the diseases of interest included bovine tuberculosis, chronic wasting disease, and neurologic viruses such 

as West Nile virus, eastern equine encephalomyelitis, and rabies infections. The DCPAH houses all current 

diagnostic disciplines such as necropsy, histopathology and immunohistochemistry, bacteriology, virology, 

parasitology, nutrition, endocrinology, toxicology and immunodiagnostics; but also includes space for our 

partners in disease surveillance, the MI Departments of Natural Resources and Agriculture. 

During the last three and one half years of operation this 152,000 gross square feet facility has utilized each 

of its 5 necropsy floors, 4 biosecure cattle holding facilities, BL3 microbiology laboratory, incinerator, and 

liquid waste treatment equipment, to deal with several existing and emergent infectious disease problems. 

Features specific to BL3 will be illustrated and highlighted. Some of these features include double door 

entries for personnel and animals, coded keypads to prevent non-approved personnel access, HEPA filtering 

of incoming and outgoing air, negative air pressure in the BL3 areas relative to the rest of the facilities, 

treatment of waste water under specific conditions of temperature and pressure, and high temperature 

incineration to inactivate bacteria, viruses and prions. To date we have processed over one thousand cattle 

and tens of thousands of deer for bovine tuberculosis, thousands of deer for chronic wasting disease, 

thousands of sheep for scrapie, hundreds of neurologic horses, and thousands of birds and wild mammals 

for West Nile virus. In addition to improved bio-security for protecting the health of our faculty, staff and 

veterinary students, this facility also has promoted a closer working relationship with our government 

partners resulting in rapid recognition and response to newly emerging disease conditions. 

In summary, these new BL3 level laboratory facilities have resulted in greater safety for workers, greater 

containment of infectious agents, as well as providing for a closer and better working relationship amongst 

the various animal disease control groups in the state of Michigan. 




LINKING MULTIPLE VETERINARY LABORATORY INFORMATION MANAGEMENT SYSTEMS TO 

SUPPORT THE NATIONAL ANIMAL HEALTH LABORATORY NETWORK 

The National Animal Health Laboratory Network (NAHLN) currently involves more than fifty veterinary 

diagnostic laboratories throughout the United States of America and is dependent on real time reporting of 

diagnostic test results using standardized and secure techniques. This presentation will focus on the history, 

requirements analysis and current design of the information technology infrastructure which supports the 

NAHLN and the challenges we have worked through to implement a scalable network and database system 

which allows diverse laboratory information systems to provide timely and consistent data. 

Four years ago, a small group of veterinary diagnostic laboratories representing the American Association of 

Veterinary Diagnostic Laboratories (AAVLD) worked collaboratively with the USDA APHIS VS National 

Veterinary Service Laboratories (NVSL) and the USDA APHIS VS Centers for Epidemiology and Animal 

Health (CEAH) to conceptualize an approach to sharing data. The group envisioned an approach to 

aggregating information using processes independent of the type or version of Laboratory Information 

Systems in use by veterinary diagnostic labs, and establishing standards which would allow analysis of the 

data. 

The concept was proven successful in a pilot project and lessons learned from the pilot project and 

application of the approach to an on-going surveillance program were used as the basis for implementing the 

first version of the NAHLN Information Technology System. 

The design and lessons learned from the implementation of the information technology system which now 

supports the National Animal Health Laboratory Network are independent of factors specific to the United 

States and will be shared through this presentation with the anticipation that that they will be beneficial to 

other countries. Anticipated future functionality will also be identified. 

It is also hoped that this same approach may lead to the possibility of the real time sharing of Veterinary 

Diagnostic Laboratory Information internationally in the near future. With that as a potential goal, benefits of 

such sharing of real time international data will also be identified.


IMPLEMENTATION, FUNCTION AND BENEFITS OF A LABORATORY INFORMATION MANAGEMENT 

SYSTEM IN A NATIONAL VETERINARY LABORATORY SERVICE. 

Author: *Paul M. Collery, Irish Department of Agriculture, Fisheries and Food, Veterinary Laboratory Service. 

Background 

The Irish Veterinary Laboratory Service (VLS) - a division of the Department of Agriculture, Fisheries and 

Food (DAFF) - comprises a Central Veterinary Research Laboratory (CVRL) at Backweston, Co. Kildare and 

six Regional Laboratories at strategic locations throughout the country. The VLS provides laboratory support 

for national animal disease control and surveillance schemes – as well as a veterinary diagnostic pathology 

service to the farming community. 

In May 2001, the VLS commenced a process of moving an almost entirely paper-based submission 

recording and reporting system to a proprietary electronic Laboratory Information Management System 

(LIMS). The LIMS now encompasses the entire laboratory network and provides electronic tracking of all 

submission information from sample receipt, through test assignment and result entry, to reporting and data 

retrieval and analysis. This presentation comprises a description of the functions, scope, management and 

benefits of the LIMS - with particular reference to the challenges and complexities of its implementation in a 

multi-discipline veterinary laboratory environment - as well as to the opportunities provided for enhanced 

support of national animal disease surveillance activities. 

Scope 

This is a large system supporting about 160 users – at six geographically distinct locations - and 

electronically mapping the over 800 tests available from the Laboratory Service repertoire. The system 

manages a wide range of submission types – from high volume surveillance samples to carcass and other 

animal materials for pathology and microbiology investigations. LIMS workflows map the movement, receipt 

and testing of submissions through the VLS. Result recording ranges from manual input text-intensive 

morphological pathology – to automated transfer from a range of instruments. Currently about 30 

instruments have direct connections to the LIMS - allowing electronic transfer of test assignment and result 

data in the areas of microbiology, serology, PCR, haematology, biochemistry and genotyping. The LIMS also 

has direct links with two other DAFF animal health databases. These provide automated submission login 

and result reporting for the TB eradication and scrapie genotyping programs. Client invoicing is facilitated 

through connection to the Department’s financial accounting system. 

Implementation 

The specific LIMS application was selected in 2001 by international tender. The most significant challenges 

during project implementation reflected the diverse nature of veterinary diagnostic pathology procedures - 

and the related networking issues consequent upon high data transmission requirements in a multi-site 

environment. Fitting the LIMS to meet requirements involved a combination of close user involvement in 

initial design workshops, as well as a substantial amount of work by the suppliers on workflow development 

and report design. 

The first phase of the implementation – covering the CVRL (then located at Abbotstown, Co. Dublin) and one 

Regional Laboratory at Athlone - identified line-speed issues which were ultimately addressed by distributing 

the application to users as a ‘thin-client’ terminal service – rather than by the initial approach of direct 

installation on users’ PCs. While ultimately successful – allowing roll-out of the LIMS to all Regional 

Laboratories in 2003 - the solution introduced some of its own problems which have been far from trivial in 

impact and resolution. The use of ‘thin clients’, however, greatly facilitated the transfer of CVRL activities 

from Abbotstown to a purpose-built laboratory campus at Backweston in 2005/2006. Despite the size and 

complexity of the LIMS, all internal support to date has been by the VLS’ own users. Underlying operating 

system, hardware and networking support is provided by DAFF IT Division. 

Benefits 

The overall experience of the implementation of a LIMS has been extremely positive – both for users and the 

VLS as a whole. Time savings in areas with repetitive data recording have been substantial. Any 

disadvantages of increased PC-usage in areas such as post-mortem rooms and ‘wet’ laboratories are 

regarded as being heavily outweighed by improved data access and reporting. The need to ensure data 

quality and consistency has also encouraged standardisation of laboratory methodology in several areas of 

diagnostic pathology. 

Probably the greatest benefits at VLS-level derive from enhanced disease surveillance opportunities. While 

these are only in the early stages of exploitation, the LIMS has already facilitated preparation of Regional 

Laboratory surveillance reports - as well as national input to EU-wide zoonotic and Class A animal disease 

reporting. 

Looking to the immediate future, the potential for linkages with other DAFF national animal databases and 

farm mapping systems should assist in the establishment of more accurate baseline data on the occurrence 

and distribution of indigenous diseases in farm animals in Ireland. 



Wed 14 November



BEYOND THE LABORATORY GATE – ENHANCING A LABORATORY INFORMATION MANAGEMENT 

SYSTEM (LIMS) FOR EXOTIC ANIMAL DISEASE PREPAREDNESS 

P. A. Durr, I. Zupanovic, J. Watson, L. Wright and M. Johnson 

Australian Animal Health Laboratory (AAHL), 5 Portarlington Road, East Geelong, Victoria, Australia. 

INTRODUCTION 

The UK FMD epidemic in 2001 exposed the importance of data management for effective exotic animal 

disease (EAD) preparedness, and in response many laboratories have introduced or upgraded their 

laboratory information management systems (LIMS). However, many commercial LIMS are inward-looking 

applications, and issues and problems remain in establishing effective communication with other laboratories 

and EAD management systems (EADMS). This is the current situation in Australia, where the pending 

introduction of such an EADMS (BioSIRT) requires that the exotic disease laboratory, the Australian Animal 

Health Laboratory (AAHL), develop a solution to enable the electronic submission of high volumes of data in 

the event of an EAD incursion and to permit reporting of results direct to the BioSIRT database. Here we 

describe progress made in resolving this problem, with the design of a custom built interfacing application, 

“STARS”, which is an acronym for Submission, Tracking And Reporting System. 

DESIGN OF STARS 

The design phase of STARS followed a requirements phase, when the underlying “business” of sample 

processing was carefully analyzed. Initially a design which made use of AAHL’s current commercial LIMS 

application, SampleManager, was explored, but the complexity of this implementation plus security concerns 

argued for an interfacing application specialized upon the handling of submissions and reporting. According 

to this design, AAHL’s sample processing will be split between two applications, with SampleManager 

handling specimen processing (leading to a test result) and STARS handling submission processing (leading 

to a client report). 

To enable submission and reporting from any client, STARS will be in essence a web-enabled database (1) , 

with an architecture following closely that recommended by Microsoft within their .NET framework. The user 

interface is designed to be both intuitive and work-flow orientated, aiming to guide users through tasks. 

Accordingly, it makes extensive use of Web 2.0 technologies, such as AJAX, to provide users with 

enhancements, such as auto-suggestion and federated access. For data transfer, STARS uses XML 

technology to ensure encrypted security and permit direct database to database delivery of data. 

DISCUSSION 

At first impression, it might seem that splitting AAHL’s sample processing across two applications might be 

adding unnecessary complexity, and a solution based upon SampleManager would be preferable. However, 

the split architecture has a number of advantages, including removing the need for the current complex 

customization of SampleManager required to disaggregate submissions (“accessions”) into samples and 

then re-aggregate the test results back for reports. Accordingly, SampleManager will be able to be treated as 

a COTS (“commercial off-the-shelf”) application, minimizing the cost when version upgrading occurs. Added 

to the fact that STARS will be using industry common standards, and thus readily understood by a large 

potential pool of IT professionals, then AAHL will be minimising the risk of a failure of its LIMS systems 

during an EAD. A further benefit of the interfacing solution is that it will be adaptable to other veterinary 

laboratories within Australia, including those not using SampleManager. Accordingly the possibility for 

creating a true animal health laboratory network for Australia, with direct sharing of results, will move a step 

closer to realization. 

REFERENCE 

Durr, P.A. and Eastland, S. (2004). Use of web-enabled databases for complex animal health investigations. 

Revue Scientifique et Technique de L Office International Des Epizooties 23, 873-84. 


THE RELAIS PROJECT: AN EPI-INFORMATICS CONSTELLATION 

P-M Agapow*, Institute for Animal Health 

J. Bashiruddin, Institute for Animal Health 

Introduction 

Global disease control presents an information management problem. Routine epidemiological work 

generates vast amounts of data in various forms: outbreak reports, clinical samples, the results of laboratory 

analyses, genetic sequences, phylogenetic trees. Much of this data must in turn be distributed in a timely 

and secure fashion to scientists, field personnel and decision makers. Unfortunately and unremarkably, 

disease data currently tends to be dispersed over a variety of information systems, using incompatible 

formats. Where data sharing takes, it is on an ad hoc basis. 


To this end, we have developed ReLaIS: the Reference Laboratory Information System. This loosely coupled 

constellation of software systems and databases allows allied laboratories to gather, query, visualise and 

share epidemiological data in semi-automated manner. Rather than force workers to adopt their style and 

data to a common format, and workflow the ReLaIS system instead makes it easy for data to be imported 

and communicated between systems. Analyses are controlled and visualised via web browser (TTW: 

through the web), so that remote workers may manipulate data just as easily as those in the lab, in a 

standardised environment. 

ReLaIS is based upon a stack of free open source software, including the programming language Python, 

bioinformatics library BioPython, the MySQL database, the content management system Plone for web 

presentation and geospatial visualisation via OpenLayers. The choice is not ideological, but practical: By 

adopting widely used FOSS tools, we ensure that development time is lowered, individual components have 

been rigorously tested, any software developed can be redistributed without problems and there exists a 

large pre-existing body of expertise for development and deployment. Finally, low cost is an obvious 

attraction, especially where systems may need to deployed in impoverished areas. 

RelaIS also includes Amergin, a web-based platform for storing, editing and analysing molecular 

epidemiological data. By working through-the-web, operators gain a consistent analysis environment where 

expensive computations are carried out on a remote server and data is stored consistently and safely in a 

single location. Amergin engages with the ReLaIS workflow so that updated data flows to and from the 

system. 

ReLaIS has been designed to be flexible and extensible for easy adoption and customisation for different 

laboratories and pathogens (currently the FMDV world reference laboratory, and Bluetongue reference 

laboratory at IAH-Pirbright by the end of 2007). Further, it has been constructed from widely used, open 

source software for which there exists a wide pool of expertise for support and modification and limited 

developmental and set-up costs. 


Future developments include expansion of data and analyses (e.g. molecular structural functions), and the 

introduction of a tracking facility for field workers and clients to follow the analysis of their samples in real 

time. 

References 

OPENLAYERS. 1994. Website. http://openlayers.org. 

BIOPYTHON. 1994. Website. http://biopython.org. 

PYTHON. 1994. Website. http://www.python.org. 

PLONE. Website http://www.plone.org. 

Wed 14 November



1530 - 1700 Concurrent Session 1.6 - Molecular Diagnostic assys- II (Viral) 

HIGH THROUGHPUT DIAGNOSTIC PCR FOR BLUETONGUE VIRUS 

Katarzyna Bachanek-Bankowska*, Carrie A. Batten, Andrew Shaw, Peter P. C. Mertens and Chris A.L. Oura 

Institute for Animal Health, Ash Road, Pirbright, UK, GU24 0NF. 

Introduction: 

In August 2006, bluetongue disease (BT) was confirmed in the Netherlands and the outbreak rapidly spread 

to Belgium, Germany, Luxembourg and northern France. By late September 2007 over 26,000 premises had 

been confirmed to be infected in Northern Europe. On the 21 st of September 2007 samples from a Highland 

cow in the county of Suffolk in the UK were submitted to the lab and were found to be positive for BTV 

antibodies by C-ELISA and BTV RNA by real-time RT-PCR. Following this initial case further positive cases 

rapidly followed and surveillance sampling of animals in the control zone revealed BTV was present and 

circulating in South East England. In order to respond to the expected high throughput of samples we have 

developed a high throughput RNA extraction and real-time RT-PCR system for the detection of BTV. 

Material & methods and Results: 

Two RNA extraction robots (the 96 well Universal Qiagen robot and the 32 well Roche MagNA Pure LC 

robot), based on different chemistries, have been validated for high throughput RNA extraction from cattle 

and sheep blood and a real-time RT-PCR assay for the detection of BTV RNA has been developed and 

validated. Generic RNA extraction protocols are available from Qiagen and are widely used for the extraction 

of RNA from human blood however these protocols do not work for animal blood due to clogging of the 

filters. The most likely reason for this clogging is due to the higher protein content in animal blood compared 

to human blood. It has been especially difficult to develop a protocol for sheep blood which contains higher 

levels of protein than cattle blood. We have worked with Qiagen to develop and optimise protocols for the 

extraction of RNA from both cattle and sheep blood. For bovine blood it is necessary extract RNA from a 

reduced volume of 80µl of blood and a protocol is in the process of being optimised for RNA extraction from 

sheep blood and will be discussed. Due to the different chemistry used by the Roche MagNA Pure LC Robot 

we have found that this robot effectively extracts RNA from both cattle and sheep blood using the standard 

protocols. The Universal Qiagen robot is able to extract RNA from 96 samples taking approximately two 

hours whereas the Roche MagNA Pure LC Robot can extract RNA from 32 samples in 1.5 hours. Although 

the MagNA Pure robot has a reduced throughput compared to the Qiagen Universal robot we have found it 

very useful for extracting RNA from fewer samples as it can process up to 16 samples in 45 min. We have 

also found that throughput can be increased by pooling blood samples. Results show that pooling blood 

samples up to 1:10 does not significantly compromise the sensitivity of the assay. 

A real-time RT-PCR assay has been developed (Shaw et al., 2007) using primers and probes targeting 

genome segment 1. In the assay a combination of two sets of primers and two probes are used. Reports 

from other labs and our experience have revealed that the level of background fluorescence in the assay is 

very dependent on the quality/batch of primers used. In order to solve this background problem a single 

degenerate probe has been designed for use with the same primers. This modified assay has been fully 

validated and results in a reduced level of background. 


Both the Universal Qiagen and Roche MagNA Pure LC Robotic extraction systems have been used to 

increase diagnostic throughput. Protocols have been developed to enable both cattle and sheep blood to be 

extracted by the Qiagen robot and the advantages and disadvantages of both systems will be discussed. A 

new real-time RT-PCR assay has been developed for the detection of BTV RNA that reduces the level of 

background fluorescence. Both the Qiagen Universal and the MagNA Pure RNA extraction robots have been 

used successfully in conjunction with real-time RT-PCR to process a high throughput of samples during the 

outbreak of BT in Northern Europe in 2006/2007. 

References 

A.E. Shaw, P. Monaghan, H.O. Alpar, S. Anthony, K.E. Darpel, C.A. Batten, A. Guercio, G. Alimena, M. 

Vitale, K. Bankowska, S. Carpenter, H. Jone, C.A.L. Oura, D.P. King, H. Elliott, P. Mellor and P.P.C 

Mertens. (2007) Development and initial evaluation of a real-time RT-PCR assay to detect bluetongue virus 

genome segment 1. Journal of Virological methods, 145: 115-126. 


NUCLEIC ACID DIAGNOSTIC TOOLS FOR EARLY DETECTION OF 

ARTHROPOD-BORNE ANIMAL VIRUSES 

W.C. Wilson, E.S. O’Hearn, R.J. Lenhoff, B. Hindson, C. Torres, D.E. Stallknecht, D.G. Mead, C.Y. Kato, R.T. Mayer, B.S. Drolet, and 

J.O. Mecham 

USDA, ARS, Arthropod-Borne Animal Diseases Research Laboratory, Laramie WY (Drolet, Harpster, Kato, O’Hearn, Mayer, Mecham, 

Wilson); Lawrence Livermore National Laboratories, University of California, Livermore CA (Hindson, Lenhoff, Torres); Southeastern 

Cooperative Wildlife Disease Study, College of Veterinary Medicine, The University of Georgia, Athens, GA (Stallknecht, Mead) 

Introduction: The objective of this paper is to provide a review of our strategy for developing nucleic acid 

diagnostic tools for existing and emerging arthropod-borne animal viral diseases. The outbreak of West Nile 

virus in the United Sates and the recent outbreak of Rift Valley fever (RVF) virus in East Africa have 

highlighted the importance of validated early detection tools for arthropod-borne animal viral diseases. The 

Arthropod-Borne Animal Diseases Research Laboratory has been involved with the development of rapid 

nucleic acid detection tests for bluetongue virus (BTV) and the related epizootic hemorrhagic disease virus 

(EHDV). Bluetongue virus causes disease in sheep and cattle and has significant economic impact due to 

trade barriers. Although U.S. EHDV strains have not been experimentally proven to cause clinical disease in 

cattle, there is serologic evidence of widespread infection. Vesicular stomatitis, caused by vesicular 

stomatitis virus (VSV) is also an important arthropod-borne livestock disease because of its clinical 

resemblance to foot and mouth disease. In addition, the Rift Valley fever (RVF) outbreak has prompted the 

development of new and the evaluation of existing diagnostic assays on livestock samples. 

Materials and methods: A common approach has been used for all of these arboviruses. A target gene is 

selected based on existing virological data and known degree of genetic conservation. Additional 

phylogenetic studies are conducted where limited sequence data is available. Bioinformatic software is 

utilized to predict the most likely polymerase chain reaction (PCR) primer/probe set of signatures to be 

successful. Laboratory evaluation is done using standardized protocols for real-time quantitative reverse 

transcriptase-PCR qRT-PCR. The assays are then evaluated by collaborating diagnostic laboratories. 

Results: We have developed (qRT-PCR) tests that detect RNA from indigenous and exotic strains of BTV 

and EHDV based on sequencing of multiple target genes. The EHDV qRT-PCR detected all 40 field strains 

available. Additionally, 105 archived sheep, cattle, deer and other antelope samples were tested. The 

assay detected 90% of previously virus isolation-positive clinical samples which was 12% better than our 

previously published EHDV PCR protocols. The samples missed by the assay are being re-evaluated to 

determine if the sample was degraded. The BTV qRT-PCR detected 43 indigenous and exotic field strains 

available using a two probe detection assay. A similar design strategy reported in another presentation was 

used to develop a qRT-PCR for VSV. This assay is proving useful in determining potential transovarial 

transmission of VSV in Culicoides sonorensis biting midges. The existing RVF qRT-PCR assays have been 

combined into a multiplex assay utilizing a previously described RNA template control. 

Discussion and conclusion: The standardized approach to use a Phylogenetic/bioinformatics analysis to 

design qRT-PCR assays for arboviruses has proven to be successful. A similar approach has been 

successful in developing qRT-PCR assays for these viruses by other researchers as well. The next 

generation of nucleic acid diagnostic tests will include multiplex or multi-target assays either to compensate 

for genetic variation and to differentiate pathogens that cause similar clinical signs, or differentiate species of 

a specific pathogen. Such assays are currently in development at Lawrence Livermore National 

Laboratories where they have incorporated qRT-PCR into single multiplex Luminex assays for multiple 

related pathogens. These assays have undergone a multiple laboratory field evaluation study that 

demonstrated the potential of this technology. ABADRL researchers are also developing non-enzymatic 

nucleic acid hybridization detection assay using fluorescence signal amplification and Raman spectroscopy 

technologies. In conclusion, a number of new nucleic acid tests have been and are being developed for early 

detection of arboviral animal pathogens, and are, or soon will be, available to veterinary diagnostic 

laboratories. The concept of simultaneous detection of multiple genomic targets for a single pathogen will 

help to ensure detection of RNA viruses which are known to be highly variable genetically. 

References: 

Drosten et al., J. Clin. Microbiol. 40, 2323-2330. 2002. 

Garcia et al., J. Clin. Microbiol. 39, 4456-4461. 2001. 

Moniwa et al., J. Vet. Diag. Investig. 19, 9-20. 2007. 

Shaw et al., 2007. J. Virol. Methods 145, 115-126. 

Wed 14 November



THE DEVELOPMENT OF METHODS FOR THE DETECTION OF NEWCASTLE DISEASE VIRUS 

Carmel Hancock, David Townsend, Debby Cousins 

AB-CRC, Curtin University of Technology, Department of Agriculture & Food, Western Australia 

Objectives 

There are many infectious agents that require fast and reliable detection methods so as to prevent 

epidemics. The aim of this project is the development of techniques for the detection of Newcastle Disease 

Virus (NDV). 

Key Messages 

While both methods employ real-time PCR, the first is aimed at the detection of viral RNA. The fusion 

cleavage site of the NDV genome is a molecular determinant of virulence of the virus and was targeted in the 

project. The use of LightUp probes to detect this sequence in both a real-time PCR and a field setting is 

examined. 

The second method developed is known as immuno-PCR and combines the concepts of antigen/antibody 

detection via ELISA with the targeting of specific nucleic acid sequences in PCR. This project examines 

some of the various methods of constructing a viable immuno-PCR system and the most efficient method of 

doing so for detecting NDV. 

Conclusion 

The use of LightUp probes for the detection of NDV encountered difficulties due to the nature of the fusion 

cleavage site but has also shown aspects that are very promising for a field based detection system. 

The combination of the two methods in the immuno-PCR allows the detection of the antibody at much lower 

levels than typically possible with a traditional ELISA. 

Stream: New Technologies and Platforms for Diseases Diagnosis 


MOLECULAR DETECTION OF BETANODAVIRUSES FROM SUBCLINICALLY INFECTED AQUARIUM 

FISHES AND INVERTEBRATES 

D. K. Gomez* 1 , S. C. Park 1,2,4 , G. J. Heo 3 , J. H. Kim 2,4 and C. H. Choresca Jr. 1,2,4 

1 KRF Zoonotic Disease Priority Research Institute, Seoul National University, Seoul 151-742, Korea 

2 Laboratory of Aquatic Animal Medicine, College of Veterinary Medicine, Seoul National University, Seoul 151-742, Korea 

3 College of Veterinary Medicine and Research Institute of Veterinary Medicine, Chungbuk National University, Cheongju 361-763, 

Korea 

4 Brain Korea 21 Program for Veterinary Science, College of Veterinary Medicine, Seoul National University, Seoul 151-742, Korea 

Introduction 

Viral nervous necrosis (VNN) or viral encephalopathy and retinopathy (VER) caused by betanodavirus 

(Nodaviridae) is a worldwide disease affecting several species of cultured marine fish including Korea. The 

present study was conducted to investigate asymptomatic infection of betanodavirus from aquarium fishes 

and invertebrates. 


A total of 237 apparently healthy imported aquarium fish, marine (65 species) and freshwater (12 species) 

fishes and marine invertebrates (4 species), were collected from November 2005 to February 2006 in a 

commercial aquarium in Seoul, Korea. The brains of the fish and other tissues of the invertebrates were 

examined by reverse transcriptase polymerase chain reaction (RT-PCR) and nested PCR to detect the coat 

protein gene of betanodavirus and analyzed by phylogenetic tree. 

Results 

Positive nested PCR (420 bp) results were obtained from the brains of 8 marine and 2 freshwater fish 

species and 1 marine invertebrate species. Phylogenetic analyses based on the partial nucleotide sequence 

(177 bases) of the RNA2 coat protein gene of 11 strains were all identical to one another (93–100%) and 

highly homologous to the redspotted grouper nervous necrosis virus (RGNNV) genotype. The identity of the 

strains with the other 3 genotypes ranged only from 66.5-73.9%. 


The results indicate that all detected samples imported from different countries regardless of host species 

and geographical areas were subclinically infected and genetically closely related, suggesting an importance 

of these asymptomatic carrier fish or invertebrate as natural hosts of betanodavirus. 

References 

1. DK Gomez, J Sato, K Mushiake, T. Isshiki, Y Okinaka and T Nakai (2004): PCR-based detection of 

betanodaviruses from cultured and wild marine fish with no clinical signs. Journal Fish Diseases 27:603- 

608. 

2. Dennis Kaw Gomez, Dong Joo Lim, Gun Wook Baeck, Hee Jeong Youn, Nam Shik Shin, Hwa Young 

Youn, Cheol Yong Hwang, Jun Hong Park, Se Chang Park (2006): Detection of betanodaviruses in 

apparently healthy aquarium fishes and invertebrates. Journal of Veterinary Science 7(4): 369-374. 

3.G.W. Baeck, D.K. Gomez, K. S. Oh, J.H. Kim, C.H. Choresca Jr. and S.C. Park (2007): Detection of 

piscine nodaviruses from apparently healthy wild marine fish in Korea. Bulletin of the European Association 

of Fish Pathologists 27(3): 116-122. 

Wed 14 November



CHARACTERISATION OF THE HERPES-LIKE VIRUS INFECTING AUSTRALIAN POPULATIONS OF 

ABALONE HALIOTIS SPP. BY WHOLE GENOME PYROSEQUENCING 

*F. Wong 1 , M. Lancaster 1 , M. Crane 3 , S. Corbeil 3 , A. Hyatt 3 , J. Tan 1 , K. Savin 1 , N. Cogan 2 , T. Sawbridge 2 , S. Warner 1 

1 2 

Department of Primary Industries, Animal Health Sciences, 475 Mickleham Road, Attwood, VIC 3049 Australia; Department of Primary 

Industries, Victorian AgriBiosciences Centre, 1 Park Drive, Bundoora, VIC 3086; 3 CSIRO Livestock Industries, Australian Animal Health 

Laboratory, 5 Portarlington Road, Geelong, VIC 3220 Australia 

Introduction 

Mortalities of wild populations of abalone due to infectious ganglioneuritis continue to occur and spread 

along the Victorian coast, although the first reported outbreak of disease had affected farmed abalone 

Haliotis rubra, H. laevigata and hybrids in the state’s southwest (2). The likely cause is infection by a herpeslike 

virus resulting in high rates of morbidity and mortality in affected populations. Gross signs have included 

loss of adhesion due to relaxation of the pedal muscle, swelling of the buccal region and aversion of the 

radula. Histopathology revealed severe lesions centred in nerve tissues including oedema, cell necrosis and 

haemocytic infiltrations. Herpes-like virus particles were isolated from infected abalone tissues for DNA 

extraction and application to whole genome pyrosequencing. 


Pooled tissues from infected Victorian wild abalone were homogenised and sonicated for virus isolation. 

Virus particles were isolated using discontinuous 10-60% sucrose density gradient ultracentrifugation. 

Herpes-like virus particles were found to be concentrated at the 40-50% sucrose interface. DNA extraction 

from virus containing interface fractions produced a single high MW DNA fragment. The DNA extract was 

used for multiple displacement amplification using QIAGEN REPLI-g, which generated sufficient template for 

direct ultrahigh-throughput parallel DNA sequencing using the 454 Life Sciences Genome Sequencer-FLX 

System. The abalone herpes-like virus was characterised via de novo assembly and annotation of the 

generated DNA sequences. 

Results 

A single sequencing run yielded in excess of 20.4 megabases of parallelised sequence information from the 

abalone virus DNA sample. Analysis of the sequence data has assembled multiple contigs with the largest 

up to 46 kb and totalling to greater than 150 kb of non-overlapping sequence segments, putatively 

representing a large portion of the expected virus genome. Assembled contigs were initially analysed by 

BlastX comparison to the genome of ostreid herpesvirus OsHV-1, a virus that causes similar disease 

pathology in oysters and other bivalves (1). The translated sequence contigs from abalone herpes-like virus 

showed 25-50% peptide sequence similarities with those of OsHV-1. PCR primers based on the derived 

abalone virus sequences were designed for application to specific conventional end-point and real-time PCR 

detection assays for virus infected abalone tissues. PCR primers tested so far have shown promise when 

tested against infected abalone and non-infected controls. 


Analysis of the putative genome sequences derived from our study has facilitated the definitive identification 

and characterisation of the herpes-like virus causing abalone mortalities in Australia, and in gastropod 

molluscs. The virus affecting Victorian abalone populations appear to be only distantly related to the OsHV-1 

herpesvirus affecting bivalve molluscs in other countries. The two respective herpes-like virus pathogens do 

not appear to be the same virus or closely related strains. At present there is no rapid or specific detection 

method available for identification of the abalone herpes-like virus, making environmental surveillance of the 

disease and study of the pathogen extremely difficult. The development of specific PCR primers and in situ 

DNA probes for immunohistological detection tests in our study would greatly facilitate further investigation of 

the environmental spread and distribution of the virus. 

References 

(1) Davison, A. J., B. L. Trus, N. Cheng, A. C. Steven, M. S. Watson, C. Cunningham, R. -M. Le Deuff, and 

T. Renault. 2005. A novel class of herpesvirus with bivalve hosts. J. Gen. Virol. 86: 41-53. 

(2) Hooper, C., P. Hardy-Smith, and J. Handlinger. 2007. Ganglioneuritis causing high mortalities in farmed 

Australian abalone (Haliotis laevigata and Haliotis rubra). Aust. Vet. J. 85: 188-193. 


DEVELOPMENT OF A REAL-TIME DUPLEX TAQMAN RT-PCR ASSAY FOR THE DETECTION OF 

EQUINE RHINITIS A AND B VIRUSES IN CLINICAL SPECIMENS 

Mori A., De Benedictis P., Zecchin B., Marciano S., Capua I., Cattoli G. 

Istituto Zooprofilattico Sperimentale delle Venezie, Research & Development Department 

OIE/FAO and National Reference Laboratory for Avian Influenza and Newcastle Disease 

OIE Collaborating Centre for Epidemiology, Training and Control of Emerging Avian Diseases 

Viale dell’Università 10, Legnaro, Padova, Italy 

Introduction 

Equine rhinitis A and B viruses (ERAV and ERBV) are respiratory viruses of horses belonging to the family 

Picornaviridae, genus Aphthovirus and Erbovirus respectively. Their laboratory confirmation is rare, even 

when there is serological evidence of their circulation. Virus isolation is often unsuccessful, due to inefficient 

growth in cell cultures, in many cases without a cytopathic effect (Li et al., 1997; Black et al, 2007). We 

describe here a real-time duplex TaqMan RT-PCR as a diagnostic tool for the detection of these viruses. 


Strains of European and North American origin were used as positive controls. The titre in tissue culture 

infectious dose/ml (TCID50/ml) in RK13 cells was calculated for selected strains (Lorenz and Bogel, 

1973).Total RNA was extracted using the “High Pure TM RNA extraction kit” (Roche Diagnostics). The RNA 

was reverse-transcribed using “High capacity cDNA archive kit” (Applied Biosystems). Two sets of primers 

and probe were designed to detect viral RNA of ERAV and ERBV respectively. Both sets were located in the 

highly conserved 3D region (Huang J-A et al., 2001). The Real Time Duplex PCR reaction was carried out in 

25 µl with 1X “TaqMan Universal PCR Master Mix 2X” (Applied Biosystems), 240 nM of each primer, 250 nM 

of each probe and 5 µl cDNA template. The reaction was performed in a 7300 Real Time PCR System 

(Applied Biosystems) with the following protocol: 2 minutes at 50°C and 10 minutes at 95°C followed by 45 

cycles at 95°C for 15 sec and 60°C for 1 minute. 

The specificity of the method was assessed by testing each set of primers and probe for the ERAV or the 

ERBV template distinctly. Common equine RNA and DNA viruses, bacterial and protozoan pathogens were 

analysed to further ensure the specificity of the primer-probe sets. To assess the sensitivity of the method, 

ten-fold serial dilutions of titrated ERAV and ERBV were tested in different matrices, namely tissue culture 

supernatant, lung homogenates, urine and nasal swabs. Three different concentrations (high, medium, low) 

for both ERAV and ERBV were analyzed to assess the intra-assay repeatability and the inter-assay 

reproducibility. 

Results 

The designed sets were able to distinguish ERAV and ERBV viral genomes. No cross interaction was 

observed among the two sets of primers and probes. The analysis of other equine viruses, bacterial and 

protozoan pathogens gave negative results.The limit of detection (LoD) was 10 TCID50/ml for ERAV and 1 

TCID50/ml for ERBV in all tested matrixes. The Coefficient of Variation (CV) was calculated as below 7% and 

below 12%, for the intra-assay repeatability and the inter-assay reproducibility respectively. 


The real-time duplex TaqMan-PCR developed was capable of detecting and differentiating both ERAV and 

ERBV. The method demonstrated excellent specificity and sensitivity, intra-assay repeatability and interassay 

reproducibility. The results of this investigation indicate that the molecular assay can be considered a 

valuable tool to aid the diagnosis of respiratory viral infections in horses. The high sensitivity and specificity 

of the test make it a valid instrument to provide further insights into the pathogenesis of these infections. 

References 

Black WD, Hartlley CA, Ficorilli NP, Studdert MJ. Arch Virol (2007) 152:137-149. 

Huang J-A, Ficorilli N, Hartley CA, Wilcox RS, Weiss M, Studdert MJ. J Gen Virol (2001) 82:2641-2645. 

Li F, Drummer HE, Ficorilli N, Studdert MJ, Crabb BS. J Clin Microbiol. (1997) 35:937-943. 

Lorenz RG., Bogel K. In: Kaplan MM, Koprowski H, eds. Laboratory techniques in rabies, 3rd ed. Geneva, 

Switzerland: World Health Organization (1973) 321:35-41. Dean AG, Dean JA, Burton AH, et al. Epi Info 

Version. 


The authors wish to thank Udeni B. R. Balasuriya, University of Kentucky-USA, Janet Daly and Bob 

Geragthy, Animal Health Trust, Suffolk-UK, for kindly supplying ERAV and ERBV strains used in this work. 

Wed 14 November



1530 - 1700 Concurrent Session 2.6 - Epidemiology & Surveillance 

EFFECTS OF DYNAMIC ‘COMMUNAL’ INTERACTIONS ON DISEASE PROCESSES AND INDIVIDUAL 

AGENT DIAGNOSIS WHERE MULTIPLE INFECTIOUS AGENTS ARE PRESENT IN SHEEP 

K.L Tyrrell 1* , J.R White 2 , S.J McClure 1 & J. Lello 3 

1 

CSIRO Livestock Industries, Locked Bag 1, Armidale, NSW 2350 

2 

Australian Animal Health Laboratory, CSIRO Livestock Industries, Private Bag 24, Geelong, VIC 3220 

3 

School of Biosciences, Cardiff University, Cardiff, UK 

Introduction 

The concept of community ecology (an assemblage of living organisms that share and interact within a 

common environment) is explored in relation to multiple infections of parasitic worm species in sheep. 

Although single parasitic infections are not uncommon, mixed infection with various species or with several 

different types of parasites is generally considered to be normal. There are a number of examples in the 

literature which have shown that in mixed infections the presence of one pathogen can have either a 

detrimental, neutral or positive effect on the other (Kaufmann et.al 1992, Yabob et.al 2002, Dobson and 

Barnes 1995). It has also been shown that these interactions can affect the hosts response to one pathogen 

thereby giving an advantage to the other pathogen (Sharma et.al, 2000). In previous studies involving 

infection with a combination of up to three species, results showed a marked immunological difference 

between sheep with a single infection of Trichostrongylus colubriformis and dually infected sheep which 

were given a mixture of T. colubriformis and H. contortus. Total T. colubriformis worm counts were higher in 

dually infected sheep and there was a trend for lower T. colubriformis egg outputs in these sheep. The 

current study further examined this interaction to determine the mechanisms involved. 


The study was conducted on 132 5 month old merino sheep. Animals were trickle infected with single or 

mixed nematode species over a period of 14 weeks. Faecal collections were made over the course of the 

study to measure nematode worm egg count and worm species composition. Blood collections were made 

to measure haematocrit, specific antibody levels and nutritional parameters. At the conclusion of the study 

animals were euthanased for total nematode worm counts and abomasal and jejunal tissue collected for use 

in histological assessment of immune response and antibody concentration. 

Results 

Integration of the various data collected, including worm egg count, worm count, histology and antibody 

titers, provided evidence to suggest that H. contortus suppresses those immune responses normally 

associated with a single T. colubriformis infection. Adult T. colubriformis worm counts were higher in dually 

infected sheep from day 70 through to the conclusion of the study at Day 120 post initial infection. Further, a 

suppressive effect was seen in antibody titers in mixed infection animals, whereby titers did not reach levels 

seen in animals infected with T. colubriformis only. This effect on the immune response was confirmed in the 

histology data, where smooth muscle and globular leucocyte responses to T.colubriformis were reduced 

when H. contortus was present. Glucose and protein levels taken through out the study did not suggest any 

role for nutrition in this suppression. 


This study has shown that in a mixed infections of H. contortus and T. colubriformis, that H. contortus 

suppresses the immune response normally associated with a T. colubrifomis infection despite the spatially 

difference niches which each pathogen has within the host gut. The results suggest that a number of 

parameters may need to be carefully considered when attempting to accurately determine the aetiological 

agent/s responsible for a given disease syndrome. By understanding the possible ‘communal relations’ 

(inter-specific interactions) between species, it is then possible to 1) improve parasite control programs 2) 

offer possibilities for alternative control 3) understand the treatment and immunological effect of targeting 

one species within a biological system 4) reduce chemical use in control programs and 5) improve diagnosis 

and reduce severity of disease outbreaks. 

References 

Kaufmann, J. et.al. (1992). Vet Para, 43:157-170. 

Yacob, H.T. et.al (2002). Vet Para. 104: 307-317. 

Dobson, R.J & Barnes, E.H (1995). Int J for Para 25 (4):495-501. 

Sharma, D.K. et.al. (2000). Vet Para 92:261-267. 


USE OF MOLECULAR AND EPIDEMIOLOGICAL INFORMATION FOR THE COST-EFFECTIVE 

DIAGNOSIS OF BOVINE VIRAL DIARRHOEA INFECTION IN NEW ZEALAND DAIRY CATTLE 

Introduction 

F I Hill*, M P Reichel, D J, Tisdall, Gribbles Veterinary, Palmerston North, New Zealand, *presenting author 

Veterinary interest in bovine viral diarrhoea (BVD) in New Zealand has been increasing since 2004. 

Representatives from the veterinary and farming communities formed groups to investigate the significance 

of the disease and the merits and method of diagnosis and control. Diagnostic tests allowing cost effective 

identification of BVD virus (BVDV) infected herds and individuals were a key requirement for farmers and 

veterinarians. BVDV persistently infected (PI) animals excrete vast amounts of virus in all body secretions 

including milk. Quantitative (or real-time) PCR technology has the ability to detect virus in ready-made pools, 

such as bulk tank milk in a vat. Epidemiological studies have shown that persistent BVDV infection in dairy 

cattle has a detrimental effect on lactation (Voges et al 2006) with most milking PI cattle found within the 

lowest producing 10% of the herd. This study reports on the use of PCR technology and that 

epidemiological information to identify PI animals in milking herds in a cost-effective manner. 


Milk samples were collected from the milk vat of dairy herds where veterinary practitioners suspected a 

problem with BVDV infection. Positive bulk tank milk was followed up by collection of individual serum 

samples. Testing of individual samples by PCR and antigen capture enzyme-linked immunosorbent assays 

(ACE) was used to identify PI animals. PCR and ACE are known to correlate well (Hill et al. 2007). After 

removal of the PI from the herd, repeat testing of another bulk milk sample was used to verify clearance of 

the infection. 

Results 

From 40 bulk milk samples initially tested by PCR, 6 were positive for BVDV virus. Four of these herds were 

investigated in depth. Serum samples were collected from every cow in the herd and 1/223, 1/130, 2/800 

and 1/275 PI’s identified. After removal of the PI from the herd another bulk milk sample was now negative. 

PIs were always found in the bottom 10% of producers. 

If BVDV infection was confirmed in the milking herd, investigation of the BVDV status of non-milking stock 

was undertaken using BVD antibody surveillance testing of 15 animals from each age group. Cohorts of 

seropositive groups of animals were tested in real time PCR in pools of 20 sera, followed by ACE testing to 

identify any viraemic animals. Consideration of cost-effectiveness and prevalence of PIs, rather than the 

technical ability of the assay determined pool size. 


Targeted testing of dairy herds using PCR technology, in conjunction with epidemiological information, has 

markedly reduced the cost of diagnostic testing for BVDV in dairy herds in New Zealand over the past two 

years. 

References 

Hill, F.I., M.P.Reichel, D.J.Tisdall, and R.J.McCoy. 2007. Evaluation of two commercial enzyme-linked 

immunosorbent assays for detection of bovine viral diarrhoea virus in serum and skin biopsies of cattle. N. Z 

. Vet. J. 55:45-48. 

Voges, H., Young, S., Nash, M., 2006, Direct adverse effects of persistent BVDv infection in dairy heifers – a 

retrospective case control study. VetScript, 22-25. 

Wed 14 November



ASSESSING THE WITHIN HERD PREVALENCE OF ANTIBODY POSITIVE COWS TO BOVINE 

HERPEVIRUS 1 USING AN INDIRECT ELISA ON BULK TANK MILK 

Background 

1.Aims 

The objective of the study was to evaluate the efficacy of a milk Indirect antibody ELISA to assess the within 

herd prevalence of cows seropositive to BHV 1. 

2.Methods 

Bulk milk samples from 799 dairy herds from Terceira Island in Azores/Portugal were initially tested for BHV 

1 antibodies using a commercial ELISA. The herds were then ranked in three cohorts according to their 

ELISA result sample to positve ratio (S/P) as follows: cohort 1 (C1) S/P



ZOO ANIMALS AS A POTENTIAL RESERVOIR OF GRAM-NEGATIVE BACTERIA HARBORING 

INTEGRONS AND ANTIMICROBIAL RESISTANCE GENES 

Ashraf M. Ahmed 1,3* Yusuke Motoi 1 , Maiko Sato 1 , Akito Maruyama 1 , Hitoshi Watanabe 2 , Yukio Fukumoto 2 and Tadashi Shimamoto 1 

1 Laboratory of Food Microbiology and Hygiene, Graduate School of Biosphere Science, Hiroshima University, Higashi-Hiroshima 739- 

8528, Japan; 2 Hiroshima City Asa Zoological Park, Asa-cho Asakita-ku, Hiroshima 731-3355, Japan 3 Department of Microbiology, 

Faculty of Veterinary Medicine, Kafr El-Sheikh University, Kafr El-Sheikh 33516, Egypt 

Background: 

Problems associated with the development and spread of antimicrobial resistance in clinical practice have 

been increasing since the early 1960s and are currently viewed as a major threat to the public health on a 

global level. Zoo animals constitute a potential source of zoonotic infections and, thus, a public health risk. 

Of particular concern is the potential transmission of multidrug-resistant (MDR) zoonotic pathogens from 

animals to humans. 

Aims: 

As little is known about antimicrobial-resistant bacteria in zoo animals, this study was conducted to monitor 

the incidence and prevalence of antimicrobial resistance genes in gram-negative bacteria isolated from 

mammals, reptiles and birds housed at Asa Zoological Park, Hiroshima prefecture, Japan. 

Methods: 

A total of 103 swabs (68 fecal, 33 water and two nasal swabs) were randomly taken from different mammals, 

reptiles, birds and water sources between June and September 2006 at Asa Zoological Park, Hiroshima 

prefecture, Japan. Biochemical, antibiograms, PCR and DNA sequencing techniques were used for 

identification and molecular characterization of bacteria and antimicrobial resistance genes. 

Results: 

A total of 232 isolates of gram-negative bacteria were recovered, the most common being Escherichia coli 

122 (52.6%), Klebsiella pneumoniae 17 (7.3%), Proteus mirabilis 16 (6.9%), Enterobacter aerogenes 13 

(5.6%), Klebsiella oxytoca 13 (5.6 %), Pseudomonas aeruginosa 12 (5.2%) and Enterobacter cloacae 12 

(5.2%). A total of 49 isolates (21.1%) showed resistance phenotypes to two or more antimicrobial agent and 

harbored at least one antimicrobial-resistant determinant. PCR screening for integrons showed that 16 

(6.9%) and four (1.7%) isolates were positive for class 1 and class 2 integrons, respectively. The βlactamase-encoding 

genes blaTEM-1, blaOXY-2, blaSHV-36 and blaCTX-M-2 were identified in 19 (8.2 %), three 

(1.3%), two (0.9%) and one (0.43%) isolate, respectively, in addition to a novel ampC β-lactamase gene, 

blaCMY-26, identified in a single isolate. The plasmid-mediated quinolone resistance genes, qnr and aac(6’)-Ibcr, 

were identified in 10 (4.3%) and one (0.43% ) isolate, respectively. 

Conclusion: 

Although zoo animals do not naturally come into contact with antibiotics, the results of this study established 

zoo animals as a potential reservoir of antimicrobial-resistant bacteria and clinically important resistance 

genes. This study highlights the potential risk factor of zoo animals to public health. 


PORCINE REPRODUCTIVE & RESPIRATORY SYNDROME (PRRS) - A NEW CHALLENGE 

Nguyen Van Long 

Not available at time of printing. 

Wed 14 November

Poster Presentations 


POSTER PRESENTATIONS 

PROXIMITY LIGATION ASSAY – DETECTION OF INDIVIDUAL MICROBIAL PATHOGENS 

A Nordengrahn, SM Gustafsdottir, M Merza* 

Svanova Biotech AB, Uppsala Science Park, 751 83 Uppsala, Sweden 

Introduction 

The Proximity ligation assay (PLA) enables sensitive detection of proteins in samples by binding of affinity 

probes to the target proteins. These affinity probes are equipped with DNA strands that can be joined by 

ligation when two such reagents are brought into proximity by binding to the same target molecule. The DNA 

ligation products are subsequently detected by DNA amplification. Using real time PCR detection system, 

the product can be quantified i.e. the number of targets in the sample can be calculated. 

We have successfully used PLA for the detection of three pathogens, two viruses Foot-and mouth disease 

and Porcine parvovirus and the bacterium Lawsonia Intracellularis. 


In the assays monoclonal antibodies specific to each of the pathogens were used as affinity probes. Nonsense 

oligonucleotides were attached to the antibodies by biotin-avidin coupling. 

By generating titration curves of the studied pathogens with known viral/bacterial titres the detection limit of 

the different systems were established. 

Real time PCR was used for visualisation of the reactions. 

The results were compared with Capture ELISA and Quantitative PCR. 

Results 

The results show very good sensitivity and specificity with detection limits down to less than 10 copies of the 

virus/bacteria. This was in line with the qPCR tests used for comparison. The Capture Elisa’s on the other 

hand where about 100 times less sensitive than the PLA. 


Our data strongly support the use of PLA as a diagnostic tool enabling a very sensitive and specific detection 

of microbial proteins, far more sensitive than the Capture ELISA, and being alternative to nucleic detection 

showing a sensitivity and specificity in line with the PCR. 

References 

Gustafsdottir SM, Nordengrahn A, Fredriksson S, Wallgren P, Rivera E, Schallmeiner E, Merza M, 

Landegren U. 2006. Detection of Individual Microbial Pathogens by Proximity Ligation. Clin. Chem. 52:6, 

1152-1160. 

Nordengrahn A, Gustafsdottir SM, Ebert K, Reid SM, King DP, Ferris NP, Brocchi E, Grazioli S, Landegren 

U, Merza M. Evaluation of a novel proximity ligation assay for the sensitive and rapid detection of foot-andmouth 

disease virus. Vet. Microbiol. In press. 


IMPROVED DETECTION OF BOVINE REPRODUCTIVE DISEASE PATHOGENS 

A.E. Lew 1,3 , B. Venus 1 , B. Wlodek 1 , S-Y. Guo 2 , G. Fordyce 1 , P. Moolhuijzen 3 , M.I. Bellgard 3 , G. Coleman 2 , D. Trott 2 , P. Burrell 1 , J.T. 

