Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), 2011<br />
<strong>CONTENTS</strong><br />
- Governing The Territory In A Phase Of Globalization:The Issue Of The<br />
Territorial Planning And The Local Development<br />
Majed Ali Kareem………………………..……………………………………………....……………..1<br />
- On Cp-Open Sets And Two Classes Of Functions<br />
Alias B. Khalaf and Shilan A. Mohammad ...…..……………………………………….……………..9<br />
- Genetic Diversity Assessment And Variety Identification Of Peach (Prunus<br />
persica) From Kurdistan Region-Iraq Using Aflp Markers<br />
Shaymaa H. Ali ..…………………………………………………………………….….……………..17<br />
- Existence And Uniqueness Solution For Nonlinear Volterra Integral Equation<br />
Raad. N. Butris and Ava Sh. Rafeeq………………………………………….….………….………..25<br />
- Protective Effects Of Melatonin, Vitamin E, Vitamin C And Their<br />
Combinations On Chronic Lead –Induced Hypertensive Rats<br />
Ismail Mustafa Maulood………………………………………….….……………………….………..30<br />
- Engineering Classification And Index Properties Of The Rocks At Derbandi<br />
Gomasbpan – Suggested Dam Site<br />
Mohamed Tahir A. Brifcani………………………..………………………….….………….………..39<br />
- Spectophotometric Determination Of Paracetamole Via Oxidative Coupling<br />
With Phenylephrine Ydrochloride<br />
In Pharmaceutical Preparations<br />
Firas Muhsen Al-Esawati and Raeed Megeed Qadir…………………..…………………….………..52<br />
- Certain Species Of Mallophaga (Bird Lice) Occuring On Domestic Pigeons<br />
(Columba Livia Domestica Gmelin, 1789) In Erbil City-Iraq<br />
Rezan Kamal Ahmed…………………..………………………………………….………….………..58<br />
- Incidence Of Blood Stream Infection In Neonate Care Unit In Sulaimani<br />
Pediatric Teaching Hospital<br />
Sahand K. Arif and Golzar F. Abdulrahman …………………..………………………..….………..63<br />
- Bioaccumulation Of Some Heavy Metals In The Tissues Of Two Fish Species<br />
(Barbus luteus And Cyprinion macrostomum) In Greater Zab River- Iraq<br />
Nashmeel Sa’id Khdhir, Lana S. Al-Alem and Shamall M.A. Abdullah ……....………..….………..71<br />
- Eccentricity Of The Horizontal Axial Restraint Force For Straight And<br />
Cambered Beams<br />
Kanaan Sliwo Youkhanna Athuraia and. Riyadh Shafiq Al-Rawi ……………....………..….………..78<br />
- Three Dimensional Representation Of A Remote Structure Using Reflectorless<br />
Total Station Instrument<br />
Raad Awad Kattan and Sami Mamlook Gilyana…………………….………....………..….………..87<br />
- On Generalizations Of Regular Rings<br />
Abdullah M. Abdul-Jabbar………………………………………….………....………..….………..100
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), 2011<br />
- The Existence And Uniqueness Solution For Nonlinear System Of Fractional<br />
Integro-Differential Equations<br />
Hussein J. Zekry……………………………….…………………….………....………..….………..106<br />
- Spectrophotometric Determination Of Phenylephrine Hydrochloride In<br />
Pharmaceutical Preparations<br />
Firas Muhsen Al-Esawati…………………………………………….………....………..….………..112<br />
- Use Of Water Quality Index And Dissolved Oxygen Saturation As Indicators Of<br />
Water Pollution Of Erbil Wastewater Channel And Greater Zab River.<br />
Yahya A. Shekha and Jamal K. Al-Abaychi …………………………………....………..….……....119<br />
- Flexural Analysis Of Fibrous Concrete Ground Square Slab<br />
Azad A. Mohammed………………………………………………..…………....………..….……....127<br />
- Tests On Axially Restrained Ferrocement Slab Strips<br />
Azad Abdulkadr Mohammed and Yaman Sami Shareef …………………………….…..………....138<br />
- Some New Separation Axioms<br />
Zanyar A. Ameen And Ramadhan A. Muhammed……………………………...……….…..……....156<br />
- Some New Separation Axioms<br />
Zanyar A. Ameen and Baravan A. Asaad……………………..………………...……….…..……....160<br />
- Gamma – Ray And Annealing Effects On The Energy Gap Of Galss<br />
AHMAD KHALAF MEHEEMEED and SULAIMAN HUSSEIN AL-SADOON ……..……...……...……......165<br />
- Effect Of Long-Term Administration Of Melatonin, Vitamin E, Vitamin C And<br />
Their Combinations On Some Lipid Profiles And Renal Function Tests In Rats<br />
Exposed To Lead Toxicity<br />
Almas M.R. Mahmud……………………..………………………...…………...……….…..……....177<br />
- Hyalomma aegyptium As A Dominant Tick On Certain Tortoises Of The Testudo<br />
graeca In Erbil Province-Kurdistan Region-Iraq<br />
Qaraman Mamakhidr Koyee………………..……………..………...…………...……….…..……....186<br />
- On Detectionof Feedback In The Time Series<br />
Sameera Abdulsalam Othman………………..……………..……....…………...……….…..……....191<br />
- The Singularity Of M-Connected Graph<br />
Payman A.Rashed………………..……………..……....…………...……….…..……………….......207<br />
- A Study Of Naupliar Stages Of Mesocyclops edax Forbes, 1891(Copepoda:<br />
Cyclopoida)<br />
Luay A. Ali and Kazhal H. H. Rahim………………..……………..…..…....………….......……....217<br />
- Effect Of Salicylic Acid On Some Biomass And Biochemical Changes Of<br />
Drought- Stressed Wheat (Triticum aestivum L. var. Cham 6) Seedlings<br />
Fakhriya M. Karim and Mohammed Q. Khursheed……………..……................……….…..……....223<br />
- Bacteriological Study And Antibacterial Activity Of Honey Against Some<br />
Pathogenic Bacteria Isolated From Burn Infections<br />
Suhaila N. Darogha and Ahmed A.Q.A.S. Al-Naqshbandi…………………...……….…….……....232
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), 2011<br />
- Ann-Based Static Slip Power Recovery Control Of Wrim Drive<br />
Ali A. Rasool and Hilmi F. Ameen……………..……................……….…..……...........................242<br />
- Lower Bound Of T-Blocking Sets In Pg(2, q ) And Existence Of Minimal<br />
Blocking Sets Of Size 16 And 17 In Pg(2,9)<br />
Abdul Khalik L.Yassen and Chinar A.Ahamed ……………..……................……….…..……….253<br />
- A Multiple Classifier System For Supervised Classification Of Remotely Sensed<br />
Data<br />
Ahmed AK. Tahir……………..……................……….…..……........................................................260<br />
- Experimental Determination Of Paschen Curve And First Townsend Coefficient<br />
Of Nitrogen Plasma Discharge<br />
Sabah Ibrahim Wais……………..……................……….…..…….....................................................274<br />
- Numerical Solution Of Gray-Scott Model By A.D.M. And F.D.M.<br />
Saad A. Manaa And Chully M. R. ……………..…….............….…..…….........................................281<br />
- Anatomical Comparison Between Cissus Repens, Cayratia Japonica (Vitaceae)<br />
And Leea Aequata (Leeaceae)<br />
Chnar Najmaddin, Khatija Hussin, And Haja Maideen……………..……................……….…......290<br />
- Effects Of Acetamiprid And Glyphosate Pesticides On Testis And Serum<br />
Testosterone Level In Male Mice<br />
Mahmoud Ahmed Chawsheen……………..……................……….…..……......................................299<br />
- Minimal Blocking Sets In Pg(2,7) And Lower Bounds Of The Sixth And Seventh<br />
Blocking Sets.<br />
Chinar A. Kareem……………..……................……….…..…….......................................................207
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 1-8, 2011<br />
GOVERNING THE TERRITORY IN A PHASE OF GLOBALIZATION:<br />
THE ISSUE OF THE TERRITORIAL PLANNING<br />
AND THE LOCAL DEVELOPMENT<br />
MAJED ALI KAREEM<br />
Urban & Regional Planning, University of Venice-Italy<br />
(Received: January 22, 2009; Accepted for publication: November 28, 2010)<br />
ABSTRACT<br />
One of the consequences of the present of the financial, communicative and decisional nets globalization is to make<br />
ineffective the traditional instruments for the direct control of the territory by the public authorities. The territories<br />
are nowadays structured in over-regional and over-national nets and fluxes which tend to establish direct relations<br />
with the single local systems (i.e., towns, districts, regions, tourist resorts, etc).<br />
In this complex situation, the territorial planning shall thus and in first place propose itself as governance, that is<br />
to say as governing negotial process for the cooperative and conflictual interactions between subjects which are<br />
capable, for various reasons, to act on the territory and transform it.<br />
The scope of this research is to investigate on the role of the territorial planning in relation with two relational<br />
aspects: global and local. The target is that to locate a methodological approach able to have an “open” view to the<br />
territorial phenomenon in a globalized context; to define the territorial planning’s role, procedures and instruments.<br />
T<br />
PROBLEM DEFINITION<br />
he territory becomes ever more<br />
fragmented in parts, each one of which<br />
tends to become a “junction” of over-local<br />
networks and, therefore, to follow different<br />
development routes according to the long<br />
distance relation system to which it belongs. At<br />
the same time each one of these subjects<br />
depends ever less from those relations of<br />
physical proximity with the contiguous<br />
territories, which were the territorial planning’s<br />
existence and operative justification. The<br />
proximity relations continue, anyway, to be<br />
important also and above all in order to optimize<br />
the long distance local relations; but just for this<br />
reason they risk to be subordinate to an<br />
exogenous rationality which tend to impose<br />
itself as the territorial organization’s principle<br />
also at a local level.<br />
In order to plan rationally a territory it should<br />
be necessary to check this nets body which<br />
however, for its trans-national nature, today is<br />
not directly controllable by any public authority.<br />
On the other end neither these “long nets” nor<br />
the organizations which operates them can<br />
directly control the territories which they use as<br />
“anchorages” for their junctions and as physical<br />
paths of their fluxes. They interact with the<br />
territories and try to obtain “competitive<br />
advantages” through a series of negotiations<br />
with those private and public subjects who, for<br />
various reasons, operate or have competences on<br />
a local level.<br />
WHAT ROLE FOR THE<br />
TERRITORIAL PLAN?<br />
The role of the “Territorial Plan” 1 today and<br />
in the next future, must be placed in the local<br />
development context 2 . It has to take into<br />
account, above all, the growing role of the<br />
municipalities-being the base level of the<br />
territory governance – and of the pluralities of<br />
the institutions involved by the growing<br />
environmental problems’s expansion and<br />
complexity, but also by the ever major difficulty<br />
to govern the local effects (Perulli, P., 2000), of<br />
decisions taken elsewhere and which are taken<br />
basing on pure sectorial rationalities. Its role<br />
seems to be usefully subdivisible in three main<br />
directions: knowledge and evaluation, strategic<br />
orientation and netting, in being conflicts’<br />
adjustment.<br />
a) A first function concerns the cognitive and<br />
evaluation support which the territorial plan can<br />
supply to all the subjects, capable, for various<br />
reasons, to affect the territorial and urban<br />
conditions and dynamics (Mazza L., 1997).<br />
This function is important locally, not only the<br />
local authonomies couldn’t be efficaciously<br />
excercised unless on the base of an adequate<br />
knowledge of the reality into which they are<br />
asked to weigh heavily (and often such a<br />
knowledge is precluded to the Municipalities for<br />
territorial dimensions and technical, professional<br />
and administrative resources). In general, there<br />
could be not an effective dialogue between the<br />
various interested subjects unless it would be on<br />
the base of data and objective ties’ common<br />
1
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 1-8, 2011<br />
knowledge, of the values and the stakes at play,<br />
reasons of conflict and effects associable with<br />
the different alternatives corresponding to the<br />
different interests which legitimately confront<br />
each other.<br />
b) A second function concerns the actions<br />
strategic orientation, exercised by different<br />
subjects in different sectors, susceptible to affect<br />
the conditions and the dynamic of a district’s<br />
territory. Such a function, traditionally entrusted<br />
to the territorial planning, assumes today<br />
particular importance above all in relation to<br />
emerging exigencies. As already noted, the local<br />
systems exploitation requires, the netting of<br />
resources, opportunities, projects and initiatives<br />
which, themselves alone, couldn’t allow the<br />
insertion of endogenous and self propulsive<br />
developments (Rullani E., 1997). It means, in<br />
other terms, to favour, on a wide territorial area,<br />
synergic interactions, complementarity relations,<br />
and proximity and cohesion ties able to create a<br />
cooperative sphere propitious to the local<br />
systems’ durable development and to the<br />
strengthening of their own competitive capacity.<br />
The development processes rooting in the<br />
specific structural conditions of a specific<br />
territory in all its natural, historical and cultural<br />
aspects, requires the construction of images,<br />
visions and long term strategies able to foresee<br />
and, if possible, to anticipate the cumulative and<br />
indirect effects of the in being dynamics and the<br />
programmable actions to control same.<br />
These exigencies emphasize the usefulness<br />
of the referring scenarios, continuously and<br />
flexibly adapted to the changes of the economic,<br />
territorial and environmental conditions, and the<br />
opportunity to direct the interest of the various<br />
actors and economical and institutional available<br />
resources towards some integrated projects of<br />
strategic prominence.<br />
c) A third function, more properly and directly<br />
ruler, concerns the protection of the over-local<br />
interests which are of specific competence of the<br />
district. Such competence, to be precise, through<br />
the legislative reforms, both national and<br />
regional (Castells M., 1997), concerns certainly<br />
some typical contents which cannot be<br />
adequately treated only within local scale (i.e.,<br />
the municipal area), like those which concern the<br />
whole territory organization, the intermediate<br />
scale infrastructural systems, the soil protection<br />
and the hydraulic, hydrogeological and<br />
hydroforestal arrangement, as well as the<br />
institution of parks and natural reservoirs.<br />
2<br />
Beside, such competence must be better defined<br />
for at least two aspects.<br />
From one side it is necessary to consider the<br />
role that a wide area’s (a whole region) planning<br />
is requested to develop and to ensure the respect<br />
and the exploitation of the territorial structural<br />
characters. Certainly also those relevant to the<br />
landscape and historical-cultural characteristics<br />
and the territory ecological infrastructure.<br />
From the other it occurs that not necessarily<br />
the territorial planning ruling action expresses<br />
itself with immediately binding and prevailing<br />
regulations on the possible different rules of the<br />
local or other sectorial plans. The legislative<br />
systems of the territorial plans show that the<br />
ruling efficacy can be entrusted more frequently<br />
to guidelines or to negotiated regulations which<br />
responsibilize the local power, especially when<br />
the subject to be protected is consisting in<br />
properties or resources whose precise<br />
determination requires probing or specifications<br />
which can be more profitably carried out on a<br />
local area. It concerns two related aspects: as a<br />
matter of fact the conspicuous widening of the<br />
contents and of the territorial plan’s application<br />
field couldn’t be proposable and juridically<br />
sustainable should such contents translate into<br />
tight and immediately binding rules.<br />
On this matter it can be affirmed that the<br />
territorial plan’s specificity comes from its<br />
capacity to treat certain territorial subjects<br />
(Magnaghi A. 2005) which assume a thematic ,<br />
problematic, projectual, managerial and ruling<br />
specificity due to the fact of being<br />
conceptualized to district level (for instance:<br />
ecological nets, “green parks”, housing<br />
nets, short range tourist circuits, local work<br />
markets etc).<br />
PRELIMINARY CONDITIONS<br />
The procedures for the territorial plan<br />
drawing represent the mean to reach the creation<br />
of new, shared rules for the territory<br />
management and its changes, of new “statutes”<br />
for the use of the available environmental<br />
resources which can be made own by the<br />
citizens who live there and by the organizations<br />
which represent them. The wide area territorial<br />
planning (i.e., be it a region or a district) remains<br />
one of the few “points of view” from which the<br />
problem to manage the change in a socially and<br />
environmentally sustainable way can be seized<br />
and treated at certain conditions:
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 1-8, 2011<br />
1. to re-anounce the technocratic attitude for<br />
defining the optimum in favour of the<br />
construction of various open alternatives on<br />
which to confront with all the interested<br />
subjects.<br />
2. that the method of comparison between the<br />
alternatives and their consequences at a system<br />
level be actually done also by the sectorial<br />
policies promoted by the municipal or districtual<br />
authorities, utilizing for such purposes the most<br />
common cognitive resources and the specific<br />
instruments of the planning itself.<br />
3. That new representation and communication<br />
forms be experimented for the territorial<br />
consequences of what agreed between social,<br />
economical and institutional actors.<br />
4. that there must be full consciousness by all the<br />
participants that the planning is a continuous,<br />
fatiguing and complex process; the plan is a<br />
contract which the actors, present on a certain<br />
territory, undertake for its transformation; once<br />
concluded it is indispensable to start to think and<br />
to build the future forms of new contracts which<br />
will rule what not foreseen or not foreseeable up<br />
to that moment, that will improve the<br />
representation of the interests which are<br />
considered excluded; which will include new<br />
knowledge.<br />
The planning process is certainly more<br />
important than the plan, but the existence of a<br />
plan changes the process, because it requires a<br />
firm and clear political projectuality, its potential<br />
contribute to the setting up for a better agenda of<br />
the regional policies (i.e., well as of their<br />
comprehensive coherent direction) is very<br />
important.<br />
The form that the territorial plan assumes in<br />
taking into account the exigencies and the<br />
perspectives up to now recalled is the following:<br />
A strategic reference scenario for the whole<br />
territory denotes the local identities 3 and it<br />
indicates the desirable development lines.<br />
To the indication of a series of strategic projects<br />
in actuation of the plan, with the concourse of<br />
the other bodies, is assigned the task of<br />
deepening the possible solutions and the<br />
feasibility conditions for what it concerns<br />
“emergency” problems.<br />
A ruling system which introduces innovative<br />
agreements procedures, limits the rules, recalls<br />
the directives, foresees the municipalities’<br />
involvement in the management of protected<br />
areas as well as in other matters of over-local<br />
interest.<br />
The general target that the plan assumes is<br />
the reaching of an environmental and social<br />
sustainability 4 for the whole territory, that is to<br />
say forms of development which are able to<br />
safeguard and increase the natural and social<br />
resources and the area’s specific identities and<br />
by the thrust of a cooperative 5 approach.<br />
From control to self-control: the choice is that<br />
to promote, in lieu of the control and of the tie,<br />
new agreements instruments such as forms of<br />
self-control between local subjects in the<br />
decision moment (Magnani, A. 2000). It is what<br />
today goes under the name of “governance”: the<br />
government of the cooperative and conflictual<br />
interactions between the actors who act in the<br />
territory and who transform it, instead of the<br />
direct government of the territory’s small single<br />
pieces.<br />
The effort is that to define the reciprocal<br />
autonomies (amongst the various authorities),<br />
adapted into a normative system which strongly<br />
limits the rules; as a support to projectuality<br />
forms on general matters, also with the scope to<br />
build projects capable to acquire external<br />
resources.<br />
THE PLAN APPROACH TO THE<br />
TERRITORIAL PROBLEMS<br />
Within the negotial procedure the strategic<br />
and ruling functions explicate territorial effects<br />
(transformation, explotation, conservation,<br />
protection etc), not directly but through<br />
collective local subjects. In order that this<br />
happens it is necessary that such subjects might<br />
act as collective actors on territorial basis, i.e. as<br />
territorial local systems 6 . With this expression<br />
are intended public and private subject's local<br />
aggregations (or “nets”) able to organize them<br />
and to organize their own territory to interact<br />
with external subjects and thus realizing<br />
common shared projects.<br />
The negotial process with the local collective<br />
subjects must therefore be seen both as an<br />
operational and latent identities “hearing” phase<br />
and as operational identities construction<br />
moments (Porter M., 1987), around over-local<br />
scale territorial projects. In such a way the plan’s<br />
promotion and planning role is explicated. It<br />
goes into effect through “knot” (“set up” of the<br />
local systems) and net policies (connection of<br />
more local systems around over-local projects).<br />
Under this point of view the local systems (and<br />
therefore also the local identities with the above<br />
3
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 1-8, 2011<br />
mentioned meaning) implies inter-municipal<br />
relations as well as with local sectorial bodies.<br />
In order to talk of “local territorial system” it<br />
is necessary that certain public and private<br />
subjects selfrepresent themselves in a projectual<br />
perspective, as “local subjects’ nets” with<br />
interface functions between the local milieu<br />
resources and over-local subjects’ nets. It is<br />
necessary therefore that the horizontal ties,<br />
which ensure the territorial system’s internal<br />
cohesion, derive, at least in part, from the<br />
relations that the subjects who compose it have<br />
with the local, specific milieu, meaning a natural<br />
and historic-cultural conditions’ stable and<br />
localized whole, seen as possible development<br />
projects and local territorial re-qualification<br />
possible “intakes”.<br />
Under this perspective the plan places itself<br />
towards the “local systems”, as claimed by<br />
Castells (1977), its directions and rules must<br />
translate into local projects and actions (of<br />
“knot”, of “net”) by the actors who constitute it<br />
in order to obtain the desired territorial effects.<br />
The teritory’s useful knowledge for the plan<br />
is of political-operational type rather than<br />
technical-operational. The political-operational<br />
territorial knowledge concerns the identification<br />
of the local systems and of the actors (and more<br />
in general the subjects) who composes them;<br />
their relations with the territory; the specific<br />
rationalities which rule such relations and thus<br />
the local organizative principles of said<br />
territories.<br />
Starting from these considerations, such<br />
knowledge can start from objective analysises<br />
and above all from a reasoned inventory of the<br />
projects promoted at sub-district level by the<br />
various public and private subjects, but if forms<br />
itself, above all, through the negotial interaction<br />
with the local systems and it builds itself in the<br />
territorial plan’s fullfilment. However this<br />
doesn’t prevent to define a map of these<br />
differents, possible aggregations which is also a<br />
map of the local identities and the basis for the<br />
identities and the “statutes of the places”<br />
definition.<br />
The local identity, in a plan’s perspective,<br />
cannot base itself only on a “passive sense of<br />
belonging”, founded on the territory’s<br />
aesthetical-symbolic characters, but a resource to<br />
be exploited.<br />
This resource derives from the local subjects’<br />
capacity to connect between them, to selforganize<br />
themselves in order to evidence their<br />
territory’s resources in the interaction with<br />
4<br />
external subjects (Dematteis, 1997). Without a<br />
common project of such a type there is not an<br />
active, operative local identity. In this sense it<br />
can be said that the territorial Plan not only<br />
utilizes the collective, local identities as a<br />
passive resource, but also operates to build them,<br />
to let them pass from a latent and potential state<br />
to a real and operational one.<br />
PLAN ORGANIZATION THROUGH<br />
ACTIONS AND PROJECTS<br />
This plan form emphasizes its procedural<br />
aspects in a double direction, activating through<br />
the projects, the local institutions, and in<br />
proposing the indication of a series of real<br />
projects of priority importance. In this way the<br />
plan “concludes” itself with the start of a<br />
complex actions procedure which, for each<br />
project, activates a system of local and overlocal<br />
pertinent actors.<br />
The Plan, therefore, starts actually with its<br />
formal conclusion, supplying, beside the<br />
strategic scenario of reference and the<br />
accomplishment rules, the indication of a series<br />
of specific projects prominent for its<br />
achievement, comprehsensive of the local actors<br />
and the extra-local institutional and financial<br />
contributions which are needed for their<br />
realization.<br />
In this way the plan obtains a procedural<br />
continuity which allows to verify the strategic<br />
scenario during the course of the projects’<br />
fullfilment and if the case to correct it. Each<br />
project has an ideal reference area (variable<br />
geometry) and an internal and external actors’<br />
system.<br />
The strategic value project is generally a<br />
project with multidisciplinary and multisectorial<br />
integrated character (Haley P. 1997), in which<br />
great relevance is given to the virtuous synergies<br />
between sectorial actions; this implies the<br />
overcoming of the sector planning and a great<br />
will to cooperate by the assessorships (at<br />
regional level, but also at districtual and<br />
municipal one) to create ad-hoc inter-assessorial<br />
coordinations for each project’s formulation and<br />
management.<br />
In order to make easier the verification<br />
procedure for the single, new actions, but also to<br />
help the construction of a dynamic stragetic<br />
scenario and sustainable in its widest meaning, it<br />
is fundamental the use and the improvement of a<br />
“polyvalent evaluation model”, a kind of
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 1-8, 2011<br />
“metaproject” amongst the proposed strategic<br />
projects.<br />
The construction and the use of a polyvalent<br />
evaluation model go towards the direction to<br />
conceive the strategic planning process as an<br />
intelligent guide of sectorial and precise actions<br />
being already operational, be them policies or<br />
works: evidencing and exploiting the positive<br />
energies existing in the territory. In any case it is<br />
thus necessary a cognitive apparatus (a record of<br />
the projects and of the actions being carried out<br />
in the project’s area, be it institutional or not)<br />
which could allow the evaluation and, case by<br />
case, exploitation, correction, integration<br />
(Piroddi E., 1999).<br />
The target is that of selecting projects and<br />
policies which might contribute to the increase<br />
of the territorial and environmental quality. If<br />
the development sustainability depends from the<br />
equilibrium and the synergies between<br />
economical, territorial, environmental and social<br />
transformations, to increase the territorial<br />
patrimony, it is just on the inter-sectorial<br />
relations that the single actions’ coherence must<br />
be searched. The construction of a polyvalent<br />
evaluation model of policies, plans and projects<br />
referred to each strategic project area constitutes<br />
a prominent element of the proposed planning<br />
methodology. In this picture the evaluation<br />
which means to attribute to a project or to a plan<br />
quality or criticity characteritsics becomes<br />
intrisecally tied to the decision and projectual<br />
action, making explicit and verifiable the<br />
projectual choices towards the local territorial<br />
impact optimization criteria.<br />
THE PROSPECT OF THE PLAN IN<br />
LOCAL DEVELOPMENT<br />
It is typically a planning activity of integrated<br />
type, in the sense that it points to exploit the<br />
effects that derive from putting in a net different<br />
sector's policies and interventions demand<br />
crucial (Mazza L., 1977). It is a creative process,<br />
in which each involved subject, bearer of a<br />
specific definition of the problems, of the<br />
priority and the development necessity,<br />
contributes to elaborate the basic orientation and<br />
the missions of the community. In this sense it<br />
intends to activate – and this constitutes perhaps<br />
its most important result – an actors’ selfreflection<br />
process (Forester J. 1989, Porter<br />
M.1987) about the future of a territory.<br />
The plan has therefore, as aim, the<br />
construction of a document which can<br />
individuate the problems, the opportunities, a<br />
territory’s development targets 7 and scenarios.<br />
Certainly the plan takes the territory as its’<br />
application field (Mazza L., 1997), but it looks<br />
towards the town as the possible policies’ space<br />
and therefore from time to time its reference<br />
changes. It can be a specific dimension because<br />
it is recognized by the local actors as worth of<br />
particular attention (requalification of the<br />
historical town) or in a wider sphere, referred to<br />
the different development geographies (the role<br />
of the town in a territorial context).<br />
The plan reference territory therefore is not a<br />
data but a sequence (construction), it depends<br />
from the places toward which the actors’<br />
attention is drawn and from the level at which<br />
the questions that they put can be treated.<br />
In order to respond to the challenges that the<br />
future delineates it is necessary to take into<br />
consideration some principles.<br />
1.The first principle refers to the assumption of a<br />
pragmatic approach, which doesn’t wait the<br />
completion of a comprehesive project to be able<br />
to operate, but which starts to work in the sense<br />
of the anticipation of that general project.<br />
Between comprehensive project and details<br />
choices it is necessary to establish a co-evolution<br />
connection, in the sense that the second<br />
contribute to define the first but that from this<br />
they are also conditioned.<br />
Let’s take the case of the historical town. It<br />
deals with a town’s area that seems to require the<br />
activation of a regeneration complex policy (that<br />
is to say made of different interventions and<br />
integrated between them) which can’t wait the<br />
conclusion of the general variant’s iter<br />
to be started, but that, instead, can supply to<br />
the General Town Plan interesting test elements<br />
and, more in general, useful indications to the<br />
urban policies on how to plan multidimensional<br />
interventions. The strategic plan intends to<br />
consider the pragmatic approach as its own<br />
orientation principle, indicating those actions<br />
which can be immediately started or that it is<br />
necessary to discuss for their relevance.<br />
2. The second principle is that of subsidiarity, as<br />
the modality to define the relations between the<br />
institutional subjects and, more in general,<br />
between the public policies’ actors. The<br />
subsidiarity concerns the appointment of<br />
competences towards those subjects who are the<br />
nearest to the treatment of the problems (be<br />
these public or private) and therefore an<br />
assumption of responsibility by them.<br />
5
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 1-8, 2011<br />
It deals with a principle already acquired,<br />
both in the administration’s theory and in the<br />
real practices. It implies the substitution of the<br />
hierarchic principle tending to cooperation. It<br />
consists in an approach which has to permeate<br />
the activity of the whole public administration,<br />
but in which it is possible to indicate the<br />
testing’s priority fields, those policies or those<br />
interventions on which to start working in this<br />
sense.<br />
Again the governing of the wide area<br />
relations seems one of the more pertinent, as<br />
well as the policies for the development’s<br />
promotion and the same cultural policies. In fact<br />
it deals with work situations which put at play<br />
actors’ pluralities, of different nature and placed<br />
at different decisional levels, in which it is<br />
crucial, the capacity to govern complex<br />
decisional organizations, both vertical and<br />
horizontal.<br />
3. The third principle – tied to the preceeding<br />
one – is the “public role requalification” that<br />
today must be able above all to develop a<br />
coordinating function, of projectuality<br />
promotion, of local resources’ activation. In fact<br />
the subsidiarity horizon doesn’t imply the public<br />
subject withdrawal, but a deep change of its<br />
action’s characters. What the “public role<br />
requalification” principle suggests is to certainly<br />
walk a step behind towards the “direct intake”<br />
relation with the society and its problems, but<br />
also being potentially able to overcome the<br />
reductive administrative logics and to invest the<br />
own resources efficicaciously.<br />
4. The fourth principle doesn’t refer on how to<br />
do things but rather to what to do. It is the<br />
principle of the research of the “urbanity” meant<br />
as town’s character to preserve and to<br />
consolidate. As “urbanity” we mean the<br />
compresence of different uses and functions in<br />
the town (starting from the historic town), the<br />
accessibility to all the services which are offered<br />
by the territory, the strenghtening of the ties<br />
between the parts as guarantee of the territory’s<br />
general good operation.<br />
6<br />
CONCLUSION<br />
The proposed approach to the planning<br />
process, of which the plan’s design constitutes<br />
and intermediate and temporary phase, intends to<br />
contribute to the debate addressed to the<br />
planning role and to its working instruments in<br />
the local development. In this debate, also under<br />
the perspective of the federalism’s reform in a<br />
local context, a whole of widely shared<br />
principles is compared:<br />
1. The principle of development sustainability<br />
must be intended in its widest meaning of<br />
political, social and cultural sustainability, of<br />
economical self-sustainability and territorial<br />
exploitation.<br />
2. The principle of subsidiarity and of<br />
responsibilization which implies not only an<br />
actual strengthening of the local powers and a<br />
direct involvement of the local actors in the<br />
choices which may concern them, but also a<br />
more coherent and transparent distribution of the<br />
government and management responsibilities, on<br />
all levels and on all sectors.<br />
3. The principle of solidarity, of cohesion and of<br />
inclusion which obliges to a continuous<br />
comparison between specific or local issues and<br />
general interests, between competitive reasons<br />
and cooperative exigencies.<br />
Such principles push, jointly, towards a deep<br />
renewal of the methods, of the approaches and of<br />
the same planning conceptions, putting into<br />
growing evidence the exigency of the dialogue<br />
and of the cooperation between the various<br />
insititutional subjects and the social actors<br />
involved in the territorial changes.<br />
In this research worker, the base of the<br />
analytic approach is constituted by the<br />
individualization of the following “innovation<br />
points”:<br />
a. new forms of the plan: that is to say the<br />
elaboration of new town planning instruments<br />
(new plans, contents and targets construction<br />
modalities, new structures of the rules’ system);<br />
definition and utilization of the concepts of<br />
equalization, compensation, sustainable<br />
development, dimensioning, compensative<br />
acquisition, from whose correct development<br />
depends the possible solutions of town<br />
planning’s historical knots.<br />
b. programmatic instruments for the socialecomomic<br />
development: the predisposition of<br />
plans and strategic documents for the local<br />
development;<br />
c. complex programs: the testing of the<br />
procedures of the “urban project” and of the<br />
“integrated programs” as overcoming of the<br />
traditional forms of the town planning<br />
instrument’s actuation; the relation with the new<br />
form of the town planning instruments and with<br />
the programmatic means for the socio-ecomomic<br />
development.<br />
The necessity of a cooperative approach to<br />
the territory’s management and planning is
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 1-8, 2011<br />
particularly emphasized, in our case, by the<br />
actual situation of a territory involved in<br />
considerable globalization processes. In this<br />
perspective the planning process cannot exhaust<br />
itself in the attempt to coordinate the<br />
municipalities institutional action, since an<br />
authentic cooperation must base itself on the<br />
self-government of the local realities and thus on<br />
the social actors’ permanent agreeement.<br />
This implies the attempt to let grow the<br />
territorial sujectivity in view of the exploitation<br />
of the local systems and of the territorial<br />
identity.<br />
For this aim it is necessary that the<br />
affirmation of the collective subjectivities, which<br />
has somehow already expressed itself with the<br />
adhesion of a pluraility of actors, institutional or<br />
not, might turn into a shared projectual<br />
engagement which can express its selforganizing<br />
capacity with actions proposal which<br />
have to respond to the local expectations and<br />
interests.<br />
The indication to articulate the plan process<br />
strenghtening the local decision systems goes<br />
towards the direction in which the local<br />
initiatives have the aim to strenghten the<br />
autonomous capacity of a specific area to look<br />
for its own development system. In specific, the<br />
plan indications identified as follows:<br />
a- It supplies specific knowlegde because it<br />
thematizes and visualizes facts and problems at<br />
systemic aggregation level which often slips<br />
away from the attention of the aforesaid<br />
interlocutors;<br />
b- It suggests to their problems possible<br />
alternative solutions, solutions which just derive<br />
from the capacity to see and to think the territory<br />
on a different scale and in any case more<br />
complex, to point out the problems in terms not<br />
purely quantitative, to seize the possible<br />
synergies with other subjects’ action, etc etc.<br />
In such a way it is built an environment<br />
favourable to the development starting from<br />
each territory’s peculiarities and wealths, in the<br />
global competition age are evidenced the<br />
advantages of territorial guideline which,<br />
engaging the typical resources aims at the<br />
quality and difference of the offer of products<br />
and services.<br />
Notes<br />
1. The territorial plan, meant as scientific<br />
definition moment, neutral, ofan ideal territory<br />
organization within a clear and firm context for<br />
the distribution of the administrative, financial<br />
and political resources amongst the various<br />
government’s levels, formulates ideal<br />
hypotheses from the point of view of the whole<br />
rationality of the territory’s use. Therefore “no”<br />
to the homologation, but research and promotion<br />
of integration chances based on the exploitation<br />
of a territory’s differences.<br />
2. It must be rather thought in local systems net<br />
terms (Magnani A. 2000, Ratti R. 1997) which,<br />
coordinating and netting by themselves, create<br />
synergies, that is to say they increase the whole<br />
wealth, not only economical but also social and<br />
cultural, at disposal of an area that is subject to<br />
this insitutional competence of the Region.<br />
According to Dematteis (1995,46) the local<br />
development is always the combination of<br />
something which is fixed with something which<br />
is mobile: the potential specific resources of a<br />
territory with the overlocal nets.<br />
This gives space, anyway, on the territory, to<br />
various development relations, that is to say to<br />
different types of combinations between global<br />
nets, local nets and territory’s resources. There<br />
are architectures which have a major<br />
endogenous component, thus a more or less<br />
strong local identity is noticed (identity meant as<br />
selforganizing capacity, that is to say as specific<br />
principles of local organization). Ther are those<br />
which, instead, strongly depend from<br />
organizations, from overlocal nets.<br />
3. The local identity is meant as a resource, from<br />
the economic point of view, as the territory’s<br />
competitive advantage, from the social and<br />
political point of view (that is to say the<br />
autonomy of the “local”) and from the cultural<br />
point of view, as cultural variety, of a specific<br />
territory (Poli D. 1998, Magnaghi A. 2005 .<br />
4. In a globalization and growing competition<br />
age to promote the sustainability means before<br />
all to strenghten local identities and peculiarities<br />
(Rullani E.1994), indispensable values to be able<br />
to place oneself on the market offering products<br />
improbably subject to world competition. To<br />
build “local systems” is indispensable to<br />
compete with continuity against the economic<br />
trends’s changes.<br />
5. The necessity of a cooperative approach to the<br />
territory’s managemnent and planning is<br />
particularly emphasized by the actual situation<br />
of a territory involved in important globalization<br />
processes (Dematteis G. 1995) .<br />
6. Quoted in Dematteis (1997), these are public<br />
and private local subjects’ self-governing forms.<br />
These local self-governing forms are those who<br />
allows the mobilization od endogenous<br />
7
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 1-8, 2011<br />
resources, proper of these territories, which<br />
otherwise couldn’t be utilized and that feed a<br />
circular accumulation process of new resources<br />
on the territory through positive competitions,<br />
that is to say competitions through which new<br />
resources and new externalities are created.<br />
7. They represents the local specificity meant as<br />
a resource (Castells, M. 1997) which can be<br />
exploited for its greatest part, only through the<br />
negotiation of the local actors who start that<br />
cumulative, circular process which is the local<br />
development and which allows, on the economic<br />
ground, to transform these potential resources in<br />
values which can be exported, to attract external<br />
human and cognitive resources; capitals and<br />
ivestments for these resources’ exploitation.<br />
REFERENCES<br />
- Becattini G., Rullani E. (1994), “Sistema locale e mercato<br />
globale”, in Becattini G., Vaccà S., Prospettive<br />
degli studi di economia e politica industriale in<br />
Italia, Franco Angeli - Milano.<br />
- Bramanti A., Maggioni M.A. (1997), La dinamica dei<br />
sistemi produttivi territoriali: teorie, tecniche,<br />
politiche, Franco Angeli - Milano.<br />
- Bramanti A., Senn L.( 1997),“ Cambiamento strutturale,<br />
connessioni locali e governance nei sistemi<br />
produttivi territoriali”, La dinamica dei sistemi<br />
produttivi territoriali: teorie, tecniche, politiche,<br />
Franco Angeli - Milano.<br />
- Castells, M., (1997),The Power of Identità, Oxford,<br />
Blackwell, publishers Ltd.<br />
- Castells M., (1997),The Rise of the Network Society,<br />
Oxford, Blackwell Publishers Ltd.<br />
- Dematteis G., (1997), "Le città come nodi di reti: la<br />
transizione urbana in una prospettiva spaziale", in<br />
G. Dematteis e P. Bonavero, Il sistema urbano<br />
italiano nello spazio unificato europeo, Bologna, Il<br />
Mulino, pp. 15-35.<br />
- Dematteis G., (1995), "Sistemi locali e reti globali: il<br />
problema del radicamento territoriale", Archivio di<br />
studi urbani e regionali, v.24, n.53, pp.39-52.<br />
- Forester J., (1989), Planning in the Face of Power , The<br />
Regents of the University of California.<br />
Grandinetti R., Rullani E.( 1996), Impresa transnazionale<br />
ed economia globale, La Nuova Italia Scientifica -<br />
Roma.<br />
- Haley P., (1997), Collaborative Planning, London Mac<br />
Millan .<br />
- Harvey D., (1997), The condition of<br />
Postmodernity,Basil,1990 Magnani A.( 2000), Il<br />
progetto locale, Torino, Bollati Boringieri.<br />
- Magnaghi A. (2005), La rappresentazione identitaria del<br />
territorio: atlanti, codici, figure, paradigmi per il<br />
progetto locale, Alinea, Firenze Maskell P. ,<br />
Malberg A.( 1997),“Apprendimento localizzato e<br />
competitività industriale”, La dinamica dei sistemi<br />
8<br />
produttivi territoriali: teorie, tecniche, politiche,<br />
Franco Angeli - Milano.<br />
- Mazza L., (1997), Trasformazione del piano, Franco<br />
Angeli, Milano<br />
- Perulli P., (2000), La città delle reti, Torino, Bollati<br />
Boringhieri.<br />
- Piroddi E., (1999), Le forme del piano urbanistico,<br />
Milano, Franco Angeli.<br />
- Poli D., (1998), Il territorio fra identità e<br />
rappresentazione. Progetto del luogo come<br />
biografia territoriale, Tesi di Dottorato in<br />
Progettazione urbana, territoriale e ambientale,<br />
Università di Firenze, IX ciclo,<br />
- Porter M., (1980), Competitive Strategy, New York.<br />
- Porter M.( 1985), Competitive Advantage - New York.<br />
- Porter M.( 1987), Competizione globale, ISEDI - Torino.<br />
- Porter M.( 1987), The competitive Advantage of Nations -<br />
New York.<br />
- Prisco M.R., Silvani A.(1997), La misurazione del<br />
capitale umano nelle politiche tecnologiche:<br />
l'esperienza delle aree meno favorite, in Bramanti<br />
A. , Maggioni<br />
- Rabellotti R.( 1997), External Economies and<br />
Cooperation in Industrial Districts,Mac Millan<br />
press ltd, Houndmills,<br />
- Ratti R.( 1997),“Lo spazio attivo: una risposta<br />
paradigmatica al dibattito locale-globale”, La<br />
dinamica dei sistemi produttivi territoriali: teorie,<br />
tecniche, politiche, Franco Angeli - Milano.<br />
- Rullani E.( 1994), “Sistema locale e mercato globale: una<br />
risposta”, in Becattini G., Vaccà S., Prospettive<br />
degli studi di economia e politica industriale in<br />
Italia, Franco Angeli - Milano.<br />
- Rullani E.( 1997), “Più locale e più globale: verso<br />
un’economia postfordista del territorio”, La<br />
dinamica dei sistemi produttivi territoriali: teorie,<br />
tecniche, politiche, Franco Angeli - Milano.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 9-16, 2011<br />
ON CP-OPEN SETS AND TWO CLASSES OF FUNCTIONS<br />
ALIAS B. KHALAF * and SHILAN A. MOHAMMAD **<br />
* Dept. of Math., Faculty of Science, University of Duhok, Kurdistan Region-Iraq<br />
** Dept. of Math., Faculty of Science, University of Zakho, Kurdistan Region-Iraq<br />
(Received: October 1, 2009; Accepted for publication: November 3, 2010)<br />
ABSTRACT<br />
In this paper we introduce the concept of cp-open set and study some of its properties. Further we introduce the<br />
cp-continuous and cp-open functions and investigate the basic propertied. Necessary and sufficient condition of P1 -<br />
closed graph and cp-continuous function were found.<br />
KEYWORDS: c-open set, cp-open set, cp-continuous and cp-open functions, P1 -closed graph.<br />
T<br />
1. INTRODUCTION AND<br />
PRELIMINARIES<br />
hroughout the present paper, X and Y<br />
denote topological spaces in which no<br />
separation axiom is assumed. Let A be a subset<br />
of X, we denote the interior and the closure of a<br />
set A by int(A) and cl(A) respectively. A subset<br />
A is said to be preopen [10] (resp. semi open[7])<br />
set if A � intcl(A)( resp. A � clint(A)). The<br />
complement of a preopen set is called preclosed.<br />
The intersection of all preclosed sets containing<br />
A is called the preclosure of A and is denoted by<br />
pcl(A). The preinterior of A is defined as the<br />
union of all preopen sets contained in A and is<br />
denoted by pint(A). The family of all preopen<br />
sets of X is denoted by PO(X) and the set of all<br />
preopen set containing x�X is denoted by<br />
PO(X, x). The union of any family of preopen<br />
sets is preopen. A subset N of X is<br />
preneighbourhood[12] of a point x of X if there<br />
exists a preopen set U containing x with U � N<br />
and it is denoted by N p (x).<br />
As stated by Mashhour et al.[10], Katetov<br />
made some comments on the paper [9] to find<br />
conditions under which the intersection of any<br />
two preopen sets is preopen.<br />
Mashhour together with others offered an<br />
answer to this remark in the form of a<br />
theorem[10, Theorem 2.3].<br />
Definition 1.1[16]. A space (X, � ) will be said<br />
to have the property P if the closure is preserved<br />
under finite intersection or equivalently, if the<br />
closure of intersection of any two subsets equals<br />
the intersection of their closures.<br />
Lemma 1.2[16]. From the above definition it<br />
readily follows that if a space X has the property<br />
P, then the intersection of any two preopen sets<br />
is preopen. As a consequence of this PO(X) is a<br />
topology for X and it is finer than � .<br />
Lemma 1.3[4]. Let A and X 0 be subsets of a<br />
space X. If A�PO(X) and X 0 is semi open in X,<br />
then A � X 0 �PO(X 0 ),<br />
Lemma 1.4[2]. If A � Y � X and Y is a preopen<br />
set in X, then A�PO(X) if and only if<br />
A�PO(Y).<br />
Definition 1.5. A function f : X �Y is called:<br />
1- preirresolute[15] if f<br />
� 1<br />
(V)�PO(X) for each<br />
preopen set V of Y.<br />
2- M-preopen[16] if the image of every preopen<br />
set in X is a preopen set in Y,<br />
3- M-preclosd[13] if the image of every<br />
preclosed set in X is a preclosed set in Y.<br />
Definition 1.6[1]. Let f :X � Y be any<br />
function, the graph of the function f is denoted<br />
by G( f ) and is said to be P1 -closed if for each<br />
(x, y)�G( f ), there exist U�PO(X,x) and<br />
V�PO(Y,y) with (U� V) � G( f )= � .<br />
We proved if the graph of f is P1 -closed<br />
and X has the property P, then the inverse image<br />
of a strongly compact subset in Y is preclosed<br />
set in X.<br />
Definition 1.7[4]. A space X is said to be<br />
submaximal if every dense subset of X is open.<br />
Lemma 1.8[4]. A space X is submaximal if and<br />
only if every preopen set is open.<br />
Definition 1.9. A space X is:<br />
1- pre- T 1 [11] if for every distinct points x, y of<br />
X, there exists U�PO(X, x) not containing y<br />
and V� PO(X, y) not containing x,<br />
2- T 2 [17](resp. pre- T 2 [11]) if for every distinct<br />
points x, y of X, there exist two disjoint<br />
open(resp. preopen) sets each containing one of<br />
them,<br />
9
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 9-16, 2011<br />
3- prenormal[13] if each pair of disjoint<br />
preclosed sets of X there exist disjoint preopen<br />
sets each containing one of them,<br />
4- p-regular[15] if for each closed set F and each<br />
point x�F, there exist disjoint preopen sets U<br />
and V such that x�U and F � V,<br />
5- strongly compact[5] if every preopen cover<br />
has a finite subcover,<br />
6- Locally p-compact[8] if for every element of<br />
X, there exists an open set containing them<br />
which is strongly compact of X.<br />
Lemma 1.10[5]. Every preclosed subset of a<br />
strongly compact space is strongly compact. The<br />
following definition appeared in [3] and [6].<br />
Definition 1.11. A subset A of a space X is said<br />
to be a c-open set if A is an open set and X\A is<br />
compact.<br />
10<br />
2. SOME PROPERTIES OF<br />
CP-OPEN SETS<br />
Definition 2.1. A subset A of a space X is said to be a<br />
cp-open set if A is a preopen set and X\A is<br />
strongly compact. The complement of a cp-open<br />
set is said to be a cp-closed set. The family of<br />
all cp-open (resp. cp-closed) sets is denoted by<br />
CPO(X)(resp. CPC(X)) .<br />
The class of c-open and cp-open sets is not<br />
comparable as shown in the following two<br />
examples:<br />
Example 2.2. Let X={a, b, c} with � ={ � , X,<br />
{a}}, then {a, b} is a cp-open set, but it is not a<br />
c-open set.<br />
Example 2.3. (- � , 0) � (1, � ) is a c-open set,<br />
but it is not a cp-open set.<br />
Theorem 2.4. If a space X is submaximal, then<br />
the family of c-open and cp-open sets are<br />
equivalent.<br />
Proof. It is obvious from Lemma 1.8.<br />
Lemma 2.5. The union of any family of cp-open<br />
sets is a cp-open set.<br />
Proof. Let { U � : � ��<br />
} be any family of cpopen<br />
set, since � U � is a preopen set and<br />
X\ � U � = � X\ U � for each � ��<br />
, by Lemma<br />
1.10, it is strongly compact. Hence { U � : � ��<br />
}<br />
is cp-open set.<br />
The intersection of two cp-open sets need not<br />
be cp-open as seen by the following example:<br />
Example 2.6. Let X={a, b, c} with topology<br />
� ={ � , X, {a, b}}, then {a, c} and {b, c} are two<br />
cp-open sets in X , but {a, c} � {b, c}={c} is not<br />
cp-open set.<br />
From the above example we notice that the<br />
family of all cp-open sets need not be a topology<br />
on X.<br />
Theorem 2.7. If a space X has the property P,<br />
then cp-open sets is a topology on X.<br />
Proof. Since X has the property P, then by<br />
Lemma 1.2, the intersection of any two preopen<br />
sets is preopen and union two strongly compact<br />
is strongly compact. Therefore, the intersection<br />
of any two cp-open sets is cp-open. It follows<br />
that cp-open sets is a topology on X.<br />
It is clear that if a space X is finite, then the<br />
family of cp-open sets and preopen sets are<br />
coincident.<br />
Definition 2.8. A subset N of a space X is cpneighborhood<br />
of a point x, if N contains a cpopen<br />
set which is containing x and it is denoted<br />
by N cp (x).<br />
Theorem 2.9. Let (X, � ) be any topological<br />
space, and A is any subset of X. A is cp-open set<br />
if and only if for every x in X there exists a cp-<br />
G � A.<br />
open set x<br />
G such that x� x<br />
Prood. Let a subset A of X be a cp-open set<br />
containing x, then x�A � A.<br />
Conversely. Let A be any subset of X and<br />
assume that there exists a cp-open set G x<br />
containing x such that x� G x � A. Hence<br />
A= � { x<br />
G : x�A}, so by Lemma 2.5, A is cpopen<br />
set.<br />
Corollary 2.10. Let A be a subset of a space X.<br />
A is cp-open set if and only if it is cpneighborhood<br />
of each of its points.<br />
Definition 2.11. A point x�X is said to be a cpinterior<br />
point of A if there exists a cp-open set U<br />
containing x such that U � A. The set of all cpinterior<br />
points of A is said to be cp-interior of A<br />
and denoted by cp-int(A).<br />
Here we give some properties of cp-interior<br />
operator on a set<br />
Proposition 2.12. For any subset A and B of a<br />
topological space X. The following statements<br />
are true:<br />
1.The cp-interior of A is the union of all cp-open<br />
sets which are contained in A,<br />
2.cp-int(A) is cp-open set contained in A,<br />
3.cp-int(A) is the largest cp-open set contained<br />
in A,<br />
4.A is cp-open set if and only if cp-int(A)=A, it<br />
follows that cp-int(cp-int(A))=cp-int(A),<br />
5.cp-int(A) � A,<br />
6.If A � B, then cp-int(A) � cp-int(B),<br />
7.cp-int(A) � cp-int(B) � cp-int(A � B),<br />
8.cp-int(A � B) � cp-int(A) � cp-int(B).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 9-16, 2011<br />
We only prove part(3), the proof of the other<br />
parts is obvious.<br />
Proof.(3). Let G be any cp-open set in X<br />
containing x, by Corollary 2.10,A is a cpneighborhood<br />
of x, this shows that x is a cpinterior<br />
of A. Hence x�cp-int(A), so x�G � cpint(A)<br />
� A. We get cp-int(A) contains all cpopen<br />
subset of A and it is therefore, the largest<br />
cp-open subset of A.<br />
In general cp-int(A) � cp-int(B) � cpint(A<br />
� B), and cp-int(A � B) � cp-int (A) � cpint(B)<br />
as shown by the following two examples:<br />
Example 2.13. Let X={a, b, c, d} with topology<br />
� ={ � , X, {c}, {a, d}, {a, c, d}} Take A={a, d}<br />
and B={b, c}. cp-int(A � B)=X cp-int(A)={a,<br />
d}and cp-int(B)={c}, so cp-int(A) � cpint(B)<br />
� cp-int(A � B)<br />
Example 2.14. Let X={a, b, c, d} and � = { � ,<br />
X,{a, b}, {a, b, c}}. Take A={b, c} and B={a, c,<br />
d}, then A � B={c}, cp-int(A � B)= � but cpint(A)={b,<br />
c} and cp-int(B)={a, c, d}. So cpint(A)<br />
� cp-int(B)={b} and hence cp-int(A � B)<br />
� cp-int(A) � cp-int(B) .<br />
It follows that, cp-int (A)=cp-int(B) does not<br />
imply that A=B. This is shown by Example 4.9<br />
in [12].<br />
Definition 2.15. Let A be a subset of a<br />
topological space(X, � ). A point x�X is said to<br />
be a cp-limit point of A if every cp-open set<br />
containing x contains a point of A different from<br />
x. The set of all cp-limit points of A is called cpderived<br />
set and denoted by cp-d(A).<br />
Lemma 2.16. Let A be a subset of a topological<br />
space (X, � ). A is cp-closed if and only if A<br />
contains all of its cp-limit points.<br />
Proof. Assume that A is cp-closed set and let p<br />
is a cp-limit point of A which belongs to X\A.<br />
Then X\A is a cp-open set containing the cplimit<br />
point of A. Therefore, we get X\A contains<br />
an element of A which is contradiction.<br />
Conversely. Assume that A contains all of its<br />
cp-limit points. For each x�X\A there exists a<br />
cp-open set U containing x such that U � A= � ,<br />
that is, x�U � X\A, by Theorem 2.9, X\A is a<br />
cp-open set. Hence A is a cp-closed set.<br />
Some properties of cp-derived set are<br />
mentioned in the following results:<br />
Proposition 2.17. For any subsets A and B of a<br />
topological space X, then we have the following<br />
properties.<br />
1. If A � B, then cp-d(A) � cp-d(B),<br />
2. x�cp-d(A) implies x�cp-d(X\A),<br />
3.cp-d(A) � cp-d(B) � cp-d(A � B),<br />
4.cp-d(A � B) � cp-d(A) � cp-d(B).<br />
Proof. (3) and (4) follow from (1).<br />
The equality does not hold in (3) and (4) as<br />
shown by Examples 4.12 and 4.13 in [12].<br />
Definition 2.18. The intersection of all cp-closed<br />
sets containing A is called the cp-closure of A<br />
and it is denoted by cp-cl(A).<br />
Here we give some properties of cp-closure<br />
of the set.<br />
Proposition 2.19. For any subset E and F of a<br />
topological space X. The following statements<br />
are true.<br />
1. E� cp-cl(E),<br />
2. cp-cl(E) is cp-closed set in X containing E,<br />
3. cp-cl(E) is the smallest cp-closed set<br />
containing E,<br />
4. E is cp-closed if and only if cp-cl(E)=E, then<br />
cp- cl(cp-cl(E)) =cp-cl(E),<br />
5.If E� F, then cp-cl(E) � cp-cl(F),<br />
6.cp-cl(A) � cp-cl(B) � cp-cl(A � B),<br />
7.cp-cl(A � B) � cp-cl(A) � cp-cl(B).<br />
Generally, equality in (6) and (7) does not<br />
holds as shown by Examples 4.22 and 4.23 in<br />
[12].<br />
Icp-cl(A)=cp-cl(B) does not imply A=B this is<br />
shown in Example 4.18 in [12].<br />
Theorem 2.20. Let X be a space and A be any<br />
subset of X, then A � cp-d(A) is cp-closed.<br />
Proof. Let x�A � cp-d(A). This implies that<br />
x�A and x�cp-d(A). Since x�cp-d(A) there<br />
exists a cp-open set G x of x which contains no<br />
point of A other than x but x�A. So G x<br />
contains no point of A, which implies<br />
G is a cp-open set of each<br />
G x � X\A. Again x<br />
of its points. But G x does not contain any point<br />
of A, no point of G x can be a cp-limit point of<br />
A. Then no point of G x can belong to cp-d(A),<br />
so G x � X\cp-d(A) implies<br />
x� x<br />
G � X\A � X\cp-d(A) = X\(A � cp-d(A)),<br />
by Theorem 2.9, X\(A � cp-d(A)) is a cp-open<br />
set, so A � cp-d(A) is a cp-closed set.<br />
Corollary 2.21. For any subset A of a<br />
topological space X. we have cp-cl(A) =A � cpd(A).<br />
Proof. Since by Theorem 2.20, A � cp-d(A) is<br />
cp-closed containing A and cp-cl(A) is the<br />
smallest cp-closed containing A implies that cpcl(A)<br />
� A � cp-d(A). Hence cp-cl(A) =A � cpd(A).<br />
11
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 9-16, 2011<br />
Corollary 2.22. Let E be a set in a space X. A<br />
point x�X is in the cp-closure of E if and only if<br />
E � U � � , for every cp-open set U containing x.<br />
Proof. Let x�cp-cl(A), so by Corollary 2.21,<br />
either x�A or x�cp-d(A) and in both case<br />
E � U � � , for every cp-open set U containing<br />
x.<br />
Conversely. Suppose that U is any cp-open set<br />
containing x such that E � U � � this implies<br />
that x�E, then x�cp-cl(E).<br />
Theorem 2.23. For any subset A of a<br />
topological space X. The following statements<br />
are true:<br />
1. cp-cl(A) = X\cp-int(X\A),<br />
2. X\cp-cl(A) = cp-int(X\A),<br />
3. cp-int(A) = X\cp-cl(X\A),<br />
4. X\cp-int(A) = cp-cl(X\A).<br />
We only prove part (i) and the other parts are<br />
similar.<br />
Proof. For any x�X, x�cp-cl(A) and by<br />
Corollary 2.22 � A � U= � for each cp-open<br />
set U contains x � x�U � X\A � x�cpint(X\A)<br />
� x�X\cp-int(X\A).<br />
Definition 2.24. The set of all points neither in<br />
the cp-interior of A nor in the cp-interior of X\A<br />
is called cp-boundary of A and denoted by cpb(A).<br />
Some properties of cp-boundary are<br />
mentioned in the following results:<br />
Theorem 2.25. For any subset A of a<br />
topological space X. cp-b(A) =cp-cl(A)\cpint(A).<br />
Proof. since cp-b(A)=X\(cp-int(A) � cpint(X\A))=X\<br />
cp-int(A) � X\cp-int(X\A)=cpcl(A)<br />
� X\cp-int(A)=cp- cl(A) \cp-int(A) .<br />
Corollary 2.26. For any subset A of a<br />
topological space X, the following are true:<br />
1. If A is cp-closed, then cp-b(A)= A\cp-int(A),<br />
2. If A is cp-open, then cp-b(A)= cp-cl(A)\A,<br />
3. If A is both cp-open and cp-closed, then cp-<br />
b(A)= � ,<br />
4. A is cp-open if and only if cp-b(A) � A= � .<br />
That is cp-b(A) � cp-int(A) = � ,<br />
5. A is cp-closed if and only if cp-b(A) � A,<br />
6. If A is cp-closed and cp-int(A)= � , then cp-<br />
b(A)=A,<br />
7. cp-cl(A)=cp-int(A) � cp-b(A).<br />
We only prove parts(4), (5) and (7), the proof of<br />
other parts are obvious.<br />
Proof.(4). Let A be a cp-open set. Then cpb(A)=cp-cl(A)\A<br />
� X\A implies that cpb(A)<br />
� A= � .<br />
12<br />
Conversely. If cp-b(A) � A= � . So A � cp-<br />
cl(A) � X\cp-int(A) = � implies A � X\cp-int(A)<br />
= � . Thus A � X\X\cp-int(A)=cp-int(A) but on<br />
other hand cp-int(A) � A. It follows that A is cpopen<br />
set.<br />
(5). Let A be a cp-closed. Then cp-b(A)=A\cpint(A)<br />
� A.<br />
Conversely. If cp-b(A) � A, then cpb(A)<br />
� X\A= � implies that cp-cl(A) � X\cp-<br />
int(A) � X\A= � and hence cp-cl(A) � cpint(X\A)<br />
� X\A= � , then cp-cl(A) � X\A= � .<br />
