presentation, part 1 - Molecular Evolution

More documents

Recommendations

Info

“Phylogenomics Toolkit”Table 2: Primer InformationLocus Forward Primer Sequence Reverse Primer Sequence Gene Hg18 ChrPCR Size(bp)NEWLY DESIGNEDABCA1 Newly Designed CCTCCATCTTTTCAGCTCTACCTAC ~9kb (11 nuclear ACAAGAGCCTGGAGATTGGATAAC loci across 9 chromosomes)ATP-binding cassette sub-family A member 1 Chr9 638AXIN1 CTCTGCCTTCGCTGTACCGTCTAC GACCCACCTTTCCTAATCCTTGTC axin 1 isoform a Chr16 995CFTR-Pair A CTGTGATAGAACAGTTTCCTGGG GCTTCTATCCTGTGTTCACAGAG cystic fibrosis transmembrane conductance Chr7 839CFTR-Pair B CTCTGTGAACACAGGATAGAAGC TTACCTCCAGGAGGCTCAAAAGCC cystic fibrosis transmembrane conductance Chr7 815ERC2 AGCTCATCCTCCTCCTGGTTTAG CTCCTTGAGGATCTCCAGCAAC cytomatrix protein p110 Chr3 790LRPPRC-Pair A CTGGAGACAGCTTTTGTGTTATCC ACCTTAGAGGCTGAAAGTGACTG leucine-rich PPR motif-containing protein Chr2 916LRPPRC-Pair B GACACAGGGAGTCTACACAAACAC GATGCCAGAGCTCTCCTACAG leucine-rich PPR motif-containing protein Chr2 818LUC7L CAGCAGTCCAGAAGGTGACTCTTG GCAGATGGGTACAGTATGTGTTGG LUC7-like isoform a Chr16 728Non-coding CCAGATGACTTAGAAATCTCTCCC GCTTCTTATGATGGTCTGAGTTGG none Chr15 850SRBEF2 AAGACGCTCAGGACAATCACAC CTTCCTGTGCCTCTCCTTTAAC sterol regulatory element-binding transcription Chr22 715ZNF202 AAGTGATATCCTCTGCTGAAGC CCAGACTCCAGATTGGGAAA zinc finger protein 202 Chr11 861PUBLISHEDMITO COII AACCATTTCATAACTTTGTCA CTCTTTAATCTTTAACTTAAAAG Cytochrome oxidase II mitochondrialPreviously MITO CYTB CGAAGCTTGATATGAAAAACCATCGTT Published ~7.5kb (7 AACTGCAGTCATCTCCGGTTTACAAGAC nuclear & mtDNA) Cytochrome b mitochondrialADORA3 TGGACTTCAAGTCTCCCGATGACCCCAGC CCAAGCTCCCCAGTCATCCTGGTCAAA Adenosine receptor A3 - exon 2 Chr1 403FGA AAGCGCAAAGTCATAGAAAAAG CTAAAGCCCTACTGCATGACCCT fibrinogen alpha polypeptide isoform alpha-E - intron 4 Chr4 735RBP3 ATGGCCAAGGTCCTCTTGGATAACTACTGCTT CGCAGGTCCATGATGAGGTGCTCCGTGTCCTGretinol-binding protein 3 precursor - exon 1 Chr10 1346NRAMP ACATGCAGGAAGTCATCGG CGAGGAAGAGGAGAAGAAGG natural resistance-associated macrophage protein Chr2RAG1 AAGACATCTTGGAAGGCATGA AAAGTTGCCATTCATCCTCA recombination activating gene 1 Chr11TTR TGCCTCGCTGGACTGGTATT GACAGCATCTAGAACTTTGACCAT thyroxine-binding prealbumin - intron 1 Chr18VWF Check Check von Willebrand Factor - intron 11 Chr12Dave please fill inHorvath et al. (2008) Genome Research
22 out of 25 nodeshave bootstrapsupport greater than90% and posteriorprobabilities of 1.0when all nuclear lociare combined.Horvath et al. (2008) Genome Research
Page 1 and 2:
How to Study an Island (Madagascar)
Page 3 and 4:
Using Tree Thinking to Reconstructt
Page 5 and 6:
Rush hour traffic in Madagascar
Page 8 and 9:
Imbalance & Endemism in !Madagascar
Page 11 and 12:
Dr. Chris Scotese (Arizona State)Th
Page 13 and 14: Vicariance?(“paleo-endemics”)Di
Page 15 and 16: (i.e., the end of the“age of dino
Page 17 and 18: Montane rainforest!(Annual rainfall
Page 19 and 20: Has central plateau served as a bar
Page 21: 1! 2! 3!10 mya (+1.8)1! 2! 3!9.2 my
Page 24: Human Impact:- Humans arrived in Ma
Page 27 and 28: So what are we going to doabout it?
Page 29 and 30: Rodents
Page 31 and 32: LEMURS!!LEMURS!!
Page 33 and 34: Photo by David Haring
Page 35 and 36: Photo by Franz Lanting
Page 37 and 38: Photo by me
Page 39 and 40: Photo by David Haring
Page 41 and 42: Ascending Pharyngeal Artery!
Page 43 and 44: Genetic Consensus of Strepsirrhine
Page 45 and 46: Archaeoindris!Mouse lemur!
Page 47: Office!Main lab!Thermocycler!Gel el
Page 51 and 52: Megaladapis cytochrome b sequences
Page 53: Extinct &Extant lemursform a cladeA
Page 57 and 58: Single dispersal:lemurs (Yoder et a
Page 59 and 60: “Hard” polytomy versus “Soft
Page 61 and 62: Lineage SortingComplete Lineage Sor
Page 63: Developing New Lemur-Specific Loci
Page 67 and 68: “Ignoring temporal information ob
Page 69 and 70: What is the Molecular Clock Hypothe
Page 71 and 72: Raw Genetic Differences"Species 1:
Page 73 and 74: The Molecular ClockThe Present0.10s
Page 75 and 76: The Molecular ClockThe Present0.022
Page 77 and 78: T3C2C1T2T1Rate and Time are confoun
Page 79 and 80: General Time Reversible (6-paramete
Page 81 and 82: Monkey! Human!Whale! Hippo!TimeUsin
Page 83 and 84: We need a method that …!• allow
Page 85 and 86: Major Innovation …• Both method
Page 87 and 88: Parameter Estimates by Data Partiti
Page 90 and 91: Figure 1 Middle Eocene lorisiforms
Page 93 and 94: N8N9N10C3N1N3N4N5N6N7N11C2N2C8C1C7C
Page 95 and 96: Excellent data quality; very good t
Page 97 and 98: Poor data quality; good taxon sampl
Page 99 and 100: Table 4 Posterior means and 95% cre
Page 101 and 102: Lessons learned (a few):• Multipl
Page 103 and 104: Bayesian analysis of new data set,
Page 105 and 106: At precisely 65 mya, an asteroid ne
Page 107 and 108: David A. Kring and Daniel D. Durda,
Page 113 and 114: Hypothetical IslandChain between Af
Page 115 and 116:
Malagasy!lemuriforms!AMalagasy!carn
Page 117 and 118:
The Davie Ridge: Possible Sub-aeria
Page 119 and 120:
Cenozoic!Crown-basedSouthern RouteS
Page 121 and 122:
SWEEPSTAKES!
Page 123 and 124:
Reconstructed Indian Ocean currents
Page 125 and 126:
Current Data (presence/absence;mole
show all

presentation, part 1 - Molecular Evolution

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?