Ellis 4 , B. Corney 1 , W.K. Jorgensen 1 * 

1 Department of Primary Industries & Fisheries, Yeerongpilly, Qld, Australia 

2 School of Veterinary Science, The University of Qld, Qld, Australia 

3 Centre for Comparative Genomics, Murdoch University, WA, Australia 

4 University of Technology Sydney, NSW, Australia 

Introduction 

Reproductive diseases are known to cause bovine embryonic loss and calf abortion but it is often difficult to 

determine the aetiological pathogen using gold standard methods such as serology, microscopy and culture 

isolation. Sensitive molecular probe based polymerase chain reaction (PCR) assays (real time assays) were 

developed and evaluated for the improved detection of four pathogens implicated in the following 

reproductive diseases: trichomoniasis (Tritrichomonas foetus), campylobacteriosis (Campylobacter fetus 

subsp. venerealis), ephemeral fever (bovine ephemeral fever virus), and neosporosis (Neospora caninum). 


Probes based on 3’ minor groove binder probe (TaqMan®MGB) technology were developed for each 

pathogen targeting the internal transcribed spacer region for T. foetus and N. caninum respectively (2,5), the 

parA gene in C. fetus (4), and the BEFV glycoprotein RNA (RT-PCR) (1). 

Results 

All assays demonstrated sensitivity and specificity improvements over existing methods and conventional 

PCR protocols. For the bovine venereal diseases, a new animal sampling tool (Tricamper TM Sampling 

Device) proved more efficient and improved the sensitivity of pathogen identification over conventional 

sampling methods (by culture and PCR). Real time PCR demonstrated a higher field prevalence of 

campylobacteriosis pathogens than previously determined due to a two thousand fold increase in sensitivity 

compared with the gold standard culture method. Comparative genomic studies have identified new gene 

targets for C. fetus subsp. venerealis molecular diagnostic assay development to confirm this high 

prevalence (3). The BEFV real time PCR identified cattle previously not identified as infected using culture 

and the assay did not amplify closely related ephemeroviruses. The application of the N. caninum real time 

assay demonstrated the presence of N. caninum in Hammondia heydornii (CZ and NZ) preparations 

originating from dogs. The assay was useful in detecting N. caninum in serum, organs and milk from 

infected cattle and dogs, and in formalin fixed mouse brains (infection trial). 

Discussions & Conclusions 

The above assays will assist in identifying the contributing factors to substantial (>10%) unexplained 

reproductive losses (confirmed pregnancy to weaning) that occur in many northern Australian beef herds. 

These initial assays for each of the four pathogens have been adopted by Australian diagnostic laboratories 

and have provided useful disease research tools. The C. fetus subsp. venerealis parA gene assay has been 

submitted to the Sub-Committee on Animal Health Laboratory Standards (Australia/NZ) for evaluation. 

This research was funded by Meat & Livestock Australia. 

References 

1. Lew AE, Corney B, Minchin CM, Wright L. (2005a) Real time RT-PCR detection of bovine ephemeral 

fever virus infections. National Conference for the Australian Society for Microbiology, Canberra, Australia, 

25-29 th September, 2005. 

2. Lew A, Ellis J, Coleman G, McMillen L, Turner S, Venus B. (2005b) Real time PCR detection of 

Neospora caninum. World Association for the Advancement of Veterinary Parasitology WAAVP, New 

Zealand, 16-20th October 2005. 

3. Lew A, Guo SY, Venus B, Moolhuijzen P, Sanchez D, Trott D, Burrell P, Wlodek B, Bellgard M. (2007) 

Comparative genome analysis applied to develop novel PCR assays to characterise and identify 

Campylobacter fetus subsp. venerealis isolates. Zoonoses and Public Health, 2007, 54 (Supplement 1), 

19-155. 

4. McMillen, L., Fordyce, G., Doogan, V. J., Lew, A.E. (2005) Comparison of culture and a novel 5' Taq 

nuclease assay for the direct detection of Campylobacter fetus subspecies venerealis in clinical specimens 

from cattle. Journal of Clinical Microbiology 44(3): 938-945. 

5. McMillen, L. & Lew, A.E. (2006) Improved detection of Tritrichomonas foetus in bovine diagnostic 

specimens using a novel probe based real time PCR assay. Veterinary Parasitology 141: 204-215. 

Poster Presentations



IDENTIFICATION OF A NOVEL BABESIA SPECIES FROM SABLE, ROAN AND GIRAFFE BY MEANS 

OF THE REVERSE LINE BLOT (RLB) HYBRIDIZATION ASSAY 

MC Oosthuizen 1* , E Zweygarth 2 & BL Penzhorn 1 

1 Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Private Bag X04, Onderstepoort, 

0110, South Africa. (E-mail: marinda.oosthuizen@up.ac.za) 

2 Onderstepoort Veterinary Institute, Private Bag X05, Onderstepoort, 0110, South Africa 

Introduction 

Sable (Hippotragus niger) and roan (Hippotragus equinus) antelope populations have shown alarming 

decreases in numbers in the past decades. Sable antelope are listed as “conservation dependent” on the 

IUCN Red List and declining numbers could lead to a “threatened” listing in the near future. Roan antelope 

are classified as vulnerable. They are specialist grazers, rarely feeding on browse, making them endangered 

in some areas such as the Kruger National Park. 

Wild ruminants are known to harbour a variety of intra-erythrocytic parasites. Theileria sp., Babesia sp. and 

Anaplasma sp. have previously been reported from sable antelope, mostly from asymptomatic carriers; 

clinical signs only appear when the animals are stressed. Babesiosis has been reported in roan antelopes. 

Piroplasms have also previously been reported from giraffes in Kenya and Namibia and in one case 

theileriosis was suspected of causing mortality. Specimens from sable, roan and giraffe that presented a 

sudden onset of disease and subsequently died were submitted for molecular characterization. The Reverse 

Line Blot (RLB) assay, developed for the simultaneous detection and identification of tick-borne parasites 

infecting cattle and small ruminants, was successfully used to identify previously undescribed Theileria and 

Babesia species infecting wild ruminants. 


Blood smears, blood and/or spleen samples collected from sable, roan and giraffe were received. DNA was 

extracted; the V4 variable region of the 18S rRNA gene amplified and analyzed using RLB. PCR products 

which did not hybridize with any of the Babesia or Theileria species-specific probes on the blot, but only with 

the Babesia / Theileria genus-specific probe were further investigated. Full-length 18S rDNA was amplified, 

cloned and the recombinants were analysed by sequencing analysis. Sequencing data were analysed using 

the Staden package, aligned with published sequences of related genera using ClustalX and phylogenetic 

trees were constructed using neighbor-joining in combination with the bootstrap method. 

Results 

Microscopic examination of thin blood smears revealed the presence of small piroplasms. RLB results 

showed that the PCR products amplified from the giraffe, sable and roan specimens hybridized only with the 

Babesia / Theileria genus-specific probe, but not with any of the Babesia or Theileria species-specific probes 

present on the blot. This probably indicated the presence of a novel Babesia or Theileria species or variant 

of a species. 


Sequence analysis revealed the presence of novel Babesia and/or Theileria species in sable, roan and 

giraffe that presented a sudden onset of disease and subsequently died. Molecular characterization 

indicated that the parasite in sable antelope is a member of the Babesia sensu stricto clade. It is tempting to 

propose that the parasite described in this study is B. irvinesmithi, first described in 1930 and responsible for 

the fatal cases reported in sable antelope in the past. The 18S rRNA gene sequences of the parasites 

isolated from roan and giraffe were most similar to Babesia sp Xinjiang-2005, a sheep isolate, which was 

originally isolated in China and described as often leading to clinically inapparent infection in sheep. Also, a 

Theileria species infection was present in some of the giraffe samples. Piroplasmosis could therefore be 

implicated as a possible cause of mortality in sable, roan and giraffe. It is not known whether these were 

isolated incidents or whether these parasites cause severe disease in free-ranging populations. 


Symposium attendance sponsored by: FAO-EMPRES 


DETECTION OF BLV IN FROZEN SEMEN SAMPLES BY PCR ASSAY 

L. Rossich 1 , J. Gutierrez 1 , S. Rodriguez 1 , E. Lefebvre 2 , K. Trono 1 and M. J. Dus Santos 1* 

(1) Instituto de Virología, CICVyA, INTA-Castelar. CC 77. Buenos Aires, Argentina. 

(2) Centro de Inseminación Artificial La Elisa. Argentina. 

* mdussantos@cnia.inta.gov.ar 

Introduction 

The major route of transmission of BLV is horizontal by direct exposure to biological fluids contaminated with 

infected lymphocytes, mainly blood. Although viral antigens and proviral DNA has been identified in semen, 

milk and colostrums, natural transmission through these secretions has not been demonstrated. The sanitary 

and economic impact of BLV infection is associated with the interference in the international movement of 

cattle and their germ plasm. Although experimental data support the improbability that semen from BLVpositive 

bulls could infect recipient cows, restriction for commercialization of semen from infected animals is 

still present 1-6 . Since there is no vaccine or treatment available, eradication and control of the disease is 

exclusively based on early diagnostic and segregation of infected animals. In this context the specificity and 

sensitivity of the diagnostic test used is a critical point. 

We have previously developed a PCR assay with high sensitivity and specificity to detect BLV genome in 

frozen semen samples. 

The objective of this work was to study the detection of BLV in semen. 


Samples: Serum, whole blood and semen samples were obtained from CIALE (Artificial Insemination Centre 

La Elisa, Capitan Sarmiento, Buenos Aires, Argentina) 

Serology: The agar gel immunodifussion (AGID) test kit used to detect antibodies to BLV was produced by 

the Faculty of Veterinary, La Plata University, Argentina. 

An indirect ELISA using recombinant p24 as antigen was used to detect antibodies to BLV. This assay has 

been completely developed and standardized in the Institute of Virology, INTA-Castelar, Buenos Aires, 

Argentina. 

Detection of proviral DNA: DNA was extracted from PMBCs (purified from whole blood) and semen samples 

(fresh and straw). PCR assays that amplified a region of genes pol and gag and a nPCR that amplified a 

region of gene env were developed. 

Results 

Two PCR assays were standardized for detecting BLV genome in semen and PMBC. The limit of detection 

of viral particles was assessed by the addition of purified pBLV344 (a plasmid containing the complete BLV 

genome, kindly provided by Dr. Willems, Faculté Universitaire des Sciences Agronomiques, Gembloux, 

Belgium) to DNA from semen or PMBCs of a seronegative bull. By gag-PCR and pol-PCR, it was possible to 

detect 60 viral particles, using bromide staining after electrophoresis separation of DNA. In order to increase 

analytical sensitivity, a nested-PCR was developed which amplified a region of env gene. The n-PCR was 

able to detected 6 viral particles. Assessment of the limit of detection was highly repetitive under the 

standardized conditions. 

Frozen semen samples from 30 seropositive bulls were remitted to the laboratory and analyzed in the period 

2005-2007. It was possible to detect proviral DNA in 172 out of 862 samples. BLV genome detection 

occurred in several collections but in an alternated way with non detection periods. 

Fresh semen samples, straws and whole blood were also obtained from 5 seronegative and 5 seropositive 

bulls and tested together for the presence of BLV provirus. Results indicated that while detection of provirus 

was positive in PMBC from all seropositive bulls, detection of gag, pol and env genes in semen did not 

occurred in all the samples. 


The results obtained suggest that BLV could present an intermittent pattern of excretion. 

Further studies should be done to confirmed the results obtained and to establish why the presence of BLV 

provirus in semen is not constant. 

References 

1. Choi, K, et al. 2002. Vet Diagn Invest 14: 403-406. 

2. Kaja, R. and Olson, C. 1982. Theriogenology 18: 107-112. 

3. Miller, J. and Van Der Maaten, M. 1979. J Natl Cancer Inst 62; 425-428. 

4. Monke, D. 1986. JAVMA 188 (8): 823-826. 

5. Romero, C., et al. 1983. Tropical Animal Health and production. 15: 215-218. 

6. Straub O. 1982. In: Fourth International Symposium of Bovine Leukosis. The Hague: Martinus Nijhoff 

Publishers: 299-308. 




A SIMPLE INTERNAL PCR CONTROL FOR MYCOBACTERIUM AVIUM SUBSP. PARATUBERCULOSIS 

CONSTRUCTED BY PCR TECHNIQUES 

Introduction 

I. Marsh, M. McLoon, S. Austin, S. Fell, V. Saunders and L.Reddacliff 

New South Wales Department of Primary Industries, Elizabeth Macarthur Agricultural Institute, Australia 

Polymerase chain reaction (PCR) is routinely used to confirm the presence of Mycobacterium avium subsp. 

paratuberculosis (MAP) in the diagnosis of ovine Johne’s disease (OJD). A limitation of diagnostic PCR 

assays is false negative results, that is, samples that are positive but do not amplify due to inhibition of the 

assay. PCR assays that do not include an internal control for each individual reaction can at best produce 

an interpretable result from non-inhibited positive samples and this makes it difficult to interpret negative 

results. Under these conditions diagnosticians cannot determine if a negative result is truly negative or if the 

reaction failed as a result of inhibitory substances present in the sample. Even though the appropriate 

positive and negative controls may have been included within a PCR run, generally run as individual 

reactions, these are only useful for establishing the integrity of the PCR reagents and act as references for 

which the samples can be compared against. To overcome this situation PCR-based diagnosticians have 

begun to introduce internal controls such that each amplification reaction can be monitored. A number of 

these internal controls have been reported 1-3 but have yet to be adopted widely by the M. a. paratuberculosis 

research or diagnostic community. Generally, these internal controls are produced using DNA cloning 

techniques and this may be a limitation on their widespread use, as many laboratories may not have time, 

finances or the laboratory expertise to prepare these internal controls. To overcome this we have designed 

a PCR-based method for producing an internal amplification control (IAC), based on a method described and 

used in the detection of Bordetella pertussis by PCR 4 . Unlike other internal controls that require cloning and 

other molecular manipulations, this IAC only requires PCR capability for its production. 

Method 

The IAC was constructed in a two step PCR process that amplified a region of the Mycobacterium avium 

subsp. avium (MAA) genome that is not present in the MAP genome using composite primers made of an 

MAA region and an MAP region. The IAC was then incorporated in to a multiplex PCR that included a new 

MAP specific target to increase specificity. The analytical sensitivity of the IAC and multiplex PCR was 

established prior to evaluation on DNA samples that had been previously examined for OJD. 

Results 

The IAC had no adverse effects on the analytical sensitivity of the MAP specific multiplex PCR. The new 

PCR test was successfully used to determine the presence/absence of MAP in 25 faecal samples with 

known OJD status and simultaneously determine the integrity of each reaction. Future work includes 

modifying this PCR test to a real-time PCR format. 

Conclusion 

We present a new multiplex PCR test for MAP that incorporates an IAC. The procedure used to produce the 

IAC is simple and highly adaptable to other PCR-based diagnostic tests. 

References 

1. Englund, S., A. Ballagi-Pordany, G. Bolske, and K. E. Johansson. 1999. Single PCR and nested PCR with 

a mimic molecule for detection of Mycobacterium avium subsp. paratuberculosis. Diagn Microbiol 

Infect Dis 33:163-71. 

2. Englund, S., G. Bolske, A. Ballagi-Pordany, and K. E. Johansson. 2001. Detection of Mycobacterium 

avium subsp. paratuberculosis in tissue samples by single, fluorescent and nested PCR based on 

the IS900 gene. Vet Microbiol 81:257-71. 

3. Brey, B. J., R. P. Radcliff, D. L. Clark Jr, and J. L. Ellingson. 2006. Design and development of an internal 

control plasmid for the detection of Mycobacterium avium subsp. paratuberculosis using real-time 

PCR. Mol Cell Probes 20:51-9. 

4. Muller, F. M., N. Schnitzler, O. Cloot, P. Kockelkorn, G. Haase, and Z. Li. 1998. The rationale and method 

for constructing internal control DNA used in pertussis polymerase chain reaction. Diagn Microbiol 

Infect Dis 31:517-23. 


INVESTIGATING SHEDDING RATES AND THE PROPORTION OF ANIMALS SHEDDING 

MYCOBACTERIUM AVIUM SUBSP PARATUBERCULOSIS IN CATTLE AND GOAT HERDS 

G.J. Eamens, NSW Department of Primary Industries 

Introduction 

Many diagnostic tests for Johne’s disease rely on, or correlate with, the level of faecal shedding of 

Mycobacterium avium subsp paratuberculosis (Map). Among faecal culture positive cattle, approximately 

70% are considered low faecal shedders of Map and 10% moderate shedders, 6 with low shedders the most 

difficult to detect in all diagnostic tests. Assessment of test performance must therefore be based on 

populations weighted more toward low to moderate shedder animals. However, such categories have only 

been defined from cultural results on solid media. 6 In recent studies of radiometric pooled faecal culture 

(PFC) for cattle and goats, a need to better understand shedding rates was highlighted. 


During PFC studies in cattle and goats, 1-3 the growth of Map in dilutions in radiometric (Bactec) culture media 

with IS900 PCR/REA confirmation was used to identify a critical threshold for positive cultures. Map was 

isolated from faeces of 20 cattle and 16 goats in the studies. From several samples, the number of viable 

Map cells in the inoculum of each animal was calculated by endpoint titration (Most Probable Number, MPN) 

and then related to the rate of growth in radiometric culture. 4 This data was used to establish a regression 

equation to estimate the concentration of Map in all inocula, and then shedding rates in faeces of all animals 

were estimated, based on known processing losses during Bactec culture. 5 From the highest culture 

positive dilutions used in the PFC evaluations (between neat to 1:50), the minimal threshold number of Map 

was estimated. Estimates of growth from identical inocula on Herrold’s solid medium and Bactec media were 

compared to adjust known cutpoints for low to high shedders on solid media. 

Results 

Bactec culture was found to be 10 fold analytically more sensitive than solid media culture, so figures applied 

to delineate low to high shedding rates from solid culture growth were considered to contain 10 fold more 

bacteria when radiometric culture was applied. Based on adjusted cutpoints for Bactec culture of < 7.5 x 10 4 

/g for low shedders and > 7.5 x 10 5 /g for high shedders in either species, 8, 3 and 9 samples were classified 

as low, medium and high shedders respectively in cattle and 9, 5 and 2 were similarly classified in goats. 

This information was vital in establishing the applicability of the PFC study findings. There was also a 

correlation between the maximum dilution positive in PFC and the estimated shedding rate. These estimates 

included an allowance for processing losses estimated to be 250-300 fold/g faeces based on earlier studies. 5 

As all animals shedding > 5 x 10 5 Map/g were positive at the highest PFC dilution (1:50), estimates of the 

minimum number of viable Map in the Bactec inoculum required for positive culture were limited to 11 cattle 

and 14 goats excreting < 5 x 10 5 Map/g. From these (which included 5 cattle and 7 goats still positive at the 

1:50 dilution), Bactec culture was capable of detecting < 20 viable Map/g from an inoculum (Table 1). 

5 

Table 1. Detection limits of radiometric culture from 11 cattle and 14 goats excreting < 5 x 10 Map/g faeces 

Detection limit Detection limit 

Mean/g < 4.9 x 10 3 

Mean/g < 3.7 x 10 3 

Processing loss/g 250 x Processing loss/g 300 x 

Map in inoculum < 19.8 Map in inoculum < 12.3 


From known processing losses, a minimum shedding rate of 2.5-3 × 10 2 Map/g of undiluted faeces would be 

required based on a single organism in the inoculum. The above results indicated that detection of < 3.7 x 

10 3 Map/g is readily achievable. Since these results allow populations to be categorised by growth rate in 

Bactec media, and more easily define populations as low, medium and high shedders, the same approach 

can be used to better evaluate the expected sensitivity of diagnostic tests that rely on or correlate with 

shedding rates. Further, these results indicate that to improve detection rates of low shedder animals using 

Bactec culture, an increase in the final number of Map cells in the Bactec inoculum is obligatory. Studies to 

capture larger numbers of Map cells or reduce losses during decontamination are therefore warranted. 

References 

1. Eamens GJ, et al (2007). Aust Vet J 85, 243-251 

2. Eamens GJ, et al (2007). Vet Microbiol 119, 184-193 

3. Eamens GJ (Unpublished). Final research report to Meat and Livestock Australia, 2006. Project PSHIP.184A 

4. Reddacliff LA, et al (2003). Appl Environ Microbiol 2003; 69, 3510-3516 

5. Reddacliff LA, Vadali A, Whittington RJ. (2003). Vet Microbiol 95, 271-282 

6. van Shaik G, et al (2003). J Vet Diag Invest 15, 233-241 

Supported in part by Meat and Livestock Australia 




A STREAMLINED WORKFLOW FOR RAPID AND SENSITIVE DETECTION OF Mycobacterium avium 

subsp. paratuberculosis (MAP) IN BOVINE FECAL SAMPLES BY REAL-TIME PCR 

D. A. Myers 1 , Q. Hoang 1 , R. Shah 1 , I. M. Moon 1 , R. C. Willis 1 , W. Xu 1 , A. M. Burrell 1 , W. Ge 1 , M. Bounpheng 1 , X. Fang 1 , J. El-Attrache 1* , 

and L. Effinger 2 

1 Applied Biosystems, Austin, TX, 2 Animal Health Lab, Oregon Department of Agriculture, 635 Capitol St. NE, Salem, OR 97301, *John 

El-Attrache, Applied Biosystems., 2130 Woodward Street, Austin, Texas 78744, Ph: (512) 651-0200 ext.6605 , Fax: (512) 651-0201, 

email: john.el-attrache@appliedbiosystems.com 

Johne’s disease is a chronic wasting disease of ruminants, caused by an incurable infection of the intestinal 

tract by the bacterium Mycobacterium avium subsp. paratuberculosis (MAP). Currently, the laboratory 

standard for diagnosing Johne’s disease is fecal culture. Cultures of samples taken from a herd’s 

environment are also used to identify a herd’s overall risk for Johne’s disease. Unfortunately, due to the 

slow growth of the MAP organism, cultures typically take between 6 and 16 weeks to determine MAP 

presence. This allows more time for infected animals to shed MAP into the environment, increasing the risk 

of infection to healthy animals in the same herd. 

Quantitative real-time PCR (qPCR) provides a much faster solution for the detection of MAP from animal 

feces with results available within hours. Applied Biosystems has developed an integrated workflow, 

consisting of streamlined sample preparation, high throughput nucleic acid isolation and purification, and 

qPCR for detection of the bovine strain of MAP in bovine fecal samples as well as environmental samples 

from cow alleyways and manure pits. The MAP DNA isolation protocol combines the use of chemical and 

mechanical cell lysis with the Ambion ® MagMAX technology - a rapid, high-throughput magnetic beadbased 

nucleic acid isolation and purification method - to purify MAP DNA with minimal reaction inhibitors 

commonly found in animal feces. The purified nucleic acid is analyzed using our AgPath-ID MAP reagent 

kit on the Applied Biosystems 7500 Real-Time PCR system. To minimize false negatives, our MAP assay 

contains XenoDNA, a unique nucleotide sequence that serves as an internal process control to monitor the 

presence of qPCR inhibitors and reagent functionality. 

Using 80 field samples with known MAP culture status, our workflow method resulted in 100% sensitivity and 

specificity, out-performing the currently available commercial fecal DNA isolation methods and MAP qPCR. 

In addition, we identified all samples in the 2007 NVSL Johne’s Check Test with 100% accuracy using our 

MAP detection method. We also tested 87 bovine fecal samples that grew ≤1 colony of MAP per culture 

tube on Herrold’s egg yolk medium with mycobactin J and antibiotics (HEY) resulting in 78 samples detected 

as MAP positive samples by our method. With our method 17 out of 19 fecal samples with growth of ≥100 

MAP colonies on HEY culture were easily distinguishable from all fecal samples we tested that grew ≤30 

MAP colonies on HEY culture (n=145). This allows samples with high quantities of MAP to be distinguished 

consistently from medium to low MAP positive samples, providing reliable data for determining the risk an 

animal presents to the rest of a herd. 

Performance of our MAP detection protocol was evaluated using 409 field samples of unknown status that 

were later tested by HEY culture at an independent NVSL certified laboratory. For high and medium-low 

MAP shedders (≥3 colonies MAP/tube on HEY culture, n = 47), this evaluation resulted in 97.9% sensitivity 

and 100% specificity for our MAP detection method when using HEY culture as the “gold standard.” HEY 

culture results for low MAP shedders (



AUTOMATED DNA ISOLATION: AN ADVANTAGEOUS TOOL IN MOLECULAR DIAGNOSTIC OF 

DERMATOPHYTOSIS 

Jose L. Blanco *, Sergio Alvarez, Patricia Alba, Marta E. García 

Dpto Sanidad Animal. Facultad de Veterinaria. UCM. 28040 Madrid. Spain. 

Introduction: 

The development and standardization of new techniques of DNA isolation from fungi is urgently needed. The 

use of automated procedures is an attractive alternative, and results in maximum efficiency when large 

numbers of specimens are handled. In this work, an automated system of DNA isolation from canine hairs 

experimentally infected by dermatophytes was compared with a manual protocol. 

Material & Methods: 

Hair samples from a healthy dog were experimentally infected by M. canis and T. mentagrophytes cultures. 

For the experimental infection, a small amount of hair was inserted into plate cultures of M. canis and T. 

mentagrophytes grown on Sabouraud agar containing 0.5 g l -1 of chloramphenicol (Sigma-Aldrich, St. Louis, 

USA) and 0.5 g l -1 of actidione (Sigma-Aldrich) that had been previously incubated for 12 d at 30ºC. After 

incubation at 30ºC for 72 h, approximately 5 mg of infected hairs were introduced into 1.5 ml Eppendof 

tubes. After the experimental infection, fungal DNA was isolated by two different procedures: a phenolchloroform 

method (manual protocol) and the automated system QuickGene-810 (Fujifilm, Japan). This 

automated system relies on pressured filtration technology through a porous membrane (50μm) that 

immobilizes nucleic acids due to their hydrophilic nature. The kit used (QuickGene DNA, Tissue Kit S) was 

initially designed for DNA extraction from different tissue samples, and has proven to be valid for isolation of 

fungal DNA. These procedures were compared at three levels: yield, purity of the DNA extract and time 

requirement of the protocol. To determine the quantity and quality of the DNA, the absorbance at 260 nm 

and the ratio of absorbances at 260 and 280 nm were measured. 

Results: 

The quantity and quality of DNA obtained in both procedures were suitable for the molecular techniques 

used in our laboratory to diagnose dermatophytosis (Table 1). Although a significatively lower yield was 

obtained with the automated procedure than with the manual protocol, purity of the DNA extracts was higher 

when DNA was isolated from M. canis infected hairs by the automated system. Moreover, the use of the 

automated procedure saved up to 22.5 minutes per sample with respect to the manual protocol. This 

procedure also reduces the time for which the direct intervention of a technician is required, which could 

compensate for the initial investment in the acquisition of the apparatus and the cost of the isolation kits. In 

addition, standardization of the extraction protocol is obtained, which is desirable in any laboratory. 

Discussion & Conclusions: 

The automated procedure of DNA extraction presents clear advantages: reduces considerably the handling 

time, prevents the use of nocive chemicals, minimizes the risk of cross-contaminations and improves the 

repeatability of the DNA isolation process. These multiple advantages of the automated DNA extraction 

procedure make it suitable for its application to the molecular techniques used in laboratorial diagnostic of 

dermatophytosis. 

Table 1: Comparison of procedures for DNA extraction from A. fumigatus mycelium and conidia 

Sample type 

Mycelium 

Conidia 

Extraction procedure 

* 

n 

Yield 

(µg DNA/mg sample) 

X ± SD 

Purity 

(DO260/DO280) 

X (range) 

M 4 3.46 ± 1.00 2.02 (1.98-2.06) 

A 4 0.91 ± 0.44 † 2.12 † (2.08-2.17) 

M 4 0.02 ± 0.01 1.48 (1.14-1.71) 

A 4 0.12 ± 0.06 † 1.38 (1.26-1.50) 

* Extraction procedure: M (manual), A (automated). 

† Significant difference (p < 0.05) between extraction procedures. 


DEVELOPMENT OF REAL TIME PCRS TO DETECT IMPORTANT 

BACTERIAL PATHOGENS OF THE HORSE. 

S. North*, P. R. Wakeley, N. Mayo, J. Mayers, J. Sawyer. 

Technology Transfer Unit, Biotechnology Department, Veterinary Laboratories Agency, New Haw, Addlestone, Surrey, England. 

Introduction 

We have developed three real time TaqMan ® PCRs to detect the causative organisms of two important 

bacterial diseases of the horse. Both of these diseases, and their control, have a significant economic 

impact on the equine industry and the welfare of horses. Two PCRs were developed to detect the causative 

agents of equine metritis, Klebsiella pneumoniae and Pseudomonas aeruginosa. Another PCR was 

designed to detect the causative agent of horse strangles, Streptococcus equi equi. These PCRs were 

designed to detect their target organisms directly from swabs. 


Two real time PCRs detected two of four causative organisms of CEM, Klebsiella pneumoniae and 

Pseudomonas aeruginosa, straight from swabs (we have previously validated a real time PCR to detect the 

other two, Taylorella equigenitalis and Taylorella asinigenitalis 1 ). The PCR to identify K. pneumoniae 

amplified a 95bp region of the 23S rDNA genes, the P. aeruginosa and S. equi equi PCRs amplified 131bp 

and 143bp fragments of the gyrase B gene. Another PCR detected Streptococcus equi equi, the causative 

organism of strangles, straight from swabs. For all three PCRs, swabs were firstly used to inoculate culture 

medium before a crude DNA extraction was performed, enabling a comparison with conventional culture 

methods. A control 16S rDNA PCR was run simultaneously with the diagnostic PCRs to determine whether 

the DNA extraction was successful. PCRs were tested against a panel of bacterial species, including horse 

commensals such as Rhodococcus equi and Oligella urethralis, to determine their analytical specificity. The 

sensitivity and efficiency of each PCR were also calculated. 

Results 

The PCRs did not cross-react with any of the 36 different bacterial organisms tested, including closely 

related species and known horse commensal bacteria. DNA was successfully extracted from nasal, abscess 

and genital swabs. All of the PCRs successfully identified a panel of positive and negative samples. The 

Pseudomonas aeruginosa PCR can detect as little as 20.3 gene copies and has an efficiency of ~100%. 


We have successfully developed real time PCRs to identify two of the causative bacteria of equine metritis 

and horse strangles. These tests, alongside that previously published, provide a fast and accurate means of 

bacterial identification enabling rapid diagnosis and treatment. 

References 

1 Wakeley, P.R., et al. 2006. Development of a real time PCR for the detection of Taylorella equigenitalis 

directly from genital swabs and discrimination from Taylorella asinigenitalis. Vet. Microbiology. 118, 247- 

254. 

� 




ENHANCED CULTURAL SENSITIVITY OF STAPHYLOCOCCUS AUREUS FROM BOVINE MASTITIS 

MILK BY SAMPLE FREEZING AND CENTRIFUGATION 

1 Msoud Ghorbanpoor, 2 Seed Goraninejad and 3 Mansoreh Keshavarzi 

1 Department of Pathobiology, 2 Department of Clinical Science, 3 Graduate of, Faculty of Veterinary Medicine, Shahid Chamran 

University, Ahvaz, Iran. 

Bacterial culture of some milk samples may yields no bacterial growth due to presence of low colony forming 

unite of bacteria in the samples. These false negative results are more likely to occur with coliforms and 

S.aureus. Zecconi et al (1997) reported a 94% increased recovery rate of S. aureus from sediment after 

centrifugation of bovine mastitis milk. Villanueva et al (1991) reported a 1.5 times increased recovery rate of 

S. aureus by pre-culture freezing. Pre-culture freezing and incubation may also increased S. aureus recovery 

rate (sol et al, 2002). In attempts pre-culture freezing and centrifugation were examined to increase the 

recovery rate of S. aureus from milk of clinical bovine mastitis. 

Culture of milk from 60 affected quarters were done by standard techniques (0.01 ml of samples streaked on 

sheep blood agar). The result of this method was compared with that of pre-culture centrifugation (1500g for 

5 minutes), pre-culture freezing (12 hours at -56˚C) and pre-culture freezing and centrifugation. 

S. aureus were isolated from 22(36.6%) samples by standard method. Pre-culture freezing or freezing and 

centrifugation of these samples reveal 30(50%) positive S. aureus infection, in the other hand, freezing 

cause's detection of 8 additional S. aureus positive samples. 

Pre-culture centrifugation significantly increased the count of recovered S.aureus. Freezing enhanced 

(P



MULTILOCUS SEQUENCE ANALYSIS AS A TOOL FOR IDENTIFICATION OF VIBRIO HARVEYI- 

RELATED ISOLATES FROM THE LARVAL REARING SYSTEM OF THE TROPICAL ROCK LOBSTER 

PANULIRUS ORNATUS 

A. Cano Gomez 1,2 , M.R. Hall 1 , L. Owens 2 , D.G. Bourne 1 , L. Høj 1 * 

1 Australian Institute of Marine Science, PMB 3, Townsville MC, QLD 4810; 2 Department of Microbiology and Immunology, James Cook 

University, Townsville, QLD 4811 

Introduction 

The development and sustainability of the crustacean aquaculture sector requires a fast and reliable 

technique for the detection of pathogenic vibrios in order to manage potential infections. At the Australian 

Institute of Marine Science (AIMS) we currently work towards closing the life cycle of the tropical rock lobster, 

Panulirus ornatus, which is a potential high value aquaculture candidate in Australia. The species has an 

extended larval phase (6 months), which makes controlling the microbial hatchery environment particularly 

challenging. Vibrio harveyi and related species are relevant pathogens of reared crustacean and fish causing 

severe economic losses due to high mortality rates (Haamed et al. 1996, Karunasagar et al.1994). 

Conventional biochemical tests and analysis of the 16S ribosomal RNA marker gene are unable to 

differentiate between these species as they share many phenotypic and genotypic characteristics (Gómez- 

Gil et al. 2004). To solve this problem we used a Multilocus Sequence Analysis (MLSA) which included 

screening of the housekeeping genes 16S rRNA, recA, rpoA, pyrH, dnaJ, and the V. harveyi toxR and luxN 

genes to obtain a precise identification of V. harveyi-related strains isolated from the larval rearing system of 

P. ornatus during mass mortality events. 


DNA was extracted from V. harveyi-related strains isolated from different compartments of the larval rearing 

tank of P. ornatus at AIMS. PCR amplifications of the rpoA, recA, and pyrH genes, the dnaJ gene, the toxR 

gene and the luxN gene were based on Thompson et al. (2005), Nhung et al. (2006), Conejero and 

Hedreyda (2003), and Bassler et al. (1993), respectively. Sequenced PCR products were aligned and 

phylogenetic trees were constructed using ContigExpress, AlignX, (Vector NTI Advance Software, 

Invitrogen) and Mega 3.1 Software. In addition, for each gene and strain the closest relatives were identified 

using the BLAST database algorithm available from NCBI. 

Results 

PCR products from the housekeeping genes were visualized in agarose gels as individual bands with the 

expected size for all tested strains. After BLAST search the isolates were identified as either V. harveyi, V. 

campbellii or V. rotiferianus with sequence identities of 99-100% for the 16S rRNA, rpoA, and pyrH genes, 

97-98% for the recA gene and 96-99% for the dnaJ gene. The identity of the two isolates identified as V. 

harveyi strains by the MLSA was confirmed by specific amplification of the V. harveyi toxR and luxN genes. 

The luxN was also amplified for two strains identified as V. campbellii but these sequences showed only 96% 

homology to the luxN gene of V. harveyi in the databases. 


This study used a MLSA approach including the 16S rRNA, recA, rpoA, pyrH, dnaJ, toxR and luxN genes to 

specifically identify closely related Vibrio strains as either V. harveyi, V. campbellii or V. rotiferianus. The 

housekeeping genes included in the analysis have been reported as the most appropriate phylogeny 

markers for the identification of V. harveyi-related species (Thompson et al., 2005; Nhung et al., 2006). 

Identification based on the dnaJ gene was however not consistent with the other genes. This discrepancy 

with the literature is potentially due to the limited number of sequences included in previous studies. The V. 

harveyi luxN primers amplified the gene also for strains identified as V. campbellii. The luxN gene codes for 

one of the components of the quorum sensing system of V. harveyi but the results suggest that the gene 

may not be specific of this bacterium. This study suggests that a MLSA is required for a definitive 

identification of V. harveyi-related species and it will form the basis of a potential diagnostic assay for the 

detection and monitoring of Vibrio populations associated to the larval rearing system of P. ornatus and other 

aquaculture species. 

References 

Bassler BL, Wright M, Showalter RE, Silverman MR, 1993. Mol. Microbiol. 9: 773-786. 

Bourne DG, Høj L, Webster NS, Swan J, Hall MR, 2006. Aquaculture 260 (1-4): 27-38. 

Conejero MMU, Hedreyda CT, 2003. J. Appl.Microbiol.95: 602-611 

Gómez-Gil B, Soto-Rodríguez S, García-Gasca A, Roque A Vazquez-Juarez R, Thompson FL, Swings J 2004. Microbiology 150: 1769- 

1777. 

Haamed ASS, Rao PV, Farmer JJ, Brenner FWH, Fanning GR, 1996. Aquac. Res.27: 853-863. 

Karunasagar I, Pai R, Malathi GR, Karunasagar I, 1994. Aquaculture 128: 203-209. 

Nhung PH, Shah MM, Ohkusu K, Noda M, Hata H, Sun XS, Iihara H, Goto K, Masaki T, Miyasaka J, Ezaki T 2006. Syst. Appl. 

Microbiol. 30 (4): 309-315. 

Thompson FL, Gevers D, Thompson CC, Dawyndt P, Naser S, Hoste B, Munn CB, Swings J 2005 Appl Environ Microbiol 71: 5107- 

5115. 


INDONESIA VETERINARY LABORATORY CAPACITY BUILDING PROJECT FOR HIGHLY 

PATHOGENIC AVIAN INFLUENZA 

S Gibbs*#, N Widowati†, A Axell*, R Lunt*, C Groocock‡, L Lauerman‡, A Foord*, I Pritchard*, T Taylor*, P Selleck*, M Johnson*, E 

Siregar†, B Poermadjaja†, and P Daniels* 

*Australian Animal Health Laboratory, LI, CSIRO, Geelong, Victoria, Australia; †Directorate of Animal Health, Department of Agriculture, 

Jakarta, Indonesia; ‡United States Department of Agriculture, APHIS, Jakarta, Indonesia 

# presenting author, poster submission 

Introduction 

In 2006, the Australian Animal Health Laboratory began a project in collaboration with the Disease 

Investigation Centers (DICs) of the Directorate General of Livestock Services (Indonesia), Balitvet 

(Indonesia), and the United States Department of Agriculture to ensure that highly pathogenic avian 

influenza diagnostic testing in Indonesia, and the surveillance programs which rely on that testing, achieve 

and sustain international best practice standards in managing the threat of pandemic influenza. Through this 

work, the Surveillance and Epidemiology and Laboratory Services elements of the Indonesian National 

Strategic Work Plan are supported. 

Objectives 

The objectives of the project are to support the use of laboratory testing capabilities for on-going and durable 

surveillance programs that investigate outbreaks, monitor the spread of highly pathogenic avian influenza, 

and monitor vaccination coverage, as well as promote the use of the OIE reference laboratory to analyze 

changes in the genetic composition of circulating avian influenza viruses. 

Methods 

Real-time RT-PCR units were purchased and installed in each of eight regional veterinary laboratories (DICs 

and Balitvet). Training, support, reference materials, and proficiency testing for real-time RT-PCR and 

serological testing (HI and ELISA) were provided to each laboratory. Formal training sessions in 

epidemiological techniques, on-site support visits, and field exercises for sample collection, biosafety and 

biosecurity training were also delivered. 

Results 

The first round of proficiency testing by the laboratory capacity building project has shown a good level of 

capability in the regional veterinary laboratory network with both HI serology and real-time RT-PCR. The 

real-time RT-PCR is ready for use in routine diagnosis of AI in Indonesia, with ongoing support from the 

project. Epidemiological training has helped to refine field procedures (blood, tissue, and swab collection), 

improve the use of personal protective equipment, increase understanding of data collection and analysis 

approaches, improve outbreak investigation techniques, and refine the sampling strategy at each regional 

laboratory. 

Conclusions 

Highly pathogenic avian influenza continues to be a major concern in Indonesia, both for human and poultry 

health. The transmission of subtype H5N1 directly from infected birds to humans has raised concerns that 

the potential for an influenza pandemic is increasing. There are also concerns about the potential for field 

strains of avian influenza viruses to mutate with consequences for diagnostic tests, appropriateness of 

vaccine strains and infectivity for people. Addressing these problems will require continuing surveillance 

throughout Indonesia. Isolation and characterization of AI viruses from the field will serve as important 

guides for adjusting laboratory tests to suit current strains, as well as providing information for vaccine 

development and application. Serological surveillance of poultry populations will provide needed information 

about vaccine coverage, exposure, and immunity. Continued public education campaigns and community 

involvement will be vital to the success of avian influenza control efforts in Indonesia. 



Introduction 


MANAGEMENT OF A DIVA VACCINATION PROGRAMME FOR THE CONTROL OF LOW 

PATHOGENICITY AVIAN INFLUENZA (LPAI) IN ITALY 

M. Dalla Pozza 1 *, L. Busani 1 , C Ceolin 1 , C. Terregino 1 , G. Vicenzoni 1 , L. Bonfanti 1 , G. Ortali 2 , S. Marangon 1 

1 Istituto Zooprofilattico Sperimentale delle Venezie, Legnaro, Padova, Italy 

2 Gruppo Veronesi 

From 2000 to 2005, Italy was affected by several Low Pathogenecity Avian Influenza (LPAI) epidemics 

caused by viruses of the H5 and H7 subtypes. During these epidemic waves, a set of control measures and 

restriction policies were enforced together with a “DIVA” – Differentiating Infected from Vaccinated Animals – 

vaccination strategy based on heterologous vaccination (1.2). Collection, storage, and processing of all the 

data arising from the vaccination programme and monitoring activity were of fundamental importance in 

ensuring the complete control of the epidemiological situation in the vaccination area. This paper describes 

the features of the vaccination strategy implemented and the Information System (IS) established for the 

continuous monitoring of vaccination campaign activities and results. 


The vaccination program was applied in a well-defined area in the northern part of Italy (Lombardia and 

Veneto Regions). The criteria taken into account to define the area to be vaccinated were: risk factors for 

virus introduction and spread; occurrence of epidemics in previous years; poultry densities; presence of 

highly susceptible bird species (such as turkeys) and economic impact of the restriction measures in the 

vaccination zone. The vaccination strategy was targeted to specific types of poultry with long life-span and 

high LPAI infection risk (meat turkeys and layers). According to EU legislation (3) and guidelines a 

vaccination approach able to distinguish between vaccinated and infected birds through the use of a “DIVA” 

strategy was implemented. This strategy was based on the use of a vaccine containing a virus strain of the 

same H type as the field virus but with a heterologous neuraminidase. Heterologous monovalent and 

bivalent vaccines were selected depending on which virus was circulating. An intensive monitoring 

programme was implemented to ensure a prompt identification of field-exposed vaccinated flocks. To 

ensure the success of the control programme, detailed information on vaccinated farms and results of the 

monitoring programme were collected, stored, and processed in a central database (db). This permitted the 

continuous monitoring of the field situation including the results of the vaccination campaign. 

Results 

From 2003 to 2006 a total of 188,858,000 doses of vaccines were delivered, 697,712 serum samples and 

14,666 virological samples were tested in the framework of the vaccination monitoring programmes. A 

continuous flow of information to the central db was implemented from: farms (data on identification and 

location, species, vaccination schedule and production cycle); laboratory (data from the monitoring 

programme); vaccine delivery unit (doses of vaccine delivered to each farm). A centralised database to store 

and process all the data arising from the vaccination program was developed. 


The success of a vaccination campaign is correlated with the implementation of restriction measures and the 

monitoring programmes associated with the DIVA vaccination strategy. The development and 

implementation of a dedicated I.S. allows the continuous monitoring of the epidemiological situation, linking 

laboratory information with field data, and eventually provides the evidence of lack of virus circulation in 

vaccinated flocks. In addition, a dedicated I.S. is a valuable tool to manage emergency situations during 

LPAI epidemics. 

References 

1. European Union (2000). Commission Decision 2000/721/EC of 7 November on introducing vaccination to 

supplement the measures to control avian influenza in Italy and on specific movement control measures. 

Off.J.Eur. Communities, L291, 33-36. 

2. CAPUA I, MARANGON S, 2005, The use of vaccination to combat multiple introductions of Notifiable 

Avian Influenza viruses of the H5 and H7 subtypes between 2000 and 2006 in Italy. Vaccine 2005; 25: 

4987-4995. 

3. CAPUA I, MARANGON S, 2006, Control of Avian Influenza in poultry. Emerg. Infect. Dis. 2006; 12: 1319- 

1324. 


ADAPTATION OF REAL TIME PCR ASSAYS FOR DETECTION OF NEW AND EVOLVING AVIAN 

INFLUENZA VIRUS STRAINS 

Introduction 

A.J. Foord* and H.G. Heine 

CSIRO Livestock Industries, Australian Animal Health Laboratory, PO Bag 24, Geelong VIC 3220, Australia 

The design of TaqMan real-time PCR assays for rapid detection of AI H5N1 strains is based on available 

sequence information at the time of assay design. AI H5N1 continues to spread and cause disease in 

different geographic regions and hosts. Various genetic sublineages or clades of H5N1 strains have evolved 

and some recent isolates have acquired multiple genetic changes in primer or probe target regions. This has 

led to reported test failures for established TaqMan assays. Sequence analysis of GenBank data suggests 

that some of the recent AI strains will not be identified by the existing TaqMan assay. The project addresses 

the recent test failures of established TaqMan assays. We assessed the implications of sequence mismatches 

in detection probes and evaluated the use of generic detection dyes such as SYBR Green to 

overcome test failure due to nucleotide changes in the TaqMan probe binding region. 


Sequences of AI isolates where TaqMan assays have failed have been determined and analysed. The 

potential use of generic dyes such as SYBR Green an alternative to TaqMan has been evaluated using 

recent AI strains from South East Asia and a panel of laboratory reference strains. 

Results & discussion 

Real-time PCR assays using SYBR Green were able to detect strains where TaqMan assay had failed due 

to nucleotide mismatches in the probe region. The same technology was able to differentiate highly 

pathogenic from low pathogenic AI strains based on sequence differences in the hemagglutinin cleavage 

sites and could potentially be used for subtyping and molecular pathotyping. Real time PCR using SYBR 

Green was less specific than TaqMan assays and resulted in cross-reactivity of some closely related 

subtypes. Results have to be analysed carefully by melting curve analysis of amplified product. Generic dyes 

such as SYBR Green offer a robust alternative to TaqMan assays for detection of AI, esp. newly evolving AI 

strains that may fail in TaqMan assays. 

References 

Spackman E., Senne D. A., Myers T. J., Bulaga L. L., Garber L. P., Perdue M. L., Lohman K., Daum L. T., 

Suarez D. L.. (2002). Development of a real-time reverse transcriptase PCR assay for type A influenza virus 

and the avian H5 and H7 hemagglutinin subtypes. J. Clin. Microbiol. 40:3256–3260 

Heine H.G., Trinidad L., Selleck P., Lowther S. (2007). Rapid Detection of Highly Pathogenic Avian Influenza 

H5N1 Virus by TaqMan Reverse Transcriptase-Polymerase Chain Reaction. Avian Diseases 51: 370-372 




IDENTIFICATION OF A NOVEL HEMAGGLUTININ CLEAVAGE SITE IN A HIGHLY PATHOGENIC AVIAN 

INFLUENZA H7 FROM NORTH KOREA 

Introduction 

H.G. Heine 1* , L. Gleeson 1, 2 , G. Fusheng 3 , L. Sims 4 , L. Trinidad 1 , S. Lowther 1 , J. Bingham 1 , P. Selleck 1 

1 CSIRO Livestock Industries, Australian Animal Health Laboratory, PO Bag 24, Geelong VIC 3220, Australia 

2 current affiliations: United Nations Food and Agriculture Organisation (FAO), Bangkok. 

3 United Nations Food and Agriculture Organisation (FAO), Beijing 

4 Asia Pacific Veterinary Information Services, Manuda, Queensland 

An avian influenza (AI) H7N7strain was isolated from an outbreak associated with high mortality in chicken in 

the Democratic Peoples Republic of Korea (North Korea) amidst the H5N1 epidemic in surrounding countries 

in 2005. Virus was submitted to the OIE regional reference laboratory at the Australian Animal Health 

Laboratory in Geelong for further characterisation. 


Virus was propagated in embryonated eggs and the intravenous pathology index (IVPI) determined. 

Pathology and histology were determined in 9 and 12 week old chickens. Molecular characterisation of the 

virus was by real-time PCR TaqMan assays (1) for type A, H5 and H7 and by conventional PCR and 

sequence analysis of the hemagglutinin gene. 

Results 

The original diagnostic specimen consisted of a lung sample from which virus was propagated in 

embryonated eggs. The virus was highly pathogenic avian influenza (HPAI) with an IVPI of 3.0. Oral/nasal 

challenge resulted in high mortality within 48 to 96 hours after inoculation confirming the virulence of the 

virus by natural routes of infection. TaqMan assays performed on the original submitted sample and the 

derived allantoic fluid of the first passage in embryonated eggs were strong positive for type A and H7, but 

negative for H5, ruling out potentially mixed populations with H5 virus. Brain, pancreas, kidney, lung and 

spleen from 4 chickens infected by natural route were AI TaqMan positive by day 1-2 post infection, 

indicating a high virus load in all tissues. Sequence and phylogenetic analysis of the hemagglutinin placed 

the virus into the Eurasian lineage of H7 strains. The molecular pathotype was determined as highly 

pathogenic by the presence of multiple basic amino acid residues at the H0 cleavage site and a unique 

amino acid sequence was identified at the haemagglutinin cleavage site that was longer than previously 

observed in HPAI strains of the Eurasian lineage. The cleavage region contained aromatic amino acids 

histidine and proline previously not observed in this context. 


Molecular analyses indicate that a novel HPAI has been infecting poultry on the Korean Peninsula. The virus 

contained a unique haemagglutinin cleavage site that was longer than those observed in HPAI strains from 

previous outbreaks in Australia (1997), Italy (1999) and the Netherlands (2003). The outbreak of an HPAI H7 

amidst the H5N1 epidemic in surrounding countries emphasizes the necessity for broad and comprehensive 

detection methods in avian influenza surveillance and diagnosis. The occurrence of novel changes in the 

virus sequence highlights the unpredictable nature of influenza virus. 