Therefore, cp-cl(A) � A but on other hand A �<br />
cp-cl(A). It follows that A is cp-cdosed.<br />
(7).cp-int(A) � cp-b(A)=cp-int(A) � cp-cl(A)\cpint(A)=<br />
cp-cl(A).<br />
Proposition 2.27. For any subset A of a<br />
topological space X, the following are true.<br />
1. cp-b(A) is cp-closed,<br />
2. cp-b(A)=cp-b(X\A),<br />
3. cp-b(cp-b(A)) � cp-b(A),<br />
4. cp-b(cp-int(A)) � cp-b(A),<br />
5. cp-b(cp-cl(A)) � cp-b(A).<br />
Proof.(1).cp-cl(cp-b(A))=cp-cl(cp-cl(A) � cpcl(X\A))<br />
� cp-cl(cp-cl(A)) � cp-cl(cp-cl(X\A))=<br />
cp-b(A). Therefore A is cp-closed.<br />
(2).cp-b(A)=X\(cp-int(A) � cp-int(X\A))=X\(cpint(X\A)<br />
� cp-int(A))=cp-b(X\A).<br />
(3).cp-b(cp-b(A))=cp-cl(cp-b(A)) � cp-cl(X\cpb(A))<br />
� cp-cl(cp-b(A))=cp-b(A).<br />
(4).cp-b(cp-int(A))=cp-cl(cp-int(A))\cp-int(cpint(A))=cp-cl(cp-int(A))\cp-int(A)<br />
� cp-cl(A)<br />
\cp-int(A) = cp-b(A).<br />
(5).cp-b(cp-cl(A))=cp-cl(cp-cl(A))\cp-int(cpcl(A))=cp-cl(A))\cp-int(cp-cl(A))<br />
� cp-cl(A)\cpint(A)=cp-b(A).<br />
3. CP-CONTINUOUS AND CP-OPEN<br />
FUNCTIONS<br />
In this section, we introduce the concept of<br />
cp-continuous and cp-open functions by using<br />
cp-open sets also we give some properties and<br />
characterizations of such functions.<br />
Definition 3.1. The function f : X � Y is cpcontinuous<br />
at a point x�X if for each x�X and<br />
each cp-open set V of Y containing f (x), there<br />
exists a preopen set U of X containing x such<br />
that f (U) � V. If f is cp-continuous at every<br />
point of X, then it is called cp-continuous.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 9-16, 2011<br />
Theorem 3.2. Let f :X �Y be any function. If<br />
f is a preirresolute function, then it is cpcontinuous<br />
function.<br />
Proof. For each x�X and each cp-open set V of<br />
Y containing f (x). Then V is preopen set<br />
containing f (x). Since f is preirresolute<br />
function, there exists a preopen set U of X<br />
containing x such that f (U) � V. Hence f is<br />
cp-continuous.<br />
The converse of Theorem 3.2 is not true<br />
as it is shown in the following example:<br />
Example 3.3. Let f from R with usual<br />
topology onto R with co-finite topology be the<br />
identity function. Then f is cp-continuous but<br />
it is not preirresolute because (0, 1] is preopen<br />
set in R with co-finite topology and inverse<br />
image (0, 1] is (0, 1] which is not preopen set in<br />
R with usual topology.<br />
Theorem 3.4.If the co-domain of cp-continuous<br />
function f :X �Y is strongly compact, then it is<br />
preirresolute.<br />
Proof. For each x�X and each preopen set V of<br />
Y containing f (x), so Y\V is preclosed and Y\V<br />
is a subset of strongly compact Y, then by<br />
Lemma 1.10, Y\V is strongly compact. Since f<br />
is cp-continuous there exists a preopen set U of<br />
X containing x such that f (U) � V it follows<br />
that f is preirresolute.<br />
Theorem 3.5. For a function f : X �Y, the<br />
following statements are equivalent:<br />
1. f is cp-continuous,<br />
2. f<br />
cp-open set V in Y,<br />
3. f<br />
� 1<br />
(V) is preopen set in X, for each<br />
� 1<br />
(E) is preclosed set in X, for each<br />
cp-closed set E in Y,<br />
4. f (pcl(A)) � cp-cl( f (A)), for each<br />
subset A of X,<br />
� 1<br />
(B)) � f<br />
� 1<br />
(cp-cl(B)), for<br />
5. pcl( f<br />
each subset B of Y,<br />
6. f<br />
� 1<br />
(cp-int(B)) � pint( f<br />
� 1<br />
(B)), for<br />
each subset B of Y,<br />
7. cp-int( f (A)) � f (pint(A)) , for each<br />
subset A of X.<br />
Proof. (1) �(2). Let V be any cp-open set in Y.<br />
We have to show that f<br />
X. Let x� f<br />
� 1<br />
(V) is preopen set in<br />
� 1<br />
(V), then f (x)�V. By (i), there<br />
exists a preopen set U of X containing x such<br />
that f (U) � V which implies that<br />
x�U � f<br />
� 1<br />
(V) then f<br />
� 1<br />
(V) } is preopen set in X.<br />
� 1<br />
(V) = � { U :<br />
x� f<br />
(2)�(3). Let E be any cp-closed set in Y, then<br />
Y\E is a cp-open set of Y. By(ii),<br />
f<br />
� 1<br />
(Y\E)=X\ f<br />
� 1<br />
(E) is preopen set in X and<br />
� 1<br />
(E) is preclosed set in X.<br />
hence f<br />
(3)�(4). Let A be any subset of X, then<br />
� 1<br />
(cp-<br />
f (A) � cp-cl( f (A)) and A � f<br />
cl( f (A))). Since cp-cl( f (A)) is cp-closed set<br />
in Y. By(iii), we have f<br />
� 1<br />
(cp-cl( f (A)) is<br />
preclosed set in X. So pcl(A) � f<br />
� 1<br />
(cp-<br />
cl( f (A)))<br />
cl( f (A)).<br />
and hence f (pcl(A)) � cp-<br />
(4)�(5). Let B be any subset of Y, then<br />
f<br />
� 1<br />
(B) is a subset of X. By (iv), we have<br />
f (pcl( f<br />
� 1<br />
(B))) � cp-cl( f ( f<br />
� 1<br />
(B)))= cp-<br />
� 1<br />
cl(B). It follows that pcl( f (B)) � f<br />
cl(B)).<br />
� 1<br />
(cp-<br />
(5) � (6). Let B be any subset of Y, then apply<br />
(v)to Y\B, then pcl( f<br />
cl(Y\B)) � pcl(X\ f<br />
� 1<br />
(Y\B)) � f<br />
� 1<br />
(B)) � f<br />
int(B)) � X\pint((B)) � X\ f<br />
� 1<br />
(cp-intB) � pint f<br />
� 1<br />
(B)).<br />
� 1<br />
(cp-<br />
� 1<br />
(Y\cp-<br />
� 1<br />
(cp-<br />
int(B)) � f<br />
(6)�(7). Let A be any subset of X, then f (A)<br />
is a subset of Y. By (vi), f<br />
� 1<br />
(cp-int( f (A)) �<br />
� 1<br />
( f (A)))=pint(A). It follows that cp-<br />
pint( f<br />
int( f (A)) � f ( pint(A)).<br />
(7)�(1). Let x�X and lef V be any cp-open set<br />
of Y containing f (x), then x� f<br />
and f<br />
( f ( f<br />
� 1<br />
(V)<br />
� 1<br />
(V) is a subset of X. By(vii), cp-int<br />
� 1<br />
(V))) � f ( pint( f<br />
int(V) � f ( pint( f<br />
open set. Then V � f ( pint f<br />
that f<br />
f<br />
� 1<br />
(V) � pint( f<br />
� 1<br />
(V))). So cp-<br />
� 1<br />
(V))), since V is a cp-<br />
� 1<br />
(V))) implies<br />
� 1<br />
(V)) and hence<br />
� 1<br />
(V) is preopen set in X which contains x<br />
and clearly f ( f<br />
� 1<br />
(V)) � V.<br />
Definition 3.6. A function f : X � Y is said to<br />
be a cp-open function if for each x�X and for<br />
each preopen set U containing x, there exists a<br />
cp-open set V containing f (x) such that<br />
V � f (U).<br />
13
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 9-16, 2011<br />
Theorem 3.7. For a function f : X � Y, the<br />
following statements are equivalent:<br />
1. f is a cp-open function,<br />
2. The image of every preopen set in X is<br />
cp-open in Y,<br />
3. f (pint(A)) � cp-int( f (A)) for each<br />
subset A of X,<br />
4. pint( f<br />
each subset B of Y,<br />
5. f<br />
14<br />
� 1<br />
(B)) � f<br />
� 1<br />
(cp-cl(B)) � pcl( f<br />
� 1<br />
(cp-int(B)) for<br />
� 1<br />
(B)) for each<br />
subset B of Y,<br />
6. cp-cl( f (A)) � f (pcl(A)) for each<br />
subset A of X.<br />
Proof.(1) �(2). Let U be any preopen set in X,<br />
we show that f (U) is cp-open set in Y. Let<br />
f (x)� f (U) implies x�U. since f is cpopen<br />
function, there exists cp-open set V in Y<br />
such that f (x) �V � f (U). It follows that<br />
f (U)= � {V : f (x) � f (U) }, by Lemma 2.5,<br />
f (U) is cp-open set in Y.<br />
(2) �(3). Let A be any subset of X. Since<br />
pint(A) � A and pint(A) is a preopen set in X.<br />
by (ii), f (pint(A)) is a cp-open set in Y. So<br />
f (pint(A)) � cp-int f (A).<br />
(3) �(4). Let B be any subset of Y, then<br />
f<br />
� 1<br />
(B) is a subset of X. By(iii),<br />
f (pint( f<br />
� 1<br />
(B))) � cp-int f ( f<br />
int(B). It follows that pint( f<br />
� 1<br />
(B))=cp-<br />
� 1<br />
(B)) � f<br />
� 1<br />
(cp-<br />
int(B)).<br />
(4) �(5). Let B be any subset of Y, so Y\B is a<br />
subset of Y. By(iv),<br />
pint( f<br />
� 1<br />
(Y\B)) � f<br />
implies that pint(X\ f<br />
cl(B)), then X\pcl( f<br />
� 1<br />
(cp-int(Y\B)) which<br />
� 1<br />
(B)) � f<br />
� 1<br />
(B)) � X\ f<br />
cl(B)). This shows that f<br />
� 1<br />
(B)).<br />
� 1<br />
(Y\cp-<br />
� 1<br />
(cp-<br />
� 1<br />
(cp-cl(B))<br />
� pcl( f<br />
(5) �(6). Let A be any subset of X, then f (A)<br />
is a subset of Y. By(v), we obtain f<br />
cl( f (A))) � pcl( f<br />
� 1<br />
(cp-<br />
� 1<br />
( f (A)))=pcl(A). Hence<br />
cp-cl( f (A)) � f (pcl(A)).<br />
(6) �(1). For each x�X. Let U be any preopen<br />
set in X containing x, then X\U is a subset of X.<br />
By(vi), cp-cl( f (X\U)) � f (pcl(X\U))=<br />
f (X\U) and hence f (X\U)=Y\ f (U) is cpclosed.<br />
Therefore, f (U) is cp-open set<br />
containing f (x) and f (U) � f (U). Hence f<br />
is a cp-open function.<br />
Theorem 3.8. If f : X � Y is a cp-open<br />
function, then it is M-preopen, and the converse<br />
is also true if the space Y is strongly compact.<br />
Proof. Let U be any preopen set in X. Since f<br />
is cp-open, by Theorem 3.7(ii), f (U) is cpopen<br />
set in Y which is also preopen set in Y.<br />
Hence f is M-preopen function.<br />
Conversely. Let Y be a strongly compact and let<br />
U be any preopen set in X. Since f is Mpreopen,<br />
then f (U) is preopen set in Y and by<br />
Lemma 1.10, Y\ f (U) is strongly compact. So<br />
by Theorem 3.7(ii), f is cp-open.<br />
In general the converse of above<br />
theorem is not true as it is shown in the<br />
following example:<br />
Example 3.9. Let f from R with usual<br />
topology onto R with co-finite topology be the<br />
identity function. Then f is M-preopen, but it is<br />
not cp-open because (0, 1) is preopen set in R<br />
with usual topology and image of (0, 1) is (0, 1)<br />
which is not cp-open set in R with co-finite<br />
topology.<br />
Theorem 3.10. Let f be a M-preopen(resp. Mpreclosed)<br />
function from X onto Yand let<br />
g :Y �Z be any function such that g � f : X<br />
� Z is cp-continuous. Then g is cpcontinuous.<br />
Proof. Let V be cp-open (resp. preclosed<br />
strongly compact) subset of Z. Since g � f is<br />
cp-continuous, then ( g � f ) 1 � (V) is preopen(<br />
resp. preclosed) subset of X. Since f is a M-<br />
preopen(resp. M-preclosed) implies that<br />
f (( g � f ) 1 � � 1 � 1<br />
� 1<br />
(V))= f ( f ( g (V)))= g (<br />
V) is a preopen(resp. preclosed) set in Y. Hence<br />
g is cp-continuous.<br />
Theorem 3.11. Let f : X �Y be a function.<br />
Then the following statements are true:<br />
1. If f is cp-continuous and A is a semi<br />
open subset of X, then so is f \A: A � Y,<br />
2. If {U � : � in A} is a preopen set of X<br />
and if for each � , f � = f \U � is cp-continuous,<br />
then so is f .<br />
Proof (1). Let V be a cp-open set of Y. Since f<br />
is cp-continuous, then f<br />
and so ( f \A) 1 � = f<br />
� 1<br />
(V) is a preopen set<br />
� 1<br />
(V) � A, by Lemma 1.3,
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 9-16, 2011<br />
is a preopen subset of A. Hence f \A is cpcontinuous.<br />
(2). Let V be a cp-open set of Y. Then<br />
� 1<br />
�1<br />
f (V)=� { f � (V) : � in A} and since<br />
each f � is cp-continuous, it follows that<br />
�1<br />
each f (V) is a preopen set in U � and by<br />
�<br />
Lemma 1.4,<br />
�1<br />
�<br />
� 1<br />
(V) is a preopen set on X.<br />
f (V) is a preopen set in X. So<br />
f<br />
Theorem 3.12. If f : X �Y is preirresolute<br />
function and g :Y � Z is cp-continuous, then<br />
g � f : X � Z is cp-continuous.<br />
Proof. Let V be any cp-open set in Z. Since g is<br />
cp-continuous, so g 1 � (V) is preopen set in Y.<br />
Since f is preirresolute, then we obtain<br />
f<br />
� 1 � 1<br />
� 1<br />
( g (V))= ( g � f ) (V) is a preopen set<br />
in X. Hence g � f is cp-continuous.<br />
Theorem 3.13. Let f : X � Y be M-preopen<br />
and g : Y � Z be a cp-open function, then<br />
g � f is cp-open function.<br />
Proof. Let U be any preopen set in X. Since f<br />
is M-preopen, then f (U) is preopen set in Y.<br />
since g is cp-open function, so g ( f (U))=<br />
( g � f )(U) is cp-open set in Z. By Theorem<br />
3.7(ii), g � f is a cp-open function.<br />
Theorem 3.14. Let f : X � Y and g : Y � Z<br />
be any two function, then.<br />
1. If g � f is cp-open function and f is<br />
preirresolute, then g is a cp-open function,<br />
2. If g � f is preirresolute and f is Mpreopen<br />
surjective, then g is cp-continuous<br />
function,<br />
3. If g � f is cp-open function and g is<br />
cp-continuous injective, then f is a M-preopen<br />
function,<br />
4. If g � f is cp-continuous function<br />
and g is cp-open injective, then f is<br />
preirresolute function.<br />
Proof. (1). Let V be any preopen set in Y. Since<br />
� 1<br />
(V) is preopen set<br />
f is preirresolute, then f<br />
in X. Since g � f is cp-open function, so<br />
( g � f )( f<br />
� 1<br />
(V))= g ( f ( f<br />
� 1<br />
(V)))= g (V)<br />
is cp-open set in Z. By Theorem 3.7(ii), g is a<br />
cp-open function.<br />
(2). Let V be any cp-open set in Z, thus it is also<br />
preopen set. Since g � f is preirresolute, then<br />
( g � f ) 1 � (V) is preopen set in X. Since f is<br />
M-preopen surjective, implies that<br />
f (( g � f ) 1 � (V))= f ( f<br />
� 1 � 1<br />
( g (V)))<br />
= g 1 � (V) is preopen set in Y. By Theorem<br />
3.5(ii), g is cp-continuous function,<br />
(3). Let U be any preopen set in X, g � f is cpopen<br />
function, then by Theorem 3.7(ii),<br />
( g � f )(U) is a cp-open set in Z. Since g is<br />
cp-continuous injective, so g 1 � (( g � f )(U)))=<br />
g 1 � ( g ( f (U)))= f (U) is a preopen set in Y.<br />
Hence f is M-preopen function.<br />
(4). Let V be any preopen set in Y. Since g is<br />
cp-open function, so g (V) is a cp-open set in Z.<br />
Since g � f is cp-continuous and g is<br />
injective function, then ( g � f ) 1 � ( g (V))=<br />
f<br />
� 1 � 1<br />
( g ( g (V)))= f<br />
� 1<br />
(V) is a preopen set in<br />
X. Hence f is a preirresolute function.<br />
Theorem 3.15. Let f : X �Y be a cpcontinuous,<br />
M-preclosed function from a<br />
prenormal space X on to a space Y. If either X<br />
or Y is pre-T 1 , then Y is pre-T 2 .<br />
Proof (i). Y is pre-T 1 . Let y 1 , y 2 �Y and<br />
y 1 � y 2 . So {y 1 }, {y 2 } are preclosed strongly<br />
compact subset of Y, by Theorem 3.5(iii), we<br />
� 1<br />
have f ( y 1 ) and f<br />
� 1<br />
( y 2 ) are preclosed<br />
subset of a prenormal space X, then there exist<br />
two disjoint preopen sets U 1 and U 2 in X<br />
containing them. Since a function f is M-<br />
preclosed, the set V 1 =Y\ f (X\U 1 ) and<br />
V 2 =Y\ f (X\U 2 ) are preopen set in Y . Also are<br />
disjoint and containing y 1 and y 2 respectively,<br />
so Y is pre-T 2 .<br />
(ii). X is pre-T 1 , Let f (x) be a point of Y. {x}<br />
is preclosed in X. Since f is M-preclosed, then<br />
{ f (x)} is a preclosed set of Y. Hence Y is pre-<br />
T 1 and the proof is complete by part(i).<br />
Theorem 3.16. Let f : X � Y be any function<br />
with P1 -closed graph, X has the property P and<br />
Y is strongly compact, then f is cpcontinuous.<br />
Proof. For each x�X and each cp-open set V of<br />
Y containing f (x), then V is preopen set<br />
containing f (x). Hence Y\V is preclosed and<br />
Y\V is a subset of strongly compact Y, so Y\V is<br />
strongly compact. Since f has a P1 -closed<br />
15
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 9-16, 2011<br />
graph, then<br />
16<br />
�1<br />
f (Y\V) is preclosed and by<br />
Theorem 3.5(iii), we get f is a cp-continuous<br />
function.<br />
Theorem 3.17. If a function f : X �Y is cpcontinuous<br />
and Y is locally p-compact, pregular,<br />
T 2 space, then f has P1 -closed graph.<br />
Proof. Let (x, y)�G( f ), then f (x) � y. Since Y<br />
is a T 2 space, then there exists an open set V 1<br />
containing y and f (x)�cl(V 1 ). Since Y is<br />
locally p-compact, p-regular space, there exists a<br />
preopen set V in Y such that<br />
y�V � pcl(V) � V 1 and V 1 is strongly compact,<br />
by Lemma 1.10, pcl(V) is strongly compact.<br />
Therefore, Y\pcl(V) is cp-open set in Y<br />
containing f (x). Since f is cp-continuous,<br />
there exists a preopen set U containing x such<br />
that f (U) � Y\pcl(V) which implies<br />
f (U) � pcl(V)= � and hence we obtain<br />
f (U) � V= � . It follows that f has P1 -closed<br />
graph.<br />
REFERENCES<br />
� N. Bandyopadhyay and P. Bhattacharyya, Function with<br />
preclosed graph, Bull. Malays. Math. Sci. Soc.,<br />
28(1-2)(2005), 87-93.<br />
� N. Bandyopadhyay and P. Bhattacharyya, On function<br />
with strongly preclosed graph, Soochow. J. of Math.,<br />
32(1)(2006), 77-95.<br />
� H.S. Behnam. Some results about c-continuous<br />
functions and c- dimension functions, Mosul<br />
University M.SC. Thesis 1984.<br />
اسةوةي . ىركرايد ةهتاي َىمَوك َىظ وَيتةمخاس كةدهي و ينساين اد<br />
رةف وَيجرةم<br />
. ىركرايد ةم رةف وَيتةمخاس كةدهيو ينساين ةناد<br />
لاودلا ةفاضلااب اهصاوخ ضعب انسنسردو ) cp<br />
قلغملا نايبلا تاذ<br />
� J. Dontchev, Survey of preopen sets, The Proceedings<br />
of the Yatsushiro Topological Conference,<br />
(1998) 1-18.<br />
� S. Jafari and T.Noiri, More on strongly compact<br />
Spaces, Conference of Topology and its Application<br />
(Topo 2000) Miami University, USA,<br />
� A.B. Khalaf. Closed, compact sets and some<br />
dimension function, Mosul University M.SC. Thesis<br />
1982.<br />
� N. Levine, Semi-open sets and semi-continuity in<br />
topological spaces, Amer. Math. Monthly,70(1963),<br />
36-41.<br />
� A.S. Mashhoure, M.E. Abd El-Monsof, I.A. Hasanein,<br />
and T. Noiri. Strongly compact spaces, Delta J. Sci.,<br />
8(1)(1984), 30-46.<br />
� A.S. Mashhoure, M.E. Abd El-Monsof, and S.N. El-<br />
Deeb. On precontinuous and weak precontinuous<br />
mappings, Proc. Math. and Phys. Soc. Egypt,<br />
53(1982), 47-53.<br />
� A.S. Mashhoure, M.E. Abd El-Monsof, and S.N. El-<br />
Deeb. On pretopological spaces, Bull. Math. Soc.<br />
Sci. Math. R.S. Roumanie (N.S.). 28(76)(1984),<br />
39-45.<br />
� G. B. Navalagi, Further Properties of pre- T 0 , pre- T 1<br />
and pre- T 2 Spaces, Topology Atlas preprints #428.<br />
� G. B. Navalagi, pre-neighbourhoods, The<br />
Proceedings of the Yatsushiro Topological<br />
Conference, (1998), 1-18.<br />
� G. B. Navalagi, Definition Bank in general topology,<br />
Topology Atlas preprints #422.<br />
� T.Noiri, On � -preirresolute functions, Acta Math.<br />
Hungar, 95(4) (2002), 287-298.<br />
� T.Noiri, Almost p-Regular Spaces and some Functions,<br />
Acta Math. Hungar, 79(3)(1998), 207-2160<br />
� R. Paul and P. Bhattacharyya. On pre-Urysohn spaces,<br />
Bull. of the Malaysian Math. Soc.(Second series),<br />
22(1999), 23-34.<br />
� S. Willard, General Topology, Addison-Wesley<br />
publishing company , 1970.<br />
cp<br />
cp<br />
ةتخوث<br />
َىروج ذ ىركةظ وَيموك ةم اد َىهيلوكةظ َىظ د<br />
َىروج ذ<br />
. تنيد ةيتاي ماوةدرةب وَيشخةنو P1<br />
(<br />
ىركةظ وَيشخةنو ماوةدرةب وَيشخةن ةم<br />
َىروج ذ ىترط فارط وَيشخةن وَيي ىظدَيثو<br />
ةصلاخلا<br />
طمنلا نم ةحوتفملا ةعومجملا موهفم انمدق ثحبلا اذه يف<br />
ةلادلل ايفاكو ايرورض اطرش اندجو . ةيساسلاا ههصاوخ انثحبو ) cp<br />
(<br />
طمنلا نم ةحوتفملاو<br />
.<br />
ةرمتسملا ةلادلاو P1<br />
ةرمتسملا<br />
طمنلا نم
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011<br />
GENETIC DIVERSITY ASSESSMENT AND VARIETY IDENTIFICATION<br />
OF PEACH (Prunus persica) FROM KURDISTAN<br />
REGION-IRAQ USING AFLP MARKERS<br />
SHAYMAA H. ALI<br />
Scientific Research Center, University of Duhok. Kurdistan Region-Iraq<br />
(Received: January 25, 2010; Accepted for publication: February 27, 2011)<br />
ABSTRACT<br />
The peach (Prunus persica) is an important member of the Rosaceae family, which contains many fruit, nut, and<br />
ornamental species. It has a basic chromosome number of 8. Amplified fragment length polymorphisms (AFLP)<br />
markers were used to determine the level of genetic diversity, genetic relationships, and fingerprinting of peach<br />
varieties cultivated in Kurdistan- Iraq. A total of 21 samples have been collected from different districts of Kurdistan<br />
including Duhok, Erbil and Sulaymani. The samples were analyzed by using AFLP markers. Two primer<br />
combinations generated a total of 124 bands and among them 109 (87.9%) were polymorphic. Using UPGMA<br />
clustering analysis method based on the similarity coefficient, varieties were separated into three major genetic<br />
clusters. The first genetic cluster mostly includes (Korneet asfer, Floredasin, Motaem bkornet mobaker (ahmer),<br />
Sprink time, Nectar 4, Nectar 6, Ahmer myse, Badree, Mskee, Tenee, Esmailly, Migrant, Abo-zalma, Silverking). The<br />
second genetic cluster includes (Read heaven, Sharly shapor). While the third genetic cluster contains (Zard, Elberta,<br />
Zaefaran, Dixired, j. h. hale). Genetic distance among 21 peach varieties were ranged from 0.0073 to 0.8572. The<br />
lowest genetic distance (0.0073) was found between varieties (Tenee) and (Esmailly) which were collected from Erbil,<br />
whereas the highest genetic distance (0.8572) was found between varieties num (Badree) and (Elberta) collected from<br />
Duhok and Sulaymani respectively. The results obtained in this study may assist peach cultivation and peach breeding<br />
programs in the region.<br />
KEYWORDS: - Peach (Prunus persica), Genetic Diversity, AFLP-Markers.<br />
T<br />
INTRODUCTION<br />
he peach (Prunus persica) is one of the<br />
species of genus, Prunus, native to<br />
China that bears an edible juicy fruit. It is a<br />
deciduous tree growing to 5-10m tall, and it is an<br />
important member of the Rosaceae family,<br />
which contains many fruit, nut, and ornamental<br />
species having a basic chromosome number of 8<br />
(Wang et al. 2002). The scientific name persica,<br />
along with the word "peach" itself and its<br />
cognates in many European languages, derives<br />
from an early European belief that peaches were<br />
native to Persia. The modern botanical<br />
consensus is that they originate in China, and<br />
were introduced to Persia and the Mediterranean<br />
region along the Silk Road before Christian<br />
times (Huxley 1992).<br />
Polymerase chain reaction (PCR)-based<br />
methods for genetic diversity analyses have been<br />
developed, such as random amplified<br />
polymorphic DNA (RAPD), amplified fragment<br />
length polymorphism (AFLP), and inter simple<br />
sequence repeat (ISSR/SSR). Each technique is<br />
not only differed in principal, but also in the type<br />
and amount of polymorphism detected. AFLP<br />
technique is based on the selective PCR<br />
amplification of restriction fragments from a<br />
total digest of genomic DNA. The technique<br />
involves three basic steps: (1) restriction of the<br />
DNA and ligation of oligonucleotide adapters,<br />
(2) selective amplification of sets of restriction<br />
fragments, and (3) gel analysis of the amplified<br />
fragments (Vos et al. 1995).<br />
Recently, the use of Amplified fragment<br />
length polymorphisms (AFLP) in genetic marker<br />
technologies has become the main tool due to its<br />
capability to disclose a high number of<br />
polymorphic markers by single reaction, high<br />
throughput, and cost effective (Jones et al.<br />
1997). AFLP have been widely utilized markers<br />
for constructing genetic linkage maps and<br />
genetic diversity analysis. It is a useful<br />
technique for breeders to accelerate plant<br />
improvement for a variety of criteria, by using<br />
molecular genetic maps to undertake markerassisted<br />
selection and positional cloning for<br />
special characters. Molecular markers are more<br />
reliable for genetic studies than morphological<br />
characteristics because the environment does not<br />
affect them (Vos et al. 1995).<br />
AFLP markers have successfully been used<br />
for analyzing genetic diversity in some other<br />
plant species. It has been proven the most<br />
efficient technique estimating diversity in barley<br />
(Russel et al. 1997), provides detailed estimates<br />
of the genetic variation of papaya (Kim et al.<br />
2002), and have been used to analyze the genetic<br />
17
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011<br />
diversity of various plants such as tea (Lai et al.<br />
2001), eggplant (Mace et al. 1999), peach<br />
(Manubens et al. 1999), apple (Guolao et al.<br />
2001), rapeseed (Lombard et al. 1999), wild<br />
radish (Man and Ohnishi 2002), Musa sp. (Wong<br />
et al. 2001; Ude et al. 2002), peanut (Herselman,<br />
2003), soybean (Ude et al. 2003), and maize<br />
(Lübberstedt et al. 2000). A little work has been<br />
done on peach using AFLP molecular techniques<br />
for evaluating genetic diversity in relatedness<br />
with geographical origin.<br />
The objectives of this study are to use AFLP<br />
markers for varietal identification and to<br />
estimate genetic relationships among the peach<br />
varieties from Kurdistan region of Iraq.<br />
MATERIALS AND METHODS<br />
Sample Collection<br />
Leaf samples of the local peach varieties<br />
were collected from different districts in<br />
Kurdistan region and analyzed for AFLP. These<br />
samples were obtained from Duhok, Erbil and<br />
Sulaymani. The varieties of peach selected for<br />
this study were: Korneet asfer, Floredasin,<br />
Motaem bkornet mobaker (Ahmer), Sprink time,<br />
Nectar 4, Nectar 6, Ahmer myse, Badree,<br />
Mskee, Tenee, Esmailly, Migrant, Abo-zalma,<br />
Silverking, Read heaven, Sharly shapor, Zard,<br />
Elberta, Zaefaran, Dixired, and J. H. Hale.<br />
DNA Extraction<br />
From each variety, approximately 3g of<br />
young leaf tissue was collected and grounded to<br />
a fine powder using liquid nitrogen. DNA was<br />
extracted as reported by Weigand et al., (1993).<br />
This method was based on the use of 10ml of<br />
pre-heated (60 o c) 2x CTAB extraction buffer<br />
(2x CTAB, 5M NaCl, 1M Tris-HCl, 0.5 M<br />
EDTA), mixed well, and incubated at 60 ° c in<br />
shaking water bath. After 30 min of incubation,<br />
the mixture was extracted with an equal volume<br />
of choloroform/isoamyl alcohol (24:1, v/v). The<br />
mixture was then centrifuged (at 4000 rpm for<br />
30min). The aqueous phase was transferred into<br />
another tube and precipitated with 0.66 volume<br />
of isopropanol, and then TE- buffer was added to<br />
dissolve the nucleic acids.<br />
The samples of DNA obtained were loaded<br />
on to a 0.8% agarose gel, and DNA<br />
concentration was estimated by comparing the<br />
florescence with �DNA standard.<br />
PCR Amplification of AFLP- primers<br />
The AFLP analysis was performed according<br />
to Vos et al. (1995) method with minor<br />
modifications. Initially, genomic DNA (500ng of<br />
each sample) were digested with 5U each of two<br />
restriction enzymes, Tru91 (recognition site<br />
5’T↓TAA3’) and PstI (recognition site<br />
5’CTGCA↓G3’) in 30µl a final volume of<br />
18<br />
reaction mix containing, 1x one phor-all buffer<br />
(pharmacia Bioteh, Uppsala, Sweden) incubating<br />
three hours at 37 o C. The DNA fragments were<br />
then ligated with PstI and Tru91 adapter. This<br />
was achieved by adding 50 pmol of Tru91adapter,<br />
5 pmol of PstI-adapter,in a reaction<br />
containing1U of T4-DNA ligase, 1mM rATP in<br />
1x one phore-all buffer and incubating for 3<br />
hours at 37 o C. After ligation, the reaction<br />
mixture was diluted to 1:5 using sterile distilled<br />
water. Pre-selective PCR amplification was<br />
performed in a reaction volume of 20µl<br />
containing 50ng of each of the oligonucleotid<br />
primers (P00, M43) corresponding to the Tru91<br />
and PstI adapters (P00 primer corresponding for<br />
Pst1 adapter and M43 primer corresponding for<br />
Mse1(Tru91) adapter), 2µl of template- DNA,<br />
1U Taq DNA polymerase, 1x PCR buffer and<br />
5mM dNTPs, in a final volume 20µl.<br />
The PCR reaction was performed in a thermal<br />
cycler using following temperature: 30 cycles of<br />
30sec at 94 ºC, 6 at 60ºC, 1min at 72ºC. After<br />
that, the pre-amplification product was diluted to<br />
1:5 and 2µl used as template for selective<br />
amplification. Selective amplification was<br />
conducted using Tru91 and Pst1 primers<br />
combinations. The Pre-amplification and<br />
selective amplification primer combinations that<br />
used in this study are (P101+M181,<br />
P101+M184). Amplification was performed in<br />
thermo cycler programmed for 36 cycles with<br />
the following cycle profile: a 30sec DNA<br />
denaturation step at 94ºC, 30 sec annealing step<br />
(see below) and a 1min extension step at 72ºC.<br />
The annealing temperature was varied in the first<br />
few cycle it was 65ºC; in each subsequent cycle<br />
for the next 12 cycle it was reduced by 0.7ºC<br />
(touchdown PCR), and for the remaining 23<br />
cycles, it was 56ºC. The selective amplification<br />
products were loaded onto 6% denaturating<br />
polyacrylamid gels, and DNA fragments were<br />
visualized by silver staining kit (Promega,<br />
Madison, Wis) as described by the supplier,<br />
silver-stained gels were scaned to capture digital<br />
images of the gels after air dryin.<br />
Data analysis<br />
Total bands were scored visually and<br />
polymorphic bands were recorded for presence<br />
(1) or absence (0). The polymorphic adapt was<br />
used to estimate Jaccard coefficient of<br />
dissimilarity (Rohlf, 1993). The similarity<br />
coefficient was used for construction of<br />
dendrogram base on Unweighted Pair-Group<br />
Method Arithmetic (UPGMA). The dissimilarity<br />
coefficient estimation and dedrogram<br />
construction were performed using NTSYS-pc<br />
ver. 1.8 software (Rohlf, 1993).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011<br />
RESULTS & DISCUSSION<br />
Figure 1 shows a typical AFLP gel image for<br />
the 21 varieties studied with the primer<br />
combinations (P101/M181) and (P101/M184). In<br />
this study genetic fingerprinting, phylogenetic<br />
diversity and genetic distance of peach varieties<br />
from Kurdistan region was evaluated by using<br />
AFLP markers. There were some studies had<br />
been done to estimate diversity of peach<br />
cultivars in Lebanon using microsattalite primer,<br />
(Chalak et al., 2006), AFLP markers also used to<br />
evaluate genetic diversity of ornamental peaches,<br />
(Donglin et al., 2005). Table 4 summarize the<br />
values of genetic distance of 21 peach varieties<br />
from different sources and locations.<br />
The genetic distance values ranged from<br />
(0.0073 to 0.8572). It was clear that the lowest<br />
genetic distance (0.0073) was found between<br />
varieties (Tenee) and (Esmailly) which were<br />
collected from Erbil, whereas the highest genetic<br />
distance (0.8572) was found between varieties<br />
Badree) and (Elberta) were collected from<br />
Duhok and Sulaymani respectively means that<br />
the similarity between them is very low.<br />
The dendrogram based on UPGMA produced<br />
three major clusters as shown in (Figure 2). The<br />
first genetic cluster mostly consisted of (Korneet<br />
Asfer, Floredasin, Motaem Bkornet Mobaker<br />
(Ahmer), Sprink Time, Nectar 4, Nectar 6,<br />
Ahmer Myse, Badree, Mskee, Tenee, Esmailly,<br />
Migrant, Abo-zalma, Silverking). The second<br />
genetic cluster consist of (Read Heaven, Sharly<br />
Shapor). While the third genetic cluster consists<br />
of (Zard, Elberta, Zaefaran, Dixired, J. H. Hale).<br />
The total number of amplified DNA fragments<br />
may make these varieties comes in separated<br />
groups. Studying the morphology of these<br />
varieties, it is noted that they have some<br />
characters that are close to each other, for<br />
example, the shape and color of fruits. Subclusters<br />
separated the varieties and form distinct<br />
genetic diversity among clusters.<br />
The genetic relationship among the cultivars<br />
based on molecular marker analysis will be<br />
useful for varietal identification and in further<br />
genetic improvement. It will also provide<br />
support for selection of parents for crossing in<br />
order to broaden the genetic base of the breeding<br />
programs (Thorman and Osborn, 1992).<br />
Estimation of genetic relationships will help to<br />
prevent genetic erosion within varieties by<br />
selecting a large number of different clones of<br />
each variety (Rühl, et al., 2000). Results of this<br />
study will provide guidance for future<br />
germplasm collection, conservation and breeding<br />
of peach.<br />
Table (1): Primer name and their sequences used for AFLP analysis<br />
No. Pre selective primer (‘5------3’) Selective primer (‘5-----3’)<br />
1 POO GACTGCGTACATGCAG P101 GACTGCGTACATGCAGAACG<br />
2 M43 GATGAGTCCTGAGTAAATA M181 GATGAGTCCTGAGTAACCCC<br />
3 M184 GATGAGTCCTGAGTAACCGA<br />
Table (2): Name and sampling region of the peach varieties used<br />
No. Name of Varieties Location Number of<br />
1. Korneet Asfer, Floredasin, Motaem Bkornet mobaker (ahmer), Sprink time,<br />
Nectar 4, Nectar 6, Ahmer myse, Badree<br />
Varieties<br />
Duhok 8<br />
2. Mskee, tenee, Esmailly, Migrant, Abo-zalma, Silverking Erbil 6<br />
3. Read heaven, Sharly shapor, Zard, Elberta, Zaefaran, Dixired, J. H. hale Sulaymani 7<br />
Total 21<br />
Table (3): Total number of bands, number of polymorphic bands and their<br />
percentage as amplified by the two primer combinations.<br />
AFLP primer Combination Number of Amplified<br />
Bands<br />
Number of<br />
Polymorphic Bands<br />
Percentage of Polymorphic<br />
Bands<br />
P101/M181 57 49 85.9%<br />
P101/M184 67 60 89.5%<br />
Total 124 109 87.9%<br />
19
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011<br />
A B<br />
Fig. (1): AFLP Gel image of 21 peach varieties produced by primer combination (P101/M181) and<br />
(P101/M184). ((1.Korneet asfer 2. Floredasin 3. Motaem bkornet mobaker (ahmer) 4. Sprink time 5. Nectar 4 6.<br />
Nectar 6 7. Ahmer myse 8. Badree 9. Mskee 10. Tenee 11. Esmailly 12. Migrant 13. Abo-zalma 14. Silverking<br />
15. Read heaven 16. Sharly shapor 17. Zard 18. Elberta 19. Zaefaran 20. Dixired 21. j. h. hale).<br />
20
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011<br />
Table (4): Genetic distance (Jaccard coefficient) between the peach varieties<br />
Fig. (2): The genetic relationship between peach varieties as estimated by AFLP markers analysis.<br />
21
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011<br />
REFERENCES<br />
- Wang Y., Georgi L. L., Reighard G. L., Scorza R., and<br />
Abbott A. G. (2002). Genetic Mapping of the<br />
evergrowing Gene in Peach [Prunus persica (L.)<br />
Batsch]. 2002 The American Genetic Association<br />
93:352–358.<br />
- Vos P, Hogers R, Bleeker M, Reijians M, Lee T, Hornes<br />
M, Frijters A, Pot J, Peleman J, Kuiper M, and<br />
Zaneau M, 1995. AFLP: a new technique for DNA<br />
fingerprinting. Nucleic Acids Res 23:4407–4414.<br />
- Jones CJ, Edwards KJ, Castaglione S, Winfield MO, Sala<br />
F, van de Wiel C, Bredemeijer G, Vosman B,<br />
Matthes M, Daly A, Brettschneider R, Bettini P,<br />
Buiatti M, Maestri E, Malcevschi A, Marmiroli N,<br />
Aert R, Volekaert G, Rueda J, Linacero R, Vazquez<br />
A, and Knap A, (1997). Reproducibility testing of<br />
RAPD, AFLP and SSR markers in plants by a<br />
network of European laboratories. Mol Breed<br />
3:381–390.<br />
- Huxley, A., ed. (1992). New RHS Dictionary of<br />
Gardening. Macmillan ISBN 0-333-47494-5.<br />
- Herselman L. (2003). Genetic variation among Southern<br />
African cultivated peanut (Arachis hypogaea L.)<br />
genotypes as revealed by AFLP analysis.<br />
Euphytica, September, vol. 133, no. 3, p. 319-327.<br />
- Ude G. N., Kenworthy W. J., Costa J. M., Cregan P. B.<br />
and Alvernaz J. (2003). Genetic diversity of<br />
soybean cultivars from China, Japan, North<br />
America, and North American ancestral lines<br />
determined by amplified fragment length<br />
polymorphism. Crop Science, September-October,<br />
vol. 43, no. 5, p. 1858-1867.<br />
- Lübberstedt T., Melchinger A. E., Duble C., Vuylsteke<br />
M., and Kuiper M. (2000). Relationships among<br />
Early European Maize Inbreds: IV. Genetic<br />
diversity revealed with AFLP markers and<br />
comparison with RFLP, RAPD, and pedigree data.<br />
Crop Science, May-June, vol. 40, no. 3, p. 783-791.<br />
- Thormann, C.E. and T.C. Osborn. 1992. Use of RAPD<br />
and RFLP markers for germplasm evaluation. In:<br />
Applications of RAPD technology to plant<br />
breeding. Proceedings of the Joint Plant Breeding<br />
Symposia Series. Minneapolis, Minnesota, pp. 9-11.<br />
- Weigand, F.; Baum and Udupa S. (1993). DNA Molecular<br />
Marker Techniques.Technical Manual No.20.<br />
International Center For Agricultural Research in<br />
the Dry Areas (ICARDA). Aleppo, Syria.<br />
- Rohlf, F. J. (1993). NT SYS-PC. Numerical Taxonomy<br />
and Multivariate Analysis System. Version 1.8<br />
Exter Software, Setauket, New York, U.S.A.<br />
- Sneath P. H. A. and Sokal R. R. (1973). The principle and<br />
practice of numerical classification. In: Kennedy<br />
D., Park R. B. (Eds.), Numerical Taxonomy.<br />
Freeman, San Francisco.<br />
- Olsen G. J. and Swofford D. L. (1990). Phylogenetic<br />
Reconstruction in Molecular Systematics. Hillis D.<br />
M. and Moritz C. (eds). Sinauer Associates,<br />
Sunderland, 411-501 pp.<br />
22<br />
Nei M. (1972). Genetic distance between populations. Am.<br />
Nat.106:283-292.<br />
- Russel, J.R., J.D. Fuller, M. Macaulay, B.G. Hatz, A.<br />
Jahoor, W. Powell, and R. Waugh. (1997). Direct<br />
comparison of levels of genetic variation among<br />
barley accessions detected by RFLPs, AFLPs, SSRs<br />
and RAPDs. Theor. Appl. Genet. 95:714-722.<br />
- Kim, M.S., P.H. Moore, F. Zee, M.M.M. Fitch, D.L.<br />
Steiger, R.M. Manshardt, R.E. Paull, R.A. Drew, T.<br />
Sekioka, and R. Ming. (2002). Genetic diversity of<br />
Carica papaya as revealed by AFLP markers.<br />
Genome 45: 503-512.<br />
- Lai, J.A., W. Yang, and J.Y. Hsiao. (2001). An<br />
assessment of genetic relationships in cultivated tea<br />
clones and native wild tea in Taiwan using RAPD<br />
and ISSR markers. Bot. Bull. Acad. Sin. 42: 93-<br />
100.<br />
- Mace, E.S., R.N. Lester, and C.G. Gebhardt. (1999).<br />
AFLP analysis of genetic relationships among the<br />
cultivated eggplant, Solanum melongena L. and<br />
wild relatives (Solanaceae). Theor. Appl. Genet. 99:<br />
626-633.<br />
- Manubens, A., S. Lobos, Y. Jadue, M. Toro, R. Messina,<br />
M. Lladser, and D. Seelenfreund. (1999). DNA<br />
isolation and AFLP fingerprinting of nectarine and<br />
peach varieties (Prunus persica). Plant Mol. Biol.<br />
Rep. 17: 255-267.<br />
- Guolao, L., L. Cabrita, C.M. Oleiveira, and J.M. Leitao.<br />
2001. Comparing RAPD and AFLPTM analysis in<br />
discrimination and estimation of genetic similarities<br />
among apple (Malus domestica Borkh.) cultivars.<br />
Euphytica 119: 259-270.<br />
- Lombard, V., C.P. Baril, P. Dubreuil, F. Blouet, and D.<br />
Zhang. 1999. Potential use of AFLP markers for the<br />
distinction of rapeseed cultivars. Proceeding of the<br />
10th International Rapeseed Congress, Canberra,<br />
Australia.<br />
- Man, K.H. and O. Ohnishi. (2002). Genetic diversity and<br />
genetic relationships of East Asian natural<br />
populations of wild radish revealed by AFLP.<br />
Breed. Sci. 52: 79-88.<br />
- Wong, C., R. Kiew, J.P. Loh, L.H. Gan, O. Set, S.K. Lee,<br />
S. Lum, and Y.Y. Gan. (2001). Genetic diversity of<br />
the wild banana Musa acuminata Colla in Malaysia<br />
as evidenced by AFLP. Annals Bot. 88: 1017-1025.<br />
- Ude, G., M. Pillay, D. Nwakanma, and A. Tenkouano.<br />
(2002). Genetic diversity in Musa acuminata Colla<br />
and Musa balbisiana Colla and some of their natural<br />
hybrids using AFLP markers. Theor. Appl. Genet.<br />
104: 1246-1252.<br />
- Chalak, L.; Chehade, A.; Elbitar1, A.; Cosson1, P.;<br />
Zanetto1, A.; Dirlewanger1, E. and Laigret1, F.<br />
(2006). Morphological and molecular<br />
characterization of peach accessions (prunus<br />
persica l.) cultivated in Lebanon. Lebanese Science<br />
Journal, Vol. 7, No. 2<br />
- Donglin,H.; Zuoshuang, Z.; Donglin, Z.; Qixiang, Z. And<br />
Jianhua, L. (2005). Genetic relationship of<br />
ornamental Peach determined using AFLP-Markers.<br />
HortScience 40(6):1782-1786.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011<br />
ىووب شةبادةوامؤب ىندشليسايد ؤب AFLP ىليهكةت ةدسةطةذهيص<br />
قاشَيع-ىاتطدسوك<br />
ةه خؤخ<br />
ىناكةسؤج ىةوةهيطان و<br />
ةتــخوـث<br />
وضَيوط وةويم ىكةووِس ةه سؤص ىكةيةسامر ةك ةناكةساذَهوط ةكةووِس ىناضَيخ ىطنشط ىليماذنةئ خؤخ ىكةووس<br />
مةه<br />
. ةيةي ىايمؤطؤمؤشك تشةي ىتشط ىكةيةوَيشةب ةك تَيشطةدؤخةه ةوةنذناصاس ىكةووس و مةداب و قةتظف<br />
ىذنةويةث و ىيةوامؤب ىنووبشةباد ىتطائ ىندشليسايد ؤب ةواشهَيي ساكةب<br />
ةه خؤخ ىةنونم سؤج نةي و تظيب ىتشط ىؤك<br />
AFLP<br />
ىليهكةت ةدسةطةذهيص ادةيةوةهيزَيوت<br />
. اذناتطدسوكةه خؤخ ىناكةسؤج ىيةوامؤب ىسؤمةنجةث و ىيةوامؤب<br />
وةوةهيزَيوت<br />
وةوةناشكؤك ىنامَيوط وشَيهوةي و نؤيد ىناكاطضَيساث ةه نةي سةيةه ىاتطدسوك ىناكةصاواج ةضوان<br />
و ىاتطدسوك ةه ةساج مةكةي ؤب ةك<br />
AFLP<br />
ىليهكةت ةدسةطةذهيص ىناهَييساكةب ةب اسد مانجةئ ؤب ىاييةوامؤب ىندشلَهةتيش<br />
ةذناب ىتشط ىؤك سةلَيجتطةد ىثوشط وود ىناهَييساكةب ةب ادةيةوةهيزَيوت مةه<br />
و ىووبةوَيشةشف وصاوايج<br />
ىدشلَهةتيشةب تةبيات<br />
) %89(<br />
ىايذناب ) 406(<br />
UPGMA<br />
ةك , ذناب ) 421(<br />
ةه<br />
ىووب ىتيشب<br />
ىسةتويجمؤك ىةمانسةب يناهَييساكةب ةب<br />
DNA<br />
. ىووب ةوَيشواي<br />
. تَيشهَييةدساكةب ادةكةضوان<br />
ىكةوان ىششت ىناكةواشكسؤص<br />
) % 4224(<br />
ىايذناب<br />
خؤخ<br />
ىةكةسؤج نةي و تظيب تشط ةيةوةهيزيوت مةئ ىناكةمانجةئ<br />
ةب تنطةب تشث ةب و ىيةوامؤب ىسامائ ىةوةناذلَيهو<br />
ةه ووب ىتيشب مةكةي ىثوشطةوامؤب . ىكةسةط ىثوشطةوامؤب َىط ؤب ىاشــلهَيهؤث ةوةماشطؤِشث و ميهكةت مةئ ىةطَيِس ةه<br />
Korneet asfer, Floredasin, Motaem bkornet mobaker (ahmer), Sprink time, Nectar 4, Nectar 6, Ahmer<br />
ووب ىتيشب مةوود ىثوشطةوامؤب و ) myse, Badree, Mskee, Tenee, Esmailly, Migrant, Abo-zalma, Silverking<br />
Zard, Elberta, Zaefaran, Dixired,<br />
ىيةوامؤب ىسوود ويترمةك . ووب<br />
025242<br />
( ةه ووب ىتيشب مةي َيط ىثوشطةوامؤب ةو<br />
ؤب<br />
) Read heaven, Sharly shapor(<br />
) 42(<br />
020040 ىاوَين ةه خؤخ ىناكةسؤج ىاوَين ىيةوامؤب ىسوود .) j. h. hale<br />
و ) 5(<br />
ةسامر ىاوَينةه ىيةوامؤب ىسوود ويشتسؤص اذلَيتاكةه , شَيهوةي ىاطضَيساث ةه ووب ) 44(<br />
و ) 40(<br />
ؤب وشاب ىلَيسةذيتةمساي و شخةبدوط ةنامانجةئ مةئ<br />
23<br />
(<br />
ةه<br />
ةسامر ىسؤج ىاوَينةه<br />
. نةي ىاودةه نةي ىنامَيوط و نؤيد ىاطضَيساث ةه ووب<br />
ةي ةه خؤخ ىناكةشاب ةسؤج ىنذناض و ىدشكسؤص و ىاذطَيهو<br />
ىدسازبَهةي ىتطةبةمةب خؤخ ىناساكةدسةوسةث<br />
و ىاسايتوج<br />
) 45(<br />
.<br />
اذقاشَيع<br />
ىناتطدسوك<br />
ىمَيس
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Scienes), Pp 17-24, 2011<br />
24<br />
قارعلا ناتسدروك ميلقأ يف خوخلا ةهكافل فانص لأا زيمتو يثارولا عونتلا يف AFLPلا<br />
تارشؤم مادختسا<br />
ةهكاف لثم وكاوفلا نم ديدعلا نمضتت يتلا ةيدرولا ةلئاعلا يف ةمهملا ةهكافلا دحأ<br />
داجيلا ةساردلا هذى يف تمدختسا<br />
AFLP<br />
لا اندلا تارشؤم<br />
. 5<br />
) Prunus persica(<br />
ةصلاخلا<br />
خوخلا ربتعي<br />
يموسوموركلا ددعلا تاوذ ةيرىزلا ةهكافلاو لقنلا<br />
قارعلا يف ىلولأا ةساردلا هذى ربتعتو<br />
, قارعلا ناتسدروك يف ةعورزملا خوخلا فانصأ نيب ةيثارولا ةقلاعلاو يثارولا عونتلا<br />
نم ةفلتخم قطانم نم ةنيع 24 عمج مت ذا.<br />
ةيضفنلا ةهكافلا ىلع AFLP اندلا تارشؤم مدختست يتلا ناتسدروك ميلقأو<br />
مت<br />
AFLPلا<br />
تارشؤم مادختساب ايثارو تانيعلا ليلحت متو<br />
ذا<br />
, ليبرأ و ةيناميلسلا<br />
, كوىد<br />
تاظفاحم<br />
تمض ميلقلأا<br />
مزحلا ددع تناك نيح يف ةنيابتم مزح ) % 54 ( 406 اهنيب نمو ةمزح 421 تجتنأ يتلاو تائدابلا نم<br />
نيتفيلوت مادختسا<br />
جمانرب قفو اهليلحت متو بوساحلا ىلا اهيلع لوصحلا مت يتلا تانايبلا تلخدأو<br />
.% 42<br />
ةبسنب يأ<br />
عيماجم ةثلاث ىلا تانيعلا تمسق<br />
جمانربلا اذى ىلع ادامتعاو تاساردلا نم عونلا اذهب صاخلا يئاصحلاا<br />
تينروكب معطم<br />
, ةملز وبأ<br />
, تناركيام<br />
, نساديرولف<br />
, يليعامسا<br />
ةيثارولا ةعومجملا تمض امنيب<br />
, رفصأ تينروك(<br />
, ينيت<br />
, يكسم<br />
. ) روباش يلراش<br />
42<br />
ةهباشتملا<br />
UPGMA<br />
ةيلاتلا فانصلأا ىلولأا ةيسيئرلا ةيثارولا ةعومجملا تمض ةيسيئر ةيثارو<br />
, يرذب,<br />
سيام رمحأ<br />
انيفاى دير(<br />
, 3<br />
راتكن<br />
تحوارت ةسوردملا فانصلأا نيب يثارولا دعبلا حوارت.<br />
) لوى جا يج ديرتسكيد<br />
يثارو دعب ىلعأ امنيب<br />
, ) ليبرأ ةظفاحم نم(<br />
نأ لمؤملا نم . يلاوتلا ىلع ةيناميلسلاو كوىد نم تعمج يتلا<br />
و<br />
, 1<br />
راتكن<br />
, ميات كنربس<br />
, ) رمحأ(<br />
ركبم<br />
تمضف ةيناثلا ةيسيئرلا ةيثارولا ةعومجملا<br />
و.<br />
) كنيكرفليس<br />
, ةينارفعز<br />
, اتريبلا<br />
, درز(<br />
ةثلاثلا ةيسيئرلا<br />
يليعامساو<br />
ينيت نيفنصلا نيب ناك يثارو دعب لقأ ناو 025242-020040نيب<br />
اتربلأ و رفصأ تينروك نيفنصلا نيب تدجو ) 025242(<br />
يف<br />
ةيبرتلا تلااجم يف خوخلا يبرم كلذكو خوخلا ةعارز ريوطت يف ةساردلا هذى نم اهيلع انلصح يتلا جئاتنلا دعاسي<br />
.<br />
قارعلا ناتسدروك ميلقأ
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 25-29, 2011<br />
EXISTENCE AND UNIQUENESS SOLUTION FOR NONLINEAR<br />
VOLTERRA INTEGRAL EQUATION<br />
RAAD. N. BUTRIS * and AVA SH. RAFEEQ **<br />
* Dept. of Mathematics, Faculty of Education, University of Zakho ,Kurdistan Region-Iraq<br />
** Dept. of Mathematics, Faculty of Science, University of Duhok ,Kurdistan Region-Iraq<br />
(Received: February 14, 2010; Accepted for publication: November 28, 2010)<br />
ABSTRACT<br />
In this paper, we study the existence and uniqueness solution for nonlinear Volterra integral equation, by using<br />
both methods ( Picard Approximation ) and (Banach Fixed Point Theorem). Also these methods could be developed<br />
and extended throughout the study.<br />
KEYWORDS: Existence and Uniqueness Solution; Volterra Integral Equation; Non-linear; Picard Approximation; Banach<br />
Fixed Point Theorem.<br />
I<br />
INTRODUCTION<br />
ntegral equations are encountered in<br />
various fields of science and numerous<br />
applications (oscillation theory, fluid dynamics,<br />
electrical engineering, etc.).<br />
Exact (closed-form) solutions of integral<br />
equations play an important role in the proper<br />
understanding of qualitative features of many<br />
phenomena and processes in various areas of<br />
natural science. Lots of equations of physics,<br />
chemistry and biology contain functions or<br />
parameters which are obtained from experiments<br />
and hence are not strictly fixed. Therefore, it is<br />
expedient to choose the structure of these<br />
functions so that it would be easier to analyze<br />
and solve the equation. As a possible selection<br />
criterion, one may adopt the requirement that the<br />
model integral equation admit a solution in a<br />
closed form. Exact solutions can be used to<br />
verify the consistency and estimate errors of<br />
various numerical, asymptotic, and approximate<br />
methods. Recently, [2,3,6].<br />
Pachpztte [5] studied the global existence of<br />
solutions of some volterra integral and integrodifferential<br />
equations of the form<br />
t<br />
x ( t ) �h( t ) ��k(<br />
t , s ) g ( s, x ( s )) ds ,<br />
and<br />
0<br />
t<br />
'<br />
x t f t x t k t s g s x s ds<br />
( ) � ( , ( ), � ( , ) ( , ( )) ),<br />
0<br />
with initial condition x(0) � x . o<br />
Tidke [7] investigated the existence of global<br />
solutions to first-order initial-value problems,<br />
with non-local condition for nonlinear mixed<br />
Volterra-Fredholm integro differential equations<br />
in Banach spaces of the form.<br />
t b<br />
'<br />
x () t f ( t , x ( t ), k ( t , s, x ( s)) ds, h( t , s, x ( s)) ds )<br />
0 0<br />
� � �<br />
with non-local condition<br />
x (0) �g( x ) � x . o<br />
Consider the following non linear system of<br />
Volterra integral equations which has the form :<br />
t s<br />
( , ) ( ) ( , ( , ), ( , �) ( �, ( �, )) �,<br />
o o<br />
a<br />
o<br />
��<br />
o<br />
x t x F t f s x s x G s g x x d<br />
� �� �<br />
�<br />
b( s)<br />
as ( )<br />
g ( �, x ( �, x )) d� ) ds,<br />
o<br />
(1)<br />
where x D<br />
n<br />
R<br />
n<br />
domain subset of Euclidean space R .<br />
Let the vectors functions<br />
f ( t , x , y , z ) � ( f ( t , x , y , z ), f ( t , x , y , z ),..., f ( t , x , y , z ))<br />
� � D is a closed and bounded<br />
1 2<br />
g ( t , x ) � ( g1( t , x ), g2( t , x ),..., g n ( t , x ))<br />
and<br />
Fo ( t ) � ( Fo1( t ), Fo2( t ),..., Fon ( t ))<br />
are defined and continuous in the domain<br />
( t , x , y , z ) �[ a, b] �D �D1 �D 2 � ( ��, � ) �D �D1 �D<br />
(2)<br />
2<br />
where 1 D and D 2 are closed and bounded<br />
m<br />
domains subsets of Euclidean space R .<br />
Suppose that the functions f ( t , x , y , z ) and<br />
g ( t , x ) satisfy the following inequalities :<br />
f ( t , x , y , z ) �M, g ( t , x ) � N<br />
(3)<br />
f ( t , x , y , z ) �f( t , x , y , z ) �Kx�x�Ly� y<br />
1 1 1 2 2 2 1 2 1 2<br />
�Qz1� z 2<br />
(4)<br />
g ( t , x ) �g( t , x ) �Hx� x<br />
(5)<br />
1 2 1 2<br />
for all t �[ a, b] , x , x 1, x 2 �D , y , y 1, y 2 � D1<br />
,<br />
z , z 1, z 2 � D2<br />
.<br />
where M and N are positive constant vectors<br />
and K , L , Q and H are positive constant<br />
matrices. Let G(t , s) is an (n � n) positive<br />
matrix which is defined and continuous in the<br />
n<br />
25
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 25-29, 2011<br />
domain [ a, b] � [ a, b]<br />
satisfying the following<br />
condition:<br />
( t s)<br />
G ( t , s) e , , 0<br />
� � �<br />
����� (6)<br />
where �� � a � s � t � b � �<br />
and also<br />
h � max t�[ a, b ] b( t ) �a( t ) , . � max t�[ a, b ] . ,<br />
where a(t) and b(t) are continuous functions<br />
defined on the domain (2).<br />
We defined the non-empty sets<br />
Df � D � M ( b �a) �<br />
�<br />
��<br />
D1f�D1�HM( b �a) �<br />
�<br />
�<br />
D2f�D2 � hHM ( b �a) �� 26<br />
(7)<br />
Furthermore, we suppose that the greatest<br />
eigenvalue � max of the matrix:<br />
�<br />
� � ( K � H ( L �Qh ))( b � a)<br />
, does not exceed<br />
�<br />
unity , i.e : �max � 1.<br />
PICARD APPROXIMATION METHOD<br />
The study of the existence and uniqueness<br />
solution of Volterra integral equation (1) will be<br />
introduced by the theorems :<br />
Theorem 1. ( Existence Theorem )<br />
Let f ( t , x , y , z ) , g ( t , x ) and Fo() t be vector<br />
functions which are defined and continuous on<br />
the domain (2), satisfy the inequalities (3),(4)<br />
and (5) , also G(t,s) is defined and continuous<br />
in [ a, b] � [ a, b]<br />
, satisfies the condition (6), then<br />
the sequence of functions :<br />
t s<br />
m 1 ( , ) ( ) ( , ( , ), ( , ) ( , ( , )) ,<br />
o o<br />
a<br />
m � � o m � �<br />
��<br />
o<br />
x t x F t f s x s x G s g x x d<br />
� � �� �<br />
b( s)<br />
� g ( �, x ( , )) ) ,<br />
as ( )<br />
m � x o d� ds<br />
(9)<br />
with x o ( t , x ) �F( ) o o t �xo, m � 1,2,...<br />
convergent uniformly on the domain :<br />
( t , x ) �[ a, b] �D f � ( ��, � ) �D<br />
f<br />
(10)<br />
to the limit function x �(<br />
t , x o ) which is<br />
satisfying the integral equation:<br />
t s<br />
x ( t , x ) �F( t ) �� f ( s, x ( s, x ), G ( s, �) g ( �, x ( �, x )) d�<br />
,<br />
o o<br />
a<br />
o � ��<br />
o<br />
b( s)<br />
� g ( �, x ( �, x )) ) ,<br />
as ( )<br />
o d� ds<br />
(11)<br />
with x � ( t , x 0)<br />
� Fo ( t ) � M ( b � a)<br />
(12)<br />
and<br />
(13)<br />
m<br />
�1<br />
x � ( t , x 0) � x m ( t , x 0)<br />
� � ( E �� ) M ( b �a)<br />
.<br />
Proof: Consider the sequence of functions<br />
x ( t , x ), x ( t , x ), ... , x ( t , x ) , ... defined by<br />
1 0 2 0 m 0<br />
recurrence relation (9) , each function of these<br />
sequence is continuous in t , x .<br />
From (9) when m = 0 and using (3), we have<br />
t<br />
x 1( t , x 0)<br />
�Fo( t ) � Fo ( t ) ��f(<br />
s, x , ( , ) ( , ) ,<br />
a<br />
o � G s � g � x o d�<br />
�<br />
b( s)<br />
as ( )<br />
s<br />
��<br />
g ( �, x ) d�) ds � Fo<br />
() t<br />
t<br />
s b ( s )<br />
� �a o ��� o � as ( )<br />
o<br />
o<br />
f ( s, x , G ( s, � ) g ( �, x ) d� , g ( �, x ) d� ) ds<br />
so that<br />
x 1( t , x 0)<br />
� Fo ( t ) �M( b � a)<br />
(14)<br />
By using (5) and (14), we get<br />
t<br />
y ( t , x ) � y ( t , x ) � G ( t , s) g ( s, x ( s, x )) ds �<br />
�<br />
1 0 0 0<br />
��<br />
1 0<br />
�<br />
t<br />
�<br />
t<br />
��<br />
G ( t , s ) g ( s, x ) ds<br />
� G ( t , s) g ( s, x (, s x )) �g(<br />
s, x )) ds<br />
��<br />
� � �<br />
1 0 0<br />
t<br />
��( t�s) e H x 1(, s x 0) x 0)<br />
ds<br />
��<br />
�<br />
therefore<br />
�<br />
y 1( t , x 0) �y0( t , x 0)<br />
� HM ( b � a)<br />
�<br />
for all xo �D and f<br />
�<br />
t<br />
y (, t x)<br />
� G ( t , s) g ( s, x ) ds �D<br />
0 0<br />
��<br />
0 1f<br />
Again, using (5) and (14), we have<br />
b ( t ) b ( t )<br />
� �<br />
z ( t , x ) � z ( t , x ) � g ( s, x ( s, x )) ds � g ( s , x )) ds<br />
1 0 0 0<br />
a( t )<br />
1 0<br />
a( t )<br />
0<br />
�<br />
bt ()<br />
� g ( s, x (, s x )) �g(<br />
s, x )) ds<br />
at ()<br />
�<br />
t<br />
1 0 0<br />
� H x (, s x ) �x)<br />
ds<br />
��<br />
1 0 0<br />
and hence<br />
z ( t , x ) �z( t , x ) �hHM( b � a)<br />
1 0 0 0<br />
for all xo �D and f<br />
�<br />
bt ()<br />
z (, t x)<br />
� g ( s, x ) ds �D<br />
0 0<br />
at ()<br />
0 2f<br />
So that<br />
x1(, t x0)<br />
� D where xo � D , f t � [ a, b].<br />
Therefore by mathematical induction, we get<br />
x ( t , x ) � F ( t ) �M( b � a)<br />
,<br />
m 0 o<br />
�<br />
y m ( t , x 0) �y0( t , x 0)<br />
� HM ( b � a)<br />
,<br />
�<br />
and<br />
z ( t , x ) �z( t , x ) �hHM( b � a)<br />
,<br />
1 0 0 0<br />
for all t [ a, b]<br />
� , xo Df<br />
z 0 (, t x0)<br />
� D2f.<br />
In other words<br />
x (, t x)<br />
D y (, t x)<br />
D<br />
m<br />
0<br />
� , 0 0 1<br />
0<br />
.<br />
.<br />
y (, t x)<br />
� D f and<br />
� , m 0 1 � and z m (, t x0)<br />
D2<br />
for all t [ a, b]<br />
� , xo Df<br />
z 0 (, t x0)<br />
� D2f,<br />
where<br />
� ,<br />
y (, t x)<br />
� D f and<br />
� , 0 0 1
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 25-29, 2011<br />
�<br />
t<br />
y ( t , x ) � G ( t , s ) g ( s, x ( s, x )) ds, m �0,1,2,...<br />
m 0<br />
��<br />
m 0<br />
and<br />
�<br />
bt ()<br />
z ( t , x ) � g ( s, x ( s, x )) ds , m �0,1,2,..<br />
m 0<br />
at ()<br />
m 0<br />
Now, we claim that the sequence of functions<br />
x (, t x)<br />
is uniformly convergent on the domain<br />
m<br />
0<br />
[ a, b] � Df<br />
.<br />
For m=1 in (9) using (3)-(5), we find that<br />
t<br />
x ( t , x ) � x ( t , x ) � � f ( s, x ( s, x ),<br />
2 0 1 0<br />
a<br />
1 0<br />
s<br />
��� x 1( s, x 0<br />
bs ( )<br />
� as ( )<br />
1 0<br />
G ( s, � ) g ( �, )) d� , g ( �, x ( �, x )) d�<br />
) �<br />
� �<br />
bs ( )<br />
s<br />
( , , ( , � ) ( � , ) �, g ( �, x ) d�)<br />
f s x G s g x d ds<br />
o<br />
��<br />
o<br />
as ( )<br />
t<br />
( K x 1( s, x )<br />
a<br />
o � x o<br />
�<br />
� HL x 1(<br />
s, x o ) � x o<br />
�<br />
�<br />
�QhHx( s, x ) � x ) ds<br />
� �<br />
1<br />
o o<br />
t<br />
�<br />
� � ( KM ( b �a) � HLM ( b �a) �QhHM<br />
( b � a)) ds<br />
a<br />
�<br />
�<br />
2<br />
� ( K �H( L �Qh))<br />
M ( b � a)<br />
�<br />
� �M ( b � a)<br />
.<br />
Suppose that the following inequality<br />
k<br />
x k �1( t , x 0) � x k ( t , x 0)<br />
� � M ( b � a)<br />
(14)<br />
holds for some m=k, then we shall prove that<br />
the inqualtiy<br />
k �1<br />
x ( t , x ) � x ( t , x ) � � M ( b � a)<br />
k �20k �10<br />
Is true for all t [ a, b]<br />
� , xo � Df<br />
From (9) when m=k+1 and the inequality<br />
(14), we get<br />
x ( t , x ) �x( t , x ) � ( K x ( s, x ) �x(<br />
s, x ) �<br />
k �20k �10<br />
t<br />
� a<br />
k �1<br />
0 k 0<br />
�<br />
HL x k �1( s, x 0) �xk( s, x 0) �QhH<br />
x k �1(<br />
s, x 0) �xk(<br />
s, x 0)<br />
) ds<br />
�<br />
t<br />
k � k<br />
� � ( K � M ( b �a) � HL � M ( b �a) �<br />
a<br />
�<br />
k<br />
QhH � M ( b �a))<br />
ds<br />
�<br />
�<br />
k<br />
( K � H ( L �Qh )) � M ( b � a)<br />
�<br />
k �1<br />
� M ( b �a)<br />
�<br />
By mathematical induction and by (9) and<br />
(12) the following inequality holds:<br />
m<br />
x m�1( t , x 0) � x m(<br />
t , x 0)<br />
� � M ( b � a)<br />
(15)<br />
�<br />
where � � ( K � H ( L � Qh))( b � a)<br />
�<br />
m �<br />
for all 0,1,2,...<br />
From (15) we conclude that for k � 1,<br />
we<br />
have the following inequality :<br />
x ( t , x ) �x( t , x ) � x ( t , x ) �x(<br />
t , x ) �<br />
m �k 0 m 0 m �k 0 m �k �1<br />
0<br />
2<br />
o<br />
x ( t , x ) �x( t , x ) �... � x ( t , x ) �x(<br />
t , x )<br />
m �k �1 0 m �k �2 0 m �1<br />
0 m 0<br />
� � ) � � ) �... �<br />
m �k �1 m �k �2<br />
x 1( t , x 0 �x0x1( t , x 0 �x0<br />
m<br />
� x (, t x ) � x<br />
1 0 0<br />
m 2 k �2k�1 � � ( E � � � � �... � � � � ) x 1(, t x 0) � x 0<br />
therefore<br />
m<br />
�1<br />
x m �k ( t , x 0) � x m ( t , x 0)<br />
� � ( E � �) M ( b � a)<br />
(16)<br />
where E is identity matrix, t � [ a, b]<br />
and xo � D . f<br />
By using the condition (8) and the inequality<br />
(16), we find that<br />
m<br />
lim � � 0<br />
(17)<br />
m ��<br />
The relations (16) and (17) prove the uniform<br />
convergence of the sequence of function (9) in<br />
the domain (10) as m ��.<br />
Let<br />
lim x ( t , x ) � x ( t , x )<br />
(18)<br />
m ��<br />
m<br />
0 � 0<br />
Since the sequence of functions x m (, t x 0)<br />
are<br />
defined and continuous in the domain (10), then<br />
the limiting function x � (, t x 0)<br />
is also defined and<br />
continuous in the domain (10).<br />
Theorem 2. (Uniqueness Theorem)<br />
With the hypotheses and all conditions of the<br />
theorem 1 , the solution of Volterra integral<br />
equation (1) is unique.<br />
*<br />
Proof. Let x (, t x 0)<br />
be another solution of the<br />
Volterra integral equation (1), i.e.<br />
t s<br />
* * *<br />
( , ) ( ) ( , ( , ), ( , �) ( �, ( �, )) �,<br />
o o<br />
a<br />
o<br />
��<br />
o<br />
x t x F t f s x s x G s g x x d<br />
� �� �<br />
�<br />
b( s)<br />
as ( )<br />
and then we have<br />
g x d ds<br />
*<br />
( �, x ( �, o )) � ) ,<br />
( , 0<br />
*<br />
( , 0<br />
t<br />
a<br />
0<br />
s<br />
��� x( , x0<br />
bs ( )<br />
� as ( )<br />
0<br />
x t x ) � x t x ) � � f ( s, x ( s, x ),<br />
G ( s, � ) g ( �, � )) d� , g ( �, x ( �, x )) d�<br />
) �<br />
� �<br />
*<br />
s<br />
*<br />
b ( s )<br />
*<br />
0<br />
��<br />
0<br />
a( s)<br />
0<br />
f ( s, x ( s, x ), G ( s, � ) g ( �, x ( �, x )) d� , g ( �, x ( �, x )) d� ) ds<br />
t<br />
� � a<br />
�<br />
* �<br />
*<br />
( K x ( s, x o) � x ( s, x 0) � HL x ( s, x o)<br />
� x ( s, x 0)<br />
�<br />
�<br />
�QhHxsx� ds<br />
*<br />
( , o ) x (, s x 0)<br />
)<br />
�<br />
�<br />
*<br />
( K � H ( L �Qh ))( b � a) x ( t , x o ) � x ( t , x 0)<br />
so that<br />
x ( t , x ) x ( t , x ) �� x ( t , x ) x ( t , x )<br />
* *<br />
0 � 0 0 � 0<br />
By iteration we find<br />
x ( t , x<br />
*<br />
) �x( t , x<br />
m<br />
) �� x ( t , x<br />
*<br />
) �x(<br />
t , x )<br />
0 0 0 0<br />
But from the condition (8), we get<br />
m<br />
� � 0 when m ��, hence we obtain that<br />
27
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 25-29, 2011<br />
28<br />
*<br />
0) � 0)<br />
. Hence 0<br />
x ( t , x x ( t , x<br />
solution of (1).<br />
x (, t x ) is a unique<br />
Remark 1. The following theorem ensure the<br />
stability solution of Volterra integral equation of<br />
non linear system (1) when there is a slight<br />
change in the point x 0 , accompanied with a<br />
noticeable change in the function x � x (, t x 0)<br />
.<br />
Theorem 3. :Let<br />
t s<br />
( , ) ( ) ( , ( , ), ( , �) ( �, ( �, )) �,<br />
o o<br />
a<br />
o<br />
��<br />
o<br />
x t x F t f s x s x G s g x x d<br />
� �� �<br />
�<br />
b( s)<br />
as ( )<br />
g ( �, x ( �, x )) d� ) ds,<br />
is non linear system of Volterra integral<br />
equations , then the following inequality:<br />
x ( t , x ) x ( t , x ) � ( E � � ) F ( t ) F ( t )<br />
1 2 �1<br />
1 2<br />
o � o o � o<br />
1 2<br />
is true for all t �[ a, b], x o , x o � Df<br />
Proof :From [4], we have<br />
t s<br />
o � o ��a o � ��<br />
o<br />
k k<br />
k k<br />
x ( t , x ) F ( t ) f ( s, x ( s, x ), G ( s, �) g ( �, x ( �, x )) d�<br />
,<br />
�<br />
b( s)<br />
as ( )<br />
o<br />
k<br />
g ( �, x ( �, x )) d� ) ds,<br />
k k k<br />
with x o ( t , x o ) �Fo� x o , where k=1,2<br />
then we have<br />
t<br />
1 2 1<br />
1<br />
( , o ) � ( , o ) o ( ) � ( , ( , ),<br />
a<br />
o<br />
x t x x t x � F t � f s x s x<br />
s<br />
b( s)<br />
1<br />
1<br />
� ( , � ) ( �, ( �, )) �, ( �, ( �, )) )<br />
o<br />
as ( )<br />
o �<br />
��<br />
�<br />
G s g x x d g x x d ds �<br />
�� �<br />
t s<br />
2 2 2<br />
o ( ) ( , ( , ), ( , � ) ( �, ( �, )) �,<br />
a<br />
o<br />
��<br />
o<br />
F t f s x s x G s g x x d<br />
�<br />
b( s)<br />
as ( )<br />
g x x d ds<br />
2<br />
( �, ( �, o )) � )<br />
t<br />
1 2 1 2<br />
o ( ) � o ( ) � K ( , o � ( ,<br />
a<br />
o<br />
�<br />
� F t F t ( x s x ) x s x ) �<br />
�<br />
1 2 1 2<br />
HL x ( s, x o ) �x( s , x o ) � QhH x ( s , x o ) �x(<br />
s , x o ) ) ds<br />
�<br />
� F ( t ) �F( t ) �<br />
1 2<br />
o o<br />
�<br />
�<br />
1 2<br />
( K �H( L � Qh))( b �a) x ( t , x o) �x(<br />
t , x o)<br />
� F t F t x t x ) x t x ) ,<br />
1 2 1 2<br />
o ( ) � o ( ) � � ( , o � ( , o<br />
so that<br />
1 2 �1<br />
1 2<br />
x ( t , x ) �x( t , x ) � ( E � � ) x ( t , x ) �x(<br />
t , x )<br />
o o o o<br />
1 2<br />
for all t �[ a, b], x o , x o � Df<br />
By definition of stability [4],<br />
1 2<br />
o ( ) � o ( ) � ,assume that � �<br />
�1<br />
F t F t �<br />
get<br />
x ( t , x ) x ( t , x ) �<br />
1 2<br />
o o<br />
� � ,<br />
o<br />
�<br />
( E �� )<br />
for all t �[ a, b], 1 2<br />
x o , x o � Df<br />
, i.e.<br />
x (, t x o ) is a stable solution for all t � a.<br />
, we<br />
1. Banach fixed point theorem<br />
The study of the existence and uniqueness<br />
solution of integral equation (1).<br />
Lemma 1[1]. Let S be a space of all continuous<br />
functions on [a,b], for any z �S define z by<br />
z � max z ( t ) . Then (S, z ) is a Banach space.<br />
t�[ a, b ]<br />
Theorem 4[1]. ( Banach fixed point theorem )<br />
Let E be a Banach space . If T is a<br />
contraction mapping on E , then T has one and<br />
only one fixed point in E .<br />
Theorem 5.( Existence and uniqueness<br />
theorem )<br />
Let f ( t , x , y , z ) , g ( t , x ) and 0 () F t be vector<br />
functions which are defined and continuous on<br />
the domain (2) and satisfying all conditions of<br />
theorem 1. Then the Volterra integral equation<br />
(1) has a unique continuous solution z ( t , x o ) on<br />
the domain (2), provided that 0��o� 1 , where<br />
�<br />
�o � ( K � H ( L � Qh))( b � a)<br />
.<br />
�<br />
Proof: From lemma 1 , (S, z ) is a Banach<br />
space , define a mapping<br />
� �� �<br />
*<br />
T on [a,b] as<br />
*<br />
T z( t , x ) o F ( t ) o<br />
t<br />
f ( s, z ( s, x ),<br />
a<br />
o<br />
s<br />
G ( s, �) g ( �, z ( �, x )) d�<br />
,<br />
��<br />
o<br />
b( s)<br />
� g ( �, z ( �, x )) ) ,<br />
as ( )<br />
o d� ds (19)<br />
Since g ( t , x ), G ( t , s) and 0 () F t are continuous<br />
on the domain (2), then<br />
bt ()<br />
t<br />
f ( t , z ( t , x ), ( , ) ( , ( , )) , ( , ( , )) )<br />
o � G t s g s z s x d� g s z s x o<br />
o ds<br />
��<br />
� is<br />
at ()<br />
*<br />
continuous on the domain (2), thus T z ( t, x ) is o<br />
continuous on the same domain, hence<br />
*<br />
T z( t , x ) : S � S .<br />
o<br />
*<br />
Next we claim that T z( t, x ) is contraction<br />
o<br />
mapping on [a,b] , let z , w � [ a, b]<br />
, then from<br />
(19) and using (3)-(5), we have<br />
t<br />
* *<br />
t x � t x max F t � f s z s x<br />
o o o o<br />
t�[ a, b ]<br />
a<br />
T z ( , ) T w ( , ) � ( ) � ( , ( , ),<br />
s<br />
b( s)<br />
��� o � as ( )<br />
G ( s, � ) g ( �, z ( �, x )) d� , g ( �, z ( �, x )) d� ) ds �<br />
�� �<br />
t s<br />
( ) ( , ( , ), ( , � ) ( �, ( �, )) �,<br />
o<br />
a<br />
o<br />
��<br />
o<br />
F t f s w s x G s g w x d<br />
�<br />
b( s)<br />
as ( )<br />
g ( �, w ( �, x )) d� ) ds<br />
t�[ a, b ] a<br />
o<br />
s<br />
t<br />
� max � f ( s, z ( s, x o), � G ( s, � ) g ( �, z ( �, x o))<br />
d�<br />
,<br />
�<br />
b( s)<br />
as ( )<br />
g ( �, z ( �, x )) d� ) ds �f<br />
( s, w ( s, x ),<br />
��<br />
o o<br />
s<br />
b( s)<br />
��� o � as ( )<br />
G ( s, � ) g ( � , w ( �, x )) d� , g ( �, w ( �, x )) d� ) ds<br />
max ( ( , ) ( , ) ( , ) ( , )<br />
t<br />
�<br />
K z s x �wsx� HL z s x �wsx�<br />
o o o o<br />
�<br />
� �<br />
t�[ a, b ] a<br />
o<br />
o
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 25-29, 2011<br />
�<br />
�QhHz( s, x ) � w ( s , x ) ) ds<br />
o o<br />
�<br />
( K � H ( L �Qh ))( b � a)<br />
max z ( t , x o) �w<br />
