CONTENTS

J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011
RESULTS & DISCUSSION
Figure 1 shows a typical AFLP gel image for
the 21 varieties studied with the primer
combinations (P101/M181) and (P101/M184). In
this study genetic fingerprinting, phylogenetic
diversity and genetic distance of peach varieties
from Kurdistan region was evaluated by using
AFLP markers. There were some studies had
been done to estimate diversity of peach
cultivars in Lebanon using microsattalite primer,
(Chalak et al., 2006), AFLP markers also used to
evaluate genetic diversity of ornamental peaches,
(Donglin et al., 2005). Table 4 summarize the
values of genetic distance of 21 peach varieties
from different sources and locations.
The genetic distance values ranged from
(0.0073 to 0.8572). It was clear that the lowest
genetic distance (0.0073) was found between
varieties (Tenee) and (Esmailly) which were
collected from Erbil, whereas the highest genetic
distance (0.8572) was found between varieties
Badree) and (Elberta) were collected from
Duhok and Sulaymani respectively means that
the similarity between them is very low.
The dendrogram based on UPGMA produced
three major clusters as shown in (Figure 2). The
first genetic cluster mostly consisted of (Korneet
Asfer, Floredasin, Motaem Bkornet Mobaker
(Ahmer), Sprink Time, Nectar 4, Nectar 6,
Ahmer Myse, Badree, Mskee, Tenee, Esmailly,
Migrant, Abo-zalma, Silverking). The second
genetic cluster consist of (Read Heaven, Sharly
Shapor). While the third genetic cluster consists
of (Zard, Elberta, Zaefaran, Dixired, J. H. Hale).
The total number of amplified DNA fragments
may make these varieties comes in separated
groups. Studying the morphology of these
varieties, it is noted that they have some
characters that are close to each other, for
example, the shape and color of fruits. Subclusters
separated the varieties and form distinct
genetic diversity among clusters.
The genetic relationship among the cultivars
based on molecular marker analysis will be
useful for varietal identification and in further
genetic improvement. It will also provide
support for selection of parents for crossing in
order to broaden the genetic base of the breeding
programs (Thorman and Osborn, 1992).
Estimation of genetic relationships will help to
prevent genetic erosion within varieties by
selecting a large number of different clones of
each variety (Rühl, et al., 2000). Results of this
study will provide guidance for future
germplasm collection, conservation and breeding
of peach.
Table (1): Primer name and their sequences used for AFLP analysis
No. Pre selective primer (‘5------3’) Selective primer (‘5-----3’)
1 POO GACTGCGTACATGCAG P101 GACTGCGTACATGCAGAACG
2 M43 GATGAGTCCTGAGTAAATA M181 GATGAGTCCTGAGTAACCCC
3 M184 GATGAGTCCTGAGTAACCGA
Table (2): Name and sampling region of the peach varieties used
No. Name of Varieties Location Number of
1. Korneet Asfer, Floredasin, Motaem Bkornet mobaker (ahmer), Sprink time,
Nectar 4, Nectar 6, Ahmer myse, Badree
Varieties
Duhok 8
2. Mskee, tenee, Esmailly, Migrant, Abo-zalma, Silverking Erbil 6
3. Read heaven, Sharly shapor, Zard, Elberta, Zaefaran, Dixired, J. H. hale Sulaymani 7
Total 21
Table (3): Total number of bands, number of polymorphic bands and their
percentage as amplified by the two primer combinations.
AFLP primer Combination Number of Amplified
Bands
Number of
Polymorphic Bands
Percentage of Polymorphic
Bands
P101/M181 57 49 85.9%
P101/M184 67 60 89.5%
Total 124 109 87.9%
19