References 

(1) Heine H.G., Trinidad L., Selleck P., Lowther S. (2007). Rapid Detection of Highly Pathogenic Avian 

Influenza H5N1 Virus by TaqMan Reverse Transcriptase-Polymerase Chain Reaction. Avian Diseases 51: 

370-372 


PRELIMINARY VALIDATION OF A COMMERCIAL AVIAN INFLUENZA N1 ANTIBODY COMPETITIVE 

ELISA KIT THAT CAN BE USED AS PART OF A DIVA STRATEGY 

WG Dundon 1 , C. Terregino 1 , V. Tuttoilmondo 1 , M. Pizzuto 1 , L. Busani 2 , M. Mancin 2 , 

G. Cattoli 1 , I. Capua 1 

1 OIE\FAO and National Reference Laboratory for Avian Influenza and Newcastle Disease, Istituto Zooprofilattico Sperimentale delle 

Venezie, Legnaro (PD), ITALY ; 

2 Centro Regionale di Epidemiologia Veterinaria, Istituto Zooprofilattico Sperimentale delle Venezie, Legnaro (PD, ITALY 

1.Introduction and Objectives 

Key words: DIVA, Avian influenza, kit validation 

The use of vaccination as part of a set of coordinated measures to combat AI is deemed to be successful in 

achieving the goal of eradication if it allows for the “DIVA” (Differentiation of Infected from Vaccinated 

Animals) principle (1). These systems enable the detection of field exposure in vaccinated flocks and through 

this, infected flocks may be properly managed. One of the systems that enables the detection of field virus in 

a vaccinated population is based on the use of a vaccine containing a seed virus of the same H subtype but 

of a different N subtype to the field virus (eg H5N9 vaccine against H5N1 field virus). Cross-protection is 

ensured by the same H group and antibodies to the N of the field virus are a result of field infection. In the 

framework of Workpackage 4.3 of EPIZONE (DIVA diagnostics) a commercially available competitive ELISA 

kit (ID Screen®, ID-VET, France) which is designed to specifically detect antibodies directed against the N1 

antigen was validated using poultry sera from the OIE\FAO and National reference laboratory for Avian 

influenza and Newcastle disease, Padova Italy. 

2.Material and methods 

The ID Screen® ELISA kits were used according to the manufacturer’s instructions. The sera tested were 

from (A) chickens vaccinated with an H7N5 subtype virus and challenged with an H7N1 subtype virus 

(n=33); (B) turkeys (n=13) and chickens (n=8) negative for type A influenza virus; (C) unvaccinated turkeys 

infected with H7N1 subtype virus (n=41); (D) unvaccinated turkeys infected with H7N3 subtype virus (n=40). 

Each sera was tested in duplicate. The results obtained from the ID Screen® ELISA were compared to the 

indirect immunofluorescence antibody assay (iIFA) which was taken as the gold standard (2). Cohen's 

Kappa statistic (K) value was calculated to assess the agreement between the tests. 

3.Results 

The overall sensitivity of the ID Screen® ELISA test as compared to the gold standard iIFA was 93.0% (CI 

95% 85.0-98.0), 91% for chickens (CI 95% 76.0-98.0) and 95% for turkeys (CI 95% 83.0-99.0). The overall 

specificity of the ID Screen® ELISA test as compared to the gold standard iIFA was 100% (CI 95% 94.0- 

100.0), 100% for chickens (CI 95% 63.0-100.0) and 100% for turkeys (CI 95% 93.0-100.0). The K value was 

calculated as 0.9264 indicating “excellent agreement” between the two tests according to Landis & Koch (3). 

4.Discussion and Conclusions 

The preliminary validation of the ID Screen® ELISA test has revealed an almost perfect agreement with the 

iIFAT, with excellent specificity and a sensitivity of 93%. This is most probably due to the competitive nature 

of the test. Optimisation and further validation studies will be carried out using a larger number of sera from a 

larger variety of birds (e.g. ducks, quail, ostriches etc). 

5.References 

(1) Capua I, Cattoli G, Marangon S. (2004) DIVA--a vaccination strategy enabling the detection of field 

exposure to avian influenza.Dev Biol 119:229-33 

(2) Cattoli, G., Terregino, C., Brasola, V., Rodriguez, JF, Capua, I (2003) Development and preliminary 

validation of an ad hoc N1-N3 discriminatory test for the control of avian influenza in Italy. 

Avian Dis. 47:1060-2 

(3) Landis J, Koch G.(1977) An application of hierarchical kappa-type statistics in the assessment of majority 

agreement among multiple observers. Biometrics. 33:363-74. 



Introduction 


INACTIVATION OF AVIAN INFLUENZA VIRUSES (AIVs) 

BY NUCLEIC ACID EXTRACTION REAGENTS 

Beato M.S., Milani A., Mazzacan E., Cattoli G. 





Biosafety issues related to handling and shipment for diagnostic purposes of samples potentially 

contaminated by avian influenza viruses (AIVs) is a matter of concern for preventing the introduction of the 

agent in new areas or the infection of animals and human beings. In this study, the lysis buffer of two 

commonly used RNA extraction kits (High Pure RNA isolation kit, Roche; RNEasy kit, Qiagen) and of the 

FTA (Flinders Technology Associates) filter papers have been compared for their efficacy at inactivating 

AIVs. 


Two Low Pathogenicity AIVs (LPAIV): H5N2 A/turkey/Italy/80 (10 5.23 EID50/100µl) and H7N3 

A/chicken/Italy/8000/02 (10 6 EID50/100µl); and two Highly Pathogenic AIVs (HPAIV): H5N1 HPAI 

A/chicken/Yamaguchi/7/2004 (10 6.74 EID50/100µl) and H7N1 HPAI A/cicken/Italy/3665/99 (10 5.75 EID50/100µl); 

were incubated with the reagents at +4°C, 37°C and room temperature (25°) for 4 hours, 48 hours and seven 

days. Before using the lysis buffers or the filter cards, their toxicity to Specific Pathogen Free (SPF) chicken 

embryos were tested. Each lysis buffer was diluted in PBS with antibiotics from 10- 1 to 10- 3 . The active area 

of FTA filter card was removed and soaked in 2 ml of PBS with antibiotics. The supernatant was used to 

perform the toxicity test. The results of the toxicity test and virus inactivation were assessed by virus isolation 

performed in SPF eggs. The amplificability of the extracted RNA was tested by Real Time RT-PCR. 

Results 

Lysis buffers (Qiagen and Roche) were able to inactivate the four AI viruses at all the temperatures and 

contact times evaluated. The FTA filter papers inactivated both LPAIVs at all the temperatures and contact 

times, but the HPAI viruses were not inactivated under all conditions. 

The strain H5N1 (A/chicken/Yamaguchi/7/2004) was not inactivated after 4 hours at +°4C, but was 

inactivated at +37°C and at room temperature with this contact time. The same strain was inactivated after 

48 hours and seven days at all the temperatures tested. 

The strain H7N1 HPAI (A/chicken/Italy/3665/99) was not inactivated after 4 hours at any of the temperatures 

tested. Furthermore inactivation of this strain was not achieved after 48 hours at +4°C and +37°C but was 

achieved at room temperature. The H7N1 HPAI was inactivated after 7 days at room temperature and at 

+37°C but not at +4°C. Due to the discordance of results with LPAI and HPAI strains using the FTA 

technology, the test was repeated twice and the results reported above were confirmed. The viral RNA 

extracted with the three products was amplified at all temperatures and contact times. 

Discussion & Conclusions 

Data on the inactivation of AI viruses by chemical compounds are fragmentary and not in agreement (De 

Benedictis et al., 2007). Here we report results on the inactivation of AI viruses by different chemical 

compounds: lysis buffer of two different RNA extraction kits and FTA technology. 

Our data indicate that the inactivation of AI viruses by both lysis buffers was reliable under all the conditions 

evaluated. In contrast, the inactivation of AI viruses by FTA filter papers, is dependent on the subtype and 

pathogenicity of viruses as different results were obtained according to the strain tested. Moreover it seems 

that the HPAI viruses were not inactivated by FTA filter papers at +4°C even after 7 days with the H7N1 

virus. At the higher temperatures a contact time of 7 days was required to fully inactivate both HPAI viruses. 

References 

De Benedictis P, Beato MS, Capua I. Inactivation of avian influenza viruses by chemical agents and physical 

conditions: a review. Zoonoses Public Health. 2007;54(2):51-68. 


A Rapid Laboratory Diagnosis of H5N1 Avian Influenza in Saudi Arabia 

Huaguang Lu 1 , Yousef Mohammed 2 , Owais Ahmed Khan 2 , Mansoar Hashem 2 , Mohamed Shuaib 2 

1 Animal Diagnostic Laboratory, Pennsylvania State University, University Park, PA 16802, USA 

2 Central Veterinary Diagnostic Laboratory, Riyadh 11454, KSA 

An avian influenza (AI) suspicious case submission with trachea, lung, brain, intestine, and other organs 

collected from one dead chicken and one sick chicken of a family owned “back yard poultry” was received at 

the Central Veterinary Diagnostic Laboratory (CVDL) in Riyadh of Saudi Arabia in May 9, 2007. The data 

submission sheet described that 41 chickens were dead out of 150 total, 2 turkeys dead (total unknown), 

sick birds had respiratory signs. This case was treated as a high priority case at the CVDL. Six tissue 

specimens including trachea/lung, brain and intestine from both live and dead birds were tested positive for 

Flu A virus by the BinaxNOW ® Influenza A & B test, and positive for H5 subtype by the Dot-ELISA test using 

H5-specific monoclonal antibody. Real-time RT-PCR test on the 6 tissues was positive for H5 subtype of AI 

virus (AIV). Meanwhile, the 6 tissues were processed and inoculated into embryonating chicken eggs for 

virus isolation. A 50% of embryo death occurred within 15 hours post inoculation in next morning. 

Chorioallantoic fluid (CAF) samples were harvested from the dead embryos and AIV confirmation tests 

including BinaxNOW ® Influenza A & B test, Dot-ELISA and HA/HI tests for H5 subtype, and real-time RT- 

PCR test for H5 and N1 subtype were conducted on the 6 CAF samples. These tests confirmed that the 6 

CAF samples were all positive for H5N1 subtype of AIV. Therefore, a final laboratory diagnosis of this H5N1 

positive case was made within 24 hours after case submission. 




SEROPREVALENCE OF H9N2 ANTIBODY IN POULTRY FARM AND 

SLAUGHTER-HOUSE WORKERS OF IRAN USING HI TEST 

Masoud Hosseini 1,3,* , Effat Alizadeh 1 , Rouzbeh Bashar 2 , Vahideh Mazaheri 2 , Mansoureh Tabatabaeian 2 , Masoumeh Tavassoti Kheiri 2 

1) Department of Microbiology, Faculty of Biological Sciences, Shahid-Beheshti University, 2) Influenza Unit, Pasteur Institute of 

Iran 3) Central Veterinary Laboratory, Iran Veterinary Organization, Tehran, IRAN 

Introduction 

A number of different subtypes of influenza A viruses have emerged as agents of avian influenza in humans 

including H5N1, H7N2, H7N7 and H9N2. Most cases of avian influenza infection in humans have resulted 

from direct or closed contact with secretions and excretions from infected birds in poultry farm and abattoir. 

An outbreak of H9N2 infection in poultry farms is first reported in 1998 in Iran which is now endemic and 

vaccination against this subtype is practicing. The aim of this study is to investigate seropositivity among 

people with occupational risk of exposure to poultry subjects against H9N2 virus in Tehran province which is 

the most populated province with the highest number of poultry farms in Iran. 


Sera were collected from poultry farms (no.65) and slaughter houses (no.62) workers from Tehran province. 

Only 42 of sera were from vaccinated workers with European trivalent commercial influenza vaccine. Also 25 

serums were collected from individuals who were not working with poultry, set as non-contact group. HI 

assay were performed as described in WHO recommendations against locally circulating H9N2 virus. 

Results 

The total seropositivity in groups who were in contact with poultry subjects were 37 %( 48/127), whereas it 

was 4% (1/25) in non-contact group, i.e., 9.25 times higher. Seropositive workers in slaughter houses (52%) 

were 2.2 times higher than in poultry-farms (23%). Seropositive workers in visceral removing line (83%) were 

2.64 times higher than feather removing line workers (31.5%) in slaughter-houses. Cross reaction was 

observed between AntiH3 and anti H9 antibodies. This cross reaction was eliminated by adsorption of 

vaccinated people sera by H3N2 virus. 


Our study clearly showed that poultry-to-human transmission of avian influenza A (H9N2) viruses is feasible 

in contact people. However, the seropositivity rate could be different as other study (2) reported only 26% in 

compare with 37% in our work. Interestingly, the workers who were in contact with carcass visceral showed 

the highest seropositivity(83%), compare with other workers who were working in feather removing line 

(31.5%) or who were working with live poultry (23%). This implies again that visceral from infected birds in 

slaughter-house is the most contaminated material. 

References 

1) Manual on Animal Influenza Diagnosis and Surveillance (2002) WHO/CSR/NCS/2002.5 

2) Cheng X et al. Virological and Serological Surveys for H9N2 Subtype of influenza A Virus in Chickens and 

men in Shenzhen city. (2002) Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi (2002) December 16 

(4): 319-321 

3) Uyeki TM et al. Lack of Evidence for Human-to-Human Transmission of Avian Influenza A (H9N2) Viruses 

in Hong Kong, 1999 (2002) Emerging Infectious Diseases, Vol 8, No.2, February: 154-159 


ISOLATION OF PARAMYXO VIRUS-1 INFECTION IN PIGEON. 

M.D.Meshram and D.B.Sarode. 

Maharashtra Animal and Fishery Sciences University, Nagpur, (M.S.) India. 

The mortality in pigeons was observed in winter season. Mortality percentage in young ones was higher than 

adults. The mortality in male and female was not significant. 

The paramyxo virus-1 virus was isolated during the episode of mortality. The virus was measuring 220 nm in 

length. The virus was showing herrhingo pattern with envelop. 

The clinical signs were touticoulis, ataxia, greenish diarrhea, dehydration severe conjunctivitis with 

lacrymation and nasal discharge. The pigeons died suddenly with out any clinical signs were higher in young 

ones. 

The paramyxo virus-1 has got Zoonotic importance as the research workers suffered with infection during the 

period of study. 




ADVANCING THE ROLE OF A REGIONAL REFERENCE LABORATORY FOR FOOT–AND-MOUTH 

DISEASE IN SOUTH EAST ASIA. 

RA Lunt 1 , W Linchongsubongkoch 2 ,LJ Gleeson 1 , R Abila 3 ,CJ Morrissy 1 ,C Leowijuk 4 ,SF Edwards 1 ,PM Le Blanc-Smith 1 and JM 

Hammond 1 

1 CSIRO Livestock Industries, Australian Animal Health Laboratory, P.O. Bag 24, Geelong 3220, Australia 

2 Regional Reference Laboratory for FMD in South East Asia, National Institute of Animal Health, Department of Livestock 

Development, Pakchong, Nahkonratchasima, 30130, Thailand 

3 OIE SEAFMD Regional Coordination Unit, 69/1 Phaya Thai Road, Rajathevee, 10400, Bangkok, Thailand 

4 Department of Livestock Development, 69/1 Phaya Thai Road, Rajathevee, 10400 Bangkok, Thailand 

Objectives 

To assist development of a recently established BSL-3 containment laboratory for FMDV at Pakchong, 

Thailand to meet the scientific, biocontainment and quality standards necessary to operate as an 

international reference laboratory for FMD for ASEAN countries. 

Key Messages 

FMD is the major transboundary livestock disease affecting all sub-continental SEA countries and a 

significant threat to neighbouring countries including Australia. The Southeast Asian Foot and Mouth 

Disease Regional Reference Laboratory (SEAFMD RRL) has been the focus for the ASEAN-Australia 

Development Cooperation Program Regional Partnerships Scheme (AADCP RPS) project “Establishment of 

a reference laboratory for the Southeast Asian foot and mouth disease control program” which concluded a 

two-year operation in April 2007. 

Key outcomes from the project promoted regional and reference functions of SEAFMD RRL through: 

• development of a strategic plan for operation of SEAFMD RRL 

• a regional workshop/training course for representatives from ASEAN FMD testing laboratories 

• formation of LabNet, an ASEAN regional network of laboratory expertise 

• review and harmonisation of regional laboratory testing methods for FMD 

• assisting in accreditation to quality standard, engineering maintenance and the safe operation of SEAFMD 

RRL as a secure laboratory for work with FMD 

• training modules for laboratory staff at SEAFMD RRL 

• acting in complement with goals of the SEAFMD Campaign for regional FMD control, an initiative of World 

Organisation for Animal Health (the OIE or Office International des Epizooties) 

The project has also made successful the application to the OIE for additional support for a collaborative 

“twinning” process between AAHL and SEAFMD RRL. This process will strengthen the case for formal 

international recognition through the OIE of SEAFMD RRL as a reference centre of expertise for FMD. 

Conclusion 

Laboratory diagnosis is essential to correctly identify foot and mouth disease (FMD) in livestock, to trace the 

possible origin of the outbreak and to assist selection of an effective vaccine. The project assisted SEAFMD 

RRL meet the scientific, biocontainment and quality standards necessary for a regional reference laboratory. 

The project brought together as major partners the Australian Animal Health Laboratory (AAHL) and 

SEAFMD RRL to deliver outputs across laboratory management, technical operation and training. 

FMD severely impairs the potential for productivity and earnings from livestock such as buffalo, cattle, sheep, 

goats and pigs. The virus readily spreads by movement of infected livestock and livestock products. The 

effective operation of SEAFMD RRL as an ASEAN regional resource of FMD expertise is important to the 

success of control strategies within affected countries and for alleviation of FMD risk across the region. 


HETEROGENEITY IN THE OUTER CAPSID-CODING REGION OF FOOT-AND-MOUTH DISEASE VIRUS 

A AND O SEROTYPES IN AFRICA 

M Chitray 1,2* , B Blignaut 1,3 , FF Maree 1 , W Vosloo 1,2 

1 Onderstepoort Veterinary Institute, Exotic Diseases Division, Private Bag X05, Onderstepoort 0110, South Africa 

2 Department of Veterinary Tropical Diseases, Faculty of Veterinary Sciences, University of Pretoria, Onderstepoort 0110, South Africa 

3 Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria 0001, South Africa 

Introduction 

Foot-and-mouth disease (FMD), of which FMD virus is the causative agent, is a highly infectious disease of 

cloven-hoofed animals belonging to the Aphthovirus genus of the Picornaviridae family. To provide some 

insight into the complexity of disease control in Africa, the molecular epidemiology of FMDV in sub-Saharan 

Africa has focused on the SAT types in the past, despite the fact that A and O serotypes are also prevalent 

to the northern parts of the continent. Studies on evolutionary changes in A and O isolates in Africa are 

hampered due to insufficient nucleotide sequence data for the entire capsid-coding (P1) region. This led to 

the aim of this study i.e. to investigate the genetic variation in the P1 region of A and O serotypes from 

different countries and regions in Africa isolated from bovine over the last 32 years. 

Materials & Methods 

Nine O and eight A FMD viruses were chosen for P1 characterisation. Total RNA was extracted using a 

modified guanidium thiocyanate (GuSCN)/silica method, as described by Boom et al. (1990). The viral RNA 

was reverse-transcribed from the extracted total RNA using AMV reverse transcriptase enzyme (Promega) 

with the WDA (5’-GAAGGGCCCAGGGTTGGACTC-3’) antisense primer. The entire P1 region was 

amplified for all of the FMDV A and O type virus samples using two primers i.e. NCR1 (5’- 

TACCAAGCGACACTCGGGATC T-3’), which anneals in the 5’ non-coding region and WDA, which anneals 

at the 2A/2B junction. The PCR amplicons were separated on a 1.5% agarose gel, excised and purified. 

The P1 regions were determined using ‘genome-walking’ sequencing utilizing the ABI PRISM BigDye 

Terminator Cycling Ready Reaction Kit v3.0 (Applied Biosystems) as per the manufacturer’s instructions. 

The partial P1 sequences obtained for each virus were edited and aligned to form the complete P1 contigs 

using the SEQUENCHER TM 4.7 DNA sequence analysis software. Phylogenetic trees were constructed 

using MEGA 3 and hyper-variable regions identified using MEGA 1. 

Results 

The complete P1 sequences were successfully determined for all of the FMDV A and O viruses chosen in 

this study. Based on P1 phylogeny, most viruses clustered into the topotypes previously assigned using 1D 

data only, but differences were observed for serotype O viruses. Regions of variability were identified, which 

correlate with neutralisation sites that were previously determined using monoclonal antibodies and escape 

mutants of FMDV A and O viruses (Crowther et al. 1993, Samuel et al. 1990, Baxt et al. 1989). The RGD 

sequence, which is essential for receptor binding, is conserved in FMDV and this was true for the A and O 

types included in this study. The amino acid sequence alignment of the FMDV A types revealed a unique 

arginine residue neighbouring the highly conserved RGD sequence on the G-H loop of 1D. 


Phylogenetic analysis indicated that different clusters occur when utilising P1 regions compared to 1D 

sequences only. Alignments revealed hyper-variable regions in the outer capsid proteins, corresponding to 

or in close proximity to previously identified immuno-dominant sites on FMDV A and O types. Unique amino 

acid changes were observed in highly conserved residue positions neighboring the RGD sequence on the G- 

H loop of 1D. This study contributed to the expansion of the genetic database for FMDV and broadened the 

knowledge of the genetic variation within the capsid-coding regions of African field isolates. 

References 

Baxt, B., Vakharia, V., Moore, D.M., Franke, A.J., Morgan, D.O. 1989. Analysis of neutralizing antigenic 

sites on the surface of type A12 foot-and-mouth disease virus. J. Virol., 63: 2143-2151. 

Boom, R., Sol, C.J., Salimans, M.M.M., Jansen, C.L., Wertheim-Van Dillen, P.M.E. & Van Der Noordaa, J. 

1990. Rapid and simple method for purification of nucleic acids. J. Clin. Micro., 28: 495-503. 

Crowther, J.R., Rowe, C.A., Butcher, R. 1993. Characterisation of monoclonal antibodies against a type 

SAT 2 foot-and-mouth disease virus. Epidemiol. Infect., 111: 391-406. 

Samuel A.R., Ouldridge, E.J., Arrowsmith, A.E.M., Kitching, R.P., Knowles, N.J. 1990. Antigenic analysis of 

serotype O foot-and-mouth disease virus isolates from the Middle East, 1981 to 1988. Vaccine 8: 390-396. 




QUANTIFICATION OF WATER BUFFALO (Bubalus bubalis) CYTOKINE EXPRESSION IN RESPONSE 

TO INACTIVATED FOOT-AND-MOUTH DISEASE (FMD) VACCINE USING REAL-TIME PCR ASSAY 

C. N. Mingala ab *, S. Konnai a , F. A. Venturina b , M. Onuma a and K. Ohashi a 

a Laboratory of Infectious Diseases, Graduate School of Veterinary Medicine, Hokkaido University, Japan 

b Philippine Carabao Center National Headquarters and Genepool, Science City of Munoz, Philippines 

Introduction 

Recently, there are a lot of assays introduced to measure cytokine expressions of different animal species, 

which are mostly protein-based tests such as ELISA, Elispot and Flowcytometry. Other tests were PCR 

based, which rely on the analysis of expression kinetics through electrophoresis reading. Most of these 

experiments engaged in in-vitro stimulation of cytokine-secreting cells. In water buffalo, cytokine expression 

reports were already published mainly using the latter procedure since protein based assays have its own 

limitations due to unavailability of specific antibodies. In this regard, real-time PCR has been developed as a 

simple and rapid quantification of several genes. The outcome of this study significantly confirmed the water 

buffalo cytokine expression in response to immunogen. This was the first time that water buffalo cytokine 

expression was quantified by the use of real-time PCR quantification assay. 


Twelve riverine type water buffaloes were used as experimental and control animals. The treatment animals 

were vaccinated with Aftofor ® , an inactivated FMD strain “O” vaccine. Heparinized whole blood were 

collected from all of the animals at day 0 and consequently after 1, 2 and 3 weeks post-vaccination. Total 

cellular RNA was extracted and cDNA was synthesized. Real-time PCR was performed using a Light cycler, 

to quantify the cytokines (IL-2, IL12p40, IFNγ, IL-6, IL10, TNFα, IL-4) vis a vis the β-actin expression. The 

expression of the target cytokines was also compared with the humoral response of the animals by liquidphase 

blocking ELISA. 

Results 

Findings revealed that all of the cytokines were upregulated. IL-2 was immediately increased on the first 

week post-vaccination compared to the rest of the cytokines. Interestingly, IFNγ, IL-10 and TNFα had peaked 

in the last week of the observation period. TNFα significantly increased on the second week. The rest of the 

cytokines minimally started to increase on the first week and peaked on the following week. However, these 

cytokines (IL-2, IL-12p40, IL-4, IL-6) started to decline on the third week. To compare the antigen-antibody 

interaction with that of the cytokine expression of the experimental animals, a liquid-phase blocking ELISA 

was performed. The result showed that after the first week post-vaccination, all of the treatment animals 

reached the optimum antibody titer of more than 256. 


The upregulation of IL-2 and IL-12p40 (both Th1), and drop of IL-4 (Th2) expression in a short span of time 

is a classic counter reaction between Th1 and Th2 cytokines. It was well noted that while IL-4 is upregulated, 

the IFNγ was not. IL-4 promotes the production of Th1 cytokines in company with suppressing the 

expression of the Th1 cytokines including IFNγ, and vice versa (Forshubor, 1996; Bembridge et al., 1998). 

Interestingly, TNFα and IL-6, which are also considered as Th2 cytokines, although could be suppressed by 

the Th1 cytokines, the synergy between TNFα to IL-6 could be a reason in maintaining its continuous 

expression (Frei et al., 1989; Walker et al., 2002). 

The early expression of IL-2 and IL-12p40 could also correspond to the action of the cell-mediated response 

where Th1 type cytokines are related. The subsequent development of specific immunity would be one 

parameter, with which the elevated IL-12p40 level after the challenge could be the reason. The continuous 

expression of Th2 cytokine (IL-6), which is mainly related to humoral immune responses, is connected with 

the progressive titer generation of the animals by the result of the LPB-ELISA. The result of this study would 

be an initial step towards an in-depth study of the water buffalo immune system using a real-time PCR 

assay. 

References 

Bembridge, G.P., Lopez, J.A., Cook, R., Melero, J.A., Taylor, G., 1998. Recombinant vaccinia virus coexpressing the F protein of 

respiratory syncytial virus (RSV) and interleukin-4 (IL-4) does not inhibit the development of RSV-specific memory cytotoxic T 

lymphocytes, whereas priming is diminished in the presence of high levels of IL-2 or gamma interferon. J. Virol. 72,4080-4087. 

Frei, K., Malipiero, U.V., Leist, T.P., Zinkernagel, R.M., Schwab M.E., Fontana, A., 1989. On the cellular source and function of 

interleukin 6 produced in the central nervous system in viral diseases. Eur. J. Immunol. 19,689-694. 

Forshubor, T., Yip, H.C., Lehmann, P.V., 1996. Induction of TH1 and TH2 immunity in neonatal mice. Science. 271,1728-1730. 

Walker, D., Jason, J., Wallace, K., Slaughter, J., Whatley, V., Han A., 2002. Spontaneous cytokine production and its effect on induced 

production. Clin. Diagn. Lab. Immunol. 9,1049-1056. 


DEVELOPMENT OF AN IMPROVED CAPABILITY IN SUPPORT OF NATIONAL BIOSECURITY FOR THE 

SURVEILLANCE AND CONTROL OF FOOT & MOUTH DISEASE IN CATTLE AND PIGS IN VIETNAM. 

1 C. J. Morrissy, 2 Ngo Thanh Long, 1 J. Hammond, 1 L. Wright, 1 I. Pritchard, 1 D. Schafer, 1 W. Ha, 1 W. Goff, 2 Dong Manh Hoa, 1 M. Johnson 

and P, Daniels. 

1 CSIRO Livestock Industries, Australian Animal Health Laboratory (AAHL), 

Geelong, Victoria, Australia. 

2 Regional Animal Health Centre, Ho Chi Minh City (RAHC-HCMC), South Vietnam. 

Objectives 

To determine why FMD vaccination of livestock does not give the expected protection against disease and to 

fully determine which serotypes of FMDV are circulating in Vietnam. This will enable better vaccination 

strategies to be employed. Regional diagnostic laboratories will be established with the capacity to carry out 

rapid and accurate FMDV serology, virus isolation and detection of antigen. 

Key Messages 

Development and implementation of disease control strategies depend upon a good understanding of FMD 

epidemiology which in turn requires accurate laboratory testing for both virus typing and serosurveillance. 

The establishment of an integrated National laboratory network is vital, with National Biosecurity being an 

important issue for the Vietnamese Government. Pilot zones have been established in provinces near 

Vietnam’s borders to gain insight into FMDV serotypes circulating in these areas. Molecular analysis of the 

FMDV isolates from these provinces will provide information on the effectiveness of border control and the 

origin of FMDV circulating in Vietnam each year. Such a diagnostic capacity for FMD will allow the early 

detection and identification of FMD enabling better control of disease and help reduce livestock losses and so 

improve productivity. 

Conclusion 

This project has established an improved diagnostic capacity for FMD in Vietnam through development of an 

integrated network of laboratories. Nucleotide sequence anlaysis has been carried out on 50 FMDV isolates 

providing vital new information on circulating viruses. The project is aligned with the National FMD plan and 

the information generated is aiding the control of FMD in Vietnam 




NUCLEOTIDE SEQUENCE ANALYSES OF EPIZOOTIC HAEMORRHAGIC DISEASE VIRUS (EHDV) 

GENOME SEGMENTS ENCODING THE OUTER CAPSID PROTEINS: A SEROLOGICAL AND GENETIC 

RE-EVALUATION OF SEROTYPES. 

Anthony, SJ*; Maan, N; Batten, C; Maan, S; Kgosana, L; Bachanek-Bankowska, K; Attoui, H; Darpel, K; Mertens, P.P.C 

Introduction: 

EHDV is an infectious, non-contagious arbovirus. It is transmitted between domestic and wild ruminants via 

heamatophagus midges of the Culicoides spp and can cause clinical disease in both wild and domestic 

species. The objectives of this study were to establish an initial sequence database for EHDV genome 

segments 2 and 6 for molecular epidemiology studies, to define the number and relationship of EHDV 

serotypes, and to develop molecular ‘typing’ assays. 

Methods: 

Full length sequences were generated for all 10 genome segments using the anchor-primer method 

developed by Maan, Rao et al (2007). Initial sequences were achieved using the anchor primer, and 

completed by gene-walking. Serological relationships between different serotypes were assessed by 

neutralisation assays, and compared with the molecular, phylogenetic data. 

Results: 

Full nucleotide sequence analysis and phylogenetic comparisons were completed for genome segments 2 

and 6 (encoding the type specific outer coat proteins VP2 and VP5 respectively) of eleven EHDV reference 

strains. These included isolates from each serotype, and from different geographic origins. This represents 

the first complete sequence database for genome segments 2 and 6 of different EHDV serotypes, providing 

a basis for molecular epidemiology studies. The sequence data were used to assess levels of variation in 

these genome segment and the proteins they encode, and were compared to results of serum-neutralisation 

assays for the strains analysed. This genetic and serological re-evaluation identified only 7 distinct EHDV 

serotypes (the isolates of existing serotypes 1 and 3 cross-neutralised and are closely related in both Seg-2 

and Seg-6). Strain ‘318’ was identified as a member of EHDV serotype 6. 

Conclusion: 

Serological and genetic analyses identified only seven serotypes of EHDV. The viruses previously identified 

as serotypes 1 and 3 appear to belong to the same Seg-2 nucleotype and serotype. The sequence data for 

genome segment 2 form a basis for molecular epidemiology studies and for molecular typing assays (typespecific 

RT-PCR). 



PHYLOGENETIC ANALYSIS OF AFRICAN SWINE FEVER VIRUSES FROM SOUTH AFRICA, 

MOZAMBIQUE AND TANZANIA FOR THE PERIOD 2001-2007 

RM Dwarka 1* , N Mtshali 1 , BA Lubisi 1 , OC Phiri 1,2 , ML Penrith 3,6 , A Nhamusso 3 , J Banze 3 , JIG Masambu 4 , W Vosloo 1,5 

1 ARC, Onderstepoort Veterinary Institute, Transboundary Animal Diseases Division, Private Bag X05, Onderstepoort, 0110, 

South Africa 

2 Novartis South Africa (Pty) Ltd, Animal Health Business Unit, P.O. Box 92 Isando, 1600, South Africa 

3 Instituto de Investigacao de Mozambique, Direccao de Cienca Animal, Maputo, Mozambique 

4 Animal Disease Research Institute, Dar Es Salaam, Tanzania 

5 Department of Veterinary Tropical Diseases, University of Pretoria, Private Bag X07, Onderstepoort, 0110, South Africa 

6 TAD Scientific, 40 Thomson Street, Colbyn, 0083, South Africa 

Introduction 

African swine fever (ASF), a highly contagious disease of domestic pigs, is caused by a virus classified into 

the Asfarviridae family, genus Asfivirus. It is endemic in many African countries and is characterized by high 

morbidity and mortality of up to 100%. When ASF outbreaks occur, it is imperative to determine the source 

of the infection in order to prevent future re-introductions since no vaccine or treatments are available. PCR 

amplification and characterisation of a 478 bp region at the C-terminal end of the p72 gene, coding for the 

major capsid protein, VP72, permits differentiation of ASF viruses into genotypes (Bastos et al., 2003; 

Boshoff et al., 2007; Lubisi et al., 2005). 


DNA was extracted from tissue specimens, using a silica/guanidium-based nucleic acid extraction method 

(Boom et al., 1990). A PCR for molecular epidemiological analysis of ASF virus was performed, where the 

C-terminal region of the p72 gene was amplified using epidemiological primers P72-U 

(5'GGCACAAGTTCGGACATGT3') and P72-D (5' GTACTGTAACGCAGCACAG3'), as described previously 

(Bastos et al., 2003). Amplification products were separated on a 1.5 % agarose gel, excised and purified. 

The nucleotide sequence was determined by automated sequencing on an ABI Prism 310 Genetic Analyser 

(Applied Biosystems) using a Big Dye version 3.1 kit using the same primers as for PCR. Sequences were 

aligned using the DAPSA programme and neighbour joining trees constructed using MEGA 3. 

Results 

Previously, 4 genotypes were described in Mozambique and recent ASF viruses characterized from 2001- 

2005 clustered in 2 of these. ASF isolates obtained from Tanzania for the period 2001-2005 grouped in 4 

genotypes. Two consisted exclusively of Tanzanian isolates from 2001 and 2003 and are newly described 

genotypes while the other 2 genotypes clustered with viruses previously isolated from Kenya, Uganda and 

Burundi. In South Africa ASF is endemic only in the northern parts of the country where a sylvatic cycle 

exists, involving warthogs and argasid ticks. Part of the ASF surveillance strategy involves characterization 

of viruses obtained from ticks collected from warthog burrows within the control zone as well as from 

outbreaks in domestic pigs. All isolates characterized from pigs, ticks and warthog between 2001-2007 

clustered within 8 genotypes. 


These studies demonstrate the way in which molecular epidemiological studies add value to diagnostic 

services and disease control as well as contributing to the risk assessment of ASF as information on 

geographic distribution of genotypes can be determined. In addition, phylogenetic trees can contribute to 

determining the genetic relatedness between strains. A molecular database can be useful when 

communicating the risk of infection to relevant stakeholders as it provides scientific proof of the presence of 

the risk and its possible origin which can be used to justify the management procedures. 

References 

Bastos, A.D., Penrith, M.L., Cruciere, C., Edrich, J.L., Hutchings, G., Roger, F., Couacy-Hymann, E. R., 

Thomson, G. 2003. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. 

Arch Virol, 148:(4): 693-706. 

Boom, R., Sol, C.J., Salimans, M.M.M., Jansen, C.L., Wertheim-Van Dillen, P.M.E. & Van Der Noordaa, J. 

1990. Rapid and simple method for purification of nucleic acids. J. Clin. Micro, 28: 495-503. 

Boshoff CI, Bastos AD, Gerber LJ, Vosloo W. 2007. Genetic characterisation of African swine fever viruses 

from outbreaks in southern Africa (1973-1999). Vet Microbiol, 121(1-2): 45-55. 

Lubisi BA, Bastos AD, Dwarka RM, Vosloo W. 2005. Molecular epidemiology of African swine fever in East 

Africa. Arch Virol, 150(12):2439-52. 




EFFORTS TO CONTROL AND ERADICATE BOVINE TUBERCULOSIS IN A WILDLIFE RESERVIOR IN 

MICHIGAN, USA: A PRELIMINARY SUCCESS STORY 

S. D. Fitzgerald 1 , D. J. O’Brien 2 , S. M. Schmitt 2 , and J. B. Kaneene 3 

1 Diagnostic Center for Population & Animal Health, Department of Pathobiology and Diagnostic Investigation, College of Veterinary 

Medicine, Michigan State University, Lansing, MI 48910 

2 Wildlife Disease Laboratory, Michigan Department of Natural Resources, Lansing, MI 48910 

3 Center for Comparative Epidemiology, College of Veterinary Medicine, Michigan State University, Lansing, MI 48910 USA 

Bovine tuberculosis (TB) has been recognized in wild white-tailed deer (Odocoileus virginianus) as its 

principal reservoir host since 1994 in Michigan (MI), USA. Ongoing surveillance and control measures for 

the last 12 years have involved the cooperation of state, federal and university scientists in a multiinstitutional 

task force. We report here the methods and results of our efforts. 

To date, over 150,000 free-ranging deer have been tested for TB, with over 550 infected individuals 

identified. Approximately 98% of positive deer have originated within seven contiguous counties located in 

the northeastern lower peninsula of MI. The vast majority of deer tested have been voluntarily harvested by 

hunters. Hunters submit heads from their deer at road-side check stations, where data are entered on 

gender, age, and location of harvest. Heads are then forwarded to the Diagnostic Center where parotid, 

submandibular and medial retropharyngeal lymph nodes are examined. Those with suspicious lesions are 

harvested for routine histopathology, acid-fast staining, and mycobacterial isolation and identification. 1 

Control strategies have focused on reducing deer densities through increased hunter harvesting, and 

decreased human-caused congregation of deer by restriction or elimination of baiting and supplemental 

feeding. Significant decreases in disease prevalence have been achieved with these methods. 2 All-age 

apparent prevalence in the core outbreak area has decreased from 4.9% in 1995 to 1.2% in 2005. Apparent 

prevalence in yearling deer, a crude index of the rate of new infections, has dropped from 1.9% in 1995 to 

0.2% in 2005. Significant decreasing trends in prevalence have been observed in both yearlings (p = 

0.0007) and deer of all ages (p < 0.0001) over this period. Unfortunately, during the 2006 survey a 

significant increase in deer tuberculosis prevalence was found. Continued efforts include development of 

rapid ante-mortem testing to detect positive deer which have been live-trapped in high prevalence locations. 

While still decades away from disease eradication, MI has made encouraging progress in its initial efforts to 

control and eliminate TB in free-ranging deer. 

References 

1 Fitzgerald SD, Kaneene JB, Butler KL, Clarke KR, Fierke JS, Schmitt SM, Bruning-Fann CS, Berry DE, 

and JB Payeur: Comparison of post-mortem techniques for the detection of Mycobacterium bovis in whitetailed 

deer. J. Vet. Diagn. Invest. 12:322-327, 2000. 

2 O’Brien DJ, Schmitt SM, Fitzgerald SD, Berry DE, and GJ Hickling: Managing the wildlife reservoir of 

Mycobacterium bovis: The Michigan, USA, experience. Vet. Microbiol. 112:313-323, 2006. 


DETECTION OF MAJOR BACTERIAL AND VIRAL PATHOGENS FROM 

TRASH FISH FOR CULTUREDFLOUNDER 

Ji Hyung Kim a,c, *, Se Chang Park a,b,c , G.J. Heo d , Dennis K. Gomez a,b and Casiano H. Choresca Jr. a,b,c 

a Laboratory of Aquatic Animal Medicine, College of Veterinary Medicine, Seoul National University, Seoul 151-742, Korea 

b KRF Zoonotic Disease Priority Research Institute, Seoul National University, Seoul 151-742, Korea 

c Brain Korea 21 Program for Veterinary Science, College of Veterinary Medicine, Seoul National University, Seoul, Korea 

d College of Veterinary Medicine and Research Institute of Veterinary Medicine, Chungbuk National University, Cheongju 361-763, Korea 

Introduction 

Several bacterial and viral diseases usually take place during feeding of trash fish to cultured flounder 

especially in Korea. The aim of this study is to know the possibility of trash fish-direct infection to cultured 

flounder. Target pathogens are Streptococcus iniae and S. parauberis (streptococcosis); iridovirus (iridovirus 

infection) and betanodavirus (viral nervous necrosis). 


Twenty-six different species of trash fish samples were collected from 11 different hatcheries in Jeju Island in 

November 2006. Pooled organs (liver, kidney for Streptococcus sp.; eye, brain for betanodavirus; gills, 

spleen for iridovirus) were collected aseptically, homogenized and processed for detection of pathogens 

using polymerase chain reaction (PCR) based method. Positive iridovirus sample was analyzed by 

phylogenetic tree. 

Results 

Streptococcus iniae (300 bp) PCR positive results were obtained from Pacific cutlass fish Trichiurus lepturus, 

mysidacea Neomysis awatschensis and mixed fish samples. S. parauberis (718 bp) and Iridovirus (1299 bp) 

PCR positive results were obtained from 2 and 1 mixed fish samples, respectively. Phylogenetic analysis of 1 

iridovirus strain based on the partial nucleotide sequence (355 bases) portion of the MCP gene was identical 

and homologous with other known fish iridovirus: seabass and red seabream (98.3%); rock bream (97.4%); 

turbot and Korean flounder (95.7%). Betanodavirus was negative for PCR result. 


These results indicate that trash fish poses a serious danger for the spread of diseases to the mariculture, 

and can be one of the sources or carrier of pathogenic microbial agents (bacterial and viral) for cultured 

flounder infection in Korea. 

References 

1. Ghittino C, Latini M, Agnetti F, Panzieri C, Lauro L, Ciappelloni R, Petracca G. Emerging pathologies in 

aquaculture: effects on production and food safety. Vet. Res. Comm. 2003, 27, 471-479. 

2. Kim WS, Oh MJ, Jung SJ, Kim YJ, Kitamura SI. Characterization of an iridovirus detected from cultured 

turbot Scophthalmus maximus in Korea. Dis. Aquat. Org. 2005, 64, 175-180. 

3. Baeck GW, Kim JH, Dennis KG, Park SC. Isolation and characterization of Streptococcus sp. from 

diseased flounder (Paralichthys olivaceus) in Jeju Island. J. Vet. Sci. 2006, 7(1), 53-58. 




SURVEY ON SALMONELLA SPP INFECTION IN SLAUGHTER PIGS IN SASKATCHEWAN BY 

CULTURE AND PCR 

N. Atashparvar 1 ,R.C. Mainar-Jaime 2 , M. Chirino-Trejo 2 

1)-Dept. of Microbiology, School of Veterinary Medicine, Lorestan University, Khorram-Abad, Iran 

2)-Department of Veterinary Microbiology, WCVM, University of Saskatchewan, 52 Campus Drive, Saskatoon, Saskatchewan S7N 5B4 

In Canada salmonellosis ranks as the second most common bacterial foodborne illness in humans, and pork 

and its products a possible source of infection. We carried out a survey in Saskatchewan to collect baseline 

information on the prevalence of Salmonella infection from slaughter pigs through bacteriological culture and 

PCR. Salmonella spp was isolated from 13.9% (95%CI=9.2%-18.6%) and 5.4% (95%CI=2.3%-8.5%) of the 

caecal content and lymph nodes samples, respectively. When PCR was used the prevalence of Salmonella 

infection from caecal content was significantly higher (32.6%; 95%CI=26.2%-39%). The large differences 

observed suggested that the accuracy of both techniques should be evaluated on field samples before 

deciding which one is more advantageous for surveillance purposes. While among all samples analysed 

main Salmonella serotypes detected (Derby –23.1%-, Typhimurium var. Copenhagen -15.4%-, and 

California -7.7%-) were also commonly found in pigs from other areas of Canada, it was also detected a high 

prevalence of the serotype Enteritidis (20.5%) which is commonly associated with infection in humans. A 

larger survey would be advisable to determine the extent of this serotype in the province and its potential 

implication in human infection. Antimicrobial resistance, although detected to some common antibiotics 

(ampicilline, chloramphenicol, tetracyclin, and trimethoprim/sulfamethoxazole), appeared to be a lesser 

problem compared to overall AR results in Canada. 

Key Words: Salmonella, PCR, Pig, Slaughter house. 


EXPERIMENTAL TRANSMISSION OF TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHIES 

(SCRAPIE, CHRONIC WASTING DISEASE, TRANSMISSIBLE MINK ENCEPHALOPATHY) TO CATTLE 

AND THEIR DIFFERENTIATION FROM BOVINE SPONGIFORM ENCEPHALOPATHY 

A.N. Hamir, R.C. Cutlip, J.M. Miller, R.A. Kunkle, J.A. Richt, J.J. Greenlee, E.M. Nicholson, M.E. Kehrli. 

Virus and Prion Diseases of Livestock Research Unit, National Animal Disease Center, USDA, Agricultural Research Service, Ames, IA 

50010, USA. 

Introduction: Experimental cross-species transmission of TSE agents provides valuable information for 

identification of potential host ranges of known TSEs. This report provides a synopsis of TSE (scrapie, CWD, 

TME) transmission studies that have been conducted in cattle and compares these findings to those seen in 

animals with BSE. 

Materials & Methods: Generally 6-month-old bull calves were obtained and assigned to inoculated and 

control groups. Inoculated calves were housed in a Biosafety Level 2 isolation barn at the National Animal 

Disease Center (NADC), Ames, Iowa. Calves were inoculated intracerebrally with 1 ml of a 10% TSE brain 

inoculum. 

Results: Results of various TSE cattle experiments with intracerebral inoculation of scrapie, CWD and TME 

are shown in tabular form (Table 1). 

Table 1. Comparison of experimental scrapie, chronic wasting disease (CWD) and transmissible spongiform 

encephalopathy (TME) in cattle inoculated by the intracerebral route during first passage of the inocula. 

Scrapie CWD TME 

Abnormal CNS signs Anorexia, weight loss, leg Anorexia, weight loss, occasional Variable hyperexcitability with 

and back stiffness. Some showed aimless circling, listlessness and occasional falling to the ground. 

incoordination and posterior excited by loud noises. Some showing circling and 

weakness. Eventual severe lethargy. aggressive behavior. 

Incubation (survival) time 14 – 18 months. 23 – 63 months. 13 – 16 months. 

Attack rate 100% CWD from mule deer: 38%. 100% 

CWD from elk: 86%. 

Histopatholgic lesions Some vacuolation and central of Isolated vacuolated neurons, a Extensive vacuolation of neuronal 

chromatolysis of neurons*. few degenerate axons, and a mild perikarya and neuropil. Presence of 

astrocytosis. mild multifocal gliosis. 

Western blot (brainstem) All three isoforms of PrP res present. All three isoforms of PrP res seen. All three isoforms of PrP res seen. 

Immunohistochemistry 

PrP res in lymphoreticular 

tissues. Not present. Not present. Not present. 

PrP res in CNS Present within perikaryon and Multifocal distribution with Diffusely present and usually evenly 

processes of neurons. labeling primarily in glial cells distributed in neuropil. 

(astrocytes). 

Conclusions: 1. All three TSEs agents (scrapie, CWD and TME) are capable of propagating in 

cattle tissues when administered intracerebrally. 

2. All three TSEs can be distinguished from each other and from BSE when inoculated 

intracerebrally by histopathology, immunohistochemistry and Western blot techniques. 



Objectives 


TSE SURVEILLANCE IN AUSTRALIA: A REGIONAL LABORATORY PERSPECTIVE 

E. Houston 

Biosecurity, Department of Primary industries & Fisheries, Queensland 

The aim of this project was to evaluate Australia’s ability to implement enhanced TSE surveillance in a 

regional laboratory. The Animal Disease Surveillance Laboratory (ADSL) in Toowoomba was subcontracted 

by Animal Health Australia to conduct this work. This followed validation by the Australian Animal Health 

Laboratory (AAHL) at Geelong of the BioRad TeSeE ELISA kit method, for the purification and detection of 

resistant prion proteins. This method was validated for use under Australian conditions. 

Key messages 

• ADSL is the only regional facility in Australia conducting TSE surveillance using this method 

• The facility was upgraded from PC2 to derogated PC3 to perform this work 

• Equipment and reagents were purchased by ADSL 

• Procedures and methods were evaluated on site 

• The validation phase of the project involved the testing of 200 samples 

• The working phase of the project involved the testing of 2000 samples from throughout Australia 

• Accreditation with NATA was achieved 

• Requirements for future work were highlighted 

Conclusions 

ADSL was able to renovate an existing PC2 laboratory to derogated PC3. Equipment was purchased and 

installed and procedures and methods implemented to test bovine and ovine brain stem material, sourced 

from around the country, using the TeSeE Bio-Rad ELISA. The laboratory’s scope of accreditation by NATA 

to ISO/IEC 17025 in the field of Veterinary Testing was extended in 2006 to include prion detection by 

immunological methods in production animals. Test validation was completed on 200 samples provided by 

AAHL, followed by the testing of 2000 surveillance samples. The information gained from this project was 

reported to Animal Health Australia. 


BOVINE SPONGIFORM ENCEPHALOPATHY PREVENTION PROGRAM IN ARGENTINA. 

SURVEILLANCE OF BRAIN SAMPLES 

F.J.Blanco Viera*; E.L.Weber; F.Delgado; G.Pinto; F.Capellino; L. Jiménez; M.C.Tagle; Gl. Francinelli ; Cl. Moreno; B.J.Carrillo 

Laboratorio Nacional de Referencia. CICVyA. INTA Castelar Buenos Aires Argentina C.C 77 (1708) Morón 

Introduction 

The surveillance program, together with other activities such as the risk analysis are the best tools for a 

country to make a preventive study and show its sanitary status. One important issue of the surveillance 

program is the continuous monitoring of brain samples. In Argentina this activity has been carried out since 

1992, and during this time it was modified to qualitatively and quantitatively improve the results, according to 

the international requirements. The objective of this presentation is to show the surveillance activities of the 

TSE National Reference Laboratory of Argentina, with special emphasis in the last seven years 


First, a surveillance network was designed, with the main purpose of collecting brain samples for analysis, 

but also to make contacts with the actors of the cattle production system. The network was formed by official 

institutions (Secretary of Agriculture, Fishery and Food, National Agrifood Quality Service, National Institute 

of Agricultural Technology, County authorities, rabies control centers), Universities, official and private 

diagnostic laboratories, veterinary practitioners, federal and provincial slaughterhouses and abattoirs, 

professionals related with the agricultural production. At the beginning of the Program, the whole encephalic 

mass was collected, preserving its integrity and separating it from the craneal bone structure following preestablished 

methods; sampling through the foramen magnus was also implemented (3), and the technique 

was transferred to the members of the surveillance network. The encephalic samples were analyzed by. a) 

histopathology, following the procedures established at the Spongiform Encephalopathies Diagnosis 

Workshop III, Veterinary Laboratory Agency (VLA), Weybridge, United Kingdom (UK) (3). In some cases 

immunohistochemistry was applied, following procedures accepted by the International Animal Health 

Organization (OIE) (1); b) Immunochemical analysis for detection of the infectious prion protein (PrP Sc ), 

using the “traditional” Western Blot method following the protocol of the VLA Weybridge, UK (1,3), and the 

rapid tests Prionics Check Western and Enfer (Abbott). 