( t , x o)<br />
�<br />
t�[ a, b ]<br />
so that<br />
T z ( t , x ) �T w ( t , x ) � � z ( t , x ) � w ( t , x )<br />
* *<br />
o o o o<br />
Since 0��o� 1,<br />
we find<br />
mapping on [a,b], then by theorem 4,<br />
unique fixed point z ( t , x ) � [ a, b]<br />
, i.e.<br />
*<br />
T z ( t , x ) � z ( t , x ) and<br />
o o<br />
o<br />
*<br />
T is contraction<br />
t s<br />
*<br />
T z( t , x ) F ( t ) f ( s, z ( s, x ), G ( s, �) g ( �, z ( �, x )) d�<br />
,<br />
o o<br />
a<br />
o<br />
��<br />
o<br />
� �� �<br />
�<br />
b( s)<br />
as ( )<br />
g ( �, z ( �, x )) d� ) ds,<br />
o<br />
*<br />
T has a<br />
Hence z ( t , x o ) is the unique continuous<br />
solution for the Volterra integral equation (1) on<br />
the domain (2).<br />
Remark 2. The Picard approximation method<br />
give us a global solution for the Volterra integral<br />
equation (1), while contraction mapping theorem<br />
give us a local solution for the Volterra integral<br />
equation (1).<br />
REFERENCES<br />
- Butris, R. N. , Solution for the Volterra Integral<br />
Equations of Second Kind, Thesis, M.Sc.,<br />
University of Mosul, Iraq,(1984).<br />
- Gripenberg G., Londen S. O. and Staffens O., Volterra<br />
Integral and Functional Equations, Cambridge<br />
University Press, Cambridge, NewYork, (1990).<br />
- Miller, R. K. , Volterra integral equations in Banach<br />
space, Funkcialaj Ekvacioj, 18 (1995), 163-194.<br />
- Mitropolsky, Yu. A. and Martynuk D. I. , Periodic<br />
Solutions for the Oscillations Systems with<br />
Retarted Argument , Kiev, Ukraine, 1979 .<br />
- Pachpztte B. G., Applications of the leray-schauder<br />
alternative to some Volterra integral and integrodifferential<br />
equations, Indian J. pure appl.<br />
Math.,26(12): 1161–1168 (1995)<br />
- Polyanin A. D. and Manzhiriv A. V., Handbook of<br />
integral equations, CRC press, NewYork, 1998.<br />
- Tidke H. L., Existence of global solutions to nonlinear<br />
mixed Volterra-Fredholm integro-differential<br />
equations with nonlocal conditions, Elect. J. of diff.<br />
eq., Vol 2009,no.55,1-7(2009).<br />
ايةن ايراكواوةت اي ارًَتلىظ اشًَكواي ذ امَيذر انركراكًش اًناكات و ىوىبةي اندناخ ب ةياديرطةظىبخ َىهًلىكةظ َىظ<br />
مةئ اسةورةي و , ) ىخاناب اي رًَطًَج لااخ اندنالمةس ( و ) ىوىبكيزن ىب دراكًب ( اكَير وود اناهًئراكب ىذوةئ و ،ىلًَي<br />
ةتخىث<br />
. ويةكب هةرفرةب و ينخًَب شًَث ىرةس ل اكَير<br />
وةئ َىندناخ َىظ اكَيرب ىاًش<br />
ةصلاخلا<br />
مادختساب كلذو ةيطخلالا ةيلماكتلا اريتلوف تلاداعم نم ماظنل لحلا ةينادحوو دوجو ةسارد ثحبلا اذه نمضتي<br />
ةقيرطلا عيسوتو ريوطت ةساردلا هذه للاخ نم انعطتسا كلذكو .) خاناب ( ل ةتباثلا ةطقنلا ةنهربمو بيرقتلل دراكيب يتقيرط<br />
.<br />
هلاعا<br />
29
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
03<br />
PROTECTIVE EFFECTS OF MELATONIN, VITAMIN E, VITAMIN C<br />
AND THEIR COMBINATIONS ON CHRONIC LEAD –INDUCED<br />
HYPERTENSIVE RATS<br />
ISMAIL MUSTAFA MAULOOD<br />
Dept of Biology, College of Science, University of Salahaddin, Kurdistan Region-Iraq<br />
(Received: February 25, 2010; Accepted for publication: March 9, 2011)<br />
ABSTRACT<br />
The aim of the present study was to investigate the effects of long-term administration of melatonin, vitamin C,<br />
vitamin E and their combinations, on blood pressure, serum nitric oxide (NO ),calcium ions and electrolytes in leadinduced<br />
hypertensive rats . Fifty four adult female albino rats were used in this study. The experimental rats were<br />
divided to nine groups, each of six individuals and the treatments were continued for 10 weeks as the following:<br />
Group 1: Control rats. Group 2: Sodium acetate (0.1mg/L drinking water). Group 3: Lead acetate (Pb). (0.1mg/L<br />
drinking water) Group 4: Pb + Melatonin. (60 mg of melatonin/kg diet) Group 5: Pb + Vitamin E. (1000 I.U of<br />
vitamin E /kg diet) ,(Group 6: Pb +Vitamin C (1mg of vitamin C/L drinking water). Group 7 (Combination ): Pb<br />
+Melatonin + Vitamin E ,Group 8 (Combination ): Pb + Melatonin +Vitamin C , and Group 9 ( Combination ): Pb<br />
+Vitamin E+ Vitamin C. A significant rise in systolic blood pressure (SBP) was noted 10 weeks after the onset of lead<br />
exposure in the Pb group. Administration of melatonin or vitamin c significantly reduced SBP on fourth week of<br />
treatments , whereas vitamin E caused a reduction in SBP on the sixth of treatments. Interestingly, melatonin in<br />
combination with vitamin E or C reduced SBP statistically more than vitamin E or C or their combinations. Coadministration<br />
of melatonin and vitamin E caused a significant decrease in heart rate on the eighth weeks of<br />
treatments. Reduction of serum NO that were detected in Pb treated rats were improved by melatonin, vitamin C,<br />
vitamin E and their combinations. Serum calcium was decreased in Pb treated rats , whereas serum sodium and<br />
potassium did not change. There were no statistical changes in body weight and food intake among the studied<br />
groups.<br />
In conclusion, long term lead-treated rats exhibited marked elevation of SBP , heart rate, and a significant<br />
reduction of serum NO . These abnormalities nearly disappeared with the melatonin in combination with vitamin E or<br />
C more than vitamin E or C or their combinations.<br />
KEY WORDS: Lead(Pb) , Hypertension, Nitric oxide Melatonin, Vitamin E, Vitamin C<br />
C<br />
INTRODUCTION<br />
hronic exposure to low levels of lead<br />
results in arterial hypertension in<br />
humans and in experimental animals (Sharp et<br />
al.,1988). Lead exposure increases blood<br />
pressure (BP) by unknown mechanisms (Badavi<br />
et al.,2008). Although different considerations<br />
have been raised to explain the pathogenesis of<br />
lead-induced hypertension, and several studies<br />
have suggested the primary involvement of the<br />
increased production of reactive oxygen species<br />
(ROS) in lead-exposed animals (Gonick et al.,<br />
19997). Elevated levels of ROS reduce the<br />
bioavailability of NO. Zhang et al., (2005)<br />
indicated that expression of eNOS of the Pb<br />
exposed rats was significantly upregulated. It has<br />
been reported that chronic exposure to lead<br />
raises plasma angiotensin-converting enzyme<br />
and kininase II activities, events that can support<br />
a rise in BP by elevating plasma angiotensin II<br />
and depressing plasma bradykinin levels<br />
(Carmignani et al.,1999). In addition, alter<br />
prostaglandin production, enhance endothelin<br />
generation, and increase protein kinase C<br />
activity have been implicated in the pathogenesis<br />
of lead-associated hypertension (HTN) (Gonick<br />
et al.,1998).<br />
Melatonin, the principal secretory product of<br />
pineal gland, is produced during the dark phase<br />
of circadian cycle. It has been shown that<br />
melatonin involves in the regulation of many<br />
physiological system including cardiovascular<br />
system (Vazan et al.,2004).The administration<br />
of melatonin significantly attenuates BP in NOSinhibited<br />
hypertensive rats(Deniz et al., 2006).<br />
Melatonin has roles in the regulation of calcium<br />
homeostasis and bone metabolism (Suzuki et<br />
al.,2000). Vitamin E is a potent, naturally<br />
occurring lipid-soluble antioxidant that<br />
scavenges ROS and lipid peroxyl radicals<br />
(Braunlich et al., 1997). Administration of highdose<br />
vitamin E significantly ameliorates but did<br />
not completely abrogate lead-induced HTN<br />
(Nostratola et al.,1999)<br />
Vitamin C is also an important water-soluble<br />
antioxidant in biological fluids (Frei et al.,<br />
1990). It readily scavenges reactive oxygen,<br />
nitrogen, and chlorine species, thereby<br />
effectively protecting other substrates from
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
oxidative damage. The reactive species<br />
scavenged by vitamin C include superoxide,<br />
aqueous peroxyl radicals, singlet oxygen, ozone,<br />
peroxynitrite, nitrogen dioxide, and<br />
hypochlorous acid (Halliwell,1996). Attri et al.,<br />
(2003) concluded that concomitant<br />
administration of vitamin C ameliorates HTN,<br />
and normalizes NO levels. Compared with<br />
control group, blood Pb level was decreased<br />
significantly after given vitamin C, vitamin E or<br />
combination of vitamin C and E. The<br />
concentrations of superoxide dismutase, NO and<br />
NOS were significantly higher in vitamin C<br />
and/or E groups than those in control group<br />
(Li et al., 2008)<br />
The effects of co-administration of melatonin<br />
with vitamin C and E on SBP are not examined<br />
yet. Therefore, the aim of the present study was<br />
to investigate the effects of long-term<br />
administration of melatonin, vitamin C, vitamin<br />
E and in combinations, on BP, serum NO<br />
,calcium ions ,electrolytes and body weight gain<br />
or loss in lead-induced hypertensive rats.<br />
MATERIALS AND METHODS<br />
Animals and housing<br />
Fifty four adult female albino rats (Rattus<br />
norvegicus) were used in this study. All rats<br />
were weighing about (240 - 280 gm) and (7-9)<br />
weeks of age at the time when the experiment<br />
started. Animals were housed in plastic cages<br />
bedded with wooden chips. They were housed<br />
under standard laboratory conditions, 12:12<br />
light/dark photoperiod at 22 ± 2 ºC. The<br />
animals were given standard rat pellets and<br />
tap water ad libitum.<br />
Experimental Design<br />
This experiment was planed to study the<br />
effects of melatonin, vitamin E ,vitamin C and<br />
their combinations on SBP, heart rate, serum<br />
NO, sodium, potassium , calcium and body<br />
weight in rats treated with lead acetate. The<br />
experimental rats were divided to nine groups,<br />
each with six individuals and the treatments<br />
were continued for 10 weeks as the following:<br />
Group 1: Control. The rats were given standard<br />
rat chow and tap water ad libitum.<br />
Group 2: Sodium acetate . The rats were given<br />
standard rat chow and sodium acetate at dose<br />
(0.1mg/L drinking water).<br />
Group 3: Lead acetate (Pb). The rats were given<br />
standard rat chow and lead acetate at dose<br />
(0.1mg/L drinking water).<br />
Group 4: Pb + Melatonin. The rats were<br />
supplied with standard rat chow with melatonin<br />
(60 mg/kg diet) and Pb<br />
Group 5: Pb +Vitamin E. The rats were supplied<br />
with standard rat chow with vitamin E (1000<br />
I.U/kg diet) and Pb<br />
Group 6: Pb +Vitamin C. The rats were given<br />
standard rat chow with Pb and vitamin C at dose<br />
(1mg/L drinking water).<br />
Group 7: Pb + Melatonin + Vitamin E. The rats<br />
were supplied with standard rat chow with<br />
melatonin , vitamin E and Pb.<br />
Group 8: Pb + Melatonin +Vitamin C. The rats<br />
were supplied with standard rat chow with<br />
melatonin , vitamin C and Pb.<br />
Group 9: Pb +Vitamin E+ Vitamin C. The rats<br />
were supplied with standard rat chow with<br />
vitamin E , vitamin and Pb.<br />
Collection of blood samples<br />
At the end of the experiment, the rats were<br />
anesthetized with ketamine hydrochloride (50<br />
mg/kg). Blood samples were taken by cardiac<br />
puncture into chilled tubes and centrifuged at<br />
3000 rpm for 20 minutes; then sera were stored<br />
at -85C 0 until assay.<br />
Blood pressure and heart rate measurements<br />
Measurements of SBP and heart rate were<br />
obtained each two weeks by the tail-cuff method<br />
in all groups using power Lab (AD Instruments,<br />
power lab 2/25). During the week before<br />
treatment the rats were trained to become<br />
accustomed to the blood pressure measurements.<br />
Rats were placed in a restraining chamber and<br />
warmed to an ambient temperature of<br />
approximately 37C o , typically taking about 10-<br />
15 minute after that occluding cuffs and<br />
pneumatic pulse transducers were placed on the<br />
rats' tails. Six readings were taken for each rat,<br />
the highest, lowest and any associated with<br />
excess noise or animal movement were<br />
discarded. The average was taken of the<br />
remaining readings to generate a value for a<br />
given rat for that week.<br />
BIOCHEMICAL DETERMINATION<br />
Determination of serum sodium, potassium<br />
and calcium ion concentrations<br />
Serum Na + and K + ion concentrations were<br />
determined by using flame photometer<br />
(Galenkamp Flame Analyzer, Germany). Serum<br />
calcium was determined by spectrophotometer<br />
calcium kit Serum total nitric oxide<br />
measurement Serum total NO was<br />
determined by NO non –enzymatic assay kit<br />
(US Biological, USA)<br />
03
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
03<br />
STATISTICAL ANALYSIS<br />
All data were expressed as means + standard<br />
error (SE) and statistical analysis was carried out<br />
using available statistical soft ware (SPSS<br />
version 15). Data analysis was made using oneway<br />
analysis of variance (ANOVA). The<br />
comparisons among groups were done using<br />
Duncan post hoc analysis. P values
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
Furthermore, SBP was decreased on the<br />
second week of melatonin in combination with<br />
vitamin C treatment, while vitamin C and E<br />
combination did not change it significantly on<br />
the same week, however, their combination<br />
reduced SBP on the fourth weeks. As noted in<br />
the same table(1), Interestingly, melatonin in<br />
combination with vitamin E or C reduced SBP<br />
statistically more than vitamin E, C and their<br />
combinations. Meanwhile, melatonin, vitamin C<br />
,vitamin E and their combinations treatments<br />
caused the same degree of SBP reduction on the<br />
eighth and tenth weeks.<br />
Heart rate was elevated only on the last ten<br />
week of Pb treatment. Co-administration of<br />
melatonin and vitamin E caused a significant<br />
decrease in heart rate on the eighth weeks of<br />
treatments. However, melatonin supplementation<br />
alone did not change heart rate, but its<br />
combination with vitamin C and E reduced<br />
it significantly.<br />
After 10 weeks of Pb treatment, serum NO<br />
was markedly reduced (12.971 ±0.835 μmol/L)<br />
compared to control group (14.991 ±0.461<br />
μmol/L). On the other hand, a significant<br />
increase in serum NO concentration was<br />
recorded when rats treated with melatonin,<br />
vitamin C, vitamin E and their<br />
combinations,(Table 3). Serum calcium was<br />
decreased in Pb treated rats (9.9458 ±0.691 mg/<br />
dL) , whereas serum sodium and potassium did<br />
not change. However, vitamin E increased serum<br />
calcium (11.1954 ±0.47 mg/dL), and its<br />
combination with vitamin C reduced and<br />
restored it to the Pb group (9.5164 ±0.266<br />
mg/dL)(Table 3). Administration of vitamin E ,<br />
C and their co-administrations caused an<br />
increase in serum sodium, Furthermore,<br />
melatonin and its combination with vitamin E<br />
and C decreased serum potassium significantly<br />
compared with Pb group. There were no<br />
statistical changes in body weight and food<br />
intake among the studied groups, however,coadministration<br />
of melatonin and vitamin E<br />
slightly reduced it comparing with Pb group.<br />
Table( 3):- Effects of melatonin, vitamin E, vitamin C and their combination on serum NO, sodium ,potassium<br />
and calcium in rats treated with lead acetate.<br />
Treatments<br />
Parameters Treatments<br />
Control<br />
Na +<br />
Pb<br />
Pb + Mel<br />
Pb + Vit E<br />
Pb + Vi C<br />
Pb + Mel + Vit E<br />
Pb + Me l+ Vit C<br />
Pb + Vit E + Vit C<br />
Serum NO<br />
14.994 ± 0.461 abc<br />
14.091 ±0.950 ab<br />
12.971 ±0.835 a<br />
16.434 ±0.367 c<br />
15.680 ±0.434 bc<br />
16.251 ±1.084 bc<br />
16.76 ±0.379 bc<br />
15.11 ±0.592bc<br />
15.400 ±0.770 bc<br />
Serum Na +<br />
143.18 ±0.954 ab<br />
146.96 ±2.430 abc<br />
139.77 ±2.798 a<br />
143.05 ±1.387 ab<br />
154.69 ±2.306 c<br />
153.61 ±3.372 c<br />
147.12 ±2.444 abc<br />
139.67 ±3.351 a<br />
150.87 ±2.786b c<br />
Serum K +<br />
3.7661 ±0.113 de<br />
3.5879 ±0.079 cd<br />
3.7921 ±0.244 de<br />
3.0851 ±0.168 a<br />
3.6802 ±0.090 cde<br />
3.2665±0.134 abc<br />
3.1209 ±0.111 ab<br />
3.1504 ±0.178 ab<br />
3.8600 ±0.151 cde<br />
Serum Ca 2+<br />
9.4778 ±0.226 a<br />
11.3385 ±0.435 b<br />
9.9458 ±0.691 a<br />
10.6886 ±0.537 ab<br />
11.1954 ±0.470 b<br />
10.1625 ±0.610 ab<br />
10.0619 ±0.350 ab<br />
10.8201±0.380 ab<br />
9.5164 ±0.266 a<br />
Table (4):- Effects of melatonin, vitamin E, vitamin C and their combinations on body weight in lead treated<br />
rats during 10 weeks of treatments<br />
Treatments Body weight (grams)<br />
1 st week 2 nd week 4 th week 6 th week<br />
Control 250.1±8.75 a<br />
261.0 ±18.0 a<br />
261.3 ±6.4 a<br />
262.1±6.77 a<br />
Na +<br />
261.8±13.9 a<br />
272.3 ±26.5 a<br />
267.5±10.7 a<br />
271.1±9.83 a<br />
Pb 257.8 ±20.2 a<br />
270.1 ±40.0 a<br />
258.8 ±10.8 a<br />
277.1±14.8 a<br />
Pb + Mel<br />
254.1±10.8 a<br />
259.3 ±26.4 a<br />
265.3±13.9 a<br />
279.1±19.7 a<br />
Pb + Vit E 273.0 ±6.12 a<br />
274.6 ±19.8 a<br />
261.0±12.7 a<br />
261.3±9.75 a<br />
Pb + Vi C<br />
268.0 ±7.86 a<br />
287.8 ±21. a<br />
284.0±9.41 a<br />
280.6±9.43 a<br />
Pb + Mel + Vit E 265.8 ±6.15 a<br />
267.6 ±19.2 a<br />
267.3±6.98 a<br />
267.8±4.96 a<br />
Pb + Me l+ Vit C 249.00±14.2 a<br />
264.8 ±28.4 a<br />
261.3 ±6.4 a<br />
262.1±6.77 a<br />
Pb + Vit E + Vit<br />
C<br />
266.3 ±18.7 a<br />
280.8 ±31.9 a<br />
267.5±10.7 a<br />
271.1±9.83 a<br />
Similar letters indicate no significant difference.<br />
Different letters indicate significant difference at P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
a<br />
Fig.( 2):- Effects of melatonin, vitamin E, vitamin C and their combination on heart rate (H.R)in lead inducedhypertensive<br />
rats during 10 weeks of treatments<br />
03<br />
DISCUSSIONS<br />
Results in the present study, showed that<br />
chronic exposure of lead acetate increased SBP<br />
significantly. The mechanism by which lead<br />
acetate caused an increase in SBP is not fully<br />
understood yet. Gonick et al., (1997) suggested<br />
the primary involvement of the increased<br />
production of ROS observed in lead-exposed<br />
animals. Moreover, chronic exposure to lead has<br />
been reported to raise plasma angiotensinconverting<br />
enzyme and kininase II activities,<br />
events that can support a rise in blood pressure<br />
by elevating plasma angiotensin II and<br />
depressing plasma bradykinin levels<br />
(Carmignani et al.,1999). In addition, altered<br />
prostaglandin-I production, enhanced endothelin<br />
generation, and increased protein kinase C<br />
activity have been implicated in the pathogenesis<br />
of lead-associated HTN (Gonick et al.,1998).<br />
Heart rate was elevated only on the last tenth<br />
weeks of Pb treatment. This elevation may be<br />
due to the effects of Pb on activation of<br />
adrenergic system or endothelium-derived<br />
vasoregulatory factors (Ding et al.,2001). These<br />
findings helped us to choose this model of<br />
elevated blood pressure in order to find, for the<br />
first time, a new method trying to reduce this<br />
elevation using co-administration of melatonin<br />
with vitamin E or C.<br />
Administration of melatonin significantly<br />
reduced SBP on fourth week of treatments.<br />
Several potential mechanisms of BP reduction<br />
are considered. Melatonin can act via its<br />
scavengering and antioxidant nature, improving<br />
endothelial function with increased availability<br />
of NO exerting vasodilatory , antioxidative and<br />
b<br />
c<br />
hypotensive effects. Therefore, NO deficiency<br />
lead to increase accumulation of superoxide<br />
anion in biological tissues and the development<br />
of oxidative stress in the body which in turn<br />
involved in pathophysiology of many forms of<br />
HTN (Kopkan and Majid, 2005). Melatonin<br />
seems to interfere with peripheral and central<br />
autonomic nervous system with subsequent<br />
decrease in the tone of adrenergic system and an<br />
increase in cholinergic system (Paulis and<br />
Simko,2007). Meanwhile, vitamin E caused a<br />
reduction in SBP on the sixth of treatment. This<br />
result is confirmed by Nosratola et al.,(1999)<br />
concluded that administration of high-dose<br />
vitamin E significantly ameliorated but did not<br />
completely abrogate lead-induced HTN.<br />
However, vitamin C significantly reduced<br />
SBP on the fourth weeks of treatment. SBP was<br />
decreased on the second weeks of melatonin<br />
with vitamin C or E combinations. The<br />
hypotensive effects of vitamin C and E may be<br />
due to their effects on NO levels as obtained by<br />
the current results shown in table 3. Attri et al.,<br />
(2003) concluded that concomitant<br />
administration of vitamin C ameliorated HTN.<br />
Furthermore, Li et al., (2008) attributed that<br />
concentrations of superoxide dismutase, NO and<br />
NO synthase were significantly higher in<br />
vitamin C and/or E groups than those in control<br />
group. Interestingly, melatonin in combination<br />
with vitamin E or C reduced SBP statistically<br />
more than vitamin E or C or their combinations<br />
on the sixth week of their treatments. According<br />
to our knowledge, this is the first study that<br />
shows how co-administration of melatonin with<br />
vitamin E or C prevents the increase of HTN.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
The mechanisms were by oxidative stress plays a<br />
role in the pathogenesis of HTN involve in both<br />
hemodynamic (vasoconstrictive) and structure<br />
mechanisms (Denu et al.,1998). Vitamin E or C<br />
which they represent as antioxidants, might be<br />
strengthen the ability of melatonin to reduce<br />
further degree of blood pressure. Melatonin can<br />
significantly lower plasma ET-1(Maulood,2005),<br />
it can also reduce serum total cholesterol and<br />
serum triacylglycerol (Nishida et al.,2002).<br />
Additionally, Sozmen et al., (1998) concluded<br />
that increased total cholesterol, triacylglycerol,<br />
low-density lipoprotein (LDL) and decreased<br />
high-density lipoprotein(HDL) values were<br />
found in patients with HTN. As mentioned<br />
previously, melatonin seems to interfere with<br />
peripheral and central autonomic system with<br />
subsequent decrease in the tone of adrenergic<br />
system and an increase in cholinergic system<br />
(Paulis and Simko,2007). Unlike other<br />
antioxidant, melatonin also does not undergo<br />
redox cycling; melatonin once oxidized can not<br />
be reduced to its former state because it forms<br />
several stable end products upon reacting with<br />
free radicals (Pechanova et al., 2006).<br />
Meanwhile, melatonin, vitamin C ,vitamin E and<br />
their combinations treatments caused the same<br />
degree of SBP reduction on the eighth and tenth<br />
week. One possible hypothesis is that long term<br />
administrations of these treatments might<br />
improve the hypertensive effects of lead<br />
exposure through normalizing NO levels as<br />
detected in the current results on the last<br />
week of treatments.<br />
Current study demonstrated that long-term<br />
lead administration significantly decreased<br />
serum calcium, this result may be due to reduces<br />
in sarcolemmal calcium influx (Vassalo et<br />
al.,2008). Furthermore, different considerations<br />
have been raised to explain the pathogenesis of<br />
lead-induced HTN, such as an increased<br />
intracellular calcium concentration (Khali-<br />
Manesh et al., 1993). However, vitamin E<br />
increased serum calcium , its combination with<br />
vitamin C reduced and returned it to the Pb<br />
group. This result is consist with Norazlina et<br />
al., (2004) presented that vitamin E deficiency<br />
caused hypocalcaemia during the first month of<br />
the treatment period, increased the parathyroid<br />
hormone level in the second month and<br />
decreased the bone calcium content in the 4th<br />
lumbar bone at the end of the treatment.<br />
Interestingly, vitamin C and E in combination<br />
returned serum calcium to normal values. The<br />
reason of this result may firmly related with<br />
vitamin C rather than vitamin E. Boaz et al<br />
.,(2005) concluded that vitamin C<br />
supplementation could prevent bone loss caused<br />
by chitosan through the increment of retained<br />
Ca +2 followed by suppression of urinary<br />
Ca +2 excretion.<br />
Melatonin and its combination with vitamin<br />
E and C decreased serum potassium significantly<br />
compared with Pb group. Maulood, (2005)<br />
found that melatonin decreased ET-1, thereby<br />
decreasing serum potassium level. However the<br />
evidence for direct action of melatonin on<br />
adrenal gland is highly conflicting in nocturnal<br />
rodents like rats (Reiter et al., 2008). Hurwitz et<br />
al., (2003) demonstrated that there was a diurnal<br />
variation of aldosterone and plasma renin<br />
activity in relation to melatonin, they reported<br />
that melatonin precedes aldosterone secretion<br />
independent on plasma renin activity, in turn<br />
increase the potassium excretion.<br />
There were no significant changes in body<br />
weight among the studied groups, however, on<br />
the last week of treatments, co-administration of<br />
melatonin and vitamin E slightly reduced body<br />
weight comparing with Pb group. This finding is<br />
confirmed by Liu and Huang (1996)who<br />
showed that, rats fed the vitamin E diet had<br />
significantly lower body weight gain and food<br />
intake than rats fed the vitamin E-deficient<br />
control diet. Additionally, it has been<br />
documented that melatonin reduced plasma<br />
leptin (Nishida et al., 2002). Thus, leptin serves<br />
a primary role as an anti-obesity hormone<br />
(Ahima and Flier,2000).<br />
In conclusion, long term lead-treated rats<br />
exhibited marked elevation of blood pressure<br />
and heart rate, significant reduction of serum NO<br />
and calcium levels. These abnormalities nearly<br />
disappeared with the antioxidants melatonin in<br />
combination with vitamin E or C more than<br />
vitamin E, C and their combinations.<br />
REFERENCES<br />
-Ahima, R.S.; Flier, J. S., (2000). Leptin. Annu. Rev.<br />
Physiol. 62:413–37<br />
-Attri, J; Dhawan, V; Mahmood, S; Pandhi, P; Parwana,<br />
H.K and Nath R.(2003): Effect of vitamin C<br />
supplementation on oxidative DNA damage in an<br />
experimental model of lead-induced hypertension.<br />
Ann Nutr Metab. ;47(6):294-301.<br />
-Badavi ,M; Mehrgerdi ,F.Z; Sarkaki ,A; Naseri, M.K,and<br />
Dianat, M.(2008) Effect of grape seed extract on<br />
lead induced hypertension and heart rate in rat. Pak<br />
J Biol Sci. 15;11(6):882-7.<br />
-Boaz ,M; Weinstein ,T; Matas, Z; Green, Smetana<br />
.S(2005): Peripheral vascular disease and serum<br />
phosphorus in hemodialysis: a nested case-control<br />
study. Nephrol. 63(2):98-105.<br />
03
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
-Braunlich, H; Marx, F; Fleck, C and Stein ,G. ( 1997):<br />
Kidney function in rats after 5/6 nephrectomy (5/6<br />
NX); effort of treatment with vitamin E. Exp<br />
Toxicol Pathol 49: 135–139.<br />
-Carmignani ,M; Boscolo P, Poma A and Volpe AR (1999):<br />
Kininergic system and arterial hypertension<br />
following chronic exposure to inorganic lead.<br />
Immunopharmacology 44:105–110.<br />
-Deniz ,E; Colakoglu, N; Sari ,A; Sonmez, M.F; Tugrul<br />
,I,;Oktar, S; Ilhan, S and Sahna, E(2006): Melatonin<br />
attenuates renal ischemia-reperfusion injury in<br />
nitric oxide synthase inhibited rats. Acta<br />
Histochem. ;108(4):303-9.<br />
-Denu, J.M. and Tanner K.G., (1998): Specific and<br />
reversible inactivation of protein trypsine<br />
phosphates by hydrogen peroxide: evidence for a<br />
sulfenic acid intermediate and implications for<br />
redox regulation. Biochemistry. 7: S633-S642.<br />
-Ding, Y; Gonick, H.C; Vaziri, N.D; Liang, K and Wei L<br />
(2001): Lead-induced hypertension:Increased<br />
hydroxyl radical production. Am J Hypertens<br />
14:169–173.<br />
-Frei, B; Stocker ,R, England ,L and Ames ,B.N.(1990):<br />
Ascorbate: the most effective antioxidant in human<br />
blood plasma. Adv Exp Med Biol ; 264:155–163.<br />
-Gonick HC, Ding Y and Vaziri ND (1998) :Effect of low<br />
Lead exposure on eicosanoid excretion in rats.<br />
Prostaglandins Other Lipid Mediat 55:77–82.<br />
-Gonick, H.C, Ding Y, Bondy S.C, Ni Z, Vaziri N.D(1997):<br />
Lead-induced hypertension: interplay of nitric oxide<br />
and reactive oxygen species. Hypertension 30:<br />
1487–1492.<br />
-Halliwell B.(1996): Vitamin C: antioxidant or pro-oxidant<br />
in vivo? Free Radic Res; 25:439–454.<br />
-Hurwitz, S., Cohen R.J. and Williams G.H., (2003).<br />
Diurnal variation of aldosterone and plasma renin<br />
activity: Timing relation to melatonin and cortisol<br />
and consistency after prolonged bedrest. J Appl<br />
Physiol. 00611.<br />
-Khalil-Manesh, F; Gonick, H.C; Weiler, EWJ; Prins ,B;<br />
Weber, M.A and Purdy, R.E(1993): Lead-induced<br />
hypertension. Possible role of endothelial factors.<br />
Am J Hypertens 6: 723–729.<br />
-Kopkan, L. and Majid S.A., (2005). Superoxide<br />
contributes to development of salt sensitivity and<br />
hypertension induced by nitric oxide deficiency.<br />
Hypertension. 46: 1026.<br />
-Li ,X.R; Long ,Y.H; Fang, X and Liu ,X.G(2008): Effect<br />
of vitamin C and E on antioxidative enzyme, NOS<br />
activity and NO contents in hippocampus of rats<br />
with lead poisoning, Zhejiang,;37(2):189-92.<br />
-Liu, Jen-Fang and Huang ,Ching-Jang (1996): Dietary<br />
oxidized frying oil enhances tissue a-Tocopherol<br />
depletion and radioisotope tracer excretion in<br />
vitamin E-deficient rats, J.Nutr. 126: 2227-2235.<br />
-Maulood, I.M., (2005): Effects of L-arginine and<br />
melatonin on plasma endothelin-1 level in rats with<br />
induced diabetes mellitus or pulmonary fibrosis.<br />
Thesis. Salahaddin university.<br />
03<br />
-Nishida, S; Segawa, T; murai, I. and Nakagawa, S., (2002).<br />
Long-term melatonin administration reduces<br />
hyperinsulinemia and improves the altered fatty<br />
acid compositon in type-2 diabetic ras via the<br />
restorstion of ∆-5 desatarase activity. J Pineal Res.<br />
32:26-33.<br />
-Norazlina, M; Chua, C.W and Ima-Nirwana S.(2004):<br />
Vitamin E deficiency reduced lumbar bone calcium<br />
content in female rats. J Malaysia. ;59(5):623-30.<br />
-Nosratola, D; Vaziri, Yaoxian. Ding and Zhenmin, N.i<br />
(1999): Nitric oxide synthase expression in the<br />
course of lead-induced hypertension. Hypertension,<br />
4:558-562.<br />
-Paulis, L. and Simko F., (2007). Blood pressure<br />
modulation and cardiovascular protection by<br />
melatonin: Potential mechanism behind. Physiol.<br />
Res. 56: 671-687.<br />
-Pechanova, O., Zicha J., Paulis L., Zenebe W., Dobesova<br />
Z., Kojsova S., Jendekova L., Sladkova M.,<br />
Dovinova I., Simko F. and Kunes J., (2006): Effect<br />
of N-acetylcysteine and melatonin in adult SHR<br />
with established hypertension. Submitted to Eur J<br />
Pharmacol. Pediatr Nephrol. 22: 2011–2022.<br />
-Reiter, R.J., Tan D.X., Jou M.J., Korkmaz A., Manchester<br />
L.C. and Paredes S.D., (2008). Biogenic amines in<br />
the reduction of oxidation stress: melatonin and its<br />
metabolites. Neuro Endocrinol Lett. 29: 391-8.<br />
-Sharp, D.S; Osterloh ,J; Becker ,C.E; Bernard, B; Smith,<br />
A.H; Fisher, J.M; Syme, S.L; Holman, B.L and<br />
Johnson, T (1988): Blood pressure and blood lead<br />
concentration in bus drivers. Environ Health<br />
Perspect 78: 131–137.<br />
-Sozmen, B., Kazazi C., Taskiran D., Aslan L., Akyol A.<br />
and Sozmen E.Y., (1998):Plasma antioxidant status<br />
and nitrate levels in patients with hypertension and<br />
coronary heart disease. Tr. J. of Medical Science.<br />
28: 525- 531.<br />
-Suzuki, N., Suzuki T. and Kurokawa T., (2000):<br />
Suppression of osteoclastic activities by calcitonin<br />
in the scales of goldfish (freshwater teleost) and<br />
nibbler fish (seawater teleost). Peptides. 21:115-<br />
124.<br />
-Vassallo,D.V; Lebarch ,E.C; Moreira ,C.M; Wiggers ,G.A<br />
and Stefanon, I (2008): Lead reduces tension<br />
development and the myosin ATPase activity of the<br />
rat right ventricular myocardium. Braz J Med Biol<br />
Res. ;41(9):789-95.<br />
-Vazan, R., Styk J. and Beder I., (2004): Melatonin and<br />
heart. Cesk Fysiol. 53: 29-33.<br />
-Vaziri, N.D, Ding Y, and Ni Z ( 2001): Compensatory upregulation<br />
of nitric-oxide synthase isoforms in leadinduced<br />
hypertension; Reversal by a superoxide<br />
dismutase-mimetic drug, The Journal of<br />
Pharmacology and experimental<br />
therapeutics,298:679–685.<br />
-Zhang ,L.F; Peng ,S.Q; Wang, S; Li, B.L; Han, G and<br />
Dong ,Y.S ( 2007): Direct effects of lead (Pb2+) on<br />
the relaxation of in vitro cultured rat aorta to<br />
acetylcholine. Toxicol Lett. 25;170(2):104-110.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
ةب وَيوخ يشزةب يؤتضةثةلاث ةب ووب شووت يجزوج ةل ىايةلةكَيت ةو C ينماتيظ ، E ينماتيظ , يننؤتلايم ييةصَيزاث لىؤز<br />
واينةتةب<br />
C<br />
ينماتيظ ،<br />
E<br />
. ىةياخرَيزد يشموقزوق ينادَيث يؤي<br />
ينماتيظ و يننؤتلايم ةل كةيزةي ينةياخرَيزد ىزةطيزاك نييهكشث ةيةوةهيرَيوت مةل تضةبةم<br />
ةل وَيوخ ىوادزةش تييلاؤتركيلةئ و مؤيطلاك و كيتريان ىديطكؤئ و وَيوخ ىؤتضةثةلاثزةضةل<br />
ىايندسكولاةكَيتةب<br />
ادةيةوةهيرَيوت مةل ىجض ىةيَيم يجزوج زاوض وانجةث . مشوقزوق ىنادَيث ىؤيةب شزةب ىؤتضةثةلاث ةب واسك شوت يجزوج<br />
ىةوام ؤب كَيجزوج زةي ؤب ثوسط شةش زةي شاوايج يثوسط<br />
ؤن ؤب ىاسك شةباد ىاكةوتايزاكةب ةجزوج.<br />
1.0<br />
( ) مؤيدؤض يتاتيضةئ(<br />
مةزاوض يثوسط<br />
مةوود يثوسط<br />
, ) ةوةندزاوخ ىوائ ترل/<br />
مطم<br />
) لؤترنؤك ىجزوج(<br />
1.0<br />
مةكةي يثوسط<br />
( ) مشوقزوق يتاتيضةئ(<br />
: ةوةزاوخ ىةنامةئ وكةو ةتفةي<br />
ةتخوث<br />
تايزاكةب<br />
01<br />
مةيَيض يثوسط)<br />
ةوةندزاوخ ىوائ ترل/<br />
مطم<br />
ةل شةب 0111()<br />
E ينماتيظ + مشوقزوق(<br />
مةحهَيث يثوسط ، ) كازؤخ مطك/<br />
يننؤتلايم ةل مطم 01(<br />
) يننؤتلايم+<br />
مشوقزوق(<br />
, ةوةندزاوخ ىوائ ترل/<br />
C ينماتيظ ةل مطم 0(<br />
) C<br />
ينماتيظ+<br />
مشوقزوق ( مةشةش يثوسط , ) كازؤخ ةل مطك/<br />
+ يننؤتلايم+<br />
مشوقزوق(<br />
) ىيةلةكَيت(<br />
مةتشةي<br />
يثوسط,<br />
) E ينماتيظ + يننؤتلايم+<br />
مشوقزوق(<br />
) ىيةلةكَيت(<br />
وَيوخ ىةوؤبذسك ىزاشف ىوةنوبشزةبةب .) E ينماتيظ + c ينماتيظ+<br />
مشوقزوق(<br />
) ىيةلةكَيت(<br />
مةيؤن يثوسط,<br />
C<br />
ينماتيظ ىاي يننؤتلايم يناهَييزاكةب<br />
مةك يؤي ةوب<br />
E<br />
.<br />
E<br />
ينماتيظ<br />
مةتفةح يثوسط<br />
)<br />
C<br />
ينماتيظ<br />
مشوقزوق يةدامةب ىاكةجزوج ينادَيث شاث ةل اسك يدةب مةيةد ىةتفةي ةل<br />
ينماتيظ ىةتاك وةل مزاوض يةتفةيةل ةوةدسك مةك ىايهَيوخ ىةوؤبذسك واضزةب يكةيةوَيشةب<br />
لةطةل ىيةلةكَيت ةب يننؤتلايم ةوةيطنسطةب<br />
ىاي<br />
C<br />
ىهيشةباد<br />
ىاي<br />
C<br />
ىاي<br />
E<br />
ينماتيظ<br />
. مةشةش يةتفةيةل وَيوخ ىةوؤبذسك ىزاشف ىةوةنوبشزةب ىةوةندسك<br />
ةل دناشةباد ستايش ىايهَيوخ ىةوةنوبذسك ىزاشف يةوؤبشزةب<br />
. اد مةتشةي يةتفةيةل لد ىنادَيل<br />
ىةوةندسك مةك ىؤي ةوب<br />
ينماتيظ ،<br />
E<br />
ينماتيظ<br />
E<br />
C<br />
ىاي<br />
E<br />
ينماتيظ<br />
ينماتيظ و يننؤتلايم ينادةوةكَيث.<br />
ىايةلةكَيت<br />
, يننؤتلايم ىؤيةب ةوؤبتركاض مشوقزوق ىنادَيث ىؤيةب اسهيب ةك كيتريمن ىديطكؤئ<br />
يمَويضاتؤث و مؤيدؤض ىةتاك<br />
وةل مشوقزوق ةب وازدَيث يجزوج ةل ةوؤب مةك وَيوخ<br />
ىايندزاوخ ىةرَيز و ىاكةزةوةنايط يشَيكةل اسكةن يدةب ىزايسَيمذ يكةيشاوايج ضيي<br />
ىوادزةش ىمؤيطلاك<br />
.<br />
. ىايةلةكَيت<br />
ىازؤطةن وَيوخ ىوادزةش<br />
. ىاكةوتايزاكةب ةثوسط ىاوَينةل<br />
ىةوَوبذسك ىزاشف ىواضزةب ىةوةنوبشزةب ىؤي ةتيبةد مشوقزوق ينةياخرَيزد<br />
ينادَيث ةكتيوةكةدزةد اوادمانجةزةدةل<br />
ةوةتيبةد<br />
مةك ييةكيصنةب ةنانوضكَيت مةئ<br />
.<br />
ىايةلةكَيت ىاي<br />
C<br />
ىاي<br />
E<br />
. وَيوخ ىوادزةش ىكيتريان ىديطكؤئ ىةوةندسك مةك و لد ينادَيل و<br />
ينماتيظ ةل ستايش ىكةيةوَيشةب<br />
C<br />
ىاي<br />
E<br />
وَيوخ<br />
ينماتيظ لةطةل ىيةلةكَيتةب يننؤتلايم ينادَيث ىؤيةب<br />
03
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 30-38, 2011<br />
ةطساوب مدلا طغض طرفب ثدحتتسملا ناذرجلا يف امهنيب لخادتلاو ،<br />
ةدملو امهنيب ليخادتلاو<br />
03<br />
E<br />
نيماتيف ،<br />
c<br />
. صاصرلا ةدام<br />
طرفب ثدحتسملا ناذرجلا يف تيلاورتكللأاو مويسيلاكلا تانويا<br />
C<br />
نيماتيف ،<br />
E<br />
نيماتيف ،نينوتلايملل يئاقولا رودلا<br />
ةصلاخلا<br />
نيماتيف ،نينوتلايم ءاطعأ ريثأت نع فشكلل يه ةيلاحلا ةساردلا يف فدهلا نا<br />
, ىكيرتيانلا ديسكولأا زيكرت<br />
ىلع تاناويحلا تعزوو ةساردلا هذه يف ثانلأا نم اغلاب اذرج نوسمخو ةعبرا تمدختسا<br />
: ىلولاا ةعومجملا<br />
ةثلاثلا ةعومجملا<br />
/ مغك<br />
01<br />
:<br />
ىتلأاكو عيباسا<br />
.) برشلا ءاملا نم رتل<br />
زيكرتب نينوتلايم<br />
+ صاصرلا(<br />
01<br />
. مدلا طغض ىلع ةليوط<br />
. صاصرلا ةطساوب مدلا طغض<br />
ةدمل ةيرجتلا ترمتساو تاناويح<br />
تس تلمتشا امهنم لك عيماجم عست<br />
/ مغلم<br />
1.0<br />
ةعبارلا ةعومجملا<br />
زيكرتب مويدوصلا تاتيسا(<br />
.) برشلا ءاملا نم رتل<br />
ةيناثلا ةعومجملا ،<br />
/ مغلم<br />
1.0<br />
) ةرطيسلا تاناويح(<br />
زيكرتب صاصرلا تاتيسا(<br />
+ صاصرلا(<br />
ةسداسلا ةعومجملا ). فلع مغك / ةدحو 0111 زيكرتب E نيماتيف + صاصرلا(<br />
ةسماخلا ةعومجملا ،)<br />
فلع<br />
) E<br />
+<br />
نيماتيف+<br />
E<br />
ءاطعا نا<br />
نيماتيف<br />
نينوتلايم<br />
+<br />
+<br />
صاصرلا(<br />
صاصرلا(<br />
) لخادت(<br />
: ةعباسلا ةعومجملا<br />
لخادت<br />
: ةعساتلا ةعومجملا<br />
. صاصرلاب ةعومجملا ةلماعم يف عيباسا<br />
تببسامنيب ةلماعملا نم<br />
عم لخادتب نينوتلايم ءاطعا ىداو<br />
. امهنيب لخادتلا وأ c وا<br />
) c<br />
01<br />
نيماتيف<br />
+<br />
) برش ءاملا نم رتل<br />
/<br />
مغلم<br />
نينوتلايم+<br />
صاصرلا(<br />
) لخادت(:<br />
0<br />
زيكرتب<br />
c<br />
نيماتيف<br />
ةنماثلا ةعومجملا<br />
.) c<br />
دعب يونعم لكشب يضابقنلإا مدلا طغض عافترا ظحول<br />
عبارلا عوبسلأا يف يونعم لكشب مدلا طغض يف ضافخنا ىلا اتدا<br />
E<br />
. ةلماعملا نم سداسلا عوبسلأا يف يضابقنلأا مدلا طغض يف اظافخنا<br />
نيماتيف ءاطعا نم رثكا لكشب يضابقتلأا مدلا طغضل يونعم ضافحنا ىلا<br />
c<br />
نيماتيف<br />
نيماتيف وا نينوتلايملا<br />
c<br />
وا<br />
E<br />
E<br />
نيماتيف<br />
نيماتيف<br />
نا . ةلماعملا نم نماثلا عوبسا يف بلقلا تابرض لدعم يف يونعم ضافخنا ىلا ىدا E نيماتيف<br />
عم نينوتلايم ءاطعا ناو<br />
. امهنيب ليخادتلاو c،<br />
E<br />
نيماتيف ، نينوتلايم ءاطعا ةطساوب تنسحت دق صاصرلا ءاطعاب ىكيرتيانلا ديسكوا نم ضافخنا<br />
يف مويساتوبلاو مويدوصلا نم لك تريغت<br />
مل امنيب ، صاصرلاب ةلماعملا ناذرجلا لصم يف مويسلاكلا ةبسن تضفخنا<br />
. ةسوردملا تلاماعملا نيب ذوخأملا ءاذغلا رادقمو تاناويحلا نزو يف يئاصحا ريغت يا ضحلاي ملو لصملا<br />
تابرض لدعمو يضاقبنلأا مدلا طغض عافترا ىلا يدؤي ةليوط ةدمل صاصرلاءاطعا ناب ةيلاحلا ةساردلا نم جتنتسي<br />
ءاطعا ةطساوب ابيرقت ةعيبطلا ريغ تلااحلا هذه تضفحناو ،لصملا يف يكيرتيانلا ديسكولأا<br />
ةبسن يف ضافخناو بلقلا<br />
امهنيب لخادتلا وا<br />
c<br />
وا<br />
E<br />
نيماتيف نم ربكا لكشب<br />
c<br />
وأ<br />
E<br />
نيماتيف عم ليخادتلاب نينوتلايم
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
ENGINEERING CLASSIFICATION AND INDEX PROPERTIES OF THE<br />
ROCKS AT DERBANDI GOMASBPAN – SUGGESTED DAM SITE<br />
MOHAMED TAHIR A. BRIFCANI<br />
School of Engineering, Faculty of Engineering and Applied Sciences, University of Duhok, Kurdistan Region-Iraq<br />
(Received: May 15, 2010; Accepted for publication: February 27, 2011)<br />
ABSTRACT<br />
This study concerns the ground conditions and the engineering properties of the rocks in Derbandi Gomasbpan<br />
(Gomasbpan valley), which was suggested to be a site for a dam construction. The study emphasized on the<br />
qualitative engineering classifications and index properties of the existed rocks at the site as to be the dam foundation,<br />
their abutments and for the stability of the slopes, including the slopes of the dam embankments (when it is built<br />
from) during and after construction.<br />
The Pila Spi Limestone which is one of the rock types and widely exposed at the site, was exceptionally, studied<br />
for its engineering behavior. The geotechnical laboratory testing of Pila Spi limestone was carried out and the<br />
acquired data were used for its engineering classifications both, as an intact rock and as a rock mass. The study<br />
results show that the general qualitative classification of this rock is rigid and high in mass strength, eventually, the<br />
rock was reliably evaluated for the dam foundation and its abutments.<br />
The Gercus and Kolosh Formations which are predominantly composed of shale, which extensively, exposed at the<br />
dam site and most of the stream drainage-basin area. The rocks at the dam site were studied in part for their<br />
mechanical properties, emphasized on their slake durability indexes and shale ratings. The test results of the slakedurability<br />
and rating of the shale were variable in values, few tested samples showed, relatively, with very low rating.<br />
The shale rating results were evaluated for the estimations of allowable slope angles of the dam embankment<br />
(construct from this shale) as a function of the shale ratings. The allowable lift thicknesses and required compaction<br />
field densities of the shale for the embankment were also estimated.<br />
KEYWORDS: Gomasbpan, Dam Site, Rocks, Index-Properties, Shale Rating.<br />
D<br />
1. INTRODUCTION<br />
erbandi Gomasbpan is located about 30<br />
Km NE of Hawler ( Irbil) city,<br />
between the longitudes 44 o - 18’- 00’’ and 44 o -<br />
21’- 00”N and the latitudes 36 o - 16’- 00’’ and<br />
N<br />
App. Scale 1: 3,500,000<br />
Fig. (1): Location map<br />
36 o - 19’- 00’’ E, at the vicinity of Gomasbpan<br />
village, Figure (1), and (2). The location was<br />
suggested to be a site for a dam construction, so<br />
that, the surrounding area could be developed for<br />
the out-door people-recreations, as well as for<br />
the agricultural and inhabitant benefits.<br />
Suggested dam site<br />
93
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
This study concerns the ground conditions<br />
and the engineering properties of the rocks in the<br />
Derbandi Gomasbpan. The study is emphasized<br />
mainly, on the qualitative engineering<br />
classification and index properties of the rocks<br />
existed at the dam site, such information<br />
basically, used for the design of dams<br />
foundations and their abutments, as well as for<br />
the study of the slopes stability and construction<br />
materials needed.<br />
Geomorphologically, the area is a part of the<br />
highland, mountainous, folded region, maximum<br />
elevation at the site is 1080 m above sea level,<br />
04<br />
while the lower elevation is 800m at the bottom<br />
of the narrowest gully path, which is about 50m<br />
in width where the dam foundation has to be<br />
located. The left-side slope of the valley is<br />
steeper ( 20 – 35 o ) than the right-side slope<br />
which is generally gentle (15 – 20 o ), along<br />
which the highway was constructed. The valley<br />
is with permanent stream flow, collecting water<br />
from the very wide drainages basin to the north<br />
and north-east of the site, down from the site. the<br />
stream opens to a wide cultivated planes and<br />
hills.<br />
SE NW<br />
Fig. (2): Derbandi Gomasbpan dam site, view from the upstream.<br />
Geologically the dam site is located on the<br />
southern limb of the Pirmam Anticline, the Pila<br />
Spi Limestone forms the highest ridges in the<br />
area and consists of resistant limestone beds,<br />
their thicknesses range between 0.3 to 2 m, the<br />
thickest beds are at the lower part, and all are<br />
dipping 25 to 30 o toward the Southwest. This<br />
study was restricted on the best exposure at the<br />
lower part (lithostratigraphically) of Pila Spi<br />
Limestone (about 10 to 15 m in thichness). The<br />
rock at this exposure was mostly, expected to be<br />
the dam foundation as well as the abutments,<br />
therefore, samples were taken from this<br />
limestone for the laboratory tests and the results<br />
were evaluated. The upper part of the exposure<br />
is thinly bedded and highly fractured so, it would<br />
be removed. The output of the qualitative<br />
classifications of the intact rocks and their<br />
masses from their properties and indexes could<br />
be considered during the planning, design and<br />
construction of the Derbandi Gomasbpan Dam.<br />
Pila Spi Limestone is underlained,<br />
predominantly, by clastic rocks of Gercus and<br />
Kolosh formations. These rocks are<br />
lithologically, feasible and consist mainly of<br />
shales which are extensively exposed at the dam<br />
site and all over the drainage basin. These rocks<br />
are relatively, soft and lower in rock mass<br />
strength and durability than the Pila Spi<br />
Limestone above. Parts of the Gercus and<br />
Kolosh rocks are expected to be submerged by<br />
the reservoir water of the future dam and the<br />
rock slopes toward the lake expected to be<br />
unstable due to rising and lowering of the water<br />
level in the reservoir. These rocks were<br />
classified based on their physical and<br />
mechanical properties including, slake durability<br />
indexes and shale rating values. The study of<br />
the slopes stability and durability of the shale<br />
and other soft rocks at the proposed dam site and<br />
along the valley sides were carried out from their<br />
slake durability indexes and rating. A correlation<br />
between shale rating values and the slopes<br />
amounts of the dam embankments of a certain<br />
heights was performed, as well as between the<br />
shale rating values and the required compaction
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
field density and lift thickness for the dam<br />
embankments in case when such materials are<br />
mechanically reliable and needed.<br />
2. MATERIAL AND METHODS<br />
Derbendi Gomasbpan was chosen for the<br />
dam site based on the available ground<br />
conditions required for a dam construction in<br />
this site, including, the geomorphological<br />
characteristics, permanent water flow and over<br />
all, the engineering geological properties of the<br />
rocks which include, the rock types, their<br />
structural features and their physical and<br />
mechanical characteristics. The study of these<br />
properties is required during the planning and<br />
designing of the dam foundation and abutments<br />
as well as for the stability of the dam<br />
embankments and the slopes around the<br />
reservoir.<br />
This study started with the site investigation<br />
for the dam site and surrounding area, The<br />
general information about the physiography, the<br />
lithostratigraphy, the surface water flow and the<br />
geologic structures such as the attitude of strata,<br />
their thicknesses, discontinuities characteristics<br />
and others were collected. Rock sampling from<br />
the proposed dam site was also carried out<br />
during this stage of work. Figures (3) and (7).<br />
Sixteen rock samples were taken from the<br />
Pila Spi dolomitic limestone for the laboratory<br />
testing, most of them were tested directly in the<br />
field, Figure (4). This rock was considered to be<br />
designed for the dam foundation and its<br />
abutments., The dolomitic limestone samples<br />
were tested for their strength indexes using the<br />
point load strength test device, Broch, E and J.A.<br />
Franklin, (1972), Figure (4). The point load<br />
strength index (Is) of each tested sample, was<br />
corrected (Is50) to the size of 50 mm diameter by<br />
using the correction factor f = (D/50) 0.45 ,then<br />
(Is50) = f x (P/D 2 ), were: P = the applied load<br />
in Newtons, and D = the distance between the<br />
load points in mm, and (P/D 2 )= Is<br />
The resulted values were determined and<br />
later on converted to unconfined compressive<br />
strength (UCS), using the equation adapted by<br />
D’ Andrea et, al., (1965). The tangent modulus<br />
of elasticity ( Et50) was also determined using the<br />
equation adapted by Irfan T.Y. and Dearman W.<br />
R. (1978), as following:<br />
UCS = 15.296 x Is50 + 16.375<br />
Et 50 = ( 0.588 x Is50 + 0.084 ) x 10 4<br />
The results of the point load strength tests<br />
and the other engineering properties of the<br />
dolomitic limestone are listed in table (1). The<br />
joints spacing range ( the range of distances in<br />
cm between two parallel and adjacent planes of<br />
joints of any set or orientation. ) was the only<br />
joint characteristic used and needed in this study.<br />
Each of these 16 joint spacing ranges, showing<br />
on the table (1), was taken within a square meter<br />
of the surface area of each specific location or<br />
spot on the outcrop, Palmstron, A., (1982), at<br />
which the rock sample was taken from and the<br />
procedure was integrated for the whole<br />
exposure.. The range values of these spacing in<br />
each specific sampled location might be close in<br />
the range values to that of the next spot<br />
locations.<br />
NE SW<br />
Fig. (3): The bedding attitude & Discontinuities of the Pila Spi Limestone at the dam site.<br />
04
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
04<br />
Fig. (4): Point – load test, Broch, E and J.A. Franklin, (1972).<br />
The dolomitic limestone, as an intact rock<br />
was classified for their engineering mechanical<br />
properties including, strength, tangent modulus<br />
of elasticity ( stiffness ) and Modulus ratio Et/σc<br />
Sample<br />
No.<br />
(MR), using Deere D.U. and Miller R.P.,(1966)<br />
method of intact rock classifications,,<br />
Figure (5).<br />
Table (1): Point-load test results of the Pila Spi limestone intact rock.<br />
Joint Spacing<br />
(Cm).<br />
Point L. Strength.<br />
Index (Is50) ( MPa)<br />
UCS (σc )<br />
( MPa)<br />
* Modulus- ratio numbers are rounded .<br />
Et50<br />
(MPa)<br />
Modulus<br />
Ratio*<br />
1 30 - 70 3.636 71.991 2.222 x10 4 308.6 : 1<br />
2 50 - 75 8.089 140.104 4.840 x10 4 345.5 : 1<br />
3 55 - 110 6.289 112.572 3.782 x10 4 336.0 : 1<br />
4 35 - 95 4.344 82.821 2.638 x10 4 318.5 : 1<br />
5 40 - 70 4.101 79.104 2.495 x10 4 315.4 : 1<br />
6 45 - 80 5.554 101.329 3.350 x10 4 330.6 : 1<br />
7 40 - 130 8.125 140.655 4.862 x10 4 345.7 : 1<br />
8 50 -110 4.904 91.387 2.968 x10 4 324.8 : 1<br />
9 20 - 60 4.148 79.822 2.523 x10 4 316.1: 1<br />
10 50- 110 4.126 79.486 2.510 x10 4 315.8 : 1<br />
11 80 - 120 7.633 133.129 4.572 x10 4 343.4 : 1<br />
12 30 - 115 7.074 124.578 4.244 x10 4 340.7 : 1<br />
13 30 - 70 5.360 98.362 3.236 x10 4 329.0 : 1<br />
14 40 - 110 6.525 116.181 3.921 x10 4 337.5 : 1<br />
15 60 - 110 5.200 95.914 3.142 x10 4 327.6 : 1<br />
16 60 - 150 7.512 131.279 4.501x10 4 342.9 : 1
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
The unconfined compressive strength was<br />
used along with the joint spacing of the rock<br />
mass, measured in the field, to determine the<br />
mechanical and the quality of the rock-mass<br />
using the Z. T. Bieniwaski’s rock mass<br />
classification diagram, (1974), Figure (6), on<br />
which all data were plotted. The cohesion and<br />
the angle of internal friction of the rocks were<br />
also determined from the diagram.<br />
There were six weathered rock zones, 40 to<br />
80 cm in thicknesses with very close fracture<br />
spacing existed within the upper part of the Pila<br />
Fig. (5): Intact-rock modulus ratio, Deere and Miller Diagram, (1966).<br />
Spi Dolomitic Limestone, Figure (3). These<br />
weathered rock zones would affect the overall<br />
quality of the rock at the abutments of the<br />
proposed dam, so that, specific geotechnical<br />
engineering measures are necessary to deal with<br />
this case.<br />
The above properties of the dolomitic<br />
limestone, all together, are to be evaluated<br />
qualitatively for the design of the dam<br />
foundation, the abutments and for uses as a<br />
construction materials, depending on the type of<br />
the dam to be constructed.<br />
Fig. (6): Rock mass classification diagram, Z.T. Bieniwaski, (1974)<br />
09
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
Fourteen samples were taken from the existed<br />
Gercus and Kolosh shale and others miner<br />
degradable or nondurable rocks of claystone and<br />
siltstone. Shale and these soft rocks are exposed<br />
widely, along the valley sides, and at the dam<br />
site. Sampling started from the dam site and<br />
outward to the direction of upstream, within<br />
300m distance. Samples were collected at equal<br />
intervals and from the best available rock<br />
exposures Figure (7). These samples were taken<br />
with their natural water contents preserved and<br />
sent to the laboratory for their slake durability<br />
00<br />
Fig. (7): Red Shale of Gercus Formation.<br />
Fig. (8): Lab samples and equipments used for testing.<br />
index test, Figures (8) and (9). This test has been<br />
chosen based on the fact that shale is particularly<br />
variable material and behave quite differently in<br />
engineering works. The key performance<br />
variable for shale is their rate of breakdown<br />
during wetting and drying and the slake<br />
durability of the shale is its resistance to such<br />
process. The devise used to measure this<br />
property is the slake durability devise, adopted<br />
by International society of rock mechanic, (<br />
ISRM. (1979b) and Figure (9).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
Each of these 14 samples were tested and<br />
subjected to two cycles of slaking, the slake<br />
durability index (Id2 % ) of the second-cycle was<br />
calculated as:<br />
Weight of shale remaining inside drum<br />
Original weight of sample .<br />
Fig. (9): Slake durability test.<br />
x 100<br />
The soil-like shale (rocks that disintegrated<br />
through slaking) with slake durability indexes of<br />
less than 80% were then further characterized by<br />
measuring the plasticity index of fragments<br />
passing through the slake drum mesh, Lama and<br />
Vutukuri, (1978). While the rocks-like shale<br />
with slake durability indexes greater than 80%<br />
Table (2): Two cycles slake-durability (Id2) classification,<br />
ASTM. (1992) and others.<br />
Slake Durability, (Id2) % Classification<br />
00 -30<br />
30-60<br />
60- 85<br />
85- 95<br />
95- 98<br />
98-100<br />
The second-cycle was considered for the<br />
classification purposes. The results were firstly,<br />
classified qualitatively using the following<br />
classification method, adopted by the Geological<br />
Society, (1977); ISRM, (1979b), Franklin J.A.<br />
(1981) , ASTM, D-4644-87. (1992), Table (2).<br />
Very low<br />
Low<br />
Medium<br />
Medium to high<br />
High<br />
Very high<br />
were tested to determine their strength using<br />
point load strength index ( Is50) test, the result<br />
data are shown in table (3). The test was<br />
conducted on shale at natural water content and<br />
the load applied perpendicular to the bedding<br />
when tested for its strength.<br />
04
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
Sample<br />
Number<br />
The results of the lab tests were plotted on the<br />
Franklin Shale Rating System, modified from<br />
the original system adopted by Okland and<br />
Lovell, (1985), Figure (10), to determine the<br />
corresponding rating values ( Rs ) for each<br />
sample. The shale rating values obtained was<br />
04<br />
Slake Durability<br />
Index Id2 %<br />
Table (3): Results of shale lab-tests.<br />
P.L. Str.<br />
Index<br />
Is50 MPa<br />
Liquid limit<br />
used to derive a number of slope design<br />
parameters, from the correlation between shale<br />
rating and parameters relating to the stability of<br />
shale forming slopes of the dam embankment<br />
and of the area.<br />
Fig. (10): Modified Franklin Shale Rating System ( Okland and Lovell. (1985<br />
%<br />
Plastic<br />
Limit %<br />
Plasticity<br />
Index %<br />
Shale<br />
Rating Rs<br />
1 98.9 very high 1.818 _ _ _ C 7.60<br />
2 91.2 medium-high 0.505 _ _ _ B 5.85<br />
3 6.3 very low _ 84 54 30 A 1.40<br />
4 90.4 medium-high 0.394 _ _ _ B 5.90<br />
5 95.6 high 0.61 _ _ _ C 6.50<br />
6 97.6 high 1.113 _ _ _ C 7.00<br />
7 21.6 very low _ 73 41 32 A 1.35<br />
8 39.5 low _ 79 43 36 A 1.70<br />
9 92.3 medium-high 0.601 _ _ _ C 6.25<br />
10 94.9 medium-high 0.528 _ _ _ C 6.40<br />
11 93.3 medium-high 0.344 _ _ _ B 6.05<br />
12 83.4 medium 0.283 _ _ _ B 4.85<br />
13 87.7 medium-high 0.183 _ _ _ B 5.30<br />
14 92.6 medium-high 0.199 _ _ _ B 5.85
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
Shale rating values obtained were used<br />
specifically, to derive parameters for damembankment<br />
slope design and their stability,<br />
which include an estimate of allowable slope<br />
angle for the embankment heights as a function<br />
of shale rating, Figure (11). Shale rating was<br />
also used to estimate the allowable lift<br />
thicknesses when compacted and eventually, to<br />
develop the required compaction densities, their<br />
relationships are shown in Figure (12). This will<br />
help to find out a control procedure for<br />
nondurable shale before starting of the major<br />
earthwork.<br />
Fig (11): Embankment slope angle as a function of embankment height and shale rating.<br />
( modified from Franklin. 1981 )<br />
Fig. (12): Tentative correlations among shale Rating, lift thicknesses and<br />
Compacted-shale densities ( modified from Franklin, 1981 ).<br />
04
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
04<br />
Sample groups Shale rating<br />
A<br />
3, 7, 8<br />
B<br />
2,4,5,12,<br />
13,14<br />
C 1,6,9,10,11<br />
1.35–<br />
1.70<br />
4. 85–<br />
5.80<br />
6. 25–<br />
7. 60<br />
3. ANALYSIS OF RESULTS<br />
Table (4): Performance parameters and data results.<br />
Embankment<br />
height<br />
(m)<br />
The results of the field work show that the<br />
different thicknesses of the dolomitic-limestone<br />
beds which are forming the lower part of the Pila<br />
Spi Formation at the dam site range from 0.5 to<br />
2 m, decrease upward with some weathered<br />
zones intervals. The dip angles of the beds range<br />
from 25 to 35 o toward the Southwest, same as<br />
the down stream direction, structurally, this type<br />
of ,rock with such properties can be considered<br />
as a positive aspect for the evaluation of the dam<br />
foundation and abutments.<br />
The results of the laboratory tests of Pila Spi<br />
Dolomitic Limestone samples, listed in Table<br />
(1), show that the unconfined compressive<br />
strength of the intact rocks ranges from 71.99 to<br />
140.60MPa which can be classified as medium<br />
to high in strength. The tangent modulus of<br />
deformation ( Et50) ranges from 2.11x10 4 to<br />
4.84x10 4 MPa and can be classified as medium in<br />
stiffness to stiff, while the modulus ratio (MR)<br />
ranges from 293 : 1 to 340 : 1, and mainly,<br />
classified as medium modulus ratio, Figure (5).<br />
Hint: The chalky limestone was not developed<br />
within the Pila Spi Formation at this dam site.<br />
The discontinuities in the rock mass are<br />
mostly bedding planes. The rock mass strength<br />
was classified, based on Z.T. Bieniawski’s<br />
strength classification diagram, (1974), Figure<br />
(6), as strong rock mass, cohesion (c) of the rock<br />
is between 200 to 300KPa, average 250KPa,<br />
the angle of the internal friction (Ø) ranges from<br />
40 – 45 o , average is 42.5 o . and the average wet<br />
density of the Pila Spi Dolomitic tested in the<br />
laboratory is 2.7 gm/cm 3 . The rock mass<br />
properties and the obtained data all together<br />
could be evaluated qualitatively, for the type and<br />
design of the dam foundation and the abutments<br />
as well as for their behavior during the stages of<br />
15<br />
15<br />
15<br />
Slope<br />
angle. (deg).<br />
7.5 - 15<br />
15 - 22<br />
22 - 26<br />
Lift thickness<br />
(m).<br />
0.22 – 0.28<br />
0.40 – 0.78<br />
0.54 - 0.77<br />
Compacted field<br />
density (Ton/m 3 )<br />
1.67 – 1.90<br />
1.95 - 2.35<br />
1.76 – 2.25<br />
the construction, depending on the type of the<br />
dam.<br />
The slake durability-index (Id2) values of 3<br />
samples ( # 3, 7, and 8 of group A) from the total<br />
of 14 tested samples that were taken from the<br />
shale of Gercus and Kolosh Formations are 6.3,<br />
21.6 and 39.5% respectively, and classified as<br />
low to very low, Table (2). The plasticity<br />
indexes of these samples range from 30 to 36%,<br />
these results give very low shale rating (Rs)<br />
(1.35. 1.40 and 1.70) on the shale rating system,<br />
Figure (10). The first sample was taken from the<br />
upper part of Gercus Formation, while the 2nd<br />
sample was taken from area closes to the middle<br />
part of the this formation while the third sample<br />
was taken from the upper most part of the<br />
Kolosh Formation. Therefore, the rock zones or<br />
intervals from which these three samples<br />
represent are to be considered eventually, as very<br />
unstable and deformable in behavior in terms of<br />
slake durability. The slake durability- index (Id2)<br />
values of all other tested samples ( group B & C<br />
) are variable, ranged between 83.4 to 98.9%<br />
and were classified as medium to very high, and<br />
their corresponding shale rating values (Rs )<br />
range from 4.85 to 7. 60 on the shale rating<br />
system diagram.<br />
The evaluation of the shale-rating results for<br />
the estimation of allowable slope angle of the<br />
shale for the dam-embankment of a certain<br />
height (built from that shale) as a function of Rs<br />
was determined. For 15m embankment height,<br />
for example, the slope angle as well as the lift<br />
thickness and the corresponding shale<br />
compaction for the embankment in terms of<br />
shale rating for the shale represented by each<br />
group of samples tested are shown in Figure (11)<br />
and table (4).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
4. CONCLUSIONS<br />
As a result of the study and analysis<br />
conducted, the following conclusions are<br />
reached:<br />
1- Based on the site investigation, the existed<br />
rocks at the Derbandi Gomaspan suggested damsite<br />
are generally of two different types:<br />
The dolomitic limestone at the dam site is<br />
underlain by red to dark bluish shale-beds. The<br />
dolomitic limestone is the most resistant and<br />
stable rock, forming a narrow path (gully) with<br />
permanent stream flow. The mechanical<br />
properties of the intact dolomitic limestone<br />
characterize with medium to high in strength,<br />
medium stiffness to stiff in tangent modulus of<br />
elasticity and medium in modulus ratio. The<br />
discontinuities in the dolomitic limestone are<br />
mainly bedding planes with strong engineering<br />
rock mass, cohesion ranges from 200 to 300KPa,<br />
and the angle of the internal friction ranges from<br />
40 – 45 o . These physical and mechanical<br />
properties are proper for the dolomitic limestone<br />
to be used as the dam foundation<br />
2- The slake durability index ( Id2) of about 3/4<br />
of the total number of tested samples taken from<br />
the existed shale and other soft rocks at the dam<br />
site was classified as medium to very high, and<br />
the corresponding shale rating ranges from 4.85<br />
to 7.6. The other 1/ 4 of the number of the tested<br />
samples are with very low slake durability index,<br />
and their shale rating ranges from 1.35 to 1.70<br />
respectively. The rock zones or intervals,<br />
represented by the last 1/4 of the samples should<br />
be considered specifically, unstable with respect<br />
to the slake durability and rating, eventually the<br />
slopes of such rocks toward the lake would be<br />
unstable when the water level in the lake<br />
fluctuated.<br />
3- The shale rating obtained was evaluated for<br />
the estimation of allowable slope angle of the<br />
dam embankment at any height, as well as, for<br />
the estimation of allowable lift thicknesses and<br />
required compaction field density of the shale.<br />
5. RECOMMENDATIONS<br />
1- Additional data from the study area are<br />
required to improve the accuracy of the results<br />
and to expand the information for a better<br />
evaluation of the dam site.<br />
2- Special attention has to be concentrated on<br />
the weathered rock interval at the dam site and<br />
to be studied more quantitatively.<br />
3- The very low and low slake durability of the<br />
shale and other soft rock zones in the site have to<br />
be studied specifically, in detail in terms of<br />
