View - ResearchGate

More documents

Recommendations

Info

Dual Bait-Compatible Bacterial Two-Hybrid System 301Table 3Bacterial Screening StrainsStrain/source Genotype Comments/descriptionBacteriomatch ∆(mcrA)183II Reporter a ∆ (mcrCB-hsdSMR-mrr)173,endA1 endA1 hisB supE44thi-1recA1 gyrA96, relA1 lac(F′ laqI q HIS3 aadA Kan R )KJ1567 b ∆hisB463, Reporter strains in which the∆(gpt-proAB-arg-lac)expression of the HIS3XIII zaj::Tn10 (F′ LacI q and aadA reporter genesHIS3 aadA Kan R )is directed by a weakpromoter bearing anupstream λcI DNAbindingsiteAG58A(RP28) b ∆hisB463, Reporter strain in which the∆ (gpt-proAB-expression of the lacZarg-lac)XIII zaj::Tn10 reporter gene is directed(F′ LacI q LacZ Kan R )by a weak promoter bearingan upstream λcIDNA-binding sitea Stratagene.b Golemis lab.2.6. Primers for Sequencing and Polymerase Chain reaction (PCR)PrimerSequence/name Sequence Target PCR DirectionFPB1 ATGATCCCATGCAATGAGAG pBaitC Sequence ForwardFPP1 ATCCTGAAGAGGCGATTCG pLibB, Sequence ForwardpTRGFPP2 TGGAAACCAACGGCACAATC pLibB, Sequence, ForwardpTRG PCRRPP1 TCTCGCCTGTGTCTTCTTACTTAGG pLibB Sequence, ReversePCRRPP2 GACGCTCAGTGGAACG pTRG Sequence, ReverseAAAACTCPCR
Page 2:
Gene Function Analysis
Page 6:
METHODS IN MOLECULAR BIOLOGYGene Fu
Page 12:
PrefaceThis volume of Methods in Mo
Page 16:
Prefaceixcolleagues demonstrate how
Page 20:
xiiContentsPART III EXPERIMENTAL ME
Page 26:
ICOMPUTATIONAL METHODS I
Page 34:
4 BidautTable 1Input File Format Us
Page 38:
6 BidautTable 2Folder Layout to Use
Page 42:
8 Bidaut• alphaA: this is the num
Page 46:
10 Bidautcomputing the maximum corr
Page 50:
12 BidautFig. 3. The complete Clutr
Page 54:
Table 3Some Identified Patterns (5,
Page 58:
16 BidautFig. 4. This is a comparis
Page 62:
18 BidautReferences1. Hughes, T. R.
Page 66:
20 Kirov et al.way to associate gen
Page 70:
22 Kirov et al.based on a study ass
Page 74:
24 Kirov et al.1. Retrieve the gene
Page 78:
26Fig. 1. Functional associations f
Page 82:
28 Kirov et al.Fig. 2. Pathway anal
Page 86:
30 Kirov et al.3. Gene symbols usag
Page 90:
32 Kirov et al.9. OBO_Team, Open Bi
Page 94:
3Estimating Gene Function With Leas
Page 98:
Estimating Gene Function With LS-NM
Page 102:
Page 106:
Page 110:
Page 114:
Page 118:
Page 122:
50 Gonye et al.activity and problem
Page 126:
52 Gonye et al.Currently, PAINT can
Page 130:
54 Gonye et al.dynamic nature of th
Page 136:
Prediction Using PAINT 57represente
Page 140:
Prediction Using PAINT 59In PAINT,
Page 144:
Prediction Using PAINT 6114. On the
Page 148:
Prediction Using PAINT 634.2. Size
Page 152:
65Fig. 4. Localization of enrichmen
Page 156:
Prediction Using PAINT 673. Okubo,
Page 160:
5Prediction of Intrinsic Disorder a
Page 164:
Prediction of ID and Its Use in Fun
Page 168:
Table 1Summary of the Web Servers O
Page 172:
Page 176:
Page 180:
Page 184:
Page 188:
Page 192:
Page 196:
Page 200:
Page 204:
Page 208:
IICOMPUTATIONAL METHODS II
Page 212:
94 Crabtree et al.genomes, which is
Page 216:
96 Crabtree et al.Fig. 2. Sybil pro
Page 220:
98 Crabtree et al.Fig. 3. Computing
Page 224:
100 Crabtree et al.3.1.5.1. FILTER
Page 228:
102 Crabtree et al.3. For the sake
Page 232:
104 Crabtree et al.Fig. 5. Best bid
Page 236:
106 Crabtree et al.17. Some cluster
Page 240:
108 Crabtree et al.19. Chado—The
Page 244:
110 Dateproducts prevents the under
Page 248:
112 DateDetails of these tasks are
Page 252:
114 DateThis step creates additiona
Page 256:
116 Date>hsapiens|gi|20093443 >hsap
Page 260:
118 DateBLAST score from the match
Page 264:
Table 1A Sample of Results From Pro
Page 268:
122 DateFig. 1. A network of functi
Page 272:
124 Datedescribed by Verjovsky Marc
Page 276:
126 Dateor contracts put forth by t
Page 280:
8Bioinformatics Tools for Modeling
Page 284:
Modeling Transcription Factor Targe
Page 288:
VISTA Program to search for TFBSs H
Page 292:
Page 296:
Page 300:
Page 304:
Page 308:
Ac 0 0 0 1 0 1 0 1 0 1 1 0 0 0 0 0
Page 312:
Page 316:
Page 320:
Page 324:
Page 328:
154 Osborne et al.are included in t
Page 332:
156 Osborne et al.Fig. 2. Flowchart
Page 336:
158 Osborne et al.UMLS source abbre
Page 340:
160 Osborne et al.Fig. 3. Querying
Page 344:
162 Osborne et al.3.4.2. Installati
Page 348:
164 Osborne et al.amount of filteri
Page 352:
166 Osborne et al.public class MMTx
Page 356:
168 Osborne et al.Fig. 4. Input tes
Page 360:
10Statistical Methods for Identifyi
Page 364:
Identifying Differentially Expresse
Page 368:
Page 372:
Page 376:
Page 380:
Page 384:
Page 388:
Page 392:
Page 396:
Page 400:
Page 404:
11Gene Function Analysis Using the
Page 408:
Gene Function Analysis Using the Ch
Page 412:
Page 416:
Page 420:
Page 424:
Page 428:
Page 432:
Page 436:
Page 440:
12Design and Application of a shRNA
Page 444:
Design and Application of a shRNA 2
Page 448:
Page 452:
Page 456:
Page 460:
Page 464:
224 Cheng and Chang1. IntroductionR
Page 468:
226 Cheng and ChangFig. 1. Structur
Page 472:
228 Cheng and ChangFig. 2. Sequence
Page 476:
230 Cheng and Chang3. Handheld ultr
Page 480:
232 Cheng and ChangFig. 4. Sequence
Page 484:
234 Cheng and ChangFig. 5. Experime
Page 488:
236 Cheng and Chang3.4. Functional
Page 492:
238 Cheng and Chang3.4.4. Fixation
Page 496:
240 Cheng and Chang16. Player, M. R
Page 500:
14Selection of Recombinant Antibodi
Page 504:
Selection of Recombinant Antibodies
Page 508:
Page 512:
Page 516:
Page 520:
Page 524:
Page 528:
258 Tikhmyanova et al.functionally
Page 532:
260 Tikhmyanova et al.partner was f
Page 536:
262 Tikhmyanova et al.5. pGLS22-Ras
Page 540:
264 Tikhmyanova et al.4. pYESTrp2 p
Page 544:
266 Tikhmyanova et al.Fig. 3. Polyl
Page 548:
268 Tikhmyanova et al.To minimize t
Page 552:
270 Tikhmyanova et al.Fig. 4. Flow
Page 556:
272 Tikhmyanova et al.3.3.1. Transf
Page 560:
274 Tikhmyanova et al.3. At room te
Page 564: 276 Tikhmyanova et al.the frozen ma
Page 568: 278 Tikhmyanova et al.Fig. 6. Detai
Page 572: Table 3Suggested PCR Reactions and
Page 576: 282 Tikhmyanova et al.15. Prepare a
Page 580: 284 Tikhmyanova et al.6. Assay of m
Page 584: 286 Tikhmyanova et al.of tubes. Fin
Page 588: 288 Tikhmyanova et al.the polylinke
Page 592: 290 Tikhmyanova et al.25. Petermann
Page 596: 292 Serebriiskii et al.for eukaryot
Page 600: 294 Serebriiskii et al.(3,9), yeast
Page 604: 296 Serebriiskii et al.systems has
Page 608: 298 Serebriiskii et al.Table 1Conce
Page 612: 300 Serebriiskii et al.Table 2Plasm
Page 618: Dual Bait-Compatible Bacterial Two-
Page 646: 318 Thibodeau-Beganny and Joungbeen
Page 650: 320 Thibodeau-Beganny and JoungFig.
Page 658: 324 Thibodeau-Beganny and JoungTypi
Page 666:
328 Thibodeau-Beganny and JoungPCR
Page 670:
330 Thibodeau-Beganny and Joung16-1
Page 674:
332 Thibodeau-Beganny and Joung2. P
Page 678:
334 Thibodeau-Beganny and Joung11.
Page 682:
336 IndexKknockin (gene knockin) 19
show all

View - ResearchGate

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?