Results 

Between 1992 and 2006 a total of 20,995 brain samples from bovines of different provinces and different 

subpopulations were collected. During the last seven years 16,797 bovine brain samples were analyzed. The 

distribution of samples according to age, sampling categories and points asigned to each samples, following 

the suggestions of OIE (2) were showed. The summing up of the points these past seven years equals 

521,342 points, figure that exceeds the suggestions of OIE for a type A surveillance (2). No lesions 

compatible with BSE were observed. The biochemical analysis for PrP Sc detection were all negative. 


These negative results in 100% of microscopical examination and biochemical analysis for PrP Sc detection 

allow the conclusion that BSE is not present in the country. The continuity of the surveillance program, plus 

the other measures taken by the organisms in charge of surveillance for animal diseases will secure this 

condition and it will allow the international recognition of Argentina as a BSE free country. 

References 

1-0ffice International Des epizooties (OIE). Manual of Standards for Diagnostic Test and Vaccines. 5th 

Edition 2004 ISBN 92-9044-632-3 

2-0ffice International Des epizooties OIE - Bovine Spongiform Encephalopathy – Terrestrial Animal Health 

Code – Chapter 2.3.13 y 3.8.4 16 th Edition. 2007. ISBN 978-92-9044-696-5 www.oie.int 

3)-Wood J.L.N.; Done S.A.; Bradley R. “Diagnosis of BSE and Scrapie”. Spongiform Encephalopathy 

Diagnosis Workshop III. Central Veterinary Laboratory Weybridge England oct. 1997. 




COMPLETE AUTOMATION OF A BSE POST MORTEM DIAGNOSTIC TEST 

P. Marguerat 1 , J. Rodriguez 2 , S.Koller 3 , V. Leathers 3 , M. Zalunardo 4 

IDEXX Laboratories 

1 Eragny- sur Oise, France, 2 Barcelona, Spain, 

3 Westbrook, Maine, USA, 4 Rydalmere, New South Wales, Australia 

The IDEXX Herdchek* BSE Antigen and BSE-Scrapie Antigen Test kits have recently been validated for full 

automation from the starting tissue homogenate tube. These are the only commercial BSE kits on the market 

capable of automating the entire protocol of sample preparation and EIA after tissue homogenization. This is 

possible because the assay only involves pipetting tissue homogenate onto a microtiter plate with no sample 

processing requirements (no proteinase K). This unique feature has allowed us to propose a “front-end 

automated system” with high throughput which guarantees full traceability of samples that is not possible 

with other systems on the market. Since sample preparation is the rate-limiting step in all TSE assays and 

due to the fact that samples arrive continuously during the day, our automation system allows for continuous 

loading mode as compared to batch mode. The equipment reads the barcode of the tubes just before the 

transfer of the homogenate to the dilution plate, guaranteeing full sample traceability. The robot automatically 

changes tips during sample transfer or if there is a clogged tip. The robot controls all pipetting and incubation 

steps. In addition the data is recorded and can be transferred directly to the LIMS. The fully automated 

IDEXX Herdchek* BSE Antigen test was validated with 100% sensitivity and 100% specificity. 


EMERGENCE OF CANINE PARVOVIRUS (CPV-2C) IN NORTH AMERICA: 2006 

S. Kapil*, E. Cooper, B. Murray, L. Johnston III, C. Lamm, G. Rezabek, G. Campbell, B. Johnson 

Oklahoma Animal Disease Diagnostic Laboratory, Farm and Ridge Road, Stillwater, OK 74076, USA 

Introduction 

Canine parvovirus (CPV) is the most significant cause of viral enteritis in puppies after 2 weeks of age. There 

are several variants of CPV: 2, 2a, 2b, and 2c that have evolved over time. In 2001, a new variant (CPV-2c) 

was first reported in Italy in clinically-affected puppies (Buanavoglia et al., 2001). CPV-2c has been detected 

in Europe, Asia, and South America. To our knowledge, there are no published reports of CPV-2c from 

Australia, and Africa. There are recent reports of of detection of CPV-2c in the USA (Hong et al., 2007 and 

Kapil et al., 2007). 

Materials and Methods 

Many cases were submitted with the history of CPV vaccination and/or lack of reactivity in commercial CPV 

diagnostic test but the clinical condition and lesions were compatible with CPV. Total DNA was extracted 

from fecal, intestinal, and tongue samples from cases suspected of CPV. The PCR protocol has been 

described (Desario et al., 2005). PCR was followed by sequencing to detect the CPV genotypes circulating 

in the USA during Feb. 2006-August, 2007. A 583 base pair PCR product was amplified, and sequenced. 

Codon positions 426, 494, and 572 were recorded for the CPV isolates. Fifty of the CPV samples (tongue 

and intestines) were inoculated in Crandell feline kidney cell line (CRFK). The presence of the CPV antigen 

in cell culture supernatant was detected with hemagglutination test with swine erythrocytes (1%) in PBS 

buffer with 1% fetal calf serum. 

Results 

A wide range of breeds of dogs were involved in these CPV cases. The distribution of CPV genotypes in 

OADDL cases was CPV-2 (n=4); CPV-2b (n=26) and CPV-2c (n=27). OADDL received the first case of 

CPV-2c from Texas, USA in February, 2006. To our knowledge, this was the first detection of CPV-2c in the 

USA (Kapil et al., 2007a).We found that the identification of CPV-2c in canines has increased over the last 

20 months to about 47% and CPV-2c is wide spread in the USA. We observed that the CPV isolates (CPV- 

2b) in USA have pin-point mutations that are unique to the North American CPV viruses. On codon 426, AAT 

(CPV-2 or CPV-2a), GAT (CPV-2b), and GAA (CPV-2c) were observed. Position 426 was used to assign the 

CPV genotype. In CPV-2b isolates, the codons at positions 494 and 572 were TGC and GTC, except three 

isolates that had TGT and GTA, respectively. In CPV-2c, the codons at positions 494 and 572 were TGT 

and GTA. We also observed few changes at other codon positions (431, 440, 449, 469, 562 and 573) in a 

few CPV isolates. We were able to propagate approximately 45% of the CPV isolates in CRFK cell line. 


In the American CPV-2c cases, many dogs had either yellow mucous diarrhea or hemorrhagic feces based 

on gross necropsy. Anti-CPV antibody (clone A3B10, VMRD, WA, USA) reacts well with the CPV variants in 

FA and IHC procedures for CPV diagnosis, including new CPV-2c variants. It is critical to monitor the CPV 

genotypes because the virus can infect in presence of low levels of antibodies. Unique mutations in VP 2 

gene of CPV can serve as “epidemiological markers” in tracing the origin of CPV. CPV-2c has spread around 

the globe. 

References 

Buanavoglia, C., V. Martella, A. Pratelli, M. Tempesta, A. Cavalli, D. Buonavoglia, G. Bozzo, G. Elia, N. 

Dacrdo, and L. Carmichael. 2001. Evidence for evolution of canine parvovirus type 2 in Italy. J. Gen. Virol. 

82:3021-3025. 

Desario, C., N. Decaro, M. Campolo, A. Cavalli, F. Cirone, G. Elia, V. Martella, E. Lorusso, M. Camero, and 

C. Buonavoglia. 2005. Canine parvovirus infection: Which diagnostic test for virus? J Virol. Meth. 126:179- 

185. 

Hong, C., N. Decaro, C. Desario, P. Tanner, M.C. Pardo, S. Sanchez, C. Buonovglia, and J. Saliki. 2007. 

Occurrence of canine parvovirus type 2c in the United States. J. Vet. Diagn. Invest. 19:535-539. 

Kapil, S., E. Cooper, G. Campbell, C. Lamm, G. Rezebek, and B. Johnson. February, 2007a. Canine 

parvovirus variants circulating in South-Central USA, Western Veterinary Conference, Las Vegas, NV. 

Kapil, S., E. Cooper, C. Lamm, B. Murray, G. Rezebek, L. Johnston, G. Campbell, and B. Johnson. 2007b. 

Canine parvovirus types 2b and 2c circulating in North American dogs: 2006-2007. J. Clin. Microbiol. (In 

Press). 




PREVALENT STUDY OF PARASITIC INFESTATION IN MYANMAR TIMBER ELEPHANT 

Tin Tin Myaing, Soe Soe Wai, Latt Latt Tun, Kyaw San Linn and 

Tay Zar Aye Cho 

Almost 12,000 elephants are populated in Myanmar and most of them are utilizing as drought power in 

timber production. Even recommended dose of anthelmintics were administered routinely to them, some 

baby elephants were infested heavy parasitic infestation in those areas. The aim of the study is to investigate 

the prevalence of parasites in Myanmar timber elephants and to promote the health and care of baby 

elephants as there was a very limited record relevant to parasitic infestation in elephants. A total of (811) 

fresh faecal sample was collected per rectum on every month from both adult and baby elephants from the 

year 2004 to 2006 from middle part of Myanmar. Sample collection and faecal examination was done every 

month during the three years. All faecal samples were examined for intestinal nematodes eggs and larvae 

by using faecal sedimentationfloatation method and identified under microscope. The sedimentationfloatation 

technique was followed to get a minimum estimate of the number of eggs per gram of dung, which 

was used as an index of parasite load. 

Intestinal parasites are best identified by examining adult worms Strongyloides eggs 111/811(13.7%), 

Strongyloides larvae 114/811(14.1%), Amphistome eggs 32/811(3.9%), Coccidia eggs 2/811 (0.2%) and 

Toxocara eggs 2/811 (0.2%) were identified from the year 2004 to 2006. Strongyloides eggs 11/87(12.6%), 

26/81(32.0%), 16/120(13.3%) and Strongyloides larva 15/87(17.2%), 25/81(30.7%) and 8/120 (6.7%) was 

identified in summer, rainy and winter season, respectively in the year 2004. Amphistome eggs 7/87(8.0%) , 

9/81(11.1%) and 2/120(1.7%) had been observed in summer, rainy and winter season, respectively in 

2004.Strongyloides eggs 13/68(13.26%), 10/68(14.7%), 4/28(14.2%) and Strongyloides larva 25/98(25.5%), 

26/68(38.23%) and 5/28 (17.85%) was identified in summer, rainy and winter season, respectively in the 

year 2004 while Amphistome eggs 9/98(9.1%) , 7/68(10.29%) and 0/28( 0%) had been observed in 

summer, rainy and winter season, respectively in 2005. Strongyloides eggs 5/74(6.8%), 15/144(10.4%), 

11/110(10.0%) and Strongyloides larva 1/74(1.4%), 6/144(4.1%) and 3/110 (2.7%) was identified in summer, 

rainy and winter season, respectively in the year 2006 while Amphistome eggs 0/74(0%) , 7/144(4.9%) and 

1/110(0.9%)had been observed in summer, rainy and winter season, respectively in 2006. Ectoparasites 

(mites) and Hypoderma species (warble fly) were also observed. Only one Metastrongylus larvae has been 

identified where earthworms persisted in the pasture. 

The higher percentage of parasites eggs and larvae were investigated in rainy and winter season than 

summer season. Potential factors determining the parasitic infestations were influenced by environmental 

factors such as climate, humidity and temperature that affect the viability and behavior of parasite 

propagates and feeding. Transmission through contaminated forage may be one of the sources due to 

survivorship of eggs and juvenile stages of many nematodes is higher under moist conditions and because 

more food is consumed during the wet than in the dry season. Transmission through water may play as an 

important role since elephants often defecate near or in water where stream or river available at their place. 

Diet may influences the host’s nutritional status, and hence probably resistance to parasitic attack A 

moderate percentage of intestinal parasites eggs and larva identified in timber elephants may be due to the 

presence of large population of suitable host and favorable climate in these locations even anthelmintic had 

been given. Furthermore emerging parasitic zoonotic diseases transmitted from wild life should be 

investigated as mahout and their families are still living closed together with elephants. 

Key words: elephants, nematodes, Strongyloides, favourable climate, zoonoses 

Corresponding author: tintinmyaing@mail4u.com.mm 


THE CONCEPT OF EARLY DETECTION AND RAPID RESPONSE TO TAD'S 

By APH, IAEA. 

TAD’s, i.e. highly infectious diseases with great socio-economic impact, present a major challenge to 

national veterinary services. Proper measures have to be put in place to monitor the absence and to alert the 

service in case of potential outbreaks. This implies the formation of field staff in clinical and epidemiological 

features of such diseases and the procurement of pen side tests for an early detection, demands direct 

information of the responsible veterinary laboratory for further investigations and entails a response plan 

involving further investigations and control measures at the veterinary and political level. 

To allow such a straight forward approach diagnostic tools fit for the purpose ( field or laboratory test, known 

diagnostic sensitivity and specificity, robustness) have to be available in assured quality and sufficient 

quantity. Results from the field, i.e. alert messages, have to be communicated to a “centre” where decisions 

on the next appropriate steps can be made without delay (Send field teams, collect samples). At the same 

time the responsible diagnostic laboratory needs this information to prepare for the analysis and a differential 

diagnosis. 

Molecular techniques offer the chance to identify the potential pathogens already at the field level. 

Communicating these results to the “centre” will allow a much easier risk assessment and a better focused 

response strategy. Only positive confirmation tests will enact the full response plan, but delays as with CBPP 

of several weeks after the alert should become history in this way. 

The concept of transporting mainly DNA back to the laboratory has the charm of a much lower risk of 

spreading disease or contaminating laboratory workers, a more stable substrate to be analysed and a much 

quicker test procedure for most diseases in the responsible laboratory. 




BRUCELLOSIS IN MARINE MAMMALS: VETERINARY LABORATORIES AGENCY INVOLVEMENT. 

E. STUBBERFIELD*, C. DAWSON, L. PERRETT, S. BREW, and J. STACK 

Veterinary Laboratories Agency, Woodham Lane, Addlestone, Surrey, KT15 3NB, UK 

Brucellosis is an important zoonotic disease usually associated with cattle, sheep goats and pigs. In 1994 

Brucella was isolated from four common seals (Phoca vitulina), two harbour porpoises (Phocoena phocoena) 

and one common dolphin (Delphinus delphis) in Scotland 1 and a captive bottlenose dolphin (Tursiops 

truncatus) in the USA 2 . These isolates were found to be morphologically and molecularly different to the 

terrestrial strains and have been proposed the names Brucella maris or B. cetacea and B. pinnipedia on host 

specificity 3 . 

There is serological evidence of brucellosis in marine mammal sp. around the world however isolation of the 

organism has only occurred in the northern hemisphere 4 . Brucella maris has been shown to be zoonotic by 

four reported cases of infection in humans. The first human case was reported in 1999, a laboratory acquired 

infection in the UK 5 , a further three cases have occurred as natural causes of infection 6,7 – believed to be 

linked with the consumption of raw seafood. 

The Veterinary Laboratories Agency (VLA) has been involved in the examination of marine mammals both 

serologically and with the culture and molecular typing of Brucella isolated from various tissues. Since the 

first isolations in 1994 VLA has tested 150 isolations from a variety of marine mammals, primarily from British 

waters, but also isolates from USA, Canada and Northern Europe. We have tested over 3900 serological 

samples from around the world, both captive and wild animals, by three ELISAs. 

This poster summarises brucellosis in marine mammals and shows the results obtained from work done at 

the VLA. 

Acknowledgements: 

The authors would like to thank G. Foster (SAC, Inverness, Scotland), N. Davison (VLA Truro, Cornwall) and 

other laboratories that have kindly supplied material. 

References: 

1. Ross, H.M., Foster, G., Reid., Jahans, K.L. and MacMillan, A.P., Brucella species infection in seamammals. 

(1994) Vet. Rec., 134(14):359 

2. Ewalt, D.R., Payeur, J.B., Martin, B.M., Cummins, D.R. and Miller, W.G. Characteristics of a Brucella 

species from a bottlenose dolphin (Tursiops truncatus). (1994) J. Vet. Diagn. Invest. 6:448-452. 

3. Cloeckaert, A., Verger, J-M. Grayon, M., Paquet, J-Y., Garin-Bastuji, B., Foster, G. and Godfroid, J. 

Classification of Brucella spp. isolated from marine mammals by DNA polymorphism at the omp2 locus. 

(2001) Microbes and Infection, 3:729-738. 

4. Foster G, MacMillan AP, Godfroid J, Howie F, Ross HM, Cloeckaert A, Reid RJ, Brew S and Patterson 

IAP. A review of Brucella sp. Infection of sea mammals with particular emphasis on isolates from Scotland. 

Dec(2002) Veterinary microbiology 90(1-4):563-80 

5. Brew, S.D., Perrett, L.L., Stack, J.A., MacMillan, A.P. and Staunton, N.J. Human exposure to Brucella 

recovered from a sea mammal. (1999) Vet. Rec., 144:(17)483. 

6. Sohn AH, Probert WS, Glasser CA, Gupta N, Bollen AW, Wong JD, Grace EM and McDonald WC. Human 

neurobrucellosis with intracerebral granuloma caused by a marine mammal Brucella spp. Apr(2003) 

Emerging infectious diseases (USA) 9(4):485-8 

7. Mc Donald WL, Jamaludin R, Mackereth G, Hansen M, Humphrey S, Short P, Taylor T, Swingler J, 

Dawson CE, Whatmore AM, Stubberfield E, Perrett LL and Simmons G Characterization of a Brucella sp. 

strain as a Marine Mammal Type Despite Isolation from a Patient with Spinal Osteomyelitis in New Zealand. 

(2006) Journal of Clinical Microbiology 44(12): 4363-70 


PREVALENCE OF METHICILLIN RESISTANT STAPHYLOCOCCUS AUREUS (MRSA) IN A 

VETERINARY TEACHING HOSPITAL. 

Magda Dunowska 1 *, David C. VanMetre 1 , Gage Patterson 1 , Scott Weese 2 , Doreene R. Hyatt 1 , Paul S. Morley 1 

1 

Animal Population Health Institute, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, 

CO, 80523, 

2 

Dept of Clinical Studies, University of Guelph, Guelph, Ontario , Canada 

Magda Dunowska*, David C. VanMetre, Gage Patterson, Scott Weese 2 , Doreene R. Hyatt, Paul S. Morley 

*Current address: Department of Primary Industries, PIRVic, Victoria, Australia 

Introduction 

In general, Methicillin Resistant Staphylococcus aureus (MRSA) is regarded as a human pathogen and there 

are numerous publications describing problems associated with high prevalence of MRSA infections in 

human hospital settings. 1 However, several recent reports described MRSA isolation from animals. 2-5 

Although humans are a likely source for limited numbers of MRSA infections in animals, such reports raise 

concerns that MRSA would establish itself in the animal population. The purpose of this study was to 

determine the prevalence of MRSA carriage among animal patients and the extent of MRSA environmental 

contamination at the Veterinary Medical Center at Colorado State University (VMC-CSU). 


This was a prospective study conducted over a period of 9 months between February and October 2004. 

Patients were chosen by convenience from both in-patients and out-patients at the VMC-CSU. A total of 473 

nasal swabs were collected from 450 animals, including dogs, horses and cattle. In addition, 70 udder swabs 

were collected from cattle. Environmental samples (n = 218) were collected using electrostatic wipes. 

Bacteriological swabs and electrostatic wipes were cultured for the presence of MRSA. Selected MRSA 

isolates were typed by pulsed field gel electrophoresis (PFGE) of bacterial DNA digested with the restriction 

enzyme SmaI. 

Results 

Overall, 3.5 % of all animals and 3.2 % of the environmental samples tested positive for MRSA. Hospitalized 

horses showed highest prevalence of MRSA shedding (5.8 %), followed by canine patients (2.6 %). None of 

the bovine patients were positive for MRSA. The majority of samples tested by PFGE belonged to one of the 

two PFGE types, classified as USA100 and USA500. Positive environmental samples were collected from 

the small animal areas (4 samples), large animal areas (2 samples) or mixed areas (1 sample). 


Although, at present, the prevalence of MRSA carriage among veterinary patients seems to be low, the 

potential for emergence of MRSA as animal pathogen is concerning. 3 While humans are presumably the 

initial source of MRSA infection in animals, it is likely that a carrier animal may then serve as a vector for 

disseminating MRSA among other animals or people. The fact that identical MRSA strains have been 

isolated from veterinary patients and veterinary clinic personnel in several studies seems to support this 

hypothesis. 2,5 This may be of particular concern for pet owners who are immunocompromised or those in 

contact with immunocompromised people. 

MRSA was isolated from the environmental samples collected from VMC-CSU. Although the percentage of 

positive samples was low, these samples were collected from the high traffic areas. Similarly to the situation 

in human hospitals, appropriate infection control measures are recommended. 

References 

1. Richards MJ, Russo PL. Surveillance of hospital-acquired infections in Australia--One Nation, Many 

States. J Hosp Infect. 2007;65 Suppl 2:174-81. 

2. O'Mahony R, Abbott Y, Leonard FC, et al. Methicillin-resistant Staphylococcus aureus (MRSA) isolated 

from animals and veterinary personnel in Ireland. Vet Microbiol 2005;109:285-96. 

3. Waller A. The creation of a new monster: MRSA and MRSI--important emerging veterinary and zoonotic 

diseases. Vet J 2005;169:315-6. 

4. Weese JS. Methicillin-Resistant Staphylococcus aureus: An Emerging Pathogen in Small Animals. J Am 

Anim Hosp Assoc 2005;41:150-7. 

5. Weese JS. Methicillin-resistant Staphylococcus aureus in horses and horse personnel. Vet Clin North Am 

Equine Pract 2004;20:601-13. 




A VIRUS NEUTRALIZATION TEST FOR THE DETECTION OF ANTIBODY TO AUSTRALIAN BAT 

LYSSAVIRUS 

KM Newberry, RA Lunt, KA McColl and T Chamberlain 

CSIRO Livestock Industries, Australian Animal Health Laboratory, P.O. Bag 24, Geelong 3220, Australia 

Introduction 

Australian bat lyssaviruses (ABLV) form a monophyletic group (genotype 7) with two clades that correlate 

with the identified biological reservoirs in flying foxes (Megachiroptera spp.) and one species of 

insectivorous bat (Microchiroptera Saccolaimus flaviventris). The ABLV genotype is more closely related to 

the terrestrial rabies virus (RABV, genotype 1) than any of the other six genotypes currently recognised, and 

consequently shares a common serotype (serotype 1). 

In published studies to date 1, 2 , the efficacy of RABV vaccination for protection against ABLV has been based 

on relatively limited data and has not accounted for possible differences due to ABLV variants. We have 

developed neutralization tests based on the FAVN for measuring antibody to pteropid and insectivorous bat 

variants of ABLV (ABLV-pt and ABLV-ins). These tests have been used to assess various sets of sera for 

antibody titres to RABV and ABLV. 


Sera: Variously obtained as sequential bleeds from animals (feline, canine, pteropid) used in ABLV 

experimental transmission studies (39 animals, 130 sera), pteropid field surveillance sera, various and 

unspecified collections (164 sera), human post RABV vaccination (118 sera) and human RABV/ABLV clinical 

investigations (3 individuals, 11 sera). 

Viruses: 96-0648 (ABLV-pt) and 96-1256 (ABLV-ins), Challenge Virus Standard RABV (CVS-11 genotype 1) 

were used in comparative serology tests. 

Serology tests: Two virus neutralization serology techniques were used, the Rapid Fluorescent Focus 

Inhibition Test (RFFIT) 3 and the Fluorescent Antibody Neutralization Test (FAVN) 4 . Only RABV was used in 

the RFFIT, while rabies, ABLV-Pt and ABLV-In all used in the FAVN. 

Results 

Summarised results from this work are: 

- FAVN format assays were set up and optimised for both ABLV variants 

- Qualitative agreement between tests (RABV RFFIT, RABV FAVN, ABLV-ins FAVN, ABLV-pt FAVN) 

assays ranged between 94 to 97.6% 

- 4/95 human sera were RABV antibody test-positive, but test-negative for one or both ABLV variants 

- Regression plots of ABLV against rabies titres for 95 post vaccination sera demonstrate equivalence 

at around 0.5 IU/ml, but with slope and intercept parameters favouring a differential for RABV at 

higher antibody titres 


ABLV is closely related to RABV and has been associated with a rabies-like disease in both bats and 

humans. Vaccination for rabies is commonly used in Australia to protect bat handlers and others against 

potential infection with ABLV. In the absence of a specific ABLV antibody test, rabies serology tests have 

been used as a guide for effective response to vaccination. Furthermore, the lack of a specific assay for anti- 

ABLV antibody has impaired evaluation of results from assays employing heterologous virus (RABV) to 

measure antibody responses in animals that may have been exposed to ABLV. Our results show that the 

modified FAVN can be effectively applied for comparative measurement of antibody to RABV and ABLV 

variants. The results are significant both for appropriate test selection (e.g. in ABLV surveillance serology) 

and for interpretation of protective antibody levels against ABLV in rabies vaccine recipients. 

References 

1. Fraser GC, Hooper PT, Lunt RA, Gould AR, Gleeson LJ, Hyatt AD, Russell GM, Kattenbelt JA. 1996. 

Encephalitis caused by a lyssavirus in fruit bats in Australia. Emerg. Infect. Dis.; 2: 327-331. 

2. Brookes SM, Parsons G, Johnson N, McElhinney LM, Fooks AR. 2005. Rabies human diploid cell vaccine 

elicits cross-neutralising and cross-protecting immune responses against European and Australian bat 

lyssaviruses. Vaccine; 23: 4101-4109. 

3. Smith JS, Yager PA, Baer GM 1973. A rapid reproducible test for determining rabies neutralizing 

antibody. Bull. WHO, 48: 535-541. 

4. Cliquet F, Aubert M, Sagné L (1998). Development of a fluorescent antibody virus neutralisation test 

(FAVN test) for the quantification of rabies-neutralising antibody. J. immunol. Meth., 212:79-87. 


DEVELOPMENT OF PORCINE CIRCOVIRUS (PCV) DIAGNOSTIC CAPABILITY AT AAHL ALLOWING 

THE DETECTION AND NUCLEOTIDE SEQUENCE ANALYSIS OF PCV FROM DISEASE OUTBREAKS. 

1 C. J. Morrissy, 1 D. Schafer, 1 L. Wright, 1 J. Hammond, 1 J. Bingham, 3 Nguyen Thi Thu Hong, 2 E. Neumann, 1 D. Middleton, 1 W. Goff, 1 W, 

Ha, 2 P, Jaros, 

2 L McIntyre and 1 M. Johnson 

1 CSIRO Livestock Industries, Australian Animal Health Laboratory (AAHL), 

Geelong, Victoria, Australia. 

2 EpiCentre, Massey University, Palmerston North, New Zealand. 

3 National Veterinary Company (NAVETCO), Ho Chi Minh City, Vietnam. 

Objectives 

1. To establish a diagnostic capability at AAHL for PCV. 

2. To collate nucleotide sequence data from Australian, New Zealander (NZ) and Vietnamese viruses 

isolated from pigs showing a variety of clinical signs of disease. 

Key Messages 

Postweaning multisystemic wasting syndrome (PMWS) causes severe loss of weight and mortality in weaner 

pigs. There is an increasing body of evidence that PCV type 2 (PCV2) is associated with PMWS. PMWS and 

PCV associated disease have been described in commercial pig populations in many countries worldwide 

including the USA, the UK, Asia and most of Europe; it has not been reported from Australia. We have 

isolated PCV2 from a number of samples submitted from Australia and NZ. We have also assisted 

NAVETCO, in Vietnam, to isolate PCV from pigs as part of a technology transfer program. Nucleotide 

sequence analysis has enabled comparisons with historical Australian PCV isolates and with other 

sequences from PMWS endemic countries. 

Conclusions 

AAHL has developed a diagnostic capability for PCV which includes virus isolation, immunodetection 

techniques including immunohistochemistry, PCR and nucleotide sequencing. The sequence data 

demonstrate that the most recent Australian PCV isolates differ from historical Australian PCV isolates and 

that these isolates are different from those viruses isolated in NZ. 




STUDY OF BRUCELLOSIS AMONG ABATTOIR WORKERS IN ISFAHAN, IRAN 

Babak Asghari*, Jamshid Faghri, Foad Abdollahpour 

Brucellosis is a serious zoonotic problem in most developing countries, caused by Brucella spp.Brucella can 

spread from animals to people. Brucellosis is an occupational hazard particularly for abattoir workers, 

veterinarians and farm workers. Brucellosis was determined through a sampling of 150 abattoir workers in 

Isfahan. Diagnosis was obtained from Rose Bengal plate test, standard tube agglutination test (STA) and 

blood culture. The prevalence of brucellosis was 2.1% among abattoir workers. It would also be beneficial to 

create awareness about brucellosis in such professional so that essential precautions and repeated 

screening of such occupationally exposed individual can be done. Vaccination of animals for Elimination of 

the infection to produce Brucella free animals can prevent the infection in humans. 

*Babak Asghari– Dept. of Microbiology, School of Medicine, Isfahan Medical Sciences University 

Post Box: 81745-359 

ISFAHAN-IRAN 

E-mail : bab.asghari@gmail.com 


GENETIC VARIABILITY ANALYSIS OF RABIES VIRUS -SEROTYPE 1- ON ROMANIAN TERITORY 

M. Turcitu*, Handan Coste, St Nicolae, Gh. Barboi 

Institute for Diagnostic and Animal Health, Bucharest, Romania 

Introduction 

Nucleotides sequence analysis for virus isolates belonging to different geographical regions of Romania 

allows phylogenetic diversities screening for a particular region, as well as similarity degree especially with 

isolates from different european countries. 


Viral genome sequencing was performed at nucleoprotein gene region, due to the relatively high genetic 

stability, with the pathologic material consisting of brain homogenates from different species of domestic and 

wild animals (2 dogs, 3 cats, 1 jackal, 4 foxes, 2 cows, 1 horse, and 1 sheep) find with rabies through direct 

immunofluorescence and mice inoculation. 

For preparation of virus RNA, commercially available kits were used (HighPure RNA Isolation Kit- Roche 

Applied Science, RNEasy Mini Kit- Qiagen), followed by nested PCR using primers previously described 

(Heaton et al). Revers Transcription and the first PCR were carried out in a single tube RT-PCR (OneStep 

RT-PCR kit- Qiagen), followed by second PCR. The amplicons obtained (606bp) were purified from gel 

agarosis using "MinElute Gel Extraction Kit- Qiagen" and subjected to direct sequencing using "BigDye 

Terminator Cycle Sequencing Kit- Applied Biosystems ". 

Results 

Sequences obtained were aligned using Clustal W Alignment software and a phylogenetic tree was build 

using Mega 3.1 software. Data analysis showed three major characteristics regarding virus circulation: virus 

isolates belonging to central and southern Romania (Danube natural barrier with Bulgaria) tends to form a 

separate cluster, without many foreign infusion of genetic material; for western and south-western isolates, 

due to the high phylogenetic similarities with hungarian and former Yugoslavia strains, showed the 

permanent exchange of genetic material through bidirectional movement of virus. Finally, eastern and northeastern 

isolates falls into clusters with sequences from north-eastern Europe (Finland, Estonia), probably via 

Ukraine. 


Data obtained show two majors route of virus circulation in Romania that extends into neighboring countries 

to witch Romania has terrestrial borders: west and south-west with Hungary and former republic of 

Yugoslavia, east and north-east with Ukraine. However, Danube river (witch is the natural border with 

Bulgaria to the south) tends to act as an efficient barrier for virus movement, whiteout any genetic material 

exchange detected so far. 

The results obtained needs to be completed with new data from all romanian territory to have a clear view 

upon virus circulation; moreover, sequencing of larger fragments could be relevant for phylogenetic analysis, 

although with the genetic diversity detected in this study do not appear to have a decisive role. 

References 

1 PAUL R. HEATON, LORRAINE M. McELHINNEY, J. PAUL LOWINGS (1999). Detection and identification 

of rabies and rabies-related viruses using rapid-cycle PCR, Journal of Virological Methods, 81, 63-69. 

2. HERVE BOURHY, BACHIR KISSI, LAURENT AUDRY, MARCIN SMRECZAK, MALGORZATA 

SADKOWSKA-TODYS, KATARIINA KULONEN, NOEL TORDO, JAN F. ZMUDZINSKI, EDWARD C. 

HOLMES(1999). Ecology and evolution of rabies virus in Europe, Journal of General Virology, 80, 2545- 

25573. 

3. S KUMAR, K TAMURA, and M NEI (2004) MEGA3: Integrated software for Molecular Evolutionary 

Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5:150-163. 

*corresponding author: e-mail Turcitu.Mihai@idah.ro 




ANALYSIS OF CYTOKINE EXPRESSION IN CULTURE OF MONONUCLEAR CELLS FROM 

TUBERCULOUS BOVINES 

1 *Díaz-Otero F., Lugo-Arriaga TM., Jaramillo-Meza L., González Salazar D., Espitia-Pinzón CI, Arriaga-Díaz 

1 CENID-Microbiología-INIFAP 2 INIB-UNAM 

The aim of this work was to evaluate expression of IFN-γ, IL-2, IL-4 and IL-10 by RT-PCR in bovines 

showing different reactivity in the diagnostic tests of bovine tuberculosis. Group 1 was formed by animals 

negative to the tuberculin skin test, ELISA and IFN-γ test, group 2 by animals positive to all tests and group 3 

by animals positive only to the ELISA test. Peripheral blood mononuclear cells (PBMC) were obtained from 

all animals and were stimulated in vitro with PPD bovis, PPD avium and Concanavalin A and assayed for 

cytokine expression. Expression of IFN-γ and IL-2 was evident in cells of group 1 stimulated with Con A while 

no significant expression of these cytokines was observed when stimulated with PPD bovis or PPD avium. In 

cells from group 2 stimulated with PPD bovis high expression of IFN-γ, IL-2 and IL-4 was observed; when 

stimulated with PPD avium expression of IL-2 was lower than with IFN-γ. In contrast, cells of group 3 showed 

higher expression of IL-4 and IL-10 in the presence of PPD bovis. These results indicate that as the infection 

progresses, the pattern of cytokine expression changes from Th1 type to Th2, which was confirmed by the 

presence of high levels of antibodies and no reactivity to the skin tuberculin test that was observed in group 

3; this immune response is usually observed in advanced stages of the disease. 

Supported in part by CONACYT Nº.- D43244-Z 

1 Corresponding author: Fernando Díaz Otero, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Centro Nacional 

de Investigación Disciplinaria en Microbiología. Departamento de Biotecnología Aplicada. Carretera México-Toluca, Km. 15.5 Col. Palo 

Alto, 05110, México, DF. Teléfono: 55703100 EXT.-34, Fax: 55704073, E-mail: diof0009@servidor.unam.mx 


INTER-LABORATORY EVALUATION OF A REAL-TIME PCR ASSAY FOR DETECTION OF BOVINE 

HERPESVIRUS 1 IN BOVINE SEMEN 

J. Wang 1* , J. O’Keefe 1 , D. Orr 1 , L. Loth 1 , S. Cork 1 , M. Banks 2 , P. Wakeley 2 , D. West 2 , R. Card 2 , G. Ibata 2 , C. Van Maanen 3 , P. Thoren 4 , 

M. Isaksson 4 , P. Kerkhofs 5 

1 Investigation and Diagnostic Centre, Biosecurity New Zealand, Upper Hutt, New Zealand 

2 Veterinary Laboratories Agency, Weybridge, United Kingdom 

3 Animal Health Service, Deventer, The Netherlands 

4 National Veterinary Institute, Uppsala, Sweden 

5 Veterinary and Agrochemical Research Centre, Brussels, Belgium 


Introduction 

Bovine herpesvirus 1 (BoHV-1) is an important pathogen economically in cattle causing different syndromes, 

including infectious bovine rhinotracheitis (IBR), and infectious pustular vulvovaginitis (IPV) and 

balanoposthitis (IBP). BoHV-1 infected bulls are regarded as life-long carriers of the virus and may 

potentially shed virus intermittently in their semen. BoHV-1 is of significance to international bovine semen 

trade. To guarantee the safety of semen for artificial insemination, rapid, sensitive and reliable tests for virus 

detection are crucial. Virus isolation is routinely used for the detection of BoHV-1 in bovine semen, which is 

also the prescribed test for international trade by the Office International des Epizooties (OIE). However, this 

method is time and labour-consuming, and lacks sensitivity 1 . A more sensitive and reliable method would be 

valuable. We have previously developed and validated a real-time PCR assay for the detection of BoHV-1 in 

extended semen 2 . The PCR assay was shown to be more sensitive than virus isolation, highly specific and 

repeatable. The specific objectives of this study were: (1) to evaluate the test reproducibility when the same 

real-time PCR assay was used in different laboratories employing different personnel and instrument; (2.) to 

further assess the sensitivity and specificity of the real-time PCR assay. 


An international inter-laboratory ring trial was performed with the participation of six laboratories from five 

countries. Sets of coded samples were prepared in one laboratory and distributed to each of the participating 

laboratories. The sample panel consisted of semen from naturally and artificially infected bulls, serial 

dilutions of positive semen, semen from uninfected bulls, spiked negative semen with virus, as well as serial 

dilutions of reference virus. The samples were tested using a previously validated real-time PCR assay for 

the detection of BoHV-1 in each participating laboratory 2 . The PCR tests were conducted with four different 

real-time PCR amplification/detection platforms. Virus isolation using one set of samples was performed in 

one laboratory. 

Results 

The PCR results from the participating laboratories were compared with one another, and with those of virus 

isolation. Analysis using к statistic showed that there was a substantial level of agreement on PCR testing 

results between the laboratories (к = 0.59-0.95). The sensitivity of the PCR ranged from 78.6% to 89.3%, 

with an overall result at 82.7%, in comparison to 53.6% for virus isolation. The overall specificity for the PCR 

across all six participating laboratories was 93.6%, while the specificity for virus isolation was only 84.6%. 


The real-time PCR assay applied in the ring trial provided a satisfactory reproducibility when conducted by 

different personnel in different laboratories. The sensitivity and specificity of the PCR assay was greater than 

those of virus isolation. The high specificity and sensitivity of the real-time PCR assay, in combination with 

significant reduction of time for detecting amplified products, make it a valuable alternative to the slow and 

laborious virus isolation for the detection of BoHV-1 in extended semen. The real-time PCR assay has been 

ratified by the OIE as a prescribed test for international trade. 

References 

1. Weiblen, R., Kreutz, L., Canaboroo, T. F., Schuch, L. C., Rebelatto, M. C., 1992. Isolation of bovine 

herpesvirus 1 from perputial swabs and semen of bulls with balanoposthitis. J. Vet. Diag. Invest. 4, 341-343. 

2. Wang, J., O’Keefe, J., Orr, D., Loth, L., Banks, M., Wakeley, P., West, D., Card, R., Ibata, G., Van 

Maanen, C., Thoren, P., Isaksson, M., Kerkhofs, P. 2007. Validation of a real-time PCR assay for the 

detection of bovine herpesvirus 1 in bovine semen. J. Virolo. Methods. 144, 103-108. 




THE AUSTRALIAN NATIONAL QUALITY ASSURANCE PROGRAM (ANQAP) 

*PL Young, ME Beggs, LME McCauley, Department of Primary Industries, Victoria 

The Australian National Quality Assurance Program (ANQAP) is an international proficiency testing program 

for veterinary laboratories. The major focus of the program is to evaluate tests associated with disease 

control programs, quarantine and export health certification. Participation in proficiency testing provides 

laboratories with an objective means of assessing and demonstrating the reliability of the results produced. 

ANQAP currently offers proficiency testing for 36 different tests used for the diagnosis of 21 diseases in the 

areas of veterinary virology, serology and bacteriology. The tests available include agar gel immunodiffusion 

(AGID), enzyme linked immunosorbent assay (ELISA), virus neutralisation, complement fixation, virus 

isolation, microscopic agglutination (MAT) and polymerase chain reaction (PCR) tests. In the current 2007 

testing cycle there are 33 participant laboratories from Australia, New Zealand, Asia, Africa, Europe and 

Northern America. 

For each proficiency test, a panel of six samples is sent to each laboratory for testing. The samples are 

either freeze dried serum or whole blood which are reconstituted by the participant laboratory prior to testing. 

The panel of samples will generally be comprised of at least one negative, one low positive and one high 

positive sample to reflect a range of results that are likely to be found in routine diagnostic testing. 

Laboratories are encouraged to treat the panel as diagnostic specimens and include them in their routine 

testing schedule. For each assay evaluated, ANQAP collates the results reported by the individual 

laboratories and prepares a report that summarises all of the results reported by the participating 

laboratories. The ANQAP report includes a statistical analysis of the results where appropriate, and a 

classification of the results. Results that fall within an acceptable variation range will be classified as 

satisfactory. If the results demonstrate variation, the laboratory is given the opportunity to retest with a fresh 

vial of the same sample. Following retesting the result will be classified as either retest satisfactory, retest 

demonstrating minor variation or retest unsatisfactory. Laboratories receiving an unsatisfactory classification 

are encouraged to take corrective action. 

ANQAP has been providing proficiency testing since 1991. The program began with only four tests and has 

undergone continuous growth to offer 36 tests in 2007. The number of tests monitored by ANQAP will 

continue to increase as additional tests are considered. In 2006 ANQAP included the first molecular assay in 

the program: Bovine viral diarrhoea PCR. Other molecular tests will be included in the program over the next 

few years beginning with the Influenza A and Newcastle disease virus PCR tests. 

Objectives 


LESTER: THE USE OF A SIMULATION TOOL TO ENABLE DETAILED EVALUATION OF 

LABORATORY CAPACITY TO RESPOND TO AN OUTBREAK. 

DR JAMES WATSON 

To design and implement a simulation tool that would enable detailed assessment of laboratory capabilities 

as part of an emergency animal disease exercise. 

Key Messages 

As part of Exercise Hippolytus, a program of emergency animal disease (EAD) exercises for animal health 

laboratories, a tool (LESTER) was developed to allow detailed simulation of laboratory systems. 

This tool, based on manipulation of magnetic tokens and labels on whiteboards laid out to represent 

functional areas of the laboratory, allowed laboratory staff to participate directly as players in the unfolding 

scenario. Tokens represented actual staff members and real resources, including key reagents; availability 

was based on an unannounced laboratory audit. Strict time constraints were enforced to mimic realistic 

workflow. 

A spreadsheet model of key functional areas was also developed to explore the effects of management 

decisions and tune the simulation for maximum benefit. 

The simulation identified key constraints on laboratory surge capacity as well as generating feedback on 

ways to improve AAHL’s EAD response plan. The outcomes provided a realistic assessment of the 

laboratory’s surge capacity in an outbreak situation. Direct involvement of staff, not usually the case in such 

exercises, was a useful training exercise. 

Conclusion 

LESTER enabled detailed simulation of laboratory response to an outbreak, providing useful data on 

laboratory capacity and constraints as well as providing considerable input towards process improvements. 




REPRODUCIBILITY OF RESULTS IN BATCHES OF 3 ELISA KITS FOR JOHNES’ DISEASE: 

RECOMMENDATIONS FOR KIT EVALUATION CRITERIA 

J.M. Gwozdz*, M. Carajias 

OIE and National Reference Laboratory for Johne’s Disease 

Department of Primary Industries 

475 Mickleham Road, Attwood, Victoria 3049, Australia, phone: 61 3 9217 4277 

e-mail: Jacek.Gwozdz@dpi.vic.gov.au 

Introduction 

Johne's disease (JD) is a chronic, wasting disease of ruminants caused by infection with Mycobacterium 

paratuberculosis. 

Currently, there are 3 commercially available ELISA kits that are approved for testing cattle for JD in 

Australia. It is crucial that they show high reproducibility of results as they are used in the National Johne's 

Disease Market Assurance Program for Cattle. Therefore, new batches of the ELISA kits are subjected to 

independent evaluation to assess reproducibility of the assay performance prior to release of a kit. 

The objective of this study was to validate criteria for the evaluation of batches of the 3 ELISA kits. 


Three new batches of 3 ELISA kits supplied by Prionics (Switzerland), Institut Pourquier (France) and IDEXX 

(USA) were evaluated over a period of 3 years. A batch was considered new when there was a change in 

the source, production or processing of any biological component of a kit. The kits were coded to maintain 

confidentiality of suppliers. 

A panel consisting of about 180 sera from cattle from a region considered as free of JD and about 50 sera 

from cattle with JD was used for the evaluation of the within-plate, between-plates and between-batches 

variations, and specificity and sensitivity of each batch. Testing and interpretation of results were carried out 

following the kit manufacturer’s recommendations. Coefficient of variation (CV) of optical density (OD) values 

of replicates of each serum was calculated to assess the within-plate, between-plates and between-batches 

variations. In addition, the percentage of diagnostic agreement was used to further assess the betweenbatches 

reproducibility. 

Results 

The total average CVs of OD values within a plate (among wells), between plates and between batches of 

the three kits were 6.8% (3.73 to 9.12%), 1 9.3% (5.35 to 14.9%) and 13% (8.8 to 16.98%), respectively. 

The overall average agreement of diagnostic classification for all kits and batches was 99% (98 to 100%). 

The overall average specificity and sensitivity for all kits and batches were 99.75% (98.53 to 100%) and 

78.6% (70.6 to 90.9%), respectively. 

Data derived from this study was used to formulate acceptance criteria for the evaluation of new batches of 

the ELISA kits. For the within-plate, between-plates and between-batches variations, the sum of the average 

CV of OD values and 2 standard deviations (SD), representing the upper scale of 95% of the population, was 

adopted as an acceptance limit. For the percentage of diagnostic agreement, the minimum acceptance limit 

was established by deducting 2 SD from the overall average. 

In addition, data derived from this study was used to formulate the measurement of uncertainty for assay 

results. 


The high reproducibility of results warrants the use of the 3 ELISA kits in market assurance programs to 

consistently assess levels of M. paratuberculosis infection in cattle herds. 

The recommended acceptance criteria for the evaluation of new batches of the 3 ELISA kits are as follows: 

• Within-plate variation < 10% CV of OD values of serum replicates 

• Between-plates variation < 15% CV of OD values of serum replicates 

• Between-batches variation < 20% CV of OD values of serum replicates 

• % diagnostic agreement < 98% 

Acknowledgment 

This study was supported by the Department of Primary Industries Victoria and suppliers of the ELISA kits: 

IDEXX, Institut Pourquier and Prionics. 

1 , figures in brackets indicate a range of results. 


LATERAL FLOW TECHNOLOGY-PENSIDE TEST 

FOR THE DETECTION OF FOOT-AND-MOUTH DISEASE 

T Kristersson, A Nordengrahn, M Merza* 


Introduction 

Consistent with the guidelines of new policy oriented research is the development of rapid, simple tests that 

could be used as first line diagnostics. Pen-side tests represent tools that satisfy these requirements: their 

application could be useful as a first line diagnosis for Veterinarians in slaughter house, in farms and in 

simply equipped regional laboratories, mainly to control the spreading of viral infections when the primary 

outbreak has been confirmed by a Reference laboratory. The on site assays are mainly based on antigen or 

antibody recognition, consequently they use antibody-based detection systems. 


An FMDV pan-reactive mAb was bound to colloid gold as well as immobilised on a nitrocellulose membrane. 

If virus is present in the sample it will bind to the gold-antibody and form an immune complex. The complex 

then migrates by capillary action along the membrane until it reaches the immobilised antibody on the 

membrane. The complex will bind, resulting in a read line. 

In order to evaluate the assay, inactivated viral cellcultures representing serotype A, O, C, Asia1, Sat1, Sat2 

and Sat3 as well as samples from Vesicular stomatitis virus (VSV), Swine disease virus (SVDV) and normal 

non infected cell cultures were analysed. 

Results 

Results show that all seven serotypes were detected by the assay, but with a weaker reaction with Sat1, 

Sat2 and Sat3 samples. No reaction was seen with VSV, SVDV or with normal cells. 


We have successfully used the lateral flow technology in order to develop a test system for FMDV. By the 

use of a panreacting monoclonal antibody a good sensitivity and specificity was established as all seven 

serotypes of FMDV were recognised, while samples from other vesicular diseases such as VSV and SVDV 

as well as other cellculture samples did not react. 

The Pen-side test is considered to be a quick and easy to perform assay and our results shows that it could 

be of great value as the first line of diagnosis. By using the Pen-side test a yes/no answer could be obtained 

within 10 minutes giving the responsible Veterinarian the ability to quickly take the right precautionary 

measures in the matter. 

Further evaluations are ongoing in order to develop a new line of diagnostics for FMDV market. 




DEVELOPMENT OF A HIGH THROUGHPUT ROBOTICS-BASED ELISA FOR THE DETECTION OF 

ANTIBODIES SPECIFIC FOR PARASITE WORM SPECIES IN SHEEP 

Introduction 

K. L. Tyrrell 1* & J. R. White 2 

1 CSIRO Livestock Industries, Locked Bag 1, Armidale, NSW 2350 

2 Australian Animal Health Laboratory, CSIRO Livestock Industries, Private Bag 24, Geelong, VIC 3220 

Traditionally ELISA have been performed manually in the laboratory with little, if any input from automated 

machinery due to either the sample type or the complexity of the plate formats required. Manually operated 

ELISA assays require scrupulous adherence to test parameters to maintain acceptable intra- and inter-test 

reproducibility. Assay consistency can suffer due to such factors as operator error, the throughput of large 

numbers of samples within short given timelines and the involvement of different operators. An existing 

ELISA protocol for the detection of separate immunoglobulin isotype responses in sheep plasma to the 

parasitic worms Haemonchus contortus and Trichostrongylus colubriformis, was adapted to perform on a 

Tecan Genesis 200 robotic deck. The primary aim of this activity was to enable the rapid processing of a 

very large number of samples in a highly consistent and reproducible manner and simultaneously investigate 

the robustness of a ‘roboticised’ ELISA format. 