sediment disintegration, transportation and<br />
geotechnical measures to be used to stabilize the<br />
slopes of such rock masses.<br />
REFERENCES<br />
- ASTM, (1992), Standard Test Method for Slake<br />
Durability of Shale and Other Similar Weak<br />
Rock ASTM Designation D-4644-87. In ASTM,<br />
Book of Standards, Vol. 4.08, Soil & Rock;<br />
Dimension Stone; Geosynthetics, ASTM,<br />
Philadelphia, Pa., pp., 951 -953.<br />
- Bieniwaski, Z. T., (1974) “Estimating the Strength of<br />
Rock Materials”. J.S. Afr. Inst. Min. Mettal. 74 (8)<br />
pp. 312-320.<br />
- Broch, E. and J. A. Franklin., (1972) “The Point-Load<br />
Strength Test” International Journal of Rock<br />
Mechanics and Mining Sciences. V.9, PP. 669-697.<br />
- D’Andrea, D.V., Fischer, R. L., Fogelson D. E., (1965):<br />
Prediction of Compressive Strength of rock<br />
from other properties. U.S. Bur. Mines Rep. Invest,<br />
6702.<br />
- Deere, D. U. And Miller R.P., (1966), Engineering<br />
Classification And Index Properties for Intact<br />
Rock, Technical Report. No. AFNL-TR-65-116,<br />
University of Illinois, Urbana, 299 pp.<br />
- Franklin, J. A., (1981), A Shale Rating System and<br />
Tentative Application to Shale Performance. In<br />
transportation Research Record 790, TRB,<br />
National Research Council, Washington, D.C.,<br />
pp. 2-12.<br />
- Geological Society, (1977), The description of rock<br />
masses for engineering purposes: Geol.Soc.<br />
(London ) Eng. Group Working Party, Q. J. Eng.<br />
Geol. Vol.10, pp. 355-388.<br />
- Irfan, T, Y., and Dearman, W. R., (1978), Engineering<br />
classification and index properties of a weathered<br />
granite., Bull., Intl. Assoc. of Engineering<br />
Geology., No.17, pp., 79 – 90.<br />
- ISRM, (1979b), Suggested methods for determining<br />
water content, porosity, density, absorption and<br />
related properties and swelling and slake<br />
durability index properties. Intl. Soc. Rock Mech.<br />
Comm. On Standardization of Laboratory and<br />
field Tests, Intl. J. Rock mech. Min. Sci. &<br />
Geomech. Abstr., Vol. 16, pp. 141 – 156.<br />
- Lama, R. D. and Vutukuri, V.S., (1978), Hand book<br />
on Mechanical Properties of Rocks -Testing<br />
Techniques and results: Volume IV, Transactions,<br />
Technical Publications. Pp. 78 – 96.<br />
- Okland, M. And Lovel C. W., (1985), “ Building<br />
Embankments with Shale” 26 th U.S. Symposium<br />
on Rock Mechanics. Rapid City, SD, pp. 305-312.<br />
- Palmstrom, A., (1982), “ The Volumetric Joint Count----<br />
- a Useful and Simple Measure of the Degree of<br />
Rock Jointing.” Proc. 4 th Int. Congr. Int. Assoc.<br />
Eng. Geol, Delhi. Vol, 5, pp, 221-228.<br />
03
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
نَيوﻪﺌ<br />
ارﻪﺑ<br />
نَيي ىيﻩزاذنﻪﺌ<br />
ﻪ<br />
44<br />
اات ىركاش اانركاﭭائ<br />
وب شاب َىي<br />
ﻪﺘﺨﻮﭙ<br />
ﻥﻳﺗﻪﻟﺧ<br />
َ اش و ىدرةئ نَييﻪﺗاهكَيﭙ<br />
َىتشورش و خودراب ب ﻪﻳذنﻩويﻪﭘ<br />
ﻪﻧﻳﻟوكﻪﭭ<br />
ڤﻪﺌ<br />
ک ﻪهج<br />
وكﻩو<br />
نيﻪﻫ<br />
) نايسموك َلىﻩوگ<br />
( نايسموك َىذنﻩﺑرﻩد<br />
َىهجﻠ<br />
نَيا ﻪﻟﺧااش<br />
و ىايﻩزاذانﻪﺌ<br />
نَياي ىرواج نَينراك الوﭙ<br />
رﻪﺴﻟ<br />
تﻪﮐد<br />
َىنرككابود ﻪﻧﻳﻟوكﻪﭭ<br />
ڨﻪﺌ<br />
. نركراينشَيﭘ<br />
و ىركش وب ت اينب ﻪﻧﻳﺑد<br />
نَيوﻪﺌ<br />
ناصيد . نيوب تشورد َىهج ََىﭭﻪﺌ<br />
َ<br />
نَيوﻪﺌ<br />
، ارﻪﺑ<br />
نَيي<br />
)<br />
Indexes<br />
(<br />
ﻪﻳﻪﻫ<br />
ﻪﻴﺴﮐﺪﻧﻹٲ<br />
و َىانركاﭬائ<br />
َىمﻩد<br />
ل ىركش َىيتاﭬائ<br />
انركاﭬائ<br />
وبﮊ<br />
ﻪتشﻩرﻪﮐ<br />
وكﻩو<br />
. ىﻪﻫ<br />
نَيصَيﭬﻧرﻪﺴ<br />
نَييﻪﻳﺗاهكَيﭘ<br />
فاند ﻪﻧﺟد<br />
ب ناَيوﻪﺌ<br />
)<br />
limestone<br />
(<br />
ﻪﻳيرلجا<br />
( نَيرﻪﺑ<br />
نَيروج ﮊ كَيئ وك ) بيشلايبلا ( نَيرﻪﺑ<br />
نَييﻪﺗاهكَيﭘ<br />
. َىنركاﭬائ<br />
ىتشﭘ<br />
رﻪﺳﻟ<br />
ىيزاذانﻪﺌ<br />
نَياي َىو نَيا ﻪﻟﺧاش<br />
َىيلاﮊ<br />
ادوج َىكﻪﮔﻧﻩر<br />
وب لوكﻪﭬ<br />
. نيﻪﻫ<br />
ىركش َىهج ل نزﻪﻣ<br />
َىكﻩوَيش<br />
ناد وبﮊ<br />
َىووداي . اد َىتﻪﮔ<br />
اتﻪﭬ<br />
تشﻩد<br />
ب ناسَيﭘ<br />
نَيمانجﻪﺌ<br />
. ىكيناكيم و ةيكينك ويج اتﻪﮔﻳﻗا<br />
نَينركيقا لﻪﮐد<br />
. نركﻪتَيتد<br />
قا د ةنوونم وكﻩو<br />
كَيئ . نانيئراكب ةن اتارﻪﺑ<br />
ناﭬﻪﺌ<br />
نَيﻳ<br />
ىﻩزاذنﻪﺌ<br />
نَيي ىروج نَينرك لوﭘ<br />
انانَيﭘ<br />
ىروج و ىتشﮔاي<br />
ىيﻩزاذنةئ<br />
انرك لوﭘ<br />
وك ) نذناﭘﺳﻪﭼ(<br />
ىركرايد نَيمانجﻪﺌ<br />
ىناتصيبل ىتشﮔ<br />
َىكﻩوَيش<br />
ب رﻪﺑ<br />
وكﻩو<br />
َىاي ىاتاﭬاائ<br />
اشَيك نزﻪﻣ<br />
نَيناتشةﭘ<br />
رﻪﺑﻣارﻪﺑ<br />
ل ىﻪﻫاي<br />
شاب اكﻪﻳ<br />
دﻳﮔرﻪﺑ<br />
و نقﻩرد<br />
( ناَيرﻪﺑ<br />
نَيايﻪﺗااهكَيﭘ<br />
ﻩرﻪﺑ<br />
ﭫﻪﺋ . ارﻪﺑ<br />
ﻦاﭬﻪﺌ<br />
. ىركاشوب تااينب وكﻩو<br />
نشابدوك نذناﮔﻧةصلﻪﻫ<br />
ةن اترﻪﺑ<br />
ﭬﻪﺌ تيباوﻪﭼ<br />
رﻪﻫ<br />
َىركاش َىاهج ل ﻪﻫ ﻩرافرﻪﺑ<br />
َىاكﻪﻳﻩوَيش<br />
ب َىي ) shale ( ) حفطلا ( َىروج ﮊ نَيوﻪﺌ<br />
. ﻯﺭﻜﺴ اﺯۄﻪﺤ<br />
اﺭﻪﭬﻩﺩﻟ<br />
نَيي<br />
ىركش<br />
) شولوكلا ( و ) سكريجلا<br />
) eganiard basin ( تايﭼد<br />
َىﭬاائ<br />
اﻳ<br />
ﻪﭬرﻪﺳ<br />
اانانَيترﻩد<br />
ناَير ﻪﭬﻩد<br />
ل و ىركرايناشَيﭘ<br />
ێﻧﻳﺭﻩۄﻟﻪﻫ<br />
ﺭﻪﺳﻟ ێﺭﻳﮔﺭﻪﺑ<br />
ێﺭﻩدﻧاﺷﻳﻧ<br />
اﻧﺭﻜﺗاﭘۄدﺐ<br />
. ﻥﺭﻜ ﻪﺗﻳﻫد<br />
ێۄاﻳﻧﻳﻟۄﻜﻪﭭ<br />
اﻜﻳﻧﻜﺗۄﻳﺟ<br />
ێﻳﻼﮊ<br />
اﺴﻩۄﺭﻪﻫ<br />
و َىانيرﻩوالﻪﻫﻫ<br />
ايرﻳﮔرﻪﺑ<br />
وك ركرايد َىتﻪﮔﻳﻗا<br />
نَيمانجﺌوئ<br />
ﺐ ﻦﺩﻧاﮕﻧﻪﺳﻟﻪﻫ<br />
ﻪﻧﺗاﻫ<br />
ﻰﻧﻳﺭﻩﻭﻟﻪﻫ ﻦﻳﻳ<br />
ﻯاركَي<br />
نَيمانجﻪﺌ<br />
. ةزاولا اﻳ<br />
) rating ( َىو نَيي ىياركَي<br />
ناﭬﮊ<br />
) embankments ( ىركاش نَياخﻩر<br />
ودرﻪﻫ<br />
اﻳﭬﻳﺸﻳﻧرﻪﺳ<br />
ىﮊ<br />
ناوﮊ<br />
اﻴﭬﺸﻴﻧﺭﻪﺴ<br />
و<br />
) etgainknud ekald(<br />
ارﻪﺑ<br />
ناﭬﮊ<br />
كﻩذنت<br />
وب َىو نَيي ﻯاركَي<br />
ﻦﻴﺸ<br />
ۄﮔ اﻧاﻧاﺩاﻫﺑ<br />
اﻤﻩﺭﻪﻤ<br />
اكﻪبجﻩو<br />
رﻪﻫ<br />
وب ناوﻩر<br />
اي اريوتش اناناد اهب اشﻩورﻪﻫ<br />
َىنيرﻩولﻪﻫ<br />
نَيي ىياركَي رﻪﺴﻟ<br />
ذنﻪﺑاﭘ<br />
وكﻩو<br />
وب راﻳد<br />
ارﻪﺑ<br />
وكﻩوﺭﻪﻫ<br />
َىو َىرﻪب<br />
انركﻩذَيز<br />
امﻩرﻪﻤ<br />
ب ) compaction ( َىوايةدار نير مَيك ۄ ) ححفط ( ﮊ ) lift ( انيشوﭘاد<br />
.<br />
َىيشَيﭘ<br />
ل ناناداهب ةي ات
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 39-51, 2011<br />
) نابزموك يداو(<br />
نابزموكيدنبرد عقوم يف ةدجاوتملا روخﺼلل ةيسدنهلا صاوخلا و ضرلاا فورظب قلعتت ةساردلا هذى<br />
صاوخلا و ةيسدنهلا ةيعونلا تافينﺼتلا نأ تدكا ةساردلا هذى<br />
وﺼﻼﺧلﺍ<br />
. دسلا ءانبل ابسانم اعقوم نوكي<br />
يكل وحارتقا مت يذلا<br />
تارادحنلاا بيكرت يف لﺧدت و دسلل ساسلاا ن َ وكي يتلا و عقوملا اذى يف تنوكت يتلا روخﺼلل<br />
يف ريبك لكشب ةدجاوتملا<br />
) Limestone(<br />
) Index(<br />
ةلﺍﺩلﺍ<br />
. ءاشنلاا دعب و ءانثا دسلا مسج ءانبل داومك و ةدجاوتملا<br />
ةيريجلا روخﺼلا عاونا ىدحا يى يتلا و يبسﻼيبلا<br />
روخص تانيوكت نا<br />
ةيكينكتويجلا ةيربتخملا تاصوحفلا عم ةيسدنهلا اهصاوﺧ ثيح نم يئانثتسا لكشب ﻝفسﺃلﺃ ﺀﺯجلﺃ ةسارد<br />
مت دسلا عقوم<br />
يف جذومنك لاوأ روخﺼلا هذهل ةيسدنهلا<br />
ةيعونلا تافينﺼت رارقلا ةلﺼحتسملا تانايبلا جئاتن تلمعتسا و . ةيكيناكيملا و<br />
وى روخﺼلا هذهل يعونلا و ماعلا يسدنهلا فينﺼتلا نأب تتبثا جئاتنلا نا و لقحلا يف ماع لكشب رخﺼك ايناث و ربتخملا<br />
ةبسانم اهنأب روخﺼلا هذى مييقت مت لاحلا ةعيبطب و ،دسلا مسج نزو نم ةريبكلا طوغضلل ةديج ةمواقم وذ و ةدلص اهنا<br />
يف عساو لكشب ةدجاوتم ) Shale(<br />
حفطلا عون نم يى يتلا و شولوكلا و سكريجلا روخص تانيوكت نا . دسلل<br />
مت ،دسلا ضوح ةقطنم يف<br />
و<br />
) Drainage Basin(<br />
) Slake Durability﴿تتفتلا<br />
ىلع ةمواقملا<br />
تارشؤم ىلع<br />
ساسأك<br />
ةيراجلا هايملل ةيحطسلا ةيفيرﺼتلا قطانملا يف و حرتقملا دسلا عقوم<br />
ادكؤم ةيكينكتويجلا ةيحانلا نم اضيأ اهتسارد<br />
مييقت مت و ةفيعض روخﺼلا هذى ضعبل اهتلادعم و تتفتلا ةمواقم نأب ةيربتخملا جئاتنلا تتبثا و<br />
نم تينب اذا ) Embankments(<br />
ىلع حفطلا نم<br />
) Lift(<br />
. ) gnitaR(<br />
اهتلادعم<br />
دسلا يبناج رادحنا اهنمض نم تارادحنلاا اياوز تاريدقت ضرغل تتفتلا تلادعم جئاتن<br />
ءاطغ ةبجو لكل بسانملا كمسلا ريدقت كلذك و ،تتفتلا تلادعم ىلع ةلادك<br />
روخﺼلا هذى<br />
.<br />
اقبسم اىريدقت كلذك و اهتفاثك ةدايز ضرغل ) Compaction(<br />
اهلدح لبق ينبملا حطسلا<br />
44
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 52-57, 2011<br />
52<br />
SPECTOPHOTOMETRIC DETERMINATION OF PARACETAMOLE VIA<br />
OXIDATIVE COUPLING WITH PHENYLEPHRINE YDROCHLORIDE<br />
IN PHARMACEUTICAL PREPARATIONS<br />
FIRAS MUHSEN AL-ESAWATI * and RAEED MEGEED QADIR **<br />
* Dept. of Chemistry, Faculty of Science, University of Zakho, Kurdistan Region-Iraq<br />
** Dept. of Chemistry, Faculty of Science, University of Duhok, Kurdistan Region-Iraq<br />
(Received: June 3, 2010; Accepted for publication: February 2, 2011)<br />
ABSTRACT<br />
A new, simple, rapid and sensitive spectrophotometric method was described in the present study for the indirect<br />
determination of paracetamol. The method is based on the oxidative coupling reaction of paracetamol ( after acidic<br />
hydrolysis to form p-aminophenol) with phenylephrine hydrochloride using atmospheric oxygen as an oxidant in<br />
alkaline medium to form a water soluble, stable indophenol dye and has a maximum absorption at 640 nm. Beer’s law<br />
is obeyed in a concentration range of 0.5-24 µg. mL -1 of paracetamol with a molar absorptivity of 7664 L.mol -1 .cm -1 ,<br />
the accuracy is 98.86% and the relative standard deviation was less than 1.88% depending on the concentration levels.<br />
The proposed method has been applied successfully for the determination of paracetamol in some pharmaceutical<br />
preparations.<br />
KEYWORDRS: Spectrophotometric, Oxidative Coupling, Paracetamol.<br />
P<br />
INTRODUCTION<br />
aracetamol(N-acetyl-p-aminophenol;<br />
PCT) is a common analgesic and<br />
antipyretic drug that is used for the relief of<br />
fever, headaches and other minor aches and<br />
pains (1) .<br />
Various methods have been described for<br />
determination of paracetamol included<br />
chromatographic (2-8) , electrochemical (9-13) and<br />
(14-18)<br />
Spectrophotometric techniques. Ratio<br />
Spectra First-Order Derivative UV<br />
(19)<br />
Spectrophotometry , and Artificial Neural<br />
Networks (ANN) (20) , also has been employed<br />
for the spectrophotometric determination of this<br />
drug.<br />
In this paper we describe a simple and<br />
accurate method for rapid indirect<br />
spectrophotometric determination of<br />
paracetamol in pharmaceutical preparations. The<br />
method is based on the reaction of the hydrolysis<br />
protect of PCT to p-aminophenol (abbreviated as<br />
PAP) with phenylephrine hydrochloride in<br />
alkaline medium.<br />
EXPERIMENTAL<br />
1. Apparatus<br />
Shimadzu model (UV-160A) double beam<br />
UV_VIS spectrometer with 1.0 cm matches<br />
silica cells was used to carry out all spectral<br />
measurements.<br />
A electo. mag model (M 96K) water bath,<br />
HANNA model (pH211) microprocessor pHmeter<br />
and model (HF-400) sensitive balance<br />
were used.<br />
2. Reagents<br />
All chemicals used were of analytical reagent<br />
grade standard. PCT was supplied by S.D.I.<br />
(Iraq), PE by S.D.I. (Iraq), Sodium hydroxide by<br />
BDH, Hydrochloric acid by Fluka.<br />
- A stock solution of PCT (1000 µg.mL -1 ) was<br />
prepared by dissolving 0.25gm of pure PCT in<br />
10 ml of ethanol and diluted to 250 ml with<br />
distilled water. 150ml of stock solution of PCT<br />
was mixed with 25ml of hydrochloric acid<br />
(11.8M), an acidic hydrolysis of mixture was<br />
made by rflexation the mixture for one hour.<br />
The mixture cooled and diluted to 250ml with<br />
distilled water to obtain a solution of (600 µg<br />
mL -1 ) of p-aminophenol (PAP). A diluting<br />
concentration of solution were prepared from<br />
the last solution after equivalent the pH of<br />
volume of using concentration before the<br />
dilution to 7 by sodium carbonate (20%) and<br />
then diluted to volume we need.<br />
- Working solution of PE (0.1M) was prepared<br />
by dissolving 5.0917gm in 250ml distilled<br />
water.<br />
- Sodium hydroxide solution (1.0M) was<br />
prepared by dissolving 10gm in 250ml distilled<br />
water.<br />
3. Procedure for indirect determination of<br />
Paracetamol
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 52-57, 2011<br />
Into a series of 25 ml calibrated flask,<br />
increasing volumes of (0.5-6 ml) of PCT (as<br />
PAP) working solution (25 and 100 µg mL -1 )<br />
were transferred to cover the range of the<br />
calibration curve and 7.0 ml of 0.1 M of PE<br />
followed by 1.0 ml of 1.0 M of sodium<br />
hydroxide, the solution was diluted to the mark<br />
with distilled water and allow the reaction<br />
mixture to stand for 10 min. The absorbance was<br />
measured at 640 nm against reagent blank,<br />
prepared in the same way but containing no<br />
PCT. The color of the dye solution was stable<br />
more than 12 hrs.<br />
4. Procedure for Pharmaceuticals<br />
Ten (10) tablets were weighed and powdered<br />
finely. An accurate weight, equivalent to one<br />
tablet, was transferred into a 100ml calibrate<br />
flask, dissolve as completely as possible in<br />
ethanol (10-25ml) and dilute to volume with<br />
distilled water. Filter and prepare solution of<br />
1000µg/ml of PCT from later and treat it as the<br />
same way as mentioned under the general<br />
procedure.<br />
RESULTS AND DISCUSSION<br />
1. Absorption Spectra:<br />
C<br />
The result of this investigation indicated that<br />
the reaction between PCT (as PAP) and PE in<br />
the alkaline medium yield highly soluble colored<br />
condensation product which can be utilized as a<br />
suitable assay procedure for PCT. This blue<br />
colored product showed a maximum absorption<br />
at 640 nm, the blank at this wavelength shows<br />
zero absorbance (Fig. 1).<br />
Fig,(1): Absorption spectrum of (A)<br />
reaction product of PCT (as PAP) 12µg<br />
mL<br />
2. Study of the optimum reaction conditions<br />
The effects of various parameters on the<br />
absorption intensity of the dye were studied and<br />
the reaction conditions were optimized.<br />
2.1-Effect of reagent concentration<br />
Various concentration of PE was added<br />
to a fixed concentration of PCT (as PAP), and<br />
the results shown that 7.0 ml of 0.1 M of reagent<br />
solution was sufficient to develop the color to its<br />
full intensity and give the maximum value of<br />
absorbance with minimum absorbance of blank.<br />
-1 with PE vs. blank. (B) blank vs.<br />
distilled water. (C) reaction product vs.<br />
distilled water.<br />
Table (1): Effect of concentration of reagent<br />
mL, volume of PE (0.1 M) Absorbance<br />
0.1 0.098<br />
5.0 0.158<br />
0.5 0.210<br />
0.5 0.238<br />
4.0 0.387<br />
5.0 0.401<br />
6.0 0.425<br />
7.0 0.431<br />
8.0 0.430<br />
10.0 0.430<br />
2.2-Effect of sodium hydroxide concentration<br />
To establish the optimum conditions (stability of<br />
the dye resulting from the reaction of the PCT<br />
with reagent intensity of the dye formed,<br />
minimum blank value and relatively rapid<br />
reaction rate), the effect of medium of reaction<br />
was studied. Only alkaline medium (1.0M of<br />
sodium hydroxide) was found to be optimum.<br />
Neutral and acidic medium results in low<br />
sensitivity of the color and was not stable. The<br />
effect of the amount of sodium hydroxide was<br />
also investigated and 1.0 ml was found to be<br />
optimal.<br />
Table (2): Effect of sodium hydroxide concentration<br />
mL, volume of NaOH ( 1.0 M) Absorbance<br />
0.1 0.108<br />
0.3 0.189<br />
0.5 0.236<br />
0.7 0.378<br />
0.9 0.422<br />
1.0 0.430<br />
1.5 0.410<br />
2.0 0.402<br />
3.0 0.390<br />
4.0 0.381<br />
5.0 0.377<br />
2.3- Effect of temperature<br />
The effect of temperature on the color<br />
intensity of the dye was studied. In practice the<br />
absorbance was decreased when the color is<br />
developed at 0°C or when the calibrated flask is<br />
placed in a water bath at 40-60°C. Therefore, it<br />
is recommended to undergo the reaction at room<br />
temperature (25°C).<br />
53
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 52-57, 2011<br />
2.4- Effect of time<br />
The color intensity reached maximum after<br />
the PCT solution was reacted in development<br />
54<br />
Temp. (� C)<br />
Table ( 3): Effect of time and temperature<br />
Absorbance/ Minutes standing time<br />
5 10 30 45 1 2<br />
time was selected to be used in the general<br />
proceeds with PE and sodium hydroxide for 10<br />
min.<br />
Absorbance / Hour standing time<br />
4<br />
6 12 Overnight<br />
0 0.387 0.390 0.391 0.390 0.384 0.366 - - - -<br />
Room temp. 0.424 0.431 0.430 0.431 0.429 0.431 0.431 0.430 0.431 0.429<br />
40 0.421 0.420 0.419 0.419 0.418 0.415 0.403 - - -<br />
50 0.411 0.408 0.405 0.403 0.400 0.391 - - - -<br />
60 0.384 0.371 0.345 0.310 0.291 0.276 - - - -<br />
2.5- Accuracy and precision<br />
To determine the accuracy and precision of<br />
the method, PCT (as PAP) was determined at<br />
three different concentrations. The results are<br />
shown in table.1 indicate that satisfactory<br />
precision and accuracy could be attained with<br />
the proposed method.<br />
Table (4): Accuracy and precision of the method.<br />
Paracetamol<br />
taken<br />
µg<br />
Relative error<br />
%*<br />
Relative<br />
standard<br />
deviation%**<br />
4 -0.19 1.27<br />
8 +0.41 0.84<br />
12 +0.33 1.88<br />
* Average of three determinations.<br />
** Average of six determinations<br />
3. Calibration curve<br />
Under the above optimum conditions, the<br />
linear calibration curve (Fig.2) for PCT (as PAP)<br />
is obtained which shows that beer's law is<br />
obeyed over the concentration range of (0.5-24<br />
µg mL -1 ) with correlation coefficient of 0.998<br />
and an intercept of 0.014 and slope of 0.0375 .<br />
the molar absorptivity of the colored product<br />
was 7664 L.mol -1 .cm -1 .<br />
Absorbance<br />
Absorbance<br />
4. The nature of reaction product<br />
The stoichiometry of the reaction between<br />
PCT (as PAP) and PE was investigated using the<br />
molar ratio method (21) Fig (2): Calibration curve for indirect determination of<br />
PCT.<br />
. The results obtained<br />
(Fig.3) shows a 1:1 of the colored product<br />
formed between PCT and PE at 640 nm.<br />
0.35<br />
0.3<br />
0.25<br />
0.2<br />
0.15<br />
0.1<br />
0.05<br />
1.0<br />
0.9<br />
0.8<br />
0.7<br />
0.6<br />
0.5<br />
0.4<br />
0.3<br />
0.2<br />
0.1<br />
0.0<br />
0.0 5.0 10.0 15.0 20.0 25.0<br />
µg/mL (PCT)<br />
0<br />
0 0.5 1 1.5 2 2.5<br />
Mole Ratio of PE/PCT (as PAP)<br />
Fig (3): Mole ratio of reaction product of PCT<br />
(as PAP)-PE.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 52-57, 2011<br />
5. Proposed reaction mechanism<br />
The acidic hydrolysis of Paracetamol (I) is<br />
formed p-aminophenol (II) which readily<br />
oxidized by atmospheric oxygen to pbenzoquinonimine,<br />
the later couples with<br />
phenylephrine hydrochloride (III) in alkaline<br />
medium to form a water soluble indophenol dye<br />
(IV) which has maximum absorption at 640nm:<br />
OH<br />
NH CH<br />
OH<br />
OH<br />
O<br />
R<br />
CH 3<br />
(I)<br />
+<br />
R= CH-CH 2NHCH 3<br />
OH<br />
NH 2<br />
HCl<br />
OH -<br />
OH<br />
OH<br />
NH 2<br />
H<br />
N<br />
(II)<br />
6. Analysis of Paracetamol in pharmaceutical<br />
preparations<br />
The proposed method was applied<br />
satisfactorily to the indirect determination of<br />
paracetamol in the following pharmaceutical<br />
preparations:<br />
Paracetamol tablets with paracetamol<br />
500mg; from Meheco (China).<br />
Paracetol tablets with paracetamol 500mg;<br />
from S.D.I. (Iraq).<br />
Algesic tablets with paracetamol 350mg,<br />
Codeine phosphate 10mg ; from S.D.I. (Iraq).<br />
Myogesic tablets with paracetamol 450mg,<br />
orphenadrinecitrate 35mg; from Dar-Al-Dawa<br />
(Jordan).<br />
The concentrations of the PCT (as PAP) were<br />
calculated by direct measurements on the<br />
appropriate calibration graph. The results<br />
obtained are summarized in (Table2), and<br />
compared favorably to those reported by Al-<br />
Esawati (22) and the official method(BP) (23) .<br />
OH<br />
(III) (IV)<br />
R<br />
Table 5: Determination of paracetamol in<br />
pharmaceutical preparations<br />
Pharmaceutical<br />
preparation<br />
Paracetamol<br />
tablets<br />
Paracetol<br />
tablets<br />
Label<br />
claim mg<br />
BP<br />
method<br />
Recovery %<br />
Reported<br />
method<br />
Proposed<br />
method<br />
500 98.73 97.97 97.34<br />
500 97.47 98.65 96.92<br />
Algesic tablets 350 97.97 102.20 98.55<br />
Myogesic<br />
tablets<br />
450 98.99 101.81 102.63<br />
CONCLUSIONS<br />
Spectrophotometric procedure is proposed for<br />
the indirect determination of paracetamol in<br />
pharmaceutical preparations. The method is<br />
based on the oxidative coupling reaction of<br />
paracetamol ( after acidic hydrolysis to form paminophenol)<br />
with phenylephrine hydrochloride<br />
using atmospheric oxygen as an oxidant in<br />
alkaline medium to form a water soluble, stable<br />
indophenol dye. The proposed method has been<br />
applied successfully for the determination of<br />
paracetamol in some pharmaceutical<br />
preparations.<br />
REFERENCES<br />
� Goodman-Hillman, A. Rall, T., Nier, A., and<br />
Taylor, P. (1996). The Pharmacology Basis Of<br />
Therapeutics. New York: McGraw-Hill.<br />
� Prasanna R. B. (2009). Simultaneous<br />
RP-HPLC Determination Of Nimesulide And<br />
Paracetamol In Tablets. Int.J. ChemTech Res.<br />
1(3), 514-516.<br />
5. Akay, C., Dečim, I. T., Sayal, A., Aydin, A.,<br />
Özkan, Y., and GUL, H., (2008). Rapid And<br />
Simultaneous Determination Of Acetylsalicylic<br />
Acid, Paracetamol, And Their Degradation And<br />
Toxic Impurity Products By HPLC In<br />
Pharmaceutical Dosage Forms. Turk J Med Sci,<br />
38 (2), 167-173.<br />
6. Uttam, D. P., Abhijit, V. N., Aruna, V. S.,<br />
Tirumal, A. D., and Kiran, V. M. (2009).<br />
Simultaneous Determination Of Aceclofenac,<br />
Paracetamol And Chlorzoxazone By Hplc In<br />
Tablet Dose Form. E-Journal of Chemistry,<br />
6(1), 289-294.<br />
55
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 52-57, 2011<br />
7. Venkatesh, K., Vaidhyalingam, Yuvaraj, G.,<br />
Rajesh, K. N. (2009). Simultaneous<br />
Estimation Of Earacetamol, Chlorzoxazone<br />
And Aceclofenac In Pharmaceutical<br />
Formulation By Hplc Method. Int.J.<br />
ChemTech Res., 1(3) , 457-460.<br />
8. Anju, G., and Sandeep, J. (2007). Simultaneous<br />
Estimation Of Paracetamol, Chlorzoxazone<br />
And Diclofenac Sodium In Pharmaceutical<br />
Formulation By A Novel HPLC Method. Acta<br />
Pharmaceutica Sciencia, 49, 147- 151.<br />
9. M. Levent ALTUN, HPLC Method For The<br />
Analysis Of Paracetamol, Caffeine And<br />
Dipyrone, Turk J Chem 26 (2002) , 521-528.<br />
10. Lakshmi, S., and Lakshmi, K. S. (2009). Reverse<br />
Phase-High Performance Liquid<br />
Chromatographic Method For The Analysis<br />
Of Paracetamol, Cetirizine And<br />
Pseudoephedrine From Tablets. Der Pharma<br />
Chemica, 1 (1):37-46.<br />
11. Silva, M. L. S., Garcia, M. B. Q., Lima, J. L. F.<br />
C., and Barrado, E. (2006). Flow System With<br />
Electrochemical Detection For Determination<br />
Of Paracetamol In Pharmaceutical<br />
Preparations. portugaliae Electrochimica<br />
Acta, 24, 261-271.<br />
12. Kanita, T., Nipon, T., and Duncan, T. B. (2005).<br />
Cyclic Voltammetric Determination Of<br />
Acetaminophen In Paracetamol Tablets.<br />
KMITL Sci. Tech. J., 5( 3), 547-551.<br />
13. Razmi, H., and Harasi, M. (2008). Rapid and<br />
Accurate Amperometric Determination Of<br />
Acetaminophen In Pharmaceutical<br />
Preparations And Spiked Human Blood Serum<br />
Samples At Cadmium<br />
Pentacyanonitrosylferrate Modified Glassy<br />
Carbon Electrode. J. Iran. Chem. Soc., 5(2),<br />
296-305.<br />
14. Duncan, T. B., Nipon, T., Sumaporn, K., and<br />
Kanita T. (2004). Assay Of Acetaminophen In<br />
Paracetamol Tablets By Differential Pulse<br />
Voltammetry. Kasetsart J. (Nat. Sci.), 38, 510<br />
– 514.<br />
15. Tatiane, S., Mariane, F. F., Noemi, N., and<br />
Christiana, A. P. (2008). Simultaneous<br />
Voltammetric Determination Of Dypirone<br />
And Paracetamol With Carbon Paste Electrode<br />
And Multivariate Calibration Methodology. J.<br />
Braz. Chem. Soc., 19(4), 762-768.<br />
16. O. Fatibello-Filho, O., H. J. Vieira, H. J. (2008).<br />
Spectrophotometric Flow Injection Procedure<br />
To Indirect Determination Of Paracetamol In<br />
Pharmaceutical Formulations Using O-<br />
56<br />
Tolidine As Reagent. Ecl. Quím., São Paulo,<br />
33(2), 47-54.<br />
17. Wafaa, S. H. (2008). Determination Of<br />
Ibuprofen And Paracetamol In Binary Mixture<br />
Using Chemometric-Assisted<br />
Spectrophotometric Methods. Am. J. Applied<br />
Sci., 5 (8), 1005-1012.<br />
18. Abbas, A., Nahid, S., and Ali, R. Z. (2006).<br />
Spectrophotometric Determination Of<br />
Salicylamide And Paracetamol In Biological<br />
Samples And Pharmaceutical Formulations By<br />
A Differential Kinetic Method. Acta Chim.<br />
Slov., 53, 357–362.<br />
19. Salah, M. S., Abubakr, M. I., and Kamal, E. E. I.<br />
(2004). Sequential Injection<br />
Spectrophotometric Method For The Assay Of<br />
Paracetamol In Drug Formulations. J. Flow<br />
Injection Anal., 21(1), 19-24.Sohan, S. C.,<br />
Ranjana, S., Sagar, B. W., and Amol, A. K.<br />
(2009). Spectrophotometric Methods For<br />
Simultaneous Estimation Of Dexibuprofen<br />
And Paracetamol. Asian J. Research Chem.,<br />
2(1), 30-33.<br />
20. Duong, T. T., and Vu Dang, H. (2009).<br />
Simultaneous Determination Of Paracetamol<br />
And Codeine Phosphate In Combined Tablets<br />
By First-Order Derivative And Ratio Spectra<br />
First-Order Derivative UV Spectrophotometry.<br />
Asian J. Research Chem., 2(2), 143-147.<br />
21. Lawan, S., and Nongluck, R. (2007).<br />
Determination Of Paracetamol And<br />
Orphenadrine Citrate In Pharmaceutical<br />
Tablets By Modeling Of Spectrophotometric<br />
Data Using Partial Least-Squares And<br />
Artificial Neural Networks. YAKUGAKU<br />
ZASSHI, 127(110), 1723-1729.<br />
22. R. Delevie, R. (1997). Principle Of Quantitative<br />
Chemical Analysis. McGraw-Hill<br />
International Edition, Singapore, p 498<br />
23. Al- Esawati, F. M. (2002). Development Of<br />
Spectrophotometric Methods For The<br />
Determination Of Some Phenolic Compounds<br />
And Drugs Via Oxidative Coupling Reactions.<br />
M.Sc. Thesis, Mosul University, 79-95.<br />
24. “British Pharmacopoeia”, Vol. I, The Stationery<br />
Office, London, p. 1854 (1998).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 52-57, 2011<br />
ةييتاي َىتشث(<br />
ليهظ لةطد َىناسكَوئ اناهيكَيث اكَيلزاك اكَيسب لىوماتيسازاث وب ىطنةبةش َىكندنلامةخ<br />
انامزةد تَينونم ظاند ىديزولكوزدياي ويسظ<br />
لىوماتيسازاث اي زةسكيئ ةن اي ىطنةبةش اَييسب اندنلامةخ، َىناسكَوئ اناهيكَيث ىكةكَيلزاك اناهيئزاكب<br />
ىتزوك<br />
اهيج ىسكوئ ىاهيئزاكبو ىديزولكوزدياي ويسظ ليهظ لةطد ) لوهيفوهيما -ازاث<br />
وب شست َىكةدنوان ةل ادَيظائ<br />
ظاند َىزاطيش<br />
ب ادَيظائ ظاند ةياناوت و لوهيفودهيئ اي ٌجوخ َىشولائ اهتاًكَيث وب ةتشثلاث ةمةتسيس ظةئ<br />
ذ ترليلم/<br />
ماسغوسكيام<br />
ارَيز ب و % 98.86<br />
) 24-<br />
0. 5(<br />
اتةي اوناهيئ ارَيز ب<br />
ذ اديرب اساي َىزوهسو تريمونان<br />
604<br />
. تفت َىكةدنوان ةل اةد َىناسمةئ<br />
َىندنارم َىزةظَيث ب ىدنارلمةي ويستشزةب<br />
1-<br />
1-<br />
و مس.<br />
لوم.<br />
ترل 4660 ىيرب يزلاوم اهيرم ىةكلوك واي ب . لىوماتيسازاث<br />
لوماتيسازاث اي انامزةد<br />
ذ ادوج تَينونم زةسل ىاهيئزاكب ةتاي ةنايتظةكزةس ب ةَييز ظةئ<br />
.<br />
% 8811<br />
فشاكلا عم يدسكأتلا نارتقلأا لعافت ىلع دامتعلأاب لوماتيسارابلل يفيطلا ريدقتلا<br />
ةيئاودلا تارضحتسملا ضعب يف ديارولكوردياه نيرف لينف<br />
ىنلع ةنقيرطلا دنمتعت ت يئانملا لنسولا ينف لوماتينسارابلا<br />
ننم ةيوركيام تايمك ريدقتل ةرشابم ريغ ةيفيط ةقيرط<br />
ل يرت ميك ىناظيث انادلا<br />
ةصلاخلا<br />
تمدختسا<br />
نيرنف لنينف فنشاكلا عنم ) لوننيفونيمأ-ارانب<br />
ىنلا ينضماي لنسو ينف فانيئام نللحت دعب(<br />
لوماتيسارابلل يدسكأتلا نارتقلاا لعافت<br />
ةرننقتسم<br />
ت ةنوولم لونيفودنوا ة بنص نونكتت ذإ . يدنعاق لنسو ينف دنسكسم لنماعك يونجلا نيجسكولأا مادنختساب ديارولكورديه<br />
ىنلإ 0.5 ننم نيكرتلا لدنم نمنم نبطوا<br />
رنيب نوواق . رتموواو<br />
1-<br />
لدنعم نانك و<br />
.<br />
600<br />
يجوملا لوطلا دنع صاصتما ىلعأ يطعتو ءاملا يف ةبئاذو<br />
1-<br />
نس.<br />
لونم.<br />
رتل 4660 يه يرلاوملا صاصتملاا لماعم ةميق تواكو لوماتيسارابلا نم رتللم/<br />
مارغوركيام<br />
نيكرتلا لوتنسم ىنلع فادانمتعا % 1.<br />
88 ننم لنقا يبنسنلا ينسايقلا ارنحولااو % 98.<br />
86<br />
.<br />
ةيئاودلا<br />
40<br />
ينه لوماتينسارابلل لاجرتنسلاا ةبنسو<br />
تارضحتسملا ضعب يف لوماتيسارابلا ريدقت يف حاجنب ةقيرطلا يبطت تو<br />
57
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 58-62, 2011<br />
58<br />
CERTAIN SPECIES OF MALLOPHAGA (BIRD LICE) OCCURING<br />
ON DOMESTIC PIGEONS (Columba livia domestica Gmelin, 1789)<br />
IN ERBIL CITY-IRAQ<br />
REZAN KAMAL AHMED<br />
Dept. of Biology, College of Science, University of Salahaddin, Kurdistan Region-Iraq<br />
(Received: June 4, 2010; Accepted for publication: June 4, 2011)<br />
ABSTRACT<br />
Pigeons are a source of food, and used as pets, cultural and peace symbols. They also make good laboratory animal,<br />
poultry are attacked by several species of biting lice. The main objective of the current study was to determine and identify<br />
the prevalence and intensity of infestation with abundance of individual species of chewing lice on certain domestic pigeons<br />
of Erbil City-Kurdistan Region-Iraq. During the period from the beginning of October 2008 to the end of October 2009, a<br />
total of 40 domestic pigeons were obtained from animal market Erbil, the feathers were examined by using magnifying lenses<br />
and dissecting microscope. The ectoparasites were collected in small vials and fixed in 70% ethanol for further<br />
identifications. Three different species of chewing lice were reported [Goniocoites gallinae from the head and neck (89.3%),<br />
Menacanthus stramineus from the breast skin (67.9%) and Columbicola columbae from the Wing and tail feather (32.1%)]<br />
with the overall prevalence 70.0%. The pigeons had higher prevalence of double 15 (37.5%) compared with single 7 (17.5%)<br />
and triple 6 (15%), whilst 12 (30 %) of the examined pigeons were uninfested.<br />
KEYWORDS: Mallophaga, domestic pigeons, Erbil, Kurdistan Region, Iraq.<br />
P<br />
INTRODUCTION<br />
igeons are a source of food, and used as<br />
pets, cultural and peace symbols. They<br />
also make good laboratory animal (Cooper,<br />
1984). Poultry are attacked by several species of<br />
biting lice that causes reduce egg production,<br />
decrease market quality of birds. This is<br />
manifested by extensive damage to feathers and<br />
marked irritation of the skin, which may cause<br />
overall weakening and even death of the birds<br />
infested (Porkert, 1978; Jurasek and Dubinsky,<br />
1993; Holscher and Wintersteen, 1998). Many<br />
authors in different parts of the world studied the<br />
ectoparasites of the bird in general and pigeon in<br />
special. Although most of them were<br />
emphasized the need for more parasite research,<br />
especially in the area of systematic because only<br />
a small percentage of parasite species have been<br />
identified (Monis, 1999; Brooks & Hoberg,<br />
2001).<br />
In a study performed by Zangana (1982) only<br />
two species of ectoparasites (Gonocoites<br />
gallinae and Columbicola tschulyschmann) were<br />
detected from 435 collected domestic pigeons<br />
(Columba livia domestica) at different parts of<br />
Nineva province and some parts of Erbil and<br />
Duhok provinces-Iraq. From three different<br />
locations of Kampala-Uganda, 34 pigeons were<br />
studied for parasites. Three lice Columbicola<br />
columbae, Menopon gallinae and Menacanthus<br />
stramineus were reported (Dranzoa et al., 1999).<br />
Mushi et al. (2000) were conducted a study on<br />
12 domestic pigeons (C. livia domestica) in<br />
Sebele, Gaborone, Botswana, the prevalence of<br />
C. columbae was 30%. Adang et al. (2008) were<br />
purchased 240 domestic pigeons (127 males &<br />
113 females) in Ziria-Nigeria, in which 177<br />
(73.8%) were infested by certain species of<br />
ectoparasites, which included: M. gallinae<br />
(6.3%), C. columbae (63.8%), and Goniodes sp.<br />
(10.8%).<br />
The study of bird parasites (including<br />
pigeons) is a neglected field of zoological study<br />
in Iraq; therefore the present study was aimed to<br />
record the incidence of chewing lice among<br />
certain domestic pigeons of Erbil City, and to<br />
determine the intensity of infestation and<br />
abundance of individual species of chewing lice on<br />
Pigeons.<br />
MATERIALS AND METHODS<br />
Sampling area:<br />
A total of 40 domestic pigeons (Columba<br />
livia domestica Gmelin, 1789) were obtained<br />
from animal market Erbil during the period from<br />
beginning of October 2008 to the end of October<br />
2009. The pigeons brought alive and kept in<br />
large special cage with grid tops and sides (2X<br />
3X 4m 3 ) in the animal house of Science College,<br />
Biology Department for further examination and<br />
fed on the wheat and adequate water. The
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 58-62, 2011<br />
feathers of the birds were brushed using a fine<br />
brush onto a white flat container for the<br />
collection of ectoparasites, with the special<br />
attention paid to the examination of the head, the<br />
neck, under wings, body and leg feathers with a<br />
hand lens. Dissecting and light microscope were<br />
used for further examination.<br />
The ectoparasites were placed immediately in<br />
a small vial containing 70% alcohol for killing<br />
and preserving. The vial then labeled with the<br />
correct host-name, locality, date and number of<br />
the ectoparasites in each pigeon (Wall &<br />
Shearer, 2001). The ectoparasites were identified<br />
using standard text by Wall and Shearer (2001).<br />
Criteria of infestation:<br />
The ecological terms (prevalence and mean<br />
intensity of infestation) were used here based on<br />
the terminology of Margolis et al. (1982)<br />
Prevalence of infestation = The percentage of<br />
number of individuals of a host species infected<br />
with a particular ectoparasite species/ Number of<br />
hosts examined.<br />
Mean intensity of infestation = Total number<br />
of each ectoparasite species per total number of<br />
infected host in a sample.<br />
Statistical analysis<br />
The results were analyzed statistically using<br />
the computer program SPSS 11.5 for Windows<br />
(� 2 analysis), the differences were considered to<br />
be statistically significant when p-value obtained<br />
was less than 0.05.<br />
RESULTS AND DISCUSSION<br />
Throughout the period of the current study<br />
several species of chewing lice were identified<br />
among 40 domestic pigeons in Erbil City-Iraq.<br />
Table (1) shows the total infested number of<br />
domestic pigeons which was 28 cases with<br />
overall prevalence of different chewing lice<br />
70%, and this is relatively similar (73.8%) to<br />
that reported by Adang et al. (2008), that may be<br />
due to the many factors, which include home<br />
range, behavior, size and roosting habit of the<br />
host, market breeding conditions, and crowdy<br />
caging of domestic pigeons. The results of the<br />
present study confirmed the finding of other<br />
studies performed in some parts of the world<br />
(Mushi et al., 2000; Petryszak et al., 2000;<br />
Senlik et al., 2005). Statistically there was non<br />
significant differences between male and female<br />
infestation rates, this result is in agreement with<br />
Petryszak et al. (2000) and Adang et al. (2008),<br />
which they mentioned that the sex of pigeons did<br />
not influence the number of bird lice present.<br />
Table (2) shows three different species of<br />
chewing lice isolated from different sites on the<br />
body of the domestic pigeons with their<br />
infestation rates. Goniocoites gallinae (Fig. 1A)<br />
from the head and neck (89.3%), Menacanthus<br />
stramineus (Fig. 1B) from the breast skin<br />
(67.9%) and Columbicola columbae (Fig 1C)<br />
from the Wing and tail feather (32.1%). This is<br />
obvious that species of chewing (biting) lice may<br />
infest pigeons; they feed on skin scales, feathers,<br />
and scabs and spend their entire lives on the bird<br />
(nymph and adult) (Holscher and Wintersteen,<br />
1998).<br />
The infested sites of the isolated chewing lice<br />
was in agreement with the finding of Richards<br />
and Davies (1973) and Pattison (1996), in which<br />
they mentioned that G. gallinae found near the<br />
end of the feathers and on the skin of the host,<br />
especially on the head, neck, M. stramineus,<br />
common birds body louse, and C. columbae<br />
common wing louse.<br />
The pigeons have higher prevalence rates of<br />
double 15 (37.5%) infestation compared with<br />
single 7 (17.5%) and triple 6 (15%), whilst 12<br />
(30 %) of the pigeons were uninfested (Table<br />
3). The differences in the prevalence rates of<br />
single and mixed infestations were non<br />
significant.<br />
The high prevalence rate of double<br />
infestation of the pigeons by G. gallinae and M.<br />
stamineus, compared with single infestation may<br />
be due to to the fact that ectoparasites can<br />
cohabit without causing any harmful effects to<br />
each other.<br />
The interaction of two or more ectoparasites<br />
on the same host may be said to be a low interspecific<br />
competitive interaction characterized by<br />
simultaneous infestations that may not be<br />
detrimental to the two species (Adang et al.,<br />
2008).<br />
59
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 58-62, 2011<br />
60<br />
Table (1): Rates of infestation with different chewing lice species among domestic pigeons in Erbil City-Iraq.<br />
Host Sex<br />
No.<br />
Examined<br />
No.<br />
Infested<br />
Prevalence<br />
(%)<br />
Male 21 15 4.17<br />
Female 19 13 68.7<br />
Total 40 28 70.0<br />
Table (2): Prevalence and preference sites of chewing lice of domestic pigeons in Erbil City-Iraq.<br />
Ectoparasites Infestation sites Number of<br />
infested Pigeons<br />
(28)<br />
Prevalence<br />
(%)<br />
Total numbers of<br />
ectoparasites<br />
Mean<br />
intensity<br />
G. gallinae Head and neck 25 89.3 108 4.3 3-9<br />
M. stramineus Breast skin 19 67.9 93 4.9 2-7<br />
C. columbae Wing and tail<br />
feather<br />
Range<br />
9 32.1 30 3.3 2-5<br />
Table (3): Frequency of single and mixed chewing lice infestations on domestic pigeons in Erbil City-Iraq.<br />
Infestation type Parasite species Total %<br />
None 12 30<br />
single G. gallinae 7 17.5<br />
Double G.gallinae+ M. stramineus<br />
M. stramineus + C. collumbae<br />
Triple G.gallinae+M. stramineus + C. collumbae 6 15<br />
A<br />
C<br />
B<br />
Fig. (1): Photomicrograph of isolated domestic pigeon lice:<br />
A: Adult of Menacanthus stramineus<br />
B: Adult of Goniocoites gallinae<br />
C: Adult of Colmbicola columubae<br />
12<br />
3<br />
30<br />
7.5
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 58-62, 2011<br />
REFERENCES<br />
- Adang, K.L.; Oniye, S.I. Ezealor, A.U.; Abdu, P.A. and<br />
Ajanusi, O.J. (2008). Ectoparasites of domestic<br />
pigeon (Columba livia domestica, Linnaeus) in<br />
Zaria, Nigeria. Research Journal of Parasitology, 3<br />
(2): 79-84.<br />
- Brooks, D.R. and Hoberg E.P. (2001). Parasite<br />
systematics in the 21st century: opportunities and<br />
obstacles. Trends in Parasitology, 17:273-275.<br />
- Cooper, J. E . (1984). A veterinary approach to pigeons.<br />
Journal of small Animal practice, 24; 505- 516.<br />
- Dranzoa, C. Ocaido, M. and Katete, P. (1999). The ecto-,<br />
gastro- intestinal and haemo-parasites of live<br />
pigeons (Columba livia) in Kampala, Uganda.<br />
Avian pathology, 28:119-124.<br />
- Holscher, K. and Wintersteen, W. (1998). Iowa<br />
Commercial Pesticide Applicator Manual Animal<br />
Pest Control. Iowa State University. Category 1E<br />
(http://www.extension.Iastate.edu/publications/cs<br />
13, 1-24pp)<br />
- Jurasek, V. and Dubinsky, P. (1993): Veterinary<br />
Parasitology (in Slovak). Priroda, Bratislava. 382<br />
(Cited by Sychra, O. (2005). Chewing lice<br />
(Phthiraptera: Amblycera, Ischnocera) from chukars<br />
(Alectoris chukar) from a pheasant farm in<br />
Jinacovice (Czech Republic). Vet. Med. – Czech, 50<br />
(5): 213–218).<br />
- Margolis, L. Esch, G.W. Holmes, J.C. Kuris, A.M. and<br />
Schad, G.A. (1982). The use of ecological terms in<br />
parasitology (Report of an ad hoc committee of the<br />
American Society of Parasitologists). Journal of<br />
Parasitology, 68 (1): 131-133.<br />
- Monis, P.T. (1999). The importance of systematics in<br />
parasitological research. International Journal of<br />
Parasitology, 29:381-388.<br />
- Mushi, E.Z. Binta, M.G. Chabo, R.G. Ndebele, R. and<br />
Panzirah, R. (2000). Parasites of domestic pigeons<br />
(Columba livia domestica) in Sebele, Gaborone,<br />
Botswana. Journal of South Africa Veternary<br />
Association, 71(4): 249-250.<br />
- Pattison M. (1996). Poultry Diseases 4th ed, Bailliere<br />
Tindal, London, WB Saunders, Jordan, FTW: 287–<br />
289<br />
- Petryszak, A. Rościszewska, M. Bonczar, Z. and<br />
Pośpiech, N. (2000). Analyses of the population<br />
structures of Mallophaga infesting urban pigeons.<br />
Wiad Parazytology, 46(1): 75-85.<br />
- Porkert, J. (1978). Mass occurrence of Goniocotes<br />
megalocephalus on one injured Hazel Grouse (in<br />
German). Angewandte Parasitologie, 19, 213–219.<br />
- Richards, O.W. and Davies, R.G. (1973). A general<br />
textbook of Entomology. 9 th edn., Halset Press, a<br />
Division of John Wileyand Sons, Inc. New york.<br />
886pp.<br />
- Senlik, B.; Gulegen, E. and Akyol, V. (2005).<br />
Ectoparasites of domestic pigeons (C. l. domestica)<br />
in Bursa province. Türkiye Parazitoloji Derneği,,<br />
29 (2): 100-102.<br />
- Wall, R. and Shearer, D. (2001). Veterinary Ectoparasites:<br />
Biology, Pathology and Control. 2 nd edn., Oxford.<br />
Blackwell Science. 262pp.<br />
- Zangana, F. M. (1982). Study on the parasites of domestic<br />
pigeon Columba livia domestica in Nineva and<br />
some areas of Erbil and Duhok province. M.Sc.,<br />
Thesis. College of Science, University of Mosul.<br />
61
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 58-62, 2011<br />
62<br />
يَهاً يستؤك زةسةه ) ةدهَهاب ي َيثسةئ(<br />
قاسَيع-<br />
سَيهوةي<br />
يزاشةه<br />
زةهَيتسق ي َيثسةئ يزؤج مَيدنةي<br />
(Columba livia domestica 1789, Gmelin)<br />
وكةو ايةوزةي . تيشائ ياٌَيي وزوتهةك و يَهاً يزةوةنايط وكةو وَيدزاكةب ةو نازؤخ يةواضزةسةه ينتيسب ستؤك<br />
َيثسةئ يناكةزؤج ةه زؤش يكةيةزاًذةب ىاكةي يزةوةهةث ةطَوَيك يزةوةنايط , تَيدزاكةب شاب ييةطيقات يلَيزةوةنايط<br />
و ةرَيِز يندسلناشين تسةد و ىدسليزايد ةه ووب تييسب ةيةوةهيرَيوت مةئ يكةزةس ينجاًائ<br />
. وَيسكةد شسَيي زةهَيتسق ي<br />
يٌَيزةةي-سَيهوةةي<br />
يزاش يناكةي يَهاً ةستؤك ةه مَيدنةي زةسةه زةهَيتسق يَيثسةئ يناكةزؤج ةب ىووب شووت يِسض<br />
يؤةك , 8002 يًةكةي نييسشت<br />
يياتؤكات 8002 يًةكةي نييسشت يطناً ياتةزةس ىاوَين يةواًةه . قاسَيع-ىاتسدزوك<br />
يةهَيواي يناهَييزاكةبةب ىاسهَيلشث ىايناكةِزةث , سَيهوةي يزاش ينازةوةنايط يِزاشابةه ىايرطزةو يَهاً يستؤك<br />
َيؤناةثيئ % 00<br />
ةةك نوةضب يةشوش وانةه ةوةةناسكؤك ىاكةي يكةزةد ةزؤخةشً<br />
00<br />
ةتخوث<br />
تيشط<br />
. يزالَيوت نييبدزوو و ىدسكةزوةط<br />
} ىاسكزاًؤت زةةهَيتسق ي َيثسةئ ةه شاوايج يزؤج َيس . ستايش يندسلناشين تسةد ؤب ىايندسكيرطَيج<br />
تيسةبةًةب ووبادايت<br />
Columbicolo<br />
ةو % 9072<br />
هةس تيةسَيث ةه Menacanthus stramineus , % 22.3<br />
ةةه يةناود ينووةب شوووت يةرَيِز .% 00 تيشط ينووب شووت يةرَيِز ةب ةو { % 3873<br />
ىً وزةسةه<br />
Goniocoites gallinae<br />
موك و َياب يِزةث ةه<br />
ةستؤك ي 38 )% 30(<br />
مَلاةب , 9 )% 33(<br />
ينايس و 0 )% 3073(<br />
يكات ينووب شووت ةب دزوازةبةب 33)%<br />
3073(<br />
(Columba livia domestica 1789,<br />
فيللاا مامحلا ىلع ةدجاوتملا ) رويطلاا لمق(<br />
قارع-ليبرا<br />
ةنيدم يف<br />
Gmelin)<br />
columbae<br />
ووبستشزةب ىاكةستؤك<br />
. ىووبووبةن شووت ىاكةواسهَيلشث<br />
ضراقلا لمقلا عاونا ضعب<br />
ياذناويحلا لذم اذ يا دذعي ي . ملاذتلاي دذيلاقتلاي ياداذعلل دذمروي ةذكيلا ياذناويحو اذ يا لمعتذتيي ااذغلا رداصم دحا وه مامحلا<br />
ةصلاخلا<br />
داذذديا ناذذو ةذذساردلا هاذذهل<br />
يذذتيسرلا ادذذهلا . ضراذذقلا لذذمقلا لذذم رذذيبو ددذذع لذذبق لذذم ةذذنجادلا ياذذناويحلا اجاذذهت , ةدذذيدلا ةذذيربتخملا<br />
. قارذعلا-ناتذسدروو<br />
ايذلقا -لذيبرا<br />
ةذنيدم يذف فذيللاا ماذمحلا ىذلع دذجاوتملا ضراذقلا لذمقلا عاوناذب ةباذصلاا ةدذ ي ةبذتن يخذشتي<br />
ةذنيدم يذف ياذناويحلا لذيب قوذس لذم ةكيلا ةمامح 00 تعمج 8002<br />
ليلاا ليرشت ةياهن ىلا<br />
8002<br />
ليلاا ليرشت ةيادب لم ةرتكلا للاخ<br />
ىذلع ةذيياح ةريغذص يناذنق يذف ةليدعملا ةيجراخلا يايليكطلا تعمج . حيرشتلا رهدمي ةيريبكت ياسدع لامعتسأب شيرلا<br />
: يذذه ضراذذقلا لذذمقلا لذذم ةذذكلتخم عاوذذنا ةذذ لا دوذذجي لدذذس .<br />
ي )% 9072(<br />
ردذصلا دذلج لذم Menacanthus stramineus ي )% 2273(<br />
ةبذتن ي % 00 ناذو ةذيجراخلا ياذيليكطلاب ةباذصلال ةذيلكلا ةبذتنلا . )% 3873(<br />
حف . ليبرا<br />
يخذذشتلا ياوذذطخ لذذم دذذيدم ارذذجاي تذذيبثتلا ضرذذغل لوناذذثيا % 00<br />
ذنعلا ي ا رذلا لذم تذلدع يذتلا<br />
لياذلاي ةذحنجلاا شذير لذم<br />
لذم ) % | 30(<br />
38 ناذو اذمنيب ) % 33(<br />
9 ةذي لاثلا ي )% 3073(<br />
0 ةدرذكملا ياباذصلااب ةذنراقم )% 3073(<br />
33<br />
Goniocoites gallinae<br />
Columbicolo columbae<br />
ىذلعا تناو ةيسانثلا ياباصلاا<br />
.<br />
ليباصم ريغ صوحكملا مامحلا
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 63-70, 2011<br />
INCIDENCE OF BLOOD STREAM INFECTION IN NEONATE CARE UNIT<br />
IN SULAIMANI PEDIATRIC TEACHING HOSPITAL<br />
SAHAND K. ARIF * and GOLZAR F. ABDULRAHMAN **<br />
* Dept. of Biology, College o Science, University of Sulaimani., Kurdistan Region-Iraq<br />
** Technical institute of Sulaiman, Kurdistan Region-Iraq<br />
(Received: June 5, 2010; Accepted for publication: November 28, 2010)<br />
ABSTRACT<br />
OBJECTIVE: To estimate the incidence of nosocomial blood stream infections, identify the common bacteria, their<br />
biotypes and antibiotic sensitivity patterns and to identify the probable exogenous source, from the environment and<br />
personnel, leading to such infections.<br />
METHODOLOGY: Two hundred and two (202) neonates were included in this study which was carried out in the<br />
Neonatal care unit- Sulaimani Pediatric Hospital in Sulaimani-Kurdistan Region - Iraq from July to December 2008<br />
RESULTS: There were 102 female and 100 male, the most common cause of disease were, Jaundice 95 (47%) followed<br />
by cyanosis 32 (15.8%), septicemia 15 (7.4%), diarrhea and vomiting. The mortality rate was increased as the neonate<br />
weight decreased. Environmental samples were collected from floor and walls, beds, sinks, tap water, disinfectants,<br />
ventilator and suction pumps, swab were also taken from hands, nasal cavity and coats of the Nurses. Suction pump<br />
and nurse coats showed the highest rate of bacterial contamination (14 isolates for each). During the study period, 15<br />
patients developed 15 episodes of confirmed nosocomial blood stream infection (NBI), accounting for an incidence<br />
rate of 7.4%, five different bacterial species were identified from blood samples, and all the infections were<br />
monomicrobial. The most common organisms causing nosocomial blood stream infection were E coli (6 isolates), P.<br />
aeroginos, (4 isolates), E. cloacae (2 isolates), S. aureas (2 isolates) and Citrobactr frundii (1 isolate).<br />
CONCLUSION: Understanding these risk factors and adjusting clinical practice to reduce the risk may reduce the<br />
incidence of nosocomial infection and improve outcomes, more continuing medical education programmes are needed<br />
for the health care team to improve their competence.<br />
KEYWORDS: Neonatal care unite, Blood stream infection, Environmental samples<br />
N<br />
INTRODUCTION<br />
eonatal deaths account for over a third<br />
of the global burden of child mortality<br />
(Lawn et al., 2004). Hospital-acquired<br />
bloodstream infection is a serious health<br />
problem in hospitals all over the world and is<br />
associated with high mortality, prolonged<br />
hospital stay, and extra cost (Garrouste-Orgeas,<br />
et al., 2006). Most studies of nosocomial<br />
bloodstream infections (NBI) in pediatric<br />
intensive care unit (PICU) were carried out in<br />
the developed countries. In Iraq and especially in<br />
Kurdistan region, the true magnitude of the<br />
problem is not known (Al-Zwaini, 2002, and<br />
Efird, et al., 2005), so the present study<br />
conducted to estimate the incidence of blood<br />
stream nosocomial infections in the neonatal<br />
care unite of Pediatric Hospital in Sulaimani<br />
city, identify the common bacteria, their<br />
biotypes and antibiotic sensitivity patterns and<br />
identify the probable exogenous source, from the<br />
environment and personnel, leading to such<br />
infections.<br />
MATERIAL AND METHODS<br />
1-Studied population:<br />
Two hundred and two neonates attended to<br />
Neonatal care unit- Sulaimani Pediatric Hospital<br />
in Sulaimani-Kurdistan Region – Iraq from<br />
March to December 2008 and who remained at<br />
least 48 hours were followed up and evaluated.<br />
Clinical data for each neonate was collected and<br />
included the following information: Neonate<br />
name, date of admission, type of delivery,<br />
gestational age, gender, body weight, clinical<br />
diagnosis on admission and length of<br />
hospitalization.<br />
2-Definitions<br />
Bloodstream infections were regarded as<br />
nosocomial if they occurred more than 48 hours<br />
after admission to the hospital. Criteria of the<br />
Centers for Disease Control and Prevention were<br />
used as standard definition for NBI (Garner, et<br />
al., 1988). The cases of clinical sepsis without<br />
laboratory-confirmed bloodstream infection<br />
were excluded.<br />
3-Blood samples:<br />
Blood samples were collected with all aseptic<br />
precautions for blood culture and sensitivity<br />
studies, inoculated into bottles containing<br />
63
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 63-70, 2011<br />
Trypticase Soya Broth for isolation of bacteria.<br />
The blood culture bottles were incubated at 37ºC<br />
and sub cultured on solid media (blood agar,<br />
MacConckey agar and Chocolate agar) after<br />
24hr to 48hr and at 7 days. Isolates were<br />
identified by Gram stain and conventional<br />
biochemical methods.<br />
4-Environmental sample<br />
Environmental sampling was obtained on a<br />
weekly basis from floor walls, sinks, tap water,<br />
disinfectants, ventilator and suction pump, swabs<br />
were also taken from hands, nasal cavities and<br />
coats of the nurses of each room in neonatal care<br />
unite. The colleted swabs then were cultured on<br />
blood agar and MacConkey agar, plates then<br />
were incubated aerobically overnight at 37ºC, if<br />
no growth was detected, plates then were reincubated<br />
for another 24 hours before reported<br />
as negative cultures.<br />
5-Identification of microorganisms<br />
Methods used for identification of Gram<br />
positive bacteria are Gram-stain, catalase,<br />
coagulase, DNase, bile esculin hydrolysis,<br />
growth on NaCl, susceptibility to optochin,<br />
colonial morphology and haemolysis. Methods<br />
used for identification of Gram-negative rods are<br />
64<br />
Male<br />
(100)<br />
Female<br />
(102)<br />
Total<br />
(202)<br />
No.<br />
30<br />
25<br />
20<br />
15<br />
10<br />
5<br />
0<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 63-70, 2011<br />
2-Types of the Disease<br />
As illustrated in figure (2), the most common<br />
cause of disease was, Jaundice 95 (47%)<br />
followed by cyanosis 32 (15.8%), septicemia 15<br />
(7.4%), diarrhea and vomiting 11 (5.4%) and<br />
bad feeding 7 (3.4%). The mortality rate in male<br />
with jaundice was (3/48, 6.2%), while in female<br />
% of Patient<br />
100<br />
80<br />
60<br />
40<br />
20<br />
0<br />
45<br />
3<br />
6.2<br />
Fig. (2). Types of the diseases<br />
7<br />
5<br />
41.6<br />
1<br />
was (3/47, 6.3%). The mortality rate in cyanotic<br />
male (5/12, 41.6%) was higher than female<br />
(3/20, 15%), one of the 4 female neonates with<br />
septicemia died while the 2 male patient whom<br />
suffered from septicemia died during the study<br />
(figure 3 and figure 4).<br />
50<br />
9<br />
4<br />
0 0<br />
2 2<br />
Jaundice Cynosis Bad feeding D and V Septicemia<br />
Live Dead % of Dead<br />
Fig. (3):- Correlation between diseases and the mortality rate in male neonates.<br />
22<br />
65
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 63-70, 2011<br />
66<br />
% of patients<br />
100<br />
80<br />
60<br />
40<br />
20<br />
0<br />
44<br />
33<br />
25<br />
17 15<br />
3<br />
6.3<br />
3<br />
6<br />
0 0<br />
4 1 3 1<br />
Jaundice Cynosis Bad feeding D and V Septicemia<br />
Live Dead % of Dead<br />
Fig. (4):- Correlation between diseases and the mortality rate in female neonates.<br />
3-Correlation between neonatal weight and<br />
mortality rate.<br />
Seventy seven (40 male and 37 female) of the<br />
patients were more than 3000 gm while only 2 (1<br />
male and 1 female) were less than 1000gm. The<br />
mortality rate was increased as the neonate<br />
weight decreased, 50% of the neonates weighted<br />
70<br />
60<br />
50<br />
40<br />
30<br />
20<br />
10<br />
0<br />
1 1 1 1<br />
50%<br />
9 8<br />
4 5<br />
38%<br />
15<br />
1110<br />
6<br />
28%<br />
less than 1000gm died while 38% of the<br />
neonates weighted 1000-1500 gm died, this rate<br />
further decreased when the weight was between<br />
2001-2500 gm, while the minimum rate of death<br />
was recorded among neonate weighted more<br />
than 2000 gm (figure 5).<br />
16 16<br />
30<br />
6%<br />
2<br />
30<br />
27<br />
49<br />
40<br />
37<br />
66<br />
14% 14%<br />
11<br />
8<br />
3001<br />
Male Female Live Dead % of death<br />
Fig. (5):- Correlation between neonatal weight and mortality rate.<br />
4-Environmental isolates as a probable<br />
exogenous source of nosocomial infection:<br />
Seven different bacterial species were<br />
isolated from different sites inside the neonatal<br />
care unit rooms, which were, E coli (18 isolates),<br />
P. aeroginosa (13 isolates), S. aureas (11<br />
isolates), S. epidermidis (10 isolates), Proteus<br />
mirabilus (7 isolates), E. cloacae (2 isolates)<br />
and Citrobactr frundii (1 isolate). The Suction<br />
pump and Nurse coats showed the highest rate of<br />
bacterial contamination (14 isolates for each),<br />
followed by Sinks (13) Surfaces (9) Beds (5),<br />
Ventilation (4) and Soaps and Antiseptics (2<br />
isolates for each) (figure 6). Infection room<br />
showed the higher rate of contamination (32<br />
isolates), all above bacterial species were<br />
detected except Citrobacter frundii, 14 bacterial<br />
isolates were isolated from Premature room<br />
included all species except Citrobacter frundii<br />
and E. cloacae, while in isolation room only 10<br />
isolates were recorded but Citrobacter frundii<br />
and E coli were not isolated (figure 7)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 63-70, 2011<br />
No. of Isolates<br />
No. of Isolates<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
10<br />
Suction P<br />
6<br />
5<br />
4<br />
4 4<br />
2<br />
2 2 2<br />
1 1 1 1 1 1111 1 1 1 1 1<br />
Sink<br />
Surface<br />
Antiseptic<br />
Bed<br />
Ventelation<br />
P aerogenosa S aureus E coli S epidermitis E cloaca P mirabilis C frundii<br />
Fig. (6):- Microorganisms isolated according to the site of isolation.<br />
16<br />
14<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
14<br />
6<br />
4 4 4 4<br />
2 2<br />
3<br />
2<br />
3<br />
2 2<br />
3<br />
1<br />
0 0 0 0 0 0<br />
Coat<br />
8<br />
Soap<br />
2<br />
1 1 1 1 1<br />
0<br />
Infecntion Premature Isolation Others<br />
P. aeroginosa S. aureas E coli S.epidermidis E. cloacae Proteus Citrobactr frundii<br />
Fig. (7):- Microorganisms isolated from different neonatal care unit rooms.<br />
5-Clinical isolates (Characteristics of<br />
nosocomial bloodstream)<br />
During the study period, 15 patients<br />
developed 15 episodes of confirmed Nosocomial<br />
blood stream infection (NBI), accounting for an<br />
incidence rate of 7.4%. Three episodes of<br />
clinical sepsis without laboratory-confirmed<br />
bloodstream infection occurred during the same<br />
period and were excluded from the analysis.<br />
Five different bacterial species were identified<br />
from blood samples, all the infections were<br />
monomicrobial. The most common organisms<br />
causing nosocomial blood stream infection were<br />
E coli (6 isolates), P. aeroginosa, (4 isolates), E.<br />
cloacae (2 isolates), S. aureas (2 isolates) and<br />
Citrobactr frundii (1 isolate) (Figure 8).<br />
67
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 63-70, 2011<br />
68<br />
No. of isolates<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
0<br />
26.6%<br />
40%<br />
13.3<br />
6.6%<br />
13.3<br />
P. aeroginos E coli S. aureas Citrobactr frundii E. cloacae<br />
Type of Bacteria<br />
Fig. (8):- Types of microorganisms isolated from blood samples.<br />
6-Comparison between clinical and<br />
environmental samples.<br />
When the environmental bacterial isolate<br />
compared to those isolated from blood samples<br />
in the same period of time and in the same place,<br />
we observed that certain environmental bacterial<br />
isolates were identical to that isolated from<br />
blood (table 2) samples as confirmed by<br />
antibiotic resistance profile (table 3) and<br />
biochemical assays (API 20 system),<br />
Enterobacter cloacae and Citrobacter frundii<br />
isolated from the surface in infectious room in<br />
two different cases were identical to those<br />
isolated from blood at first and second week of<br />
August respectively. At the fourth week in<br />
August Enterobacter cloacae was isolated from<br />
the suction pump sample in phototherapy room,<br />
which was also identical to that isolated from the<br />
blood sample.<br />
Table (2):- Comparison between clinical and environmental samples.<br />
Clinical sample Environmental sample Pathogen<br />
Blood (1st Week, Aug.) Surface (1st Week, Aug.) Enterobacter cloacae<br />
Blood (2nd Week, Aug.) Surface (2nd Week, Aug.) Citrobacter frundii<br />
Blood (4th Week, Aug.) Sanction P (4th Week, Aug.) Enterobacter cloacae<br />
Table (3):- Antibiotic pattern of clinical isolates.<br />
No. Samples CIP(5) N.A(30) DA(2)Mcg S(10) C(30) AM(10) AMC(10) TMP(5) P<br />
1A Blood (247) S S R S S R R S R<br />
1B Suction Pump (24) S S R S S R R S R<br />
2A Blood (509) S S R S S R R R R<br />
2B Surface 12(b) S S R S S R R R R<br />
3A Blood (667) S S R S S R R R R<br />
3B Surface (19-5) S S R S S R R R R<br />
S=Streptomycin, NA=Nalidixic Acid, AM=Ampicilin, C=Chlramphenicol , TMP=Trimephoprim,<br />
CIP=Ciprfloxacin , P=pinicilin, DA=Clindomycin AMC=Amoxiccillin (Clavulanic Acid).<br />
DISCUSSION<br />
Unfortunately, hospitals in developing<br />
countries are at high risk of infection<br />
transmission, and improvements in neonatal<br />
outcomes are subverted by hospital-acquired<br />
infections and their associated morbidity,<br />
mortality and cost (Nejjari, et al., 2003 and Raza<br />
et al., 2004). These infections can be attributed<br />
to lack of knowledge and training about basic<br />
infection control processes, coupled with<br />
inadequate infrastructure, systems of care and
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 63-70, 2011<br />
resources. This has serious consequences when<br />
devices such as intravenous catheters and<br />
ventilators are introduced without sufficient<br />
attention to the substantial risk of infection they<br />
entail (Martinez-Aguilar et al., 2001 and<br />
Silva et al., 2000).<br />
In the present study the majority, 77 out of<br />
202, of the neonate were more than 3000 gm<br />
while only 2 out of 202 of the neonates were less<br />
than 1000 gm. Cimiotti et al, (2008) also<br />
reported that the majority of the neonate (45.8%)<br />
were more than 2500 gm while 11.6% were less<br />
than 1000 gm. Numerous studies have indicated<br />
that neonate weight less than 1000 gm was a risk<br />
factor for nosocomial blood stream infection<br />
(Sohn, et al., 2001, Harihara, et al., 2001 and<br />
Babazone, et al., 2008), while in our study non<br />
of the patients with nosocomial blood stream<br />
infection had weight below 1000 gm, this<br />
difference may be due to that only 0.99 % of<br />
patients were belong to this weight group.<br />
The incidence rate of blood stream infection<br />
In the present study was 7.4%, a study<br />
conducted in Saudi Arabia recorded incidence<br />
rate of 19.2% nosocomial infection (NI) in<br />
neonatal intensive care unit and only 40.9% of<br />
those infections were blood stream infection<br />
(Mahfouz, et al., 2010).<br />
Previous studies have documented widely<br />
varying infection rates between individual<br />
institutions. In developing countries,<br />
investigators in Brazil and Indonesia have<br />
reported rates of hospital-acquired infections to<br />
be as high as 51%–52% among all neonatal<br />
intensive care unit (NICU) admissions (Nagata,<br />
et al., 2002 and Zaidi, et al., 2005). A<br />
prospective multicentre study conducted by the<br />
European Study Group found an infection rate of<br />
7% in 7 NICUs (Raymond and Aujard, 2000).<br />
The USA national point prevalence survey, a<br />
collaborative study in 29 hospitals representing<br />
19 states, found a NICU infection rate of 11.4%<br />
(Sohn et al., 2001). In Spain a study found an<br />
incidence rate of 1.6 NIs per 100 patients-day<br />
observation in the NICU (Urrea, 2003).<br />
Although the Centers for Disease Control<br />
and Prevention definitions are usually used in<br />
these studies, it may be difficult to make direct<br />
comparisons with these data because of<br />
inconsistencies in surveillance or study methods,<br />
such as intensity of surveillance, prospective<br />
versus retrospective data collection, infection<br />
detection methods and the populations included<br />
(Mahfouz, et al., 2010).<br />
The most common organisms causing blood<br />
stream infection in this study were E coli, P.<br />
aeroginosa, E. cloacae, S. aureas and Citrobactr<br />
frundii, In most of the developing countries<br />
gram negative organisms are still the main cause<br />
of sepsis especially early onset neonatal sepsis<br />
(Anwer et al., 2000, Joshil et al., 2000,<br />
Aurangzeb B and Hameed, 2003, Cordero, et<br />
al., 2004, Anita, et al., 2005, Larson, et al.,<br />
2005 and Jaballah, et al., 2007). In the present<br />
work, culture studies revealed growth in 62<br />
samples indicating considerable contamination<br />
of different areas of the units and sources of<br />
infection. Our results were in agreement with<br />
those reported by (Chandrashekar, et al., 1997<br />
and Newman, 2002) in which gram negative<br />
bacteria was predominant in environmental<br />
samples. In contrast to our study Deep et al.,<br />
(2004) found that gram positive bacteria<br />
(coagulase negative staphylococci and S aureus)<br />
were the most common organisms isolated from<br />
the environment as an exogenous source of<br />
nosocomial infection, this may be due to that<br />
they observed an outbreak of multi-drug<br />
resistant gram positive in their hospital. The<br />
Suction pump and Nurse coats showed the<br />
highest rate of bacterial contamination in our<br />
study. Numerous NICU outbreaks of infection<br />
have been reported. The vast majority of<br />
clustered cases for any pathogen have been<br />
found to be genetically similar strains with<br />
transmission due to cross contamination from a<br />
small number of health care workers. Reservoirs<br />
for transmission are numerous: laundry, soap<br />
bottlesand sinks, hand lotion, pet dog, bed toys,<br />
blood gas analyzer, ventilator circuits, multiuse<br />
vials, sibling-to mother- to-patient, water tap,<br />
hands, suction equipment, air conditioner,<br />
wooden tongue depressors, water bath for blood<br />
products, expressed mother’s milk, powdered<br />
milk, latex gloves, resuscitator and saline for<br />
heparin dilution. About 85% of all NICU<br />
surfaces will grow nosocomial pathogens<br />
(Spainhour, 1998, Harbarth et al., 1999 and<br />
Reese et al., 2004).<br />
In conclusion, the results of this study will<br />
assist in developing intervention strategies for<br />
the prevention of NIs in NICUs in the region.<br />
More continuing medical education programmes<br />
are needed for the health care team to improve<br />
their competence. Understanding these risk<br />
factors and adjusting clinical practice to reduce<br />
