View - ResearchGate

216 Zhang et al.Perform PCR cycles, as follows: 95°C for 3 min; 30 cycles of: 95°C for 30 s, 55°Cfor 30 s, and 72°C for 1 min; and one cycle of: 72°C for 10 min. Confirm the PCRreaction by 1% TAE agarose gel electrophoresis (8). A single PCR product ofapprox 600 bp should be apparent.3. Purify the PCR product using the Qiaquick PCR purification kit, according tomanufacture’s instructions. Collect the purified PCR product in 30 µL of ddH 2O.4. Digest the PCR product as follows:PCR product (3–5 µg DNA) 30 µL10X NEB buffer 3 4 µLEcoRI 1.5 µLXhoI 1.5 µLddH 2O 3 µL, to make a final volume of 40 µLIncubate for 2 h at 37°C and then add 4 L of 10X TAE-loading buffer. For thevector, digest 3 µg of pPUR V2 in the same way.5. Purify both DNA fragments by TAE agarose electrophoresis in low-melting pointagarose (1% agarose for the PCR product and 0.6% agarose for pPUR V2). Excisethe DNA bands. Bands containing DNA can be stored at −20°C at this point.6. Perform ligations as follows: melt the agarose gel slices at 75°C and set up ligationreactions as follows:Vector DNA (µL) 1 1Insert DNA (µL) 0 3ddH 2O (µL) 9 6Melt the agarose/water mix at 75°C for 4 min. Place at 37°C for 4 min. During thistime, make a T4 ligase/buffer master mix. For each ligation reaction: 7 µL ofwater, 2 µL of 10X T4 DNA ligase buffer (Roche), and 1 µL of T4 DNA ligase(Roche). Add 10 µL of reaction mix to each ligation reaction. Stir gently withpipet tip. Place at room temperature for 2 h to overnight. Melt ligation at 75°C andtransform 1 µL into DH5α competent cells.7. Restriction digest screening and sequencing of shRNAs: verify that the ligationsworked, based on the number of colonies obtained. Ideally, ligation of cut pPUR V2alone should generate zero colonies and pPUR V2 with the U6-shRNA insert shouldgenerate 10 or 100 s of colonies. Inoculate three to five colonies from each shRNAligation reaction into 5 mL of Luria Bertani media + ampicilin and grow overnightat 37°C with shaking. Purify plasmid DNA with an Eppendorf perfect-prep miniprepkit (Eppendorf, Hamburg, Germany), according to the manufacturer’s instructions.Verify the clones by restriction digest with XhoI and EcoRI, which shouldrelease an approx 600-bp fragment. Confirm those plasmids with the correct size,insert by direct sequencing using the primer AATTTCTTGGGTAGTTTGCAG,which anneals to the human U6 promoter and directs sequencing into the shRNA.8. Transfection of pPUR V2-shRNA into U2OS cells: transfection quality DNA ofeach sequence-verified pPUR V2-U6-shRNA plasmid is made using a Qiafilter