In adapting the assay to an automated format, careful consideration needed to be given to the mechanical 

capabilities / limitations of the robot in relation to the degree of permitted modifications within individual steps 

of the assay. A program for the Tecan Genesis 200 robotic deck was written to accomplish the major steps 

involved in the ELISA with little or no interference required by the operator. These steps included sample, 

antibody and conjugate addition to individual plates together with the associated washing steps involved for 

each step. 18 standard ELISA plates were pre-coated with antigen two days prior to testing and 

subsequently blocked with a !% casein solution one day prior to testing, using a PerkinElmer MultiProbe 

robotic deck. At the start of the ELISA assay proper, all plates were placed on the deck of the Tecan Genesis 

200 in the correct order for sample addition. Individual animal plasma samples were prepared in 96 deep 

well plates which acted as the stock supply to be aliquotted by the robotic arm to specific plates. Each 

sample was fully titrated across the plate. Plasma standards were also included in the deep well format and 

needed to be individually placed in the appropriate plates by predefined programming of the robotic arm. At 

the completion of the robotic steps on the deck, substrate was added manually and the reaction stopped for 

plates to be read on a standard plate reader. The assay was completed in approximately 7.0 hr. 

Results 

The ELISA was successfully translated to a robotics format (RELISA) with equivalent results obtained when 

the assay was conducted manually. Comparisons of standard curves obtained from both the robot and 

manual assays showed an improvement in the consistency in the robotic data between plates and between 

days that the assay was performed. It was determined that leaving the plates soaking in assay wash buffer 

(NaCl 3.85M, Na2HPO4 281mM, KCL 67mM, KH2PO4 plus 0.05% Tween 20) on the deck, for prolonged 

periods at the end of the assay run, did not affect the expected OD levels. This finding meant the RELISA 

was able to routinely process 36 plates per day and up to 54 plates per 24 hour period where a third 

overnight run was employed. A total of 730 plates were run in a 25 day period, providing data on 610 

individual animal samples. 


The improved consistency of standards both within and between ‘runs’ suggests that there will be an 

increase in the quality of the data produced when the robotic deck is employed to process samples. The 

successful translation of the RELISA to a high-throughput, automated protocol has also provided invaluable 

insights into the various factors and parameters that need to be considered for the adaptation of other 

ELISA-based assays to a robotics format. At the Australian Animal Health Laboratory (AAHL) we wish to now 

extend this process to other existing ELISA formats in particular, those assays specific for exotic agents with 

the potential to cause major, widespread disease outbreaks. 


LATE-PCR DETECTION OF FOOT AND MOUTH DISEASE VIRUS 

Kenneth E. Pierce 1 , *Rohit Mistry 2 , Scott M. Reid 3 , Juliet P. Dukes 3 , Katja Ebert 3 , Donald P. King 3 and Lawrence J. Wangh 1 . 

1 Brandeis University, Waltham, MA, USA 

2 Smiths Detection, Watford, WD23 2BW, UK 

3 Institute for Animal Health, Pirbright, GU24 0NF, UK. 

*presenting author 

Introduction: Foot and mouth disease (FMDV) is caused by a positive-strand RNA virus and outbreaks are 

highly contagious and costly. Virus detection is complicated by the presence of 7 serotypes and variation 

within serotypes. We aim to construct a pan-FMDV assay using a novel technology, LATE-PCR suitable for a 

sophisticated field instrument. 

Materials & Methods: The most highly conserved sequences in the 3D (RNA polymerase) gene were used 

to design a Limiting and an Excess Primer according to the criteria of Linear-After-The-Exponential (LATE)- 

PCR 1,2,3 . A one-step RT-PCR was performed using the Excess Primer to initiate cDNA synthesis. The two 

primers then generate an abundance of single-stranded DNA that is freely available to hybridize with a 

fluorescent probe at low temperature. The probe is mis-match tolerant and therefore hybridizes to sequence 

variants within its target sequence. Fluorescence detection during a post-PCR melt identifies and quantifies 

the amplification products. This assay also includes an internal control target that is amplified by the same 

primers and hybridizes to a probe with a different fluorophore. In a parallel experiment, a one-step real-time 

RT-PCR assay (designed to 3D) in routine use by national reference laboratories 4, 5, 6 was used to test 

identical viral RNA samples. 

Results: Amplification of synthetic DNA templates demonstrated that the signal at end-point was 

proportional to number of initial target molecules over the range 10 to 1 million copies. Serial dilutions of 

viral RNA also showed quantitative end-point signals, although variation was higher. A single pair of LATE- 

PCR primers amplified RNA for multiple strains from all 7 FMDV serotypes. All samples which contained 

culturable FMDV, as well as several samples with titers below culturable limits were positive. There were no 

false positive signals with RNA from other viruses that cause vesicular disease in livestock. Each FMDVnegative 

sample generated a signal from an internal control sequence, insuring against amplification failures. 

Comparison of the LATE and reference laboratory RT-PCR assay data showed the results were concordant. 

Conclusions: Our LATE-PCR pan-FMDV assay uses a single pair of primers and a single probe to detect a 

wide spectrum of FMDV isolates in a convenient quantitative-end-point assay suitable for a field instrument. 

Supported by: Smiths Detection, Inc 1, 2 and Defra UK 3 (project SE 1121). 

References: 

1. Sanchez, J.A., Pierce, K.E., Rice, J.E., and Wangh, L.J. (2004). Linear-After The Exponential (LATE)- 

PCR: An advanced method of asymmetric PCR and its uses in quantitative real-time analysis. Proc. Natl. 

Acad. Sci (USA) 101, 1933-1938. 

2. Pierce, K.E., Sanchez, J.A., Rice, J.E., and Wangh, L.J. (2005). Linear-After-The-Exponential (LATE)- 

PCR: optimizing primer design for high yields of specific single-stranded DNA and improved real-time 

detection. Proc. Natl. Acad. Sci (USA) 102, 8609-14. 

3. Pierce, K.E, and Wangh, L.J. (2007). LATE-PCR and allied technologies: Real-time detection strategies 

for rapid, reliable diagnosis from single cells. In: Single Cell Diagnostics, A.R. Thornhill (ed.), Humana 

Press, pages 65-85. 

4. Callahan JD, Brown F, Osorio FA, Sur JH, Kramer E, Long GW, Lubroth J, Ellis SJ, Shoulars KS, Gaffney 

KL, Rock DL, Nelson WM.(2202). Use of a portable real-time reverse transcriptase-polymerase chain 

reaction assay for rapid detection of foot-and-mouth disease virus. J Am Vet Med Assoc. 220 (11), 1636-42. 

5. Reid SM, Grierson SS, Ferris NP, Hutchings GH, Alexandersen S. (2003). Evaluation of automated RT- 

PCR to accelerate the laboratory diagnosis of foot-and-mouth disease virus. J Virol Methods 107 (2),129-39. 

6. King DP, Ferris NP, Shaw AE, Reid SM, Hutchings GH, Giuffre AC, Robida JM, Callahan JD, Nelson WM, 

Beckham TR. 2006. Detection of foot-and-mouth disease virus: comparative diagnostic sensitivity of two 

independent real-time reverse transcription-polymerase chain reaction assays. J Vet Diagn Invest 18, 93-7 




A HIGHLY MULTIPLEXED RT-LATE-PCR ASSAY FOR DETECTION AND ANALYSIS OF SUBTYPES OF 

AVIAN INFLUENZA VIRUS 

C. Hartshorn, A.H. Reis, Jr., J.E. Rice, L.J. Wangh 

Brandeis University, Waltham, MA, USA 02254-9110 

(email: Wangh@brandeis.edu) 

Introduction: Pathogenic strains of avian influenza, particularly subtypes H5N1 and H7N1 continue to 

spread and evolve through out Eurasia and Africa, causing death and requiring culling of millions of birds. 

Several hundred people have died of avian influenza primarily following direct contact with infected livestock, 

but there is reason to fear that relatively few genetic changes could lead to efficient human-to-human 

transmission raising the specter of a devastating global pandemic. Rapid accurate detection of the presence 

and type of influenza is needed urgently, particularly in remote rural areas where people live in close 

proximity with their livestock. Using novel technologies developed in our laboratory at Brandeis University, 

we are constructing a highly multiplexed assay that can detect and distinguish between several subtypes of 

avian influenza and their strains in a single tube. This assay is designed to work on an advanced “pen side” 

sample preparation and PCR system which is being designed and built by Smiths Detection (see C.Volpe et 

al in this volume). 

Materials & Methods: Our multiplexed Avian Influenza assay utilizes Linear- 

After-the-Exponential (LATE)-PCR and PrimeSafe (For more information about these technologies see 

Wangh et al. in this volume.) In the proof-of-principle experiments described here we utilize viral RNA 

sequences transcribed in vitro from plasmid construct (GenScript Corporation ) using T7 RNA polymerase. 

Each of these RNAs, either alone or in a multiplex, is hybridized first to one of the LATE-PCR primers (the 

RT primer) and is then reverse transcribed at 55°C. The second LATE-PCR primer, together with one or 

more fluorescently tagged probes, is then added to the cDNA, along with a thermally stabile polymerase. In 

accord with the logic of LATE-PCR, exponential amplification of double-stranded DNA is carried out until 

each limiting primer is exhausted (phase I) and then is followed by ten or more cycles of linear amplification 

(phase II), during which the single-stranded amplicon for each target accumulates. It is possible to follow 

LATE-PCR amplification in real-time by measuring probe-target hybridization after the extension step of 

each thermal cycle (see Wangh et al. this volume). However, in the LATE-PCR Avian Influenza assay 

discussed here, no real-time product detection is performed. Instead, each single-stranded amplicon is 

detected at end-point by dropping to temperatures at which probe-target hybridization takes place and is 

measured. Each of the four fluorescent colors available on the instrument is used to detect two different 

targets using two different probes having different hybridization temperatures. 

Results: Multiplexed (RT)-LATE-PCR assays are highly versatile and inclusion of PrimeSafe suppresses 

mis-priming and primer-dimer formation among the pairs of primers. The four-color, double-temperature, 

Avian Influenza assay, that we are currently constructing, is comprised of 9 pairs of primers that reverse 

transcribe 9 RNA sequences and then generate 10 single-stranded amplicons which are detected using 10 

different fluorescent probes, all in a single closed-tube. (One pair of primers is used to amplify both RNA 

and an internal DNA control.) Depending on which virus is present this assay will generate independent 

positive signals for: 1) Avian Influenza – Subtypes: H5-LPA, H5-HPA, H7-LPA, H7-HPA, N1; 2) Newcastle 

Disease Virus (if Avian Influenza is absent). In addition, each sample will contain an internal control, to verify 

that PCR amplification has occurred and will be spiked with an additional control to verify that sample 

preparation has been successfully achieved. 

Discussion & Conclusions: Once this assay is fully implemented on the “pen side” instrument,, sample 

preparation, addition of all reagents and PCR will all be performed by the instrument and will require no 

manual actions by the operator. We estimate that the total elapsed time from sample-to-read out will be less 

than one hour. Finally, because of the nature of the LATE-PCR amplification process, each of the singlestranded 

amplicons generated in a multiplex reaction of the type described here can be used for Dilute-‘N’- 

Go dideoxy-sequencing which is both convenient and cost-effective (see Wangh et al. this volume). This is 

particularly important in the case of RNA viruses like Avian Influenza in which sequence changes occur 

readily and can significantly alter the infectivity and evolution of the virus. 

References: 

All of our publications on LATE-PCR are available at: http://www.brandeis.edu/projects/wanghlab/ 


ONE-STEP PRIMER-PROBE ENERGY TRANSFER (PRIPROET) REAL-TIME RT-PCR DETECTION 

OF SVDV USING ROTOR-GENE 6000 

M. Hakhverdyan 1 , T.B. Rasmussen 2 , Å. Uttenthal 2 , S. Belák 1 

1 Joint Research and Development Division, Departments of Virology, The National Veterinary Institute and the Swedish University of 

Agricultural Sciences, Uppsala, Sweden; 

2 National Veterinary Institute, Technical University of Denmark, Lindholm, Kalvehave, Denmark 

Introduction 

The aim of the present work was to develop a one-step real-time RT-PCR based on primer-probe energy 

transfer (PriProET) technology for sensitive and specific detection of swine vesicular disease virus (SVDV). 

The main importance of this exotic pig disease is that the clinical signs produced by the SVDV are 

indistinguishable from those caused by foot-and-mouth disease virus (FMDV) and vesicular stomatitis virus 

(VSV). Earlier, PriProET was successfully applied for the detection of FMDV, SVDV and VSV in two-step 

PCR protocol (1-4). 


Fifteen SVDV strains, FMDV O and C, VSV New Jersey and Indiana, human CV-B5 strain Faulkner used in 

this study were obtained from IAH (Pirbright, UK) and CISA-INIA (Valdeolmos, Madrid, Spain). The basic 

principle of the assay relies on fluorescence energy transfer between primer and probe. In the PriProET 

system, one of the two primers is labelled with a 5’-donor fluorophore (FAM) and the probe is labelled with a 

3’-reporter fluorophore (Texas Red or Cy5). During the PCR cycles, when the probe anneals to the extended 

fluorescent primer, energy transfers from the donor to the reporter due to their close proximity. The reporter 

emits fluorescence that is monitored and quantified. Directly following the amplification, a melting profile is 

generated for determination of specific probe melting peaks. 

Results 

Fifteen SVDV strains, eight of which had one or two mutations in the probe region, were successfully 

amplified resulting in positive amplification plots and specific melting peaks. The mutations in the probe 

region were reflected in the melting profile by a shift in observed melting peaks. In average, one mutation 

decreases probe Tm on 6 o C. Heterologous viruses like FMDV, VSV or human CV-B5 remained negative. 

Discussions and Conclusions 

The ability of PriProET to detect SVDV strains with mutations in the probe region makes it superior for 

analysis of unknown diagnostic specimens. For the PriProET system even a low efficient hybridising probe 

will bring the reporter fluorophore in proximity of the donor enabling release of reporter fluorescence. There 

is no competition with the stem-loop structure (as in molecular beacons) and there is no need for probe 

degradation to release fluorescence (as in TaqMan), which impairs detection of strains with mutations in the 

probe target region. In addition, the PriProET system gives a specific Tm for each SVDV strain, which can 

reveal mutations in the target. There is a chance to identify phylogenetically divergent strains of SVDV, 

which may appear negative in other probe-based real-time PCR assays. At the same time any difference in 

melting points may provide an indication of divergence in the probe region. The one-step SVDV PriProET 

assay may improve the early and rapid detection of viral nucleic acids of a wide range of SVDV strains, 

allowing reduced turnaround time and use of high-throughput, automated technology. 


We thank Dr. Donald King, Dr. Scott Reid (IAH, Pirbright, UK), Dr. Montserrat Agüero, Dr. Jovita Fernandez 

(CISA-INIA, Valdeolmos, Madrid, Spain) for providing us material. This study was supported by the EU 

projects QLK2-CT-2000-00486 (Multiplex PCR) and SSPE-CT-2004-513 645 (LAB-ON-SITE). 

References 

1. Hakhverdyan M, Rasmussen TB, Thorén P, Uttenthal Å, Belák S (2006). Development of a real-time 

PCR assay based on Primer-Probe Energy Transfer for the detection of swine vesicular disease virus. 

Arch Virol 151: 2365-2376. 

2. Rasmussen TB, Uttenthal A, de Stricker K, Belak S, Storgaard T (2003). Development of a novel 

quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of foot-and-mouth 

disease virus. Arch Virol 148: 2005-2021. 

3. Rasmussen TB, Uttenthal A, Fernandez J, Storgaard T (2005). Quantitative multiplex assay for 

simultaneous detection and identification of Indiana and New Jersey serotypes of vesicular stomatitis 

virus. J Clin Microbiol 43: 356-362. 

4. Rasmussen TB, Uttenthal A, Agüero M (2006). Detection of three porcine vesicular viruses using 

multiplex real-time primer-probe energy transfer. J Virol Methods 134, 176-182. 




DEVELOPMENT AND VALIDATION OF A REAL TIME RT-PCR ASSAY FOR THE SIMULTANEOUS 

DETECTION OF AVIAN INFLUENZA VIRUSES BELONGING TO THE H5, H7 AND H9 SUBTYPES 

Monne I., Salviato A., Ormelli S., De Battisti C., Salomoni A., Drago A., Zecchin B., Bertoli E., 

Capua I, Cattoli G. 





Introduction 

Influenza A viruses are responsible for avian influenza, a disease of great importance for animal health and 

sometimes also for human health. Several subtypes of AI have been identified basing on antigenic 

differences between the two surface glycoproteins HA and NA (1). Among the different HA subtypes, the H5, 

H7 and H9 strains are of great interest for the scientific community because of serious consequences for the 

poultry industry and the increasing frequency of direct transmission of these viruses to humans. In certain 

areas of the world, these subtypes are co-circulating in domestic birds and in order to manage this situation 

appropriately an adequate and rapid diagnostic tool is necessary. Here we report the development and 

validation of a one step reverse transcription real time PCR (RRT-PCR) assay to detect simultaneously the 

H5, H7 and H9 subtypes of AIVs. 


A one step real time PCR was developed using fluorogenic hydrolysis-probes to detect the H5, H7 and H9 

subtypes of AI from clinical samples. Multiple alignments of previous and recent H5, H7 and H9 HA 

sequences were performed to design primers and probes minimizing mismatches. 

The specificity of the primer-probe sets was examined with RNA and DNA extracted from a diverse array of 

viral and bacterial avian pathogens. The sensitivity were tested using in vitro-transcribed RNA and ten-fold 

serial dilutions of titrated avian influenza viruses. Intra and inter-assay variability of the method were 

assessed. The test was also validated on clinical samples of avian origin. 

Results 

The protocol allows a rapid (less than 2 hrs) determination of the three AI subtypes. The H5, H7 and H9 

primer and probe sets were able to detect the nucleic acids only of isolates of their respective subtypes. High 

sensitivity levels were obtained, with limits of detection ranging from 10 2 to 10 4 RNA copies. Excellent results 

were achieved in the intra- and inter-assay variability tests. The coefficient of variation intra-assay and 

interassay resulted < to 2,64% and < to 7,22% respectively. Results derived from the test validation on 

clinical samples were in agreement with the gold standard applied (virus isolation). 

Discussion and Conclusion 

Conventional avian influenza diagnostic tools are time consuming and require facilities (e.g. BSL3) not easily 

available in many affected areas. The molecular tests for diagnosis of AI are commonly applied for type A 

influenza viruses. However, the only Real Time PCR detection assay published for H7 subtype has been 

validated only on strains belonging to the AI American lineage, and probes are currently not available for the 

identification of H9 subtypes. 

The high sensitivity, specificity and reproducibility of the H5, H7 and H9 RRT-PCR assay together with its 

rapidity indicate that this method is suitable as a routine laboratory test for rapid detection and differentiation 

of three prevalent avian influenza virus subtypes in samples of avian origin. 

To date, this is the first real time PCR protocol available for the simultaneous detection of AI viruses 

belonging to H5, H7 and H9 subtypes. 

References 

1. Fouchier RA, Munster V, Wallensten A, et al. (2005). Characterization of a novel influenza A virus 

hemaglutinin subtype (H16) obtained from blackheaded gulls. J Virol; 79: 2814-2822. 


AN EVALUATION OF COMMERCIALLY AVAILABLE NUCLEIC ACID EXTRACTION METHODS FOR 

THE PROCESSING AND SUBSEQUENT qPCR ANALYSIS OF SAMPLES INFECTED WITH AVIAN 

INFLUENZA VIRUS. 

John R. White 1* , Glen R. Hewitson 2 , Tyrone S. McDonald 3 , Eric Hansson 1 , Hans-G Heine 1 , Adam J. Foord 1 and Ibrahim S. Diallo 2 . 

Introduction 

1 Australian Animal Health Laboratory, CSIRO, Division of Livestock Industries, P.O. Bag 24, Geelong, VIC. 

2 Animal Research Institute, Queensland Dept. Primary Industry and Fisheries, Locked Bag 4, Moorooka, 

QLD. 

3 School of Life and Enviromental Sciences , Faculty of Science and Technology, Deakin University, Pigdon’s 

Rd., Waurn Ponds, Geelong, VIC. 

The Australian Animal Health Laboratory (AAHL) is responsible for the ongoing monitoring of the exotic 

disease-free status of endemic animal populations via regular submission of field samples and in cooperation 

with relevant State Departments, specifically targeted field surveillance programs. At AAHL, the 

quantitative (real-time) polymerase chain reaction (qPCR) is usually one of the first methods of choice for 

rapid infectious agent identification. To accommodate the large daily sample numbers expected during an 

outbreak and an ongoing surveillance phase, we need to have proven sample processing protocols in place 

that will minimise ‘bottlenecks’ prior to final qPCR analysis. In collaboration with the Animal Research 

Institute (Queensland Department of Primary Industry and Fisheries) we have therefore undertaken a study 

of a number of commercially available methods for the extraction of viral RNA from field and laboratoryderived 

samples known, or suspected to be, infected with strains of avian influenza virus. The efficiency and 

sensitivity of each method was assessed by the ultimate detection of viral genomic material in an appropriate 

qPCR reaction 1 . In addition to overall extraction efficiency, each method was also assessed for ease of use, 

extent of operator exposure to material, suitability for adaptation to a high throughput requirement and 

applicability for adoption in regional laboratory settings. 


Original animal swab material was suspended in collection medium (0.01M Phosphate-buffered saline, 1% 

foetal calf serum, 0.1 % glucose and 0.1 % (v/v) phenol red and/or inoculated into embryonated eggs. 

Between 10 -100 ul of subsequently inactivated allantoic fluid or swab suspension was then used for 

influenza virus RNA extraction. A small number of various tissue types from experimentally infected ducks 

were also used for extraction. The column matrix based RNeasy Kit (Qiagen) and the magnetic bead based 

MagMax Kit (Ambion - Applied Biosystems) were used to extract viral RNA according to the manufacturer’s 

instructions. The thermostable protease based nucleic acid extraction system from Zygem (New Zealand) 

(PrepGEM) was used basically according to manufacturer’s instructions but with minor modifications. 

Extracted RNA derived from each kit was then used as the template in a previously described Taqman© 

assay 1 for the detection of influenza virus type A matrix protein-specific RNA. This assay was analysed on an 

Applied Biosystems 7500 System using a threshold setting of 0.05 units. 

Results 

All three nucleic acid extraction methods produced acceptable and generally similar Ct values (within 1-2 Ct 

units) for specific samples. However, after considering all the data obtained, the MagMax Kit appeared 

potentially the most sensitive method and the PrepGEM Kit was marginally the least sensitive. 


All three extraction kits are reliable for the isolation of influenza virus RNA. The MagMax and PrepGEM Kits 

are the most appropriate for application to automated high throughput systems. The PrepGEM Kit is the 

simplest and most rapid procedure and involves least exposure of reaction material during the extraction 

process. There is potential for the sensitivity of the PrepGEM Kit to be further optimised. 

References 

1 Heine HG, Trinidad L, Selleck PW, Lowther S. (2007). Avian Diseases. 51: 370-372. 




HIGH THROUGHPUT ISOLATION AND DETECTION OF NORTH AMERICAN AND EUROPEAN 

PORCINE REPRODUCTIVE AND RESPIRATORY VIRUS BY QRT-PCR 

A. M. Burrell 1* , W. Xu 1 , Q. Hoang 1 , R. C. Willis 1 , R. Shah, M. Bounpheng 1 , and X. Fang 1 

PRRSV, an RNA virus, order Nidovirales of the Arteriviridae family, is one of the most costly infectious 

diseases for swine producers. Two main antigenic subtypes of PRRSV exist: North American strain (ATCC 

VR-2332) and European strain (Lelystad strain). Infected animals present with reproductive difficulties, and 

respiratory disease often associated with secondary infections. 

We have developed an integrated workflow consisting of high throughput nucleic acid purification, and qRT- 

PCR for concurrent detection of North American and European PRRSV. Using an Ambion ® MagMAX TM high 

throughput magnetic bead-based viral RNA isolation method, RNA can be isolated from diverse sample 

matrices. Purified nucleic acid is analyzed with the Ambion AgPath-ID NA/EU PRRSV Reagent Kit, which 

can detect North American and European strains of PRRSV, allowing subtyping. As few as 50 copies of 

PRRSV RNA are consistently detected using this assay. An internal control RNA, XenoRNA, is provided to 

monitor nucleic acid purification efficiency, and to detect PCR inhibitors. It ensures that false negative results 

are minimized, if not eliminated. 

Assay performance was evaluated using >100 field samples of known PRRSV status. RNA was isolated 

from swine serum, tonsil, and lung tissues and the purified RNA underwent qRT-PCR using the AgPath-ID 

qRT-PCR Kit. Results showed 98% concordance with secondary laboratory PCR results. Furthermore, 

subtyping of North American and European strains were 100% concordant demonstrating that this 

method provides an economical and rapid solution for PRRSV detection and identification. 

For research use only, not for use in diagnostic procedures. Not licensed by the USDA. 

1 Applied Biosystems, Austin, TX 

* Angela M. Burrell, Applied Biosystems, 

2130 Woodward Street, Austin, Texas 78744 

Ph: (512) 651-0200, Fax: (512) 651-0201, E-mail: angela.burrell@appliedbiosystems.com 


CSFV DIVA ASSAY: POTENTIAL APPLICATION OF A ROBUST MULTIPLEX REAL-TIME RT-PCR IN 

WILD BOAR VACCINATION AND CONTROL 

L. Liu a , B. Hoffmann b , F. Widén a , C. Baule a , M. Beer b , S. Belák a 

a Joint R&D Division in Virology, The National Veterinary Institute & The Swedish University of Agricultural Sciences, SE-751 89 

Uppsala, Sweden. b Friedrich-Loeffler-Institute Federal Research Institute for Animal Health, Boddenblick 5a, D-17493 Greifswald - Insel 

Riems, Germany 

Introduction: 

CSF is a highly contagious and devastating viral disease affecting both domestic pigs and wild boars. In 

Europe, the virus is largely maintained in wild boar reservoir and is reintroduced to domestic pigs by contacts 

between domestic and free-living species. About 80% of the first outbreaks of CSF have occurred in regions 

where CSF in wild boar is endemic. Within the EU project “CSFV Vaccine & Wild Boar”, a chimeric marker 

vaccine CP7_E2alf has been developed and evaluated for application in wild boar 1 . The aims of this study is 

development of a multiplex real-time RT-PCR assay for detection and differentiation of wild type CSFV from 

the marker vaccine CP7_E2alf, and to highlight its potential application in CSFV vaccination and control in 

wild boar. 

Methods: 

Multiplex DIVA assay includes two sets of primers and probes, one for the marker vaccine CP7_E2alf (CP7 

assay) with TexasRed as reporter dye and another for wild type CSFV (CSF assay) with 6’-FAM as reporter 

dye. The reaction was carried out with QuantiTect Probe RT-PCR kit. 

Results: 

The performance of DIVA assay was highly specific, with either CP7- or CSFV-specific amplification out of a 

total of 35 related pestiviruses (including vaccine virus). The DIVA assay had same sensitivity as single 

assays, with excellent reaction efficiencies (close to 100%) and good linearity. 

Conclusions: 

The robust multiplex DIVA assay was developed with excellent performance. With this high throughput 

diagnostic tool to differentiate infected from vaccinated animals, its potential application will be effect control 

of CSF in wild boar population in European countries. 

References: 

1. Koenig P, Lange E, Reimann I, Beer M. CP7_E2alf: a safe and efficient marker vaccine strain for oral 

immunisation of wild boar against Classical swine fever virus (CSFV). Vaccine. 2007 Apr 30;25(17):3391-9. 

2: Hoffmann B, Beer M, Schelp C, Schirrmeier H, Depner K. Validation of a real-time RT-PCR assay for 

sensitive and specific detection of classical swine fever. J Virol Methods. 2005 Dec;130(1-2):36-44. 




A REAL-TIME RT-PCR (RRT-PCR) WITH INTERNAL CONTROL TO DETECT PERSISTENT BVD VIRUS 

(BVDV) INFECTION IN POOLED EAR NOTCH SAMPLES 

A. G. Wise, P. Wu, J. Harmala, C. Benson, J. Heissler, L. Stolle and R. K. Maes x 

Persistently infected (PI) cattle are the main source of spread of BVDV. In the US, ear notches are the most 

common diagnostic sample. Assay formats include IHC, antigen capture ELISA (ACE), and RT-PCR on 

pooled PBS extracts. Our aim was to develop and validate a Taqman-based rRT-PCR with internal control to 

detect PI animals. 

Primers and probe were designed from conserved sequences within the 5’ UTR. The detection limit was 0.8 

TCID50. Dynamic range was determined with a panel provided by Dr. Ridpath. Initial testing of RNA from 

individual PBS extracts of 42 known positive samples yielded only 38 positives. In contrast, all RNA samples 

from tissue pools made by mixing each of the same 42 positive samples with 9 known negative samples, 

tested positive by rRT-PCR. Subsequently, 2,570 ear notch samples were analyzed by rRT-PCR (257 pools) 

and individually by ACE. Twenty-one pools were positive and were subsequently found to contain at least 

one positive sample by ACE. All individual samples in the 236 negative pools tested negative by ACE. 

Our current preference is for testing of pooled ear notch tissue pieces rather than pooled PBS extracts. An 

internal control in the rRT-PCR assay is essential to detect assay inhibition, resulting in false negatives. 

DCPAH- MSU, 4125 Beaumont Road, Lansing, MI 48910, USA. 


RAPID DETECTION OF CLASSICAL SWINE FEVER VIRUS IN PORK PRODUCTS BY A REAL-TIME 

RT-PCR ASSAY 

Songhua Shan 1 *,Yi Xia 2 , Zhongrong Huang 1 , Yi Zhou 2 , Chungyang Li 1 

1 Shanghai Entry-Exit Inspection and Quarantine Bureau, Shanghai, China; * Murdoch University, Australia; 2 Shanghai Fosun Med-Tech 

Development Co., Ltd, Shanghai,China 

Introduction 

Although some countries have successfully eradicated classical swine fever virus (CSFV), outbreaks still 

continue to occur throughout the world. CSFV-contaminated swine products have become the main risk 

factor for the introduction of CSFV into CSF-free countries (1, 2). Real-time PCR has been increasingly used 

for the diagnosis, quantitative and qualitative measurement of a broad range of animal pathogens, which has 

attractive advantages over RT-PCR (3, 4, 5). However, there are limited reports on CSFV detection in 

musculature or meat products by RT-PCR, although there are some promising reports about detection of 

other viruses in meat (2). The aim of the present study was to develop a CSFV-specific real-time RT-PCR 

and evaluate its suitability for the detection of small amounts of CSFV in swine products. 


CSFV Thiveral strain (T strain), bovine diarrhoea virus (BVDV) Oregon C24V strain and PK-15 cells were 

provided by National Control Institute of Veterinary Bioproducts and Pharmaceuticals, China. CSFV lapinized 

Chinese virus (C strain), BVDV Singler, Drapper, NADL and NY-1 strains were donated by Nanjing 

Agricultural University. Other reference isolates including PPV, PRCV, TGEV, PRV, and PRRSV were from 

the Shanghai Entry-Exit Inspection and Quarantine Bureau, China. Primers and FAM-labeled Taqmanprobes 

specific for CSFV were designed using Primer Express 1.0 software based on the consensus 

sequence of the 5’ non-translated region of available CSFV nucleotide sequences. Parameters (the ratio of 

primer/probe, reverse transcriptase/Taq polymerase, the concentration of Mg 2+ , dNTPs, annealing 

temperature and PCR cycle) of real-time RT-PCR were optimized using CSFV T strain. In total, 211 samples 

from clinically suspected cases, imported pigs and porcine products were simultaneously tested by real-time 

RT-PCR and CSFV-specific antigen-capture ELISA (IDEXX kit). 

Results 

The one-step real-time RT-PCR showed 100% specificity against CSFV, other pestiviruses, porcine viruses 

and cell cultures. The PCR product of T strain was sequenced, and showed the expected sequence. The 

detection limit of the real-time RT-PCR is 1 TCID50/mL. Serial 10-fold dilutions of virus stock tested by realtime 

RT-PCR on LightCycler, SLAN, PE5700, iCycler, PE7000 and PE7700 present similar results. A 

comparison of three RNA extraction kits from Roche, Invitrogen and Shanghai Fosun Med-Tech 

Development Co., Ltd. showed similar results. 75 visceral organs from CSFV suspect infected pigs and 132 

imported swine products were tested by real-time RT-PCR and ELISA. The results demonstrated that realtime 

RT-PCR is more sensitive than ELISA, showing significant difference (P



DETECTION AND DIFFERENTIATION OF AVIAN INFLUENZA AND NEWCASTLE DISEASE VIRUS 

DIRECTLY FROM POULTRY SPECIMENS BY MULTIPLEX RT-PCR 

Songhua Shan A* , Weirong Jing B , Min Wang B , Caozhe Xu A , Hongyou Qin B , Qi Tao A and Jinping Liu A 

A Shanghai Entry-Exit Inspection and Quarantine Bureau, Shanghai, China; 

*Murdoch University, Australia; B Shanghai Huaguan Biochip Company, Shanghai, China 

Introduction 

Avian Influenza (AI) and Newcastle Disease (ND) are the most devastating infectious diseases in poultry 

industry. Confirmatory diagnosis of AI and ND depends on the isolation of the virus (1). RT-PCR has 

currently been applied in rapid detection and identification of AI and ND (1). Because AIV and NDV share 

many similar characteristics, it was considered appropriate to develop an multiplex RT-PCR (mRT-PCR) for 

both AI and ND. However, reports on mRT-PCR for detection of AIV and NDV are limited (2, 3). In this study, 

an mRT-PCR capable of simultaneously detection of AIV and NDV is described, focusing on the detection of 

AIV and NDV from tissue and organ samples, swabs and poultry products. 


NDV (F48E9, Mukteswar, N79 isolates), A/chicken/HK/1000/97(H5N1), A/Chicken/HK/216.3/01 (H6N?), 

A/chicken/HK/230.2/01 (H9N?), A/Shanghai/29/78(H1N1), A/Shanghai/49/78(H3N2), Duck hepatitis virus 

(DHV) and Duck plague virus (DPV) used were from Shanghai Entry-Exit Inspection and Quarantine Bureau, 

China. Eighty isolates with haemagglutinating activity were collected and identified as AIV or NDV by HI. 

Other avian pathogens including IBV, ARV, IBDV, MDV, EDSV, chicken coccidiosis and Infectious Coryza 

were from different commercial vaccines. 

The primers were designed from the nucleocapsid protein (NP) gene of AIV and the fusion protein (F) gene 

of NDV to amplify products of 502bp and 421bp, respectively. Parameters (concentration of primer, Mg2+, 

dNTPs and Taq DNA Polymerase, PCR cycle, annealing temperature) of the single-virus RT-PCR ( sRT- 

PCR) were optimized by checkerboard titration. mRT-PCR procedures were determined by balancing 

different parameters based on the result of sRT-PCR. 

Results 

The ratio of 1 to 1.25 of NDV vesus AIV primers and the annealing temperature (55�) suitable for bigger 

fragment amplification(AIV) was chosen for the mRT-PCR. In addition to testing different avian pathogens, 

the PCR products of nine AIV and ten NDV isolates were sequenced to further confirm the specificity of 

mRT-PCR. The detection limit of AIV and NDV by mRT-PCR were respectively 10 3.5 EID50 and 10 4.75 EID50, 

being the same sensitivity as sRT-PCR for AI and 100 fold decrease for ND compared to sRT-PCR. Thirtynine 

AIV consisting of H1, H5, H9 subtype and 41 NDV of different origins (chicken, duck, goose, ostrich, 

pigeon and peacock) were compared by multiplex RT-PCR and typing by HI, showing 100%(80/80) 

agreement. Tissue and visceral organ samples from the chickens experimentally infected with AIV or NDV 

were tested by mRT-PCR and virus isolation(VI), showing 93.8%(30/32 ) agreement for AIV and 95.2% 

(20/21 ) for NDV. Additionally, 35 samples from imported poultry products and 32 cloacal swabs from 

Chinese domestic markets were tested by mRT-PCR and VI , and showed 100% (67/67) agreement for AIV 

and 97.1%(65/67) agreement for NDV. These data showed that VI is more sensitive than mRT-PCR. 


Due to the primer design based on the conserved sequence of AIV NP gene and NDV F gene, different 

subtype AIVs and NDVs tested could all be detected. mRT-PCR was able to simultaneously detect and 

differentiate AIV and NDV in one day and showed the good correlation (97.1%) with VI. Although real-time 

PCR(4) and NASBA(5) have recently been developed to reduce the time and increase specificity and 

sensitivity, these instruments are very expensive. Thus, the mRT-PCR described here provides a rapid, costeffective 

way for simultaneous detection of AI and ND. 

A single-tube mRT-PCR for simultaneous detection of APV, AIV, and NDV was reported to show similar 

detection limits to sRT-PCR(2). In our study, although mRT-PCR for AI has the same sensitivity as sRT- 

PCR, the detection limit decrease for NDV was 100 fold less than that by sRT-PCR. The reasons may be 

formed primer-dimers, competition for dNTP, Taq DNA polymerase in a PCR tube. 

References 

1. Office International des Epizooties: Highly pathogenic avian influenza, Newcastle Disease. In: Manual of standard for diagnostic tests 

and vaccines, 4th ed. Office International des Epizooties, Paris, France. http://www.oie.int.20005. 

2. Malik Y.S., D.P. Patnayak, and S.M. Goyal. Detection of three avain respiratory viruses by single-tube multiplex reverse 

transcription-polymerase chain reaction assay. J Vet Diagn Invest. 16(3): 244-248. 2004. 

3. Farkas T, M. Antal, L.Sami, P. German, S. Kecskemeti, G, Kardos, S. Belak, I. Kiss. Rapid and simultaneous detection of avian 

influenza and newcastle disease viruses by duplex polymerase chain reaction assay. Zoonoses Public Health. 54(1):38-43. 2007. 

4. Spackman E., D.A. Senne, L.L. Bulaga, S. Trock, and D.L. Suarez. Development of multiplex real-time RT-PCR as a diagnostic tool 

for avian influenza. Avian Dis. 47(3 Suppl):1087-1090. 2003. 

5. Shan S.H., L.S. Ko, R.A. Collins, Z.L.Wu , J.H. Chen, K.Y. Chan, J. Xing, L.T. Lau, and A.C.H.Yu. Comparison of different methods 

for avian influenza subtype H5N1 detection. Biochem.Biophy. Res. Commun. 302: 377�383. 2003. 


SAMPLE PREPARATION METHODS FOR HIGH QUALITY NUCLEIC ACID ISOLATION FROM A 

VARIETY OF VETERINARY SAMPLES 

S. Ullmann 1 , D. Herold 1 , R. Hodgson 2 , R. Soeller, 3 S. Cramer 3 

1 QIAGEN GmbH, Hilden, Germany; 2 QIAGEN Pty Ltd, Doncaster, Vic, Australia; 

3 QIAGEN Hamburg GmbH, Hamburg, Germany 

Introduction 

Effective and reproducible isolation and purification of nucleic acids is one of the key success factors for 

amplification and detection of pathogenic nucleic acids using molecular methods. Diagnostic tests using 

PCR (e.g., for Johne’s disease in cattle) are replacing traditional ELISA or culture based methods due to 

higher sensitivity and speed. 

An easy and standardized method for nucleic acid isolation that gives high-quality nucleic acids is required. 

The major challenge when working with such diverse material is to develop optimized pretreatments for all 

sample types. Dependent on sample type, content of inhibitors, and content of nucleic acids, the samples 

demand different pretreatment conditions such as mechanical disruption, enzymatic digestion, and 

incubation times. 


Sample sources include various animal organ tissues, fresh and dried pig ears, horse hair, ruminant feces 

and ticks. Nucleic acid purification used either manual or automated sample preparation protocols. Manual 

preparation comprises different methods depending on the starting material (e.g., DNeasy ® Blood & Tissue 

Kit, QIAamp ® DNA Stool Mini Kit). For automated sample preparation, the low-throughput QIAGEN ® 

BioSprint 15 and BioRobot ® EZ1 systems were used. 

Results 

DNA isolation from a variety of different samples and animals was successful, and a range of typical DNA 

yield depending on the starting material will be presented. Quality of the isolated DNA is shown by gel 

electrophoresis, enzymatic digestion, and standard as well as real-time PCR as downstream applications. 

All types of pig ear samples, including frozen, lyophilized, and dried tissue, gave good yields and were 

successfully used in PCR analysis. Real-time PCR data for detection of M. paratuberculosis DNA isolated 

from ruminant feces have been performed with no observed PCR inhibition. Detection of Borrelia DNA with 

the artus ® Borrelia LC PCR Kit subsequent to a DNA isolation from ticks has shown a high sensitivity: the 

lowest positive curve in the real-time PCR corresponded to 5 copies. 

DNeasy Blood & Tissue Kit, BioSprint 15, BioRobot EZ1, artus Borrelia LC PCR Kit: For Research Use Only. 

Not for use in diagnostics procedures. No claim or representation is intended to provide information for the 

diagnosis, prevention, or treatment of a disease. The QIAamp DNA Stool Mini Kit is intended for general 

laboratory use. No claim or representation is intended to provide information for the diagnosis, prevention, or 

treatment of a disease. 


Purification, downstream analysis and archiving of high quality nucleic acid from various animal samples are 

now a standard requirement for many diagnostic tests in Veterinary pathology. Various sample types, 

matched with an appropriate extraction protocol, can be processed using manual or automated procedures 

to fit workflow throughput needs. For optimum performance and comparison of test results the key 

parameters to maximise in purified nucleic acid preparations are; quality, integrity, yield, reproducibility and 

standardization. 




EVALUATION OF REAL-TIME PCR BASED ASSAYS FOR THE DETECTION AND QUANTITATION OF 

DIFFERENT DISEASES IN ANIMALS 

Introduction 

T. Laue 1 , H. Marquardt 1 , S. Gauch 2 , S. Schlemm 2 , R. Hodgson, 3* P. Wakeley 4 and S. Ullmann 2 

1 QIAGEN Hamburg GmbH, Hamburg, Germany; 2 QIAGEN GmbH, Hilden, Germany; 

3 QIAGEN Pty Ltd, Doncaster, Vic, Australia; 4 Veterinary Laboratories Agency, Weybridge, United Kingdom 

In 2006 QIAGEN acquired a license to commercialize a portfolio of selected PCR-based, veterinary 

molecular test (assays) developed by the Veterinary Laboratories Agency (UK). The initial portfolio consists 

of different PCR-based assays for infectious veterinary diseases affecting wildlife and farmed livestock. 

These assays were designed at the VLA and will be available from QIAGEN as a “complete solution” 

including recommendations for nucleic acid preparation plus optimized kits and protocols for multiplex and 

real-time PCR. 


The assays will be validated by the VLA using manual and/or automated technologies for DNA and RNA 

extraction from different samples. 

Results 

This poster presents data for analytical sensitivity and specificity and diagnostic specificity and sensitivity. 


This presentation describes the cooperation between the two partners and shows the procedure of 

development and validation of the veterinary assays using the example of the specific assay for detection of 

Bovine Viral Diarrhoea Virus, an infectious disease causing infertility, abortion, and congenital defects in 

calves. 


Introduction: 

ADVANCES IN FLUORESCENCE POLARIZATION FOR DIAGNOSIS 

OF BOVINE BRUCELLOSIS IN MILK 

Samartino L., Conde, S., Schust, M., Piazza, E., Salustio, E. 

Instituto de Patobiología, CICVyA INTA 

Las Cabañas y Los Reseros, 1712, Villa Udaondo, Castelar, Buenos Aires, Argentina. 

luersa00yahoo.com.ar 

Bovine brucellosis is still an important health problem in Argentina and other countries of Latin America. The 

milk ring test is the mandatory screening test used for surveillance 4 times a year in most of these countries. 

Argentina recently also adopted the indirect enzyme-immunosorbent assay (IELISA) which is more precise 

but far more expensive. Fluorescence polarization immunoassays (FPA) were introduced in the 90s for 

serological diagnosis of brucellosis in cattle. This test is based on measuring the polarization of light caused 

by changes in molecular size as a result of antigen-antibody reactions. The test is simple to perform, gives 

rapid results, and reduces the errors that can occur when reading the conventional agglutination tests. In 

addition, FPA is adaptable to field implementation. We understand that this test could be also applied for milk 

studies. 

Objective: 

To evaluate the Fluorescence Polarization Assay (FPA) for diagnosis of bovine brucellosis in milk. 

Methods: Test samples: Milk from 252 pools ( Holstein cows) was obtained from different farms from 

samples taken for routine surveillance testing. 

Tests performed: 

The milk ring test (MRT), the routine test for surveillance in dairy cattle in Argentina, was performed 

according to the current international proceedings. The IELISA was also used. Cut off for the IELISA has 

been established previously as 23% positive (pool). FPA was done following the instruction of the 

commercial kit (Prionics) and adapted for milk. FPA was applied to stored whole milk and to milk sera using 

a portable Diachemix Sentry 100 polarization analyzer instrument (single tube reader). 

Results: 

The following results were observed: 71.8% were positive for MRT, 82.1% were positive for IELISA and 

15.1% and 71.0% of whole milk and milk sera, respectively, were positive for FPA. 

Conclusions: 

FPA results, using milk sera, agreed with MRT results, while the results obtained when whole milk was used 

were very poor. IELISA seems to have more sensitivity that the other tests. However, based in this 

preliminary study, we conclude that FPA gave results comparable to MRT and is a promising technique for 

the diagnosis of bovine brucellosis in milk. Current studies are targeted toward improving the sensibility of 

the test. 

References 

Samartino, L., Gregoret, R., Gall, D., Nielsen, K. Fluorescence polarization assay: Application to the diagnosis of 

bovina brucellosis in Argentina. J. Of Immunassay, 20 (3), 115-126. 1999. 

Nielsen, K., Smith, D., Gall, D., Perez, B., Samartino, L., Nicoletti, P., Dajer, A., Rojas, X., Nelly, W. Validation of 

the fluorescence polarization assay for detection of milk antibody to Brucella abortus. J. Immunoassay 22: 203- 

211. 2001. 

Gall, D, Nielsen, K., Bermudez, R., Moreno, F., Smith, P. Fluorescence Polarization Assay for Detection of 

Brucella abortus. Clin. Diag. Lab. Immuno. 1356-1360. 2002. 




EFFECTS OF DIFFERENT POPULATIONS ON AN ASSESSMENT OF THE 

SENSITIVITY AND SPECIFICITY OF AN ANTIGEN ELISA FOR BVDV. 

J Zhang* 1 , L Brown 1 , A Elliott 1 , S Fell 1 and PD Kirkland 1 


Introduction 

Enzyme linked immunosorbent assays (ELISAs) to detect antigens of bovine viral diarrhoea virus (BVDV), 

the so called pestivirus antigen capture ELISA (PACE), have made a major contribution to improved 

diagnosis of BVDV infection over the last decade. Assays are typically used to detect BVDV antigens in 

lymphoid or epithelial cells in blood and tissues such as spleen, lymph nodes and lung. In recent years, a 

modified assay with high sensitivity has been used to test skin samples and is in widespread use in many 

countries but has not been fully validated for use in Australia, where there is a different population of viruses 

to those found in the USA and Europe. During the evaluation of a new assay, it is important to have a good 

understanding of the epidemiology and pathogenesis of the disease under investigation, as well as to have 

samples from animals of known disease status. The status of the test samples can be established by 

selecting animals from herds known to be free of the test agent (for the determination of assay specificity) 

and to have animals or samples that have tested positive by a “gold standard” (assessment of assay 

sensitivity). This study involves the evaluation of a commercial ELISA kit that is used for the detection of 

BVDV antigens in skin samples in 2 different animal populations. The results illustrate the importance of 

knowledge of the disease and performance of the assays being used to ensure the correct assessment of 

assay sensitivity and specificity. 


Whole, heparin treated blood and skin biopsy samples were collected from more than 1200 cattle. Plasma 

and white blood cell (‘buffy coat’) fractions were separated for testing. Skin samples were transported to the 

laboratory in a liquid sample buffer. The buffer from the skin samples and detergent extracts of buffy coat 

samples were tested in separate antigen ELISAs designed to detect BVDV antigens in white cell 

preparations or skin extracts. Plasma samples were used for virus isolation in cell culture, PCR and serology 

by VNT and AGID. Any animal that gave a positive result in an antigen ELISA was resampled after 4-8 

weeks. Virus isolation was conducted by inoculating pre-confluent monolayers of secondary bovine testis 

cells while the real time PCR was based on a previously published method 1 . 

Results 

Compared to virus isolation, both ELISAs had a sensitivity of >99%. However, depending on the cattle 

population, the diagnostic specificity of the ELISA varied from 81% to >99% for skin samples. In a large dairy 

herd, where the youngest BVDV infected animal was 2 years old, there was complete agreement between 

virus isolation and both of the antigen ELISAs. Each of the BVDV infected animals was seronegative, 

remained positive in both tests when resampled and did not seroconvert. In this population, with only 9 

persistently infected (PI) animals, the relative sensitivity and specificity of the PACE for testing of skin 

samples were both 100%. However, in a large population of approximately 1500 beef cattle, 247 calves were 

tested and 172 reactors were detected when extracts of skin samples were tested. These positive samples 

were all collected from calves that were approximately 5-6 months old. In contrast only 139 of these samples 

were positive by virus isolation and by the PACE with buffy coat samples. Of the 172 animals that gave 

positive or inconclusive reactions with skin samples, 32 were seropositive at the time of first sampling. When 

these animals were re-sampled, only 139 gave positive ELISA results and on both skin and buffy coat 

samples. All of the animals that had previously reacted in the ELISA with skin samples were now 

seropositive. In this herd, if the assay performance characteristics were calculated from the results of the first 

test, the diagnostic specificity relative to virus isolation was only 81%. However, the specificity for the test on 

the later extracts of skin samples was 100%. Throughout the study, the sensitivity and specificity of the 

ELISA remained high (approaching 100%) at all times when buffy coat extracts were tested. 


When testing for the detection of BVDV infected animals, the main purpose is to detect PI animals as these 

are the reservoirs of the virus in a population. While testing of skin samples has the advantage of high 

analytical sensitivity, care must be exercised to ensure that reactors are not acute, transiently infected 

animals. To overcome this problem and avoid unnecessary culling, all reactors must be retested. The results 

obtained in these herds amply demonstrate the need to have a thorough understanding of the disease and to 

be able to apply appropriate supplementary tests when determining assay performance characteristics. 