the risk may reduce the incidence of nosocomial<br />
infection and improve outcomes.<br />
69
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 63-70, 2011<br />
REFERENCES<br />
- Al-Zwaini, E.J. (2002). Neonatal septicaemia in the<br />
neonatal care unit. Al-Anbar governorate, Iraq. East<br />
Mediterr Health J.8:509-14.<br />
- Anwer S.K., Mustafa S., Pariyani S., Ashraf S., Taufiq<br />
K.M. (2000). Neonatal sepsis an etiological study. J<br />
Pak Med Assoc. 50:91-4<br />
- Aurangzeb B. and Hameed A. (2003). Neonatal sepsis in<br />
hospital-born babies: bacterial isolates and<br />
antibiotic susceptibility patterns. J Coll Physicians<br />
Surg Pak.13(11):629-32<br />
- Babazone, A., Kitajima, H., Nishimakos, S., Nakamura<br />
,T., Shiga, S., Hayakawa, N., Tanaka ,T., Stato, K.,<br />
Nakagama ,H., Ibra, S., Une, H. and Doi, H. (2008).<br />
Risk Factors for Nosocomial Infection in the<br />
Neonatal Inteensve care unit by the Japanese<br />
Nosocomial Infection Surveillance .Acta Medica<br />
Okayama. 62 (4)261-268<br />
- Chandrashekar, M.R., Rathish, K.C. and Nagesha,<br />
C.N.(1997). Reservoirs of nosocomial pathogens in<br />
neonatal intensive care unit. J Indian Med Assoc.;<br />
95(3):72-4, 77<br />
- Cordero, L., Rau, R., Taylor, D., Ayers, L.W. (2004).<br />
Enteric gram-negative bacilli bloodstream<br />
infections: 17 years' experience in a neonatal<br />
intensive care unit. Am J Infect Control. 32(4):189-<br />
95<br />
- Deep, A., Ghildiyal, R., Kandian, S. and Shinkre, N.<br />
(2004). Clinical and Microbiological profile of<br />
nosocomial infection in the pediatric intensive care<br />
unit (PICU) .Indian Pediatrics. 41:1238-1246.<br />
- Efird, M.M., Rojas, M.A., Lozano, J.M., Bose, C.L.,<br />
Rojas, M.X. and Rondon, M.A. (2005).<br />
Epidemiology of nosocomial infections in selected<br />
neonatal intensive care units in Colombia, South<br />
America. J Perinatol. 25:531-6.<br />
- Forbes, B.A. Bailey & Scott’s diagnostic microbiology,<br />
10th ed. St. Louis, Missouri, Mosby, 1998:283–304<br />
- Garner, J.S., Jarvis, W.R., Emori, T.G., Horan, T.C. and<br />
Hughes, J.M.(1988). C.D.C. definitions for<br />
nosocomial infections. Am J Infect Control. 16:128-<br />
40.<br />
- Garrouste-Orgeas, M., Timsit, J.F., Taffet, M., Misset, B.<br />
and Zahar, J.R., Soufir, L. (2006). Excess risk of<br />
death from intensive care unit-acquired nosocomial<br />
bloodstream infections: a reappraisal. Clin Infect<br />
Dis.42:1118-26.<br />
- Harbarth, S., Sudre, P., Dharan, S., Cadenas, M., Pittet,<br />
D. (1999). Outbreak of Enterobacter cloacae<br />
related to understaffing, overcrowding, and poor<br />
hygiene practices. Infect Control Hosp Epidemiol ;<br />
20:598–60<br />
- Haribara, Y.and Konishi, T.(2002). The significance of<br />
establishment of NNIS and JNIS, including the<br />
nosocomial infection surveillance. Nippon Rinsho.<br />
60:2079-2083.<br />
- Jaballah, N.B., Bouziri, A., Mnif, K., Hamdi, K.,<br />
Khaldi, A, Kchaou, W. (2007). Epidemiology of<br />
hospital-acquired bloodstream infections in a<br />
Tunisian pediatric intensive care unit: A 2-year<br />
prospective study 35: (9), 613-618<br />
- Joshil, S.J., Golem, V.S., Niphadkar, K.B. (2000).<br />
Neonatal gram negative bacteremia. India J Pediatr.<br />
67:27-32<br />
- Larson, E.L., Cimiotti, J.P. and Haas, J. (2005). Gramnegative<br />
bacilli associated with catheter-associated<br />
and non-catheter-associated bloodstream infections<br />
and hand carriage by healthcare associated<br />
bloodstream infections and hand carriage by<br />
70<br />
healthcare<br />
workers in neonatal intensive care units. Pediatr<br />
Crit Care Med. 6:457-46.<br />
- Lawn, J.E., Cousens, S., Bhutta, Z.A. (2004). Why are 4<br />
million newborn babies dying each year? Lancet;<br />
364: 399-401<br />
- Mahfouz, A.A., Al-Azraqi, T.A., Abbag, F.I., Al-Gamal,<br />
M.N., Seef, S., Bello, C.S. (2010). Nosocomial<br />
infections in a neonatal intensive care unit in southwestern<br />
Saudi Arabia. EMHJ; 16 (1) :40-44<br />
- Martinez-Aguilar, G., Alpuche-Aranda, C.M., Anaya, C.,<br />
Alcantar-Curiel, D., Gayosso, C., Daza, C., Mijares,<br />
C., Tinoco, J.C., Santos, J.I. (2001). Outbreak of<br />
nosocomial sepsis and pneumonia in a newborn<br />
intensive care unit by multiresistant extendedspectrum<br />
beta-lactamase-producing Klebsiella<br />
pneumoniae: high impact on mortality. Infection<br />
control and hospital epidemiolog. 22:725–8.<br />
- Nagata, E., Brito, A.S. and Matsuo, T. (2002).<br />
Nosocomial infections in a neonatal intensive care<br />
unit: Incidence and risk factors. Am J Infect<br />
Control. 30:26–31.<br />
- Newman, M.J. (2002). Neonatal intensive care unit:<br />
reservoirs of nosocomial pathogens. West Afr J<br />
Med. 21(4):310-2<br />
- Nejjari, N. (2003). Infections nosocomiales a<br />
Acinetobacter experience du service de<br />
neonatologie de Casablanca. [Nosocomial<br />
infections caused by Acinetobacter: experience in a<br />
neonatal care unit in Casablanca.] La Tunisie<br />
médicale, 81:121–5.<br />
- National Committee for Clinical Laboratory Standards<br />
2000. Methods for Dilution Antimicrobial<br />
Susceptibility Test for Bacteria That Grow<br />
Aerobically. 5th ed. Wayne, PA: National<br />
Committee for Clinical Laboratory Standards; 2000.<br />
- Raymond, J., Aujard, Y.(2000). Nosocomial infections in<br />
pediatric patients: a European, multicenter<br />
prospective study. European Study Group. Infection<br />
control and hospital epidemiology. 21:2260–3.<br />
- Raza, M.W., Kazi, B.M., Mustafa, M., Gould, F.K.<br />
(2004). Developing countries have their own<br />
characteristic problem with infection control. J<br />
Hosp Infect. 57:294-299<br />
- Reese, C., Powers, R., White, R., Bloom, B., Sanchez, P.<br />
and Daniel K. (2004). Nosocomial Infection in the<br />
NICU: A Medical Complication or Unavoidable<br />
Problem? Journal of Perinatology; 24:382–388.<br />
- Silva J, Aguilar C, Ayala G, Estrada MA, Garze-Ramos<br />
U, Lara-Lemus R.(2000). TLA-1: a new plasmidmediated<br />
extended-spectrum B-lactamase from<br />
Escherichia coli. Antimicrob Agents Chemother.<br />
44:997-1003.<br />
- Sohn, A.H., Garrett, D.O. and Sinkowitz-Cochran, R.L.<br />
(2001). Prevalence of nosocomial infections in<br />
neonatal intensive care unit patients: results from<br />
the first national point-prevalence survey<br />
J Pediatr. 139:821–827<br />
- Spainhour, S. (1998). Serratia marcescens outbreak<br />
associated with extrinsic contamination of 1%<br />
chloroxylenol soap. Infect Control Hosp Epidemiol.<br />
19:476.<br />
- Urrea, M. (2003). A prospective incidence study of<br />
nosocomial infections in a neonatal care unit.<br />
American journal of infection. 31(88):5505–7.<br />
- Zaidi, A., Huskins, W., Thaver, D., Bhutta, Z., Abbas,<br />
Z. Goldmann, D.(2005). Hospital-acquired<br />
neonatal infections in developing countries. Lancet.<br />
365:1175–88.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 71-77, 2011<br />
BIOACCUMULATION OF SOME HEAVY METALS IN THE TISSUES OF<br />
TWO FISH SPECIES (Barbus luteus AND Cyprinion macrostomum) IN<br />
GREATER ZAB RIVER- IRAQ<br />
NASHMEEL SA’ID KHDHIR * , LANA S. AL-ALEM ** and SHAMALL M.A. ABDULLAH ***<br />
* Dept. of Environmental Science, College of Science, University of Salahaddin, Kurdistan Region-Iraq<br />
** Dept. of Biology, College of Science, University of Salahaddin, Kurdistan Region-Iraq<br />
*** Dept. of Biology, College of Education-Scientific dept, University of Salahaddin, Kurdistan Region-Iraq<br />
(Received: June 9, 2010; Accepted for publication: April 10,2011)<br />
ABSTRACT<br />
Concentrations of the heavy metals copper (Cu), cadmium (Cd), lead (Pb) and zinc (Zn) were determined in water<br />
and six organs (testis, ovary, kidney, liver, gills and muscle) of Barbus luteus and Cyprinion macrostomum in the<br />
Greater Zab River during spring 2009. Generally, B. luteus showed no significant accumulation for the studied<br />
metals. The sex organs (testes and ovaries) of C. macrostomum exhibited a tendency toward Cd and Pb accumulation;<br />
furthermore, Cu was significantly (P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 71-77, 2011<br />
were placed in screw-capped bottles and boiled<br />
till complete dryness. Then concentrated nitric<br />
acid was added to the samples and boiled close<br />
to dryness, then diluted with distilled deionized<br />
water. The solution was filtered and stored in<br />
refrigerator till analysis (APHA, 1998).<br />
From each species, fifteen individuals fish<br />
were obtained and stored in pre-washed<br />
polyethylene containers in ice and brought to the<br />
laboratory on the same day of capture. In the<br />
laboratory, the fish sample for each organ<br />
(testes, ovary, kidney, liver, gills and muscle)<br />
from each species was dissected, using clean<br />
equipments and put separately in prewashed<br />
labeled petri dishes and transferred into oven to<br />
dry at 105 ° C for 24 hours. The dried tissues were<br />
placed in Muffle Furnace at 550 ° C for 5 hours.<br />
The dry-ashed samples were cooled at room<br />
temperature then digested in 2N HCl and the<br />
volume completed to 50 ml with distilled deionized<br />
water. The solutions were filtered<br />
(Dalaly and Al-Hakim, 1987). The resulting<br />
solutions of digested water and fish organ were<br />
analyzed by Flame Atomic Absorption<br />
Spectrophotometer (PYE UNICAm SP9-Philips)<br />
for detection of Cu, Cd, Pb and Zn<br />
concentrations according to APHA (1998). All<br />
plastics and glassware used in manipulation of<br />
samples were completely acid-washed and<br />
reagents of analytical grade were utilized for the<br />
17<br />
blanks and calibration curves (Bartram and<br />
Balance, 1996).<br />
All metal concentrations were expressed in<br />
terms of micrograms per gram of dry weight (µg.<br />
gm -1 dry wt.). One way analysis of variance<br />
ANOVA and Duncan’s multiple range test were<br />
used by applying SPSS program version 11.5 to<br />
find out statistical differences among various<br />
parameters according to the recommendations of<br />
Townend (2002).<br />
RESULTS<br />
The concentrations of cupper, cadmium, lead<br />
and zinc in the water of Greater Zab River and<br />
different organs of B. luteus and C.<br />
macrostomum are shown in Table (1) and<br />
Figures (1-4). For B. luteus, the maximum Cu<br />
value of 0.838 µg. gm -1 dry wt. was recorded in<br />
the testis, while the minimum value was 0.400<br />
µg. gm -1 dry wt. in the ovaries. Highest Pb value<br />
was 0.922 and the lowest was 0.409 µg. gm -1 dry<br />
wt. in testes and muscles respectively. On the<br />
other hand, the range of Cd was between 0.938 -<br />
1.537 µg. gm -1 dry wt. in ovary and gills<br />
respectively. Furthermore, the minimum value of<br />
Zn was 0.130 µg. gm -1 dry wt. in both muscles<br />
and ovaries, while the maximum level was<br />
evaluated to 0.260 µg. gm -1 dry wt. in the testes.<br />
Table (1):- Mean values (µg. gm -1 dry weight ± SE) of heavy metals Cu, Cd, Pb and Zn in Greater Zab River<br />
water and various organs of Barbus luteus and Cyprinion macrostomum.<br />
Parameters Copper Cadmium Lead Zinc<br />
Water 0.611±0.058 a 1.221±0.040 a 0.653±0.046 a 0.233±0.026 de<br />
Barbus luteus Testis 0.647±0.100 a 1.244±0.100 a 0.717±0.117 a 0.260±0.000 e<br />
Ovary 0.568±0.089 a 1.181±0.120 a 0.716±0.086 a 0.132±0.001 a<br />
Kidney 0.607±0.057 a 1.258±0.116 a 0.711±0.115 a 0.180±0.000 ab<br />
Liver 0.641±0.057 a 1.249±0.116 a 0.629±0.089 a 0.208±0.002 cd<br />
Gills 0.599±0.057 a 1.238±0.173 a 0.669±0.085 a 0.168±0.002 b<br />
Muscles 0.601±0.115 a 1.245±0.116 a 0.662±0.139 a 0.130±0.000 a<br />
Cyprinion<br />
macrostomum<br />
Testis 0.607±0.002 a 1.275±0.001 b 0.710±0.000 ab 0.125±0.000 ab<br />
Ovary 0.609±0.001 a 1.260±0.000 ab 0.728±0.000 b 0.150±0.012 bc<br />
Kidney 0.601±0.001 a 1.279±0.000 b 0.685±0.000 ab 0.151±0.000 bc<br />
Liver 0.749±0.001 b 1.263±0.000 ab 0.699±0.000 ab 0.160±0.006 bc<br />
Gills 0.622±0.005 a 1.240±0.000 ab 0.675±0.000 ab 0.180±0.012 c<br />
Muscles 0.601±0.000 a 1.257±0.000 ab 0.699±0.000 ab 0.090±0.006 a<br />
Mean values with different letters in each column indicate significant differences (P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 71-77, 2011<br />
Fig. (1):- Mean values (µg. gm -1 dry weight) of Cu in various organs<br />
of Barbus luteus and Cyprinion macrostomum.<br />
Fig. (2):- Mean values (µg. gm -1 dry weight) of Pb in various organs of<br />
Barbus luteus and Cyprinion macrostomum.<br />
17
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 71-77, 2011<br />
17<br />
Fig. (3):- Mean values (µg. gm -1 dry weight) of Cd in various organs of<br />
Barbus luteus and Cyprinion macrostomum.<br />
Fig. (4):- Mean values (µg. gm -1 dry weight) of Zn in various organs of<br />
Barbus luteus and Cyprinion macrostomum.<br />
Statistical analysis results showed that there<br />
were no significant accumulations of the metals<br />
Cu, Cd, Pb and Zn in the tissues of B. luteus<br />
comparing to their concentrations in the water of<br />
Greater Zab River during the period of this<br />
investigation. Moreover, significant differences<br />
(P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 71-77, 2011<br />
of C. macrostomum in the present study was in<br />
the decreasing order of gills ≥ liver ≥ kidney ≥<br />
ovary ≥ testis ≥ muscle. In other words, gills<br />
seemed to be the organ which has the highest<br />
value of Zn followed by liver and kidney. On the<br />
other hand, muscles appeared to be the organ<br />
that has minimum Zn concentration<br />
(0.090±0.006 µg. gm -1 dry wt.) and showed no<br />
significant (P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 71-77, 2011<br />
REFERENCES<br />
� Ahmed, A.M. and Hussein, M.M. (2004). Residual levels<br />
of some heavy metals in fish flesh and water from<br />
El-Manzala Lake, Egypt. J. King Saud Univ. 16(2):<br />
187-196.<br />
� APHA. Standard Methods for the Examination of Water<br />
and Wastewater (1998). Twentieth edition.<br />
American Public Health Association, American<br />
Water work Association (AWWA) and Water<br />
Pollution Control Federation (WPCF). Washington.<br />
� Ayas, Z.; Ekmekci. G.; Yerli, S. and Ozmen, M. (2007).<br />
Heavy metal accumulation in water, sediments and<br />
fishes of Nallihan Bird Paradise, Turkey. J. Environ<br />
Biol. (Online). 28(3):545-549.<br />
� Ayres, R.U. and Ayres, L.W. (2002). A Handbook of<br />
Industrial Ecology. Edward Elgar Publishing Ltd,<br />
UK. 680pp.<br />
� Bartram, J. and Balance, R. (1996). Water Quality<br />
Monitoring (a practical guide to the design and<br />
implementation of freshwater quality studies and<br />
monitoring programmes). United Nations<br />
Environmental Programme-UNEP- and WHO. E &<br />
FN Spon, an imprint of Chapman & Hall. London,<br />
U.K. 383pp.<br />
� Dalaly, B.K. and Al-Hakim, S.H. (1987). Food Analysis.<br />
The book house for press and publication. Univ.<br />
Mosul. Iraq.<br />
� Gad, S.C. (2007). Animal Models in Toxicology. Second<br />
edition. Taylor & Francis Group, CRC Press. New<br />
York. 933pp.<br />
� Hodgson, E. (2004). A Textbook of Modern Toxicology.<br />
Third edition. John Wiley & Sons, Inc. Canada.<br />
557pp.<br />
� Kalay, M.; Ay, Ö. and Canli, M. (1999). Heavy metal<br />
concentrations in fish tissues from the northeast<br />
Mediterranean sea. Bull. Environ. Contam. Toxicol.<br />
(Online). 63(5): 673-681.<br />
� Khopkar, S. M. (2004). Environmental Pollution<br />
"monitoring and control". New International (P)<br />
Ltd. New Delhi, India. 484pp.<br />
� Narayanan, M. and Vinodhini, R. (2008).<br />
Bioaccumulation of heavy metals in organs of fresh<br />
17<br />
water fish Cyprinus carpio (Common carp). Int. J.<br />
Environ. Sci. Tech. 5(2): 179-182.<br />
� Pandey, K; Shukla, J.P. and Trivedi, S.P. (2005).<br />
Fundamentals of Toxicology. New Central Book<br />
Agency (P) Ltd. India. 356pp.<br />
� Rauf, A.; Javed, M. and Ubaidullah, M. (2008). Heavy<br />
metal levels in three major carps (Catla Catla,<br />
Labeo Rohita and Cirrhina Mrigala) from the River<br />
Ravi, Pakistan. Pakistan J. Vet. 29(1): 1-3.<br />
� Saravanan, K.; Ramachandran, S. and Baskar, R. (2005).<br />
Principles of Environmental Science and<br />
Technology. First edition. New Age International<br />
(P) Limited, Publisher. 193 pp.<br />
� Shekha, Y.A. (2008). The effect of Erbil city wastewater<br />
discharge on water quality of Greater Zab River,<br />
and the risks of irrigation. Ph.D. Thesis, Univ. of<br />
Baghdad, Iraq.<br />
� Singh, J.; Kant, K.; Sharma, H. and Rana, K. (2008).<br />
Bioaccumulation of cadmium in tissues of Cirrihna<br />
mrigala and Catla catla. J. Asian Exp. Sci. 22(3):<br />
411-414.<br />
� Timbrell, J. (2000). Principles of Biochemical<br />
Toxicology. Third edition. Taylor & Francis Ltd.<br />
London. 394pp.<br />
� Townend, J. (2002). Practical Statistics for<br />
Environmental and Biological Science. John Wiley<br />
& Sons, Ltd. England. 276pp.<br />
� Viessman, W. and Hammer, M.J. (2005). Water Supply<br />
and Pollution Control. 7th edition. Pearson<br />
Education, Inc. USA. 867 pp.<br />
� WHO-IPCS-Environmental Health Criteria Report, with<br />
ILO and UNEP, International Program of Chemical<br />
Safety (1987). Geneva, Switzerland.<br />
� Williams, P.L; James, R.C and Roberts, S.M. (2000).<br />
Principles of Toxicology: Environmental and<br />
Industrial Applications. Second edition. John Wiley<br />
& Sons, Inc. 603pp.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 71-77, 2011<br />
ةروةط مةد نييةنوبو Barbus luteus يزمةح(<br />
نوط(<br />
مةد نييةنوبو<br />
يسام ةرؤج وود ىناكةناش ةل سروق ىلَيخموت دنةض ىةوةنووبؤكةدهيس<br />
قايرع - ةروةط يباس يرابور يوائ ةل ) Cyprinion macrostomum<br />
ىمادنةئ طةشو ةروةط يباس يرابوِر<br />
Barbus luteus<br />
ىزمةح يسام وود ةل<br />
يياتاو يلَينووب ةكةَلةك ضيه ىزمةح يسام<br />
ةروةط مةد نييةنوب يسام ي)<br />
نادةللَيهو نوط(<br />
(P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
78<br />
ECCENTRICITY OF THE HORIZONTAL AXIAL RESTRAINT<br />
FORCE FOR STRAIGHT AND CAMBERED BEAMS<br />
KANAAN SLIWO YOUKHANNA ATHURAIA * and. RIYADH SHAFIQ AL-RAWI **<br />
* School of Engineering, Faculty of Engineering and Applied Sciences, University of Duhok, Kurdistan Region- Iraq<br />
** Dept. of Civil Engineering, College of Engineering, University of Baghdad-Iraq<br />
(Received: June 17, 2010; Accepted for publication: April 10, 2011)<br />
ABSTRACT<br />
Theoretical formulas to predict the eccentricity of the horizontal axial restraint force (based on strain readings)<br />
for straight and cambered beams were derived. Theoretical formulas to predict the horizontal axial restraint force<br />
were derived too. Four portal frames were cast, two of them are with single span (one with straight beam 50mm x<br />
60mm and other with cambered beam). The effectiveness of cambered beams compared to straight ones are shown<br />
where there is increment in the values of axial compressive force for cambered beams.<br />
KEYWORDS: Beam, Camber, Strain, Eccentricity, Axial Force, Compressive.<br />
W<br />
1. INTRODUCTION<br />
ith the presence of end axial and<br />
rotational restraint, the flexural<br />
behavior of beams or one-way slab strips is quite<br />
different from the behavior of simply -supported<br />
beams or one-way slabs. The rotational restraint<br />
is responsible for the negative flexural moment<br />
at the ends (supports) of the member. This is not<br />
the exact situation which can be suggested<br />
according to the laws of mechanics of an elasticplastic<br />
material like reinforced concrete. Usually<br />
in the analysis and design of continuous beams<br />
and continuous one-way and two-way slabs, the<br />
rotational restraint only is assumed to be present<br />
at the edges of an interior beam or interior slab<br />
panel.<br />
In axially restrained slabs subjected to<br />
membrane forces, these forces were always<br />
theoretically assumed or considered to be acting<br />
at the mid-depth of the slab cross-section<br />
(Brotchie and Holley 1971) (Park 1965) (Park<br />
1964) (Ramesh and Datta 1973) (Fenwick and<br />
Dickson 1989) (Christiansen 1963) (Okleston<br />
1958). This means that the rotational restraint<br />
provided by the torsional stiffness of the<br />
surround was ignored in these analyses. Very<br />
few research works (Guice and Rhomberg<br />
1988) considered the presence of a partial<br />
rotational restraint at the edges of one-way slab<br />
panels, in addition to the partial axial restraint.<br />
This partial rotational restraint was provided by<br />
fixing the edges of the slab panels by cover<br />
plates.<br />
While the development of membrane<br />
compressive action has been attributed to lateral<br />
restraint, some test data (Guice and Rhomberg<br />
1988) suggest that providing lateral restraint is<br />
only one condition required for insuring an<br />
enhancement in load capacity. Guice and<br />
Rhomberg (Guice and Rhomberg 1988) stated<br />
that: “the lateral restraint acting at the midsurface<br />
of slab would permit the edge to rotate<br />
and would apparently provide little or no load<br />
enhancement”.<br />
2. RESEARCH SIGNIFICANCE<br />
The concrete is much better in compression<br />
than in tension, so, there is a need for all<br />
formulas that presents the effectiveness of any<br />
structural configuration (such as camber) in<br />
increasing the compression zone of a concrete<br />
section. In this research, an attempt is made to<br />
do so.<br />
3. EXPERIMENTAL WORK<br />
Four reinforced concrete portal frames were<br />
cast in order to measure the strains at mid-span<br />
of the beams. Using same concrete mix, portal<br />
frames denoted as F1 (single span straight), F2<br />
(single span cambered), F3 (triple span straight)<br />
and F4 (triple span cambered) were prepared.<br />
General layout of the frames is given in<br />
Appendix (A).<br />
3.1 Materials<br />
3.1.1 Cement: Ordinary (type I) Portland<br />
cement was used. The cement was produced<br />
conforming to Iraqi Specifications: No. 5: 1984<br />
[I.O.S. 5/1984]. Its chemical and physical<br />
analyses are shown in Appendix (B).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
3.1.2 Fine aggregate (Sand): The sand was<br />
sieved at sieve size (4.75mm) to get rid of coarse<br />
particles. The sand was then washed and cleaned<br />
by water several times, later it was spread out<br />
and left to dry in normal air. The sand was<br />
conforming to Iraqi Specifications: No. 45:1984<br />
and ASTM C33-86 Specifications [ASTM,<br />
1986]. Its gradation and other properties are<br />
given in Appendix (C).<br />
3.1.3 Coarse Aggregate (Gravel): Gravel was<br />
used as coarse aggregate. It was sieved to a<br />
maximum size of (9.5mm) conforming to ACI<br />
Code provisions, that the maximum size of<br />
aggregate should not be greater than one-fifth of<br />
the narrowest dimension of the concrete section.<br />
The gravel was washed and cleaned several<br />
times (in water) and left in air to dry. Its<br />
gradation and other properties are given in<br />
Appendix (C) and are conforming to ASTM<br />
C33-86 Specifications [ASTM, 1986].<br />
3.1.4 Water: Ordinary drinking water was used<br />
for mixing and curing of the concrete.<br />
3.1.5 Reinforcement: Deformed steel bars<br />
conforming to ASTM A615-86 specifications<br />
were used as reinforcement. The bars were<br />
deformed (5mm) in diameter. Other properties of<br />
the steel reinforcement are given in Appendix<br />
(C).<br />
3.2 Mix Design<br />
Mix design procedure of the ACI Committee<br />
211 (Neville 1995) was followed to design the<br />
proportions of the concrete mix. The mix was<br />
proportioned to have (28 days) cylinder strength<br />
in the range of (25 N/mm2) and the slump is<br />
chosen to be within the range of (50 mm). Trial<br />
batches were made to check the slump of the<br />
mix, and corrections were applied to mix<br />
proportions. Mix proportions (by weights) were<br />
(0.370 : 1 : 1.120 : 1.596) water to cement to<br />
sand to gravel respectively.<br />
All frames were cured (with water) for 28<br />
days after which the strain gages were firmed in<br />
position at mid-span of the beams (interior span<br />
for triple span frames). The uniformly<br />
distributed loads were then gradually applied<br />
and the deflection readings were measured<br />
3.3 Strain Gages<br />
The strain gages were fixed in the required<br />
positions before the application of the uniform<br />
load. The strains were measured using (55mm)<br />
length foil type strain gages by digital strainmeter<br />
(TDS-100) with a capacity of (10)<br />
channels. Some details of the strain gages used<br />
are as follow:<br />
* Foil type. * Precision strain gages.<br />
* Resistance = (120 +- 0.2%) Ohms.<br />
* Gage factor = (2.075 +- 0.5%).<br />
* Measurements Group Inc. (U.S.A.).<br />
Strain gages were fixed in position as<br />
follows:<br />
Strain gage at the top fiber of mid-span,<br />
another strain gage at the bottom fiber of midspan,<br />
two strain gages at mid-depth of mid-span<br />
section each one from one side to take the<br />
average of both for mid-depth strain.<br />
Dead load (DL=2.533 kN/m) were applied<br />
for a period of 35 days after which a live load<br />
(LL=2.043 kN/m) is added to dead load resulting<br />
in total load (DL+LL=4.576 kN/m.<br />
4. STRAIN READING<br />
The experimental measurements of strain<br />
reading are given in Table (1). The general<br />
shapes for the distribution of the strain<br />
reading measurements of all frames are shown in<br />
Fig. (1).<br />
Frame<br />
Table (1) Strain readings at mid-span.<br />
F1 F2<br />
Time +<br />
[Strain (ε) × 10-6] ++ at:<br />
(days) Top Middle Bottom Top Middle Bottom<br />
0 -1009 733 770 -495 -235 423<br />
9 -1002 780 812 -564 -246 475<br />
29 -1051 822 860 -537 -213 590<br />
46 -1418 1253 1384 -813 -330 956<br />
Frame F3 F4<br />
Time +<br />
[Strain (ε) × 10-6] ++ at:<br />
(days) Top Middle Bottom Top Middle Bottom<br />
0 -1520 -452 82 -1427 -878 -272<br />
9 -1610 -469 92 -1576 -817 -296<br />
29 -1702 -487 93 -1662 -980 -316<br />
46 -2053 -226 125 -2252 -906 -348<br />
+ Time is measured relatively to the first reading.<br />
++ The load of first three readings were dead load only, while for the last reading, it was (dead + live) loads.<br />
Cracks occurred in the case of the third and fourth readings (29 & 46 days).<br />
79
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
80<br />
h/2<br />
h/2<br />
5. THEORETICAL BACKGROUND<br />
In cambered beams, the difference<br />
between fully axially restrained and partially<br />
axially-rotationally restrained beams is much<br />
strict than in slabs, because the depth to width<br />
(h/b) ratio is higher in beams than in slabs. In<br />
axially restrained beams, the restraint force must<br />
be at the mid-depth point which idealizes the<br />
hinges, while in partially axially-rotationally<br />
restrained beams, that idealizes the actual<br />
connection of framed members, the restraint<br />
force must be eccentric or accompanied with a<br />
fixed end moment.<br />
Theoretically as shown in Fig. (2), it can<br />
be assumed that the eccentricity (e) of the total<br />
horizontal axial force (Fc) from the center line of<br />
the beam section is equal to the distance of the<br />
internal concrete compressive force from the<br />
center line, i.e.:<br />
6. EXPERIMENTAL PREDICTION OF<br />
ECCENTRICITY<br />
Experimentally, by measuring the strain at<br />
different locations (Top, Mid-depth and Bottom)<br />
Fig. (1): Measured strain diagrams of beams at mid-span.<br />
d<br />
b<br />
(a) (b) (c) (d)<br />
As<br />
N.A<br />
εB<br />
b<br />
εm<br />
c<br />
εT<br />
h/2<br />
h/2<br />
FC<br />
e<br />
N.A<br />
c<br />
εT<br />
e<br />
εm<br />
εB<br />
h ar<br />
e �<br />
2 2<br />
� ………… (1)<br />
where: h is the overall depth of the concrete<br />
section.<br />
r a is the equivalent rectangular stress<br />
block depth of restrained member.<br />
e is the eccentricity of total<br />
compressive force.<br />
and<br />
ar<br />
FC<br />
As<br />
f y � N<br />
� ………… (2)<br />
0.<br />
85f<br />
`c<br />
b<br />
Fig. (2): Eccentricity of the axial force.<br />
ar<br />
c<br />
εm<br />
εT<br />
εB<br />
N.A<br />
FC e<br />
where As is the area of steel reinforcement<br />
fy is the yield tensile strength of steel<br />
reinforcement.<br />
f`c is the compressive strength of<br />
concrete.<br />
N is the axial compressive force.<br />
b is the width of concrete section.<br />
0.85f`c<br />
e<br />
Fc<br />
T=Asfy<br />
of the beam section, it may be possible to<br />
estimate the eccentricity of the total horizontal<br />
axial compressive force (FC).<br />
For the strain diagram as that shown in<br />
Fig.(1.b), the eccentricity can be written as:
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
eexp<br />
h<br />
[ 3 � (<br />
�T<br />
)]<br />
6 �T<br />
� �m<br />
� …………… (3)<br />
where eexp is the experimental eccentricity of<br />
total compressive force.<br />
εm is the strain at mid-depth of concrete<br />
section.<br />
εT is the strain at top of concrete section.<br />
h is the overall depth of concrete<br />
section.<br />
While for that shown in Fig.( 1.c), it can be<br />
written as:<br />
h<br />
eexp ( 3 � y<br />
1<br />
)<br />
6<br />
Where:<br />
y<br />
1<br />
And<br />
� …………… (4)<br />
2<br />
2<br />
� ( �m<br />
� 2�T<br />
) � �m<br />
( 3�<br />
B<br />
� 4�<br />
m )<br />
� ……. (5)<br />
�.[<br />
�.(<br />
�T<br />
) � �m<br />
( � B<br />
� 2�<br />
m )]<br />
B m � � � � � …………… (6)<br />
Where εB is the strain at the bottom of the<br />
concrete section.<br />
For the strain diagram shown in Fig.( 1.d),<br />
the eccentricity is:<br />
h<br />
exp � ( y<br />
2<br />
� 3)<br />
6<br />
e ……………… (7)<br />
Where:<br />
5�T�6�m��B y 2 �<br />
� �2��� T m B<br />
….…… (8)<br />
Table (2) gives numerical values for the<br />
eccentricities of the portal frames of the present<br />
study. Figure (3) shows the relation of the ratio<br />
(eexp/h) with time. It can be seen that for the<br />
single span portal frames (F1 and F2), the<br />
camber effect is to decrease the eccentricity [at<br />
mid-span], this is due to the increase in the<br />
compressive zone of the beam section. A<br />
superior effect of the interior span compared to<br />
the single span is recognized by the small<br />
eccentricities of frames (F3 & F4) compared to<br />
that of frames (F1 & F2).<br />
Direct Axial Compressive Force (N)<br />
Considering Eq. (9) (Athuraia 2004):<br />
c<br />
As<br />
f y � N<br />
� ………………….. (9)<br />
0. 85�<br />
1<br />
f `c<br />
b<br />
The direct axial compressive force (N), may<br />
be written as:<br />
y f<br />
N � 0. 85�<br />
1<br />
f `c<br />
b.<br />
c � As<br />
.…..… ….. (10)<br />
Substituting (cexp) for (c), a semi-empirical<br />
formula would be:<br />
y f<br />
N � 0. 85�<br />
1<br />
f `c<br />
b.<br />
cexp<br />
� As<br />
……. (11)<br />
Where the term (As.fy) represents the axial<br />
force provided by steel reinforcement<br />
From Fig. (1), the following relations may be<br />
derived to calculate (cexp):<br />
For the strain diagram shown in Fig. (1.b),<br />
the experimental position of the neutral axis is<br />
given by:<br />
c<br />
h<br />
(<br />
�T<br />
)<br />
2 �T<br />
� �m<br />
� ……………… (12)<br />
where � B is the strain at bottom of concrete<br />
section.<br />
� T is the strain at top of concrete section.<br />
h is the overall depth of concrete section.<br />
For that shown in Fig. (1.c), the neutral axis<br />
position is:<br />
c<br />
h 2�<br />
m � �<br />
(<br />
B<br />
)<br />
2 �m<br />
� � B<br />
� …………...…. (13)<br />
Where m �<br />
: Strain at mid-depth of concrete<br />
section.<br />
While for the strain distribution as that shown<br />
in Fig. (1.d), the neutral axis position is given<br />
by:<br />
c<br />
h 2�<br />
m � �<br />
(<br />
B<br />
)<br />
2 �m<br />
� � B<br />
� …………… (14)<br />
Substituting the numerical values of (cexp)<br />
calculated by using Eqs. (12), (13) and (14), and<br />
given in Table (3), the direct axial compressive<br />
force (N) would be as those given in Table (4).<br />
Figure (4) shows the relationship between axial<br />
force (N) and time.<br />
It can be noticed that for the single span<br />
portal frame (F1) after increasing load, the axial<br />
compressive force inflects into an axial tension<br />
one. It is believed that this is due to excessive<br />
deflection that occurs with increased load that<br />
tends to make the eccentricity of the axial force<br />
greater than (h/2) and the line of action for this<br />
axial force to be out of the section, which<br />
produces a moment same as that of the flexural<br />
loads . The beneficial effect of camber<br />
(especially for an interior span) can also be seen.<br />
Eq. (11) is a general one with respect to<br />
(cexp). Substituting Eqs. (12), (13) and (14) into<br />
81
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
Eq.(11), the following equations can be<br />
predicted:<br />
82<br />
y f<br />
�<br />
( N )<br />
bh<br />
T<br />
exp � 0.<br />
425�<br />
1<br />
f `c<br />
( ) � As<br />
. …(15)<br />
�T<br />
� �m<br />
� B<br />
� 2�m<br />
( N ) exp � 0.<br />
425�<br />
1<br />
f `c<br />
bh(<br />
) � As<br />
. f y …(16)<br />
� B<br />
� �m<br />
7. CONCLUSIONS<br />
Theoretical formulae were derived to predict<br />
the eccentricity of axial compressive force.<br />
Force (N)<br />
e / h<br />
70<br />
60<br />
50<br />
40<br />
30<br />
20<br />
10<br />
0<br />
0.5<br />
0.4<br />
0.3<br />
0.2<br />
0.1<br />
0<br />
Fig. (3) Relation of (e/h) with time.<br />
Fig. (4) Relation of force "N" with time.<br />
2�m<br />
� �<br />
( N )<br />
f bh<br />
B<br />
exp � 0.<br />
425<br />
1<br />
`c<br />
( ) � As<br />
. f y<br />
�m<br />
� � B<br />
Fig.(3) Relation of (e/h) with time.<br />
� … (17)<br />
Where all strains (ε) are in absolute values.<br />
0 20 40 60<br />
Time (Days)<br />
F1 F2 F3 F4<br />
Fig. (4) Relation of force "N" with time.<br />
0 10 20 30 40 50<br />
Time (Days)<br />
F1 F2 F3 F4<br />
Another theoretical formulae were derived to<br />
predict the axial compressive force.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
Frame F1<br />
Frame F3<br />
APPENDIX (A)<br />
Fig. (A.1) Photos of portal frames.<br />
Beam section: (50x60) mm.<br />
Column section: (50x70) mm.<br />
Footing section for frames (F1&F2): (0.3x0.3x0.1) m.<br />
Footing section for frames (F3&F4): (0.4x0.4x0.1) m.<br />
Clear height of columns = 0.5 m.<br />
Both beams and columns are reinforced by: 2 – φ 5 mm<br />
Column stirrups: φ 5 mm @ 50 mm c/c (Stirrups),<br />
Beam stirrups: as per ACI code [Nilson & Winter, 1986]<br />
Footing for frame (F1) is reinforced by 3 - φ 5 mm<br />
(one layer in both directions)<br />
Footing for frame (F2) is reinforced by 5 - φ 5 mm<br />
(one layer in both directions)<br />
Frame F1<br />
1.0 m<br />
Frame F3<br />
Frame F2<br />
Frame F4<br />
0.5 1.0 m<br />
0.5<br />
Frame F4<br />
Frame F2<br />
1.0 m<br />
Fig. (A.2) General layout of portal frames.<br />
Fif (2): General layout of portal frames.<br />
83
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
APPENDIX (B)<br />
CHEMICAL AND PHYSICAL PROPERTIES OF ORDINARY CEMENT<br />
As tested by the National Center for Constructional Laboratories (NCCL).<br />
84<br />
B.1 CHEMICAL PROPERTIES<br />
Oxide<br />
%<br />
B.S. 882:1973<br />
Composition<br />
By Weight<br />
Limiting values<br />
SiO2 21.20<br />
CaO 61.98<br />
MgO 3.00 Max. 4 % +<br />
Fe2O3 3.28 Al2O3/Fe2O3 > 0.66<br />
Al2O3<br />
5.72<br />
SO3 2.48 Max. 3 % ++<br />
L.O.I. 1.26 Max. 4 %<br />
Ins. Residue 0.89 Max. 1.5 %<br />
L.S.F. 0.88 Min. 0.66<br />
Max. 1.02<br />
+<br />
Iraqi Standards No. 5 required 5 % as Max.<br />
++ Iraqi Standards No. 5 required 2.8 % as Max.<br />
++ B.S. 882: 1973 requirements are: SO3 = 2.5% Max.<br />
when C3A is equal or less than<br />
Compound Composition %<br />
By Weight<br />
C3S 41.01<br />
C2S 29.84<br />
C3A 9.91<br />
C4AF 9.98<br />
B.2 PHYSICAL PROPERTIES<br />
Property Value Limiting Values<br />
[IQS-NO.5/1984]<br />
Fineness Blaine 312 m2/kg Min. 230 m2/kg<br />
Setting Time<br />
(Vicat)<br />
Compressive<br />
Strength<br />
Soundness<br />
Initial<br />
160 minute Min. 45 minute<br />
Final 290 minute Max. 600 minute<br />
3 days 16.09 N/mm2 Min. 15 N/mm2<br />
7 days 25.90 N/mm2 Min. 23 N/mm2<br />
Auto-Clave 0.20 % Max. 0.80 %<br />
APPENDIX (C)<br />
GRADATION AND OTHER PROPERTIES OF SAND AND GRAVEL<br />
AND PROPERTIES OF REINFORCEMENT<br />
C.1 Gradation and other properties of sand<br />
Sieve %<br />
% Passing according to:<br />
Size Passing IQS - 45 ASTM- B.S. 882:<br />
(mm)<br />
C33-86 1973 +<br />
10.00 100 100 100 100<br />
4.75 100 90-100 95-100 90-100<br />
2.36 90 75-100 80-100 75-100<br />
1.18 71 55-90 50-85 55-90<br />
0.60 52 35-59 25-60 35-59<br />
0.30 24 8-30 10-30 8-30<br />
0.15 4 0-10 2-10 0-10<br />
Sulphate Content = 0.11 % (max. limit = 0.5 %)<br />
Specific Gravity = 2.64<br />
Absorption = 0.70 %<br />
+ Grading area (zone) number (2).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
REFERENCES<br />
Sieve Size (mm) %<br />
Passing<br />
C.2 Gradation and other properties of gravel<br />
% Passing according to :<br />
ASTM–C33-86 B.S. 882: 1973<br />
& IQS-45/1980<br />
12.5 100 100 100<br />
9.5 100 85-100 85-100<br />
4.75 17 10-30 0-25<br />
2.36 0.4 0-10 0-5<br />
1.18 0.2 0-5 ---<br />
Sulphate Content = 0.09 % (max. limit = 0.1 %)<br />
Specific Gravity = 2.57<br />
Absorption = 0.70 %<br />
- Brotchie, J. F., and Holley, M. J. (1971). Membrane<br />
Action in Slabs, ACI Special Publication Paper SP 30-16,<br />
pp. 345-377.<br />
- - Park, R.(1965). The Lateral Stiffness and Strength<br />
Required to Ensure Membrane Action at the Ultimate Load<br />
of a Reinforced Concrete Slab - and – Beam Floor.<br />
Magazine of Concrete Research (London), Vol. 17, No. 50,<br />
March, pp. 29-38.<br />
- Park, R. (1964). Ultimate Strength of Rectangular<br />
Concrete Slabs Under Short Term Uniform Loading<br />
with Edges Restrained Against Lateral Movement,<br />
Proceedings of the Institution of Civil Engineers (London),<br />
Vol. 28, June, pp. 125-150.<br />
- Ramesh, C. K., and Datta, T. K. (1973). Ultimate<br />
Strength of Reinforced Concrete Slab-Beam System–A<br />
New Approach. Indian Concrete Journal, Vol. 5, No. 3,<br />
August, pp. 301-308.<br />
- Fenwick, Richard C., and Dickson, Andrew R. (1989).<br />
Slabs subjected to Concentrated Loading. ACI Structural<br />
C.3 Steel bars (Reinforcing)<br />
As tested by:<br />
the Central Institution for Measuring and Quality Control.<br />
Deformed<br />
(diameter)<br />
bars<br />
5 mm<br />
Yield strength 774 N/mm2<br />
Ultimate strength 793 N/mm2<br />
Elongation 3 %<br />
Journal, Vol. 86, No. 6, November-December, pp. 672-<br />
678.<br />
- Christiansen, K. P. (1963). The Effect of Membrane<br />
Stresses on the Ultimate Strength of the Interior Panel in a<br />
Reinforced Concrete Slab. The Structural Engineer, Vol.<br />
41, August, pp.261-265.<br />
- Okleston, A. J. (1958). Arching Action in Reinforced<br />
Concrete Slabs. The Structural Engineer, V.36, June,<br />
pp.197-201.<br />
- Guice, Leslie K., and Rhomberg, Edward J. (1988).<br />
Membrane Action in Partially Restrained Slabs. ACI<br />
Structural Journal, Vol. 86 , No. 4 , July-August, pp.365-<br />
373.<br />
- Neville, A. M. (1995). Properties of Concrete”, 4th Ed.,<br />
The English Language Book Society-Pitman Publishing,<br />
London.<br />
- Athuraia, Kanaan Sliwo (2004). Effect of Membrane<br />
Action on Results of Load Test. Ph. D. thesis, Baghdad<br />
University, College of Engineering, Baghdad, IRAQ.<br />
85
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 78-86, 2011<br />
نَيي<br />
ىنووضلةه نَيندناخ<br />
ب دراثشار(<br />
يوشائاي يرةوةت ايادَيرط<br />
اسَيهاي<br />
َيرةتنةش ايهادوج انركرايرد ايرويت نَينتشراد<br />
86<br />
ةتخوث<br />
راض . يوشائاي ىرةوةت ايادَيرط<br />
اسَيه<br />
انركرايد ايرويت نَينتشراد<br />
اشةورةه . نترطرةو ةنتاه ىدنامةضو تشار نَيكنيزارةد<br />
ىدايو ممم ) 05 × 05(<br />
ةتشاراي ناوذ<br />
كةي اكنيزارةد[<br />
ةيةه ىهلااظ كةي ناوذ<br />
ود . نرك باش ةنتاه رطلةه نَير<br />
ةكيةث<br />
ينكنيزارةد لةطد نرك دراورةب ب نركرايد ةنتاه ىدنامةض نَيكنيزارةد<br />
انركَيلراك<br />
تابتعل ) لاعفنلإا تاءارقل دانتسلإاب(<br />
. ] ةي<br />
ىدنامةضاي ىواكنيزارةد<br />
. ىةهاياد ىدنامةض نَيكنيزارةد<br />
اي ىرةوةت اراشف نَيياوبد<br />
كةيهةدَيز<br />
يذوةئ<br />
. تشار<br />
ةصلاخلا<br />
ةيقفلأا ةيروحملا ةديقملا ةوقلل يزكرملا فلاتخلإا داجيلأ ةيرظن غيص قاقتشإ مت<br />
نانثإ ،ةلماح لكايه عبرأ بص مت . ةيقفلأا ةيروحملا ةديقملا ةوقلا داجيلإ ةيرظن غيص قاقتشإ مت ًاضيأ . ةسوقمو ةميقتسم<br />
تابتعلا ةيلاعف راهظإ مت .] ةسوقم ةبتع تاذ رخلآاو ملم ) 05 x 05(<br />
ةميقتسم ةبتع تاذ اهدحأ[<br />
دحاو ءاضف تاذ اهنم<br />
.<br />
ةسوقملا تابتعلل ةيروحملا طاغضنلإا ةوق ميقب ةدايز كانه ثيح ةميقتسملا تابتعلاب ةنراقم ةسوقملا
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
THREE DIMENSIONAL REPRESENTATION OF A REMOTE STRUCTURE<br />
USING REFLECTORLESS TOTAL STATION INSTRUMENT<br />
RAAD AWAD KATTAN and SAMI MAMLOOK GILYANA<br />
School of Engineering, Faculty of Engineering and Applied Sciences, University of Dohuk, Kurdistan Region-Iraq<br />
(Received: June 12, 2010; Accepted for publication: February 27, 2011)<br />
ABSTRACT<br />
Remote structures and objects are always make a great measuring challenge to the engineers and surveyors.<br />
Even with the introduction of the EDM instrument, a reflector has to be placed at the observed point. In this study, a<br />
reflectorless total station instrument works with red light laser was used. The objective is to measure and visualize the<br />
3d coordinates of a remote roof dome. 330 points were observed from 5 control points. For this purpose the<br />
instrument was checked and the spatial accuracy was in the range of 2mm. Points were imported to the AutoCAD<br />
software and it was possible to present the data in different forms. Contour lines, sections shaded 3d surface are<br />
presented. Deviations of the surface from the perfect spherical shape were measured. Polynomial surface was<br />
generated to fit the point cloud.<br />
KEYWORDS:- Reflectorless, Total Station, 3d Measurements, Structures, Dome<br />
R<br />
1-INTRODUCTION<br />
emote structures such as high rise<br />
towers, domes, bridges, elevated<br />
motorways, dams, require special techniques in<br />
observations and measurements. Ordinary<br />
observation by total station instruments,[4] is<br />
difficult or impossible as there is no way to place<br />
the reflector on the selected points on these<br />
structures. Fragile and delicate objects such as<br />
glass or plastic structures, ancient sites are added<br />
to such list of objects which cannot be measured<br />
using conventional surveying methods. The<br />
object in question in this project represents a<br />
problem to be tackled. It is a semispherical dome<br />
made of polycarbonate sheets supported on a<br />
metal frame. The aim is to have a 3-D model of<br />
this object<br />
2-REVIEW OF THE 3-D MEASUREMENT<br />
TECHNIQUES<br />
Different techniques are regularly used in<br />
remote object surveying among these are:<br />
1-Close range photogrammetric methods:<br />
Indirect observation of targets are carried out<br />
using pairs of close range images. Known<br />
control points are to be placed in the scene and<br />
through the well known solutions such as<br />
collinearity, coplainarity, DLT solutions, 3-D<br />
ground point coordinates can be computed,[3]<br />
2-Laser scanning technique is the most recent<br />
method. Instruments generating laser beam scan<br />
the required objects sequentially. The reflected<br />
laser signal plus the horizontal and vertical<br />
angles can be converted into 3-D coordinates.<br />
Millions of observation can be generated<br />
sequentially. A 3-D model can be generated.<br />
Such systems are still experimental and<br />
relatively expensive, [8].<br />
3-The conventional intersection method: a base<br />
line is placed at some distance from the object<br />
and horizontal and vertical angle observations<br />
are to be taken to each target from the two ends<br />
of the base line. The accuracy of this method<br />
depends mainly on the accuracy of angle<br />
observations . this method proved to be accurate<br />
and efficient, but it is time consuming and<br />
demanding,[1],[2].<br />
4-Using the reflectorless total station<br />
instruments,[8]: This technique has been tried in<br />
this research and will be dealt with in more<br />
details.<br />
3-THE REFLECTORLESS TOTAL STATION<br />
The total station instrument used is the Leica<br />
TCR1101, figure(1). The instrument can<br />
operates in two modes; the first is the reflector<br />
mode using the infrared radiation, and the<br />
second is the reflectorless mode using the red<br />
laser.<br />
In this project the reflector mode was used to<br />
establish control points around the studied<br />
object. The reflectorless mode was used to<br />
observe the selected points on the dome.<br />
87
88<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
According to the manufacture specifications<br />
the instrument has the accuracy mentioned in<br />
table (1)<br />
Fig, (1): The reflectorless total station TCR1101<br />
Table (1): Manufacture specification of the TCR 1101 total station<br />
Angle accuracy ±1.5˝<br />
Distance accuracy ±2mm±2ppm reflector mode<br />
±3mm±2ppm reflectorless mode<br />
Range in average atmospheric condition 3km reflector mode<br />
80m reflectorless mode, standard range<br />
Measuring time 3sec reflectorless mode<br />
The laser spot has an elliptical shape and it<br />
can be seen as a pulse on the observed object in<br />
dim weather. The spot has the following<br />
dimensions as it appears on the object:<br />
At 50 m: approx. 10 mm x 20 mm<br />
At 100 m: approx. 15 mm x 30 mm<br />
At 200 m: approx. 30 mm x 60 mm<br />
The spot dimension effect directly the<br />
measurement accuracy. As the spot size<br />
increases the uncertainty of the measurements<br />
increases.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
Fig. (2 ): A close view on the display screen of the instrument<br />
4- INSTRUMENT CHECK<br />
A test was made to check the spatial accuracy<br />
of the instrument. Two points A and B were set<br />
at a horizontal distance of 7m and a vertical<br />
distance of 1m,figure(3). Screws with bolt head<br />
The instrument was setup on point S in<br />
similar configuration to that will be used in<br />
observing the spherical dome. Arbitrary<br />
coordinates were given to point S and arbitrary<br />
azimuth were given. The total station instrument<br />
(in Tie Distance mode) was targeted to point A<br />
and then to B. Full observation were made at<br />
each point. The instrument then automatically<br />
display point coordinates, horizontal, vertical,<br />
and slope distance between points A and B. It is<br />
the slope distance which was more important to<br />
us. The slope distance represents the resultant of<br />
the difference in coordinates and equal to<br />
[sqrt(∆E 2 +∆N 2 +∆H 2 )].<br />
The instrument displayed the slope distance<br />
AB=7.062m. A steel tape was used to measure<br />
directly this distance. Tape value was=7.060m.<br />
A difference of 2mm is quiet acceptable value,<br />
knowing that the bolt head diameter=7mm.<br />
Fig. (3): The instrument check setup<br />
are used for observation at point A and B. These<br />
are of the same type fixed on the dome and used<br />
for observing the dome points. The diameter of<br />
the bolt head=7mm.<br />
5- OBJECT DESCRIPTION<br />
The selected object in this project is a<br />
semispherical transparent roof at the top of a<br />
3- story building ,figure (4). The dome is made<br />
of polycarbonate panels supported on a metal<br />
frame consisted of 24 steel strips joined together<br />
at the top. The diameter of the dome at the base<br />
is equal to 7.4m. Its height from its concrete base<br />
is equal to 2.2m.<br />
6-MEASUREMENTS AND DATA<br />
COLLECTION<br />
Three control points A,B, and C were<br />
selected around the dome on the roof surface.<br />
The control points make an approximately an<br />
equilateral triangle with side length of about<br />
15m. Two additional points D and E at a height<br />
of 1.5m were selected later on the top of two<br />
small rooms to allow for elevated platform,<br />
figure(5)<br />
89
90<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
A UTM coordinates were assigned to the<br />
control points using previously observed GPS<br />
point on the roof of the building. The UTM<br />
coordinate values will help in proper orientation<br />
of the survey.<br />
At each control point an accurate set up was<br />
made. Centering was made using the laser<br />
plummet spot. Leveling was achieved using the<br />
electronically sensitive bubble.<br />
After measuring the height of the instrument<br />
and height of target and feeding them to the<br />
instrument, a back sight is made on the next<br />
control point. On IR mode of observation with a<br />
reflector, ordinary traverse data is recorded to<br />
the observed control point. The instrument is<br />
then switched to the reflectorless mode and the<br />
observations will be carried out by using laser<br />
pulses. The telescope is pointed to small screw<br />
heads located on the dome metal strips.<br />
Observation of these points can constitute a<br />
complete 3-D model. After sighting each point,<br />
Fig. (4 ): Observation from traverse control point<br />
Fig. ( 5 ): Observation at the elevated point (D)<br />
a one button touch will measure the slope<br />
distance, horizontal and vertical angles. The<br />
instrument will change these values to a<br />
northing, easting, and elevation and store them<br />
sequentially according to the assigned point<br />
number sequence. The instrument screen display<br />
the point ID number and the three coordinates,<br />
figure(2 ). From each control point more than<br />
100 points were observed. The total number of<br />
observed points were=330. All observations<br />
were made in cloudy weather to avoid the effect<br />
of bright light on the laser spot.<br />
Points on the top of the object could not be<br />
observed from the control points A,B, and C.<br />
Therefore the instrument had to be transferred to<br />
the elevated points D and . From there good<br />
observation view was possible.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
7-DATA TRANSFER<br />
At the end of each observation session the<br />
data is transferred via a special cable to a laptop<br />
Fig. (6): The transformation of the data to the computer<br />
computer, (figure 6 ). In Excel format the data<br />
consists of point number, point description and<br />
the Northing, Easting and Elevation, (figure 7-a )<br />
Fig. (7): a- Data page in excel format b-Reduced data<br />
As it is not very practical to handle the UTM<br />
large figure coordinates, constants were<br />
subtracted from each coordinate value, changing<br />
the easting to X , the northing to Y and the<br />
elevation to a Z coordinates as shown in figure<br />
(7 -b). A constant value of 510 was subtracted<br />
from the elevation of all points. Some of the<br />
points with elevations less than 510 appear<br />
negative. The X,Y,Z coordinates were saved in<br />
text format.<br />
8-GRAPHICAPHICAL REPRESENTATION<br />
AND DATA ANALYSIS<br />
On the AutoCAD Civil 3-D Land2009<br />
program the X,Y,Z coordinates were imported<br />
and displayed with their actual elevations. The<br />
command :Point-Import/Export Point-Import<br />
Point was used. The format of the file was<br />
E,N,Z space delimited. This will match the text<br />
X,Y,Z file. Figure (8 ) shows the points after the<br />
import process. The figure shows a gap area on<br />
the top of the object. This is due to a lack of<br />
91
92<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
observations on this location. At this stage few<br />
points on the top of the object appear to deviate<br />
from the mean surface. On plotting contour<br />
lines, fault contours were very apparent. For this<br />
reason, 3 points were eliminated from the data<br />
set.<br />
Fig. (8): The display of the imported points. Only elevations are show<br />
Through the command terrain, terrain model<br />
explorer, a surface was created. Points file of the<br />
surface was added and selected from AutoCAD<br />
object. A surface was built and contour lines<br />
representing the shape of the dome were plotted<br />
at interval of 0.2m. The shape of the contour<br />
lines was approximately concentric circles,<br />
(figure9 ). Figure ( 10) shows the contour lines<br />
pattern in isometric projection.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
3-D Polylines were used to connect between the<br />
points located on one metal strip,. This will help<br />
Fig. (9): Surface contour lines at interval=0.2m<br />
Fig. (10): Isometric projection of the dome surface<br />
in visualizing the real shape of the object, (figure<br />
11).<br />
93
94<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
The AutoCAD program helped in drawing<br />
section through the spherical dome. Figure ( 12 )<br />
shows one section passing through the centre of<br />
Using the command Terrain- Surface<br />
Display-3D Face, the shaded face of the dome<br />
Fig. (11): The dome metal strips<br />
Fig. (12): Section passing through the centre of the dome<br />
the dome. The section shows the slightly<br />
unsymmetrical shape of the object. This is<br />
probably due to the erection process.<br />
could be displayed approximating the shape to<br />
the real object, (figure13).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
Fig. (13): Shaded terrain surface display<br />
Fig. (14): A circle of diameter=7.23 m shows the slight manufacturing error<br />
Figure (14) shows the top view of the dome<br />
enclosed by a perfect circle of diameter=7.23m.<br />
the slightly elliptical shape of the dome is<br />
apparent. The axes measured from the<br />
AutoCAD plot was =7.45m and 7.12m. The<br />
difference between the two dome axes= 33cm<br />
and its cause is a manufacturing error.<br />
95
96<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
Fig. (15) : A circle of diameter =7.48m drawn next to the dome section<br />
Figure (15) shows the deviation of the<br />
vertical section from the perfect circle plotted<br />
next to it. 15-20 cm deviation is observed at each<br />
side.<br />
A full cubic polynomial surface was tried to<br />
fit the dome surface. The polynomial was<br />
z = a + bx + cy + d 2 + ey 2 + fx 3 + gy 3 + hxy +<br />
ix2y + jxy<br />
A solution was made to the coefficients<br />
using all the 330 X,Y, and Z coordinates, i.e<br />
yielding 330 equations to be solved by least<br />
squares. The coefficients value was<br />
a = -1.7536699072728794E+01 b =<br />
1.5955209680572433E+00<br />
c = 3.2815673198281274E+00<br />
Figure (17) shows the scatter points plotted in<br />
the Z-Y and Z-X plane. This plot helps in<br />
visualizing any error in any point coordinates.<br />
The error will make the point floating above the<br />
surface. Fault points can be eventually erased.<br />
Fig. (16): Full cubic polynomial Surface plot<br />
d = -1.1415928774895295E-01 e =<br />
-1.7923917396961178E-01<br />
f = -2.8904480389045813E-03<br />
g = 4.9398526804153640E-04 h =<br />
1.4269793489451468E-02<br />
i = -8.8434044874405174E-04<br />
j = -1.3692450329015515E-03<br />
The R-squared= 0.989513646887<br />
Standard Error of Mean: in X= 9.858556E-02<br />
in Y= 9.107441E-02 in Z=3.975666E-02<br />
These values represents the deviation of the<br />
points from the assigned poly surface.<br />
Figure (16) shows a 3D plot of the poly<br />
surface<br />
Figure (18) shows the scattered points in the<br />
X-Y plane and contour plot at 0.2m interval.<br />
These plots were done with the aid of an on<br />
line processing in a web site [ 5 ]
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
Fig. (17): Z data vs. Y data Z data vs. X data<br />
Fig.(18): X data vs. Y data Contour plot<br />
9-CONCLUSIONS AND DISCUSSION<br />
1-Remote objects such as high rise roofs or high<br />
rise motorway structures can be easily<br />
measured and checked using this technique. A<br />
deflection in the bottom of high rise surfaces<br />
could be measured and visualized with sufficient<br />
accuracy.<br />
2-The metal surface bolts on the fairly reflected<br />
sheets did not contribute in large amount of error<br />
due to scattering and reflection.<br />
Some error were accounted for in points located<br />
at the top of the dome. One reason is probably<br />
due to the angle of the laser light makes with the<br />
bolt head. As the points rise, the angle will<br />
highly deviated from 90 degree, figure(19) With<br />
the few millimeter instrument accuracy, the large<br />
size of the target could lead to some accountable<br />
error.<br />
Fig. (19): deviation of the reflection angle from 90° could lead to some error.<br />
97
98<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
3-Some points on the dome top surface and one<br />
metal strip are deliberately left missing. It was<br />
possible to observed these but leaving them<br />
could indicate the effect of these missing points<br />
on the final presentation. Contour lines on the<br />
top of the object suffer from this shortage,<br />
figure(14).<br />
4-The roof surface shape is not meant to be<br />
made highly perfect spherical dome. The<br />
workmen probably use their prior experience in<br />
the erection process. And some deviation is<br />
highly expected. However the present<br />
measuring system proved to be capable of high<br />
degree of accuracy and it can be used in surface<br />
construction checks.<br />
5-The system was checked at short distances less<br />
than 20m. Further test have to be made at longer<br />
ranges, up to the declared maximum range.<br />
6-Life is getting even more easier. The<br />
motorized version of the reflectorless total<br />
station could automatically scan a surface at<br />
fixed distance scan interval. This will help in<br />
producing DTM with large huge number of<br />
points representing remote surfaces.<br />
REFERENCES<br />
- Barry F. Kavanagh,(2008),Surveying Principles and<br />
Applications, (8th Edition), Prentice Hall<br />
- F. Moffitt ,(1997),Surveying ,(10th Edition), Prentice Hall<br />
- Kattan, R, Balata F.( 2007).Ground coordinate<br />
measurements using satellite images and terrestrial<br />
photographs. Journal of Dohuk University, vol.10,no2,<br />
- Kattan, R. Zidan A. (1995)Automated surveying system.<br />
The First Iraqi Technological Conference, Baghdad<br />
- “On line curve fitting and surface fitting”, Web site,<br />
http://zunzun.com/.<br />
- Department of Maritime Archaeology Western Australian<br />
Museum,(2006), Total Station How to do it, Web site,<br />
Manual Report , No. 220<br />
- Boehnlein , D.“Tests of the Leica Total Station for Survey<br />
& Alignment”, Report no.NuMI-L-637 . Web site<br />
- Irvine W., Maclennan F., (2006),Surveying For<br />
Construction ,(5th Edition), McGraw Hill
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 87-99, 2011<br />
اناهيئزاك<br />
ب<br />
َىتخةو<br />
وخو َىناظيثوز<br />
وَييزايشادنةئ<br />
وب<br />
ادَيناظيثو<br />
طنةتضائ<br />
ةهيبد زةدةظ<br />
وَينجامزائ<br />
وائ<br />
ةشنوم<br />
وَيتاًكَيث<br />
ةتخوث<br />
زةض ل ىدناجضةض<br />
ةهَيًب<br />
ييرمائ اناوةضيث<br />
وَيظد<br />
) EDM ( يطتاهغموسيةك اكريت ب ىةكدزاك وَيي<br />
ايتاسيود اناظيث<br />
وَييرمائ<br />
يزةصَيل<br />
و<br />
اكريت<br />
ىسكةتاي<br />
ب<br />
تةكدزاك<br />
–<br />
ةناوةضيث<br />
َىي<br />
مامةت<br />
َىكةيةطصَيو<br />
–<br />
َىناظيث<br />
َىيرمائ<br />
ىاهيئزاك<br />
ب<br />
. ىاظيث<br />
ةهيتاي وَيلاخ<br />
ادَيهيلوكةظ<br />
. زايدةن َىو<br />
وَيلاخ<br />
اكةبوق َىناب<br />
وب ييلا َىض<br />
وَيلاخ<br />
اهتيد اندناظةي<br />
انسكظةيزةب<br />
و ىاظيث<br />
َىهيلوكةظ<br />
َىظانجامزائ<br />
َىيرمائ<br />
انسكحةض<br />
َىمةزةم<br />
َىظوبو<br />
–<br />
ىسكةتاي<br />
يسكلوترنوك<br />
وَيلاخ<br />
اندناظةي<br />
انسكنايش وب يت ) Auto Cad ( َىمانزةب<br />
زةض وب تنشيَيزاد<br />
ةهتاي ةلاخ ــظةئ<br />
وب ) ملم2(<br />
يكيصَين<br />
جهَيث<br />
ذ<br />
لااخ<br />
) 333(<br />
. زوج وازوج وَييهَيو<br />
َىظد<br />
. زوضاي<br />
اناظيث<br />
يزايهيبسيوي<br />
. ىسكةتاي ييلا َىض<br />
وَينابوةضزاثو<br />
يزوتهك وَيلَيي<br />
انسكظةيزةب<br />
. ىسكةتاي يزوهض دنةض َىي<br />
) Polynomial ( يزاكيرب َىكةناب<br />
ب ياظيث<br />
َىناب<br />
اندناظةيو<br />
ب اتاد<br />
هصلاخلا<br />
تافاسملا سايق<br />
مادختسا هلاح يف ىتح . نيحاسملاو نيسدنهملل سايقلا يف ايدحت ةيئانلا فادهلأاو<br />
تاشنملا لكشت<br />
فده.<br />
ءارمحلا رزيللا<br />
ةعشأب لمعي<br />
. هساقملأ طاقنلا ىلع زاهجلا هسكاع<br />
تيبثت بجيف ةيسيطانغمورهكلا هعشلااب ةلماعلا<br />
–<br />
هسكاع نودب ةلماكتم ةطحم<br />
–<br />
سايق زاهج مادختسا مت ثحبلا اذه يف<br />
333 سايق مت.<br />
هطاقق ىلإ وصولا نكمي لا ةبق فقس ىلإ داعبلإا هيثلاث تايثادحلإل يئرم ليثمت دادعإو<br />
سايق وه ثحبلا<br />
طاقنلا بلج مت . رتميلم 2 دودحب هل ةيغارفلا ةقدلا تقاكو<br />
زاهجلا صحف مت ضرغلا اذهلو . ةرطيس طاقق سمخ نم هطقق<br />
عطاقمو هيروتنك<br />
طوطخ دادعإ مت<br />
. ةفلتخم اكشإب تاقايبلا<br />
ليثمت نم نكمتلل دقلا داكوتولأا جماقرب ىلإ هساقملأ<br />
ساقملا حطسلا ليثمتو<br />
حيحصلا يوركلا لكشلا نع ساقملا<br />
حطسلا نيابت سايق مت<br />
. داعبلأا هيثلاث حوطسو<br />
.<br />
دودحلا ددعتم يضاير حطسب<br />
99
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 100-105, 2011<br />
100<br />
ON GENERALIZATIONS OF REGULAR RINGS<br />
ABDULLAH M. ABDUL-JABBAR<br />
Dept. of Mathematics, College of Science, University of Salahaddin, Kurdistan Region-Iraq<br />
(Received: July 7, 2010; Accepted for publication: March 9, 2011)<br />
ABSTRACT<br />
A ring R is defined to be right (left) SF-ring if every simple right (left) R-module is flat. In this paper we<br />
study a condition under which SF-rings are regular. Also we find some properties and main results for it by<br />
adding some conditions. Furthermore, connections of such rings with other types of rings are studied.<br />
Moreover, we continue to study SSF-rings. Also, we find several properties for it and we connected such<br />
ring with other types of rings.<br />
KEYWORDS AND PHRASES: regular rings, flat module, SF-rings, SSF-rings.<br />
T<br />
1. INTRODUCTION<br />
hroughout this paper rings are<br />
associative with identity. For a<br />
subset X of a ring R, the left annihilator of X<br />
in R is ℓ(X) = {r � R: rx = 0, for all x � R},<br />
likewise for the right annihilator r(X). Y(R)<br />
and J(R) will stand respectively, for the right<br />
singular ideal and the Jacobson radical of R.<br />
A ring R is said to be von Neumann regular<br />
(regular) [22] if for every element a � R,<br />
there is an element b � R such that a = a b a.<br />
Recall that an ideal I of a ring R is called<br />
regular if every element of I is regular. A<br />
ring R is called �-regular [14] if for any a �<br />
R, there exists a positive integer n and an<br />
element b of R such that a n = a n b a n . A<br />
ring R is called strongly regular [12] if for<br />
each a � R, there exists b � R such that a =<br />
a 2 b. It should be noted that in a strongly<br />
regular ring R, a = a 2 b if and only if a =<br />
ba 2 . A ring R is called strongly �-regular [2]<br />
if for every a � R, there exists a positive<br />
integer n, depending on a and an element b<br />
� R such that a n n�1 = a b. Or equivalently, R<br />
is strongly �-regular if and only if a n R =<br />
a n 2 R. It is easy to see that R is strongly �regular<br />
if and only if Ra n = Ra n 2 . A ring R<br />
is called right (left) weakly regular [9] if for<br />
each a � R, a � a R a R (a � R a R a).<br />
R is called weakly regular if it is both right<br />
and left weakly regular. Recall that R is<br />
reduced if it has no non-zero nilpotent<br />
element. R is semi-prime ring [8] if it<br />
contains no non-zero nilpotent ideals. A ring<br />
R is called left semi-duo [6] if every<br />
principal left ideal of R is a two-sided ideal<br />
generated by the same element. Following<br />
[23], a ring R is called right (left) quasi-duo<br />
if every maximal right (left) ideal of R is<br />