COMPARISON OF SEROLOGIC TECHNIQUES: MAT AND ELISA, WITH BACTERIOLOGIC METHODS: 

DFM EXAMINATION, IFAT, MICROBIOLOGIC CULTURAL ISOLATION AND PCR FOR DIAGNOSIS OF 

BOVINE LEPTOSPIROSIS IN IRAN 

Ehsanollah Sakhaee* Gholamreza Abdollahpour, Mahmoud Blourchi, Abdolmohammade Hasani Tabatabayi, Mohammad reza Mokhber 

Dezfouli, Rahim Haji Hajikolayi, Afshin Raoofi, Saeed Sattari 

Leptospirosis is a worldwide zoonosis caused by Leptospira interrogans. This study was conducted to 

evaluate serologic and bacteriologic findings of leptospirosis in clinically suspected cows. Three hundred and 

eighty sera and thirty three urine samples were collected from 6 industrial dairy farms in Tehran suburb, from 

December (2004) to June (2005). The prevalence of disease was determined by microscopic agglutination 

test (MAT), enzyme linked immunosorbent assay (ELISA), direct dark-field microscopic (DFM) examination, 

indirect fluorescent antibody test (IFAT), microbiologic cultural isolation technique and polymerase chain 

reaction (PCR). Antibodies were detected by MAT at least against one serovar of Leptospira interrogans in 

55 sera (14.47%) among 380 samples at a dilution 1:100 or greater, and L. icterohaemorrhagiae was the 

most prevalent serovar. Leptospiral antibodies were detected by ELISA in 85 sera (22.37%) among 380 

samples. Four samples (12.12%) among 33 urine samples were suspected by DFM examination and no 

positive sample by IFAT was observed. Leptospires could be isolated from none of the 33 samples taken 

from industrial farms, but leptospires were isolated from urine samples taken from two clinically affected 

calves in a traditional farm. In this study, positive controls were detected only at a dilution equal to or greater 

than 2000 leptospires per each ml of urine sample by PCR, therefore, no DNA from serum and urine 

samples were collected from 6 industrial dairy farms, could be detected by this method. It seems that, to 

increase the precision in the diagnosis of the disease, using a range of reliable techniques and comparing 

the results is important in reaching final conclusion. 




DEVELOPMENT OF A NEW AVIAN INFLUENZA ANTIBODY BLOCKING ELISA 

M. Zalunardo, K. Velek, R. Muñoz, J. Taxter, S. Michaud, V. Leathers 

IDEXX Laboratories 

One IDEXX Drive, Westbrook, Maine 04092, USA 

A new blocking enzyme-linked immunosorbent assay (ELISA) was developed based on nucleoprotein (NP) 

antigen coated on the solid phase which binds avian serum antibodies against avian influenza virus. A 

conjugate, prepared with monoclonal antibody directed against the conserved Influenza A nucleoprotein, is 

then used as the detection reagent. The presence of AI antibodies in a test sample is determined by the 

ability of the test sample to inhibit binding of the anti-NP conjugate to the plate. Because the basis of the test 

is the ability of sample antibody to block a conserved immunodominant epitope on the avian influenza 

nucleoprotein (NP) coated plate, the assay format does not require use of any species specific reagents and 

is therefore broadly applicable for any avian species that generates an antibody response to the NP protein 

of avian influenza. 

Well characterized serum samples from different avian species (commercial and non-commercial chickens, 

turkeys, ducks, geese, quail and ostriches) were analyzed with this new ELISA. The results showed an 

overall specificity of 99.7% and excellent correlation with other traditional test methods, such as agar gel 

immunodiffusion (AGID) and hemagglutination inhibition (HI) tests, and improved specificity when compared 

to indirect ELISAs. 


DIAGNOSTICS OF PARASITIC DISEASES OF 

AGRICULTURAL ANIMALS IN UZBEKISTAN 

M.Aminjonov, professor 

Sh. Temirov, a post-graduated student 

(Uzbek veterinary scientific research institute) 

One of the wide spread and dangerous to human health and animals parasitic diseases in Uzbekistan is 

echinococcosis. According to Ministry of public health of the republic of Uzbekistan annually more then 6 

thousand people of difference age (18-20% children up to 15 years old, more then 50% women) are 

operated. Operation fee in echinococcosis of one man is more then 10 thousand dollars (USD). 

There is observed a trend of echinococcosis growing so among the population as among the animals. 

According to our data sheep are infected with echinococcosis up to 75-80%, cattle is infected – 45% and 

more, donkeys – 35,0% and so on. 

Economic damage from echinococcosis among the animals a year was equal to 5 mln. dollars (USD). 

Success of struggle against echinococcosis in many times depend on in-time its diagnostics. 

There is widely used reaction indirect hemaglutination in Stepanovskiy’s modification for recognizing of 

echinococcosis in Uzbekistan. 

With aim of discovery of antibodies’ titres in above mentioned reaction 10 heads lambs experimentally 

infected with echinococcosis were used. As control was 5 heads lambs not infected. In experimentally 

infected animals positive titres appeared from 40 th day after infection (1:320) and maximally reached on 180 th 

day. On that day antibodies’ titres of few animals were 1:5260 and than there was observed decreasing of 

titres and in one year was equal to 1:320 and 1:160. 

Titres reaction of some animals did not exceed 1:160. 

Slaughter of animals in one year showed high infection. Number of cycts echinococcus formed in average 

52-712 copies a head, control animals were free from invasion. 

So, sensitivity and specificity of used reaction was 80,0% and higher, and it is acceptable in condition of 

sheep farmers of Uzbekistan and neighboring republics of Central Asia. 




TARGETED SELECTIVE TREATMENT OF OSTERTAGIA OSTERTAGI 

- THE USE OF AN ELISA AS A DIAGNOSTIC TOOL FOR THE CONTROL OF THE PARASITE IN 

CATTLE 

J Troeng, J Vercruysse, J Charlier, A Nordengrahn, M Merza* 


Introduction 

A prerequisite to identify herds affected by parasites and then to treat only those animals that suffer from 

clinically significant parasitism (according to TST) is access to diagnostic tool that can be included in 

surveillance programs. The nematode infestations in adult cows are predominanty subclinical, but may lead 

to a decrease in milk production. One of the most important factors is to find the infestation level 

corresponding to the necessity of anthelmintic treatment. The screening for O. Ostertagi antibodies in cattle 

milk samples have been demonstrated to be a promising parameter to determine the infestation level, thus 

becoming an instrument to determine the need for antheliminic control. 


The kit procedure is based on a solid-phase indirect ELISA where milk samples are exposed to O. Ostertagi 

antigen. A HRP conjugated a-bovine Ig is used as detection antibody. 

In order to establish the relation between OD value read in a spectrophotometer and the change in milk 

yield, bulk milk samples from more than 800 European herds were studied. 

Results 

The study established a good correlation between OD values and change in milk yield. The data were further 

analysed and put into a diagram which can be used for the interpretation of single bulk milk sample tested in 

the ELISA in order to assess the importance of the infestation in a specific herd. 


We have developed an O. Ostertagi ELISA for antibody detection in serum and milk. This ELISA used on 

bulk tank milk, is a promising diagnostic tool that can be used on a large-scale to identify dairy herds where 

the infestation level with gastrointestinal nematodes is likely to reduce productivity. By using this ELISA the 

correlation between a certain level of antibodies to O. Ostertagi in a bulk milk sample and the herd average 

milk yield reduction can be established and thereby being a tool for determination of the need for 

anthelmintic control. The ELISA has been commersialised as Svanovir® Ostertagia Ostertagi ab ELISA. 

References 

Charlier J., Duchateau, L., Claerebout E., Vercruysse J., 2007. Predicting milk-production responses after an 

autumn treatmend of pastured dairy herds with eprinomectin. Vet. Parasit. 143, 197-390. 

Charlier J., Claerebout E., Duchateau L., Vercruysse J., 2005. A survey to determine relationships between 

bulk tank milk antibodies against Ostertagia ostertagi and milk production parameters. Vet. Parasit. 

129, 67-75. 


EVALUATION OF POSTVACCINAL ANTIBODIES LEVEL AFTER VACCINATION WITH MARKER GE 

BHV1 VACCINE IN BOVINES, USING ELISA METHOD 

C. Radulescu, I. Olvedi 

Institute for Diagnosis and Animal Health, Virology Dep., Bucharest, Romania 

Key words: vaccination, marker, BHV1, ELISA 

Aims: 

Bovine Herpesvirus 1 (BHV1), a member of the Herpesviridae family (subfamily Alphaherpesvirinae), is the causative agent of infectious 

bovine rhinotracheitis (IBR), infectious pustular vulvovaginitis (IPV), infectious balanoposthitis (IBP) and several other clinical 

syndromes. BHV1 infection usually affects the respiratory or genital tracts. 

Infectious bovine rhinotracheitis is highly contagious and can be spread through airborne and sexual transmission, although infection 

can also occur through other routes. The disease is widespread throughout the world. In Romania, IBR was first diagnosed in 1964, but 

serological surveillance started in 2000. 

The purpose of this work is the evaluation of postvaccinal antibodies level after vaccination with marker gE BHV1 vaccine in bovines, 

using ELISA method. 

Materials and methods: 

Vaccine and vaccination scheme: the bovines were vaccinated with IBR live marker vaccine; this is an attenuated vaccine containing at 

least 10 5.7 TCID50 of gE¯ BHV-1, strain GK/D. 

Challenge study: was made on 50 bovine which were grouped in 7 age categories: 

Batch no. I: 7 dairy cattle; 

Batch no. II: 7 heifers; 

Batch no. III: 8 heifers at 12-18 month old; 

Batch no. IV: 10 heifers at 6-12 month old; 

Batch no. V: 10 calves at 3-6 month old; 

Batch no. VI: 4 calves at 1-2 month old; 

Batch no. VII: 4 control animals for uninfected adults. 

These bovines were vaccinated with 2 ml/animals following the program: 

Primary vaccination: - intranasal for the calves a 1-2 month old; 

- intramuscular for other batches. 

Secondary vaccination: was applied only the calves at 1-2 month old, intramuscular, after 3-4 month from the first vaccination. 

Samples: Blood samples were harvest from all 50 animals before vaccination. 

After the vaccination, the samples were taken thus: 

- after 28 and 90 days from primary vaccination for all bovines; 

-after 21 days, from recall vaccination for calves a 1-2 month old. 

Methods: - Chekit Trachitest Serum screening, ELISA kit, used for titrations the antibodies against bovine herpes virus 1 (BHV) before 

and after vaccinations; 

- Chekit BHV1 gE, ELISA kit used for detection vaccinal antibodies 

Results: 

During this experiment, all animals were clinically examined and the body temperature was measured. There were no clinical alterations 

or mortality in inoculated animals. 

Before challenge: 

- bovines of the batch no. I showed a high, stable and homogenous BHV1 titer of antibodies (around 1:64 128); 

- animals of the batch no. II present a low titer of antibodies (approximately 1:4); 

- only 2 heifers a 12-18 month old have detectable antibodies titer (1:4); 

- the batches no. IV and V showed no antibodies, being negative at ELISA; 

- controls (batch no. VII) remained seronegative, indicating the absence of the wild BHV1 contamination. 

After challenge: 

- the seroconversion observed at 28 days was significant for batch 

no. I, II, III, IV, V vaccinated i.m., and less seroconversion in batch nr. VI that received the vaccine on the nasal route; 

- at 90 days after vaccination, titers of detected antibodies were 

lower than previous determination, but higher than initially observed; 

- at the animals with secondary i.m. vaccination the titers of anti- 

bodies were higher then titers after nasal vaccination, but 

lower when compared with titers registered in the rest of batches; 

- controls remain negative, showing no detectable antibodies. 

Conclusion: 

It was observed after 28 days post inoculation significant seroconversion consequently the inoculation of the IBR live marker vaccine by 

intramuscularly route and low seroconversion following nasal route administration. After 90 days post inoculation antibodies titer 

decreased, but it was higher than initially observed (before inoculation). Seronegative animals presented at all serological exams for 

specific antibodies detection, performed with Chekit BHV1 gE ELISA kit, negative results, although all bovines permanently stayed 

together (infected animals – seropositive- and seronegative). 

Reference: 

1. Flint.S.J., Enquist, L.W., Skalka,A.M., 2003- Priciple of virology, vol1. 

2. Monika Fuchs, Peter Hübert, Jan Detterer, and Hanns-Joachim 

Rziha - Detection of Bovine Herpesvirus Type 1 in Blood from 

Naturally Infected Cattle by Using a Sensitive PCR That 

Discriminated between Wild-Type Virus and Virus Lacking Glycoprotein E. 

3. Jones C. Alphaherpesvirus latency: its role in disease and survival of the virus in nature. 

4. Engels M, Ackermann M. Pathogenesis of ruminant herpesvirus infections. 

5. Mylène Lemaire, 1 Vincent Weynants, 2 Jacques Godfroid, 3 Frédéric Schynts, 1 Gilles Meyer, 1 Jean-Jacques Letesson, 2 and Etienne 

Thiry 1* - Effects of Bovine Herpesvirus Type 1 Infection in Calves with Maternal Antibodies on Immune Response and Virus Latency . 

6. Kupferschmied HU, Kihm U, Bachmann P, Muller KH, Ackermann M. Transmission of IBR/IPV virus in bovine semen: a case report. 

7. OIE, (2004b) Office International des Epizooties, Manual of Diagnostic Test and Vaccines for Terrestrial Animals, Fifth Edition, 2004, 

Chapter 2.3.5 – Infectious bovine rhinotracheitis/Infectious pustularã vulvovaginitis. 

8. Kramps JA, Banks M, Beer M, Kerkhofs P, Perrin M, Wellenberg GJ, Oirschot JT. - Evaluation of tests for antibodies against bovine 

herpesvirus 1 performed in national reference laboratories in Europe. 




VALIDATION OF AN AGAR GEL IMMUNODIFFUSION AND WESTERN BLOT ASSAYS FOR 

DIAGNOSIS OF EQUINE INFECTIOUS ANEMIA USING A RECOMBINANT p26 PROTEIN 

Alvarez, I. 1* , Gutierrez, G. 1 , Vissani, A. 1 , Ostlund, E 2 ., Barrandeguy, M. 1 and Trono, K. 1 

1 Instituto de Virología. Centro de Investigaciones en Ciencias Veterinarias y Agronómicas. INTA. C.C. 1712. Castelar. Argentina. 

2 NVSL: National Veterinary Services Laboratoryies. P. O. Box 844, Ames, IA 50010. USA * ialvarez@cnia.inta.gov.ar 

Introduction 

In Argentina, laboratory diagnosis of equine infectious anemia (EIA) is currently made by agar gel 

immunodiffusion test (AGID) designed by Coggins in 1970 (1). It is an inexpensive, simple and highly 

specific assay to identify EIAV-infected animals and it is still internationally recognized as the “gold standard” 

test by the World Organization for Animal Health (OIE) (2). The detection of EIA antibodies by ELISA has 

also been described and test kits have been approved in some countries. Several factors can contribute to 

yield conflicting results that need to be resolved using an alternative reliable and highly specific diagnostic 

tool. Western blot (WB) is currently used as confirmatory test and as an important tool for managing human 

and animal retroviral infections. 

The objective of this study was to validate an AGID assay and a confirmatory WB test using a recombinant 

p26 protein (rp26) produced in Escherichia coli as antigen. 


We employed international guidelines (3-5) to analyze the performance characteristics of both tests and we 

compared the results of a large number of field serum samples against those obtained with an imported 

commercially available AGID test kit. 

Results 

For the rp26-AGID test, a panel of 1855 field serum samples was analyzed, showing total concordance 

(100%) with the results obtained on the same samples using a commercial test kit. 

The agreement between results from 567 sera analyzed with the rp26-WB and commercial AGID was very 

good, with 98.9% of concordance. Six samples yielded discordant results between rp26-WB and a 

commercial AGID. These samples were sent to the NVSL (EIA reference laboratory) and fully examined 

using multiple EIA test formats The positive results obtained by using rp26-WB were considered to be truepositive 

since they were coincident with those obtained with the NVSL set of serologic tests. The rp26-AGID 

and rp26-WB assays demonstrated excellent performance characteristics. Excellent repeatability and 

reproducibility and total agreement with blind previous results from 5 proficiency test panels indicated that 

both test were precise assays. No cross-reactivity was observed when serum samples from horses with 

other infectious diseases or with poorly preserved samples were analyzed by rp26-AGID or rp26-WB assays. 

In the analytical sensitivity trial, positive sera showed nearly the same endpoint dilutions for rp26-AGID and 

commercial tests, and for the rp26-WB, demonstrated to be higher than AGID. 

Discussion and conclusions 

This is the first time that a recombinant AGID assay able to identify EIAV infections has been standardized 

and validated in Argentina according to international guidelines. Based on the results obtained, the p26- 

AGID could be adopted in the Argentinean current context as an official test method. Additionally, the rp26- 

WB was shown to be an accurate confirmatory diagnostic tool to be used as a complementary test after a 

doubtful ELISA or AGID test, available at national level for confirmation of conflicting results that contribute to 

resolve legal and/or sanitary situations that can be propitious to the dissemination of AIE in Argentina. 

References 

(1) Coggins, L., and N. L. Norcross (1970). Immunodiffusion reaction in equine infectious anemia. Cornell 

Vet. 60(2):330-335. 

(2) World Organization for Animal Health (OIE) (2004). Manual of Diagnostic Test and Vaccines for 

Terrestrial Animals. Volume II. Chapter 2.5.4. Equine infectious anemia. 

(3) International Committee of Harmonisation. Tripartite Guideline Q2A: Text on validation of analytical 

procedures, (1994); and Tripartite Guideline Q2B: Validation of analytical procedures: methodology, (1996). 

(4) World Organization for Animal Health, (OIE). 2004. Manual of Diagnostic Test and Vaccines for 

Terrestrial Animals, Volume I. Chapter 1.1.3. Principles of validation of diagnostic assays for infectious 

diseases. 


NEW DIAGNOSTIC ASSAYS FOR THE DETECTION AND MONITORING OF COCCIDIOSIS IN POULTRY 

J. A. T. Morgan 1 , C. Constantinoiu 1,2 , J. B. Molloy 1 , G. T. Coleman 2 and W. K. Jorgensen 1* 

1 Emerging Technologies, Department of Primary Industries and Fisheries, Yeerongpilly, Qld. 

2 School of Veterinary Science, University of Queensland, Qld. 

Introduction 

Poultry farms suffer significant economic loss from infection with the parasitic disease coccidiosis (Shirley, 

Smith and Tomley, 2005). Transmission is via ingestion of infective oocysts which are shed in the faeces. 

Seven species have been identified from chickens based on varying biology and pathogenicity (Sutton, 

Shirley and Wisher, 1989). Control methods include chemical coccidiostats and live species-specific 

vaccines. To maximise the effectiveness of coccidiosis control programs effective diagnostic assays are 

essential. Species diagnosis has traditionally been based on morphological characters and developmental 

biology but these methods have proved problematic, particularly with mixed species infections. Diagnostic 

tests must be suitable for epidemiological investigations and investigating coccidiosis outbreaks. 

Conventional PCR and sequence based DNA markers have improved species discrimination but lack the 

ability to quantify Eimeria load, particularly in animals with mixed species infections. Quantitative detection 

and serological assays are both essential to meet these industry requirements. 


Seven real-time PCR assays were developed for the detection and quantification of Australian Eimeria 

species. The assays use species-specific minor groove binder (MGB) TaqMan probes designed with FAM or 

VIC flourophores so that the seven species can be screened by multiplexing in 4 reaction tubes. Assays can 

be applied to DNA extracted directly from faecal samples are non-invasive and permit accurate identification 

to species, and quantification of oocyst load. Profiles of mixed species infections in commercial flocks were 

monitored over time. An indirect ELISA has also been developed from merozoite antigens of E. tenella. 

Since they detect antibodies rather than the parasites themselves, ELISAs can detect exposure to Eimeria 

species even when the parasites are no longer present. The indirect ELISA was used to assess sera from 

vaccinated and unvaccinated birds from commercial farms. 

Results 

The seven newly developed real-time PCR assays show no cross reactivity to non-target species. Profiling of 

poultry broiler farms found that mixed species infections were common, there was large bird to bird 

variability, and that peak oocyst shedding occurred after 18 days. The newly developed indirect ELISA can 

detect exposure of chickens to low numbers of oocysts of E. tenella. Antibodies were detected by 14 days 

post-infection and, depending on the rearing system, persisted in most birds for greater than 10 weeks. In 

field screens 99% of birds in a flock vaccinated against coccidiosis and 97% of free-range unvaccinated 

layers, were positive in the ELISA. In contrast, less than 1% of unvaccinated broilers fed a diet containing a 

chemical coccidiostat were positive. 


Current Australian vaccines only protect against 4 species, therefore accurate disease diagnosis is important 

to the poultry industry where coccidiosis is a costly and virtually ubiquitous problem. The developed DNA 

based assays are species-specific and quantitative. They are sensitive enough to detect low level infections 

allowing infections at economic thresholds to be identified. The indirect ELISA provides a quick and 

inexpensive test that has high throughput capacity. The new assays can be used to investigate outbreaks, 

monitor and quality control vaccination programmes, check the effectiveness of biosecurity measures and 

identify the development of chemical resistance. 

References 

Shirley, M. W., Smith, A. L. and Tomley, F. M. (2005) The biology of avian Eimeria with an emphasis on their 

control by vaccination. Advances in Parasitology 60: 285–330. 

Sutton, C. A., Shirley, M. W. and Wisher, M. H. (1989) Characterisation of coccidial proteins by twodimensional 

sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Parasitology 99: 175-187. 

Acknowledgement 

This research was partly funded by RIRDC project DAQ-316A 




ACCURATE DETECTION OF BOVINE LEUKEMIA VIRUS USING RECOMBINANT P24-ELISA AND PCR 

G. Gutiérrez*, M.J. Dus Santos, I. Alvarez, M. Lomónaco, R. Politzki, S. Rodriguez and K. Trono. Instituto de Virología, Centro de 

Investigaciones en Ciencias Veterinarias y Agronómicas, INTA, CC 1712 Castelar, Argentina 

Introduction 

Diagnosis of Bovine leukemia virus (BLV) infection is currently carried out by agar gel immunodiffusion 

(AGID) and ELISA (1). Even when both tests are approved by the OIE for trade purposes, several factors 

can contribute to yield conflicting results that need to be confirmed. In this work, ELISA and PCR were used 

as complementary tools to confirm the real sanitary status for specific situations as breeding or 

commercialization. The performance characteristics of an in-house developed recombinant ELISA (rp24- 

ELISA) were evaluated according to international guidelines (2,3). 


The BLV p24 major capsid protein was expressed as a recombinant thioredoxin-6xHis fusion protein in 

Escherichia coli in our laboratory. The purified rp24 was used as antigen for the ELISA test (rp24-ELISA) to 

detect antibodies to BLV. To assess the performance characteristics of this test 710 field serum samples 

were analyzed by rp24-ELISA and a commercial AGID test (UNLP AGID). Amplification of the envelope gene 

by nested PCR (nPCR) (4) and an in-house Western Blot assay were used to confirm discordant results on a 

well-characterized herd. 

Results 

rp24-ELISA and AGID showed a 90.5% of concordance when the 710 field serum samples were analyzed 

on the accuracy trial. rp24-ELISA could detect 269 positives samples while AGID only detected 210. When 

nPCR was carried out 18 out of 22 samples that were declared as positive by rp24-ELISA were positive by 

nPCR. In addition, the rp24-ELISA was able to detect 5 out of 21 infected animals that were not detected by 

AGID. Five out of 8 samples that were not declared as positives by AGID were detected by WB and rp24- 

ELISA. Complementary, the rp24-ELISA demonstrated to be a precise assay with excellent repeatability, 

reproducibility and better analytical sensitivity than AGID 


Taking these results into account, the rp24-ELISA could be adopted as an official test method for diagnosis 

and control of BLV in Argentina, and together with the nested-PCR assay could be considered as 

complementary tools for confirmatory situations. 

References 

1- World Organization for Animal Health (OIE). 2004. Manual of Diagnostic Test and Vaccines for Terrestrial 

Animals (mammals, birds and bees). Chapter 2.3.4. Enzootic bovine leukosis 

2- World Organization for Animal Health (OIE). 2004. Manual of Diagnostic Test and Vaccines for Terrestrial 

Animals (mammals, birds and bees). Chapter 1.1.3. Principles of validation and of diagnostic assays for 

infectious diseases. 

3- International Committee of Harmonisation. Tripartite Guidelina Q2A: Text on Validation of Analytical 

Procedures, 1994, and Tripartite Guideline Q2B: Validation of Analytical Procedures: Methodology, 1996. 

4-Lew, AE; Bock, RE; Molloy, JB; Minchin, CM; Robinson, SJ; Steer, P. Sensitive and specific detection of 

proviral bovine leukemia virus by 5´Taq nuclease PCR using a 3´ minor groove binder fluorogenic probe. J 

Virol Methods, 2004 Feb;115(2):167-75 


IS THE COXIELLA BURNETII NINE MILE STRAIN A SUITABLE ANTIGEN FOR DETECTION OF 

Q FEVER ANTIBODIES OF RUMINANTS BY ELISA? 

*A Rodolakis 1 , M Bouzid 1,2 , A Souriau 1 , P Camuset 3 , M Berri 1 1 IASP INRA, Nouzilly France, 2 IRVT Tunis Tunisie 3 SNGTV Paris France 

Introduction 

Coxiella burnetii, the causative agent of Q fever, a worldwide zoonosis, infects various animal species. 

However ruminants are considered as the most common reservoir for human infection as infected ruminants 

shed high concentration of C burnetii in placenta and parturition products but also in milk, in faeces and in 

urine, which are the source of environmental contaminations causing human disease. In ruminants C burnetii 

may cause abortion, pneumonitis and retained placentitis leading to metritis and infertility namely in cows. 

But C burnetii infections are frequently asymptomatic and numerous ruminants without any clinical symptom 

shed the bacteria. The diagnosis of Q fever in ruminants is generally performed by PCR combined with 

serological analysis of serum samples by ELISA. However, several female animals that shed C burnetii in 

vaginal mucus or milk even for several months remained ELISA negative. As human chronic Q fever could 

be related to immunodeficiency, the aim of this work was to investigate if these seronegative animals were 

unable to produce antibodies against C burnetii or if the antigen used in the ELISA kit failed to detect them. 


Seven C burnetii strains were used: the Nine Mile (NM) strain isolated from ticks which is the antigen used in 

ELISA kits and 6 strains isolated from ruminants. Four of them were isolated from placenta of aborted 

females: CbB1 from a cow, CbO1 and CbO184 from a ewe and CbC1 from a goat. The CbC2 and CbB2 

strains were isolated from the milk of an asymptomatic goat and an infertile cow respectively 1 . The antigenic 

variability of C burnetii strains were analyzed by immunoblotting with the serum of a goat naturally infected 

and by immunofluorescence (IF) 2 with serum of mice immunized with CbB1, CBC1, CbC2, CbO1 and NM C 

burnetii strains. The presence of antibodies against the 4 C burnetii strains, NN, CbO1, CbC1, CbC2 in the 

ELISA-negative serum samples of ruminants shedding C burnetii in vaginal mucus, milk or feces 3 was 

investigated by IF 

Results 

Immunoblotting and IF using immune sera obtained from either mice or naturally infected ruminants 

exhibited antigenic variability between NM strain and strains isolated from domestic animals. These 

techniques also revealed minor antigenic variability inter strains isolated from ruminants. The serum of the 

animals that shed C burnetii and which were ELISA negative, were also negative in IF with the NM antigen 

but they were positive against at least one of the 3 strains isolated from ruminants: 29 sera were positive 

against the CbO1 strain and 13 gave of doubtful reaction. CbC1 and CbC2 strains detected 19 and 17 

positive sera respectively. For both of them, 3 sera gave a doubtful reaction. 


The ELISA seronegative cows, ewes or goats that shed C burnetii in vaginal mucus, feces or milk were able 

to produce antibodies but the antigenic variability between NM strain and the strains isolated that infect 

ruminants did not allow their detection. So the C burnetii N M strain, widely used in ELISA kits, is not suitable 

for the diagnosis of Q fever in ruminants, as there were lots of false negative responses with such kits. IF 

tests are not widely used in veterinary diagnosis as they cannot be automated; and they require skilled 

technicians and expensive equipment. Nevertheless ELISA is supposed to be slightly more sensible than IF 4 . 

So these results have lead us to develop an ELISA kit using a C burnetii strain isolated from ovine as antigen 

that improves the sensitivity of the serological diagnosis of Q fever in ruminants. To valid a test, this work 

underlines how, in absence of “Gold Standard”, it is crucial to dispose of a huge collection of serum samples 

from flocks of well known sanitary status. 

References 

1 Arricau-Bouvery, N., Hauck Y., Bejaoui A., Frangoulidis D., Bodier C.C., Souriau A., Meyer H., Neubauer 

H., Rodolakis A., Vergnaud G. BMC Microbiology, 2006 Apr 26; 6(1):38 

2 Souriau, A., Le Rouzic, E., Bernard, F., Rodolakis, A., 1993. Vet. Rec. 132, 217-219. 

3 Rodolakis A Berri M, Héchard C, Caudron C, Souriau A, Bodier CC, Blanchard B, Camuset P, 

Devillechaise P, Natorp JC, Vadet JP, Arricau-Bouvery N. 2007 JDS In press 

4 Rousset E, Durand B, Berri M, Dufour P, Prigent M, Russo P, Delcroix T, Touratier A., Rodolakis A, Aubert 

M. 2007 Vet Microbiol, 124: 286-297 




DIFFERENTIATION OF FOOT-AND-MOUTH DISEASE VIRUS (FMDV) INFECTED PIGS FROM 

VACCINATED PIGS USING A WESTERN BLOTTING (WB) ASSAY BASED ON BACULOVIRUS 

EXPRESSED FMDV 2C AND 3D ANTIGENS 

K. Fukai*, K. Morioka, S. Ohashi, R. Yamazoe, K. Yoshida, K. Sakamoto 

Exotic Diseases Research Station, National Institute of Animal Health, Japan 

Introduction 

FMD is probably the most contagious live stock disease known. FMDV is a member of the genus Aphtovirus 

within the family Picornaviridae. Seven serotypes have been identified, and multiple antigenic variants occur 

within each serotype. Outbreaks of FMD in a disease-free country or region are detrimental to the agriculture 

industry due to trade and movement restrictions and the severe impact on animal health and welfare, as well 

as society as a whole. Until now, the outbreaks within a FMD-free country have been controlled by a 

combination of stamping out and movement control. However, the massive destruction of animals during the 

FMD epidemic in the United Kingdom in 2001 emphasized the need alternative control procedures. Indeed, 

the European Union has been changed to allow the use of emergency vaccination for the control of FMD in 

Europe. In concordance, the time period given in the Terrestrial Animal Health Code of the Office 

International des Epizooties, before a country which has resorted to emergency vaccination can regain 

status as ‘disease free without vaccination’, has been reduced to six months, provided serological surveys 

for antibodies to FMDV non-structural proteins are carried out to ensure correct classification of infected 

animals in the presence of vaccination. Therefore, the availability of tests with high sensitivity and specificity 

as well as high capacity, is essential. In this study, to differentiate FMDV infected pigs from vaccinated pigs, 

a WB assay was performed with using baculovirus expressed FMDV 2C and 3D non-structural proteins as 

antigen. 


Sera by infection were collected in constant intervals from three pigs inoculated 10 6 TCID50 FMDV Asia1 

Shamir. Ones by vaccination were prepared with a single administration of 6 PD50 FMDV Asia1 Shamir and 

O1 Manisa inactivated vaccine to four pigs. FMDV 2C and 3D proteins were expressed by using a 

baculovirus expression system. The serum samples were examined by a WB assay based on the 

baculovirus expressed 2C and 3D non-structural proteins of FMDV O/JPN/2000. And same samples were 

also tested by liquid phase blocking ELISA (LPBE) and virus neutralization (VN) assay. 

Results 

In the WB assay, positive reactions were obtained for sera from pigs infected with FMDV Asia1 Shamir. The 

assay detected initially antibodies from 6 days following experimental infection of non-vaccinated pigs, and 

the positive reactions persisted for up to 41 days after infection. In contrast, no positive reaction was 

obtained from vaccinated pigs for up to 210 days after vaccination. In the LPBE and VN assay, positive 

reactions were obtained for sera from both infected and vaccinated pigs. And the positive reactions persisted 

for up to 41 and 210 days after infection and vaccination, respectively. 


In this study, the WB assay based on baculovirus expressed FMDV 2C and 3D antigens could clearly 

differentiate FMDV infected pigs from vaccinated pigs. In the future, the applicability of this WB assay needs 

to be verify using the field samples in FMDV endemic countries and the serum samples of pigs administrated 

an inactivated vaccine many times. And the assay which can simultaneously examine a lot of samples, i.e. a 

ELISA system, using these baculovirus expressed FMDV 2C and 3D non-structural proteins also needs to 

be established. 


DEVELOPMENT OF A COMMERCIAL ELISA FOR THE DETECTION OF SERUM ANTIBODY TO 

AKABANE VIRUS 

Lunt RA * , White JR * , Newberry KM * , Pourquier P † , Comtet, L † , Whittle, S ‡ . 

* CSIRO Livestock Industries, Australian Animal Health Laboratory, P.O. Bag 24, Geelong 3220, Australia 

† ID VET, Cap Gamma - 167 rue Mehdi Ben Barka - 34070 Montpellier, France 

‡ Laboratory Diagnostics, Serenity Cove Corporate Park Kurnell, Australia 

Introduction 

Akabane virus (AKAV; family: Bunyaviridae, Genus: Orthobunyavirus) is an insect-borne virus of ruminants 

associated with epizootics of abortion, stillbirth and congenital abnormalities in cattle, sheep and goats. The 

virus has wide distribution across Africa, the Middle East, Cyprus, Asia and Australia 1 . 

We have developed a monoclonal antibody competition ELISA for the detection of antibody in ovine and 

bovine sera. Sensitivity and specificity of the assay has been investigated using panels of experimentallyderived 

and field collection sera. The assay has been transferred to a commercial company (ID-VET, 

France) for development as a commercial kit product. This paper describes the work undertaken to 

characterize assay performance. 


Sera: 187 AKAV VNT positive sera and 1041 AKAV VNT negative sera were variously sourced as: 41 sera 

from animals experimentally infected with AKAV, 146 VNT positive field sera, 424 bovine and 593 ovine sera 

from non-endemic areas, 24 VNT-negative sera from AKAV endemic areas. 

Monoclonal antibody: A monoclonal antibody (17A12) was identified in preliminary work as an AKAV 

neutralizing antibody, with binding specificity for G1 protein identified by radio-immunoprecipitation, but not 

detected in western blots. 

Virus: AKAV isolate B8935 was used in VNT serology and antigen production for use in ELISA kits. 

VNT: sera were characterized by antibody neutralization for AKAV and Aino virus (AINOV) in a standard 

VNT format using VERO cells and 100TCID50 virus input. Sera with titres of greater than 4 were considered 

VNT antibody positive. 

ELISA: Following initial characterization, antigen and monoclonal antibody were incorporated into an ID-VET 

ELISA. Kit components included microplates coated with AKAV antigen (inactivated virus), control sera, 

horseradish peroxidise conjugated 17A12 monoclonal antibody, buffers and substrate solutions. Sera were 

tested according to the product insert method and in single wells. In brief, sera diluted 1/10 were added to 

plates for 45 minutes at 37°C. Plates were washed and conjugate added for 30 minutes. Substrate was 

reacted in washed plates for 15 minutes. After addition of stop solution, plates were read at OD 450nm. The 

sample to negative control ratio (S/N %) was used to identify reactive sera: S/N < 50% was regarded as 

positive. 

Results 

At the cut-off level (S/N = 50%), assay sensitivity and specificity were estimated at 0.94 and 0.98 

respectively, relative to VNT positive and negative division of the entire 1228 panel of sera. 19 of 20 VNT- 

NEG, ELISA-POS sera were derived from areas endemic for AKAV. Possible influence in the ELISA of 

antibody against other Simbu serogroup viruses such as AINOV was investigated. A panel of 9 AKAV VNT- 

NEG, AINOV VNT-POS field sera included 2 ELISA positives. However tests of sera from sheep 

experimentally exposed to various Simbu viruses (Peaton, Douglas, Simbu and Tinaroo) did not confirm any 

cross-reactivity. 9 of 11 AKAV VNT-POS, ELISA-NEG sera had VNT tires of ≤ 1/32. Of these sera, 6 of 11 

had S/N values between 50 to 70%, indicating that some below threshold inhibition of monoclonal binding 

was occurring. 


The development of ELISA-based assays as alternatives to VNT assays has advantages in sample 

throughput capability and the removal of dependencies on live virus and cell culture requirements. An AKAV 

neutralizing monoclonal antibody (17A12) was identified as potentially useful in a competition format ELISA 

for serum antibody. Through collaboration with ID VET, an ELISA kit was developed and assessed. A range 

of sheep and cattle sera from field and experimentally infected animals were used in determinations of 

operational levels of sensitivity and specificity. Performance characteristics of the ID-VET AKAV competition 

ELISA suggest suitable applications could include diagnostic investigations and livestock movement 

certifications in testing that might otherwise require VNT serology. 

Reference 

1. Saeed MF,Li L, Wang H,Weaver SC. Barrett ADT (2001). Phylogeny of the Simbu serogroup of the genus 

Bunyavirus. J Gen. Virol. 82: 2173-2181. 




PRELIMINARY VALIDATION OF A NEW MULTI-SPECIES COMPETITIVE ELISA KIT FOR THE 

DETECTION OF ANTIBODIES DIRECTED AGAINST THE WEST NILE VIRUS: ID SCREEN® WEST NILE 

COMPETITION 

P. Pourquier, S. Lesceu, ID VET, Montpellier, France 

Introduction and objectives: 

The West Nile virus (WNV), which causes encephalitis in infected humans and horses, is maintained in 

nature by a mosquito vector and bird reservoir host. Given the need for a rapid test able to diagnose the 

West Nile virus in horses and birds, ID VET (www.id-vet.com) has developed a multi-species competitive 

ELISA. 

The aim of this study was to validate a commercial ELISA developed by ID VET for the detection of anti- 

WNV antibodies in serum from different species (equine, avian). 

Test principle: 

The test is a competitive ELISA. The antigen is an immunocaptured E antigen. The conjugate is an anti-E 

peroxidase (Po). 

Methods : 

Sensitivity was evaluated by testing 20 positive horse sera from the South of France where WNV outbreaks 

were observed in 2003 and 2006. 

Specificity was studied by testing 320 negative horse sera from Calvados, France and 500 disease-free 

avian sera (ducks and chickens) from the Loire-Atlantique region in France. 

Results : 

The ID Screen® kit detected all 20 WNV-positive horse sera as positive and all WNV-negative horse and 

avian sera as negative. 

Conclusion: 

The ID Screen® test gives satisfactory specificity results on both bird and horse sera, and satisfactory 

sensitivity results on horse sera. The test is rapid, standardized and easy-to-use. 

The next step in the kit’s validation is to test positive avian sera. These samples are difficult to find given the 

low volume of sera obtained from wild birds. 


VALIDATION OF A NEW COMMERCIAL KIT FOR THE DETECTION OF ANTIBODIES DIRECTED 

AGAINST LEISHMANIA INFANTUM IN CANINE SERA: ID SCREEN® LEISHMANIASIS INDIRECT 

P. Pourquier 1 , S. Lesceu 1 , J. Dereure 2 , N. Keck 3 

1 ID VET, Montpellier France 

2 Parasitology-Mycology Laboratory, Centre Hospitalier Universitaire Montpellier, Leishmaniasis National Reference Centre, 

Montpellier, France 

3 Laboratoire Départemental Vétérinaire, Montpellier, France. 

Introduction: 

The visceral form of leishmaniasis is caused by Leishmania infantum in the Mediterranean area. The 

domestic dog, sensitive to infection by L. infantum, is an important reservoir host for transmission of the 

human disease. 

The aim of this study was to validate a commercial ELISA developed by ID VET (www.id-vet.com) for the 

detection of anti-L. infantum antibodies in canine sera. 


The test is an indirect ELISA. The antigen used is a purified extract of the promastigote form of L. infantum. 

The conjugate is an anti-dog peroxidase. 

Methods: 

Canine sera from Hungary (disease-free zone, n=192), from Gers, Ariège, and Aude, France (moderatelyinfected 

zones, n=515), and from Hérault, France (highly-infected zone, n=144) were studied. Samples were 

tested using the ID Screen® ELISA and results compared to those obtained by IFAT (Indirect Fluorescent 

Antibody Test) and counter immuno-electrophoresis (Hérault sera only). 

Results: 

Specificity of the ID Screen® ELISA was estimated to be superior to 99% and sensitivity superior to 98 %. 

Excellent correlation with IFAT for titers greater than or equal to 1/80 was observed. 

Conclusion: 

The ID VET test is an effective and rapid tool for the detection of anti-L. infantum antibodies in canine sera. 

The test demonstrates high specificity and sensitivity, and excellent correlation with IFAT. 




DEVELOPMENT OF A ELISA KIT TO DETECT AND EVALUATE BOVINE VIRAL DIARRHEA VIRUS 

ANTIGEN IN THE CRITICAL STAGES OF VACCINE PRODUCTION 

A. Pecora 1 , A. Ostachuk 1 , S. Levy 2 , A. Espinoza 2 , M. J. Dus Santos 1* and A. Wigdorovitz 1 

(1) Instituto de Virología, CICVyA, INTA-Castelar, Buenos Aires, Argentina 

(2) Biogénesis-Bago, Argentina 

* mdussantos@cnia.inta.gov.ar 

Introduction 

Bovine viral diarrhea virus (BVDV) is the causal agent of a worldwide spread disease. It infects bovines of all 

ages, causing reproduction problems and altering biological products of high commercial value, resulting in 

considerable economic losses. Persistently infected cattle disseminate large amounts of virus into the 

environment representing a mechanism by which the virus persist. 

Due to worldwide distribution of BVDV, disease control is based on the segregation of persistently infected 

cattle and efficient vaccination of the herd. According to that, the aim of vaccination against BVDV is to 

prevent transplacental transmission of the virus. 

Production of a BVDV vaccine usually presents the difficulty of obtaining enough antigen in order to induce 

high levels of neutralizing antibodies. 

The objective of this work was to standardize an enzyme-linked immunosorbent assay (ELISA) to detect and 

evaluate BVDV antigen in the critical stages of vaccine production. 


ELISA procedure 

U-bottom polystyrene microplates (Maxisorp, NUNC) were coated with an anti-E2 mouse monoclonal 

antibody (1:100 dilution). Samples were added at the corresponding dilution and incubated 1h at 37°C. As 

primary antibody, sera from rabbit immunized with a truncated version of E2 (1:2000) were used. 

Peroxidase-conjugated goat anti-rabbit IgG (1:2000) (KPL) were used as secondary antibody. The reaction 

was visualized with ABTS (Sigma) and absorbance was measured at 405 nm in a Multiskan EX 

(Labsystyem) reader. 

Daily calibration curves using four concentrations (104 ng/ml, 26 ng/ml, 6.5 ng/ml and 1.6 ng/ml) (each level 

in duplicate) were prepared with purified tE2, and used to compute E2 levels. 

Standard curves 

A stable CHO-K1 cell line expressing a truncated version of BVDV E2 glycoprotein (tE2) was used for 

construction of standard curves. E2t was purified by Immobilized Metal Affinity Chromatography. Purity and 

protein concentrations were determined by SDS-PAGE and Coomasie blue staining using a BSA standard 

curve followed by densitometry analysis using Image J software and bicinconic method 

Results 

A sandwich ELISA kit for the detection of BVDV was developed. In order to quantify E2 in the sample tested, 

a standard curve was performed using purified tE2 as antigen. 8 concentrations of purified E2t were 

prepared for using as standards. An aliquot of each standard was tested 12 times. A linear dose-response 

curve was obtained (from 417 to 0.4 ng/ml of purified E2t) with a coefficient of correlation R≥0.93. 

Four concentrations of purified tE2 (104 ng/ml, 26 ng/ml, 6.5 ng/ml and 1.6 ng/ml) were prepared for use as 

QC samples for evaluation of intra and inter-assay precision and accuracy. Excellent levels of repeatability 

and reproducibility were obtained. 

The limit of detection of E2 in the supernatant of the stable cell line was 0.15 ng E2/ul. The test also allows 

detecting E2 glycoprotein in BVDV cell culture production. For that purpose BVDV samples were treated with 

0.25% Triton X114 (Sigma-Aldrich). The assay could detect up to 10 4,5 TCID50/ml BVDV, Singer strain. 

Different BVDV productions and experimental and commercial vaccines were assayed. The ELISA was able 

to detect and quantify E2 in live BVDV, inactive BVDV and in the formulated vaccine. 


Results obtained indicate that the assay developed is a reliable tool to monitor the most relevant BVDV 

antigen in the process of vaccine formulation. 


FINE-TUNING A BULK MILK EBL ELISA AS PRIMARY SCREENING TOOL FOR ALL EBL-FREE 

HERDS IN NEW ZEALAND 

H Voges*, M Nash and T Trotter (LIC) 

Introduction 

Over 99.9% of New Zealand dairy herds have for several years achieved freedom from enzootic bovine 

leukosis (EBL) in accordance with OIE guidelines. 

An efficient tool to monitor these herds regularly as proscribed by the OIE Code is needed. 

The LACTELISA TM BLV Ab Bi Indirect Tank 250 test is designed for EBL antibody detection in vat milk 

samples from herds ranging of 150 to 250 cows (Ridge 2005). In the early stages of the NZ Dairy EBL 

Control Scheme, the Tank250 was employed to prioritise herds. Based on this dataset, Hayes & Burton 

(1998) reported test sensitivity and specificity equal to 81.9% and 98.7% respectively for herds of all sizes. 

Milk E4 dilution series 

Methods 

Using commercial EBL reference serum, a dilution trial was carried out with E4in EBL antibody-negative milk 

at 1: 200000 to 1: 1250000. 

Results 

At the recommended cut-off (0.2 S/P), test sensitivities fell to ~60% at high dilutions. In contrast, sensitivity 

was maintained at ~95% amongst high dilutions when the cut-off was reduced to 0.1 S/P. Clear separation 

between all E4 dilutions and EBL-free milk (+2σ) was maintained, suggesting a reduced cut-off may be 

feasible. 

Historical field data analysis 

Methods 

In 2000/01 & 2001/02 all NZ dairy herds were scheduled for a Tank250 test on a bulk milk vat sample. Case 

definition was difficult and imperfect, but only herds with 3 season test data were included: 

• Case + herds: 144 EBL-positive herds (at beginning and end of the season) 

• Case – herds: 13133 EBL-free herds that tested EBL negative on pool milk 

Results 

Overall Tank250 SE for the two seasons was 75.7% and the SP equal to 99.7% (95% CI: 99.5% - 99.7%). A 

ROC analysis shows modest SE gains were possible at the expense of small SP losses. Thus a cut-off at 0.1 

S/P resulted in an overall SE of 84.0% (SP 98.7%). In herds >500 cows SE rose from 64.3 to 76.2%. 

Operational performance and validation 

Methods 

During 2003/04 all high-risk and EBL-positive herds, as well as two-thirds of all EBL-free herds with up to 

300 cows, were screened by Tank250 using a reduced cut-off (S/P = 0.1). 

Results 

Changing the cut-off from 0.2 to 0.1 S/P resulted in big SE gains with a relatively small reduction in SP: 

� Tank250 SE amongst herds up to 600 cows was 100% 

� SE in herds >600 cows was 81.8% @ 0.1 S/P cut-off. 

� 4/5 herds >1000 milking cows (1-2 reactors) consistently tested positive on the repeated vat samples 

Repeatability of true positive results was extremely high for successive vat samples. Employing a serial 2test 

logic had no effect on test sensitivity but increased the SP substantially from 98.4% to 99.9% (p



ADAPTING A DNA TISSUE SAMPLER AS AN AID FOR EFFICIENT BVDV ANTIGEN SCREENING 

H Voges, T Trotter, M Nash and M Walker(LIC, NZ) 

Introduction 

The use of ear biopsy samples to screen cattle for BVD virus by antigen-capture ELISA is common practice 

and may be used to avoid maternal antibody interference. 

The Genemark Punch has been designed to take 1mm samples using self-contained punch-pouches for 

DNA profiling of livestock. Principal advantages of the Punch for BVDv testing include prevention of crosscontamination 

while the small biopsy size minimizes pain and distress. 


The trial objectives were to determine sample stability under adverse storage conditions and to ensure 

maximum test sensitivity for PI detection using the IDEXX HerdChek BVDv Antigen (Serum Plus) ELISA. 

Antigen extraction from tissues was carried out overnight and tested in accordance with the recommended 

protocol. 

Initial evaluation was carried out using Punch biopsies from two PI calves after storage for more than two 

weeks under a range of conditions as well as sample dilutions to 1:50. 

Thirty-five BVDv PCR-positive PIs – including 21 young calves (14 with maternal antibodies) – and 284 

PCR-negative in-contact cattle were sampled. All biopsies were tested after overnight extraction. A second 

(and third) extract from PI samples was also tested. Finally all PI extracts were diluted 1:13 in negative 

cohort extracts. 

Results 

The antigen ELISA results remained very stable over more than 2 weeks storage at a range of temperatures 

(4, 25, 37°C as well as fluctuating) and humidity. 

All raw PI sample extracts tested antigen-positive. All negative control biopsies were antigen-negative. A 

single pooled extract optical density reading fell below the test cut-off, although clearly higher than the 

negative controls. Punch ELISA optical densities of sero-positive calves were significantly lower than seronegative 

cattle (p < 0.01), although serum antigen ELISA results appeared unaffected by maternal 

antibodies. 

An additional 20 PIs were confirmed using the Punch ELISA. 


The Punch was primarily designed to provide samples for parentage confirmation and PCR testing. 

However, BVDv is an RNA virus and hence sample integrity may be compromised by cellular RNAses 

(bovine of bacterial), especially in the presence of cell death as found in skin biopsies (Oakey 2007). The 

Punch was therefore not considered suitable for BVDv PCR testing as a PI screening tool. In contrast, the 

antigens detected by the IDEXX antigen ELISA are largely unaffected during storage. 

The Punch biopsy is a highly stable sample delivering excellent sensitivity for PI detection using the 

HerdChek Antigen Serum Plus ELISA. Sample pooling however resulted in unacceptable variability of 

optical densities. 

References 

Fux RG (2007) Entwicklung und Prüfung von Verfahren zum Nachweis des Virus der Bovinen Virusdiarrhoe 

in getrockneten Ohrgewebeproben mittels Antigen-ELISA und real time RT-PCR (Thesis). Ludwig- 

Maximilians-Universität, Munich 

Hill FI, Reichel MP, McCoy RJ and Tisdall DJ (2007) Evaluation of two commercial enzyme-linked 

immunosorbent assays for detection of bovine viral diarrhoea virus in serum and skin biopsies of cattle. New 

Zealand Veterinary Journal 55(1): 45-48 

Oakey HJ (2007) A universal test to determine the integrity of RNA, and its suitability for reverse 

transcription, in animal tissue laboratory specimens. Journal of Veterinary Diagnostic investigation 19: 459– 

464 


VALIDATION OF AN INDIRECT BULK MILK BVD ANTIBODY ELISA FOR SERO-PREVALENCE 

INVESTIGATIONS AMONGST NEW ZEALAND DAIRY HERDS 

H Voges, T Trotter and M Nash (LIC, NZ) 

Introduction 

Given that contact with a persistently infected (PI) animal results in rapid sero-conversion of the majority of 

herd mates, the rationale behind a herd antibody, sero-prevalence test to gauge herd exposure to a BVDv PI 

animal is sound with careful interpretation, and has been used in BVDv control schemes overseas (Houe et 

al 2006; Niskanen 1993). 

We tested bulk milk vat samples using the indirect BVD antibody ELISA from IDEXX to assess the 

prevalence of BVDv infection amongst New Zealand dairy herds. To interpret the bulk milk test, we 

compared the result with individual sero-prevalence estimates in some herds. 


Bulk milk vat samples from 350 herds across the country were obtained from the dairy companies and tested 

by BVD antibody ELISA in accordance with the manufacturer recommendations. Individual herd test milk 

samples (minimum 15) from 34 herds were subsequently tested by IDEXX BVD antibody ELISA for withinherd 

sero-prevalence estimation. 

Results 

Correlation between bulk milk ELISA and sero-prevalence estimates was remarkably high with R 2 equal to 

0.90. 

1.4 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

BTM BVD indirect Ab ELISA (S/P) 

R 2 = 0.90 

– + 

proportion of BVD antibody-positive cows 

0.0 

0% 20% 40% 60% 80% 100% 

Vat milk samples from thirteen South Island herds were also tested by PCR. Three herds with low bulk milk 

antibody ELISA results were PCR negative, while four of ten high antibody herds (top right corner: S/P > 1.1, 

equivalent to ~90% sero-prevalence) were virus positive on PCR. 


The national vat sampling and validation suggest that about one third of NZ dairy herds either harbour active 

BVD virus infection or have been infected recently (~90% sero-prevalence). Both Westland and Taranaki 

appear to have fewer BVD infected herds than other regions. 

References 

Houe, H., Lindberg, A., Moennig V. (2006) Test strategies in bovine viral diarrhea virus control and 

eradication campaigns in Europe. Journal of Veterinary Diagnostic Investigation 18 (5): 427-436. 

Niskanen, R. (1993) Relationship between the levels of antibodies to bovine viral diarrhoea virus in bulk tank 

milk and the prevalence of cows exposed to the virus. Veterinary Record. 133 (14): 341-344. 




PRELIMINARY EVALUATION OF NEOSPORA CANINUM ELISA KITS FOR USE WITH NEW ZEALAND 

MILK SAMPLES 

H. Voges. 

A preliminary investigation was undertaken to assess the application of an indirect ELISA to detect 

antibodies against Neospora caninum in milk samples from New Zealand dairy herds. 

To determine the optimal rate of milk sample dilution for the IDEXX HerdChek Neospora caninum Antibody 

ELISA, individual milk samples were tested raw vs 1:2 vs 1:4 and compared to serum ELISA results. While 

the area under the ROC curve did not differ between treatments (0.998 vs 1.000 vs 1.000 respectively), 

greatest separation between positive and negative sample results was achieved at the 1:2 dilution with 

excellent correlation (R 2 = 0.91) between serum and milk results. 

Subsequently 308 bulk milk samples were selected randomly from across New Zealand. After 1:2 dilution the 

samples were tested by HerdChek Neospora ELISA. Using a cut-off at S/P >0.6 – indicating 15%+ seroprevalence 

according to Bartels et al (2005) – 7% of herds were found to be positive. 

The milk samples were also tested with the LSI Bovine Milk Neospora Caninum ELISA kit in accordance with 

manufacturer’s recommendations. The results were strongly correlated with serum test results (R 2 = 0.89) as 

well as the HerdChek (individual and bulk) milk ELISA. However the negative milk samples gave very high 

optical density readings and the kit will require fine-tuning for New Zealand milk. 

This limited trial data shows that milk samples may be useful to identify Neospora infected cattle or high 

prevalence herds in New Zealand, although the tests need further validation to refine the test cut-off values. 


ELISA BASED ON RECOMBINANT E RNS PROTEIN MIXTURES FOR SERELOGICAL DIAGNOSIS OF 

CLASSICAL SWINE FEVER 

*Seong-In Lim, Jae-Young Song, Eun-Jin Choi, Byoung-han Kim, Jaejo Kim, In-Soo Cho, 

Hoo-Don Joo 1 , Byoung-Sik Chang 1 , Hyun-Jung Lee 1 

Virology Division, National Veterianry Research & Quarantine Service, Anyang, Korea. 

1 Jenobiotech, Co., Ltd., Chuncheon, Gangwon-do, Korea. 

Introduction 

The principle of marker vaccine strategy is that the antibodies of vaccinated animal can be distinguished 

from those of infected animal against classical swine fever (CSF) virus. Serologically the detection of a CSF 

infection after vaccination with a marker vaccine depends entirely on the discriminatory ELISA. Recently, 

although two conventional anti-E rns ELISAs were developed and commercialized, the two test kits showed 

considerable discrepancies in CSF antibody titer between different CSFV genotypes (Vet Microbiol., 2001, 

83:121-136). In this study, a discriminatory ELISA was developed to detect antibody against the second viral 

envelope glycoprotein E rns of CSFV. 

Material & Methods 

The respective recombinant E rns proteins of 3 different genotypes of CSFV strains were expressed by 

baculovirus expression system. The E rns blocking ELISA was performed with the three recombinant E rns 

proteins mixtures as coating antigens and HRP conjugated-monoclonal antibody (Mab) against E rns protein of 

CSFV. 

Results 

Our data showed that the ELISA detected CSFV-specific antibodies as early as 14 days after infections of all 

genotypes (1, 2, and 3) of CSFVs, respectively. The sensitivity and specificity of the developed ELISA were 

validated using 266 CSF antibody positive reference sera and 1,871 CSF antibody positive field sera. The 

discriminatory E rns blocking ELISA scored a sensitivity of 93.2 % and a specificity of 94.2 %. 


Although this discriminatory ELISA kit was less sensitive than conventional E2 ELISA, this ELISA kit could be 

an effective method to detect antibodies of pigs infected with 3 genotypes CSFV after vaccination with E2 

marker vaccine, respectively. 

References: 

1. Floegel-Niesmann G. Classical swine fever (CSF) marker vaccine Trial �. Evaluation of discriminatory 

ELISAs. Vet Microbiol 2001, 83:121-136. 

2. Konig M, Lengsfeld T, Pauly T, Stark R and Thiel HJ. Classical swine fever virus: Independent induction of 

protective immunity by two structural glycoproteins. J Virol 1995, 69:6479-6486 

3. Moormann RJ, Bouma A, Kramps JA, Terpstra C and De Smit HJ. Development of a classical swine fever 

subunit marker vaccine and companion diagnostic test. Vet Microbiol 2000, 73:209-219. 

4. van Rijn PA, van Gennip HG and Moormann RJ. An experimental marker vaccine and accompanying 

serological diagnostic test both based on envelope glycoprotein E2 of classical swine fever virus (CSFV). 

Vaccine 1999, 17:433-440. 

� 




DEVELOPMENT AND EVALUATION OF ELISA FOR DETECTING ANTIBODIES AGAINST CAEV 

Introduction 

M. KONISHI 1, *, T. YAMAMOTO 1 , T. SHIMADA 1 , H. SHIRAFUJI 1 , H. SENTSUI 2 , K. MURAKAMI 1 

1 National Institute of Animal Health, 2 Nihon university 

Caprine arthritis-encephalitis (CAE) is a persistent virus infection caused by CAE virus (CAEV), which 

belongs to retrovirus. Infected animals shed the virus all their lives, but most of them are symptomless, 

therefore early detection of antibody for CAEV is very important to control this disease. In Japan, the first 

case of CAE was recognized in 2002. Since then, we have developed agar gel immunodiffusion test (AGID) 

using maedi virus, which is closely related to CAEV, as antigen for diagnosis of the disease. Although AGID 

is simple to perform, it requires experience for reading weak positive reactors. Furthermore, preparing 

antigen for the AGID is laborious, and it is difficult to keep uniform quality among different lots. In order to 

overcome the disadvantage of the AGID, two ELISAs were newly established. One used whole virus particle 

of CAEV (wELISA), and the other used recombinant core protein precursor, p55 (rELISA) as coating antigen. 

Sera of 745 goats in Japan were tested by the three assays. To evaluate the performance of the ELISAs, 

sensitivities and specificities were calculated using the result of AGID as a reference. 


Preparation of antigen: 

1) AGID: Maedi virus was propagated in fetal lamb lung (FLL) cells. The virus was recovered from the 

supernatant of infected cells by ammonium sulfate precipitation followed by dialysis and dehydration. One 

percent of Triton-X 100 was added to the concentrated viral fluid. 

2) wELISA: CAEV was propagated in FLL cells, and was purified by density gradient centrifugation. Purified 

virus was resuspended in PBS, and was treated with NP-40. 

3) rELISA: P55, a precursor of core protein of CAEV, was expressed as His-Tag fusion protein. A gene 

encoding p55 was amplified from proviral DNA, which was extracted from infected FLL cells. The DNA 

fragment was cloned into an expression vector, pCold TF (TAKARA). The recombinant protein was 

recovered from the soluble fraction of E. coli and purified using a Ni-column. 

Sera: Sera of 745 goats were collected from 16 farms in 11 prefectures of Japan. 

Procedure of ELISA: Each ELISA was performed according to the conventional method of indirect ELISA. 

The optimal conditions of ELISAs were determined by checkerboard titration. Cut-off values were determined 

with the difference of OD values between positive and negative samples determined by AGID. 

Evaluation of ELISAs: Sensitivities and specificities were calculated using the result of AGID as a reference. 

The agreement between AGID and each ELISA was evaluated from the observed percentage of 

concordance and by Kappa statistic. 

Results 

AGID, wELISA and rELISA detected 38.7%, 45.4% and 48.9% as seropositives, respectively. Two hundred 

and thirty two sera were positive and 290 were negative by all the tests. AGID+/ELISAs- were 10, and AGID- 

/ELISAs+ were 24. Fifty-nine sera were positive only by wELISA, and rest of the 46 were negative only by 

one of the ELISAs. Sensitivities and specificities calculated for each ELISA were 0.88 and 0.82 for wELISA, 

and 0.89 and 0.76 for rELISA. Concordance percentages between AGID and ELISAs were 84.2% (wELISA) 

and 81.2% (rELISA). Kappa statistics of ELISAs were 0.68 (wELISA) and 0.62 (rELISA). 


The relative sensitivity and specificity of each ELISA for AGID were almost similar. The observed percentage 

of concordance showed good agreement value between AGID and each ELISA. It is still necessary to verify 

the reference by some other serological tests like Western Blot, however, the results presented here indicate 

that these ELISAs can be used for initial screening test to detect anti-CAEV antibodies and may be suitable 

for analyzing large numbers of samples. Since ELISA is suitable for analyzing large numbers of samples, the 

ELISAs, especially rELISA, which the antigen is easily prepared, could be useful for CAE surveillance 

combined with AGID. 

References 

Konishi, M. et.al. 2004, An Epidemic of Caprine Arthritis Encephalitis in Japan: Isolation of the virus. J Vet 

Med Sci. Aug; 66 (8):911-7. 


A DIAGNOSTICALLY USEFUL PEPTIDE TO DETECT WEST NILE VIRUS INFECTION IN HORSES 

J.M. Hobson-Peters a,b,c , P.G. Toye b , M.D. Sanchez d , K.N. Bossart c,e , L.F. Wang c,e , D.C. Clark a , 

W.Y. Cheah a , R.A. Hall a . 

a School of Molecular and Microbial Sciences, University of Queensland, St Lucia, Qld, Australia, 4072 

b AGEN Biomedical Ltd, Acacia Ridge, Qld, Australia, 4110 

c Australian Biosecurity CRC for Emerging Infectious Diseases, St Lucia, Qld, Australia, 4072. 

d Department of Microbiology, University of Pennsylvania, Philadelphia, PA U.S.A. 19104 

e CSIRO Livestock Industries, Australian Animal Health Laboratory, Geelong, Vic, Australia, 3220 

Introduction 

West Nile virus (WNV) is a mosquito-borne flavivirus responsible for recent outbreaks of fever and fatal 

encephalitis in humans and horses 1 . While highly virulent strains have been reported in Europe 2 and North 

America 3 , only a benign subtype of WNV, (Kunjin virus - KUNV), occurs in Australia. However, the presence 

of suitable vectors and reservoir hosts (birds) 4 , and the ability of WNV to spread between continents 5 , flag 

virulent WNV strains as a serious biosecurity threat to Australia. To compound this threat, the antigenic 

similarity between KUNV and exotic WNV strains will require highly specific serological assays to 

differentiate infections caused by the two viruses. The aim of this study was to identify diagnostically useful 

peptides in WNV proteins for incorporation into a rapid diagnostic assay for surveillance of exotic WNV 

strains in Australia. 

Materials and Methods 

6 

Panels of monoclonal antibodies were generated to the structural (prM/M and E) proteins of WNVNY99 and 

screened for their reaction to various WNV strains in ELISA. The conformation of the epitopes recognised by 

these antibodies was assessed by their reaction in Western blot after resolution of boiled, reduced and 

carboxymethylated viral antigens on SDS PAGE. The immunogenicity of the epitopes was also assessed by 

competition binding between Mabs and WNV-immune sera in a blocking ELISA. Site directed mutagenesis, 

amino acid sequence alignments, and synthetic peptides were then used to map the contact residues of 

immunogenic epitopes. Epitopes were then expressed as recombinant fusion proteins in mammalian cells 

and assessed for recognition by WNV- and KUNV-immune horse sera using Western blot. 

Results 

We identified a continuous (linear) epitope (WN19) that was highly immunogenic during equine WNV 

infection that mapped to a 19 amino acid sequence encompassing the WNV envelope (E) protein 

glycosylation site at position 154. Of six sera collected from horses experimentally infected with WNVNY99, 

four specifically bound peptide WN19. Four of six sera from horses with natural, subclinical infection with 

WNV also bound the peptide. Testing of four KUNV-immune horse sera revealed that three recognised 

peptide WN19. These three samples also had neutralizing antibodies to another Australian flavivirus called 

Murray Valley Encephalitis virus (MVEV). The sole sample that had KUNV-neutralizing antibodies, but not 

MVEV-neutralizing antibodies, did not react with the peptide. Failure of most (83%) of the immune sera to 

recognise the epitope as a synthetic peptide or as a degylcosylated fusion protein, also demonstrated that 

the N-linked glycan was critical for antibody recognition of the peptide. 

Conclusions 

Although peptide WN19 did not enable the clear differentiation between WNV and Australian flavivirus 

infections in horses, it shows potential as an antigen for incorporation into rapid WNV diagnostic assays. 

Further testing will be performed to determine whether the peptide is recognised by serum antibodies from 

other species infected with WNV, and can differentiate between WNV and KUNV infections. 

References 

1. van der Meulen, K.M., Pensaert, M.B., Nauwynck, H.J. (2005). Arch Virol 150, 637-57 

2. Tsai, T.F., Popovici, F., Cernescu, C., Campbell, G.L., Nedelcu, N.I. (1998). Lancett 352, 767-71. 

3. Hayes, E.B., and Gubler, D.J. (2006). Annu Rev Med. 57, 181-94 

4. Hall, R.A., Broom, A.K., Smith, D.W., Mackenzie, J.S. (2002). Curr Top Microbiol Immunol 267, 253-69. 

5. Lanciotti, R.S., Roehrig, J.T., Deubel, V., Smith, J., Parker, M., Steele, K., Crise, B., Volpe, K.E., Crabtree, 

M.B., Scherret, J.H., Hall, R.A., MacKenzie, J.S., Cropp, C.B., Panigrahy, B., Ostlund, E., Schmitt, B., 

Malkinson, M., Banet, C., Weissman, J., Komar, N., Savage, H.M., Stone, W., McNamara, T., Gubler, D.J. 

(1999). Science 286, 2333-7. 

6. Sanchez, M.D., Pierson, T.C., McAllister, D., Hanna, S.L., Puffer, B.A., Valentine, L.E., Murtadha, M.M., 

Hoxie, J.A., and Doms, R.W. (2005). Virology 336, 70-82 




NOVEL ANTIGENS FOR THE DIAGNOSIS OF BOVINE TUBERCULOSIS 

V. Meikle, I. Durante, A. Cataldi, A. Alito 

Biotecnología, CICV y A INTA Castelar 

e-mail: vmeikle@cnia.inta.gov.ar. 

Aims 

The aim of the present work was to assess the cellular immune response against recombinant antigens of M. 

bovis in experimentally and naturally infected animals through the measurement of gamma interferon (γIFN) 

release. 

Methods 

Fourteen surgically-castrated Fresian calves of 6 months of age from a tuberculosis-free herd were used. 

Two animals used as negative controls. 

Eighty-five Fresian diary cows of two herds from Provincia de Buenos Aires with positive bovine PPD and 28 

diary cows with negative PPD were used. 

The selected recombinant proteins were: CFP10, ESAT6, Rv1636, Rv0138, Rv2524c, EsxV, Rv3740, HspX, 

TPX, Rv2624c, L7/L12, Rv3747, TrbB. γIFN release was measured and Specificity and Sensibility was 

assessed. 

Results 

All infected animals showed high levels of γIFN production when stimulated with DPP. 

Both CFP10 and ESAT6 showed high levels of γIFN throughout the infection (98 days). The stimulation rates 

were similar to those of DPP and in some cases even higher. No cross reaction with any M. avium protein for 

CFP10 was detected. TPX, Rv2624c and TrbB did not stimulate at the beginning of the infection; when they 

stimulated, the stimulation was not continuous but with high levels. TrbB stimulated from week 6 until the end 

of the assay. Rv2624c showed lower stimulation. It is induced by hypoxia as it is the case of HspX (Sherman 

D. et al., 2001). In naturally infected animals, EsxV could differentiate positive from negative animals. The 

combination of Rv1636/HspX and ESAT6/CFP10 reached 100% specificity and sensibility, and 

EsxV/Rv1636/Rv2524 showed 100% specificity and 67% sensibility. TPX, TrbB, Rv2624c, Rv3747 and 

L7/L12 reached specificities between 67 and 100% and sensibilities between 76 and 85%. 

Discusion 

The response of ESAT6 and CFP10 could show a persistence response throughout time, so it would be 

advisable to use these antigens for the diagnosis of TB. TPX, Rv2624c and TrbB seem to be involved at 

more advanced stages of infection. 

The combination of different recombinant antigens increased the sensibility of the assay, which proves that 

the combination of diverse epitopes influence the stimulation of more T-clones. 

Taking into account these results, we think it necessary for the diagnosis of the bovine tuberculosis through 

an γIFN test to evaluate different combinations of antigens, combining antigens that sense diverse stages of 

the infection. 

Bibliography 

-Young DB (1990) Stress proteins and the immune response. Antonie Van Leeuwenhoek. 58(3):203-8. 

Sherman DR, Voskuil M, Schnappinger D, Liao R, Harrel. 

-MI, Schoolnik GK. (2001) Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding 

alpha-cristallin. Proc Natl Acad Sci USA. 2001 Jun 19;98(13):7534-9. 

-Daniel J, Deb C, Dubey VS, Sirakova T, Abomoelak B, Morbidoni H. Induction of a novel class of 

diacylglycerol acyltranferases and triacyl glycerol accumulation in Mycobacterium tuberculosis as it goes into 

a dormancy-like state in culture. J Bacteriol. 2004 Aug;1986(15):5017-30. 

-Lin MY Lack of immune responses to Mycobacterium tuberculosis DosR regulon proteins following 

Mycobacterium bovis BCG vaccination. Infect Immun. 2007 Jul;75(7):3523-30. 


PRELIMINARY VALIDATION OF A NEW COMMERCIAL ELISA KIT FOR THE DETECTION OF 

ANTIBODIES DIRECTED AGAINST CHLAMYDIA ABORTUS 

P. Pourquier 1 , S. Lesceu 1 , A. Rodolakis 2 , K Yousef Mohamad 2 

1 ID VET, Montpellier France 

2 National Agronomie Research Institute (INRA), Nouzilly, France 

Introduction and Objectives: 

Serological diagnosis of Chlamydia abortus may be acheived by the complement fixation test (CFT) or by 

ELISA. These tests, which use LPS or whole bacteria as antigens, generally present low specificity and 

sensitivity levels, and cross reactions are often observed with Chlamydia pecorum. 

The aim of this study was to perform a preliminary validation of a commercial peptide-based ELISA 

developed by ID VET (www.id-vet.com) for the detection of anti-Chlamydia abortus antibodies in ovine and 

caprine sera. 


The test is an indirect ELISA. The antigen is a synthetic peptide from a major outer-membrane protein 

specific to Chlamydia abortus. The conjugate is an anti-ruminant peroxidase. 

Methods: 

Serum samples from sheep herds with and without a history of abortions (n=10 and 26 respectively) were 

tested for C percorum by microimmunofluorescence, and for C. abortus by the ID Screen® ELISA. 

Sheep herds, naturally or experimentally-infected with C. pecorum (n=17 and 20 respectively), were also 

tested using the two techniques. 

Sensitivity was tested through the analysis of 8, C. abortus-infected animals by CFT and by the ID Screen® 

ELISA (n=8). 

Results: 

With the ID Screen® ELISA: 

- None of the animals from the abortion-free herd were found positive. 

- None of the 17 naturally-infected C. pecorum animals were found positive (10 of these animals were 

found doubtful when tested for C. pecorum, and 7 were found positive). 

- Only 3 out of 20 animals, experimentally-infected by C. pecorum, were found positive. 

- All sera with a CFT titre superior or equal to 1/20 were found positive. 

- An excellent correlation was obtained between CFT titres and S/P values. 

Conclusion: 

Through the use of a synthetic peptide antigen, the ID Screen® Chlamydia abortus Indirect ELISA reduces 

the number of cross-reactions with C. percorum while maintaining high sensitivity. 

It is an excellent tool for the specific detection of anti-C. abortus antibodies in ruminant sera. 




PRELIMINARY VALIDATION OF A NEW COMMERCIAL DIAGNOSTIC TEST FOR THE DETECTION OF 

ANTI-EQUINE INFECTIOUS ANEMIA VIRUS (EIAV) ANTIBODIES IN HORSE SERA 

P. Pourquier 1 , L. Comtet 1 , S. Rosati 2 

1 ID VET, Montpellier, France 

2 Facoltà di Medicina Veterinaria,Torino, Italy 

Introduction and Objectives: 

Equine infectious anemia (EIA) is an infectious and potentially fatal viral disease caused by the equine 

infectious anemia virus (EIAV). Serology is often used to control and monitor this disease. 

The aim of this study was to perform a preliminary validation of a commercial ELISA developed by ID VET 

(www.id-vet.com), ID Screen ® Equine Infectious Anemia Indirect, for the detection of anti-EIAV antibodies in 

horse sera. 


The test is an indirect ELISA using a p26/Tm recombinant antigen (1) and an anti-horse-peroxidase conjugate. 

Wells are coated with GAG and Transmembrane TM recombinant antigens. 

Methods and Results: 

Specificity was evaluated by testing 594 disease-free horse populations from France and Italy by AGID (Agar 

Gel ImmunoDiffusion) and by the ID Screen ® ELISA. Both techniques gave negative results for all samples, 

giving a measured specificity of the ID Screen ® test of 100% (IC95% 99.8 - 99.99 %). 

Sensitivity was evaluated by testing 24 AGID positive sera from France, Italy, the Czech Republic and the 

USA. All sera were found positive with the ID Screen ® test, giving a measured sensitivity of 100%. 

Detectability was evaluated by testing 10 repetitions of the OIE international standard (2) . All were 

found positive. 

Conclusion: 

The ID Screen ® ELISA is an effective, reliable and rapid tool for the specific detection of anti-EIAV antibodies 

in horse sera. 

References: 

(1) ROSATI S., et al.2004. Development of recombinant capsid antigen / transmembrane epitope fusion 

proteins for serological diagnosis of animal lentivirus infections. Journ. Vir. Methods, 121, 73-78. 

(2) OIE International Reference Equine Infectious Anemia (Ecole Nationale Vétérinaire, 7 avenue du Général 

de Gaulle, 94704 Maisons-Alfort Cedex, France). 


APPLICATION OF IMMUNOMAGNETIC BEAD TECHNOLOGY FOR IMPROVED DIAGNOSIS OF 

CLASSICAL SWINE FEVER IN A LOW TECHNOLOGY SETTING 

J.V. Conlan* 1 , A. Colling 2 , C.J. Morrissy 2 , L.J. Gleeson 2 , C.R. Wilks 3 and S. Khounsy 1 

1 National Animal Health Centre, Department of Livestock and Fisheries, Vientiane Capital, Laos; 2 CSIRO Livestock Industries, 

Australian Animal Health Laboratory, Geelong, VIC Australia; 3 Faculty of Veterinary Science, University of Melbourne, Parkville, VIC 

Australia 

Introduction 

Classical Swine Fever (CSF) is a highly contagious viral disease that causes major losses to pig production 

in many parts of the world. CSF virus is a member of the genus Pestivirus of the family Flaviviridae and is 

closely related antigenically to other Pestiviruses; Bovine Viral Diarrhoea (BVD) virus and Border Disease 

(BD) virus. Laboratory testing is required to make a definitive diagnosis of CSF due of the difficulty of making 

a diagnosis based solely on clinical signs. Immunomagnetic bead (IMB) technology offers an alternative solid 

phase for the reliable and rapid detection of analyte in a diagnostic specimen. The research presented 

outlines the development and assessment of two tests using this technology: an enzyme immunoassay for 

the near-to-field detection of classical swine fever (CSF) virus antigen and a blocking ELISA for the detection 

of antibodies to CSF. 


Anti-pestivirus polyclonal capture antibody was covalently bound to the carboxyl modified surface of 

immunomagnetic beads (IMBs) (Spherotech, USA) to capture solubilised antigen from tissue samples. 

Monoclonal antibody (Mab) specific for the E2 protein of CSF virus was used to detect captured antigen and 

visualisation was achieved by adding horse-radish-peroxidase conjugate followed by TMB substrate (Sigma 

Aldrich, USA). The immunoassay for antigen detection was developed in a dropper bottle kit format for use 

near-to-field. The antigen capture immunoassay was further developed into a laboratory based blocking 

ELISA for the detection of antibodies using a Lao CSF virus strain as the standard antigen. 

Results 

The near-to-field antigen capture test was shown to have performance characteristics similar to an antigen 

capture ELISA, 100% diagnostic sensitivity and greater than 90% diagnostic specificity. The advantage that 

this test has over other more conventional tests is the simplicity, speed and cost. No sophisticated laboratory 

equipment is required and a result can be read by eye with a high level of inter-operator agreement. The 

blocking ELISA for the detection of antibodies to CSF virus is also rapid to perform and has excellent 

performance characteristics in comparison to a commercial ELISA (Cedi Diagnostics, The Netherlands) and 

the “gold standard” neutralising peroxidase linked assay (NPLA). 

Conclusions 

In Laos, where these tests were developed, CSF is endemic and outbreaks have adverse effects on the 

predominantly smallholder farming sector. Immunomagnetic bead technology is adaptable and versatile and 

can provide a platform for appropriate diagnostic test development in a low technology setting. The near-tofield 

test is inexpensive, portable and a reliable test that requires minimal training to implement and will 

improve diagnostic services for pig farmers. The blocking ELISA for antibody detection shows strong 

agreement with the ‘gold-standard’ NPLA and could be a valuable tool for monitoring vaccine uptake. 




LABORATORY EVALUATION OF THE APPROPRIATE VACCINATION PROGRAMS AGAINST 

NEWCASTLE DISEASE IN BROILER CHICKENS UNDER FIELD CONDITIONS IN MOSUL PROVINCE 

(IRAQ). 

A. Abdul -A had Shamaun * O.S. Beyon * A.M.SHAREEF** 

*Department of Pathology, College of Veterinary Medicine, Mosul, Iraq 

** Department of Veterinary Public Health, College of Veterinary Medicine, Mosul, Iraq 

Four experiments were conducted to examine the efficiency of 4 different Newcastle disease (ND) field 

vaccination programs. For all experiments young broiler chickens were obtained from breeder flocks 

regularly vaccinated against ND. 

The following vaccination programs were applied to 128000 broilers (four broiler flocks programs ,with of 

about 8000 broilers flock): 

1-Vaccination at 1 day of age with lentogenic Hitchner B1/spray with oil emulsion vaccine /SC; 7,14,25,35 

and 45 day old with Lasota/drinking water; 2- Vaccination at 1 day of age with oil emulsion vaccine /SC; 

7,14,25,35 and 45 day old with Lasota/drinking water; 3- Vaccination at 1 day of age with hitchner B1/spray 

7,14,25,35 and 45 day old with Lasota/drinking water;4- No vaccination at 1 day of age ; 7,14,25,35 and 45 

day old with Lasota/drinking water. 

In all experiments, 20 randomly chosen birds from each of 16 broiler flocks were bled just prior to vaccination 

and tested for Newcastle disease antibody by hemagglutination inhibition test(HI).Serological data indicated 

that the greatest response was found by appling the first program, when 1 day old chicks were vaccinated 

with combined Hitchner B1/spray and oil emulsion 


DEVELOPMENT OF THE RESAZURIN MICROTITER ASSAY 

FOR ASSESSMENT OF ANTI-SURRA DRUG 

Raadan Odbileg 

Animal trypanosomiasis (Surra) caused by Trypanosoma evansi is endemic through out Asia, Middle East, 

Africa and South America. Currently, Surra is on the list of notifiable diseases of OIE. With scant economic 

resources available for antiparasitic drug discovery and development, inexpensive, and high-throughput 

assays to screen potential new drugs are essential. A quantitative colorimetric assay using the resazurin 

was developed to measure the cytotoxicity of compounds against T. evansi. To validate the assay, the 

experimental conditions were adjusted, such as number of parasites, dye concentration, and time of 

incubation, with respect to linearity and lower limit of detection. We found that absorbances increased 

linearly, with the plating density of parasites as low as 2x10 5 /ml ~ 9x10 6 /ml per well when they were 

incubated for 5 to 48h at 37°C in the presence of 10% resazurin solution (2 mM). When the cytotoxicity of 

the reference drugs Samorin, Antrycide and Suramin were measured with this assay and compared to the 

microscopic counting method, the same range is obtained, demonstrating that the resazurin microtiter assay 

is valid for the screening of new trypanocidal compounds. Furthermore the emergence of resistance against 

major drug for the control of trypanosomiasis is now serious and increasing problem. The potential of this 

assay in detecting drug resistant trypanosome to some trypanocidal drug is also promising by subjecting 

these parasites to series of drug dilutions. Therefore, to evaluate a potential anti-trypanosomal drug 

candidate, resazurin microtiter assay was found reliable, simple, fast, sensitive and cheap, and could be 

easily automated for high-throughput screening. 



Aims 


WILD BIRDS – NATURAL RESEVOIR OF NEWCASTLE DISEASE VIRUS, IN ROMANIA 

Graziela NEAGOE¹, Iuliana ONIŢĂ¹, Adriana NEICUŢ¹, OLARU E. ¹, 

Aurelia IONESCU¹, DIACONU Cl. ¹ DONESCU D. ¹, Gina DRAGOMIR¹ 

1 Institute for Diagnosis and Animal Health 

In Romania, during 2005 –2006, within the framework of Reference National Laboratory for Avian Influenza 

and Newcastle Disease from Institute for Diagnosis and Animal Health were tested samples collected from 

449 wild birds from 34 different species. 

The purpose of this workpaper is to distinguish the role of wild birds like important factor for spreading of 

Newcastle disease virus. 

Methods 

Samples were represented by tracheal and cloacal swabs, tissues. Brain and intestine samples were 

processed separately from other organs. 

Have been used virus isolation on allantoic cavity of 9-11- day – old embryonating fowl eggs and virus 

identification by haemagglutination inhibition test with specific antiserum from OIE and National Reference 

Laboratory for Avian Influenza and Newcastle disease, Istituto Zooprofilattico delle Venezie, Italy. The 

assessment of virus virulence was done by intracerebral pathogenicity index (ICPI) using 0.05 ml of diluted 

virus injected intracerebrally into each of ten chicks hatched from eggs an SPF flock. 

Results 

From 449 wild birds, 338 were negative, 37 positive for avian influenza virus (1 wild duck, 21 swan, 2 pigeon, 

1 Fulica atra, 2 crow, 7 wild goose, 1 dabchick, 1 heron) and 14 for Newcastle disease virus (2 swan, 6 

pigeon, 1 Fulica atra, 1 seagull, 1 dabchick, 1 stork, 2 partridge) 

ICPI values are comprised between 1.60 and 1.86 and belong to velogenic pathotype. The high values have 

been observed at partridge – 1.86, swan – 1.77, Fulica atra and pigeon – 1.75. There are not ICPI values 

less 1.6 in samples collected from wild birds. 

Those 14 wild birds positive at Newcastle disease virus are originated from 11 villages of 7 counties (Arges, 

Bucureşti, Constanta, Ilfov, Mehedinţi, Tulcea, Vrancea). 

Conclusions 

ICPI high values recorded at those 14 wild birds which are diagnosed with Newcastle disease framed the 

strains in velogenic pathotype. 

ICPI demonstrated the pathogenicity of isolates which circulated in Romania in wild birds, correlated with 

Newcastle disease outbreaks in fowls, in same time and area. 

The isolation and identification of Newcastle disease virus in wild birds from Romania suggested that these 

represent a natural reservoir of Newcastle disease virus. 


AUSTRALIAN STRAINS OF BOVINE HERPESVIRUS 1 ARE GENETICALLY HOMOGENOUS. 

* X.Gu 1 P.D. Kirkland 1 , R.J. Davis 1 , C.L.Hornitzky 1 . 

1 Virology Laboratory, Elizabeth Macarthur Agricultural Institute, Camden, NSW, Australia 

Introduction 

Viruses belonging the bovine herpesvirus 1 (BHV-1) group cause respiratory and reproductive disease. In 

Australia neither severe respiratory disease nor abortion has been observed. It has been claimed that the 

restricted and less severe clinical manifestations observed in Australian cattle are due to an absence of the 

BHV1.1 and 1.2a subgroups 1 . The purpose of this study was to examine the characteristics of a large 

collection of Australian BHV-1 isolates. 


Bovine herpesviruses from a diversity of geographical locations in Australia and isolated over a 30 period 

from different clinical presentations were examined. Genetic analyses employed digestion of semi-purified 

viral DNA by restriction enzymes (RE) followed by agarose gel electrophoresis and antigenic characterisation 

involved immunoperoxidase (IPX) staining with monoclonal antibodies that were either pan-reactive or 

specific to a sub-group 1,2 . RE profiles were developed for 121 Australian bovine strains and 9 overseas 

reference strains - 5 of BHV-1.1, 2 of BHV-1.2a and 2 of BHV-1.2b. One buffalo isolate (BHV-2), 2 BHV-5 

strains, 1 caprine isolate (GHV) and 1 equine isolate (EHV-1) were included for comparison. Antigenic 

analyses were conducted on 164 isolates by IPX staining of antigens in virus-infected, formalin fixed cell 

culture monolayers with a panel of 3 IBR specific monoclonal antibodies 2,3 . 

Results 

None of the Australian viruses examined had RE profiles that were indicative of the BHV-1.1 subgroup. The 

RE profiles conclusively showed that all of the Australian isolates belong to the BHV-1.2b subgroup (IPVlike) 

and were also readily distinguishable from viruses in the BHV1-2a subgroup. All of the viruses reacted 

in the IPX assays with the BHV-1 group-reactive monoclonal antibodies. Although some of the monoclonal 

antibodies were claimed to be subtype specific, a presumptively BHV-1.1 reactive mAb sometimes reacted 

with Australian viruses from the BHV-1.2b subgroup. It is of some interest that these viruses came from 

clusters in 3 discrete geographical areas. 


Although Australian viruses were examined over a 30 year time period and from a range of clinical 

presentations, no isolates of BHV1.1 were identified. The results support the claim that all Australian strains 

of BHV1 belong to the BHV1.2b subgroup. The clinical presentations observed in Australia, notably the 

absence of abortigenic strains and those associated overseas with severe outbreaks of respiratory disease, 

are consistent with these findings. While a previous study 4 had suggested that variant strains of BVH-1 had 

recently been found in Australia, indistinguishable strains, isolated almost 20 years earlier, were identified in 

the present study. 

References 

1. Brake F, Studdert MJ (1985): Molecular epidemiology and pathogenesis of ruminant herpesviruses 

including bovine, buffalo and caprine herpesviruses l and bovine encephalitis herpesvirus. Aust Vet J, 

62:331-334. 

2. Metzler AE, Matile H, Gassmann U, Engels M, Wyle R (1985): European isolates of bovine herpesvirus 1: 

a comparison of restriction endonuclease sites, polypeptides, and reactivity with monoclonal antibodies. Arch 

Virol 85: 57-69 

3. Rijsewijk FA, Kaashoek MJ, Langeveld JP, Meloen R, Judek J, Bienkowska-Szewczyk K, Maris-Veldhuis 

MA, van Oirschot JT (1999): Epitopes on glycoprotein C of bovine herpesvirus-1 (BHV-1) that allow 

differentiation between BHV-1.1 and BHV-1.2 strains. J Gen Virol, 80:1477-1483. 

4. Smith GA, Young PL, Reed KC: Emergence of a new bovine herpesvirus 1 strain in Australian feedlots. 

Arch Virol 1995, 140:599-603. 




INTERFERENCE IN DISEASE DIAGNOSIS 

IN PIGS BY PESTIVIRUS CROSS-REACTIONS 

R. R. Clough*, A. McFadden, J. Wang, K. Tham, W. Garrod, T. Haydon, D. Orr, 

R. Kittelberger, M. Hannah, K. Garnett, J. Jenner, W. Stanislawek, 

S. Cork, P. Bingham, C. Pigott 

Investigation and Diagnostic Centre-Wallaceville, MAF Biosecurity New Zealand, Upper Hutt, New Zealand 


Heterologous pestiviruses can cross-react in various serological assays 1,2 and therefore may interfere with 

determination of exotic disease status. By using a case study in pigs, we aimed to show that antibodies to 

pestiviruses can cross-react in CSF ELISAs that are claimed by manufacturers to be highly specific. 

Methods used in this investigation included three commercial classical swine fever (CSF) virus enzymelinked 

immunosorbent assays (ELISA) (IDEXX Herdcheck CSFV blocking, Pourquier CSF-Ab blocking, Cedi 

Ceditest CSFV 2.0 blocking) and a porcine reproductive and respiratory syndrome (PRRS) virus antibody 

detecting ELISA (IDEXX HerdChek PRRS 2XR), plus in-house bovine virus diarrhoea (BVD), CSF and 

Border disease/hairy shaker disease (BD/HSD) virus neutralization tests (VNT), CSF, BVD and porcine 

circovirus type 2 (PCV-2) polymerase chain reactions (PCR), necropsy, virus isolation and histopathology 

(subcontracted to the Institute of Veterinary, Animal and Biomedical Sciences, Massey University, NZ). 

During an exotic disease investigation with differentials of CSF and PRRS, serological tests indicated in 2 of 

19 pigs the presence of antibodies to CSF virus by a commercial competitive ELISA, and to BVD and CSF 

viruses by VNTs. Virus isolation from tissues of three affected pigs resulted in only PCV-2 being isolated 

(confirmed by PCV-2 PCR), and histology demonstrated results most consistent with post-weaning 

multisystemic wasting syndrome (PMWS). To Investigate the CSF serology results an additional 109 pigs 

were sampled, which was sufficient to estimate a prevalence



AN UNUSUAL CASE OF INFECTIOUS LARYNGOTRACHEITIS VIRUS DETECTION 

IN A BACKYARD POULTRY FLOCK 

B.G. Corney*, S.M. Ossedryver, I.S. Diallo, G.R. Hewitson, A.J. De Jong, M.X. Tolosa, M.A. Kelly, B.J. Rodwell. 

Biosecurity Sciences Laboratory, Department of Primary Industries and Fisheries, Yeerongpilly, Queensland 4105, Australia. 

Introduction 

Infectious laryngotracheitis is a notifiable (in Queensland) respiratory disease of poultry. It is caused by an 

Alphaherpesvirus, Gallid herpesvirus 1 (Guy & Bagust, 2003; Roizman, 1982) commonly known as infectious 

laryngotracheitis virus (ILTV) (Roizman, 1982). Current dogma is that ILTV replication occurs exclusively in 

the respiratory tract and conjunctiva (Guy & Bagust, 2003). No viremic phase has been documented, and 

attempts at virus detection generally utilise samples collected from the respiratory tract and conjunctiva (Guy 

& Bagust, 2003). We report here an unusual case where ILTV was detected in cloacal swabs, but not 

trachea, collected from a hen with respiratory disease. 


A sick layer hen from a backyard flock presented with poor body condition, head swelling, congestion of the 

comb, severe bilateral conjunctivitis, swelling over the right orbital fossa and greenish watery diarrhoea. The 

bird was necropsied and tissues and swabs were collected for histology, bacteriology, virus isolation and 

molecular tests for a range of bacterial and viral pathogens. 

Results 

Histology revealed moderate congestion and subcutaneous oedema of the comb and congestion of the 

kidney. Mycoplasma pullorum was isolated from a tracheal swab. Avibacterium (Pasteurella) gallinarum was 

isolated from several sites. Av. (Haemophilus) paragallinarum was also detected in several sites by real-time 

PCR. ILTV was detected in a cloacal swab but not in fresh trachea by real-time PCR. ILTV was also isolated 

from the cloacal swab only. The isolates were identified as herpesvirus by electron microscopy and ILTV by 

real-time PCR. The bird was diagnosed as having clinical conjunctivitis involving Av. paragallinarum, Av. 

gallinarum and ILTV. 


The occurrence of ILTV in cloacal and faecal samples is not an entirely new finding (Creelan et al., 2006). In 

the case reported herein, ILTV was detected in cloacal but not tracheal samples. The presence of ILTV was 

initially demonstrated by real-time PCR and confirmed by virus isolation and sequencing. 

Kirkpatrick et al. (2006) describes ILTV genotypes exhibiting considerable variation in their tropism for 

trachea or conjunctival tissue. The bird examined in this case probably had a strain of ILTV with preferential 

tropism for the conjunctiva, causing clinical conjunctivitis in association with or complicated by the other 

bacterial organisms identified here, without overt tracheal pathology. Av. paragallinarum was detected by 

real-time PCR but not by culture probably due to overgrowth of the culture plates by other bacteria. The 

presence of Av. paragallinarum was confirmed by sequencing. 

Detection of ILTV in nonrespiratory sites is a rarity. This may be a reflection of current sampling strategies for 

ILTV detection (Guy & Bagust, 2003) rather than the actual occurrence of ILTV at these sites. Reassessment 

of current sampling strategies for ILTV may be warranted based on these findings, especially as birds 

shedding ILTV in faeces could act as a source of infection for other birds and possibly as a reservoir of 

infection in otherwise healthy flocks. 

References 

Creelan, J.L., Calvert, V.M., Graham, D.A. and McCullough, S.J. (2006). Avian Pathology 35, 173-179. 

Guy, J.S. and Bagust, T.J. (2003). Laryngotracheitis. In: Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, 

L.R. McDougald and D.E. Swayne (Eds), Diseases of Poultry, 11 ed, Iowa State University Press, Ames, 

Iowa, USA, pp. 121-134. 

Kirkpatrick, N.C., Mahmoudian, A., Colson, C.A., Devlin, J.M. and Noormohammadi, A.M. (2006). Avian 

Pathology 35, 449-453. 

Roizman, B. (1982). The family Herpesviridae: general description, taxonomy, and classification. In: B. 

Roizmann (Ed), The Herpesviruses, Vol. 1, Plenum Press, New York, pp. 1-23. 


CLINICO- PATHOLOGICAL STUDIES ON CLASSICAL SWINE FEVER VIRUS IN NATURALLY 

OCCURRING OUTBREAKS IN UNVACCINATED SWINE HERDS OF PUNJAB (INDIA). 

H. Kumar, V. Mahajan. S. Sharma and K.S. Sandhu. 

Department of Epidemiology and Preventive Veterinary Medicine, Guru Angad Dev Veterinary and Animal Sciences University, 

Ludhiana. 

Study was conducted to investigate and to confirm the outbreaks of classical swine fever and to formulate 

control strategies to check the spread of disease. Three outbreaks of classical swine fever (CSF) were 

investigated in different swine herds of Punjab (India). All herds were located in the district of Ludhiana but in 

different villages (Lopo, Haibowal and Changran) approximately at a distance of 20 km apart. A team of 

expert visited the places of outbreaks and conducted detailed investigations. About 2 ml blood samples were 

collected in heparinized vials for haematological examination and 0.5ml in nutrient broth for bacteriological 

isolation. Rectal temperature of infected and healthy animal was recorded in each herd. Dead animals were 

subjected to detailed post mortem examination. Tissues from kidney, lymph nodes, lungs, liver, intestine and 

brain were collected in 10% formalin for histopathology and in 50% glycerol saline (kidney, lymph nodes, 

intestine and tonsil) for virological studies. Confirmation of CSF virus in the tissues was made by RT-PCR. 

There were 125 pigs in all the three herds and 13 pigs died out of 32 pigs infected with classical swine fever 

virus. Over all morbidity, mortality and Case fatality rate observed were 25.6 % (32/125), 10.4 % (13/125) 

and 40.62% (13/32). Clinically, most of the affected animal were showing high fever; erythema of the skin of 

the ears, abdomen, medial thighs; and greenish watery diarrhea. Some of the animals were exhibiting 

staggering gait. Haematologically, all the infected animals were showing leucopenia and relative 

lymphocytosis. Postmortem lesions observed were intestinal ulcers (button ulcers); congestion, multifocal 

hemorrhages and infarcts of the spleen; enlarged, edematous, and hemorrhagic lymph nodes; and petechial 

hemorrhages on the kidneys. Sub capsular hemorrhages in kidneys and chronic necrotic enteritis were the 

significant histological lesions observed histopathologically. Perivascular cuffing and leptomeningitis was 

observed in brain. Lungs were showing haemorhages and bronco pneumonia. Samples subjected to RT- 

PCR revealed positive reaction confirming presence of classical swine fever virus. 




BOVINE LYMPHOTROPIC HERPESVIRUS (BLHV) IN THE UK 

*G Ibata, B Nash, J Peake, J P Frossard, F Steinbach and M Banks 

Veterinary Laboratories Agency, UK 

Introduction 

BLHV is a gamma herpesvirus, which had until recently only been described in the USA, and showed a 

tentative link with enzootic bovine leukosis (EBL) (3). It was first detected in the UK in December 2005 in 

dairy cattle presenting non-responsive post-partum metritis (NPPM), indicating the possible involvement of 

BLHV (2). A small scale investigation on 13 farms (2) provided evidence to support this hypothesis. 

Bovine leukaemia virus (BLV) is the causative agent of EBL and it has been suggested that BLHV may be a 

co-factor in the pathogenesis of EBL (3). To investigate this, BLHV positive samples were screened to 

ensure the samples were negative for BLV. 

Tissues from UK slaughterhouse carcasses from enlarged, caseous or tumorous lymph nodes are regularly 

received at the VLA for BLV detection from suspect EBL cases. These cattle had neither BLV involvement, 

nor any other indication of disease and were therefore considered to be a good source of material for BLHV 

screening. 

Also available for BLHV testing was a series of 158 EDTA bloods from a non UK herd that were BLV 

positive. 


A nested PCR was employed using pan-herpesvirus primers DFA, ILK, TGV, IYG and KG1 (4) on DNA 

extracted from samples of vaginal mucus and swabs from NPPM cattle and from the slaughterhouse 

samples and foreign cattle samples indicated above. All BLHV positive samples were tested for BLV proviral 

DNA by PCR. Selected positive BLV and pan-herpes PCR amplicons were sequenced and assessed 

phylogenetically. The remaining pan-herpes positives were confirmed as BLHV by HindIII digestion; noncutting 

amplicons were sequenced as above. 

Results 

In 9/13 herds suffering from NPPM at least one animal tested positive for BLHV and one BLHV negative 

animal from a BLHV positive herd, tested positive for BoHV4. 

27% of the vaginal exudates and swabs were positive for BLHV. There was close DNA sequence (474 nt.) 

homology between the UK isolates (96.6-100%) and to the USA isolates (97.7-100%). 

All 95 UK EBL submissions were negative by BLV PCR, 53 submissions were positive to BLHV (56%) and 

all were confirmed as BLHV by sequence analysis or HindIII digestion. 

EBL submissions were received from17/25 Animal Health Divisional Offices. BLHV virus was detected in 

samples from 13 of these regions. BLHV positives submissions were from animals aged 2 to 16 years. 

All 60 UK BLHV positive cases were negative for BLV. 

All 158 non UK EBL submissions were positive for BLV; 81 (51%) of these were positive for BLHV. 


• BLHV virus is present in cattle of all ages from across the UK and was detected in samples from 

abroad. 

• BLHV can be detected in blood and lymph nodes, and in vaginal exudates from cases of NPPM. 

• BLHV has been detected in BLV-positive tissues. 

• The UK BLHV prevalence cannot be determined from this study, but was high in the samples 

examined. 

• BLHV infection does not appear to predispose to the progression to BLV-induced lymphosarcoma as 

suggested earlier (3), but could play a role in non-BLV lymphomas. 

• To investigate a possible association of BLHV with lymphoid tumours, lymphoid tissue from tumour 

negative animals will be screened. 

References 

1. M. Banks, G. Ibata, A.M. Murphy, J.P. Frossard, T.R. Crawshaw and D.F. Twomey, (2007) The 

Veterinary Journal, in press. 

2. S.P. Cobb, M. Banks, C. Russell, and M. Thorne, Veterinary Record 158 (2006), pp807-808. 

3. J. Rovnak, S.L Quackenbush, R.A. Reyes, et al. (1998) Journal of Virology 72 pp. 4237-4242. 

4. D.R. Van Devanter, P. Warrener, L. Bennett, et al. (1996) Journal of Clinical Microbiology. 34 pp.1666- 

1671 

Introduction 


REPRODUCTION OF PMWS OF HIGH MORTALITY WITH A PORCINE CIRCOVIRUS 

TYPE 2-GROUP 1 ISOLATE 

A. Cheung 1* 

, K. Lager 1 

, P. Gauger 1 

, A. Vincent 1 

, T. Opriessnig 2 

, M. Kehrli, Jr. 1 

1 

National Animal Disease Center, Ames, Iowa, USA, 50010; 

2 

Iowa State University, Ames, Iowa, USA, 50011 

In late 2005, sporadic cases of an acute onset of high mortality disease were observed in growing pigs 

among USA swine herds. PCV2-group 1 (Gp1) virus was consistently detected among the affected animals. 