two-sided.<br />
It is well known that R is a von Neumann<br />
regular ring if and only if every right (left)<br />
R-module is flat. By adding the condition<br />
“left semi-duo ring” to prove that R is a von<br />
Neumann regular if and only if R is a right<br />
SF-ring.<br />
2. SF-RINGS<br />
In this section we continue to study SFrings<br />
due to Rege in [20]. Also we find<br />
some properties and main results for it by<br />
adding some conditions. Furthermore,<br />
connections of such rings with other types of<br />
rings are studied.<br />
The following lemma, which is due to<br />
Rege in [20], plays a central role in several<br />
of our proofs.<br />
Lemma 2.1:<br />
Let I be a right (left) ideal of R. Then, R /<br />
I is a flat right (left) R-module if and only if<br />
for each a � I, there exists b � I such that a<br />
= b a (a = a b).<br />
Definition 2.2[20]:<br />
A ring R is called right (left) SF-ring if<br />
every simple right (left) R-module is flat.<br />
Theorem 2.3:<br />
Let R be a ring. If R / a R is a right SFring,<br />
then R is a von Neumann regular.<br />
Proof:<br />
Let a be a non-zero element of R and<br />
assume that R / a R is a right SF-ring, then
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 100-105, 2011<br />
for each a � a R, there exists b � a R such<br />
that a = b a. Since b � a R, then b = a r, for<br />
some r � R. Therefore, a = a r a and hence R<br />
is a von Neumann regular. �<br />
The following result is a necessary and<br />
sufficient condition for SF-rings to be von<br />
Neumann regular.<br />
Theorem 2.4:<br />
Let R be a left semi-duo ring. Then, R is<br />
a von Neumann regular if and only if R is a<br />
right SF-ring.<br />
Proof:<br />
Let R be a von Neumann regular, then R<br />
is a right SF-ring [20].<br />
Conversely, assume that R is a right SFring<br />
and I is an ideal of R. Then, for each a<br />
� I, there exists b � I such that a = b a.<br />
Since R is a left semi-duo ring, then R a is a<br />
two-sided ideal of R and hence R a is a left<br />
flat, so there exists b � a R such that a = a r<br />
a, for some r � R and hence R is a von<br />
Neumann regular. �<br />
Proposition 2.5:<br />
If R / r(a) is a right SF-ring such that r(a)<br />
� ℓ(a), for every a � R, then R is a reduced<br />
ring.<br />
Proof:<br />
Let a � R such that a 2 = 0. Then, a � r(a).<br />
Since R / r(a) is a right SF-ring, there exists<br />
b � r(a) such that a = b a. Since b � r(a),<br />
then a b = 0 and hence b � r(a) � ℓ(a).<br />
Thus, b a = 0. Therefore, a = 0. Whence, R<br />
is a reduced ring. �<br />
Following [5], a ring R is said to be<br />
strongly right bounded (briefly, SRB) if<br />
every non-zero right ideal contains a nonzero<br />
two-sided sub ideal of R.<br />
The following lemma due to Kim et. al.<br />
in [11].<br />
Lemma 2.6:<br />
If R is a semi-prime and SRB-ring, then<br />
R is a reduced.<br />
Theorem 2.7:<br />
If R is a right SF-ring, semi-prime and<br />
SRB-ring, then R is a strongly regular ring.<br />
Proof:<br />
Let R be a semi-prime and SRB-ring, and<br />
then by Lemma 2.6, R is a reduced ring. In<br />
order to show that R is strongly regular we<br />
need to prove that a R + r(a) = R, for any a<br />
� R. Suppose that a R + r(a) � R, there<br />
exists a maximal right ideal L containing a<br />
R + r(a). But a � L and R / L is a right flat,<br />
then there exists b � L such that a = b a,<br />
whence (1-b) � ℓ(a) = r(a) � L, yielding 1<br />
� L, which contradicts L � R. In particular,<br />
a r + d = 1, for some r � R and d � r(a),<br />
whence a 2 r = a. This proves that R is a<br />
strongly regular ring. �<br />
Following [1], a ring R is said to be<br />
quasi-strongly right bounded (briefly,<br />
QSRB) if every non-zero maximal right<br />
ideal contains a non-zero two-sided sub<br />
ideal of R.<br />
Lemma 2.8[1]:<br />
Let R be a QSRB-ring. Then, R / Y(R) is<br />
a reduced ring.<br />
Theorem 2.9:<br />
If R is a right SF-ring and QSRB-ring,<br />
then R is a strongly regular ring.<br />
Proof:<br />
Let R be a QSRB-ring, then by Lemma<br />
2.8, R / Y(R) is a reduced ring. We claim<br />
that Y(R) = (0). Suppose that Y(R) � (0),<br />
then by [4], there exists 0 � y � Y(R) such<br />
that y 2 = 0. Let M be a maximal right ideal<br />
containing r(y). Since r(y) is a maximal<br />
two-sided ideal of R, then M must be<br />
maximal two-sided ideal of R. On the other<br />
hand since R / M is a right flat, and since y<br />
� M, there exists c � M such that y = c y,<br />
whence (1-c) � r(y) � M, yielding 1�M,<br />
which contradicts M � R. This proves that R<br />
is a reduced ring. In order to show that R is<br />
strongly regular, we need to show that a R +<br />
r(a) = R, for any a � R. Suppose that a R +<br />
r(a) � R, then there exists a maximal right<br />
ideal L containing a R + r(a). But a � L and<br />
R / L is a right flat, there exists b � L such<br />
that a = b a, whence (1-b) � ℓ(a) = r(a) � L,<br />
yielding 1 � L, which contradicts L � R. In<br />
particular, a r + d = 1, for some r � R and d<br />
� r(a), whence a 2 r = a. This proves that R is<br />
strongly regular ring. �<br />
Recall that an element c � R is said to be<br />
right (left) regular if r(c) = 0 (ℓ(c) = 0).<br />
Proposition 2.10([16, Proposition 4]):<br />
If R is a right SF-ring, then any left<br />
regular element is right invertible in R.<br />
Finally we give the following result.<br />
Theorem 2.11:<br />
Let R be a reduced ring such that for<br />
every a � R, R / r(a n ) is an SF-ring, for<br />
some positive integer n. Then, R is a<br />
strongly �-regular ring.<br />
Proof:<br />
101
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 100-105, 2011<br />
Let a be a non-zero element in R, and let<br />
a´ n = a + r(a n ) � R / r(a n ), for some<br />
positive integer n. Clearly, a´ n � 0´ because<br />
otherwise if a´ n = 0´, then a + r(a n ) = r(a n ),<br />
and this yields a � r(a n ) and hence a n+1 = 0,<br />
gives a = 0 since R is reduced, this is<br />
contradiction. Let a´ n x´ = 0´, we shall prove<br />
that x´ = 0´. Observe that (a + r(a n )) (x +<br />
r(a n )) = r(a n ), implies a x + r(a n ) = r(a n ),<br />
and hence a x � r(a n ), so a n+1 x = 0, thus x<br />
� r(a n+1 ). Since R is reduced, therefore, x �<br />
r(a n ) implies a n x = 0, whence x � r(a n ).<br />
Hence x´ = 0´, this means that a´ n is a right<br />
non-zero divisor. Likewise we can prove<br />
that a´ n is a left non-zero divisor. Since<br />
R / r(a n ) is SF-ring, then by Proposition<br />
2.11, a´ n is invertible element. Then, there<br />
exists 0´� y´ n = y + r(a n )<br />
� R / r(a n ) such that a´ n y´ = 1, then (a +<br />
r(a n )) (y + r(a n )) = 1 + r(a n ). So (a y – 1)<br />
� r(a n ), and a n (a y – 1) = 0. Thus, a n+1 y =<br />
a n . This proves that R is strongly �-regular<br />
ring. �<br />
102<br />
3. SSF-RINGS<br />
In this section we continue studying SSFrings,<br />
which was introduced by R. D.<br />
Mahmood and Z. M. Ibraheem in [13].<br />
Furthermore, we find several properties for<br />
it and we connection such rings with other<br />
types of rings.<br />
We start this section with the following<br />
definitions.<br />
Definition 3.1:<br />
Recall that for any ring R, and an ideal I<br />
of R, R / I is called singular if I is an<br />
essential right ideal of R.<br />
Definition 3.2[13]:<br />
A ring R is called a right (left) SSF-ring<br />
if every simple singular right (left) Rmodule<br />
is flat.<br />
Lemma 3.3[17]:<br />
For any a � C(R), if a = a r a for some r<br />
� R, then there exists b � C(R) such that a =<br />
a b a, where C(R) is the center of R.<br />
Following [21], a ring R is said to semicommutative<br />
if x y = 0 implies x R y = 0,<br />
for x, y � R. Or, for each a � R, ℓ(a)<br />
(equivalently r(a)) is a two-sided ideal of R<br />
[11]. Clearly every reduced ring is semicommutative.<br />
The following result is a relation between<br />
right SSF-rings and C(R), which is von<br />
Neumann regular ring by adding semicommutative<br />
ring.<br />
Theorem 3.4:<br />
Let R be a semi-commutative right SSFrings,<br />
then C(R) is a von Neumann regular<br />
ring.<br />
Proof:<br />
First we will show that a R + r(a) = R, for<br />
any a � C(R). If not, there exists a maximal<br />
right ideal M of R such that a R + r(a) � M.<br />
Since a � C(R), a R + r(a) is an essential<br />
right ideal and so M must be an essential<br />
right ideal of R. Therefore, R / M is a right<br />
flat. So, there exists b � M such that a = b a.<br />
This implies that (1-b) � ℓ(a). Since R is<br />
semi-commutative, then ℓ(a) � r(a), for<br />
each a � R. Therefore, (1-b) � r(a) � M and<br />
so 1 � M, which is a contradiction.<br />
Therefore, a R + r(a) = R, for any a � C(R)<br />
and so we have a = a r a, for some r � R.<br />
Applying Lemma 3.3, we obtain that C(R) is<br />
a von Neumann regular ring. �<br />
The following result is a slightly<br />
improvement of Theorem 2.4 of [13].<br />
Theorem 3.5:<br />
If R is a semi-commutative and SSFring,<br />
then R is a reduced ring.<br />
Proof:<br />
Let a 2 = 0. Suppose that a � 0. Then,<br />
there exists a maximal right ideal M of R<br />
containing r(a).<br />
First observe that M is an essential right<br />
ideal of R. If not, then M is a direct<br />
summand of R. So, we can write M = r(e),<br />
for some 0 � e = e 2 � R. Since a � M and<br />
every idempotent in R is central; a e = e a =<br />
0. Thus, e � r(a) � M = r(e), whence e = 0.<br />
It is a contradiction. Therefore, M must be<br />
an essential right ideal of R. Thus, R / M is<br />
right flat and so there exists b � M such that<br />
a = b a. If we set b = e, then a = e a.<br />
Therefore, (1-e) �ℓ(a). Thus, (1-e) a = 0,<br />
this implies that a = e a = a e. Therefore, (1e)<br />
� r(a) � M. But, also e � M, whence, 1 �<br />
M. This is a contradiction. Therefore, a = 0<br />
and so R is a reduced. �<br />
Lemma 3.6[11]:<br />
If R is a semi-commutative ring, then R a
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 100-105, 2011<br />
R + r(a) is an essential right ideal of R, for<br />
every a � R.<br />
Theorem 3.7:<br />
If R is a semi-commutative and SSFrings,<br />
then R is a right weakly regular ring.<br />
Proof:<br />
We will show that R a R + r(a) = R, for<br />
any a � R. Suppose that there exists b � R<br />
such that R b R + r(b) � R. Then, there<br />
exists a maximal right ideal M of R<br />
containing R b R + r(b) . Therefore, by<br />
Lemma 3.6, M must be an essential right<br />
ideal of R. Thus, R / M is a right flat. So, for<br />
each b � M, there exists c � M such that b<br />
= c b. This implies that (1-c) � ℓ(b). Since<br />
R is a semi-commutative and SSF-ring, then<br />
by Theorem 3.5, R is a reduced ring. Thus,<br />
ℓ(b) = r(b). Therefore, (1-c) � r(b) � M and<br />
so1 � M, a contradiction. Then, R a R + r(a)<br />
= R, for any a � R. Hence R is a right<br />
weakly regular ring. �<br />
Proposition 3.8([20, Proposition 4.7]):<br />
Let R be a right quasi-duo ring. The<br />
following statements are equivalent.<br />
(1) R is a right weakly regular ring.<br />
(2) R is a strongly regular ring.<br />
Recall that R is a 2-primal ring [3] if<br />
P(R) = N(R), where P(R) is the prime<br />
radical of R and N(R) is the set of all<br />
nilpotent elements.<br />
Theorem 3.9:<br />
Let R be a 2-primal ring. If R is an SSFring,<br />
then R / P(R) is weakly regular.<br />
Proof:<br />
Let 0´� a´ � R´ = R / P(R). We will show<br />
that R´ a´ R´ + r(a´) = R´. If it is not true,<br />
then there exists a maximal right ideal M of<br />
R such that R´ a´ R´ + r(a´) � M / P(R).<br />
Since R´ is reduced, we have that r(a´) =<br />
ℓ(a´), for any a´� R´. Then, by Lemma 3.6,<br />
R´ a´ R´ + r(a´) is an essential right ideal of<br />
R´. Thus, M / P(R) must be right essential in<br />
R´. Therefore, R / M is simple singular right<br />
R-module and R / M is right flat. So, there<br />
exists b´ � M / P(R) such that a´ = b´a´. This<br />
implies that (1- b´) � ℓ(a´) = r(a´) � M /<br />
P(R), this implies that 1 � M / P(R), which<br />
is a contradiction. Therefore, R / P(R) is<br />
right weakly regular, which completes the<br />
proof. �<br />
Theorem 3.10:<br />
If R is a 2-primal, right quasi-duo and<br />
SSF-rings, then R is a �-regular ring.<br />
Proof:<br />
Let R be a 2-primal and right SSF-ring,<br />
then by Theorem 3.9, R / P(R) is weakly<br />
regular. Therefore, by Proposition 3.8, R /<br />
P(R) is a strongly regular. Thus, by [9,<br />
Theorem 1], R is �-regular ring. �<br />
Lemma 3.11([20, Proposition 4.4]):<br />
Let R be a right quasi-duo ring. Then, R /<br />
J(R) is a reduced ring.<br />
Proposition 3.12:<br />
Let R be a right quasi-duo ring. If R is<br />
SSF-ring, then R / J(R) is a strongly regular<br />
ring.<br />
Proof:<br />
Let R be a right quasi-duo ring, then by<br />
Lemma 3.11, R / J(R) is reduced. Thus, by<br />
the same methods in the proof of Theorem<br />
3.9, R / J(R) is weakly regular. Therefore,<br />
by Proposition 3.8, R / J(R) is strongly<br />
regular. �<br />
Recall that a ring R is called right weakly<br />
continuous [18] if J(R) = Y(R), R / J(R) is<br />
regular and idempotent can be lifted modulo<br />
J(R).<br />
The following lemma is due to Ming in<br />
[15].<br />
Lemma 3.13:<br />
If Y(R) contains no non-zero nilpotent<br />
element, then Y(R) = (0).<br />
Following [7], a ring R is called<br />
reversible if ab=0 implies ba=0 for a, b � R.<br />
Lemma 3.14[10]:<br />
If R is a reversible ring, then r(a) = ℓ(a),<br />
for each a � R.<br />
Finally we prove the following result.<br />
Theorem 3.15:<br />
For a reversible ring R, the following<br />
statements are equivalent:<br />
(1) R is a von Neumann regular;<br />
(2) R is right weakly continuous and right<br />
SSF-ring.<br />
Proof:<br />
(1) � (2). Observe that if R is von<br />
Neumann regular, then R is SF-ring [20] and<br />
hence it is SSF-ring.<br />
(2) � (1). Suppose that Y(R) � (0). Then,<br />
by Lemma 3.13, we may assume that Y(R)<br />
is not reduced. So, there exists non-zero a �<br />
Y(R) such that a 2 = 0. We claim that Y(R) +<br />
r(a) = R. If not, there exists a maximal<br />
essential right ideal M containing Y(R) +<br />
r(a). Thus, R / M is a right flat. Therefore,<br />
there exists b � M such that a = b a. This<br />
implies that (1-b) � ℓ(a). Since R is<br />
103
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 100-105, 2011<br />
reversible, then by Lemma 3.14, ℓ(a) = r(a)<br />
and hence (1-b) � r(a) � M. Thus, 1 � M,<br />
which is a contradiction. Therefore, Y(R) +<br />
r(a) = R. Hence we can write 1 = c + d, for<br />
some c � Y(R) and d � r(a). Thus, a = c a<br />
and so (1-c) a = 0. Since c � Y(R) = J(R), 1c<br />
is invertible. Thus, a = 0, which is also<br />
contradiction. Therefore, Y(R) is reduced<br />
and so Y(R) = (0). �<br />
REFERENCES<br />
- Abdullah J. S. A. (2003), On YJ-Injectivity, Ph. D.<br />
Thesis, Mosul Univ.<br />
- Azumaya G. (1954), Strongly �-regular rings, J. Fac.<br />
Sci. Hokkaida Univ. Vol.13, 34-39.<br />
- Birkenmeier G. F., Heatherly H. E. and Enoch K.<br />
Lee, Completely prime ideals and associated<br />
radicals, Proc. Bienniar Ohio State-Denison<br />
Conference 1992, edited by Jain S. K. and<br />
Rizvi S. T., World Scientific, New Jersey<br />
(1993), 102-129.<br />
- Birkenmeier G. F. and Tucci R. P. (1988),<br />
Homomorphic image and the singular ideal of<br />
a strongly right bounded rings, Comm.<br />
Algebra, 16, 1099-1112.<br />
- Camillo D. M. and Yu H. P. (1994), Weakly regular<br />
rings, Comm. Algebra, 22 (10), 4095-4112.<br />
- Chen J. L. and Ding N. Q. (1999), On general<br />
principally injective rings, Comm. Algebra,<br />
27(5), 2097-2116.<br />
- Cohn P. M. (1999), Reversible rings, Bull. London<br />
Math. Soc., 31, 641-648.<br />
- Faith C. (1973), Algebra: Rings, Modules and<br />
Categories I, Springer-Verlag Berlin<br />
Heidelberg New York.<br />
- Hirano Y. (1978), Some studies on strongly �regular<br />
rings, Math. J. Okayama Univ. 20,<br />
141-149.<br />
104<br />
- Kim N. K. and Lee Y. (2003), Extensions of<br />
reversible rings, Journal of Pure and Applied<br />
Algebra 185, 207-223.<br />
- Kim N. K., Nam S. B. and Kim J. Y. (1999), On<br />
simple singular GP-injective modules, Comm.<br />
Algebra, 27(5), 2087-2096.<br />
- Luh J. (1964), A note on strongly regular rings,<br />
Proc. Japan Acad., Vol. 40, 74 -75.<br />
- Mahmood R. D. and Ibraheem Z. M. (2004), On<br />
rings whose simple singular R-modules are<br />
flat, Raf. Jour. Sci-, 5(1), 82-84.<br />
- McCoy N. H. (1939), Generalized regular rings,<br />
Bull. Amer. Math. Soc. Vol. 45, 175-178.<br />
- Ming R. Y. C. (1978/1979), On Von Neumann<br />
regular rings III, Monatsh. Math., 86 (3), 251-<br />
257.<br />
- Ming R. Y. C. (2003), On injectivity and Pinjectivity<br />
IV, Bull. Korean Math. Soc. 40, No.<br />
2, PP.223-234.<br />
- Nam S. B. (1999), A note on simple singular GP-<br />
Injective modules, Kangweon-Kyungki Math.<br />
Jour. 7(2), 215-218.<br />
- Nicholson W. K. and Yousif M. F. (2001), Weakly<br />
continuous and C2-rings, Comm. Algebra,<br />
29(6), 2429-2446.<br />
- Ramamurthi V. S. (1973), Weakly regular rings,<br />
Canad. Math. Bull., 16(3), 317-322.<br />
- Rege M. B. (1986), On von Neumann regular rings<br />
and SF-rings, Math. Japonica 31, No. 6, 927-<br />
936.<br />
- Tominage H. (1977), On s-unital rings II, J.<br />
Okayama Univ., 19.<br />
- von Neumann J. (1936), On regular rings, Proc. Nat.<br />
Scad Sci. U. S. A. 22, 707-713.<br />
- Yu H. P. (1995), On quasi-duo rings, Glasgow Math.<br />
J. 37, 21-30.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 100-105, 2011<br />
يةوةوان يةناوَيث وومةي َوب ووتاي رةطةئ SF يرَوج ةل ) ثةض(<br />
تسار ةتاكةد ةك<br />
R<br />
يةقلةئ يةساهَيث<br />
ةتخوث<br />
يرَوج ةل ةقلةئ رةسةل ويةكةد كَيجرةم يةسارد ادةوةهيَلَوكَيل مةل . وور ةتبب R َوب ) ثةض(<br />
تسار يةداس<br />
. جرةم كَيدنةي يندركدايز ةب يكةرةس ينجامائ و تافيس ةل كَيدنةي ةوةتةنامويزَود ايةورةي . كَير ةتبب<br />
ينبةد ماوةدرةب شةمةئ يارةرةس . ىاكةقلةئ يرت يرَوج َلةط ةل ةوةتةواتسةب ىامةقلةئ مةئ شةمةئ يارةرةس<br />
يناكةتةفيس يرَوز ةرةي يةبرَوز ةوةتةنامويزود ايةورةي.<br />
R<br />
ل<br />
) رسيأ(<br />
نميأ طيسب رماغ لويدوم لكل ناك اذا<br />
ضعب اندجو كلذك ،ةمظتنم حبصت يك<br />
SSF<br />
SF<br />
يرَوج ةل ىاكةقلةئ يندركةسارد َوب<br />
ىاكةقلةئ يرت يناكةرَوج َلةطةل ةيةقلةئ مةئ ةوةتةنامواتسةب ايةورةي<br />
SF<br />
SF<br />
طمنلا نم<br />
) رسيأ(<br />
نميأ اهنأب<br />
ةقلحلا ىلع طورش عضو ةسرد مت ثحبلا اذه يف<br />
R<br />
ةصلاخلا<br />
ةقلح فرعت<br />
. احطسم<br />
نم ىرخأ طامنأ عم ةقلحلا هذه انطبر ،كلذ ىلا ةفاضأ . طورشلا ضعب ةفاضأب اهل ةيسيئرلا جئاتنلا و صاوخلا<br />
مث اهل صاوخلا نم ددع اندجو كلذك<br />
.<br />
SSF<br />
طمنلا نم تاقلحلا ةسارد<br />
انلوانت كلذ ىلا ةفاضأ<br />
. تاقلحلا<br />
.<br />
تاقلحلا نم ىرخأ طامنأ عم ةقلحلا هذه انطبر<br />
105
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 106-111, 2011<br />
106<br />
THE EXISTENCE AND UNIQUENESS SOLUTION FOR NONLINEAR<br />
SYSTEM OF FRACTIONAL INTEGRO-DIFFERENTIAL EQUATIONS<br />
HUSSEIN J. ZEKRY<br />
Dept. of Mathematics, Faculty of Science, University of Zakho, Kurdistan Region, Iraq.<br />
(Received: July 7, 2010; Accepted for publication: June 4, 2011)<br />
ABSTRACT<br />
This paper deals with existence and uniqueness of solutions for a nonlinear integro-differential equation of<br />
fractional order � ; � � R , 0��� 1,<br />
with fractional initial condition. Our results are based on contraction mapping<br />
principle (Banach fixed point theorem) and Picard approximation method.<br />
KEYWORDS: Existence and Uniqueness Solution, Nonlinear Fractional Integro-differential Equation, Picard Approximation<br />
Method, Banach Fixed Point Theorem.<br />
I<br />
1. INTRODUCTION<br />
n the last few decades, fractional order<br />
models are found to be more adequate than<br />
integer order models for some real world<br />
problems. Fractional derivatives provide an<br />
excellent tool for the description of memory and<br />
hereditary properties of various materials and<br />
processes. Integro-differential equations arise in<br />
many engineering and scientific disciplines,<br />
often as approximation to partial differential<br />
equations, which represent much of the<br />
continuum phenomena. Many forms of these<br />
equations are possible. Some of the applications<br />
are unsteady aerodynamics and aero elastic<br />
phenomena, visco elasticity, visco elastic panel<br />
in super sonic gas flow, fluid dynamics,<br />
electrodynamics of complex medium, many<br />
models of population growth, polymer rheology,<br />
neural network modeling, sandwich system<br />
identification, materials with fading memory,<br />
mathematical modeling of the diffusion of<br />
discrete particles in a turbulent fluid, heat<br />
conduction in materials with memory, theory of<br />
lossless transmission lines, theory of population<br />
dynamics, compartmental systems, nuclear<br />
reactors, and mathematical modeling of a<br />
hereditary phenomena. For details, see [5, 6, 7]<br />
and the references therein.<br />
In recent years, there has been an interest in<br />
the study of fractional integro-differential<br />
equations. In [5], Schauder’s fixed-point<br />
theorem has been used to obtain local existence,<br />
and Tychonov’s fixed-point theorem to obtain<br />
global existence of solutions of fractional<br />
integro-differential equation. In [6], used Arzela-<br />
Ascoli lemma to obtain existence and<br />
uniqueness of solution of fractional integrodifferential<br />
equation. The existence of extremal<br />
solutions of the fractional integro-differential<br />
equations using comparison principle and Ascoli<br />
lemma has been investigated in [1]. While in<br />
[4, 8], some important results concerning with<br />
the stability, uniformly and asymptotically<br />
stability of solutions of fractional differential<br />
and integro-differential equations has been<br />
obtained. In [8], also we investigate the initial<br />
value problem for nonlinear fractional<br />
differential equations by using Banach fixed<br />
point theorem.<br />
In this work we considered the following<br />
nonlinear fractional integro-differential equation<br />
which has the form<br />
ht ()<br />
( � )<br />
u ( t ) �f( t , u( t )) � � g ( t , s, u( s )) ds , 0��� 1 (1.1)<br />
a<br />
with fractional initial condition<br />
( � �1)<br />
u () a � u0<br />
(1.2)<br />
u ��;( � is the set of all real<br />
Where 0<br />
n n<br />
numbers), f �C ( I �� , � ) and g �C ( I �I ��<br />
n<br />
n n<br />
, � ) where C( I �� , � ) is the set of all<br />
n<br />
continuous functions defined on I �� and<br />
n n<br />
C ( I �I �� , � ) is the set of all continuous<br />
n<br />
n<br />
functions defined on I �I �� , where �<br />
denotes the real n-dimensional Euclidean space,<br />
and I is a compact subinterval of [ ab , ] with<br />
0 � a � t � b , also ht () is a continuous function<br />
which is defined on the interval [ ab , ] .<br />
Our work is to extend some results of [8] by<br />
using both, Picard approximation method to<br />
obtain global existence and uniqueness solution<br />
and Banach fixed point theorem to obtain local<br />
existence and uniqueness solution of (1.1) and<br />
(1.2) respectively.<br />
n
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 106-111, 2011<br />
2. PRELIMINARIES<br />
In this section we present some definitions<br />
and lemmas which well be used in the sequel,<br />
see [2, 3].<br />
Definition 2.1. The Riemann-Liouville<br />
fractional integral of order � � 0 for a function g<br />
is defined as<br />
t<br />
�� 1<br />
� �1<br />
D g () t � g ( s ) �b �s�ds<br />
�( �)<br />
� (2.1)<br />
0<br />
Provided that this integral (Lebesgue) exist,<br />
where Γ is the Gamma function.<br />
Definition 2.2. The fractional derivative (in the<br />
sense of Riemann-Liouville) of order 0
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 106-111, 2011<br />
�<br />
h( s)<br />
� �1<br />
� ( t �a)<br />
u<br />
f ( s, uo( s )) � � g ( s, �, uo( � )) d� �ds<br />
�<br />
� �(<br />
�)<br />
a<br />
�<br />
108<br />
1<br />
� � �<br />
�(<br />
�)<br />
t<br />
� �1<br />
� ( t s ) � f ( s, uo ( s ))<br />
a<br />
h( s)<br />
� � b ( C1�hC2) � g ( s, � , uo ( � )) d� �ds<br />
�<br />
� �( � �1)<br />
a<br />
�<br />
that is:<br />
u ( t ) �u) �<br />
1 0<br />
Cb �<br />
�( � � 1)<br />
*<br />
1 () � u t � D where<br />
*<br />
u0� Df,<br />
t ��.<br />
and by mathematical induction we get that<br />
Um (t) –Uo(t)<br />
Cb �<br />
�( � � 1)<br />
which shows that<br />
*<br />
um () t � D<br />
where<br />
*<br />
u0� Df,<br />
t ��, for m � 0,1,2, ... .<br />
Next, we prove the uniformly convergent of<br />
the sequence of functions (3.3) in the<br />
domain *<br />
D , so for m � 1,<br />
we have:<br />
� �1<br />
( t �a)<br />
u 0 1<br />
u 2( t ) �u1( t ) � � ( t � s )<br />
�( �) �(<br />
�)<br />
� � �<br />
�f( s , u ( s )) g ( s, , u ( )) d �ds<br />
� �<br />
� � �<br />
� �1<br />
h( s)<br />
� �1<br />
( t a) u 0<br />
1 � � � 1 � � � �<br />
( �)<br />
a<br />
t<br />
h( s)<br />
� �<br />
� �1<br />
�( � ) � ( , 0( )) � ( , � , 0(<br />
� )) �<br />
� �<br />
�<br />
�<br />
a a<br />
1<br />
t s f s u s g s u d ds<br />
�( �)<br />
� �<br />
t<br />
� ( t<br />
a<br />
� �1<br />
s ) ( f ( s, u1( s )) f ( s, u 0(<br />
s ))<br />
1<br />
� � �<br />
�(<br />
�)<br />
that is<br />
h( s)<br />
�<br />
� g ( s, � , u ( � )) �g(<br />
s, � , u ( � )) d� ) ds<br />
1 0<br />
a<br />
t<br />
� ( t<br />
a<br />
� �1<br />
s ) ( L1 u1( s ) u 0 ( s )<br />
1<br />
� � � �<br />
�(<br />
�)<br />
h( s)<br />
�<br />
a<br />
L u ( � ) �u<br />
( � ) d� ) ds<br />
2 1 0<br />
C b �b( L � h L ) �<br />
�( � �1) � �( � �1)<br />
�<br />
� �<br />
2( ) � 1(<br />
) � �<br />
1 2<br />
�<br />
u t u t<br />
for m � 2<br />
t<br />
�<br />
a<br />
0<br />
t<br />
1<br />
� �1<br />
3 2 2<br />
�(<br />
�)<br />
�<br />
a<br />
u ( t ) �u ( t ) � ( t � s ) ( f ( s , u ( s )) �<br />
h( s)<br />
�<br />
f ( s, u ( s )) � g ( s, � , u ( � )) �g(<br />
s, � , u ( � )) d� ) ds<br />
1 2 1<br />
a<br />
t<br />
1<br />
�<br />
�(<br />
�)<br />
�<br />
a<br />
�<br />
� �1<br />
1 2 � 1<br />
that is<br />
( t s ) ( L u ( s ) u ( s )<br />
h( s)<br />
�<br />
� L u ( � ) �u(<br />
� ) d� ) ds<br />
a<br />
2 2 1<br />
� �<br />
2<br />
C b �b( L1�hL2) �<br />
3( ) � 2(<br />
) � � �<br />
u t u t<br />
�( � �1) � �( � �1)<br />
�<br />
suppose that the inequality<br />
� �<br />
n<br />
C b �b( L1�hL2) �<br />
n�1( ) � n(<br />
) � � �<br />
u t u t<br />
�( � �1) � �( � �1)<br />
�<br />
is true for some m=n, we have to show that<br />
� �<br />
n �1<br />
C b �b( L1�hL2) �<br />
n�2( ) � n�1(<br />
) � � �<br />
u t u t<br />
is also true.<br />
�( � �1) � �( � �1)<br />
�<br />
t<br />
1<br />
� �1<br />
n �2 n �1 n �1<br />
�(<br />
�)<br />
�<br />
a<br />
u ( t ) �u ( t ) � ( t � s ) ( f ( s, u ( s )) �<br />
h( s)<br />
�<br />
f ( s, u ( s )) � g ( s , � , u ( � )) �g(<br />
s , � , u ( � )) d� ) ds<br />
n n �1<br />
n<br />
a<br />
t<br />
1<br />
( t<br />
( �)<br />
�<br />
a<br />
� �1<br />
s ) ( L1 u n�1( s ) u n(<br />
s )<br />
� � �<br />
�<br />
h( s)<br />
�<br />
� L u ( � ) �u(<br />
� ) d� ) ds<br />
a<br />
2 n�1 n<br />
� �<br />
n<br />
C b �b( L1�hL2) �<br />
� � �<br />
�( � �1) � �( � �1)<br />
�<br />
1<br />
( �)<br />
that is<br />
t<br />
h( s)<br />
( �<br />
� �1<br />
) ( 1� 2 � )<br />
a a<br />
t s L L d ds<br />
� � �<br />
� �<br />
n �1<br />
C b �b( L1�hL2) �<br />
n�2( ) � n�1(<br />
) � � �<br />
u t u t<br />
�( � �1) � �( � �1)<br />
�<br />
thus by mathematical induction we get<br />
� �<br />
m<br />
C b �b( L1�hL2) �<br />
m�1( ) � m(<br />
) � � �<br />
u t u t<br />
�( � �1) � �( � � 2) �<br />
for m � 0,1,2, ... .<br />
from the above we deduce that, for<br />
p � 0, we have<br />
u ( t ) �u ( t ) � u ( t ) �u ( t ) �<br />
m � p m m � p m � p �1<br />
u ( t ) �u ( t ) �... � u ( t ) �<br />
u ( t )<br />
m � p �1 m � p �2 m �1<br />
m
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 106-111, 2011<br />
� �<br />
m�p�1 �<br />
� ( 1�2) �<br />
C b b L h L C b<br />
� � � �<br />
�( � �1) � �( � �1) � �( � �1)<br />
�<br />
m �p�2 m<br />
� �<br />
( 1 � 2 ) Cb ( 1 � 2 )<br />
� b L hL � �b L hL �<br />
� � �... � � �<br />
� �( � �1) � �( � �1) � �( � �1)<br />
�<br />
� �<br />
m<br />
�<br />
� 1 � � � 2 1 � 2<br />
C b b ( L h L ) b ( L h L )<br />
� � � �1�<br />
�<br />
�( � �1) � �( � �1) � � �( � �1)<br />
�<br />
2<br />
�<br />
p �1<br />
� b ( L1 �hL2) � �b ( L1 �hL2)<br />
� �<br />
� � �... � � � �...<br />
�<br />
� �( � �1) � � �( � �1)<br />
� �<br />
�<br />
(3.6)<br />
from inequality (3.2) we conclude that (3.6)<br />
*<br />
is uniformly convergent on the domain D .<br />
�<br />
u () t is a uniform<br />
Hence the sequence � �<br />
m �1 m � 0<br />
0 convergent sequence to u () t , i.e.<br />
0<br />
lim um ( t ) u ( t )<br />
m ��<br />
� . Then<br />
� �1<br />
t<br />
( t � a) u 0 1<br />
� �1<br />
lim ( t s ) �f<br />
( s, u m ( s ))<br />
m �� �( �) �(<br />
�)<br />
�<br />
a<br />
� ( � ) 1<br />
�<br />
� �( �) �(<br />
�)<br />
h( s)<br />
� g ( s , � , u m ( � )) d� �ds<br />
�<br />
a<br />
t<br />
� �1<br />
a u 0<br />
�<br />
t<br />
h( s)<br />
� �<br />
� �1<br />
� �<br />
( t �s) �f( s , u ( s )) � g ( s, � , u ( � )) d� �ds<br />
� �<br />
� �<br />
a a<br />
� � �<br />
t<br />
1<br />
� �1<br />
lim ( t s ) ( f ( s, u m ( s )) f ( s, u ( s ))<br />
m �� �(<br />
�)<br />
�<br />
a<br />
� � �<br />
h( s)<br />
�<br />
� g ( s, � , u ( � )) �g(<br />
s, � , u ( � )) d� ) ds<br />
a<br />
�<br />
�<br />
�<br />
1<br />
� �<br />
t<br />
lim � ( t<br />
m �� �(<br />
�)<br />
�<br />
a<br />
� �1<br />
s ) ( L1 u m ( s ) u ( s )<br />
m<br />
h( s)<br />
�<br />
� L2 � u m ( � ) �u ( � ) d� ) ds � � 0<br />
a<br />
��<br />
0 *<br />
Hence u () t �D and is a solution of the<br />
nonlinear fractional integro-differential equation<br />
(1.1) with fractional initial condition (1.2).<br />
Theorem 3.2. Assume that the hypotheses H1,<br />
H2 and H3 are satisfying. Then the nonlinear<br />
fractional integro-differential equation (1.1) with<br />
fractional initial condition (1.2) has a unique<br />
solution.<br />
Proof: Let us consider w() t to be another<br />
solution of (1.1) which satisfies (1.2), that is<br />
� �1<br />
t<br />
( t �a)<br />
u 0 1<br />
� �1<br />
( ) � � ( � ) ( , ( ))<br />
w t t s f s w s<br />
�( �) �(<br />
�)<br />
a<br />
h( s)<br />
�<br />
� � g ( s , � , w ( � )) d� �ds ��<br />
a<br />
hence we have<br />
t<br />
1<br />
� �1<br />
w ( t ) �u ( t ) � ( t � s ) ( f ( s, w ( s )) �<br />
�(<br />
�)<br />
�<br />
h( s)<br />
�<br />
a<br />
f ( s, u ( s )) � g ( s, � , w ( � )) �g(<br />
s , � , u ( � )) d� ) ds<br />
�<br />
a<br />
t<br />
� ( t<br />
a<br />
� �1<br />
s ) ( L1 w ( s ) u ( s )<br />
1<br />
� � � �<br />
�(<br />
�)<br />
t�[0, b]<br />
h( s)<br />
�<br />
a<br />
L w ( � ) �u<br />
( � ) d� ) ds<br />
2<br />
max w ( t ) u( t ) max w ( t ) �u<br />
( t )<br />
� �<br />
t�[0, b]<br />
�<br />
�b( L1�hL2) �<br />
� �<br />
� �( � �1)<br />
�<br />
Which is a contradiction by inequality (3.2),<br />
thus we have<br />
w ( t ) �u( t ) � 0<br />
hence w ( t ) � u( t ) .<br />
Example 3.1: Consider the following nonlinear<br />
fractional integrodifferential equation<br />
(0.5) 1 ut ()<br />
y () t � �<br />
24 2<br />
(4 �t) (1 � u ( t ) )<br />
t<br />
us ( )<br />
��<br />
ds<br />
t�s (2e �10)(2 � u ( s ) )<br />
0<br />
with fractional initial condition<br />
( �0.5)<br />
y (0) � 0<br />
on the closed interval [0,1] , here<br />
1 ut () 1<br />
f ( t , u ( t )) � � � ,<br />
24 2<br />
(4 �t) (1 � u( t ) ) 12<br />
us ( ) 1<br />
g ( t , s, u ( s )) � � ,<br />
t�s (2e �10)(2 � u( s ) ) 12<br />
f ( t , u ( t )) � f ( t , u ( t ))<br />
2 1<br />
1 u2( t ) u1( t )<br />
� �<br />
2<br />
(4 �t<br />
) (1 � u ( t ) ) (1 � u ( t ) )<br />
1<br />
� u2( t ) �u1(<br />
t )<br />
16<br />
g ( t , s, u2( s )) � g ( t , s, u1( s ))<br />
�<br />
2 1<br />
1 u2( s ) u1( s )<br />
� �<br />
t�s (2e �10)<br />
(2 � u ( s ) ) (2 � u ( s ) )<br />
1<br />
� u2( s ) �u1(<br />
s )<br />
16<br />
2 1<br />
109
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 106-111, 2011<br />
110<br />
and h( t ) � t � h � 1<br />
hence the conditions H1 H2 and H3 hold with<br />
1 1<br />
C1 �C 2 � , L1 � L2<br />
� , b � 1,<br />
12 16<br />
�<br />
b ( L1�hL2) 1/8<br />
� � 0.141 � 1.<br />
�( � �1) �(1.5)<br />
Therefore by Theorem 3.1 and Theorem 3.2<br />
the given nonlinear fractional integrodifferential<br />
equation with given fractional initial condition<br />
has a unique solution on the interval [0, 1].<br />
Ii. Banach Fixed Point Theorem<br />
In this part we apply Banach fixed point<br />
theorem to show the existence and uniqueness<br />
of solutions for nonlinear fractional integrodifferential<br />
equation (1.1) with fractional initial<br />
condition (1.2).<br />
n n<br />
Theorem 3.3. Let the function f �C ( I �� , � )<br />
n n<br />
and g �C ( I �I �� , � ) , and that they satisfy<br />
the conditions H2 and H3 respectively, then the<br />
nonlinear fractional integro-differential equation<br />
(1.1) with fractional initial condition (1.2) has a<br />
n<br />
C( I, � ), . .<br />
unique solution in � �<br />
Proof: Let us consider the mapping � on<br />
n<br />
C( I, � ), . as:<br />
� �<br />
� �1<br />
( t � a) u 1<br />
0<br />
� �1<br />
� � � �<br />
� u ( t ) � � ( t � s ) f ( s , u ( s ))<br />
�( �) �(<br />
�)<br />
t<br />
a<br />
h( s)<br />
�<br />
� � g ( s, � , u ( � )) d� �ds ��<br />
a<br />
Since f ( t , u) and g ( t , s, u) belong to<br />
n n<br />
n n<br />
C( I �� , � ) and C ( I I , )<br />
then it is clear that<br />
t<br />
h( s)<br />
� �1<br />
� �� � respectively,<br />
t<br />
( �<br />
� �1<br />
) ( , ( ))<br />
�<br />
a<br />
t s f s u s ds ,<br />
and �( t � s ) � g ( s, �, u( � )) d� ds are also in<br />
a a<br />
n<br />
C( I, � ) and it shows that:<br />
n n<br />
� u( t ) : C ( I , � ) �C ( I , � ) .<br />
� �<br />
n<br />
By Lemma 2.1 the space � ( , ), . �<br />
C I � is a<br />
Banach space. Next we shall show that the<br />
n<br />
mapping � is a contraction in C([0, b], � ) , let<br />
w() t and ut () be any two functions that belong<br />
n<br />
to C( I, � ) , and consider:<br />
� � � �<br />
� �1<br />
( t �a)<br />
u 0 1<br />
� w ( t ) � � u ( t ) � � ( t � s )<br />
�( �) �(<br />
�)<br />
h( s)<br />
� �<br />
� �1<br />
� �1<br />
h( s)<br />
� �1<br />
� � ( t �a)<br />
u 0<br />
�f( s , w ( s )) � g ( s , � , w ( � )) d� ds � �<br />
� �<br />
�<br />
�<br />
� �(<br />
�)<br />
a<br />
�<br />
t<br />
1<br />
( t �s) �f( s , u ( s )) � g ( s , � , u ( � )) d� �ds<br />
�( �)<br />
� � �<br />
�<br />
a � a<br />
�<br />
�<br />
�<br />
�<br />
1<br />
� �<br />
t<br />
max � ( t<br />
t �[<br />
a, b ] �(<br />
�)<br />
�<br />
a<br />
� �1<br />
s ) ( f ( s, w ( s )) f ( s, u ( s ))<br />
h( s)<br />
�<br />
� � g ( s, � , w ( � )) �g( s, � , u ( � )) d� ) ds �<br />
��<br />
a<br />
�<br />
�<br />
�<br />
L<br />
� �<br />
t<br />
1 max � ( t<br />
t �[<br />
a, b ] �(<br />
�)<br />
�<br />
a<br />
� �1<br />
s ) ( w ( s ) u ( s )<br />
�L2 h( s)<br />
�<br />
a<br />
w ( � ) �u( � ) d� ) ds �<br />
��<br />
b L h L<br />
� �<br />
�<br />
( 1�2) max w ( t ) u ( t )<br />
�( � �1)<br />
t�[ a, b ]<br />
that is<br />
��w ( t ) � � ��u ( t ) �<br />
�<br />
b ( L1�hL2) �<br />
�( � �1)<br />
w ( t )) �u<br />
( t ) (3.7)<br />
Consequently by inequalities (3.2) and (3.7),<br />
� is a contraction mapping. As a consequence<br />
of Banach fixed point theorem and lemma 2.2,<br />
we deduce that � has only one fixed point<br />
which is a solution of the nonlinear fractional<br />
integro- differential equation (1.1) with<br />
fractional initial condition (1.2).<br />
CONCLUSION<br />
In this paper, we studied the existence and<br />
uniqueness of solution of nonlinear fractional<br />
integrodifferential equation with fractional initial<br />
condition. Based on the Picard approximation<br />
method and Banach fixed point theorem the<br />
results are proved. We have noticed that the<br />
length of the interval I depends on the Lipschitz<br />
constants regarding to the functions f and g and<br />
the value of h .<br />
t<br />
�<br />
a<br />
�
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 106-111, 2011<br />
REFERENCES<br />
- R. El-Khazali and, S. M. Momani On the existence of<br />
extremal solutions of the fractional Integro-<br />
differential equations, J. Fractional Calculus,<br />
18(2000), 87-92.<br />
- K. M. Furati and N. Tatar, An existence result for a<br />
nonlocal fractional differential problem, J. Fract.<br />
Calc., 26(2000), 43-51.<br />
- K. S. Miller and B. Ross, An introduction to the<br />
Fractional Calculus and Fractional Differential<br />
Equations, John Wiley and Sons, Inc., New<br />
York, 1993.<br />
- S. Momani and S. Hadid, Lyapunov stability solutions of<br />
fractional Integro-differential equations, Int. J.<br />
Math. Sci., 47(2004), 2503-2507.<br />
- S. Momani, Local and global existence theorems on<br />
fractional integro-differential equations, J. Fract.<br />
Calc., 18(2000), 81-86. 435-444.<br />
- S. Momani, Some existence theorems on fractional<br />
Integro-differential equations, Abhath Al-Yarmouk<br />
Journal, 10:2B(2001),<br />
- I. Podlubny, Fractional Differential Equations,<br />
Academic Press, New York, 1999.<br />
- H. J. Zekry, Some existence and stability theorems for<br />
fractional differential and integro-differential<br />
equation, M.Sc Thesis, College of Education, Duhok<br />
Unv, (2008).<br />
111
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 112-118, 2011<br />
112<br />
SPECTROPHOTOMETRIC DETERMINATION OF PHENYLEPHRINE<br />
HYDROCHLORIDE IN PHARMACEUTICAL PREPARATIONS<br />
FIRAS MUHSEN AL-ESAWATI<br />
Dept. of Chemistry, Faculty of Science, University of Zakho, Kurdistan Region-Iraq<br />
(Received: July 21, 2010; Accepted for publication: February 3, 2011)<br />
ABSTRACT<br />
A simple, rapid and sensitive spectrophotometric method for determination of phenylephrine hydrochloride<br />
(PPH) in pure form as well as dosage forms is described. The method is based on the oxidative coupling of PPH with<br />
N,N-Diethyl-p-phenylenediamine monohydrochloride (N,N-DE-PPD) in present of N-Bromosuccinimide as oxidizing<br />
agent in sodium hydroxide medium. Beer's law is obeyed in the concentration range of 0.5 - 16 μg ml −1 for PPH with<br />
a molar absorptivity of 11381 L.mol -1 .cm -1 , the accuracy is 100.38% and the relative standard deviation was less than<br />
2.76%. The method was successfully applied for the determination of PPH in pharmaceutical preparations and the<br />
results agree favorably with the official and reported methods. Common excipients used as additives in<br />
pharmaceuticals do not interfere in the proposed method. The method offers the advantages of simplicity, rapidity<br />
and sensitivity without the need for extraction or heating.<br />
KEYWORDRS: Spectrophotometric, Oxidative Coupling, Phenylephrine Hydrochloride, Pharmaceutical Preparation<br />
P<br />
INTRODUCTION<br />
henylephrine hydrochloride (alphaadrenergic,<br />
sympathomimetic agent) is a<br />
useful vasoconstrictor of sustained action with<br />
little effect on the myocardium or the central<br />
nervous system. It is available in the following<br />
dosage forms: nasal drops, nasal spray, eye<br />
drops and phenylephrine injection (1) .<br />
Many analytical methods have been proposed<br />
for the determination of phenylephrine<br />
hydrochloride in pharmaceutical formulations (2,3)<br />
and biological samples (4,5) .<br />
Numerous methods have been reported for<br />
the determination of phenylephrine<br />
hydrochloride including spectrophotometry (6-12) ,<br />
fluorometry<br />
(13) , chemiluminescence (14) ,<br />
colorimetry (15) flow injection analysis (16) and<br />
chromatographic methods (17-20) .<br />
In this paper, We have tried to develop a<br />
method for determination of phenylephrine<br />
hydrochloride in nasal drops as pharmaceutical<br />
preparations which coupling with N,N-Diethylp-phenylenediamine<br />
monohydrochloride (N,N-<br />
DE-PPD) in present of N-Bromosuccinimide as<br />
oxidizing agent in sodium hydroxide medium.<br />
The method offers the advantages of simplicity,<br />
rapidity and sensitivity without the need for<br />
extraction.<br />
EXPERIMENTAL<br />
1- Apparatus<br />
A shimadzu model (UV-160A) double beam<br />
UV_VIS spectrometer with 1.0-cm matches<br />
silica cells was used to carry out all spectral<br />
measurements.<br />
A electo. mag (M 96K) water bath, HANNA<br />
model (pH 211) microprocessor pH-meter and<br />
AND model (HF-400) sensitive balance were<br />
used.<br />
2- Reagents<br />
All chemicals used were of analytical reagent<br />
grade standard. PPH was supplied by S.D.I.<br />
(Iraq), N,N-DE-PPD by Fluka, Nbromosuccinimide<br />
by Fluka, Sodium hydroxide<br />
by BDH, Hydrochloric acid by Fluka.<br />
- A stock solution of PPH (1000µg/ml) was<br />
prepared by dissolving 1.0 gm of pure PPH in<br />
1000 ml distilled water.<br />
- Working solution of DE-PPD (5×10 -3 M) was<br />
prepared by dissolving 0.1094 gm in 100ml<br />
distilled water.<br />
- N-Bromosuccinimide solution (3×10 -3 ) was<br />
prepared by dissolving gm in ml distilled water.<br />
- Sodium hydroxide solution (1.0M) was<br />
prepared by dissolving 1 gm in 250ml distilled<br />
water.<br />
3- General procedure<br />
Aliquots of working standard solution of PPH<br />
(0.25 – 4 mL of 100µg mL -1 ) were transferred<br />
into 25-mL calibrated flasks followed by 1.0 mL
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 112-118, 2011<br />
N,N-DE-PPD (5×10 -3 M), 3.0 mL of Nbromosuccinimide<br />
(3×10 -3 M), 0.1mL of sodium<br />
hydroxide. The solution was made up to the<br />
mark with distilled water, mixed thoroughly and<br />
the absorbance was measured at 500 nm against<br />
a reagent blank, and the calibration graph was<br />
constructed.<br />
Sample preparation<br />
4- Pharmaceutical preparations<br />
Nasal drops. – The following nasal drop<br />
formulations were purchased from local sources<br />
and used for the analysis: samsphrine (S.D.I.,<br />
Iraq) containing 0.25% PPH 10 mL –1 ,<br />
nasophrine (S.D.I., Iraq) containing 0.25% PPH<br />
10 mL –1 . A volume of 10 mL of nasal drops<br />
(equivalent to 25 mg of PPH) was diluted to 50<br />
mL with distilled water. The general procedure<br />
was then followed.<br />
RESULTS AND DISCUSSION<br />
1- Spectral characteristics<br />
The method involves the oxidation of PPH,<br />
followed by the coupling of DE-PPD in alkaline<br />
medium. The absorption spectra of the reaction<br />
product formed have absorption maxima at 685<br />
nm (Figure 1).<br />
Absorbance<br />
0.9<br />
0.8<br />
0.7<br />
0.6<br />
0.5<br />
0.4<br />
0.3<br />
0.2<br />
0.1<br />
0<br />
C<br />
400 500 600 700 800<br />
w avelength (nm)<br />
Fig (1): Absorption spectrum of (A): reaction product<br />
of PPH (8 μg mL -1 ) with DE-PPD (1 mL of 5×10 -5<br />
M), N-Bromosuccinimide ( 3 mL of 3×10 -3 M), and<br />
sodium hydroxide (0.3 mL of 0.1M). vs. blank. (B):<br />
Blank vs. D.W.<br />
B<br />
A<br />
2- Study of the optimum reaction conditions<br />
The effects of various parameters on the<br />
absorption intensity of the dye were studied and<br />
the reaction conditions were optimized.<br />
2.1- Effect of time and temperature<br />
The effect of time (5-60 min.) and<br />
temperature (0-60 o C) on the reaction of PPH<br />
and DE-PPD were studied. As (Figure 2) shows<br />
by increasing temperature the absorbance of<br />
reactions decreased with the time. Therefore, the<br />
absorbance of the reaction product measured<br />
directly at room temperature.<br />
Fig (2): Effect of time and temperature on absorbance<br />
of reaction product. a, b, c, d, and e are 0°C, room<br />
temp., 40°C, 50°C, and 60°C, respectively.<br />
2.2- Effect of pH<br />
In order to study the effect of pH on reaction<br />
product, buffer solutions covering the alkaline<br />
range (pH 8-12 were prepared by mixing<br />
different volumes of both 0.1M sodium<br />
hydroxide and 0.1 M hydrochloric acid ) were<br />
tried . The optimum pH was found to be higher<br />
alkaline media (pH ≥ 12) by adding 0.1 M of<br />
sodium hydroxide (Table.1).<br />
Table (1): effect of pH on the absorbance of<br />
reaction product.<br />
pH λ max(nm) Absorbance<br />
Sample vs.<br />
blank<br />
Blank vs.<br />
D.W.<br />
8 570 0.142 0.312<br />
9 570 0.131 0.321<br />
10 570 0.146 0.352<br />
11 570 0.175 0.381<br />
12 685 0.691 0.047<br />
≈ 13, 0.1<br />
M NaOH<br />
685 0.720 0.033<br />
113
Absorbance<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 112-118, 2011<br />
Influence of an other buffer solutions were<br />
studied with the time, but best results were<br />
obtained by using sodium hydroxide (Figure 3).<br />
Fig (3): Effect of buffer solutions (pH=12) on the<br />
absorbance of reaction product with the time. a, b, c,<br />
and d are NaOH solution, (NaOH+KCl, pH=12),<br />
(NaH2PO4+NaOH, pH=12), and (Na2HPO4+NaOH,<br />
pH=12) respectively.<br />
The effect of sodium hydroxide mL of 0.1M<br />
sodium hydroxide solutions were examined. The<br />
investigations showed that 0.3mL of 0.1M<br />
sodium hydroxide gave maximum<br />
absorbance(Figure 4.).<br />
0.9<br />
0.8<br />
0.7<br />
0.6<br />
0.5<br />
0.4<br />
0.3<br />
0.2<br />
0.1<br />
114<br />
0<br />
0 0.5 1 1.5<br />
ml of 0.1 M NaOH<br />
Fig (4): Effect of volume of 0.1M of sodium<br />
hydroxide on the reaction product.<br />
2.3- Effect of N-Bromosuccinimide<br />
The effect of different concentrations of working<br />
solution of N-Bromosuccinimide was studied,<br />
and constant absorbance values were obtained at<br />
3×10 -3 M. Above this concentration, a decrease in<br />
the absorbance was observed. Different volumes<br />
of this concentration were studied, 3.0 mL gave<br />
a maximum absorbance (Figure 5).<br />
Absorbance<br />
0.9<br />
0.8<br />
0.7<br />
0.6<br />
0.5<br />
0.4<br />
0.3<br />
0.2<br />
1 2 3 4 5 6 7<br />
ml of N-Bromosuccinimide<br />
Fig (5): Effect of volume of 3×10 -3 M of NBS<br />
on the reaction product<br />
2.4- Effect of coupling agent<br />
The effect of various concentration of<br />
coupling agent was studied using the proposed<br />
procedure, which found that 5×10 -3 M was the<br />
best for determination PPH. The influence of the<br />
volume of DE-PPD was studied. It was observed<br />
that 1.0 mL was the best volume (Figure 6).<br />
Absorbance<br />
0.9<br />
0.8<br />
0.7<br />
0.6<br />
0.5<br />
0.4<br />
0.3<br />
0.2<br />
0 0.5 1 1.5 2 2.5 3<br />
ml of DE-PPD<br />
Fig (6): Effect of volume of 5x10 -5 M of DE-PPD on<br />
the reaction product.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 112-118, 2011<br />
3- Calibration curve<br />
Under the above optimum conditions, the<br />
linear calibration curve (Figure 7) for PPH was<br />
obtained. Optical characteristics such as Beer’s<br />
law range, molar absorptivity, slope, intercept,<br />
of the method are presented in Table 2.<br />
Fig (7): Calibration curve for determination of PPH<br />
Compound Amount present<br />
(µg mL -1 )<br />
Phenylephrine<br />
Hydrochloride<br />
Table ( 2): Optical characteristics<br />
Parameters /<br />
Characteristics<br />
Color Blue<br />
ג max (nm) 685 nm<br />
Beer's law range (µg ml −1 ) 0.5-16<br />
Molar absorptivity (l mol −1<br />
cm −1 )<br />
Regression equation (Y =<br />
ax + b, where x is the<br />
concentration in µg ml −1 )<br />
Table (3): Accuracy and precision of the method.<br />
Amount added<br />
(µg mL -1 )<br />
11381<br />
Slope (a) 0.0559<br />
Intercept (b) 0.3603<br />
Correlation coefficient (r) 0.999<br />
4- Accuracy and precision<br />
The precision and accuracy of the proposed<br />
methods were evaluated by analysis of pure<br />
samples of PPH. The results are shown in Table<br />
3 indicate that satisfactory precision and<br />
accuracy could be attained with the proposed<br />
method.<br />
Recovery *<br />
(%)<br />
RSD **<br />
(%)<br />
2 2.07 103.50 1.69<br />
6 5.8 96.66 2.76<br />
10 10.1 101.00 1.99<br />
* Average of three determinations.<br />
** Average of six determinations<br />
115
Absorbance<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 112-118, 2011<br />
5- The nature of reaction product<br />
The composition of the reaction product was<br />
established by the continuous variations method<br />
and the mole ratio method (21) . These methods<br />
showed that a 1:1 reaction product of PPH and DE-<br />
PPD was formed (Figures. 8,9)<br />
116<br />
0.35<br />
0.3<br />
0.25<br />
0.2<br />
0.15<br />
0.1<br />
0.05<br />
0<br />
0 0.5 1 1.5 2 2.5<br />
Mole Ratio of [mL DE-PPD/ mL PPH]<br />
Fig (8): Mole ratio method.<br />
Absorbance<br />
0.4<br />
0.35<br />
0.3<br />
0.25<br />
0.2<br />
0.15<br />
0.1<br />
0.05<br />
0<br />
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1<br />
Fig (9): The continuous variations method<br />
6- Reaction sequence<br />
[PPH]/[PPH]+[DE-PPD]<br />
DE-PPD was oxidized by using Nbromosuccinimide<br />
to p-benzoquinone diimine in<br />
alkaline medium at pH 9-10, and then analyzed to<br />
p-benzoquinone monoamine at pH ≥ 12, the later<br />
coupled rapidly with PPH to form blue color of<br />
indophenol dye, which have a maximum<br />
absorbance at 680nm.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 112-118, 2011<br />
7- Analysis of pharmaceutical preparations<br />
Application of the proposed methods to the<br />
determination of PPH in its dosage forms was<br />
successfully made; the results are presented in<br />
Table 4 and compare favorably with those of the<br />
standard addition method. The excellent<br />
recoveries obtained indicated the absence of any<br />
interference from the excipients<br />
Table (4): Determination of phenylephrine hydrochloride in pharmaceutical preparation.<br />
Pharmaceutical<br />
Preparation<br />
Certified value<br />
(mg/10 ml)<br />
Present<br />
amount*<br />
(mg/10 ml)<br />
Standard addition<br />
method (mg/10 ml)<br />
RE1** (%) RE2*** (%)<br />
Samaphrine 0.02500 0.02535 0.02498 +1.40 +1.48<br />
nasophrine 0.02500 0.02519 0.02541 +0.76 -0.86<br />
* Average of three determinations<br />
** RE1= Oxidative coupling versus certified value<br />
*** RE2 = Oxidative coupling versus standard addition value.<br />
8- Interference<br />
The extent of interference by common ions<br />
was determined by measuring the absorbance of<br />
a solution containing 10.0 μg/mL of PPH and<br />
various amounts of diverse species. The<br />
common ions do not interfere and the common<br />
excipients which often accompany the<br />
pharmaceutical preparations do not interfere in<br />
the present method.<br />
CONCLUSIONS<br />
The proposed methods were found to be<br />
simple, economical, selective and sensitive. The<br />
statistical parameters and recovery study data<br />
clearly indicate the reproducibility and accuracy<br />
of the methods. Hence, these methods could be<br />
considered for the determination of PPH in the<br />
quality control laboratories.<br />
REFERENCES<br />
� Goth, A. (1981). Medical Pharmacology Principle and<br />
Concepts. 10th ed., The Mosby C.V. Company.<br />
� Palabıyık, I. M., and Onur, F. (2007). The<br />
Simultaneous Determination of Phenylephrine<br />
Hydrochloride, Paracetamol, Chlorpheniramine<br />
Maleate and Dextromethorphan Hydrobromide in<br />
Pharmaceutical Preparations. Chromatographia, 66,<br />
93-96.<br />
� Beyene, N. W., and Van Staden, J. F. (2004).<br />
Sequential injection spectrophotometric<br />
determination ofphenylephrine hydrochloride in<br />
pharmaceutical preparations. Talanta, 63(3), 599-<br />
604.<br />
� Ptáček, P., and Macek, J. (2007). Development and<br />
validation of a liquid chromatography–tandem mass<br />
spectrometry method for the determination of<br />
phenylephrine in human plasma and its application<br />
to a pharmacokinetic study. J. of chromatography<br />
B., 858(1-2), 263-268.<br />
� Galmier, M. J., A. M. Frasey, A. M., Meski, S.,<br />
Beyssac, E., J. Petit , J., J. M. Aiache, J. M., and C.<br />
Lartigue, C. (2000). High-performance liquid<br />
chromatographic determination of phenylephrine<br />
and tropicamide in human aqueous humor.<br />
Biomedical chromatography, 14(3), 202-204.<br />
� Ivana Savić, Goran Nikolić, Ivan Savić, Vladimir<br />
Banković. (2008). The Simultaneous<br />
Spectrophotometric Determination Of Trimazolin<br />
And Phenylephrine Hydrochloride In Nasal<br />
Preparations. Chemical Industry & Chemical<br />
Engineering Quarterly 14 (4) 261−264.<br />
� Abbas, M. N, and Mostafa, G. A. E. (2001).<br />
Spectrophotometric Determination Of<br />
Phenylephrine Using P-Aminophenol And<br />
Potassium Periodate. Egyptian J. Chemistry, 44,<br />
141-149.<br />
� Shama S.A., (2002). Spectrophotometric Determination Of<br />
Phenylephrine Hcl And Orphenadrine Citrate In Pure And In<br />
Dosage Forms. Journal of Pharmaceutical and<br />
Biomedical Analysis. 30(4), 1385-1392.<br />
� Muszalska, I., Zajac, M., Wróbel, G., and Nogowska,<br />
M. (2000). Uv/vis Spectrophotometric Methods For<br />
Determination Of Caffeine And Phenylephrine<br />
Hydrochloride In Complex Pharmaceutical<br />
Preparations. Acta Pol Pharm. 57(4), 247-52.<br />
� Kazemipour, M., and Ansari, M. (2005). Derivative<br />
Spectrophotometry for Simultaneous Analysis of<br />
Chlorpheniramine Maleate, Phenylephrine HCl, and<br />
Phenylpropanolamine HCl in Ternary Mixtures and<br />
Pharmaceutical Dosage Forms. Iranian Journal of<br />
Pharmaceutical Research, 3, 147-153.<br />
� AHMED Ibrahim S. ; AMIN Alaa S. (2007).<br />
Spectrophotometric microdetermination of<br />
phenylephrine hydrochloride in pure and in<br />
pharmaceutical formulations using haematoxylin.<br />
Journal of molecular liquids, 130(1-3), 84-87.<br />
� José R.C. Rocha | Cristiane X. Galhardo | Maria<br />
Auxiliadora E. Natividade | Jorge C. Masini .<br />
(2002). Spectrophotometric Determination of<br />
117
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 112-118, 2011<br />
Phenylephrine Hydrochloride in Pharmaceuticals by<br />
Flow Injection Analysis Exploiting the Reaction<br />
with Potassium Ferricyanide and 4-<br />
Aminoantipyrine. J AOAC Int., 85(4), 875-878.<br />
� Chien, D. S., and Schoenwald, R. D. (1985).<br />
Fluorometric Determination Of Phenylephrine<br />
Hydrochloride By Liquid Chromatography In<br />
Human Plasma. J Pharm Sci. 1985 May ;74<br />
(5):562-564<br />
� Mestre, Y., F. Zamora, L., L., and Calatayud, J. M.<br />
(2001). Determination Of Phenylephrine<br />
Hydrochloride By Flow Injection Analysis With<br />
Chemiluminescence Detection. J AOAC Int., 84(1),<br />
13-18.<br />
� Yehia M. Dessouky and Laila N. Gad El Rub. (1976).<br />
Colorimetric Determination Of Phenylephrine<br />
Hydrochloride In Pharmaceutical Preparations.<br />
Analyst, 101, 717 – 719.<br />
� Moisés Knochen, and Javier Giglio . (2004). Flowinjection<br />
determination of phenylephrine<br />
hydrochloride in pharmaceutical dosage forms with<br />
on-line solid-phase extraction and<br />
spectrophotometric detection. Talanta, 64(5), 1226-<br />
1232.<br />
–<br />
118<br />
� Jos_ Mar_a Lemus Gallego Juli_n P_rez Arroyo .<br />
(2003). Determination of prednisolone,<br />
naphazoline, and phenylephrine in local<br />
pharmaceutical preparations by micellar<br />
electrokinetic chromatography. J. Sep. Sci., 26,<br />
947–952.<br />
� CIERI, U. R. (2006). Determination of Phenylephrine<br />
Hydrochloride, Chlorpheniramine Maleate, and<br />
Methscopolamine Nitrate in Tablets or Capsules by<br />
Liquid Chromatography with Two UV Absorbance<br />
Detectors in Series. J AOAC Int., 89(1), 53-57.<br />
� Lawrence J. Dombrowski, Patrick M. Comi, Edward<br />
L. Pratt. (2006). GLC Determination Of<br />
Phenylephrine Hydrochloride In Human Plasma.<br />
Journal of Pharmaceutical Sciences. 62(11), 1761-<br />
1763.<br />
� Amer, Sawsan M.; Abbas, Samah S.; Shehata, Mostafa<br />
A.; Ali, Nahed M. (2008). Simultaneous<br />
Determination Of Phenylephrine Hydrochloride,<br />
Guaifenesin, And Chlorpheniramine Maleate In<br />
Cough Syrup By Gradient Liquid Chromatography.<br />
J AOAC Int., 276-285.<br />
� R. Delevie, R. (1997). Principle Of Quantitative<br />
Chemical Analysis. McGraw-Hill International<br />
Edition, Singapore, p. 498-504.<br />
ةينلاديصلا تارضحتسملا نم ددع يف ديرولكورديه نيرفلينفلل يفيطلا ريدقتلا<br />
وملحملا يمف دميرولكورديه نيرمفلينفلا ر مقع نمم ةلينمل ت ميمك ريدمقتل ةمس سيو ةليرمسو ةلعمس ةميفيق ةمقيرق رمصو مت<br />
ميثأ يئ منث –<br />
N,N<br />
مم منارقأو<br />
ةصلاخلا<br />
ديمنيمسكسومورا-<br />
N ةطمساوا دميرولكورديه نيرمفلينفلا ةدسكأ ىلع ةقيرطلا دمتلت . يئ ملا<br />
ملتميو مملا يمف ومئام اريا بت من نيومكتل ويدومصلا ديمسكورديه دوميوا دميرولكوردي علا هد ميأ نيمميا يئ منث نيملينف-ار<br />
ما<br />
مغلاو<br />
. رمتللم/<br />
ارروركي مم 65 ىملإ 0.6 نمم نميكرتلا ادمم نممل قبطني<br />
ريا نون ق نأ ديو . رتمون ن 586 دنع ص صتما ىصقأ<br />
6-<br />
م نا ةمقيرطلا مقبقو دمقلملا نيومكتل ىمل ملا لورمولا ةمسارد متو .<br />
6-<br />
مس.<br />
ومم.<br />
رتل 66386 ةيرلاوملا<br />
ةيص<br />
صتملااةميق<br />
ريث مممت لا نأ دممميو ممممك ةينلاديمممصلا تارمممضحتسملا نمممم ددمممع يمممفو ةممميقنلا مممتل ي يمممف دممميرولكورديه نيرمممفلينفلا ريدمممقت يمممف<br />
.<br />
ةيرتقملا ةقيرطلا يف ةيئاودلا ت ف ضملل
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 119-126, 2011<br />
USE OF WATER QUALITY INDEX AND DISSOLVED OXYGEN<br />
SATURATION AS INDICATORS OF WATER POLLUTION OF ERBIL<br />
WASTEWATER CHANNEL AND GREATER ZAB RIVER. *<br />
YAHYA A. SHEKHA * and JAMAL K. AL-ABAYCHI **<br />
* Dept.of Environmental Science, College of Science, University of Salahaddin, Kurdistan Region-Iraq<br />
** Dept. of Biology, College of Science, University of Baghdad-Iraq<br />
(Received: August 1, 2010; Accepted for publication: June 4, 2011)<br />
ABSTRACT<br />
The present investigation was conducted on Erbil wastewater channel to evaluate water quality and pollution<br />
strength by using water quality index and oxygen saturation percentage. Seven sites were chosen for the present<br />
survey, three of them were within Erbil wastewater channel and the other four sites located in Greater Zab River.<br />
Water samples were collected at regular monthly interval periods beginning at May 2006 to April 2007. Some water<br />
parameters were analyzed in both water ecosystems including, water temperature, pH, EC, turbidity, DO, BOD 5,<br />
COD, NH4, NO2, NO3, and total dissolved phosphate.<br />
Water quality index was varied from 47, 53.7 to 55.4% for Erbil wastewater channel sites respectively, which<br />
classified as bad to medium type of water or as marginal type of water, while for Greater Zab River sites was varied<br />
from 71.8% at site 4 then decreased to 68% at site 5 and increased gradually from 71.1 and 71.3% at last two sites of<br />
river respectively, which classified as medium to good type according to European Union classification and as fair<br />
type water depending on Canadian classification. The variation of oxygen saturation appeared to be directly<br />
proportional to the water quality index.<br />
KEY WORDS: Water quality index, Dissolved oxygen saturation, Water pollution.<br />
Q<br />
INTRODUCTION<br />
uality of surface waters is a very<br />
sensitive issue. Anthropogenic<br />
influences as well as natural processes degrade<br />
surface waters and impair their use for drinking,<br />
industry, agriculture, recreation and other<br />
purposes(Simeonov et al., 2003).<br />
A water quality index has been considered as an<br />
important criterion for surface water<br />
classification (Hernandez-Romero et al., 2004).<br />
(Jonnalagadda and Mhere, 2001) Showed that<br />
this index provides a single number of that<br />
expresses overall water quality at a certain<br />
location and time based on several water quality<br />
monitoring. An index is a useful tool for<br />
describing the state of water column, sediments and<br />
aquatic life and for ranking the suitability of water for<br />
use by humans, aquatic life, wildlife, etc.<br />
( CCME, 2001).<br />
The determination of WQI requires a<br />
normalization step where each parameter is<br />
transformed into a 0- 100 scale, where 100 represents<br />
the maximum quality. The next step is to apply a<br />
weighting factor in accordance with the importance<br />
of the parameter as an indicator of water quality<br />
(Nives, 1999).<br />
Dissolved oxygen (DO) and Oxygen saturation<br />
(OS %) are parameters frequently used to evaluate the<br />
water quality on different water bodies. These<br />
parameters are strongly influenced by a combination<br />
of physical, chemical, and biological characteristics<br />
* Part of Ph.D.Sc. thesis of the first author.<br />
of stream of oxygen demanding substances, including<br />
algal biomass, dissolved organic matter, ammonia,<br />
volatile suspended solids, and sediment oxygen<br />
demand (Mullholand et al., 2005).<br />
The objective of the present work was to the use<br />
of WQI and OS % as indicators of the environmental<br />
quality of Erbil wastewater channel and Greater Zab<br />
River watershed to compare between both water<br />
bodies. For the determination of the WQI, Canadian<br />
standard (4) as shown in (Table, 1) and European<br />
Standard (EU, 1975) as shown in (Table, 2), for clean<br />
water were used as references in each case.<br />
Cited from PhD Dissertation<br />
MATERIALS AND METHODS<br />
Sampling for water variables was performed from<br />
seven sites at monthly intervals during May 2006 to<br />
April 2007. Three sites have been chosen along Erbil<br />
wastewater channel (Tooraq village, Qadria village<br />
and Gameshtapa bridge respectively) and four sites<br />
selected in distal part of Greater Zab River<br />
( Near Gameshtapa<br />
village, Unkown , Kaparan village and Guwer<br />
subdistrict respectively) (Figure, 1).<br />
Field determinations of pH, conductivity, and<br />
temperature were carried out using portable<br />
equipments pH meter (Philips PW 9414) and<br />
conductivity meter (Philips PW 9525) respectively.<br />
Turbidity by using turbidity meter (HF Scientific, inc.<br />
model BRF- 15 CE).<br />
Laboratory analyses were carried out for the<br />
determination of BOD5, COD, NH4, NO2, NO3<br />
according to methods described in (APHA, 1998).<br />
111
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 119-126, 2011<br />
While for total dissolved phosphate (TDP) as<br />
recommended in (Lind, 1979) and total dissolved<br />
nitrogen as described in (Mackereth et al., 1978). As<br />
well as, dissolved oxygen concentration (DO) was<br />
determined using azid modification of winkler<br />
method as described in (APHA, 1998), and oxygen<br />
saturation calculated from the following formula:<br />
Where:<br />
C = dissolved oxygen concentration obtain from<br />
laboratory analysis.<br />
Cs= saturation concentration of pure water at a<br />
similar temperature and pressure.<br />
For the determination of water quality index<br />
(WQI), the following empirical equation was used<br />
(Sanchez et al., 2007):<br />
Where:<br />
K= is a subjective constant, Ci= is the<br />
normalized value of the parameter<br />
Pi= is the relative weight assigned to each<br />
parameter.<br />
Table (3) shows the values suggested for<br />
parameters Ci and Pi, used in the calculation of<br />
WQI, which were based on European Union<br />
standards (EU, 1975).<br />
121<br />
RESULTS AND DISCUSSION<br />
In order to evaluate the feasibility of the WQI<br />
and oxygen saturation (OS %) as an indicator of<br />
water pollution level in water sample analyzed<br />
the values of these parameters were determined<br />
in the different sampling sites.<br />
Figures 2-5 show, the plots of the variation of<br />
WQI and OS % values for both studied water<br />
ecosystems. The values of WQI increased<br />
throughout the Erbil wastewater channel from 47<br />
to 53.7 then to 55.4% respectively which was<br />
coincided with the increase in OS % from 7.8 %<br />
to 27 % then to 43.2% respectively. The reason<br />
of this result was related to the characteristics of<br />
the polluted channel. As can be seen, the mean<br />
values of EC decreased from site 1 to site 3.<br />
Also, ammonium concentration decreased, while<br />
the concentration of NO3 increased in site 2 but<br />
decreased in site 3 (Table, 4), which showing that the<br />