Phylogenetic analysis showed that the PCV2 isolates from the United States until late 2005 belonged to 

PCV2-group 2 (Gp2) (1,2). The objective of this study was to examine the pathogenic capability of Gp1 and 

Gp2 viruses in germ-free pigs. 


Virus. Infectious viruses were generated from bacterial plasmids containing Gp1 and Gp2 nucleotide 

sequences. The viral genomes were excised from the bacterial plasmids after delivered into PK15 cells via 

lipofectamine transfection. Infectious viruses were recovered from the transfection cell cultures after 1 week. 

Experimental design. Pigs were derived under sterile conditions and maintained germ-free in isolators. The 

pigs were fed a sterile milk diet and at 12 days of age (day 0 of the experiment) were given an intranasal 

inoculation of either Gp1 virus, Gp2 virus or cell culture medium. The pigs were monitored for clinical signs 

with a plan of euthanizing all pigs 41 days-post-inoculation. 

Results 

Mortality of the infected pigs in 2 independent experiments with Gp1 was 50% (6/12 pigs) and 100% (4/4 

pigs), respectively. In one experiment, Gp1 (4/4 pigs) was found to be more virulent than Gp2 (1/4 pigs). The 

most significant lesions observed in the diseased pigs were depletion and replacement of lymphoid follicles 

by macrophages, and severe vacuolar degeneration and necrosis of hepatocytes with multifocal areas of 

hemorrhagex. Abundant PCV2 antigen was detected in tissues of affected pigs. In our analysis, no other 

microorganisms were detected in the animals throughout the experiment. Since the viruses used in this 

study were derived from cloned DNA, we presume the clinical effects were attributed to the respective virus 

isolate. 


Here, we report reproduction of PMWS of high mortality in germ-free pigs by a Gp1 virus alone and without 

immune stimulation or co-infection with another infectious agent (3,4). In this study, the Gp1 isolate was 

more pathogenic when compared to the Gp2 isolate identified in the same 2005 United States outbreak. In 

our analysis, no other microorganisms were detected in the affected pigs. 

References 

1. Olvera A, Cortey M, Segales J. (2007) Molecular evolution of porcine circovirus type 2 genomes: 

phylogeny and clonality. Virology 357: 175-185. 

2. Cheung A, Lager K, Kohutyuk O, Vincent A, Henry S, Baker R, Rowland R, and Dunham A. (2007) 

Detection of two porcine circovirus type 2 genotypic groups in United States swine herds. Arch Virol 

152:1035-1044 

3. Ellis J, Krakowka S, Lairmore M, Haines D, Bratanich A, Clark E, Allan G, Konoby C, Hassard L, Meehan 

B, Martin K, Harding J, Kennedy S, McNeilly F. (1999) Reproduction of lesions of postweaning multisystemic 

wasting syndrome in gnotobiotic piglets. J Vet Diagn Invest 11:3-14. 

4. Krakowka S, Eillis J, Meehan B, Kennedy S, McNeilly F, Allan G. (2000) Viral wasting syndrome of swine: 

experimental reproduction of postweaning multisystemic wasting syndrome in gnotobiotic swine by 

coinfection with porcine circovirus 2 and porcine parvovirus. Vet Pathol 37:254-263 




AN UPDATE ON SEROPREVALENCE OF PORCINE REPRODUCTIVE AND RESPIRATORY 

SYNDROME IN MALAYSIA 

*JASBIR S. 1 , KAMARUDDIN M.I. 2 AND HASSAN L.. 3 

1 

Veterinary Research Institute, 59, Jalan Sultan Azlan Shah, 31400 Ipoh, Perak MALAYSIA 

2 

Department of Veterinary Services Head Quarters, 62630 Putrajaya MALAYSIA 

3 

Faculty of Veterinary Medicine, Universiti Putra Malaysia, Serdang, Selangor MALAYSIA 

*jasbir@jphvri.gov.my 

Introduction 

Porcine reproductive and respiratory syndrome (PRRS) is one of the most prevalent pig diseases in the 

world. It has swept across most of countries during the past two decades and brought enormous economic 

loss to the pig industry. The first laboratory confirmed case of PRRS in Malaysia was reported in 1997 

(Jasbir et al. 1997). The PRRS virus is suggested to be the primary cause of porcine respiratory disease 

complex (PRDC) in pigs (Thacker, 2001). This paper reports an update in the PRRS serological status of pig 

herds in Malaysia. 


Out of the 670 pig farms in Peninsular Malaysia, 50 farms were selected randomly from major production 

areas in the country using stratified sampling methods to represent all the major production areas. A total of 

15 blood samples were collected from each farm, five samples from sows and 10 samples from porkers of 

age >4 months to avoid interference with maternal antibodies. A questionnaire on herd health and 

management practices was administered at the farms. The blood samples were tested by a commercial 

ELISA antibody test kit (Idexx, Inc.) at the Veterinary Research Institute, Ipoh and the results were analysed 

using the xChek software programme (Idexx, Inc.). 

Results 

None of the farms selected in this study vaccinate their animals against PRRS. From the total of 735 blood 

samples tested from the 50 farms, 613 (83.4%) of the samples and 47 (94%) of the farms were positive for 

PRRS antibodies. The results demonstrate widespread occurrence of the PRRS viral agent among the pig 

population in the country. Pig farms with good biosecurity were also not spared from PRRS. However, there 

was a lack of clear clinical signs of the syndrome observed in most of the seropositive pigs, indicating a 

probable subclinical infection. 


PRRS appears to be endemic in Malaysia, however very few farms vaccinate their animals against PRRS. 

The high seroprevalence of PRRS in the country clearly mimics the occurrence of the syndrome in many 

other parts of the world. A previous serological survey of PRRS conducted in 1996 indicated that out of 1990 

blood samples tested from 100 pig herds in the country, 1195 (60.1%) of the samples and 93 (93%) of the 

herds were tested positive for PRRS antibodies (Jasbir et al., 1996). The comparison between the years 

shows that the prevalence of PRRS in the country has remained almost the same even after a decade. 

PRRS has been suggested as a major co-factor of porcine multisystemic wasting syndrome (PMWS) [Kim et 

al., 2007]. A concurrent serological study in the state of Perak on porcine circovirus type 2 (PCV2), the 

probable causative agent of PMWS has suggested a high prevalence of the syndrome. Using a commercial 

ELISA test kit (Synbiotic SERELISA PCV2 antibody test, France), 9 of 15 pig herds (60%) tested were 

seropositive for PCV2 antibodies. Many of the pig farms in the country have poor hygiene, farm 

management and biosecurity and these factors may contribute to the high prevalence of the two syndromes 

in the country. 

Acknowledgement 

The author thanks the FAO for support to attend the WAVLD symposium and the Department of Veterinary 

Services (DVS), Malaysia for permission to publish this abstract. Appreciation is also extended to all DVS 

staff who contributed in the collection of organ and blood samples and to Komala T., Nisha T.G., Kong S.L. 

for help in the bench work. 

References 

1. DH Kim, S Kim, SW Wang, et al. (2007) Serological Prevalence of Porcine Reproductive and Respiratory 

Syndrome virus by ELISA in 2005/2006 in South Korea. In: Proc. 3 rd Congr Asian Pig Vet Soc. p. 93. 

2. Jasbir S, Hussin A.A., Murdan Z.A. and Too H.L. (1996). Porcine reproductive and respiratory syndrome in 

Malaysia. - In: Proc 8 th Vet Assoc Malaysia Sc Congr, p. 72-75. 

3. Jasbir S., Chen K.S. and Kono Y. (1997). Isolation and characterisation of Porcine reproductive and 

respiratory syndrome virus in Malaysia. - In: Proc 9 th Vet Assoc Malaysia Sc Congr, p. 27-29. 

4. Thacker EL. (2001). Immunology of the porcine respiratory disease complex. Vet Clin North Am Food 

Anim Pract. 17(3):551-65. 


INVESTIGATIONS OF NODAVIRUS INFECTIONS OF AUSTRALIAN BASS 

KE Arzey* 1 , Y Lele 1 , S Vrankovic 1 , DS Fielder 2 , KR King 1 , X Gu 1 and PD Kirkland 1 


2 Port Stephens Fisheries Centre, NSW DPI, Taylor’s Beach NSW Australia 

Introduction 

In 2004, nodavirus infection was diagnosed for the first time as the cause of high mortality in a batch of 

Australian bass larvae hatched and reared in captivity for ultimate release into rivers and dams for 

recreational fishing. To protect wild populations, a program of testing of hatchery reared larvae/fingerlings for 

piscine nodavirus was initiated prior to release into the wild. However, little is known about the status of wild 

populations or the epidemiology of nodavirus in Australian bass. In 2006, a batch of Australian bass larvae 

were tested and found to be infected with nodavirus. This prevented the release of the larvae into the wild 

but provided an opportunity to assess the persistence of nodavirus infection in the batch and to compare 

virus detection methods. This paper presents the results of this investigation. 


Samples from a batch of approximately 50,000 larvae were initially collected at 22 days post spawning and 

tested for evidence of nodavirus infection. Sections of formalin fixed eyes and brains (150 larvae) were 

examined by histopathology and RNA extracts from homogenates of 150 whole larvae (in pools of 10) were 

tested in a nested reverse transcriptase polymerase chain reaction (nRTPCR) 1 . When it was found that the 

broodstock pool had inadvertently included fish that had tested positive for nodavirus 2 years before, release 

of the larvae was suspended and further testing undertaken. At 3 months of age 500 fingerlings were 

sampled for intensive testing (in pools of 5) by nested PCR, virus isolation in cell culture and later in a real 

time RTPCR (qPCR) assay that was developed during the course of this study. Further samples of 1-200 

fingerlings were collected at 6, 11, 12 and 13 months and examined by qPCR, virus isolation and, at times, 

histopathology. Virus isolation was conducted by inoculating near confluent monolayers of SSN-1 cells with 

clarified homogenates of eyes and brains (usually from individual fish). Cultures were passaged up to 3 

times at intervals of 7 days. These homogenates were also tested in the qPCR. This assay was based on 

Taqman technology with primer sequences that were conserved across all nodavirus sequences lodged in 

Genbank and from the nodaviruses isolated from barramundi and bass in Australia and used an appropriate 

fluorogenic probe to match a region within the amplified sequence. From time to time histopathology was 

conducted on sections of formalin fixed paraffin embedded sections using conventional methods. 

Results 

There was no evidence of nodavirus infection in the samples of larvae that were examined by histopathology 

and nested RTPCR at 22 days post spawning. However, at 3 months, nodavirus was isolated in cell culture 

from each of the pools of fingerlings tested. At 6 months, virus isolation was conducted on 100 individual 

fingerlings and each was found to be infected with nodavirus. Each of the 3 & 6 month samples were also 

found to be positive by qPCR. About one third of the 3 month samples gave a positive result in the nRTPCR. 

At 11 - 13 months, nodavirus was detected in a smaller proportion of fingerlings by both virus isolation and 

qPCR. The results indicate that the qPCR has higher sensitivity than virus isolation. Despite the initial very 

high incidence of infection, there was no clinical evidence of disease or histological lesions in the 

larvae/fingerlings at any time. Sampling and testing are continuing. 


Subclinical nodavirus infection has been described 2 in commercially farmed halibut in Norway that were 

survivors of a natural outbreak of viral encephalopathy and retinopathy (VER) and the virus was shown to be 

still viable in these fish 9 -12 months after hatching. This longitudinal study of Australian bass naturally 

infected with nodavirus has shown that the virus can persist in clinically normal fish for at least 12 months. 

Virus isolation was a more sensitive method than the conventional nested RTPCR for nodavirus detection. 

However, the real time RTPCR used in this study has very high sensitivity, perhaps more sensitive than virus 

isolation, and will be a valuable tool for the detection of nodaviruses in fish. 

References 

1. Moody NJ, Horwood PF and S McHardy (2004) FRDC Project No 2001/626 

2. Johansen R, Grove S, Svendsen AK, Modahl I and B Dannevig (2004) J Fish Dis. 24: 327-341 


Funding for this project was provided by the NSW Recreational Fishing Trust and NSW DPI. We are 

indebted to Drs R. Reece and S. Hum for assistance with histopathology. 




DIAGNOSIS AND COUNTERMEASURE OF ALVEOLAR ECHINOCOCCOSIS IN RED FOXES UTILIZING 

LOCAL RESOURCES IN JAPAN 

M. Kamiya 1 and J.T. Lagapa 1,2 

(1) OIE Reference Laboratory for Echinococcosis and Laboratory of Environmental Zoology, Department of Biosphere and 

Environmental Sciences, Faculty of Environmental Systems, Rakuno Gakuen University, Bunkyodai-Midorimachi 582, Ebetsu, Hokkaido 

069-8501, Japan 

(2) Animal Disease Diagnostic Laboratory, Surgery and Zootechnics, College of Veterinary Medicine, Central Mindanao University, 

Musuan, Bukidnon, 8710, Philippines 

The paper describes successful field diagnosis and countermeasures against Echinococcus multilocularis in 

red foxes utilizing intravital coproantigen examination and anthelmintic laced bait made from local resources. 

Local residents through their Nonprofit Organizations (NPO) initiated the baiting campaigns with the 

assistance of Forum on Environment and Animals, a Limited Liability Company founded by our laboratory. 

This novel concept of using local resources such as manpower, fish-waste products and finances by NPO’s 

for diagnosis and control led to what is known as “endogenous development”. This is seen as a key to a 

wider and sustainable control campaigns against echinococcosis in Hokkaido, Japan. 

Initial prevalence rate of Echinococcus infection in foxes was determined in Koshimizu, Hokkaido (200 km 2 ) 

in 1997. Annual fecal collection for diagnostic purposes and bait distribution were assumed by a local NPO 

(Okhotsk Sanctuary) from 2002 to 2006. Baits were made using fish-waste products and fortified with 

praziquantel (50 mg/bait). Prevalence rates in fox feces were assessed annually using coproantigen ELISA. 

In Kutchan, Hokkaido (100 km 2 ), a local residents’ NPO (WAO) initiated fecal collection to assess prevalence 

rates in 2005. From May to November, 2006, about 1,500 praziquantel-fortified baits were distributed 

monthly by the NPO at specific locations guided by a GIS-based map. 

Initial prevalence rates in Koshimizu in 1997 were 51.6-66.7%. Fecal examinations conducted in 2006 

revealed a zero coproantigen prevalence rate after annual bait distribution by local residents. In Kutchan, a 

coproantigen prevalence rate of 21% was registered during baseline surveys. Seven months after 

continuous baiting, the� prevalence rates of taeniid egg and coproantigen positive feces dropped to 0% and 

2%, respectively. The findings suggests a control initiative against alveolar echinococcosis by targeting the 

sources of infection which are the red foxes, the major definitive hosts. Baiting campaigns initiated by local 

residents using anthelmintic-laced baits and intravital diagnostic techniques by coproantigen examination 

conducted by FEA indicated a successful and sustainable approach in the elimination of alveolar 

echinococcosis in Japan. 


SMART FIELD SAMPLING FOR DIAGNOSIS OF ECHINOCOCCOSIS IN WILDLIFE DEFINITIVE HOST 

USING GIS-BASED MAPS 

J.T. Lagapa 1,2 , Y. Oku 3 , M. Kaneko 4 and M. Kamiya 1 

(1) OIE Reference Laboratory for Echinococcosis and Laboratory of Environmental Zoology, Department of Biosphere and 

Environmental Sciences, Faculty of Environmental Systems, Rakuno Gakuen University, Bunkyodai-Midorimachi 582, Ebetsu, Hokkaido 

069-8501, Japan 

(2) Animal Disease Diagnostic Laboratory, College of Veterinary Medicine, Central Mindanao University, Musuan, Bukidnon, 8710, 

Philippines 

(3) Laboratory of Parasitology, Graduate School of Veterinary Medicine, Hokkaido University, Kitaku, Kita 18-jo Nishi 9 chome, Sapporo, 

Hokkaido 060-0818, Japan 

(4) Laboratory of Environmental Geographic Information System (GIS), Department of Biosphere and Environmental Sciences, Faculty 

of Environmental Systems, Rakuno Gakuen University, Bunkyodai-Midorimachi 582, Ebetsu, Hokkaido 069-8501, Japan 

Field sampling of fecal samples from wild red foxes for the diagnosis of echinococcosis requires an intensive, 

costly and laborious field works. To deplete these factors, Geographic Information System (GIS)-based maps 

on potential distribution of environmental contamination by eggs of Echinococcus multilocularis from feces of 

infected foxes were made in Nopporo Forest Park, Hokkaido, Japan. It has been known that red foxes used 

their feces as landmarks at their foraging habitats. Present study aimed to determine exact locations of fecal 

contamination using Global Positioning System (GPS) and to create seasonal distribution maps using GIS 

software. Exact location of fox feces was recorded (+50 cm) by a handheld GPS (Pathfinder Pro XR; 

Trimble) using ArcPad 6 software (ESRI). Data were fed into a computer using Microsoft Active Sync 

program. Seasonal distribution maps of fox feces were created using ArcView 8 software package (ESRI). 

Data indicated changes in foraging habitats of foxes as evidenced by fecal landmarks and were tested for 

fast and easy field sampling of wild fox feces. Digital map was downloaded to a hand-held GPS and enabled 

the researcher to reach the site with ease and accuracy and a higher probability of finding fox feces. This 

novel method reduced the required time to collect fecal samples for diagnosis by 80%.These GIS-based 

maps could also be utilized in optimizing bait distribution for cost-effective intervention and in monitoring 

control programs or re-emergence of the disease over time. Our study indicates a novel system that provides 

a smart field sampling technique for the diagnosis of E. multilocularis in wild fox population. 




Mycoplasma mycoides subsp. capri ASSOCIATE WITH GOAT RESPIRATORY DISEASE AND HIGH 

FLOCK MORTALITY 

Hernandez A. L 1 , Lopez J 2 , St-Jacques M 2 , Ontiveros CL1, Acosta J 1 , Handel K 2 . 

1 CENID-Microbiología INIFAP-SAGARPA, Bacteriology Laboratory, Carretera Libre México-Toluca, Km 15.5 Palo Alto, Cuajimalpa D.F. 

ZC. 05110, México. 2 National Centre for foreign animal Disease, Canadian Food Inspection Agency, 1015 Arlington Street Winnipeg, 

Manitoba R3E 3M4. 

Introduction 

A number of Mycoplasma species has been associated with caprine respiratory disease, but some of the 

most virulent ones are Mycoplasma capricolum subsp. capripneumoniae (Mccp), M. mycoides subsp. 

mycoides Large Colony Type (MmmLC) and M. mycoides subsp. capri (Mmc). All these mycoplasmas share 

genomic and antigenic features, which result in very closely similar biochemical and serologic properties, 

making precise identification of individual isolates a difficult task and contributing to confusion among 

diagnosticians. The prevalence and relative importance of Mycoplasma infection in Mexico is not known. By 

this reason the objectives were isolate and identify the mycoplasmal organisms causing pneumonia in goats. 


An outbreak of respiratory disease occurred in a herd of 2000 Sannen dairy goats in the State of Durango, 

Mexico. This was a closed, intensive milk production flock. Due to increased demand for goat milk, animals 

of different breeds were imported from Canada and the USA, approximately 6 months before the start of the 

outbreak. Initially 200 animals died over a period of 15 d and after 6 months, the flock mortality had reached 

40%. Animals of all ages were affected, although they were most adults. The clinical picture was 

characterized by fever, abundant nasal secretion, difficult breathing, prostration, ear drop, and low milk 

production. Fourteen animals were necropsied. 

Results 

Grey, red, or both, areas of consolidation were seen in the lungs, affecting 1 or more lobes. All animals 

showed marked pleuritis and pleural effusion. The cut surface of some affected lungs revealed a fine 

granular texture with hepatisation. The histopathologic findings were consistent with proliferative interstitial 

pneumonia. Mycoplasma growth from pleural and fluid and lung samples was evident after 48 and 72 h 

incubation in Friis medium. To rule out the possibility that the outbreak might have been caused by the exotic 

Mycoplasma, the PCR-PstI digestion was followed, using DNA templates obtained from all the Mycoplasma 

isolates and directly from the pleural fluid and lung tissue. The isolates were identified as Mycoplasma 

mycoides subsp. capri. 


A high mortality outbreak of respiratory mycoplasmosis occurred in goats in Mexico. The clinicopathologic 

presentation resembled contagious caprine pleuropneumonia caused by Mycoplasma capricolum 

subspecies capripneumoniae. By using a battery of polymerase chain reaction assays, the Mycoplasma 

associated with this outbreak was identified as Mycoplasma mycoides subsp. capri. The prevalence and 

relative importance of Mmc infection in Mexico is not known. There is only 1 report of this condition in the 60s 

and, at the time, it was thought to be the first report of CCPP in the Americas. 

References 

Dedieu L, Mady V, Lefevre PC. Development of a selective polymerase chain reaction assay for the 

detection of Mycoplasma mycoides subsp. mycoides S.C. (contagious bovine pleuropneumonia agent). Vet. 

Microbiol 1994;42:327-339. 

Friis NF. Mycoplasmas cultivated from the respiratory tract of Danish pigs. Acta Vet Scand 1971;12:69-79 

Hotzel H, Sachse K, Pfützner H. A PCR scheme for differentiation of organisms belonging to the 

Mycoplasma mycoides cluster. Vet. Microbiol 1996;49:31-43. 

Solana P, Rivera E. Infection of goats in Mexico by Mycoplasma mycoides var capri. Ann NY Acad Sci 

1967;143:357-363. 

Thiaucourt F, Bölske G, Leneguersh B, Smith D, Wesonga H. Diagnosis and control of contagious caprine 

pleuropneumonia. Rev Sci Tech 1996; 15:1415-1429. 


RESERVOIR OF WEST NILE VIRUS AND ANOTHER ENCEPHALITIS VIRUS IN MEXICAN BATS 

(Desmodus rotundus). 

S. Cuevas*, A. Alvarado, P. Mejia, G. Colmenares, M. Camara (INIFAP-CENIDM-Mexico), N. Nemeth. (CDC-Fort Collins 

Colorado,USA) R. Navarro, Y. Barrera (CPA-SAGARPA-México), A. L. Salgado, G. Estrada, (UTMB-USA), E. Cruz (ZOOMAT-INHE). 

Introduction 

West Nile virus (WNV) is a flavivirus endemic in Africa, the Middle East and in South-western Asia. In North 

America the initial outbreak of WNV was reported in New York City in August 1999 with deaths reported in 

humans, horses and numerous species of birds. In the spring of 2003, the first WNV isolate found in Mexico 

was obtained from a raven in the southeastern state of Tabasco. The current study focused in determining 

the potential role of the hematofagous bat (Desmodus rotundus) might play as potential reservoir in the 

transmission cycles of WNV in Mexico. Insert text 


Eighty bats captured from southeastern Mexican state of Chiapas were tested for reservoir potential of WNV. 

Previous to the experimental procedures all serum samples were screened for antibodies to WNV by plaque 

reduction neutralization tests (PRNT) and other arbovirus and assured free flavivirus antibody response. 

Those results plus experimental data are presented here. We also tested some brain tissues to WNV by 

Real time-PCR (TIB-Molbiol, Berlin, Germany) and Rabies virus by fluorescent antibodies test. 

Results 

All serum samples were negative to presence of WNV, St. Louis encephalitis virus (SLEV) and EEV 

antibodies. Twelve brain samples of the 80 Desmodus rotundus bats were tested negatives to presence of 

WNV by a commercial kit to Rapid Cycle Real Time PCR (TIB-Molbiol, Berlin, Germany) and also these 

samples were negatives to fluorescents antibodies to Rabies virus. 


These finding suggests that Desmodus bats collected from an endemic WNV zone in Mexico, probably 

suggests a limited interaction between WNV and bats in the transmission cycle. 

References 

J. Wildl Dis, 2006, 42(2) 455-8. A survey for West Nile virus in bats from Illinois. Bunde JM, Heske EJ, et al. 

J. Wildl Dis, 2004, 40(2) 335-7. West nile virus antibodies in bats from New Jersey and New York. Pilipski 

JD, Pilipski LM, et al. 

Am J Trop Med Hyg. 2005,73(2):467-9.Experimental and natural infection of North American bats with West 

Nile virus. Davis A, Bunning M, et al. 

Stream: Diseases of Wildlife PresentationType: Poster 

Presenting Author: Sandra Cuevas Romero cuevas.julieta@inifap.gob.mx 




SEROEPIDEMIOLOGY OF THE ARBOVIRUS OF CRIMEAN- CONGO HEMORRHAGIC FEVER IN 

RURAL COMMUNITY OF BASRA 

Adel Alyabis* ,Hassan .J.Hasony 

*Laboratory Department ,Microbiology and Serology Sub department ,General Hospital ,Basra, Iraq. 

Key words; Seroepidemiology 

Introduction and objectives 

In 1979 cases of Crimean-Congo Hemorrhagic Fever (CCHF)were recognized in Iraq ,following years 

several cases of CCHF were diagnosed in Basra, southern Iraq. Aseroepidemiological survey was carried 

out in rural community of Basra to estimate the size of the enzootic focus in which the CCHF virus is 

circulating . A total of 682 serum samples were collected from apparently healthy individuals, their ages 

range from 5 to76 years , 20% of the collected sera were obtained from occupational risk groups 

(veterinarians , abattoirs workers , farmers).Sera collected from 74 sheep and 48 cattle , 42 tick pools 

were also gathered parallel to the human and animals sera in the same areas. 


Enzyme-linked immunosorbent assay (Elisa), was used to detect the prevalence of circulating IgG antibodies 

in the collected sera. 

Results 

In general IgG antibodies against CCHFV were found in 4.3% of the resident in rural areas of Basra, 

Seropositive sera were detected in 9.7% of northern residents , while 20% of the sheep sera and 37% of 

cattle sera were seropositive which indicate that the virus is circulating in the area within the endemic level . 

The tick pools were identified , the predominant tick species was diagnosed as Hyaloma marginatum. 


The existence of enzootic focus for the CCHFV is maintained by ecological , socioeconomic variables , the 

possibility of emerging infections should always be considered. 

References 

1.AL-Tikriti Sk. Crimean -Congo Hemorrhagic Fever in Iraq. Bull WHO 1981;59:58-90. 

2.Tantawi HH. Moslih IM. Hassan Fk .Crimean –Congo Hemorrhagic Fever .Al-Mthana House Baghdad , 

Iraq.1980;1-60. 

3.WHO Viral Hemorrhagic Fever. Report of WHO scientific Committee , series 1985 ;No.716. 

4.Hoogstral H.Tick Borne Crimean-Congo Hemorrhagic Fever; Handbook series of Zoo noses (ed) In chief 

Steel JH. 1' ed., section B., Viral Zoo noses , volume 1.Baron Gw.Florida Boka,Raton 1981;267-402. 

5.Gonzalis JB,Legunoo B,Gulland M,A fatal case of Crimean-Congo Hemorrhagic fever virus in Muritania, 

Virological &Serological Suggestion, Epidemic transmission Trans Roy Soc.Trop Med Hyg1990:84(4);573- 

576. 


SURVEILLANCE PROGRAM FOR NEWCASTLE DISEASE CONDUCTED SINCE 1998 IN ARGENTINA 

C. ESPINOSA 3 , M. V. TERRERA 3 , R. De BENEDETTI 3 , P. BORGNA 3 , E. PARRADO 3 1, 2 

and C. BUSCAGLIA 

1 

Cátedra de Zootecnia Especial III (Aves y Piliferos), Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata. CC 296 

(B190AVW) La Plata. Argentina. E-mail: cb235@yahoo.com 

2 Comisión de Investigaciones Científicas de la Prov. Buenos Aires. Argentina. 

3 SENASA, Buenos Aires, Argentina 

Newcastle Disease (ND) was diagnosed for the first time in Argentina in 1961. The last outbreak of the 

disease produced by a velogenic strain was reported in the province of Entre Rios in 1987.The aim of the 

epidemiological surveillance is to establish the presence or absence of antibodies or virus of ND in all the 

avian population There are two regions in the country where the samples are obtained: a) region A that 

include the avian population in the border with Brazil, Bolivia, and Paraguay, and b) region B that include the 

rest of the provinces of the country. 

This study is part of the prevention program of AI and velogenic ND in Argentina that includes the avian 

populations such as backyard chickens, commercial poultry, all the controls for importation and exportation 

of live birds and the samples obtained since 1998/. More than 30.000 sera samples and tracheal or cloacal 

swabs were tested by ELISA and/ or HI, and for virus isolation in embryonated SPF eggs respectively. The 

results were negative for velogenic NDV. 




PURIFICATION OF A HERPES-LIKE VIRUS IN ABALONE 

(HALIOTIS SPP) AND DETECTION BY TRANSMISSION ELECTRON MICROSCOPY 

Jianming Tan 1 , Malcolm Lancaster 1 , Alex Hyatt 2 , 

Rosemary van Driel 2 , Frank Wong 1 , Simone Warner 1 

1 Department of Primary Industries, 

475 Mickleham Rd, Attwood,VIC 3049, Australia 

2 CSIRO, Livestock Industries, Australian Animal Health Laboratory, 

5 Portarlington Rd, Geelong, VIC 3220, Australia 

A herpes-like virus was successfully purified from abalone diagnosed with ganglioneuritis on the south coast 

of Victoria, Australia. Pleuropedal ganglia, pedal nerve cords, head and epipodial tissue were collected and 

homogenized from abalone populations exhibiting high mortality and clinical signs consistent with herpes-like 

virus ganglioneuritis. After ultracentrifugation using a discontinuous 10-60% sucrose gradient, a total of five 

visual bands appeared at each of the five interfaces of the sucrose gradient. Herpes-like viral particles were 

mainly found at the 40-50% interface, and to a lesser extent at the 50-60% sucrose interface, as determined 

by examination of negatively stained preps on a transmission electron microscope (TEM). The virus particles 

were observed to have icosadeltahedral capsids, and many of the capsids appeared to be surrounded by a 

single envelope with numerous spikes on the external surface. The naked nucleocapsid ranged from 92 to 

109 nm, and the enveloped particle was approximately 150 nm in diameter. In order to determine the 

buoyant density of the virus, isopycnic gradient centrifugation was performed using both potassium tartrate 

and caesium chloride gradients. Using this technique, the buoyant density of the herpes-like virus was 

determined to be 1.17 and 1.18 g/mL, respectively. 

This is the first report to successfully purify herpes-like virus from infected abalone using ultracentrifugation. 

A clear result was obtained using the sucrose gradient, which reinforced its effectiveness in purification of 

the abalone herpes-like virus, where further purification with other gradients appeared unnecessary. The use 

of sea-water as the gradient buffer was critical in the preliminary purification of the virus. 

This approach to successfully purify herpes-like virus from infectious abalone establishes a firm ground for its 

further investigation in research, including the classification, identification and pathogenic studies of the 

virus. The appearance of the virus was observed clearly in negative staining by TEM, despite contamination 

by cellular debris. The quality and purity of the resultant virus was amenable to follow-on work including 

DNA extraction and sequencing. 


GENETIC HETEROGENEITY OF BOVINE VIRAL DIARRHOEA VIRUS (BVDV) ISOLATES FROM ITALY: 

IDENTIFICATION OF NEW BVDV-1 GENOTYPES 

M. Giammarioli, C. Pellegrini, E. Rossi, G.M. De Mia * 

Istituto Zooprofilattico Sperimentale dell’Umbria e delle Marche, Perugia (Italy) 

Introduction 

Bovine viral diarrhea virus (BVDV) belongs to the genus Pestivirus with classical swine fever virus and 

border disease virus in the Family Flaviviridae. Presently two species of BVDV are recognised. BVDV-1 

infection occurs worldwide involving mainly respiratory, reproductive and enteric organs. BVDV-2 causes 

similar clinical signs as BVDV-1, except that infection with highly virulent isolates may lead to fatal 

haemorrhagic syndrome. Genetic typing of BVDV has usually been performed using sequences from the 5’- 

UTR, N pro and E2 regions. Sequence analysis of 5’-UTR can distinguish BVDV-1 and BVDV-2 and can 

subdivide BVDV-1 into at least eleven genetic groups (3). Genetic typing of BVDV-2 isolates has not been as 

extensive and at present, only two to four genetic groups of BVDV-2 have been described. 

Studies on the prevalence of BVDV in Italy have been conducted providing evidence of circulation of five 

BVDV-1 genotypes (1). BVDV-2 circulation has been reported in cattle as well (2). To better define the 

genetic pattern within BVDV Italian isolates we studied a broad range of BVDV isolates. Our genetic study 

has been based on the 5’-UTR. 

Materials & Methods 

Eighty-eight BVDV strains have been collected mainly during a period of 8 years (2000-2007) from 12 Italian 

regions. The viruses were mostly from cattle (n=81), buffalo (n=3) and sheep (n=4). The samples have been 

originated from individual dead animals as well as persistently infected animals. The genomic region 

encoding the highly conserved 5'-UTR of the pestivirus genome was amplified using primers 324 and 326 

flanking a 288 bp DNA fragment (4). Nucleotide sequences were determined by cycle sequencing three 

independent cDNA clones. Sequences were aligned using the Clustal X (version 1.83) analysis program and 

were proof read using the BioEdit version 7.0.0. Phylogenetic trees was calculated using the Phylip (version 

3,66) program package based on the neighbor joining algorithm. Visualization of the phylogenetic trees was 

performed using TREEVIEW, version 1.6.6. 

Results 

All the 88 viruses were sequenced in the 5’-UTR. Genetic typing revealed that 83 isolates were BVDV-1 and 

the topology of the tree indicates that they belonged to 7 distinct genotypes namely respectively BVDV-1a 

(n=8), BVDV-1b (n=37), BVDV-1d (n=3), BVDV-1e (n=22), BVDV-1f (n=4), BVDV-1g (n=4) and BVDV-1h 

(n=5). Non-bovine isolates were all typed as BVDV-1. 

Five viruses that originated from Lombardia and Basilicata were typed as BVDV-2 and may be grouped into 

two distinct phylogenetic groups BVDV-2a (n=4) and BVDV-2b (n=1). 


The aim of this work was to study the genetic variability of a broad range of BVD viruses circulating in Italy. 

For this purpose an extensive collection of 88 BVDV isolates collected all over the country, has been 

investigated by genetic typing, providing further evidence for the heterogeneity of BVDV. 

At the subgroup level, pair wise similarity and cluster analysis provided a clear-cut assignation to 7 distinct 

genotypes of 83 isolates typed as BVDV-1. Most cattle farms were infected by the predominant BVDV-1b 

and BVDV-1e isolates,the others genotypes occurred only sporadically. The results also provided evidence 

for circulation of BVDV-1a and BVDV-1g additional genotypes, which have been never shown before in Italy. 

Five field viruses were typed as BVDV-2 and were clustered into the genotypes BVDV-2a and BVDV-2b. It 

should be mentioned that in Italy little is done to prevent the spread of BVDV, nevertheless the emergence of 

BVDV-2 in the field is very uncommon supporting the hypothesis of a iatrogenic infection in relation with 

contaminated vaccines. In summary, the results presented in this work revealed a high BVDV genetic 

heterogeneity in Italy. This is the result of the absence of any BVDV systematic control measures. Indeed, in 

Italy there is no BVDV national control program and the management practices such as cattle trade and 

movement, expose cattle herds to a high risk of introduction of BVDV infection as well as of new genetic 

variant of BVDV as a consequence of a high diversity of BVDV. 

References 

1. Falcone, E., Cordioli, P., Tarantino, M., Muscillo, M., La Rosa, G., Tollis, M., 2003. Genetic heterogeneity 

of bovine viral diarrhea virus in Italy. Vet. Res. Commun. 27, 485-494. 

2. Luzzago, C., Bandi, C., Bronzo, V., Ruffo, G., Zecconi, A., 2001. Distribution pattern of bovine viral 

diarrea virus strains in intensive cattle herds in Italy. Vet. Microbiol. 83, 265-274. 

3. Vilček, Š., Ďurkovič, B., Strojni, L., Ibata, G., Moussa, A., Loitsch, A., Rossmanith, W., Vega, S., 

Scicluna, M.T., Palfi, V., 2001. Bovine viral diarrhea virus genotype 1 can be separated into at least 

eleven genetic groups. Arch. Virol. 146, 99-115. 

4. Vilček, Š., Ďurkovič, B., Kolesàrovà, M., Greiser-Wilke, I., Paton, D., 2004. Genetic diversity of 

international bovine viral diarrhea virus (BVDV) isolates: identification of a new BVDV-1 genetic group. 

Vet. Res. 35, 609-615. 




GENETIC CHARACTERISATION OF BORDER DISEASE VIRUS ISOLATED FROM CHAMOIS 

S.Vilcek 1* , K. Willoughby 2 , P.F. Nettleton 2 

1 University of Veterinary Medicine, Kosice, Slovakia; 2 Moredun Research Institute, Pentlands Science Park, Penicuik, Midlothian EH26 

0PZ, UK 

Introduction 

Border disease virus (BDV) belongs to four well recognised Pestivirus species, family Flaviviridae. A recent 

antigenic and genetic analysis of new pestiviruses isolated from sheep of continental Europe have led to the 

proposal that BDV strains can by phylogenetically allocated into three BDV genotypes, namely BDV-1, BDV- 

2 and BDV-3 (Becher et al., 2003). Recently we have typed a pestivirus isolated from chamois in Pyrenees 

(Andorra) as additional BDV-4 genotype (Arnal et al., 2004). 

The aim of this work was further characterization of the chamois pestivirus strain by sequencing of structural 

and non-structural genes. 


Total RNA of a virus stock (Chamois-1) was extracted using the Viral RNA minikit (Quigen). The cDNA was 

prepared using random hexamers and Moloney Leukaemia Virus reverse transcriptase. Different PCR 

products of the pestivirus genome were prepared using single or nested PCR employing panpestivirus or the 

chamois virus specific primers and proofreading DNA polymerase. Longer fragments were prepared by the 

Expand Long Template system (Roche). Nucleotide sequences were proofread using the SeqMan II 

program from DNASTAR (Lasergene).The percentage of nucleotide and deduced amino acid similarities 

were calculated using the MegAlign program. Phylogenetic analysis was carried out using Neighbor-joining 

method (program NEIGBOR from PHYLIP inference package programs) including selected pestivirus 

nucleotide sequences from GenBank. 

Results 

The alignment in Npro region for all pestivirus genotypes revealed that its size is 168 amino acids and 66 of 

them are totally conserved in all pestiviruses. The Npro/C cleavage site is also conserved in all genotypes. 

Of six cysteine residues, five are conserved in all pestivirus genomes. The hydrophobicity profile is similar for 

all pestiviruses. No significant insertion/deletion was observed in any part of the pestivirus genome, including 

the NS2-3 region. The nucleotide sequence similarity between Chamois-1 strain and two other chamois 

isolates is in the entire E2 region around 86%. 

The nucleotide sequence similarity between Chamois-1 and other pestiviruses varied depending on the 

pestivirus genotypes. The most similar values were found for BDV-1 – BDV-5 viruses (62-67% in Npro, C, 

Erns and E1 regions, 53% in E2). The similarity values for CSFV varied in the range 68-74% and 59% in E2 

region. Corresponding values for BVDV-1 and BVDV-2 varied between 61-69% and 49-53% in E2 region. 

Phylogenetic analysis in all genomic region confirmed that Chamois-1 strain belongs to BDV species, BDV-4 

genotype. 


The genetic characterization of Chamois pestivirus strain contributes to better understanding of genetic 

diversity of pestiviruses as a result of virus evolution at the genetic level. The relationship between 

pestiviruses identified in chamois and similar BDV isolates detected in sheep on Iberian Peninsula remains 

to be elucidated. 

References 

Arnal, M. et al.: J. Gen. Virol. 85, 3653, 2004; Becher, P. et al.: Virology 311, 96, 2003. 


MOLECULAR CHARACTERIZATION OF NEWCASTLE DISEASE VIRUSES ISOLATED FROM RECENT 

OUTBREAKS IN ROMANIA 

Handan Coste, M. Turcitu*, St Nicolae, I. Sandu, Gh. Barboi 

Institute for Diagnostic and Animal Health, Bucharest, Romania 

Introduction 

Newcastle disease plays an important role in poultry losses in Romania due to the high morbidity and 

mortality registered in commercial and backyards farms, restrictions following the outbreaks and all the 

measures required for limiting and eventually eradicating the disease. Diagnostic approach of the disease 

needs to be fast, reliable and accurate in order to have a quick response to the emerging situations. Thus, 

sequencing and pathotyping of the isolates complete the virological methods for characterization of the 

isolates. 


All samples subjected to the study - a total of 47 field isolates from 2000 to 2007 - were initially determined to 

be velogenic by plaque formation, the mean death time (MDT) of embryonated eggs and the intracerebral 

pathogenicity index (ICPI). Apart from those isolates, challenge strain "Craiova" (local velogenic strain) was 

analyzed. 

For preparation of virus RNA, commercially available kits were used (HighPure RNA Isolation Kit- Roche 

Applied Science, RNEasy Mini Kit- Qiagen), followed by single tube RT-PCR (OneStep RT-PCR kit- Qiagen) 

using primers from "F" gene region that spans the cleavage site. The amplicons obtained were purified from 

gel agarosis using "MinElute Gel Extraction Kit- Qiagen" and subjected to direct sequencing using "BigDye 

Terminator Cycle Sequencing Kit- Applied Biosystems ". 

Results 

By translation of the nucleotide sequence from the cleavage site, all samples showed an amino acid motifs 

109 119 

SGGRRQKR/FIG thus belonging to mesogenic/velogenic pathotype. Subsequently, the sequences 

were aligned using Clustal W Alignment software and a phylogenetic tree was build using Mega 3.1 

software. Phylogenetic analysis demonstrated that all field strains belong to genotype VII (fourth panzootic of 

ND), with close phylogenetic relationship. As expected, challenge strain "Craiova", isolated from outbreaks in 

1985, belong to genotype IV (responsible for first panzootic of ND). 


Close phylogenetic relation between field isolates suggest the endemic evolution of ND in Romania, with one 

virus strain being responsible for the outbreaks. Moreover, molecular pathotyping proved to be a reliable tool 

providing important informations especially were no virus isolates can be achieved (eg low virus 

concentration samples, long time stored samples etc - data not shown). 

References 

1. Characterization of Newly Emerging Newcastle Disease Virus Isolates from the People's Republic of 

China and Taiwan: Li Yu, Zhilian Wang, Yihai Jiang, Leo Chang, and Jimmy Kwang - Journal of Clinical 

Microbiology, Oct.2001, p. 3512-3519 

2. Characterization of Newcastle Disease Virus Isolates by Reverse Transcription PCR Coupled to Direct 

Nucleotide Sequencing and Development of Sequence Database for Pathotype Prediction and Molecular 

Epidemiological Analysis: Bruce S. Seal, Daniel J. King, and Joyce d. Bennett - Journal of Clinical 

Microbiology, Oct. 1995, p. 2624-2630 

3. S Kumar, K Tamura, and M Nei (2004) MEGA3: Integrated software for Molecular Evolutionary Genetics 

Analysis and sequence alignment. Briefings in Bioinformatics 5:150-163. 

*corresponding author: e-mail Turcitu.Mihai@idah.ro 




MOLECULAR EPIDEMIOLOGY OF RABIES IN BAT-EARED FOXES (OTOCYON MEGALOTIS) IN 

SOUTH AFRICA. 

C.T. Sabeta a,b* , K.L. Mansfield c , L. M. McElhinney c , A. R. Fooks c , L H. Nel d 

a Rabies Unit, Onderstepoort Veterinary Institute, Private Bag X05, Onderstepoort, 0110, Pretoria, South Africa; b University of Pretoria, 

Department of Veterinary Tropical Diseases, P Bag XO4, Onderstepoort 0110, South Africa; c Rabies and Wildlife Zoonoses Group, 

WHO Collaborating Centre for the Characterisation of Rabies and Rabies-related Viruses, Veterinary Laboratories Agency, Weybridge, 

Woodham Lane, Surrey KT15 3NB, U.K and d University of Pretoria, Department of Microbiology and Plant Pathology, 0002 Pretoria, 

South Africa. 

Introduction 

Canid rabies was recently introduced into the southern Africa in the late 1940s from Angola (Swanepoel et 

al., 1993). It first entered the dog population in the northern Limpopo province of South Africa (Alexander, 

1952) and a few years later, the disease started to appear in black-backed jackal species C. mesomelas and 

the bat-eared fox O. megalotis (Swanepoel et al., 1993), most likely via a spill-over from the domestic dog. 

Rabies cases were later on reported in O. megalotis in the Central Cape Province, with another isolated 

case in the Etosha National Park (Namibia) in the 1950s. Rabies was identified once again in this species 

many years later in the western and central Cape Provinces, the western Free State and the rest of Namibia 

(Thomson and Meredith, 1993). In this study, we have addressed some questions pertaining to the 

transmission dynamics of RABV in this wildlife carnivore species. The primary objective of the study was to 

establish the genetic relationships of O. megalotis rabies virus strains with those obtained from other wildlife 

and domestic host species. In this way, we attempted to clarify whether rabies in O. megalotis is indeed a 

new and independent cycle and further to assess the public and veterinary health threat of the maintenance 

and expansion of rabies cycles in O. megalotis. 


A cohort of rabies viruses (n=124) from wildlife host species (principally the bat-eared fox, Otocyon 

megalotis) and domestic carnivore species were collected between 1980 and 2005 from a region of South 

Africa associated with endemic bat-eared fox rabies. The highly variable G-L intergenic region and the 

conserved nucleoprotein gene of each of the rabies viruses in this South African panel were amplified, 

sequenced and analysed phylogenetically. 

Results 

Although it was demonstrated that all these viruses were very closely related (indicating a recent and 

common origin), they could be segregated into two major phylogenetic groups. The topologies of the 

phylogenetic trees obtained with analyses of the G-L intergenic and the N gene sequences were similar, 

although some isolates were better resolved in the former. 


The data obtained in this investigation complement antigenic and surveillance data on rabies in this host 

species in South Africa. Most importantly these data support a hypothesis that the bat-eared fox 

independently maintains rabies cycles in specific geographical loci in south-western South Africa. This is the 

first molecular epidemiological investigation describing rabies transmission dynamics in this wildlife carnivore 

host species in South Africa and highlights the ever increasing radiation of rabies into new geographical 

areas and wildlife host species including the bat-eared fox. 

References 

1. Alexander, R.A. 1952. Rabies in South Africa. J. S. Afr. Vet. Med. Assoc. 23. 

2. Swanepoel, R., Barnard, B.J.H., Meredith, C.D., Bishop, G.C., Bruchner, G.K., Foggin, C.M. and 

Hubschle, O.J.B. 1993. Rabies in southern Africa. Onderstepoort J. Vet. Res. 60, 323-346. 

3. Thomson, G.R.and Meredith, C.D. 1993. Rabies in bat-eared foxes in South Africa. Onderstepoort J. Vet. 

Res. 60, 399-403. 


CANINE RABIES IN SOUTH AFRICA: IDENTIFICATION OF A NEW LINEAGE IN LIMPOPO AND A 

RECENT SPREAD INTO THE FREE STATE PROVINCE 

Introduction 

Chuene Ernest Ngoepe a, * , Gugulethu Zulu a , Claude Sabeta a , Louis Nel b 

a Rabies Unit, Onderstepoort Veterinary Institute, Private Bag X05, Onderstepoort, 0110 

b University of Pretoria, Microbiology and Plant Pathology, 0002 Pretoria, South Africa 

In 2005, there was a drastic and unexpected increase of dog rabies cases in the Limpopo province. 

Laboratory confirmed cases increased from 5 in 2004 to 35 in 2005 and to 100 in 2006. The outbreak of 

rabies in domestic dogs was followed by a human rabies outbreak in which at least 30 human deaths were 

confirmed between 2005 and 2006. In contrast, the Free State province has been historically associated with 

endemic rabies in the yellow mongoose Cynictis penicillata (Snyman, 1940; Swanepoel et al. 1993). Due to 

spillover events, rabies viruses of the mongoose biotype were recovered from domestic dogs. More recently, 

there has been increased number of rabies cases of the canid biotype reported in domestic dogs in this 

province. The objectives of this study were; 1. to establish the exact source of infection in the human rabies 

cases and the origin of the rabies virus lineage responsible for the recent rabies outbreak in Limpopo, and 2. 

to trace the origin of canid rabies and assess the public health threat of mongoose rabies (in dogs) in the 

Free State province. 


A molecular epidemiological study was therefore performed on a cohort of 98 rabies viruses recovered from 

domestic dogs between 1995 and 2007 from the Free State province and 52 rabies viruses recovered from 

domestic dogs, jackals and humans from Limpopo and southern Zimbabwe. The cytoplasmic domain of the 

glycoprotein and the G-L intergenic region of the rabies viruses in this study sample were amplified and 

sequenced. Phylogenetic trees were reconstructed from an alignment of a 592-bp region of the genome 

under investigation. 

Results 

Case 1: Phylogenetic analysis revealed that human rabies viruses were closely related to those obtained 

from domestic dogs in the same locality and the rabies viruses from Limpopo were closely related to viruses 

obtained from southern Zimbabwe. 

Case 2: The phylogenetic analyses segregated the rabies viruses in this study sample into two main 

clusters; the genetically compact canid rabies biotype and a second group of heterogeneous viruses of the 

mongoose rabies biotype. From the data, it could be demonstrated that viruses of the canid rabies group 

were recently introduced into this part of South Africa. 


The reasons for the emergence and rapid dissemination of the new dog rabies strain in Limpopo are not very 

clear. It appears that common rabies infection cycles persist between domestic dogs and jackals in southern 

Zimbabwe and northern South Africa. It is evident that the new canid group belongs to the same 

epidemiological cycle circulating in dogs in both the Free State province and across the international border 

with Lesotho. Our results confirm that spillover of the mongoose biotype into domestic dogs lead to dead-end 

infections. In comparison to mongoose rabies that is endemic here, canid rabies has emerged to become of 

much greater importance to the public and veterinary health sectors of this region. 

References 

1. Swanepoel, R., Barnard, B. J. H., Meredith, C. D., Bishop, G. C., Bruckner, G. K., Fogging, C. M., 

Hubschle, O. J. B., 1993. Rabies in Southern Africa. Onderstepoort Journal of Veterinary Research, 60: pp. 

325-346. 

2. Snyman, P.S., 1940. The study and control of vectors of rabies in South Africa. Onderstepoort Journal of 

Veterinary Science Animal Husbandry, 66: pp. 296-307 


www.wavld2007.com 

HOSTS GOLD SPONSOR 

SILVER SPONSORS 

WAVLD 2007 SYMPOSIUM MANAGERS 

The Meeting Planners 91–97 Islington Street Collingwood Victoria 3066 tel: +61 3 9417 0888 fax: +61 3 9417 0899 email: wavld2007@meetingplanners.com.au

WAVLD Symposium Handbook_V4.indd - csiro

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?