nitrification process took place (Dodson et al., 1998).<br />
Moreover, the values of BOD5 and COD decreased<br />
from (89.3 to 38.3 mg.l -1 ) and (474 to 192 mg.l -1 )<br />
respectively, accompanied by an increase of DO<br />
level, as an indication of relatively self-purification<br />
(Hynes, 1960). According to (EU, 1975) the water<br />
can be classified as bad for site 1 and as medium for<br />
site 2 and 3, while depending on (CCME, 2001)<br />
classification, all sites were regarded as poor or<br />
marginal type (Grade D). That was considered as<br />
impaired water, condition often depart from natural or<br />
desirable levels.<br />
On the other hand, the water quality improved<br />
considerably downstream of Greater Zab River, the<br />
values of WQI were 71.8% in site 4 then decreased to<br />
68% in site 5 which coincided with effluent from<br />
Erbil wastewater channel, then increased to 71.1%<br />
and 71.3% respectively (Figure 5). Taking into<br />
account all the points sampled, the water from<br />
Greater Zab River may be classified as fair (Grade C)<br />
depending of the classification of (CCME, 2001),<br />
meanwhile according to (EU, 1975) classification the<br />
water of site 4 can be regarded as good to medium in<br />
site 5 then good in sites 6 and 7. The water quality<br />
index increased through the sampling sites 4-7,<br />
showing a certain self-purification capacity of Greater<br />
Zab River (Figure 5).<br />
The variation of OS % appeared to be directly<br />
proportional to the WQI, the maximum value being at<br />
site 3 in Erbil wastewater channel and in site 7 in<br />
Greater Zab River. However, the values of OS%<br />
improved the above results in which the OS value in<br />
site 4 was 73.74% decreased to 71.48% then<br />
increased to 74.14% and 81.33% respectively (Table<br />
4). According to (Key, 1956) based on OS% content<br />
the water quality of polluted channel was regarded as<br />
badly polluted, while Greater Zab River can be<br />
classified as doubtful for all sites except site 7 that<br />
was considered as a fair type. (Klein, 1959) Stated<br />
that OS % levels below 60-80% can be harmful to<br />
many aquatic animals.<br />
Generally, there is directly proportional relationship<br />
between water organic matter load with OS% in<br />
water bodies. Therefore, WQI well be affected by<br />
increasing and decreasing of OS%.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 119-126, 2011<br />
Table (1):- Grading scale and rationale used for the all Water Quality indicators (WQI), (4):<br />
Indicator<br />
(100- point<br />
scale)<br />
Ecological condition Grade<br />
point<br />
Grade<br />
95- 100 Excellent: water quality is protected with virtual absence of threat or<br />
impairment; conditions very close to natural or pristine levels<br />
4 A<br />
80- 94 Good: water quality is protected with only minor degree of threat or<br />
impairment; conditions rarely depart from natural or desirable<br />
levels<br />
3 B<br />
65- 79 Fair: water quality is usually protected but occasionally threatened or<br />
impaired; conditions some-times depart from natural or<br />
desirable levels<br />
2 C<br />
45- 64 Poor (marginal): water quality is frequently threatened or impaired;<br />
conditions often depart from natural or desirable levels<br />
1 D<br />
0-44 Very Poor: water quality is almost always threatened or impaired;<br />
conditions usually depart from natural or desirable levels<br />
0 F<br />
Note: Canadian water quality guidelines for the protection of aquatic life ( After Canadian Council of Ministers of the<br />
Environment, 2001)<br />
Table (2):- WQI values according to European standard (7).<br />
Range Quality<br />
0-25 Very Bad<br />
25-50 Bad<br />
51-70 Medium<br />
71-90 Good<br />
91-100 Excellent<br />
Note: European Union (1975).<br />
Table (3): Values of Ci and Pi for different parameters of water quality.<br />
Parameter Pi Ci<br />
100 90 80 70 60 50 40 30 20 10 0<br />
Range of<br />
analytical value<br />
pH 1 7 7-8 7-8.5 7-9 6.5-7 6-9.5 5-10 4-11 3-12 2-13 1-14<br />
EC 2
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 119-126, 2011<br />
122<br />
Fig. (1):- Map of:<br />
A- Northern part of Iraq.<br />
B- Studied sites.<br />
Table (4): Water characteristics of Erbil water channel and Greater Zab river, data represented as mean ± S.E.,<br />
during studied period.<br />
Variables<br />
Water<br />
temperature (ºC)<br />
pH<br />
EC (µS.cm -1 )<br />
( at 25ºC)<br />
Turbidity (NTU)<br />
DO (mg.l -1 )<br />
BOD5 (mg.l -1 )<br />
COD (mg.l -1 )<br />
NH4 (µg NH4-N.l -<br />
1<br />
)<br />
NO2 (µg NO2-N.l -<br />
1<br />
)<br />
NO3 (µg NO3-N.l -<br />
1<br />
)<br />
TDP (µg.l -1 )<br />
OS (%)<br />
A<br />
1<br />
20.8± 1.96<br />
7.15± 0.08<br />
630± 28.7<br />
49.8± 15.3<br />
0.75± 0.32<br />
89.3± 16.2<br />
474± 84.2<br />
12.7± 1.29<br />
116± 46.3<br />
677± 373<br />
989± 134<br />
7.78±3.34<br />
Erbil channel<br />
2<br />
19.1±2.12<br />
7.38± 0.06<br />
655± 40.9<br />
8.61± 1.44<br />
2.67±0.39<br />
33.2± 10.0<br />
287± 61.5<br />
17.4± 1.51<br />
80.3± 13.1<br />
1006± 749<br />
1044± 77.6<br />
26.95±3.96<br />
3<br />
19.1± 2.11<br />
7.58± 0.1<br />
722± 49.4<br />
22.8± 4.26<br />
4.36± 0.55<br />
38.3± 13.0<br />
192± 54.2<br />
12.4± 1.10<br />
772± 168<br />
940± 221<br />
945± 105<br />
43.17±4.83<br />
4<br />
17.7± 2.34<br />
7.7 ± 0.09<br />
389± 26.8<br />
61.7± 22<br />
7.01± 0.44<br />
4.60± 2.41<br />
128± 31.7<br />
1.00± 0.09<br />
51.8± 3.69<br />
854± 233<br />
108± 39<br />
73.74±2.73<br />
Greater Zab river<br />
5<br />
6<br />
17± 1.82 17.5± 2.11<br />
7.77± 0.08<br />
464± 36.9<br />
61.1± 21.9<br />
6.84± 0.43<br />
5.69± 2.16<br />
236± 127<br />
1.68± 0.17<br />
86.7± 8.69<br />
963± 241<br />
132± 16.2<br />
71.48±2.72<br />
7.84± 0.09<br />
410± 29.8<br />
62.9± 20.3<br />
7.04± 0.38<br />
3.63± 1.92<br />
107± 23.3<br />
1.04± 0.07<br />
46.7± 16.6<br />
916± 204<br />
74.2± 12.4<br />
74.14±1.67<br />
7<br />
17.7± 1.89<br />
7.83± 0.08<br />
402± 25.5<br />
66.6± 23.4<br />
7.59± 0.63<br />
5.97± 3.00<br />
104± 25.9<br />
1.00± 0.08<br />
44.4± 4.98<br />
948± 219<br />
68.8± 12.4<br />
81.33±6.53
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 119-126, 2011<br />
WQI (%)<br />
60<br />
55<br />
50<br />
45<br />
40<br />
site 1 site 2 site 3<br />
Fig. (2):- Water quality Figure(2): index and Water oxygen quality saturation index and in oxygen Erbil saturation wastewater in channel Erbil (values as mean± SE), water<br />
wastewater channel classified (values according as mean±SE), to (Eu, water 1975). classified<br />
according to (7).<br />
WQI (%)<br />
80<br />
75<br />
70<br />
65<br />
60<br />
55<br />
50<br />
45<br />
40<br />
47<br />
WQI OS<br />
Medium<br />
Fig. (3):- Water quality index<br />
Figure(3):<br />
in Erbil<br />
Water<br />
wastewater<br />
quality index<br />
channel<br />
in Erbil<br />
(values<br />
wastewater<br />
as mean±<br />
channel<br />
SE), water classified according to<br />
(CCME, 2001).<br />
( values as mean), water classified according to (4)<br />
Bad<br />
53.7<br />
Fair<br />
55.4<br />
Marginal<br />
0 1 2 3 4<br />
Sites<br />
C<br />
D<br />
60<br />
50<br />
40<br />
30<br />
20<br />
10<br />
0<br />
OS (%)<br />
123
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 119-126, 2011<br />
124<br />
WQI (%)<br />
Fig. (4):- Water quality index and oxygen saturation in Greater Zab river (values as mean± SE),<br />
Greater water Zab classified river (values according as to mean (EU, ± 1975). SE), water<br />
WQI (%)<br />
75<br />
70<br />
65<br />
60<br />
74<br />
72<br />
70<br />
68<br />
66<br />
64<br />
71.8<br />
Good<br />
WQI OS<br />
Medium<br />
site 4 site 5 site 6 site 7<br />
Figure(4): Water quality index and oxygen saturation in<br />
classified according to (7).<br />
68<br />
Fig. (5):- Water quality index Figure(5): in Greater Water Zab river quality (values index as mean± in Greater SE), zab water river classified according to (CCME,<br />
(values as mean), water 2001). classified according to (4).<br />
71.1<br />
71.3<br />
Fair C<br />
0 4 1 5 2 6 3 47 Sites<br />
5<br />
100<br />
80<br />
60<br />
40<br />
20<br />
0<br />
OS (%)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 119-126, 2011<br />
REFERENCES<br />
-American Public Health association (A.P.H.A.). (1998):<br />
Standard methods for the examination of water and<br />
wastewater. 20 th Ed. A.P.H.A., 1015 Fifteenth<br />
Street, NW, Washington, DC. 20005-2605.<br />
-Canadian Council of Ministers of the Environment.<br />
(CCME). (2001): Canadian water quality guidelines<br />
for the protection of aquatic life: CCME, Water<br />
Quality Index. 1, Users Manual. Winnipeg.<br />
- Dodson, S.I.; Allen, T.F.H.; Carpenter, S.R.; Ives, A.R.;<br />
Jeanne, R.L.; Kitchell, J.F.; Langston, N.E. and<br />
Turner, M.G. (1998): Ecology. Oxford University<br />
Press. USA. 434pp.<br />
-European Union(EU). (1975): Council Directive<br />
75/440/EEC of 15 June 1975 concerning the quality<br />
required of surface water intended for the<br />
abstraction of drinking water in the member states.<br />
Official J. L. 194, 0026- 0031.<br />
-Hernandez-Romero, A.H.; Tovilla-Hernandez, C.; Malo,<br />
E.A. and Bello-Mendoza, R. (2004): Water quality<br />
and presence of pesticides in a tropical coastal<br />
wetland in southern Mexico. Marine Pollution Bull.<br />
48:1130- 1141.<br />
-Hynes, H.B.N. (1960): The biology of polluted waters.<br />
Liverpool University Press.UK. 202pp.<br />
-Jonnalagadda, S.B. and Mhere, G. (2001): Water quality of<br />
the Odzi river in the eastern highlands of<br />
Zimbabwe. Water Research. 35:2371- 2376.<br />
-Key, A. (1956): Pollution of surface water in Europe.<br />
World Health Organization Bull., 14:845- 948. In:<br />
Klein,L.(1959).<br />
-Klein, L., River pollution. (1959): I. Chemical analysis.<br />
Butterworth and Company Publishers. UK. 206pp.<br />
Lind, O.T. (1979): Handbook of common methods<br />
in limnology. C.V. Company. USA. 197pp.<br />
-Mackereth, F.J.H.; Heron, J. and Talling, J.F. (1978):<br />
Water analysis: Some revised methods for<br />
limnologists science publication. No.36. Freshwater<br />
Biological Association, Titus Wilson and SonsLtd.<br />
UK. 121pp.<br />
-Mullholand, P.J.; Houser, J.N.; Maloney, O.K. (2005):<br />
Stream diurnal dissolved oxygen profiles as<br />
indicators of in- stream metabolism and disturbance<br />
effects: fort Benning as case study. Ecological<br />
Indicators. 5:243- 252.<br />
-Nives, S.G. (1999): Water quality evaluation by index in<br />
Dalamatia. Water Research. 43: 3423- 3440.<br />
-Sanchez, E.; Colmenarejo, M.F.; Vicente, J.; Rubio, A.;<br />
Garcia, M.G.; Travieso, L. and Borja, R. (2007):<br />
Use of the water quality index and dissolved<br />
oxygen deficit as simple indicators of watersheds<br />
pollution. Ecological Indicators. 7:315- 328.<br />
-Simeonov, V.; Stratis, J.A.; Samara, C.; Zachariadis, G.;<br />
Voutsas, D.; Anthemidis, A.; Sofoniou, M. and<br />
Kouimtzis. (2003): Assessment of the surface water<br />
quality in Northern Greece. Water Research.<br />
37:4119- 4124.<br />
125
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 119-126, 2011<br />
126<br />
ىوائ زةس ةل ينحسكؤئ ىنووبسَيت ىةرَيز و وائ ىت ةيزؤج ىزةوَيث ىناهَيي زاكةب<br />
. ةزوةط ى َىش وسَيلوةي ىؤزةوائ لىانةك<br />
, وائ ىزَوج ىهيناش َوب ةزوةط ى َىش ىزابووز و سَيلوةي ىزاش ىَوزةوائ لىانةك زةسةلازدمانجةئ ةيةوةهيرََيوت<br />
مةئ<br />
َوب اسك ىزايد ةطتسَيو توةح . ينحسكَوئ ةب ىنووبسَيت ىزةوَيث و وائ ىت ةيزؤج ىزةوَيث<br />
ةتخوث<br />
ىناهَييزاكةبةب ىنوبسيث ىةمث<br />
. ةزوةتط ى َىش ىزاتبووز زةتسةل ةطتتسَيو زاوض و سَيلوةي ىَوزةوائ لىانةك ىيارَيزدةب ىاي َىس ةك ةوةهيرَيوت مةئ<br />
. 6002 ىناسين<br />
ؤب<br />
6002<br />
ىزاشائ ىطنام ىكَيجتسةد ةل ةناطنام ىكةيةوَيش ةب ىايرطزةو ىاكةنونم<br />
, وائ ىمَيل , ابةزاك ىندنايةط ىاناوت , ىهيجَوزدياي ىةزامذ , وائ ىامزةط ىةمث ؤخ ةتسط ىةنازةوَيث مةئ ةكةوةهيريوت<br />
ىتافسَوف , تاترين , تيترين , اينَومةئ , ينحسكَوئ ىياينيك ىتسيوَيث , ينحسكَوئ ىطةدهيش ىتسيوَيث , وةواوت ىهيحسكَوئ<br />
ىناكةطتسَيو ؤب كةي ىاودةب كةي % 7737 وكةوات 7.32 و72<br />
: ةوةزاوخ ىةمةل ةوةتَيسكب تزوك ىاكةمانجةئ<br />
َىسناوتةد ةو . ىتشط ىةواوت<br />
ىاوَين ةل اسك ىزايد وائ ىت ةيزؤج ىزةوَيث ىايةب<br />
ىةطتسَيو وود ةل دنةوان مام ؤب مةكةي ىةطتسَيو ةل ثاسخ ةل َىسكب وَيلؤث َىسناوتةد ةك سَيلوةي ىؤزةوائ لىانةك<br />
َىسطةدؤخةل مةزاوض ىةطتسَيو ةل % 2.37<br />
ةل ةزوةط ى َىش ىناكةطتسَيو ةل ةزةوَيث مةئ ادكَيتاك ةل مةَيس و مةوود<br />
ةل % 2.3. و 2.3. ةل ةمث ةب ةمث ىةوةنووبشزةب لةطةل مةحهَيث ىةطتسَيو ةل % 27<br />
ؤب َىشةبةداد ةزةوَيث مةئ ىاشاث<br />
ىةسَيوط ةب شاب ؤب دنةوان مام ىتةيزؤج ىاوَين ةل اسك وَيلؤث زابووز ىوائ ةو , كةي ىاود ةل كةي ىياود ىةطتسَيو وود<br />
ىةوام ةل ينحسكؤئ ىنووب سَيت ىةرَيز و وائ ىزؤج ىاوَين ةل ةيةي ةناوةتساز ىكةيدنةويةث ةو , ىثوزوةئ ىتَيكةي ىهيلؤث<br />
. ةوةهيرَيوت مةئ<br />
. ىلعلاا بازلا رهنو ليبرا يراجم ةانق هايملا ثولتل رشؤمك نيجسكولاا عابشا ةبسن و هايملا ةيعون<br />
رشؤم لامعتسا<br />
ةصلاخلا<br />
لامعتةس ب اةه ولا ةةجرب و هاةيملا ةةيعون ةةارعمل ىةلعرا بازةلا رةهنو لةيبرأ ةةنيدم يراةجم ةاةنق ىةلع ةةساردلا هذه تيرجأ<br />
ةاةنق نرةجم لوةو ىةلع اهنم ة لا ،ةيلاحلا ةساردلل تاطحم ةعبس رايتخإ ما . نيجسكولاا عابشأ ةبسن و هايملا ةيعون رشؤم<br />
اةةسين رهةةش ىةةتح 6002 راةةيا رهةةش نةةم اا ادةةتبإ ايرهةةش هاةةيملا جلاةةمن تذةةخأ . ىةةلعرا بازةةلا رةةهن زةةا اةةقاوم اةةبرأو لةةيبرأ<br />
. 6002<br />
نيجةةةسكورا ،ةروةةة<br />
علا ،ز اةةةبره لا ليةةةصوتلا ،زنيجوردةةةهلا را ، اةةةملا ةرارةةةح ةةةةجرب نةةةم الاةةةك اةةةيق ةةةةساردلا تلمةةةش<br />
تافةةةسوفلا ، تارةةةتنلا ،تةةةيرتنلا ،اةةةينومرا ،نيجةةةسكوال يواةةةيمي لا وةةةلطتملا ،نيجةةةسكوال يوةةةيحلا وةةةلطتملا ،باذةةةملا<br />
: زلي امك ج اتنلا صيخلا ن ميو . زل لا باذملا<br />
نة مي زةتلاو لةيبرأ يراةجم ةاةنق تاةطحمل ،زلاوتلا ىلع 7737 % ىلا ،7.32،<br />
72 نم هايملا ةيعون رشؤم ميق تحوارا<br />
تاةطحم زةا مية لا هذةه تةحوارا اةمنيب . ةةالاالا و ةةيناالا نيةتطحملا زةا ةطةسوتم ىةلا ىةلولاا ةةطحملا زةا زةس نم اهفينصا<br />
زجيردةتلا عاةفارلاا اةم ةةسماخلا ةةطحملا زةا % 27 ىةلا تة فخنا مة ةةعبارلا ةطحملا زا % 2.37 نم ىلعرا بازلا رهنو<br />
ةدةيجلا ىةلا ةطةسوتملا ةةيعون نيباةم رةهنلا هاةيملا تفنةص دةقو . زلاوةتلا ىةلع نيارةيخلاا نيةتطحملا زةا % 2.3. و 2.3. نةم<br />
ةرةتا للاةخ نيجةسكولاا عابةشأ ةبةسن و هاةيملا ةةيعون رشؤم نيبام ةيبرو ةقلاع تدجو امك . زبرولاا باحالاا فينصا وسح<br />
.<br />
ةساردلا
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
FLEXURAL ANALYSIS OF FIBROUS CONCRETE<br />
GROUND SQUARE SLAB<br />
AZAD A. MOHAMMED<br />
Dept. of Civil Engineering, College of Engineering, University of Sulaimani , Kurdistan Region, Iraq<br />
(Received: August 29, 2010; Accepted for publication: February 27, 2011)<br />
ABSTRACT<br />
In this paper, flexural analysis of ground square slab made of normal strength fibrous concrete subjected to<br />
central concentrated load is presented. Two models were proposed for analysis, one without the effect of stress<br />
concentration due to punching circular area under the load and the other with consideration of such effect. The<br />
proposed model is based on deriving moment-curvature relationship combined with the deflection behavior of the<br />
elastic plate. The second model can predict reasonably the cracking load , ultimate load and the load-deflection<br />
relationship. Comparison with the previous test data indicates that the ratio of test/ calculated ultimate load using<br />
model ( 1 ) is 2.48 and using Model ( 2 ) is 1.1. The effect of important parameters affecting the load-deflection<br />
response of fibrous concrete ground slab were studied.<br />
KEYWARDS: Curvature, Deflection, Fibrous Concrete, Ground Slab, Moment, Subgrade,<br />
U<br />
1-NTRODUCTION<br />
sing fiber reinforced concrete instead of<br />
normal reinforced concrete gained<br />
extensive applications in the case of concrete<br />
slabs on grade. This change is due to the<br />
acceptable crack control characteristics of<br />
distributed fibers inside the concrete especially<br />
in the zones of high stress concentration. Due to<br />
high truck loads, the slab is considered to be<br />
loaded with concentrated loads and there are<br />
locations of high stress concentration. In<br />
reinforced concrete slabs, there are zones<br />
between steel bars without reinforcement may<br />
subjected to cracking as a result of such high<br />
stress concentration. For this purpose the<br />
addition of fibers to concrete is quite necessary.<br />
Tests were reported by Beckett ( 1990 )<br />
indicate that the load carrying capacity of 3 x 3<br />
m slab tested on grade by central point load and<br />
separated by a membrane polythene from ground<br />
surface were increased by 45 – 90 % as a result<br />
of reinforcing the plain concrete with steel<br />
fibers. Other tests carried out by Chen ( 2004 )<br />
showed that there is a chance for using low<br />
amount of fiber ( lower than the minimum ratio<br />
indicated by Chinese construction practice ) and<br />
the load capacity can be effectively increased<br />
using different types of steel fibers.<br />
The analysis of continuous slabs is different<br />
compared with the separated square or<br />
rectangular one due to elastic geometrical<br />
deformations and the previous methods usually<br />
proposed for analysis and design of continuous<br />
slabsmay not applied directly in the case of<br />
separated slabs on grade. Previous works in this<br />
context indicated that the load capacity of<br />
ground slab can be predicted reasonably by<br />
assuming an ideally plastic concrete slab on<br />
elastic subgrade. Works by Westergaard ( 1948 )<br />
and Meyerhof ( 1962 ) may be a source for many<br />
specifications discusses the strength of slab on<br />
grade. Concrete Society: Concrete Industrial<br />
Ground Floors [ Concrete Society 1994) ] offers<br />
a design guide for SFRC ground slabs.<br />
It is observed from observation of cracking<br />
pattern of many tested square slabs on subgrade<br />
that there is a punching circular area under the<br />
point load formed at later stages of loading<br />
subjects to high cracking damage due to stress<br />
concentration. Studying the complete load-<br />
deflection relationship was not attempted<br />
extensively by previous investigations in the best<br />
of the author's idea.<br />
The present research is an attempt to draw<br />
the complete load- deflection response from<br />
which the cracking load, ultimate load and the<br />
nonlinear load-deflection behavior of fibrous<br />
concrete ground slab can be predicted. The<br />
analysis is based on calculating the momentcurvature<br />
relationship for a slab section then<br />
drawing the load-deflection response from the<br />
properties of elastic plate. The effect of tensile<br />
membrane action occurred after the slab section<br />
is fully cracked at the critical section was<br />
included in the analysis.<br />
2-ANALYSIS<br />
The idealized tensile and compressive stressstrain<br />
relationships used by Lim, Paramasivam,<br />
and Lee ( 1987 ) for the analysis of fibrous<br />
127
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
concrete beams shown in Fig.( 1 ) are adopted in<br />
the present analysis. Calculating moment –<br />
curvature relationship is based on the<br />
equilibrium of forces and compatibility of<br />
strains. According to the compressive stress-<br />
strain and tensile stress- strain relationships<br />
128<br />
different cracking stages will exist [ Fig.(2) ] and<br />
as a result nonlinear response is obtained. Hence,<br />
the material nonlinearity is included in the<br />
present analysis. It is assumed here that there is<br />
linear strain distribution and the load is applied<br />
statically without any shock or impact.<br />
Fig. (1):- Idealized Stress-strain Relationship for Fibrous Concrete r Lime, paramasivm , and Lee (1987)<br />
Fig.(2):- Stress and Strain Distribution Acting on Fibrous Concrete Section<br />
2-1 Moment-Curvature Relationship<br />
2-1-1 Elastic Stage<br />
Stress and strain distributions for this stage<br />
are shown in Fig. (2-a). Depth of the<br />
compression zone<br />
( c ) is calculated from equilibrium of<br />
compressive and tensile forces acting on the<br />
section, or<br />
C-T = 0 ------ ( 1 )<br />
Where C and T are the compressive and<br />
tensile forces acting on the slab section,<br />
respectively.<br />
It is assumed that the elastic modulus in<br />
compression and in tension are the same. As a<br />
result, the depth of compression zone for the<br />
elastic stage is equal to that in tension zone and
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
equal to h/2. On the basis of neglecting the<br />
effect of Poisson's ratio of concrete, the moment<br />
– curvature relationship per unit width becomes<br />
3<br />
Ech<br />
Me � -------- ( 2a )<br />
12<br />
Where Me is the moment of the elastic stage.<br />
Ec is the elastic modulus of fibrous concrete. In<br />
the absence of the test data, Ec can be<br />
approximately calculated from the ACI 318<br />
Code [ ACI ( 2005 ) ] as follows<br />
Ec = 4730 f ' cf ( in MPa ) ----- ( 2b )<br />
Where f'cf is the compressive strength of<br />
fibrous concrete ( MPa ). f'cf can be calculated<br />
from the equation given by Soroushian and Lee<br />
( 1991 ) as follows<br />
V flf<br />
f'cf = f'c + 3.6<br />
------ ( 2c )<br />
df<br />
Where f'c is the compressive strength of plain<br />
concrete ( MPa ), Vf is the fiber ratio, lf is the<br />
fiber length and df is the fiber diameter.<br />
This stage is valid until the matrix cracks, in<br />
which the corresponding curvature becomes<br />
2�cr<br />
�e<br />
� ------ ( 3a )<br />
h<br />
Where Фe is the limiting curvature for elastic<br />
stage and εcr is the cracking strain given by<br />
fr<br />
εcr =<br />
Ec<br />
----- ( 3b )<br />
where fr is the modulus of rupture for fibrous<br />
concrete. At the absence of test results fr can be<br />
calculated by the equation of ACI 318 Code [<br />
ACI ( 2005 ) ] as follows<br />
fr = 0.62 f ' cf ---- ( 3c )<br />
2-1-2 Elastic-Plastic Stage ( 1 )<br />
Stress and strain distributions for this stage<br />
are shown in Figure ( 2-b ). Taking the<br />
integration of the small value of force over the<br />
area and using equilibrium of forces, for this<br />
stage the depth of compression zone is given by<br />
2<br />
ftu ftu 2 2 ftu�cr<br />
Ec�cr<br />
c � � � ( ) � ( � � ftuh<br />
Ec�<br />
Ec�<br />
Ec�<br />
� 2�<br />
---(4)<br />
Where Φ is the curvature in general, and ftu<br />
is the post cracking residual stress for fibrous<br />
concrete. It is convenient here to use ftu = fe,3<br />
in which fe,3 is the equivalent flexural strength<br />
of fibrous concrete suggested to be used by the<br />
Japan Society of Civil Engineers standard<br />
method [ Japan ( 1984 ) ] which based on test<br />
results of beam specimen is given by<br />
fe,3 =<br />
TL<br />
------- ( 5a )<br />
2<br />
3bh<br />
where T is the area under the load – deflection<br />
curve for a fibrous concrete beam specimen,<br />
L is the span between supports,<br />
b is the beam width, and<br />
h is the beam depth.<br />
At the absence of test data for beam<br />
specimen, ftu can be calculated from the<br />
equation given by Hannant ( 1978 ) as follows<br />
1<br />
ftu = τ<br />
2<br />
V flf<br />
------- ( 5b )<br />
df<br />
Where τ is the interfacial bond stress between<br />
fiber and concrete.<br />
M<br />
ep<br />
2<br />
2<br />
�f<br />
' cf�o<br />
Ec�cr<br />
ftu�cr<br />
Ec�o<br />
� � � ftuh<br />
�<br />
� 2�<br />
� 2�<br />
�<br />
�f<br />
' cf � ftu<br />
-----(6a)<br />
Where α is the compressive stress reduction<br />
factor equal to 0.9 [ Lim, Paramasivam, and Lee<br />
( 1987 ) ]<br />
and<br />
�f<br />
' cf<br />
εo = ------ ( 6b )<br />
Ec<br />
This stage is valid until the curvature becomes<br />
�f<br />
' cf<br />
�ep � ------- ( 7 )<br />
Ecc<br />
2-1-3 Elastic- Plastic Stage ( 2 )<br />
Stress and strain distributions for this stage<br />
are shown in Fig.( 2-c ). Equilibrium of forces<br />
indicates that for this stage the depth of<br />
compression zone is given by<br />
129
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
Mp<br />
130<br />
2 2<br />
Ec(<br />
�o<br />
� �cr<br />
) � 2�ftuh<br />
� 2 ftu�cr<br />
� 2�f<br />
'cf�o<br />
c �<br />
2�(<br />
�f<br />
'cf<br />
� ftu)<br />
For the plastic stage the moment per unit width is given by<br />
2 3<br />
3<br />
3<br />
ftu �f<br />
' cf 3 ftu�cr<br />
Ec�o<br />
�f<br />
' cf�o<br />
Ec�cr<br />
ftuh<br />
� ( � ) c � ftuhc<br />
� � � � �<br />
2 2<br />
2<br />
2<br />
2 2<br />
2�<br />
3�<br />
2�<br />
3�<br />
2<br />
The terminating point for this stage is that<br />
curvature makes the cross section to undergo<br />
fully cracking and the analysis stopped here for a<br />
depth c to be 0.02 times the slab thickness.<br />
Later the tensile membrane action starts and the<br />
analysis for such stage is done approximately as<br />
discussed later.<br />
2<br />
-----(8)<br />
-----(9)<br />
2-2 Load-Deflection Relationship<br />
2-2-1 Case of square slab//////From the results<br />
of classical plate theory the deflection of<br />
rectangular elastic plate on subgrade subjected<br />
to central point load is given by [Timoshenko<br />
and Woinowsky- Krtege ( 1959 ) ]<br />
m��<br />
n��<br />
Sin Sin<br />
4P<br />
� �<br />
m x n y<br />
w<br />
a b � �<br />
� � �<br />
Sin Sin<br />
------- ( 10 )<br />
ab<br />
2 2<br />
m�1,<br />
3,..<br />
n�1,<br />
3,..<br />
4 m n 2 a b<br />
� D(<br />
� )<br />
2 2<br />
a b<br />
Taking the integration between the limits 0 and<br />
a and between 0 and b then taking the second<br />
derivatives of the deflection with respect to x ,<br />
the load curvature relationship becomes<br />
P �<br />
4�<br />
�<br />
� �<br />
2<br />
� � 4 2 2 4<br />
m�1 , 3,..<br />
n�1, 3,..<br />
� D(<br />
m � n ) � kb<br />
For a square plate, the deflection equation is<br />
given by<br />
2 � �<br />
1<br />
w � 4Pb<br />
� �<br />
------ (12)<br />
m�1 , 3,..<br />
n�1, 3,..<br />
4 2 2 4<br />
� D(<br />
m � n ) � kb<br />
2-2-2 Case of circular slab<br />
The load- moment relationship for a rigid<br />
slab on elastic foundation derived by Meyerhof<br />
( 1962 ) is used here for elastic-plastic and<br />
plastic stages and has a following form<br />
a<br />
Pc = 6 ( 1+ 2 ) Mo ----- ( 13a )<br />
l<br />
1<br />
Where l is the diameter of the relative<br />
stiffness given by<br />
D 0.25<br />
l = ( ) ------- ( 13b )<br />
k<br />
------ ( 11 )<br />
and a is the equivalent radius of the area under<br />
the point load. Mo is the moment in elasticplastic<br />
and plastic stages.<br />
The deflection equation for the circular plate<br />
on grade is given by [Timoshenko and<br />
Woinowsky- Krteger (1959)]<br />
Pc<br />
wc = ------ ( 14 )<br />
8 kD
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
2-2-3 Range of tensile membrane action<br />
The analysis presented above is accurate only<br />
when the value of the depth of compression zone<br />
( c ) remains realistic, otherwise there is another<br />
stage after that the section is fully cracked (value<br />
of c become too small ) . This stage is the stage<br />
of tensile membrane action occurred in the<br />
critical zone under the load.<br />
Using the stress distribution for fibrous<br />
concrete for ultimate moment capacity given by<br />
Hannant ( 1978 ) [ Model A ), a yield criterion<br />
for the enhanced moment due to the existence of<br />
tensile force acting at the mid-depth of the<br />
section to the moment without such force was<br />
drawn. The values of parameters α and β was<br />
calculated and found to be α = 0.66 and β =<br />
0.11.<br />
Using the equation given by Morley ( 1967 )<br />
for the case of polygonal slab the load<br />
enhancement factor is as follows<br />
�<br />
For ≤<br />
h<br />
2<br />
�<br />
�<br />
�<br />
2<br />
------- ( 15a )<br />
P � � 2<br />
=1+ ( + 2 ) (<br />
Po 12 � h<br />
� ) 2 -------(15b)<br />
Substituting the above ratios for α and β<br />
�<br />
For ≤ 0.25<br />
h<br />
P = 1 + 4.1 x 10 -5 h<br />
Po<br />
�<br />
Where P is the enhance load, Po is the control<br />
load to be enhanced, and Δ is the deflection for<br />
the tensile membrane action stage . Eq. ( 15b )<br />
offer approximate value of load enhancement<br />
because it is derived basically for simply<br />
supported slabs without subgrade. It should be<br />
noted that the load enhancement is effective only<br />
when the value of deflection Δ is too large . In<br />
the present study the stage on membrane action<br />
is useful for drawing the range of plastic portion<br />
of the load-deflection relationship and the load<br />
enhancement is not of considerable importance.<br />
2-3 Procedure for Analysis<br />
Two models are presented for analysis. In<br />
Model (1) the load-deflection for the slab is<br />
obtained by using the deflection equation for<br />
square plate for all cracking stages without<br />
considering the effect of circular area under the<br />
central point load. In Model ( 2 ) the deflection<br />
equation for the square plate is used only for the<br />
elastic stage. For other stages the calculated load<br />
and deflection are for a circular plate.<br />
Calculation steps for Model ( 2 ) are given<br />
below.<br />
1- calculate the moment for elastic stage from<br />
Eq. ( 2a ) and check the curvature limit from<br />
Eq. ( 3a ).<br />
2- calculate the flexural rigidity from dividing<br />
the moment by the curvature.<br />
3- calculate the load from Eq. ( 11 ) and later the<br />
deflection from Eq. ( 12 ).<br />
4- increase the curvature and calculate the depth<br />
of compression zone from Eq. ( 4 ) and the<br />
moment from Eq. ( 6 ) for elastic- plastic stage.<br />
Calculate the flexural rigidity from dividing the<br />
moment by the curvature.<br />
5- calculate the load from Eq.( 13a ) and the<br />
deflection from Eq. ( 14 ) for the circular area.<br />
6- check the curvature limit of elastic-plastic<br />
stage from Eq. ( 7 ). Repeat steps ( 4 ) to ( 6 ).<br />
7- for the curvature value larger than the limit of<br />
Eq. ( 7 ), increase the curvature and calculate the<br />
depth of compression zone from Eq. ( 8 ) and the<br />
moment from Eq. ( 9 ) for plastic stage.<br />
Calculate the flexural rigidity from dividing the<br />
moment by the curvature.<br />
8- repeat step ( 5 ).<br />
9-for any depth of compression zone of 0.02<br />
times the slab thickness, calculate the load<br />
enhancement factor from Eq. ( 15b ) and then<br />
the enhanced load by multiplying the factor by<br />
the final load obtained from step ( 8 ).<br />
3- COMPARISON BETWEEN TEST AND<br />
ANALYSIS<br />
It is necessary here to check the accuracy of<br />
the predicted loads and load-deflection<br />
relationship through a comparison with the test<br />
data for fibrous concrete slab on grade. Four<br />
slabs were cast and tested by Chen( 2004 ), three<br />
of them were reinforced with steel fiber. The<br />
tested slabs were reinforced with steel fiber with<br />
ratios of 0.38% and 0.26% and were tested on<br />
subrade of stiffness equal to 0.055 N/mm 3 . The<br />
slab dimensions were 2000 x 2000 x 120 mm<br />
and the cube compressive strength were 27.4<br />
MPa , 26.3 MPa and 26.5 MPa. Table ( 1 )<br />
contains the values of cracking and ultimate<br />
loads obtained by Chen ( 2004 ). The ultimate<br />
131
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
load ( Pu ) is the central load when cracks<br />
develop through the full depth of the slab at the<br />
center. Values of calculated cracking and<br />
ultimate loads using Models ( 1 ) and ( 2 ) are<br />
also shown in the table in addition to the test /<br />
calculated loads. Both models offer the same<br />
cracking load. Because the cracking load is that<br />
for the square slab and the difference between<br />
the two models begins after elastic stage. The<br />
ratio of test / calculated cracking load is high<br />
because the test cracking load given by Chen<br />
( 2004 ) is that load related to visible cracks that<br />
appeared at the slab edges and cached by the<br />
tester, while the calculated one is the load<br />
produces firs crack at the tension face under the<br />
load which is invisible. The test / calculated<br />
ultimate load is 1.46 for Model ( 1 ) and 1.1 for<br />
Slab<br />
Code<br />
DS1<br />
DS2<br />
HS<br />
Mean<br />
132<br />
Model ( 2 ). It is obvious that the Model ( 2 )<br />
gives better prediction. Therefore it is necessary<br />
to incorporate the effect of stress concentration<br />
occurred in the punching zone under the<br />
concentrated load. It is useful to note that the<br />
Model ( 1 ) offers accurate prediction for the<br />
case of fibrous concrete ground slab subjected to<br />
uniformly distributed load. Fig. ( 3 ) to ( 5 )<br />
shows the load-deflection relationship<br />
for tested slabs in addition to load-<br />
deflection relationship obtained from the<br />
calculation steps presented above. It is shown<br />
that Model ( 2 ) offers better prediction for the<br />
most entire range of load – deflection<br />
relationship. Accordingly the load-deflection<br />
relationship can be predicted reasonably using<br />
the present analytical procedure.<br />
Table ( 1 ):- Comparison between test and calculated cracking and ultimate loads<br />
Test Load ( kN ) Calculated Load (kN) Calculated Load (kN)<br />
Test / Calculated Load<br />
[Model (1)]<br />
[Model (2)]<br />
Pcr Pu Pcr Pu Pcr Pu Pcr Pu<br />
Pu<br />
[ Model (1)] [ Model (2)]<br />
151<br />
151<br />
-<br />
276.5<br />
278.8<br />
217<br />
50.98<br />
55.3<br />
44.95<br />
188.5<br />
209.6<br />
137.5<br />
4- EFFECT OF SOME PARAMETERS<br />
It is convenient here to study the role of the<br />
available parameters affecting the strength and<br />
deformations of fibrous concrete ground slab<br />
through observing the shape of load- deflection<br />
response and measuring the ultimate load. The<br />
parameters truckled here are the fiber ratio ( Vf ),<br />
slab thickness ( h ), concrete compressive<br />
strength ( f'c ), subgrade stiffness ( k ), and slab<br />
dimensions ( a and b ). The control slab has the<br />
following properties , Vf = 1 %, h = 150 mm, f'c<br />
= 30 MPa, k = 0.04 N/mm 3 , a = b = 3 m . Fig.<br />
( 6 ) to Fig.( 10 ) show the load-deflection<br />
relationship variation with the parameters<br />
variation. The shape of load-deflection<br />
relationship is slightly changed due to increasing<br />
the ultimate load in Fig. ( 6 ) and Fig.( 7 ) and<br />
not changed for other cases. The ultimate load<br />
band is high in Fig.( 6 ) and Fig.( 7 ) indicates<br />
50.98<br />
55.3<br />
44.95<br />
246.1<br />
285.9<br />
181.6<br />
2.96<br />
2.73<br />
-<br />
1.47<br />
1.33<br />
1.58<br />
1.12<br />
0.98<br />
1.19<br />
2.85 1.46 1.1<br />
that the role of changing the parameter is<br />
important. To take a more clear view of the<br />
influence of each parameter Fig.( 11 ) was<br />
constructed. In the figure the slope of a given<br />
line indicates the role of the parameter on the<br />
ultimate load capacity. It is clear that the most<br />
important parameter is the slab thickness<br />
followed by the fiber ratio in the concrete. The<br />
parameters of subgrade stiffness and slab<br />
dimensions have a small effect and the concrete<br />
compressive strength has no effect on the<br />
ultimate load capacity of the slab. Based on the<br />
present analysis result it is important to note that<br />
fibrous concrete separated slab must be<br />
constructed with higher thickness from a<br />
concrete mix contains high fiber ratio. The<br />
effect of other slab properties and subgrade type<br />
has a small influence on the slab strength.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
Fig. (3):- Test and calculated load-deflection relationship for slab DS1<br />
Fig. (4):- Test and calculated load – deflection relationship for slab DS2<br />
Fig.(5):- Test and calculated load – deflection relationship for slab Hs<br />
133
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
134<br />
Fig.(6):- Variation of load – Deflection Relationship for Fibrous concrete Slab with Fiber Ratio<br />
Fig.(7):- Variation of load –Deflection Relationship for Filbrous Concrete Slab with Slab Thickness<br />
Fig. (8):- Variation of Load – Deflection Relationship for Fibrous Concrete Slab<br />
with concrete compressive Strength
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
Fig.(9):- variation of load – Deflection Relationship for Fibrous Concrete Slab with Subgrade Stiffness<br />
Fig. (10):- variation of Load – Deflection Relationships for Fibrous Concrete Slab with Slab Dimensions<br />
Fig.(11):-Percentage of Ultimate load with Parameter Weight Variation<br />
135
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
136<br />
5- CONCLUSIONS<br />
Based on the results of the present analytical<br />
method presented above the following<br />
conclusions can be drawn<br />
1- The cracking load, ultimate load and the<br />
load-deflection relationship of fibrous concrete<br />
ground slab subjected to concentrated load can<br />
be predicted reasonably based on deriving<br />
moment-curvature relationship combining with<br />
elastic plate theory results.<br />
2- To obtain an accurate prediction it is<br />
necessary to incorporate the effect of stress<br />
concentration produced by the concentrated load<br />
in the analysis. As this done the ratio of test /<br />
calculated ultimate load can be changed from<br />
1.46 to 1.1.<br />
3- Those parameters affecting the ultimate load<br />
capacity of the ground slab is slab thickness<br />
followed by fiber ratio. Other parameters like<br />
slab dimensions, concrete compressive strength<br />
and subgrade type has no considerable<br />
importance on the ultimate load capacity of the<br />
slab.<br />
REFERENCES<br />
- ACI ( 2005 ) ,Building code requirements., ACI 318M-<br />
05 , American Concrete Institute, Detroit, USA<br />
- Beckett, D., ( 1990 ) , Comparative tests on plain, fabric<br />
reinforced and steel fiber reinforced ground slabs.<br />
Concrete, 24, 3, 43-45<br />
- Chen, S. , ( 2004 ), Strength of steel fiber reinforced<br />
concrete ground slabs. Structures and Building,<br />
SB2, 157-163<br />
- Concrete Society: Concrete industrial ground floors,<br />
(1994), A guide to their design and construction.<br />
Slough, Technical report, 34<br />
- Hannant, D.J.,( 1978 ), Fiber cements and fiber<br />
concretes. John Wiley and Sons.<br />
- Japan Society of Civil Engineers, ( 1984 ), Method of<br />
tests for flexural strength and flexural toughness of<br />
steel fiber reinforced concrete, JSCE-SF4<br />
- Lim, T. Y. , Paramasivam, P. and Lee, S.L. ( 1987 ),<br />
Bending behavior of steel fiber concrete beams.<br />
ACI Structural Journal, 84, 6 , 524-536<br />
- Meyerhof, G.G., ( 1962 ), Load carrying capacity of<br />
concrete pavements. Journal of Soil mechanics and<br />
foundations division, ASCE, 88, SM3, 89-116<br />
- Morley , C.T. ( 1967 ), Yield line theory for reinforced<br />
concrete slabs at moderately large deflection.<br />
Magazine of Concrete Research , 19 , 61 , 211-222<br />
- Soroushian, P. and Lee, C.D.,( 1991 ), Constitutive<br />
modeling of steel fiber reinforced concrete under<br />
direct tension and compression. Fiber reinforced<br />
cements and concretes, R.N. Swamy and Barr Eds.,<br />
Elsivier applied science, New York, 363-377<br />
- Timoshenko ,S.P. and Woinowsky- Krteger, S., ( 1959 ),<br />
Theory of plates and shells. New York, McGraw-<br />
Hill<br />
- Wesrergaard, H. M., ( 1948 ), New formulas for stresses<br />
in concrete pavement of airfields. Transactions of the<br />
American Society of Civil Engineers, 113, 425-444<br />
ىتَيسكنؤك ةل واسك تضوزد ىوةشزةض ىناب ىةوةنامةض ىزاكيش ؤب ةواسك شةكشَيث كةياطَيِز ادةيةوةهيَلؤكَيل مةل<br />
ىتزوك<br />
ةةل ىزاكيةش ؤةب ةواسةك شةكةشَيث ةةنونم وود . كات ىياضزوق ةب واسك زاب ينهضائ ىَلاشيِزةب واسك صَيهةب و ةداض<br />
ةل و ةوازدةن َىث ى َىوط تادةدووِز ةكةي ىياضزوق سَيذ ىةييةنشاب<br />
ةشةب و ةل زاشف ىةوةنوبِسض ىزاكؤه ادنايمةكةي<br />
شةكشَيث ةي ىزاكيش ةنونم وةئ . ةواسك َلى ىضاب ادمةوود ىةنونم<br />
ىتَيمث ىةشَيكواه َلةطةل ىنادَيسط و ةوةناِزوض -سبةش<br />
ىيةوامةض ىدنةويةث ةب تنضةب تشث ةب ةواسن دايهب ةواسك<br />
ىدنةويةث ةو , ىياضزوق اتؤك,<br />
ندسب شزد ىياضزوق ىهيبشَيث تَيسناوتةد ىزاكيشؤب مةوود<br />
ىةنونم ىناهَيهزاكةب ةب . ادمزةن<br />
ىمانجةةئ َلةطةل ىزاكيش ىمانجةئ ىندسك دزوازةبةب<br />
. تَيسكب شاب ىكةيةوَيش ةب ىوةشزةض ىناب ىهيشةباد-ىياضزوق<br />
و مةكةي ىمَيدؤم ىناهَيه زاكةب ةب 84.2 ةب ةناطكةي واسك ىهيبشَيث/<br />
تطَيت ىياضزوق اتؤك ىةرَيِز ةك اسهيب ادناكةتطَيت<br />
ةيةه نايَلؤِز ةك طنسط ىزاكؤه كَيدنةه زةضةل ةواسك ةوةهيَلؤكَيل . مةوود ىمَيدؤم ىناهَيهزاكةب ةب141<br />
ةب ةناطكةي<br />
.<br />
ينهضائ ىَلاشيِزةب واسك صَيهةب و ةداض ىتَيسكنؤك ةل واسك تضوزد ىوةشزةض ىناب ىهيشةباد -ىياضزوق<br />
ىدنةويةث ةل
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 127-137, 2011<br />
ةحلةحقلام ةةمماققلا ةةيداع ةناسرخلا نم ةعونصم ةيضرلاا تاطلابلل ءانحنلاا ليلحت ةقيرط ميدقت مت ىلاحلا ثحبلا ىف<br />
ىةةف داةة نلاا ةةي رت ريا ةةت لاةةثدا ملةةي مةةل لملاا ىةةف , لةةيلحللل نينيوةةقن<br />
ميدةةقت مةةت .<br />
ةة رقلا لةةقحلا ريا ةةت تةةحت<br />
ةصلاخلا<br />
ىةلع دةقلمي يرةلققلا لةيلحللا.<br />
راةبلعلاا رةتنب ريا ةللا أةثا مةت ىناةنلا ىةفم ة رقلا<br />
لةقحلا تةحت ةةطلابلا ىف ةيرئادلا ةحاحقلا<br />
لةةيلحللل ىناةنلا ثيوةةقنلا لاقملةساب . ةةنرقلا ائائةةصلل دملاا ةةلدامم لةةم ةعبر م ووةقللا-<br />
ئاةلنلا لةم ةةنراققلا مت امدنع . دملاا-لقحلا<br />
ة لاع م ىص لاا لقحلا<br />
ادخلةةةسابم 84.2 ىةةةه لملاا ثيوةةةقنلا ادخلةةةساب رةةةتنلا/<br />
اةةيللااب<br />
ةةملل ةةيعخلا رةةيا ةة لاملا ااقلةشا<br />
, ققشللل ببحقلا لقحلاب دين لكشب ؤبنللا نكقي<br />
رةةةبلخقلا ىةةص لاا لةةةقحلا ةبةةةحن ةةةب دةةةنم ةقباةةةحلا ةةةيربلخقلا<br />
ةناةسرخلا نةم ةيةضرلاا تاةطلابلل دملاا-لةقحلا<br />
ةة لاع ىةلع راؤةت ىةللا ةةق قلا لةماوملا ةةسارد مت<br />
.<br />
4141<br />
ىه ىنانلا ثيوقنلا<br />
ايللااب ةحلحقلام ةمماققلا ةيداع<br />
137
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
838<br />
TESTS ON AXIALLY RESTRAINED FERROCEMENT SLAB STRIPS<br />
AZAD ABDULKADR MOHAMMED * and YAMAN SAMI SHAREEF **<br />
* Dept. of Civil Engineering, College of Engineering, University of Sulaimani, Kurdistan Region-Iraq<br />
** School of Engineering, Faculty of Engineering, University of Duhok, Kurdistan Region-Iraq<br />
(Received: August 30, 2010; Accepted for publication: June 20, 2011)<br />
ABSTRACT<br />
Flexural strength and deformation of axially restrained ferrocement slabs and thin reinforced slabs were studied<br />
through laboratory tests on 36 slab strips. Special steel frame was fabricated to furnish axial restraint for preventing<br />
outward movement of the strip at supports. Test results indicate that due to existence of axial restraints, properties of<br />
cracking load, ultimate load, corresponding deflections as well as load-deflection relationship were considerably<br />
changed. Due to existence of end restraints cracking load was increased slightly, however, as a result of produced<br />
compressive membrane action the ultimate load was increased significantly which found to be higher for thinner<br />
slabs. Such load increase can be obtained without reduction in ductility compared with unrestrained slabs. The role of<br />
slab thickness on ductility was found to be not important for all types of tested slabs. Ferrocement slabs showed better<br />
load capacity compared with those slabs reinforced with steel bars but the ductility was reduced to about one half.<br />
T<br />
1- INTRODUCTION<br />
he application of ferrocement can be<br />
observed in the case of boat hulls,<br />
floating marine structures, silos, water tanks,<br />
folded plate and shell roofs, wind tunnels, pipes,<br />
in repairing of damaged structures and in<br />
architectural or decoration purposes. According<br />
to ACI 549R-01 Committee [1] ferrocement is<br />
defined as a type of thin reinforced concrete<br />
element commonly constructed of cement-sand<br />
mortar reinforced with closely spaced layers of<br />
continuous and relatively small diameter wire<br />
meshes. The mesh may be made of metallic or<br />
other suitable materials.<br />
Many tests were carried out on flexural<br />
behavior and ultimate flexural strength of<br />
ferrocement sections as done by Rao and<br />
Gowdar [2] and Balaguru et al [3] and others.<br />
Ferrocement slab roofs are usually used in low<br />
cost housing projects in the form of pre-cast unit<br />
erected one beside another. If there is no gap<br />
between them or the existing gap is to be filled<br />
with a cementitious material, the given slab has<br />
axially restrained ends against outward<br />
movement. As a result, membrane forces will be<br />
produced and the phenomenon of arch action<br />
will occur. The effect of membrane action was<br />
found to increase the load carrying capacity of<br />
the conventionally reinforced concrete slab [4].<br />
A few number of published researches are<br />
available that deal with behavior of slabs made<br />
from non-conventional concrete like fibrous<br />
concrete and ferrocement, subjected to both inplane<br />
force and flexural moment. Taylor and<br />
Mullin [5] extended the existing knowledge of<br />
arching action in laterally restrained slabs to<br />
analyze glass fiber reinforced plastics (GFRP)<br />
type of slab. The results of laboratory tests on<br />
six one-way spanning slabs with varying<br />
concrete strengths, reinforcement type (steel or<br />
GFRP) and slab boundary condition were tested.<br />
The deflection was higher in the (GFRP)<br />
reinforced slab compared to the steel reinforced<br />
slab. This increase in deflection was attributable<br />
to the low modulus of elasticity of GFRP. In the<br />
laterally restrained slabs, the deflections were<br />
less in the slabs reinforced with GFRP compared<br />
to the equivalent slabs reinforced with steel.<br />
In the best of authors idea, there is a<br />
shortcoming in knowledge about the flexural<br />
strength and deformation of ferrocement slabs<br />
and reinforced concrete thin slabs having axially<br />
restrained edges. In the present paper the flexural<br />
behavior of ferrocement slab strips were studied<br />
through experimental laboratory tests. The<br />
effects of end restraint, slab thickness,<br />
reinforcement ratio and span length on the<br />
flexural strength and deformation were<br />
illustrated and discussed.<br />
2- EXPERIMENTAL WORKS<br />
2-1 Materials<br />
For casting concrete slab strips ordinary<br />
Portland cement (OPC) [Type (I) ASTM]<br />
manufactured by Kurtlen factory / Turkey was<br />
used. The chemical composition and physical<br />
properties are shown in Table (1). It is shown<br />
that the cement used conforms to the Iraqi<br />
standard limits. Clean, Natural River sand of
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
normal weight type prepared from Fishkhaboor /<br />
Zakho pit was used in the experimental works.<br />
The fine aggregate used passes 100 % through<br />
sieve No. 8 (2.36 mm). The specific gravity was<br />
2.68. Results of sieve analysis indicated that the<br />
sand grading falls within ASTM-C33 [6] limits<br />
as shown also in Table (2). Commercially<br />
available square welded galvanized wire mesh<br />
(SWGM) was used with the average diameter of<br />
0.6 mm and of 12 mm spacing between wires.<br />
Two types of skeletal smooth steel of 2.48 mm<br />
diameter and deformed steel of 4.5 mm diameter<br />
were also used. Properties and results of yield<br />
and ultimate stresses are shown in Table (3) and<br />
the stress-strain relationship for reinforcements<br />
used is shown in Figure (1).<br />
Table (1): Chemical composition and Physical properties of cement used in the present work<br />
Chemical component Projects cement<br />
%<br />
CaO 63.17<br />
SiO2 19.56<br />
Ai2O3 5.31<br />
Fe2O3 3.56<br />
Iraqi standards No.5 (1984) limits<br />
SO3 1.83 1 - 3<br />
MgO 2.37 5 % max.<br />
Loss of ignition 2.55 4 % max.<br />
Insoluble residue 0.39 1.5 % max.<br />
L.S.F. 0.97 0.66 - 1.02<br />
C3S 62.46<br />
C2S 9.04<br />
C3A 8.05<br />
C4AF 10.82<br />
Physical Test Results IQS 5 limits<br />
Fineness (Blaine Air Permeability) 3124 cm 2 /g Min. 2250<br />
Initial setting time 2.46 hr Min. 1 hr<br />
Final setting time 3.53 hr Max. 10 hr<br />
Compressive strength (3 days) 404 kg / cm 2 Min. 160<br />
Compressive strength (7 days) 474 kg / cm 2 Min. 240<br />
Soundness (Le Chatelier) 1.5 mm Max. 10 mm<br />
Specific Gravity 3.15<br />
Table (2): Sieve analysis of fine aggregate<br />
Sieve size Limit of percentage passing ASTM-<br />
Total percentage passing (by<br />
No. 8 (2.36 mm) C33-03[6] 80 - 100 weight) 100<br />
No. 16 (1.18 mm) 50 - 85 72<br />
No. 30 (0.60 mm) 25 - 60 47<br />
No. 50 (0.30 mm) 5 – 30 22<br />
No. 100 (0.15 mm) 0 - 10 5<br />
Table (3): Yield and ultimate strengths of wire mesh and steel reinforcement<br />
Properties Wire mesh Steel reinforcement<br />
Type of reinforcement SWGM Smooth Deformed<br />
Diameter (mm) 0.6 2.48 4.5<br />
Yield stress, fy ( MPa) 458 393 440<br />
Ultimate strength, fu( MPa) 481 455.5 593<br />
839
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
841<br />
Fig. (1): Stress-Strain relationship for wire mesh and skeletal reinforcements<br />
2-2 Description of Slab Strips<br />
The slab strips can be classified into two<br />
main types. The first type is axially restrained<br />
slabs, while the second one includes those slabs<br />
that axially unrestrained at ends. For this<br />
purpose a total of 36 slab strips were cast. All<br />
slab strips were 475 mm width, with 1575 mm in<br />
length, and variable thicknesses of 25, 37 and 50<br />
mm. Clear span for all strips was 1450 mm<br />
except for strips S4-5 and S4-6 the clear span was<br />
1000 mm. Accordingly slab aspect ratios were<br />
58, 38.7 and 29 for thicknesses 25 mm, 37 mm<br />
and 50 mm, respectively . For slab S4-5 the aspect<br />
ratio was 26.7 and for slab S4-6 was 20. A<br />
constant mix proportion of 1: 2: 0.45 (cement:<br />
sand: water / cement ratio) was used throughout<br />
the experimental works. According to ACI 549R<br />
-01 specification [1], ratio of sand/cement is<br />
limited between 1 and 3. Test variables can be<br />
summarized to the following parameters: end<br />
restraint conditions, thickness, number of wire<br />
Fig. (2): General view of slab mould<br />
mesh layers, and type of reinforcement.<br />
Properties of strips in detail can be found in<br />
Table (4).<br />
2-3 Detail of the Moulds<br />
Two steel moulds were used for casting slab<br />
strips. The base of moulds was steel of 550 mm<br />
width and 1700 mm length. Edge strips of equalleg<br />
angle cross-section were provided with three<br />
different leg widths of 25, 37, and 50 mm in<br />
order to obtain variable thickness of the strip.<br />
According to ACI 549R specification [1] the<br />
ferrocement section should be not smaller than<br />
6mm and not more than 50mm. The angle strips<br />
were tightly connected to the steel base by mean<br />
of 8 mm diameter screws spaced at 150 mm c/c<br />
to prevent any leakage of mortar during<br />
compaction. Figure (2) illustrates the view of the<br />
steel mould for slab strips and steel cubes (100 ×<br />
100 × 100 mm) used for casting cube specimens<br />
to measure the compressive strength of mortar.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
2-4 Mixing and Casting Processes<br />
The wire mesh and steel reinforcement were<br />
cut to an appropriate size and the wire mesh<br />
layers were well straightened, then they were<br />
oriented in longitudinal direction along the span.<br />
Sand and cement were first mixed by hand for<br />
about five minutes, and then water was added<br />
and mixed for other two minutes in order to<br />
obtain a homogeneous mixture. The layers were<br />
distributed either in the form of single layer or<br />
pair of layers according to the required<br />
reinforcement ratio. First, the mortar was spread<br />
inside the mold homogeneously and well leveled<br />
to obtain about 3 to 5 mm thickness cover and<br />
the wire mesh was then put on the mortar layer.<br />
The new batch of mortar was then spread and<br />
well leveled and the process was repeated until<br />
all layers of wire meshes were provided. The<br />
surface of slab strip was well leveled by mean of<br />
trowel for obtaining a constant thickness of the<br />
slab. With each slab, three (100 × 100 × 100<br />
mm) cubes were cast to measure the mortar<br />
compressive strength. Concrete cubes and slab<br />
strips were left inside the mould for one day, and<br />
2-6 Instrumentation and Testing<br />
All slabs were tested by applying two central<br />
point line loads spaced 300 mm at top surface of<br />
the slab and gradually until failure. Universal<br />
computerized testing machine of (Walter + Bai<br />
AG/ Switzerland / 08 - 2003) type was used for<br />
testing slab strips and concrete cubes. The<br />
general view of the testing machine can be seen<br />
in Figure (4). For the axially restrained slabs, the<br />
slab was put and erected in order to fit with the<br />
support ends of the steel frame to surround them<br />
and to provide an axial restraint. This is done in<br />
order to prevent the lateral displacements due to<br />
Fig. (3): Schematic view of test frame<br />
later they were marked and removed from the<br />
moulds and immersed in water for 28 days.<br />
Finally, the slab strips were taken out of the<br />
water tank and kept in the laboratory at room<br />
temperature before testing for 7 days. Before<br />
testing, all slab strips were painted white to show<br />
the pattern of cracks after testing.<br />
2-5 Details of the Test Frame<br />
A steel frame was fabricated especially for<br />
testing axially restrained slab strips. The test<br />
frame essentially consisted of three different<br />
parts. The first part consisted of two C-section<br />
channels with 700 mm length, 100 mm width<br />
and 10 mm thickness and contained two holes in<br />
each side in order to provide space for solid steel<br />
bars to enter. The second part consisted of two<br />
solid steel bars with 1700 mm length and 26 mm<br />
in diameter, one edge of the solid steel bars has a<br />
sprocket to provide connection with screws. The<br />
last part of the steel frame was two nuts of 25<br />
mm internal diameter to connect the two steel<br />
channels to provide end restraints. Figure (3)<br />
shows the schematic view of the test frame.<br />
the produced compressive membrane action<br />
during testing. Two rubber pads were placed<br />
under the two line loads in order to diminish the<br />
effect of local stress concentration. For the<br />
purpose of observing any possible lateral<br />
movement at the end of slabs strips, dial gage<br />
was erected at the center of end restraint<br />
channels. The position of dial gage is illustrated<br />
in Figure (5). The load was applied in<br />
increments of 0.6 kN/min and a careful search<br />
was made for initial cracks of the slab by the<br />
mean of hand microscope. The measurements<br />
for the outward lateral displacement was then<br />
848
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
taken from the dial gage readings and loading<br />
continued until failure of slabs. All cubes were<br />
tested by the 3000 kN capacity machine at a rate<br />
of loading equal to 0.6 N/mm 2 /sec. The load<br />
increment and corresponding deflection were<br />
taken from the measurements of the device<br />
841<br />
which had a plotter to draw the load-deflection<br />
curve automatically [Figure (4)]. Figure (6)<br />
illustrate the general view of the slab strip inside<br />
the testing frame after testing.<br />
Fig. (4): Machine used for testing slab strips and concrete cubes<br />
Top view channels Side view channels<br />
Fig. (5): Dial gage position erected at the center of end restraint channels
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
3- RESULTS AND DISCUSSION<br />
Observation of load-deflection relationship<br />
obtained from test results indicates that the<br />
response is linear up to first cracking load. In the<br />
later stages of loading, the slope of load-central<br />
deflection curves is decreased which may<br />
attribute to the decrease in the composite<br />
stiffness and continuing to decreases with the<br />
load increase. After the peak load, there is a<br />
descending part for the axially restrained slabs<br />
only.<br />
In order to study the important parameters<br />
affecting the behavior of axially restrained slab<br />
strips, it is better to classify the slab strips to the<br />
following groups: "Ferrocement Slabs (F)” is<br />
those slabs reinforced with wire mesh only.<br />
"Reinforced Ferrocement Slabs (RF) “refers to<br />
those slabs reinforced with steel reinforcement<br />
(skeletal steel) in addition to wire meshes, while<br />
"Reinforced Slabs (R)" are those slabs<br />
containing steel reinforcement only. Table (4)<br />
contains the test results of load and deflections<br />
for slab strips. Results of compressive strength<br />
of concrete cubes are also presented. N is the<br />
number of ferrocement wire meshes, Vf is the<br />
ratio of wire mesh in the section and ρs is the<br />
percentage of steel wire or deformed bar<br />
Fig. (6): General view of a slab strip after testing<br />
reinforcements. In the following paragraphs the<br />
effect of test parameters on the strength and<br />
deformation of slab strips are studied through the<br />
discussion of test results.<br />
843
144<br />
Slab Code<br />
S1-1<br />
S1-2<br />
S1-3<br />
S1-4<br />
S1-5<br />
S1-6<br />
S1-7<br />
S1-8<br />
S1-9<br />
S1-10<br />
S1-11<br />
S1-12<br />
S1-13<br />
S1-14<br />
S1-15<br />
S1-16<br />
S1-17<br />
S1-18<br />
S1-19<br />
S1-20<br />
S2-1<br />
S2-2<br />
S2-3<br />
S2-4<br />
S2-5<br />
S2-6<br />
Slab<br />
Type<br />
AR<br />
( F )<br />
(G1)<br />
AU<br />
(F)<br />
(G2)<br />
AR<br />
( F )<br />
(G3)<br />
AU<br />
(F)<br />
(G4)<br />
AR<br />
( R )<br />
(G5)<br />
f 'c<br />
(MPa) d<br />
26.8<br />
29.2<br />
24.8<br />
28.0<br />
24.4<br />
25.2<br />
29.2<br />
28.0<br />
32.4<br />
26.8<br />
26.8<br />
24.4<br />
28.0<br />
27.2<br />
32.4<br />
36.4<br />
27.6<br />
29.6<br />
30.4<br />
25.6<br />
27.2<br />
24.4<br />
30.8<br />
29.2<br />
25.6<br />
26.4<br />
Table (4): Properties of Strips and Test results of the load and mid-span defection for slab strips<br />
h<br />
(mm)<br />
25<br />
25<br />
37<br />
37<br />
50<br />
50<br />
25<br />
25<br />
50<br />
50<br />
25<br />
25<br />
37<br />
37<br />
50<br />
50<br />
25<br />
25<br />
50<br />
50<br />
25<br />
25<br />
37<br />
37<br />
50<br />
50<br />
Reinforcement<br />
N<br />
(Vf)<br />
3<br />
(0.271)<br />
4<br />
(0.241)<br />
5<br />
(0.226)<br />
3<br />
(0.271)<br />
5<br />
(0.226)<br />
6<br />
(0.543)<br />
8<br />
(0.482)<br />
10<br />
(0.452)<br />
6<br />
(0.543)<br />
10<br />
(0.452)<br />
-<br />
-<br />
-<br />
Ratio<br />
ρs<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
0.98 a<br />
0.98<br />
0.98<br />
Act.<br />
-<br />
-<br />
1.3<br />
1.38<br />
2.98<br />
2.6<br />
0.45<br />
0.45<br />
2.78<br />
2.53<br />
1.46<br />
-<br />
-<br />
-<br />
3.65<br />
-<br />
0.2<br />
-<br />
3.5<br />
3.4<br />
0.6<br />
0.3<br />
2.37<br />
1.95<br />
4<br />
5.4<br />
Pcr<br />
(kN)<br />
Avg.<br />
-<br />
1.34<br />
2.79<br />
0.45<br />
2.7<br />
1.46<br />
-<br />
3.65<br />
0.2<br />
3.45<br />
0.45<br />
2.16<br />
4.77<br />
Act.<br />
-<br />
-<br />
1.2<br />
1.3<br />
3.2<br />
2.4<br />
9.4<br />
11<br />
6.3<br />
5.5<br />
4.2<br />
-<br />
-<br />
-<br />
4<br />
-<br />
3.5<br />
5<br />
6<br />
13.2<br />
5<br />
3.7<br />
4.7<br />
4.3<br />
8.9<br />
σcr<br />
(mm)<br />
Avg<br />
-<br />
1.25<br />
2.8<br />
10.2<br />
5.9<br />
4.2<br />
4<br />
3.5<br />
5.5<br />
9.1<br />
4.2<br />
6.6<br />
Act<br />
1.4<br />
1.4<br />
2.7<br />
2.9<br />
3.9<br />
4.1<br />
0.8<br />
0.75<br />
3.3<br />
3.4<br />
2.1<br />
1.75<br />
4.4<br />
4.6<br />
7.7<br />
7.9<br />
1.3<br />
1.4<br />
6.1<br />
6<br />
1.4<br />
1.5<br />
4.2<br />
3.9<br />
8.4<br />
8.8<br />
Pu<br />
(kN)<br />
Avg<br />
1.4<br />
2.8<br />
4<br />
0.78<br />
3.35<br />
1.93<br />
4.5<br />
7.8<br />
1.35<br />
6.05<br />
1.45<br />
4.05<br />
8.6<br />
Act.<br />
24<br />
24.5<br />
23<br />
23.4<br />
11.6<br />
14.7<br />
20<br />
19.3<br />
15<br />
16<br />
35.4<br />
37.8<br />
34.1<br />
40.1<br />
33.9<br />
34.6<br />
54.2<br />
50.2<br />
33.8<br />
35<br />
73.4<br />
69.9<br />
87.3<br />
89.8<br />
58.1<br />
60<br />
σp<br />
(mm)<br />
Avg<br />
24.3<br />
23.2<br />
13.2<br />
19.7<br />
15.5<br />
36.6<br />
37.1<br />
34.3<br />
52.3<br />
34.4<br />
71.7<br />
88.5<br />
59.1<br />
Act.<br />
25.4<br />
26.5<br />
24.1<br />
24.7<br />
13.5<br />
15.7<br />
20<br />
19.3<br />
15<br />
16<br />
37.4<br />
38.4<br />
34.4<br />
41.1<br />
36.4<br />
35.1<br />
54.2<br />
50.2<br />
33.8<br />
35<br />
73.9<br />
73.0<br />
90<br />
90<br />
76.1<br />
80<br />
σmax<br />
(mm)<br />
Avg<br />
26<br />
24.4<br />
14.6<br />
19.7<br />
15.5<br />
37.9<br />
37.8<br />
35.5<br />
52.3<br />
34.4<br />
73.5<br />
90<br />
78.1<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011
145<br />
S3-1<br />
S3-2<br />
S3-3<br />
S3-4<br />
S4-1<br />
S4-2<br />
S4-3<br />
S4-4<br />
S4-5<br />
S4-6<br />
AR<br />
(RF)<br />
(G6)<br />
AR<br />
( R )<br />
(G7)<br />
AR<br />
(R)<br />
(G8)<br />
30.4<br />
29.2<br />
27.2<br />
28.8<br />
25.2<br />
26.8<br />
26.0<br />
26.0<br />
26.0<br />
27.6<br />
25<br />
25<br />
37<br />
37<br />
25<br />
25<br />
37<br />
50<br />
37<br />
3<br />
(0.271)<br />
4<br />
(0.271)<br />
-<br />
-<br />
-<br />
-<br />
0.98<br />
0.98<br />
0.643 b<br />
0.643 c<br />
0.643 c<br />
0.643 c<br />
0.643 b<br />
h=slab thickness<br />
a= Ø2.48 mm smooth wire @ 2.5 cm c/c<br />
b= Ø 4.5 mm deformed bars @ 15 cm c/c<br />
c= Ø 4.5 mm deformed bars @ 15 cm c/c+ Ø 4.5 mm deformed bars @ 10 cm c/c<br />
d= f’c = fcu × 0.8<br />
AR= axially restrained<br />
AU= axially unrestrained<br />
50<br />
-<br />
2<br />
2.07<br />
2.17<br />
2.05<br />
0.75<br />
0.59<br />
1.54<br />
2.45<br />
3.36<br />
3.41<br />
2.03<br />
2.11<br />
0.67<br />
25<br />
22.5<br />
6.8<br />
2.9<br />
1.45<br />
-<br />
8<br />
2.5<br />
2.1<br />
1.0<br />
23.8<br />
4.85<br />
1.45<br />
2.4<br />
2.4<br />
6.4<br />
6.2<br />
2.2<br />
2.1<br />
5.3<br />
11.4<br />
8.8<br />
18.9<br />
2.4<br />
6.3<br />
2.15<br />
57<br />
59.7<br />
75.2<br />
70<br />
65.2<br />
63.3<br />
63.4<br />
61.1<br />
28.3<br />
27.0<br />
58.4<br />
72.6<br />
64.3<br />
57<br />
60<br />
81.3<br />
81.2<br />
66.6<br />
63.3<br />
67.3<br />
66.6<br />
35.0<br />
27.9<br />
58.5<br />
81.2<br />
67.9<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
3-1 Outward Lateral Movement<br />
For all slab strips having 25 mm and 37 mm<br />
thickness no reading of dial gage indicating the<br />
lateral outward movement was observed, for all<br />
loading history. It is mean that the lateral support<br />
is stiff enough. For slab strips of 50 mm<br />
thickness the maximum outward movement was<br />
0.15 mm. Such movement is too small and on<br />
neglecting, one can decide that there is a stiff<br />
surround and the slab has fully restrained edges<br />
and the phenomenon of membrane action is<br />
expected to occur.<br />
3.2 Effect of End Restraint on Cracking Load<br />
(Pcr)<br />
The measured load at which first crack occurs<br />
at bottom surface of the slab at mid-span for<br />
most of the slab strips is shown in Table (4). The<br />
effect of end restraints on cracking load can be<br />
known by making a comparison between group<br />
(1) slabs with group (2) and between group (3)<br />
with group (4) for ferrocement slabs of 25 mm<br />
Slab Symbol Cracking Load<br />
(Pcr)<br />
846<br />
and 50 mm thickness respectively. Table (5)<br />
shows the percentage of cracking load (Pcr),<br />
deflection at cracking load (δcr), ultimate load<br />
(Pu), deflection at ultimate or peak load (δp) and<br />
maximum deflection (δmax) for restrained to<br />
unrestrained ferrocement slab strips.<br />
The result of Pcr for slabs (S1-11 and S1-17)<br />
seems to be inaccurate and makes the ratio to be<br />
730 percent increase. This result is neglected and<br />
not used for discussing the effect of end restraint<br />
on Pcr. Therefore, as an average the ratio of<br />
cracking load for restrained to unrestrained slabs<br />
is 104.5 percent and the role of slab thickness<br />
here is not important. This small increase in<br />
cracking load is regarded to prevent outward<br />
movement of the slab strip at initial stage of<br />
loading. Such prevent made from supports does<br />
not rotate freely and as a result reduces the<br />
elastic curvature that leads to some increase in<br />
cracking load.<br />
Table (5): Percentage of restrained / unrestrained load and deflection results<br />
Mid-Span<br />
Deflection at<br />
Cracking Load<br />
(σcr)<br />
Ultimate Load<br />
(Pu)<br />
Mid-Span Deflection at<br />
Ultimate Load<br />
(σp)<br />
Maximum<br />
Deflection<br />
(σmax)<br />
Act. Avg. Act. Avg. Act. Avg. Act. Avg. Act. Avg.<br />
S1-1 & S1-7 - - - - 175 181 120 123 127 133<br />
S1-2 & S1-8 - - 187 127 139<br />
S1-5 & S1-9 107 105 51 47 118 119 77 85 90 94<br />
S1-6 & S1-10 103 44 121 92 98<br />
S1-11 & S1-17 730 730 120 120 162 144 65 70 69 72<br />
S1-12 & S1-18 - - 125 75 76<br />
S1-15 & S1-19 104 104 80 80 126 129 100 100 108 104<br />
S1-16 & S1-20 - - 132 99 100<br />
3.3 Effect of End Restraint on Deflection at<br />
Cracking Load (δcr)<br />
Table (4) shows the results of deflection<br />
corresponding to cracking load (δcr) for most of<br />
the tested slabs. Table (5) contains the ratio of<br />
restrained to unrestrained slab deflection at<br />
cracking load (δcr). The deflection (δcr) is<br />
reduced for slab S1-5, S1-6 and S1-15 and increased<br />
for S1-11 by 20 %. The later result can be<br />
considered inaccurate and on neglecting it, the<br />
ratio varies from 47 % to 80 %. As an average<br />
the existence of end restraints reduces the<br />
deflection at cracking load by 53 % for lightly<br />
reinforced slab with ferrocement wires and by 20<br />
% for ferrocement slabs moderately reinforced<br />
with wire meshes. On considering all results the<br />
deflection at cracking load is reduced by 18%<br />
due to end restraints.<br />
3.4 Effect of End Restraints on the Ultimate<br />
Load (Pu)<br />
When the geometrical deformation of<br />
ferrocement slab, namely deflection and rotation,<br />
are controlled within the allowable limits, the<br />
ultimate load carried by the slab is the important<br />
factor that indicates the usefulness of the slab in<br />
service. Table (4) contains the results of ultimate<br />
load for all tested slab strips. The possible<br />
effects of end restraints of ultimate load (Pu) are<br />
well illustrated in Table (5). For all slabs the<br />
ultimate load is higher for restrained slabs as<br />
compared with unrestrained ones. From a<br />
comparison between restrained and unrestrained<br />
slabs having the same properties, it is concluded<br />
that the effect of membrane action in<br />
ferrocement one-way slabs exists and causes an<br />
increase in load carrying capacity. The<br />
percentage of increase in ultimate load is 81 %<br />
for slabs which contain 3 layers of ferrocement<br />
mesh, while for those slabs reinforced with 6<br />
layers the percentage of increase is 44 % for<br />
slabs of 25 mm thickness. From the results<br />
shown in Table (5), one can find that the
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
percentage of increase for the 50 mm slabs is<br />
lower as compared with the 25 mm slabs. The<br />
percentage of increase is 19 % and 29 % for the<br />
slab strips reinforced with 5 layers and 10 layers,<br />
respectively. Therefore, the effect of membrane<br />
action on increasing the ultimate load is<br />
important, especially in lightly reinforced thin<br />
sections. So the behavior of ferrocement thin<br />
slabs is different as compared with conventional<br />
reinforced concrete slabs at which the effect of<br />
compressive membrane action exists only in<br />
lightly reinforced concrete sections. Such<br />
difference between the two cases can be argued<br />
due to controlling the large deflection and<br />
instability occurred in thin sections like<br />
ferrocement sections due to the existence of end<br />
restraints preventing the support to rotate freely.<br />
3.5 Effect of End Restraints on Deflection at<br />
Ultimate Load (δp) and Maximum Deflection<br />
(δmax)<br />
Table (4) shows results of deflection<br />
corresponding to ultimate load (δp) and<br />
maximum deflection (δmax) for the tested slabs.<br />
Table (3) contains the ratio of restrained to<br />
unrestrained slab deflection at ultimate load (δp)<br />
and maximum defection (δmax). The deflection<br />
(δp) is increased only for slab S1-1, S1-2 and has no<br />
effect for S1-15, S1-16 and there is a reduction in<br />
(δp) for other slabs occurred due to end<br />
restraints. The ratio varies from 70 % to 85 %<br />
or the deflection (δp) is decreased for S1-5, S1-6<br />
and S1-11, S1-12 by 15 % and 30 % respectively.<br />
The deflection (δp) is increased for slab S1-1, S1-2<br />
and S1-15, S1-16, and such results can be<br />
considered inaccurate, and as conclusion there is<br />
a reduction in (δp) of about 15 % to 30 % for<br />
axially restrained slabs compared with<br />
unrestrained slabs.<br />
Figures (7) and (8) show the load-deflection<br />
relationships for those slabs identical in<br />
properties except the end condition. The effect<br />
of end restraint or membrane action is obvious<br />
via increasing the ultimate load and changing the<br />
shape of the load-deflection relationship.<br />
In axially restrained slab strips, the deflection<br />
at all stages of cracking was found to be lower<br />
than that of axially unrestrained slab strips,<br />
while the corresponding load was higher. From<br />
Figures (6) and (7) one can observe that the<br />
increase in ultimate load is accompanied with no<br />
reduction in ductility which is considered a<br />
shortcoming in structural performance if<br />
occurred. Even in very thin ferrocement slabs<br />
lightly reinforced (i.e. slabs S1-1 and S1-2) there<br />
is an increase in ductility beside the increase<br />
in ultimate load indicating the positive effect<br />
of compressive membrane action in such<br />
slabs due to end restraints.<br />
Fig. (7): Load-deflection relationship of axially restrained and axially unrestrained<br />
ferrocement slabs [Group (1)&(2)]<br />
847
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
Fig. (8): Load-deflection relationship of axially restrained and axially unrestrained ferrocement slabs [Group (3&4)]<br />
3-6 Effect of Wire Mesh<br />
The effect of wire mesh layer on the loaddeflection<br />
response can be known from a<br />
comparison between relationships shown in<br />
Figure (9). It is observed that the ductility<br />
increased considerably when the wire mesh ratio<br />
increases twice times. In order to illustrate the<br />
role of slab thickness and reinforcement ratio on<br />
ultimate load Figure (10) was drawn. It is shown<br />
848<br />
that with increasing the ratio of wire meshes, the<br />
effect of slab thickness in axially unrestrained<br />
slabs on ultimate load is low (the ratio increases<br />
from 173% to 181%). For axially restrained<br />
slabs there is a steady increase in ultimate load<br />
with increasing slab thickness. This indicates the<br />
important role of slab thickness on ultimate load<br />
when the ratio of wire mesh increases.<br />
Fig. (9): Load-deflection relationship of axially restrained slabs for Group (1) & (3)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
Fig.(10) Variation of Ultimate load of ferrocement slab strips when the ratio of wire meshes<br />
increased (twice times)<br />
3-7 Effect of Reinforcement Type<br />
Figure (11) shows the load-deflection<br />
relationship for Group (5) slabs. For this group<br />
instead of wire mesh layers a constant ratio of<br />
smooth steel bar (0.98%) was used as<br />
reinforcement and therefore the unique variable<br />
is the slab thickness. In general, the load-central<br />
deflection curves are linear up to first cracking<br />
load. In the cracked stage, the slope of the loadcentral<br />
deflection curve was small for slab strips<br />
having 25 mm thickness compared with 37 mm<br />
or 50 mm thickness. The stiffness is reduced<br />
slowly and gradually with the deflection increase<br />
and the response is somewhat a smooth curve<br />
in which the cracking stages can not be<br />
defined well. For other slab strips different<br />
cracking stages can be easily observed and each<br />
stage has a different flexural stiffness. It is<br />
clearly shown that the plastic stage (last stage)<br />
for all slabs initiates nearly at the same<br />
deflection value, or the slab thickness does not<br />
affect the deflection at which the plastic stage<br />
commences. Making a comparison with Figure<br />
(9) which illustrates the load-deflection relation<br />
of ferrocement slabs, one can observe that there<br />
is a similarity in ductility between the two<br />
groups in which the ductility is independent on<br />
slab thickness. Figure (12) shows the loaddeflection<br />
relationship of reinforced concrete<br />
slabs [Group (5)] in addition to ferrocement<br />
slabs [Group (3)], all axially restrained.<br />
Although the reinforcement ratio for Group ( 3 )<br />
slabs is about one half of that provided for<br />
reinforced concrete slabs [ Group( 5 )] nearly<br />
the same ultimate load (or even higher ) can be<br />
obtained, indicating the superiority of<br />
25<br />
25<br />
37<br />
50<br />
50<br />
ferrocement slabs over reinforced thin slabs. For<br />
obtaining a better comparison between<br />
reinforced and ferrocement slab strips Figure<br />
(13) was drawn which illustrates the percentage<br />
of ultimate load for ferrocement strips to that of<br />
reinforced slab strips. It is shown that the ratio is<br />
higher than 100% for 25 mm and 37 mm<br />
thickness slabs. Therefore, for ferrocement slabs<br />
of 25 mm and 37 mm thicknesses ( or thin slab<br />
strips ) if the ductility is not considered as an<br />
effective parameter governing the design of thin<br />
slabs, it is better from economical view point to<br />
use ferrocement slabs instead of reinforced<br />
concrete slabs having ends axially restrained<br />
against lateral movement. In Group (6) the slabs<br />
were reinforced by both skeletal steel<br />
reinforcement and ferrocement mesh wires.<br />
Figure (14) shows the load-central deflection of<br />
reinforced slab strips in addition to those<br />
reinforced with both reinforcement and wire<br />
meshes. The effect of wire mesh layers addition<br />
to the slab section containing steel reinforcement<br />
is important to increase the ultimate load but<br />
reduces the ductility slightly. Therefore the<br />
existence of skeletal steel reinforcement is<br />
important to restore the lost ductility occurred<br />
due to providing wire mesh to the slab section.<br />
Figure (15) illustrates the percentage of<br />
ultimate load for reinforced ferrocement slabs<br />
[Group (6)] to that of ferrocement slabs [Group<br />
(3)] and reinforced slabs [Group (5)]. It is shown<br />
that if the reinforcement ratio increased from<br />
0.98% to 1.21% due to the addition of wire mesh<br />
layers the percentage increase in ultimate load is<br />
66%, while due to addition of skeletal steel<br />
(reinforcement ratio changed from 0.54% to<br />
849
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
1.21%) the percentage increase in ultimate load<br />
is only 24%. Such comparison indicates the<br />
important role of wire mesh addition to<br />
reinforced concrete slab strips having restrained<br />
ends on the load carrying capacity.<br />
Figure (16) shows the load-deflection<br />
relationship for reinforced slabs [Group (7)] and<br />
reinforced slabs [Group (5)]. The difference<br />
between the two groups is that in group (7) slabs<br />
deformed bars of 4.5 mm diameter were used as<br />
reinforcement while in the other group 2.48 mm<br />
diameter smooth bars was used. It is concluded<br />
that the strength performance of strips reinforced<br />
851<br />
with deformed bars is better than that of slabs<br />
reinforced with smooth bars. This result can be<br />
attributed to the effect of good bond between the<br />
mortar and deformed bar. Figure (17) shows the<br />
results of load-deflection of reinforced slabs of<br />
Group (7) and ferrocement slabs Group (3). The<br />
ductility for reinforced slabs is always higher<br />
than that of ferrocement slabs regardless of slab<br />
thickness. The ultimate load of reinforced slabs<br />
is higher only for slabs of higher thickness, but it<br />
is not changed considerably for thin slabs of 25<br />
mm and 37 mm thickness.<br />
Fig. (11): Load-deflection relationship of axially restrained reinforced concrete slabs for Group (5)<br />
Fig. (12): Load-deflection relationship of slab strips [Group (3) and Group (5)]
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
25<br />
37<br />
Fig. (13): Percentage of ultimate load for axially restrained ferrocement slab strips<br />
[Group (3)] to that of axially restrained reinforced slab [Group (5)]<br />
Fig. (14): Load-deflection relationship of reinforced ferrocement slabs Group (6)<br />
and reinforced concrete slabs Group (5)<br />
50<br />
858
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
851<br />
25<br />
25<br />
37<br />
Fig. (15): Percentage of ultimate load for group (6) to group (3) and group (6) to group (5) slabs<br />
Fig. (16): Load-deflection relationship of axially restrained slabs for Group (5) and Group (7)<br />
Fig. (17): Load-deflection relationship of reinforced slab Group (7) and ferrocement slab Group (3)<br />
37
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
3-8 Effect of Span Length<br />
Figure (18) shows the results of loaddeflection<br />
relationship for reinforced slabs of<br />
Group (7) and Group (8). The main variable here<br />
is the span length (or span / depth ratio). Based<br />
on test results shown in Table (2), decreasing the<br />
span length from 1450 mm to 1000 mm tends to<br />
increase the cracking loads by 118.2 % and<br />
39.2 % and ultimate loads by 66 %<br />
and 65.8 % for 37 mm and 50 mm slab<br />
thickness, respectively. It is also observed that<br />
decreasing the span length from 1450 mm to<br />
1000 mm tends to decrease the deflection at<br />
cracking load by 73.75 % and 60% for 37 mm<br />
and 50 mm slab thickness respectively.<br />
Fig. (18): Load-deflection relationship of reinforced slabs [Group (7) and Group (8)]<br />
3-9 Cracking Pattern<br />
It is observed from the test results that the<br />
ferrocement and reinforced this slabs undergo<br />
large deflections before failure and both types of<br />
membrane action (compressive and tensile) are<br />
expected to develop due to their thin crosssections.<br />
Figures (19) show the pattern of cracks<br />
for some of the tested slabs. It is obvious that<br />
increasing number of wire mesh layers increases<br />
the number of cracks and reduces their spacing.<br />
It means that wire mesh layers have an effective<br />
role in distributing of the stresses within the<br />
crack tips. By increasing thickness of the slab<br />
strips of axially restrained slab strips, the<br />
cracked area in the tension face is increased, and<br />
in general such area is higher as compared with<br />
unrestrained slabs. The number of extension<br />
cracks is higher for axially restrained slabs<br />
compared with unrestrained ferrocement slabs.<br />
In comparison with the ferrocement slabs, the<br />
number of cracks is reduced for reinforced<br />
concrete slabs, especially when the diameter of<br />
bars is increased and the span length is reduced.<br />
In this type of slabs when the first crack occurs<br />
in the central part of slab, the load then carried<br />
by the steel reinforced bars and due to<br />
concentration of stress the slab undergoes large<br />
plastic rotation. But in ferrocement slabs due to<br />
large flexibility the crack extends and covers<br />
higher area in tension face due to distribution of<br />
stresses.<br />
853
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
854<br />
4- CONCLUSSIONS<br />
From the experimental test results presented<br />
in this study, the following conclusions may be<br />
drawn:<br />
1. The existence of axial restraint at supports<br />
responsible for preventing outward movement,<br />
affects the overall properties of ferrocement and<br />
thin reinforced slabs, like cracking load, ultimate<br />
load, the corresponding deflections as well as the<br />
load-deflection response.<br />
2. The average percentage increase in cracking<br />
load was 4.5% and reduction in deflection at<br />
cracking load was 18%, while the ultimate load<br />
increased by 81% and 44% for 25 mm thickness<br />
ferrocement slabs reinforced with 3 and 6 layers<br />
of wire mesh, respectively. The percentage of<br />
increase was found to be 19% and 29% for 50<br />
mm thickness slab. The average reduction in<br />
deflection corresponding to ultimate load was<br />
found to vary from 15% t0 30%.<br />
3. The increase in ultimate load occurs due to<br />
axial restraints can be obtained without<br />
scarifying the ductility of the slab strip.<br />
4. Nearly the same ultimate load of axially<br />
restrained ferrocement slabs can be obtained by<br />
providing reinforcement of about one half of that<br />
provided to slabs reinforced with steel wires or<br />
Fig. (19): Cracking pattern for some of tested slab strips<br />
bars, but the ductility is reduced to about one<br />
half. If the ductility is not considered an<br />
effective parameter governing the design of thin<br />
slabs of axially restrained ends, it is suggested to<br />
use ferrocement slabs instead of thin slabs<br />
reinforced with single grid of reinforcement<br />
provided to tension zone .<br />
5. Ductility of ferrocement slabs, reinforced<br />
slabs and reinforced ferrocement slabs was<br />
found not to be affected by the existence of end<br />
restraint and slab thickness but considerably<br />
changed with the variation of wire mesh layers,<br />
amount of steel reinforcement, and type of<br />
skeletal steel reinforcement. The performance of<br />
deformed bar grid was found to be better than<br />
that of smooth wire reinforcement.<br />
6. It is observed from the test results that the<br />
axially restrained ferrocement elements undergo<br />
large deflections before failure due to their thin<br />
cross-section.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 138-155, 2011<br />
5- REFERENCES<br />
- ACI Committee 549R-01(2001). State of the Art<br />
Reports on Ferrocement. Manual of Concrete<br />
Practice, Part 5.<br />
- Rao, A.K. and Gowdar, C.S.K. (1971). A Study of the<br />
Behavior of Ferrocement in Flexure. Indian<br />
Concrete Journal, 45(4), 178-183.<br />
- Balaguru, P.N., Naaman, A.E., and Shah, S.P. (1977).<br />
Analysis and Behavior of Ferrocement in Flexure.<br />
Journal of the Structural Division, ASCE,<br />
103(ST10), 1937-1951.<br />
- Ocklestone (1958). Arching Action in Reinforced<br />
Concrete Slabs. The Structural Engineer, 36, 197-<br />
201.<br />
- Taylor, S. E. and Mullin, B. (2006). Arching Action in<br />
FRP Reinforced Concrete Slabs. Construction and<br />
Building Materials, 71-80.<br />
- ASTM-C33 (2003). American Society for Testing<br />
and Materials.<br />
ىناضينهب و ىتهسمويرف ىضينهب ةل ىاكةواركناروط لةط ةل ىاكش ىهترطار ىةشاريد اداتصَيئ ىةوةهَيلَوكَيل مةل<br />
.<br />
( One-way )<br />
وةِراِر كةي ىتهسمَويرف ىضينهب<br />
36<br />
ةتخوث<br />
رةش ةل ادروبلا لىوش ةل تيبةي وترطاِر ىياتَوكةك كنةت ىرادشيش<br />
ىنووب اوةك توةكرةد وتوةكتشةد ىمانجةئةل . ةواركتشورد وترطاِر ىياتَوك وب تةبيات ىكةلةكيةي شةتشةبةم وةئ َوب<br />
اتَوك,<br />
ىدربزرد ىياشروق ىهيِرَوط ىضئاضخ رةش ةل واركنور ىكةيةوَيش ةب<br />
ىاكةي ىياتَوك ىيرطاِر ىنووب<br />
. ويزةباد<br />
–<br />
(End restraint)<br />
ىياشروق ىدنةويةث و ىدربزرد<br />
ىهيزةباد و<br />
ىاكةي ىياتَوك ىيرطاِر<br />
(Ultimate Load)<br />
اتَوك ىيةدرةث ىراكَوي ىنوبةي ةب مَلاةب مةك ىِربةب ىدربزرد ىياشروق ىنووبدايز ىَوي ةتَيبةد<br />
. تيبةي مةك ىزرةب<br />
ىناضينهب ةل وبرتايز ةدايز مةئ و واركنور ىكةيةوَيش ةب تيبةد دايز<br />
(Ultimate Load)<br />
ىياشروق<br />
(End restraint)<br />
ىياشروق<br />
ةك توةكرةد . ىدربزرد ىهيزةباد ىدربزرد ىهيزةباد ىةوةنووب مةك ىبةب تَيوةكةد تشةد ىياشروقاتؤك ىنوبدايز<br />
وبرت شاب ىتهسمؤيرف ىضينهب ىفرةصةت . ىاكةضينهب ىناكةروج ومةي ةل ةطنرط ةن ويزةباد ى رةشةل ةضينهب ىناث لىور<br />
. وين وب ةووب مةك ويزوباد ملاةب ىهشائ ىشيش ةب ىاكةوارك سَيي ةب ةضينهب<br />
دروارةب ىياشروق اتَوك ىنوبدايز ةل<br />
ةديقملا ةقيقرلا ةحلسملا تاطلابلاو تنمسوريفلا تاطلابل تاىوشتلا و ءانثنلاا ةمواقم ةسارد مت يلاحلا ثحبلا يف<br />
عنم فدهب صاخ يديدح لكيى عينصت مت<br />
. ) ةحيرش(<br />
دحاو هاجتاب فقس<br />
63<br />
ةصلاخلا<br />
ىلع يربتخم لمع للاخ نم بناوجلا<br />
ببسملا لمحلا صئاصخ ظوحلم لكشب ريغي بناوجلا دييقت دوجو نأب دكءوت ةلصاحلا جئاتنلا . ةطلابلل ةيبناجلا ةكرحلا<br />
دادزا بناوجلا دييقت دوجو ببسب<br />
. دولاا-لمحلا<br />
ةقلاع ىلا ةفاضلااب<br />
ول بحاصملا دولااو ىصقلاا لمحلا<br />
,<br />
ققشتلل<br />
ناك ةدايزلاو ظوحلم لكشب ىصقلاا لمحلا دادزا يئاشغلا لعفلا دوجو ببسب نكل ةليلق ةبسنب ققشتلل ببسملا لمحلا<br />
كمس رود نأب دجو . ةنودللا يف ناصقن نودب ويلع لوصحلا<br />
نكمي لمحلا يف ةدايزلا<br />
. ليلق كمس تاذ فقسلل ربكا<br />
ةنراقم لمحلا ةدايزل نسحا لكشب تفرصت ةيتنمسوريفلا<br />
تاطلابلا نا . تاطلابلا عاونا لكل مهم ريغ ةنودللا<br />
ىلع ةطلابلا<br />
.<br />
ةميقلا فصن ىلا تضفخنا ةنودللا<br />
نكل<br />
ةحلسملا تاطلابلاب<br />
855
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 156-159, 2011<br />
651<br />
SOME NEW SEPARATION AXIOMS<br />
ZANYAR A. AMEEN AND RAMADHAN A. MUHAMMED<br />
Dept. of Mathematics, Faculty of Science, University of Duhok, Kurdistan-region-Iraq<br />
(Received: September 6, 2010; Accepted for publication: June 4, 2011)<br />
ABSTRACT<br />
In this paper sc-open sets [6] are used to define some new separation axioms and study some of their basic properties.<br />
The implications of these axioms among themselves, some strong types of separation axioms and semi-separation axioms are<br />
investigated.<br />
KEYWORDS: strongly semi-Ti, sc-Ti and semi-Ti spaces for i = 0, 1, 2<br />
I<br />
1. INTRODUCTION<br />
n 1963, Levine [7] introduced and<br />
investigated the notions of semi-open sets<br />
and semi-continuity in topological spaces. Since<br />
then many separation axioms and mappings have<br />
been studied using semi-open sets. In [8], some<br />
new separation axioms, namely, semi-T0, semi–<br />
T1 and semi-T2 are introduced and studied.<br />
Khalaf [5] introduced and investigated then<br />
notion of strongly semi-separation axioms. The<br />
purpose of this paper is to introduce and<br />
investigate some more separation axioms called<br />
sc-Ti spaces for i = 0, 1, 2. These spaces lie<br />
strictly between strongly semi-Ti and semi-Ti.<br />
2. PRELIMINARIES<br />
Throughout the present paper spaces X, Y<br />
etc., will denote topological spaces. The closure<br />
and interior of A � X are denoted by Cl(A) and<br />
Int(A) respectively. A subset A of a space X is<br />
said to be semi-open [7] (resp., preopen [9] and<br />
regular open [11]) if A � Cl(Int(A)) (resp., A �<br />
Int(Cl(A)) and A = Int(Cl(A))). The complement<br />
of a semi-open (resp., preopen and regular open)<br />
set is said to be semi-closed [3] (resp., preclosed<br />
[9] and regular closed [11]). Joseph and Kwack<br />
[4], introduced that a subset A of a space X is<br />
said to be θ-semi-open if for each x � A, there<br />
exists a semi-open set G such that x � G �<br />
Cl(G) � A. A peropen (resp. semi-open) subset<br />
A of a space X is said to be pc-open [2] (resp.<br />
sc-open [6]) if for each x � A, there exists a<br />
closed set F such that x � F � A. The family of<br />
all pc-open (resp. sc-open, semi-open and<br />
clopen) subsets of a space X is denoted by<br />
PCO(X) (resp. SCO(X), SO(X) and CO(X)). It is<br />
proven that the family of pc-open (resp. sc-open)<br />
sets forms a supra topology. A subset N of X is<br />
said to be sc-neighborhood of x, if there exists<br />
an sc-open set U in X such that x � U � N. A<br />
point x � X is said to be in the sc-closure [6] of<br />
A if for each sc-pen set U containing x, U � A ≠<br />
�. A subset<br />
A of X is said to be sc-closed if A = sc-Cl(A).<br />
It worth mentioning that the class of sc-open sets<br />
lies between the class of θ-semi-open sets and<br />
the class of semi-open sets.<br />
Definition 2.1. A topological space X is semi-<br />
T0-space [8] (resp., strongly semi-T0-space [5])<br />
if to each pair of distinct points x, y of X, there<br />
exists a semi-open (resp., �-semi-open) set<br />
containing one but not the other.<br />
Definition 2.2. A topological space X is semi-<br />
T1-space [8] (resp., strongly semi-T1-space [5])<br />
if to each pair of distinct points x, y of X, there<br />
exists a pair of semi-open (resp., �-semi-open)<br />
sets, one containing x but not y, and the other<br />
containing y but not x.<br />
Definition 2.3. A topological space X is semi-<br />
T2-space [8] (resp., strongly semi-T2-space [5])<br />
if to each pair of distinct points x, y of X, there<br />
exists a pair of disjoint semi-open (resp., �-semiopen)<br />
sets, one containing x and the other<br />
containing y.<br />
Definition 2.4. A space X is said to be<br />
Alexandroff [1], if arbitrary intersections of the<br />
family of open sets are open, equivalently, any<br />
union of closed sets is closed.<br />
Lemma 2.5 [6] Let (X, �) be a space. Then<br />
SCO(X, �) = SCO(X, �α ).<br />
Lemma 2.6. Let (X, �) be a topological space.<br />
(1) If A � CO(X) and B � SCO(X), then A �<br />
B � SCO(A) [6].<br />
(2) If A � PCO(X) and B � SCO(X), then A<br />
� B � SCO(A)[2].<br />
Lemma 2.7. [6] If a space X is T1-space, then<br />
the families SO(X) and SCO(X) are equal.<br />
Lemma 2.8. [6] If a topological space (X, τ) is<br />
Alenxandroff, then θSO(X) = SCO(X).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 156-159, 2011<br />
Lemma 2.9. [6] Let X and Y be two topological<br />
spaces and X × Y be the product topology. Let A<br />
� SCO(X) and B � SCO(Y). Then A × B �<br />
SCO(X × Y).<br />
3. SC-T0-SPACES<br />
Definition 3.1. A topological space X is sc-T0space<br />
if to each pair of distinct points x, y of X,<br />
there exists an sc-open set containing one of<br />
them but not the other.<br />
It is evident that strongly semi-T0-space implies<br />
sc-T0-space, and sc-T0-space implies semi-T0space.<br />
But the converses may not be true as<br />
shown in the following examples:<br />
Example 3.2. Clearly an infinite set X with the<br />
cofinite topology is sc-T0 but not strongly semi-<br />
T0, because the only non-empty regular closed<br />
subset of X is X itself.<br />
Example 3.3. Let X = {a, b, c}, and � = {�, {a},<br />
X} be a topology on X. Then X is<br />
semi-T0 but not sc-T0.<br />
Theorem 3.4. A topological space X is sc-T0space<br />
if and only if sc-Cl{x} � sc-Cl{y} for<br />
every pair of distinct points x, y of X.<br />
Proof. Let X be an sc-T0-space and x, y be any<br />
two distinct points of X. There exists an sc-open<br />
U containing x or y, say, x but not y. Then X-U<br />
is an sc-closed set which does not contain x but<br />
contains y. Since sc-Cl{y} is the smallest scclosed<br />
set containing y, sc-Cl{y}� X-U, and so<br />
x � sc-Cl{y}. Consequently sc-Cl{x}<br />
� sc-Cl{y}.<br />
Conversely, suppose for any x, y � X with x � y<br />
, sc-Cl{x} � sc-Cl{y}. Now, let z � X such that<br />
z � sc-Cl{x}but z � sc-Cl{y}. Now, we claim<br />
that x � sc-Cl{y}. For if x � sc-Cl{y}, then<br />
{x}� sc-Cl{y} which implies that sc-Cl{x} �<br />
sc-Cl{y}. This is contradiction to the fact that z<br />
� sc-Cl{y}. Consequently x belongs to the scopen<br />
set X- sc-Cl{y} to which y does not<br />
belong. It gives that X is sc-T0-space.<br />
Theorem 3.5. Every clopen (pc-open) subspace<br />
of an sc-T0-space is sc-T0-space.<br />
Proof. Let Y be a clopen (pc-open) subspace of<br />
an sc-T0-space X and x, y be two distinct points<br />
of Y. Then there exists an sc-open set U<br />
containing x or y, say, x but not y. Now by<br />
Lemma 2.6, U � Y is an sc-open set in Y<br />
containing x but not y. Hence Y is sc-T0-space.<br />
Definition 3.6. A function f: X�Y is said to be<br />
a point-sc-closure 1-1 if x, y � X such that sc-<br />
Cl{x} � sc-Cl{y}, then sc-Cl{f(x)} � sc-<br />
Cl{f(y)}.<br />
Theorem 3.7. If f : X � Y is a point-sc-closure<br />
1-1 function and X is sc-T0-space,<br />
then f is 1-1.<br />
Proof. Let x, y �X with x � y. Since X is sc-T0space,<br />
then by Theorem 3.4, sc-Cl{x} � sc-<br />
Cl{y}. But f is point-sc-closure 1-1 implies that<br />
sc-Cl{f(x)} � sc-Cl{f(y)}. Hence f(x) � f(y).<br />
Thus, f is 1-1.<br />
Theorem 3.8. If a topological space X is sc-T0,<br />
then it is T0.<br />
Proof. Let X be an sc-T0-space and x, y be any<br />
two distinct points of X. There exists an sc-open<br />
U containing x or y, say, x but not y. Then there<br />
exists a closed set F such that x � F � U, so X-F<br />
is an open set containing y, and it is obvious that<br />
x � X-F. Therefore, X is T0-space.<br />
4. SC-T1- SPACES<br />
Definition 4.1. A topological space X is sc-T1 if<br />
to each pair of distinct points x, y of X, there<br />
exists a pair of sc-open sets, one containing x but<br />
not y, and the other containing y but not x.<br />
Remark 4.2. Obviously, every strongly semi-T1space<br />
is sc-T1, but the converse is not always<br />
true, as in Example 3.2, the space X is sc-T1 but<br />
not strongly semi-T1.<br />
Remark 4.3. Every sc-T1-space is semi-T1, but<br />
the following example shows that the converse is<br />
not always true.<br />
Example 4.4. Let X = {a, b, c}, and � = {�, {a},<br />
{b}, {a, b}, X} be a topology on X. Then X is<br />
semi-T1 but not sc-T1.<br />
Remark 4.5. Every sc-T1-space is sc-T0, but the<br />
converse is not always true as shown in the<br />
following example.<br />
Example 4.6. Let X = {a, b, c}, and � = {�, {a},<br />
{b}, {a, b}, {b, c}, X} be a topology on X. Then<br />
X is sc-T0 but not sc-T1.<br />
Theorem 4.7. For a topological space X, each of<br />
the following statement are equivalent:<br />
(1) X is sc- T1.<br />
(2) Each singleton set {x} is sc-closed.<br />
(3) Each subset of X is the intersection of all<br />
sc-open sets containing it.<br />
(4) The intersection of all sc-open sets<br />
containing the point x � X is the set {x}.<br />
Proof. (1) � (2) Suppose (1). Let x � X. Then<br />
for any y � X, x � y, there exists an sc-open sets<br />
U containing y but not x. Hence y � U � {x} c .<br />
This implies that {x} c = �{U: y � {x} c }. So<br />
{x} c being a union of sc-open sets. Hence {x} is<br />
sc-closed.<br />
651
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 156-159, 2011<br />
(2) � (1) Suppose (2). Let x, y � X and x � y.<br />
Then {x} and {y} are sc-closed sets. Hence {x} c<br />
is an sc-open set containing y but not x and {y} c<br />
is an sc-open set containing x but not y.<br />
Therefore X is sc-T1.<br />
(2) � (3) Suppose (2). If A � X, then for each<br />
point y � A, there exists a set {y} c such that A �<br />
{y} c and each of these sets is sc-open. Hence A<br />
= �{{y} c : y � A c } so that the intersection of all<br />
sc-open sets containing A is the sets A itself.<br />
(3) � (4) Obvious.<br />
(4) � (1) Suppose (4). Let x, y � X and x � y.<br />
Hence there exists an sc-open set Ux such that x<br />
� Ux and y � Ux. Similarly, there exists an scopen<br />
set Uy such that y � Uy and x � Uy. Hence<br />
X is sc- T1.<br />
Theorem 4.8. Every clopen (pc-open) subspace<br />
of an sc-T1-space is sc-T1-space.<br />
Proof. Let A be a clopen (pc-open) subspace of<br />
an sc-T1-space X. Let x � A. Since A is sc-T1,<br />
X-{x} is sc-open in X. Now, A being clopen (pcopen),<br />
A � (X-{x}) = A-{x} is sc-open in A, by<br />
lemma 2.6. Consequently, {x} is sc-closed in A.<br />
Hence by Theorem 4.3, A is sc-T1-space.<br />
651<br />
5. SC-T2- SPACES<br />
Definition 5.1. topological space X is sc-T2 if<br />
to each pair of distinct points x, y of X, there<br />
exists a pair of disjoint sc-open sets, one<br />
containing x and the other containing y.<br />
Remark 5.2. Since every �-semi-open set is scopen,<br />
then every strongly semi-T2-space is sc-T2,<br />
but the converse is not always true as shown in<br />
the following example.<br />
Example 5.3 Consider the prime integer<br />
topology [see 10, page 83]. Then the space is<br />
both T1and semi-T2 and consequently it is sc-T2<br />
but not strongly semi-T2, since the open set<br />
containing the prime number p = 2 is dense.<br />
Remark 5.4. Every sc-T2-space is semi-T2, but<br />
the following example shows that the converse is<br />
not always true.<br />
Example 5.5. Consider the space X given in<br />
Example 4.4. Then X is semi-T1 but not sc-T1.<br />
Remark 5.6. Every sc-T2-space is sc-T1, but the<br />
converse need not be true in general, as in<br />
Example 3.2, the space X is sc-T1 but not sc-T2<br />
Theorem 5.7. For a topological space X, the<br />
following statements are equivalent:<br />
(1) X is sc-T2.<br />
(2) If x � X, then there exists an scneighborhood<br />
N(x) of x such that<br />
y � sc-Cl(N(x)).<br />
(3) For each x � X, �{sc-Cl(N) : N is an scneighborhood<br />
of x} = {x}.<br />
Proof. (1) � (2) Suppose (1). Let x � X. Then<br />
there exist disjoint sc-open sets U and V such<br />
that x � U, x � V. Then x � U � X-V, so that<br />
X-V is an sc-neighborhood of x. We write N(x)<br />
= X-V. Then N(x) is sc-closed and y � sc-<br />
Cl(N(x)). Hence y � sc-Cl(N(x)).<br />
(2) � (3) Straight forward.<br />
(3) � (1) Suppose (3). Let x, y � X and x � y.<br />
Then by hypothesis there exists an sc-closed scneighborhood<br />
N of x such that y � N. Now there<br />
is an sc-open set U such that x � U � N. Thus U<br />
and X-N are disjoint sc-open sets containing x<br />
and y respectively. Hence<br />
X is sc-T2.<br />
Theorem 5.8. Every clopen (pc-open) subspace<br />
of an sc-T2-space is sc-T2-space.<br />
Proof: It is analogous to Theorem 3.5.<br />
Theorem 5.9. A space is sc-T2 if and only if (X,<br />
��) is sc-T2.<br />
Proof. Let x, y � X with x � y . Since X is sc-T2,<br />
there exist disjoint sc-open sets U and V in X<br />
such that x � U and y � V. Then by Lemma 2.5,<br />
U, V � SCO(X,��). Thus, (X,��) is sc-T2.<br />
Converse follows similarly since<br />
SCO(X,�) = SCO(X,��).<br />
Theorem 5.10. Let X be a T1-space. Then X is<br />
sc-Ti if and only it is semi-Ti for i = 0,1,2.<br />
Proof. Directly follows from Lemma 2.7.<br />
Corollary 5.11. Let X be an Alexandroff space.<br />
Then X is strongly semi-Ti if and only it is<br />
sc-Ti for i = 0,1,2.<br />
Proof. Follows from Lemma 2.8.<br />
Theorem 5.12. The product of two sc-T2<br />
spaces is sc-T2.<br />
Proof. Let X, Y be semi-T2 spaces and let x, y �<br />
X � Y with x ≠ y. Let x = (a, b) and y = (c, d).<br />
Without any loss of generality suppose that a ≠ c<br />
and b ≠ d. Since a and c are distinct points of X,<br />
there exist disjoint sc-open sets U and V of X<br />
such that a � U and c � V. Similarly let G and H<br />
are disjoint sc-open sets in Y such that b � G<br />
and b � H. Then by Lemma 2.9, U � G and V �<br />
H are sc-open sets X � Y containing<br />
x and y respectively.<br />
Also,<br />
(U � G) � (V � H) = (U � V) � (G � H) = �.<br />
Hence X � Y is sc-T2.<br />
The following diagram indicates the<br />
implications between the separation axioms that<br />
we have come across in this paper and examples
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 156-159, 2011<br />
show that no other implications hold between<br />
them.<br />
strongly semi-T2 sc-T2 semi-T2<br />
strongly semi-T2 sc-T2 semi-T2<br />
strongly semi-T2 sc-T2 semi-T2<br />
Diagram (1)<br />
REFERENCE<br />
- P. Alexandroff, Diskrete Räume, Rec.[math Sbornik]<br />
(1937) (501-518).<br />
- Z. A. Ameen, pc-open sets and pc-continuity in<br />
topological spaces, Journal of Advanced Research<br />
in Pure Mathematics, Vol. 3(1) (2011) 123 - 134.<br />
- S. G. Crossley and S. K. Hildebrand, Semi-closure,<br />
Texas J. Sci., 22 (1971), 99-112.<br />
- J. E. Joseph and M. H. Kwack, On S-closed spaces, Proc.<br />
Amer. Math. Soc., 80 (2) (1980), 341-348.<br />
- A. B. Khalaf, Some strong types of separation axioms,<br />
Journal of Dohuk Univ., 3(2) (2000) (76-79).<br />
- A. B. Khalaf and Z. A. Ameen, sc-open sets and sccontinuity<br />
in topological spaces, Journal of<br />
Advanced Research in Pure Mathematics,<br />
2(3) (2010), 87-101.<br />
- N. Levine, Semi-open sets and semi-continuity in<br />
topological spaces, Amer. Math. Monthly, 70 (1)<br />
(1963), 36-41.<br />
- S. N. Maheshwari and R. Prasad, Some new separation<br />
axioms, Ann. Soc. Sci. Bruxelles, Ser. I., 89 (1975),<br />
395-402.<br />
- A. S. Mashhour, M. E. Abd El-Monsef and S. N. El-<br />
Deeb, On precontinuous and week precontinuous<br />
mappings, Proc. Math. Phys. Soc. Egypt, 53<br />
(1982), 47-53.<br />
- L. A. Steen and J. A. Seebach, Counterexamples in<br />
Topology, Springer Verlag New York Heidelberg<br />
Berlin, 1978.<br />
- M. H. Stone, Applications of the theory of boolean<br />
rings to topology, Trans. Amer. Math. Soc.,<br />
41(1937), 375-481.<br />
651
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 160-164, 2011<br />
061<br />
SOME NEW SEPARATION AXIOMS<br />
ZANYAR A. AMEEN * and BARAVAN A. ASAAD **<br />
* Dept. of Mathematics, Faculty of Science, University of Duhok, Kurdistan Region-Iraq<br />
** Dept. of Mathematics, Faculty of Science, University of Zakho, Kurdistan Region-Iraq<br />
(Received: September 6, 2010; Accepted for publication: May 2, 2011)<br />
ABSTRACT<br />
In this paper ps-open sets [8] are used to define some new separation axioms and study some of their basic<br />
properties. The implications of these axioms among themselves, �-Ti and pre-Ti for i = 0, 1, 2 are investigated.<br />
KEYWORDS: �-Ti, ps-Ti and pre-Ti spaces for i = 0, 1, 2<br />
I<br />
1. INTRODUCTION<br />
n 1982, Mashhour et. al. [13] introduced<br />
and investigated the notions of preopen<br />
sets and pre-continuity in topological spaces.<br />
Since then many separation axioms and<br />
mappings have been studied using preopen sets.<br />
In [6], some weak separation axioms, namely,<br />
pre-T0, pre-T1 and pre-T2 spaces are introduced<br />
and studied. In 1980, Jain [5] introduced and<br />
investigated the new classes of separation<br />
axioms called �-T0, �-T1 and �-T2. The purpose<br />
of this paper is to introduced and investigated<br />
some more separation axioms called ps-Ti<br />
spaces, for i = 0, 1, 2. These spaces lie strictly<br />
between �-Ti and pre-Ti spaces, for i = 0, 1, 2.<br />
2. PRELIMINARIES<br />
Throughout the present paper, spaces X,<br />
Y etc., will be denoting topological spaces. The<br />
closure and interior of A � X are denoted by<br />
Cl(A) and Int(A), respectively. A subset A of a<br />
space X is said to be preopen [13] (resp., semiopen<br />
[10], �-open [14], regular open [16] and<br />
semi-regular [1]) if A � Int(Cl(A)) (resp., A �<br />
Cl(Int(A)), A � Int(Cl(Int(A))), A = Int(Cl(A))<br />
and A = sInt(sCl(A))). The complement of a<br />
preopen (resp., semi-open and regular open) sets<br />
is said to be preclosed [3] (resp., semi-closed [2]<br />
and regular closed [16]). Velicko [17],<br />
introduced that a subset A of a space X is said to<br />
be �-open if for each x � A, there exists an open<br />
set G such that x � G � Int(Cl(G)) � A. A<br />
peropen subset A of a space X is said to be psopen<br />
[8] if for each x � A, there exists a semiclosed<br />
set F such that x � F � A. The family of<br />
all ps-open (resp., preopen and regular-semi)<br />
subsets of a space X is denoted by PSO(X)<br />
(resp., PO(X) and RS(X)). It is proven that the<br />
family of ps-open sets forms a supra topology. A<br />
subset N of X is said to be ps-neighborhood [8]<br />
of x, if there exists a ps-open set U in X such<br />
that x � U � N. A point x � X is said to be in<br />
the ps-closure [8] of A if for each ps-open set U<br />
containing x, U � A ≠ �. A subset A of X is said<br />
to be ps-closed [8] if A = ps-Cl(A). It worth<br />
mentioning that the class of ps-open sets lies<br />
between the class of �-open sets and the class of<br />
preopen sets. A function f : X � Y is said to be<br />
almost ps-continuous [7] (resp., weakly pscontinuous<br />
[9]) if for each x � X and each open<br />
set V of Y containing f (x), there exists a PS-open<br />
set U of X containing x such that f(U) �<br />
Int(Cl(V)) (resp., f(U) � Cl(V)).<br />
Definition 2.1. A topological space X is pre-T0<br />
[6] (resp., semi-T0 [11] and �-T0 [5]) space if to<br />
each pair of distinct points x, y of X, there exists<br />
a preopen (resp., semi-open and �-open) set<br />
containing one, but not the other.<br />
Definition 2.2. A topological space X is pre-T1<br />
[6] (resp., semi-T1 [11] and �-T1 [5]) space if to<br />
each pair of distinct points x, y of X, there exists<br />
a pair of preopen (resp., semi-open and �-open)<br />
sets, one containing x but not y, and the other<br />
containing y, but not x.<br />
Definition 2.3. A topological space X is pre-T2<br />
[6] (resp., �-T2 [5]) if to each pair of distinct<br />
points x, y of X, there exists a pair of disjoint<br />
preopen (resp., �-open) sets, one containing x<br />
and the other containing y.<br />
Definition 2.4. [4] A space X is called locally<br />
indiscrete if every open subset of X is closed.<br />
Definition 2.5. [12] A space X is s-regular if and<br />
only if for each x � X and each open set G<br />
containing x, there exists a semi-open set H such<br />
that x � H � sCl(H) � G.<br />
Lemma 2.6. [8] Let (X, �) be a space. Then<br />
PSO(X, �) = PSO(X, �α).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 160-164, 2011<br />
Lemma 2.7. Let (X, �) be a topological space.<br />
Then:<br />
(1) If A � � and B � PSO(X), then A � B �<br />
PSO(A) [8].<br />
(2) If A � RS(X) and B � PSO(X), then A � B<br />
� PSO(A)[8].<br />
Lemma 2.8. [8] If a space X is semi-T1, then<br />
PO(X) = PSO(X).<br />
Lemma 2.9. [8] If a topological space (X, �) is<br />
locally indiscrete, then PSO(X) = �.<br />
Lemma 2.10. [8] If a topological space (X, �) is<br />
s-regular, then � � PSO(X).<br />
Lemma 2.11. [8] Let X and Y be two<br />
topological spaces and X × Y be the product<br />
topology. Let A � PSO(X) and B � PSO(Y).<br />
Then A × B � PSO(X × Y).<br />
Lemma 2.12. [8] If f : X � Y is a continuous<br />
and open function and U is a ps-open set of Y,<br />
then f −1 (U) is a ps-open set in X.<br />
3. PS-T0 SPACES<br />
In this section, we introduce a new type<br />
of separation axioms called ps-T0 space, this<br />
space lies strictly between �-T0 and pre-T0 space,<br />
and we give some properties of ps-T0 space.<br />
Definition 3.1. A topological space X is ps-T0 if<br />
to each pair of distinct points x, y of X, there<br />
exists a ps-open set containing one, but not the<br />
other.<br />
It is evident that strongly �-T0 space implies<br />
ps-T0, and ps-T0 space implies pre-T0. But the<br />
converses may not be true as shown in the<br />
following examples:<br />
Example 3.2. Let X = {a, b, c, d}, and � = {�,<br />
{a}, {b}, {a, b}, X} be a topology on X, then X<br />
is ps-T0 but not �-T0, since c ≠ d, there is no �open<br />
set containing one of them, but not the<br />
other.<br />
Example 3.3. Let X = {a, b, c}, and � = {�, {a},<br />
X} be a topology on X. Then X is pre-T0 but not<br />
ps-T0, since for every two distinct points in X,<br />
there is no ps-open set containing one of them,<br />
but not the other.<br />
Theorem 3.4. A topological space X is ps-T0<br />
space if and only if ps-Cl{x} � ps-Cl{y}, for<br />
every pair of distinct points x, y of X.<br />
Proof. Let X be a ps-T0 space and x, y be any<br />
two distinct points of X. There exists a ps-open<br />
set U containing x or y, say x, but not y. Then<br />
X\U is a ps-closed set, which does not contain x,<br />
but contains y. Since ps-Cl{y} is the smallest psclosed<br />
set containing y, ps-Cl{y}� X\U, and so<br />
x � ps-Cl{y}. Consequently ps-Cl{x} � ps-<br />
Cl{y}.<br />
Conversely, suppose for any x, y � X with x �<br />
y, ps-Cl{x} � ps-Cl{y}. Now, let z � X such that<br />
z � ps-Cl{x}, but z � ps-Cl{y}. Now, we claim<br />
that x � ps-Cl{y}. For if x � ps-Cl{y}, then {x}<br />
� ps-Cl{y}, which implies that ps-Cl{x} � ps-<br />
Cl{y}. This is contradiction to the fact that z �<br />
ps-Cl{y}. Consequently x belongs to the ps-open<br />
set X\ps-Cl{y} to which y does not belong. It<br />
gives that X is ps-T0 space.<br />
Theorem 3.5. Every open (or semi-regular)<br />
subspace of a ps-T0 space is ps-T0 space.<br />
Proof. Let Y be an open (or semi-regular)<br />
subspace of a ps-T0 space X and x, y be two<br />
distinct points of Y. Then there exists a ps-open<br />
set U containing x or y, say, x but not y. Now by<br />
Lemma 2.7, U � Y is a ps-open set in Y<br />
containing x but not y. Hence Y is ps-T0 space.<br />
Definition 3.6. A function f: X � Y is said to be<br />
a point-ps-closure 1-1 if x, y � X such that ps-<br />
Cl{x} � ps-Cl{y}, then ps-Cl{f(x)} � ps-<br />
Cl{f(y)}.<br />
Theorem 3.7. If f : X � Y is a point-ps-closure<br />
1-1 function and X is ps-T0 space, then f is 1-1.<br />
Proof. Let x, y �X with x � y. Since X is a ps-T0<br />
space, then by Theorem 3.4, ps-Cl{x} � ps-<br />
Cl{y}. But f is point-ps-closure 1-1 implies that<br />
ps-Cl{f(x)} � ps-Cl{f(y)}. Hence f(x) � f(y).<br />
Thus, f is 1-1.<br />
Theorem 3.8. Let f : X � Y be a mapping from<br />
ps-T0 space X into ps-T0 space Y. Then f is<br />
point-ps-closure 1-1 if and only if f is 1-1.<br />
Proof. Follows from Theorem 3.7.<br />
Theorem 3.9. Let f : X � Y be an injective,<br />
continuous and open function. If Y is ps-T0, then<br />
X is ps-T0.<br />
Proof. Let x, y � X with x ≠ y. Since f is<br />
injective and Y is ps-T0, there exists a ps-open<br />
set Ux in Y such that f(x) � Ux and f(y) � Ux or<br />
there exists a ps-open set Uy in Y such that f(y)<br />
� Uy and f(x) � Uy with f(x) ≠ f(y). Since f is<br />
continuous and open function, then by Lemma<br />
2.12, f −1 (Ux) is ps-open set in X such that x �<br />
f −1 (Ux) and y � f −1 (Ux) or f −1 (Uy) is ps-open set in<br />
X such that y � f −1 (Uy) and x � f −1 (Uy). This<br />
shows that X is ps-T0.<br />
Theorem 3.10. If a topological space X is ps-T0,<br />
then it is semi-T0.<br />
Proof. Let X be a ps-T0 space and x, y be any<br />
two distinct points of X. There exists a ps-open<br />
set U containing x or y, say, x but not y. Then<br />
there exists a semi-closed set F such that x � F<br />
060
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 160-164, 2011<br />
� U, so X\F is a semi-open set containing y, and<br />
it is obvious that x � X\F. Therefore, X is semi-<br />
T0 space.<br />
061<br />
4. PS-T1 SPACES<br />
In this section, we introduce a new type of<br />
separation axioms called ps-T1 space, this space<br />
lies strictly between �-T1 and pre-T1 space, and<br />
we give some properties of ps-T1 space.<br />
Definition 4.1. A topological space X is ps-T1 if<br />
to each pair of distinct points x, y of X, there<br />
exists a pair of ps-open sets, one containing x<br />
but not y, and the other containing y but not x.<br />
Remark 4.2. Obviously, every �-T1 space is ps-<br />
T1, but the converse is not always true, as shown<br />
in the following example.<br />
Example 4.3. Let X be any infinite set with the<br />
cofinite topology. Simplify the space X is T1 and<br />
hence it is semi-T1 and pre-T1. Then by Lemma<br />
2.8, X is ps-T1, but not �-T1, since for x and y in<br />
X, there is no �-open set containing one of them,<br />
but not the other.<br />
Remark 4.4. Every ps-T1 space is pre-T1, but the<br />
following example shows that the converse is<br />
not always true.<br />
Example 4.5. Let X = {a, b, c} with the<br />
indiscrete topology �. Then X is pre-T1, but not<br />
ps-T1.<br />
Remark 4.6. Every ps-T1 space is ps-T0, but the<br />
converse is not always true as seen in the<br />
Example 3.2, X is ps-T0 but not ps-T1.<br />
Theorem 4.7. For a topological space X, the<br />
following statements are equivalent:<br />
(1) X is ps-T1.<br />
(2) Each singleton set {x} is ps-closed.<br />
(3) Each subset of X is the intersection of all psopen<br />
sets containing it.<br />
(4) The intersection of all ps-open sets<br />
containing the point x � X is the set {x}.<br />
Proof. (1) � (2) Suppose (1). Let x � X. Then<br />
for any y � X, x � y, there exists a ps-open set U<br />
containing y but not x. Hence y � U � X\{x}.<br />
This implies that X\{x} = �{U: y � X\{x}}. So,<br />
X\{x} being a union of ps-open sets. Hence, {x}<br />
is ps-closed.<br />
(2) � (3) Suppose (2). If A � X, then for each<br />
point y � A, there exists a set X\{y} such that A<br />
� X\{y} and each of these sets is ps-open.<br />
Hence A = �{ X\{y} : y � X\A} so that the<br />
intersection of all ps-open sets containing A is<br />
the set A itself.<br />
(3) � (4) Obvious.<br />
(4) � (1) Suppose (4). Let x, y � X and x � y.<br />
Hence there exists a ps-open set Ux such that x �<br />
Ux and y � Ux. Similarly, there exists a ps-open<br />
set Uy such that y � Uy and x � Uy. Hence X is<br />
ps- T1.<br />
Theorem 4.8. Every open (or semi-regular)<br />
subspace of a ps-T1 space is ps-T1.<br />
Proof. Let A be a open (or semi-regular)<br />
subspace of a ps-T1 space X. Let x � A. Since X<br />
is ps-T1, then by Theorem 4.7, {x} is ps-closed<br />
set in X and hence X\{x} is ps-open set in X.<br />
Now, A being open (or semi-regular), A �<br />
X\{x} = A\{x} is ps-open in A, by Lemma 2.7.<br />
Consequently, {x} is ps-closed in A. Hence by<br />
Theorem 4.7, A is ps-T1 space.<br />
Theorem 4.9. Let f : X � Y be an injective,<br />
continuous and open function. If Y is ps-T1, then<br />
X is ps-T1.<br />
Proof. Similar to Theorem 3.9.<br />
Theorem 4.10. Let f : X � Y be a weakly pscontinuous<br />
injection. If Y is Hausdorff, then X is<br />
ps-T1.<br />
Proof. Let x1 and x2 be any distinct points in X.<br />
Then f(x1) ≠ f(x2) and there exist disjoint open<br />
sets V1 and V2 of Y such that f(x1) � V1 and f(x2)<br />
� V2. Then we obtain f(x1) � Cl(V2) and f(x2) �<br />
Cl(V1). Since f is weakly ps-continuous, there<br />
exists a ps-open set Ui of X containing xi such<br />
that f(Ui) � Cl(Vi), for i = 1,2. Hence we obtain<br />
x2 � U1 and x1 � U2. This shows that X is ps-T1.<br />
5. PS-T2 SPACES<br />
In this section, we introduce a new type of<br />
separation axioms called ps-T2 space, this space<br />
lies strictly between �-T2 and pre-T2 space, and<br />
we give some properties of ps-T2 space.<br />
Definition 5.1. A topological space X is ps-T2 if<br />
to each pair of distinct points x, y of X, there<br />
exists a pair of disjoint ps-open sets, one<br />
containing x and the other containing y.<br />
Remark 5.2. Since every �-open set is ps-open,<br />
then every �-T2 space is ps-T2, but the converse<br />
is not always true as shown in the following<br />
example.<br />
Example 5.3. Consider the Prime Integer<br />
topology [see 15, page 83]. Then the space is<br />
both semi-T1and pre-T2 and consequently by<br />
Corollary 5.10, it is ps-T2 but not �-T2, since for<br />
x = 2 and y = any other number with x � y.<br />
There exist no �-open sets Ux and Vy such that<br />
Ux � Vy = �, the only �-open set containing the<br />
prime number p = 2 is X.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 160-164, 2011<br />
Remark 5.4. Clearly every ps-T2 space is pre-T2,<br />
but the converse need not be true in general, as<br />
in Example 4.3, the space X is pre-T2 but not ps-<br />
T2.<br />
Remark 5.5. Clearly every ps-T2 space is ps-T1,<br />
but the converse is not always true as shown in<br />
the following example.<br />
Example 5.6. Consider the space (X, �) given in<br />
Example 4.3. Then the space X is ps-T1 but not<br />
ps-T2, since for x and y in X, there is no pair of<br />
disjoint ps-open sets, one containing x and the<br />
other containing y.<br />
Theorem 5.7. For a topological space X, the<br />
following statements are equivalent:<br />
(1) X is ps-T2.<br />
(2) If x � X, then there exists a ps-neighborhood<br />
N(x) of x such that y � ps-Cl(N(x)).<br />
(3) For each x � X, �{ps-Cl(N) : N is a psneighborhood<br />
of x} = {x}.<br />
Proof. (1) � (2) Suppose (1). Let x � X. Then,<br />
there exist disjoint ps-open sets U, V such that x<br />
� U, x � V. Then x � U � X\V, so that X\V is a<br />
ps-neighborhood of x. We write N(x) = X\V.<br />
Then N(x) is ps-closed and y � ps-Cl(N(x)).<br />
Hence y � ps-Cl(N(x)).<br />
(2) � (3) Straight forward.<br />
(3) � (1) Suppose (3). Let x, y � X and x � y.<br />
Then, by hypothesis there exists a ps-closed psneighborhood<br />
N of x such that y � N. Now there<br />
is a ps-open set U such that x � U � N. Thus U<br />
and X\N are disjoint ps-open sets containing x<br />
and y respectively. Hence, X is ps-T2.<br />
Theorem 5.8. Every open (or semi-regular)<br />
subspace of a ps-T2 space is ps-T2.<br />
Proof: It is analogous to Theorem 3.5.<br />
Theorem 5.9. A space (X, �) is ps-T2 if and only<br />
if (X, ��) is ps-T2.<br />
Proof. Let x, y � X with x � y . Since X is ps-T2,<br />
there exist disjoint ps-open sets U and V in X<br />
such that x � U and y � V. Then by Lemma 2.6,<br />
U, V � PSO(X, ��). Thus, (X, ��) is ps-T2.<br />
Converse follows similarly since PSO(X, �) =<br />
PSO(X, ��).<br />
Corollary 5.10. Let X be a semi-T1 space. Then<br />
X is ps-Ti if and only if is pre-Ti for i = 0,1,2.<br />
Proof. Directly follows from Lemma 2.8.<br />
Corollary 5.11. Let X be an indiscrete space.<br />
Then X is Ti if and only if is ps-Ti for i = 0,1,2.<br />
Proof. Directly follows from Lemma 2.9.<br />
Corollary 5.12. Every s-regular Ti space is ps-Ti<br />
for i = 0,1,2.<br />
Proof. Directly follows from Lemma 2.10.<br />
Theorem 5.13. The product of two ps-T2 spaces<br />
is ps-T2.<br />
Proof. Let X, Y be ps-T2 spaces and let x, y � X<br />
� Y with x ≠ y. Let x = (a, b) and y = (c, d).<br />
Without any loss of generality suppose that a ≠ c<br />
and b ≠ d. Since a and c are distinct points of X,<br />
there exist disjoint ps-open sets U and V of X<br />
such that a � U and c � V. Similarly let G and H<br />
be disjoint ps-open sets in Y such that b � G and<br />
d � H. Then by Lemma 2.11, U � G and V � H<br />
are ps-open sets in X � Y containing x and y<br />
respectively. Also,<br />
(U � G) � (V � H) = (U � V) � (G � H) =<br />
�.<br />
Hence X � Y is ps-T2.<br />
Theorem 5.14. Let f : X � Y be an injective,<br />
continuous and open function. If Y is ps-T2, then<br />
X is ps-T2.<br />
Proof. Similar to Theorem 3.9.<br />
Theorem 5.15. If for each pair of distinct points<br />
x1 and x2 in a space X, there exist a function f of<br />
X into a Urysohn space Y such that f(x1) ≠ f(x2)<br />
and f is weakly ps-continuous at x1 and x2, then<br />
X is ps-T2.<br />
Proof. Let x1 and x2 be any distinct points in X.<br />
Then there exists a function f : X � Y such that<br />
Y is Urysohn, f(x1) ≠ f(x2) and f is weakly pscontinuous<br />
at x1 and x2. Let yi = f(xi) for i = 1; 2.<br />
We have y1 ≠ y2. Since Y is Urysohn, then there<br />
exist open sets V1 and V2 containing y1 and y2,<br />
respectively, such that Cl(V1) � Cl(V2) = �.<br />
Since f is weakly ps-continuous at x1 and x2, then<br />
there exist ps-open sets Ui for i = 1, 2 containing<br />
xi such that f(Ui) � Cl(Vi). This shows that U1 �<br />
U2 = � and hence X is ps-T2.<br />
Theorem 5.16. If for each pair of distinct points<br />
x1 and x2 in a space X, there exists a function f of<br />
X into a Hausdorff space Y such that (1) f(x1) ≠<br />
f(x2), (2) f is almost ps-continuous at x1 and (3) f<br />
is weakly ps-continuous at x2, then X is ps-T2.<br />
Proof. Since Y is Hausdorff, there exist open<br />
sets V1 and V2 of Y such that f1(x1) � V1, f2(x2)<br />
� V2 and V1 � V2 = � implies that Int(Cl(V1)) �<br />
Cl(V2) = �. Since f is almost ps-continuous at x1,<br />
there exists a ps-open set U1 in X containing x1<br />
such that f(U1) � Int(Cl(V1)). Since f is weakly<br />
ps-continuous at x2, there exists a ps-open set U2<br />
in X containing x2 such that f(U2) � Cl(V2).<br />
Therefore, we obtain U1 � U2 = �. This shows<br />
that X is ps-T2.<br />
Corollary 5.17. Let f : X � Y be almost PScontinuous<br />
(resp., weakly PS-continuous)<br />
injection. If Y is Hausdorff (resp., Urysohn)<br />
space, then X is PS-T2.<br />
062
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 160-164, 2011<br />
The following diagram indicates the<br />
implications between the separation axioms that<br />
we have come across in this paper and examples<br />
show that no other implications hold between<br />
them.<br />
063<br />
�-T2 ps-T2 pre-T2<br />
�-T1 ps-T1 pre-T1<br />
�-T0 ps-T0 pre-T0<br />
Diagram (1)<br />
REFERENCE<br />
- D. E. Cameron, Properties of S-closed spaces, Proc.<br />
Amer. Math. Soc., 72 (3) (1978), 581-586.<br />
- S. G. Crossley and S. K. Hildebrand, Semi-closure,<br />
Texas J. Sci., 22 (1971), 99-112.<br />
- El-Deeb S. N., Hasanein I. A., Mashhour A. S. and<br />
Noiri, T., On p-regular spaces, Bull. Math. Soc. Sci.<br />
Math. R.S. Roum., 27 (4) (1983), 311-315.<br />
- J. Dontchev, Survey on preopen sets, The Proceedings<br />
of the Yatsushiro Topological Conference, (1998),<br />
1-18.<br />
- R.C. Jain, The role of regularly open sets in general<br />
topology spaces, Ph.D. Thesis, Meerut Univ. Inst.<br />
Advance Stud. Meerut, India 1980.<br />
- A.Kar and P.Bhattacharyya, Some weak separation<br />
axioms, Bull. Cal. Math. Soc., 82 (1990),415-422.<br />
- A. B. Khalaf and B. A. Asaad, Almost PS-continuous<br />
functions, submitted.<br />
- A. B. Khalaf and B. A. Asaad, ps-open sets and pscontinuity<br />
in topological spaces, J. Duhok univ., 12<br />
(2) 2009, 183-192.<br />
- A. B. Khalaf and B. A. Asaad, Weakly PS-continuous<br />
functions, submitted to the J. Duhok Univ..<br />
- N. Levine, Semi-open sets and semi-continuity in<br />
topological spaces, Amer. Math. Monthly, 70 (1)<br />
(1963), 36-41.<br />
- S. N. Maheshwari and R. Prasad, Some new separation<br />
axioms, Ann. Soc. Sci. Bruxelles, Ser. I., 89 (1975),<br />
395-402.<br />
- S. N. Maheshwari and R. Prasad, On s-regular spaces,<br />
Glasnik Mat. 10(30) (1975), 347-350.<br />
- A. S. Mashhour, M. E. Abd El-Monsef and S. N. El-<br />
Deeb, On precontinuous and week precontinuous<br />
mappings, Proc. Math. Phys. Soc. Egypt, 53 (1982),<br />
47-53.<br />
- Njastad O., On some classes of nearly open sets, Pacific<br />
J. Math., 15 (3) (1965), 961-970<br />
- L. A. Steen and J. A. Seebach, Counterexamples in<br />
Topology, Springer Verlag New York Heidelberg<br />
Berlin, 1978.<br />
- M. H. Stone, Applications of the theory of boolean<br />
rings to topology, Trans. Amer. Math. Soc.,<br />
41(1937), 375-481.<br />
- N. V. Velicko, H-closed topological spaces, Amer.<br />
Math. Soc. Transl., 78 (2) (1968), 103-118.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
GAMMA – RAY AND ANNEALING EFFECTS ON<br />
THE ENERGY GAP OF GALSS<br />
AHMAD KHALAF MEHEEMEED * and SULAIMAN HUSSEIN AL-SADOON **<br />
* Dept. of Physics, College of Education, University of Mosul-Iraq<br />
** Dept. of Physics, Faculty of Science, University of Zakho, Kurdistan Region-Iraq<br />
(Received: September 6, 2010; Accepted for publication: June 28, 2011)<br />
ABSTRACT<br />
This study deals with the effect of gamma rays and heat treatment on the absorption coefficient and energy gap of<br />
the glass and the times of irradiation (10, 20, 30, 40, 50, 70, 80)hrs treated thermally at temperatures (20,<br />
50,100,150,200,250,300,350) o C for period time 15 min. We found that the absorption coefficient increases with<br />
increasing the gamma rays and decreases with the temperature increases. It was found that the values of the energy<br />
gap of the glass decreased with the increase of irradiation time at the range 40-50 hrs, and then increases when the<br />
irradiation time increasing, but it has been found that the thermal treatment will increases the values of the energy<br />
gap of the glass. These increases and decreases in the values of the energy gap are may be related to formation of Fcenter<br />
or coloration center as a result of exposure to the radiation, while heating repairing the glass damage.<br />
I<br />
1- INTRODUCTION<br />
onizing radiation (charged particles,<br />
neutrons, gamma rays, X-ray and other)<br />
has observed effects on the transparent materials<br />
such as glass and polymer, it affects on the<br />
electrical conductivity, hardness, and other<br />
mechanical properties [Pye et. al., 1972]. When<br />
ionizing radiation incident on the glass, the kind<br />
of coloration centers will be prevalent and can<br />
lead to the darkness of the glass. Darkness of the<br />
glass took place when the impact of radiation<br />
increase in the optical absorbance is almost<br />
identical in the visible spectrum. Optical<br />
absorbance is of great importance in the<br />
diagnosis of physical and chemical changes that<br />
occur on the glass and also used the optical<br />
absorbance as ameasur of the radiation dose [Al<br />
Sadoon, 2004]. There are many studies on the<br />
effect of gamma radiation and heat treatment on<br />
the optical properties of the glass. Brekhovaskish<br />
confirmed a simple glass crystallized boron-<br />
Lead-barium after an absorbed dose (108 rad) of<br />
gamma rays [Brekhovaskish, 1959]. Friebele et<br />
al, found the appearance of the absorption bands<br />
in the high-purity silica glass after gamma-ray or<br />
x-ray irradiated. They concluded that the<br />
appearing of these bands due to damage in the<br />
glass lattice in the absence of any added ions or<br />
impurities in high-purity silica glass [Friebele et.<br />
al., 1985]. Sharma et. al. studied effects of<br />
gamma-ray irradiation on some optical<br />
properties of xZnO· 2xPbO· (1–3x)B2O3<br />
glasses in the wavelength range 300–800 nm.<br />
Decrease in transmittance indicated the<br />
formation of color-center defects. Values for the<br />
energy-band gap, the width of the energy tail<br />
above the mobility gap and the cut-off<br />
wavelength have been measured before and after<br />
irradiation. Changes in the optical properties are<br />
explained in terms of radiation-induced<br />
structural defects and the composition of the<br />
glass [Sharma et. al., 2006]. Baccaro et. al., have<br />
been studied gamma ray effects on the some<br />
optical band gap of PbO–B2O3 glasses in the<br />
wavelength (200-1200) nm, absorption of<br />
glasses in near UV-visible have been used to<br />
calculate the optical mobility gap and width of<br />
tail before and after irradiation. They found that<br />
the decreasing in transmission due to irradiation,<br />
which indicates to the formation of color centers<br />
and structural changes in glass[Baccaro et. al.,<br />
2008]. Yuwen et. al., found that the variations:<br />
absorption coefficient (�),the optical mobility<br />
gap (E0), and the width of the energy tail above<br />
the gap (ΔE) changed due to irradiation and for<br />
this the structure of glass will be changes[Yuwen<br />
et. al., 2009].<br />
The current study aims to study the effect of<br />
gamma rays and heat treatment on both the<br />
absorption coefficient and energy gap of the<br />
glass, as well as to find a comprehensive<br />
empirical equation between the energy gap and<br />
both of the irradiation time and heating<br />
temperatures in the range of the present study.<br />
2- THE THEORETICAL PART<br />
2-1- Optical Absorbance In The Glass:<br />
When passing electromagnetic radiation<br />
(light) through a layer of transparent material,<br />
561
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
the intensity of irradiance (Io) in general is<br />
greater than the intensity of the radiation force<br />
(I) because some of the photons of certain<br />
frequencies may be absorbed. The intensity of<br />
the radiation absorbed is directly proportional to<br />
the number of molecules absorbing This is the<br />
basis of the Beer - Lambert Law [Soulignac<br />
and Lamotte,1987, Urbano et. al., 1999].<br />
x<br />
oe I I<br />
��<br />
� …(1)<br />
Where: x: thickness of absorbent material, �:<br />
absorption coefficient<br />
� I 0 � �x<br />
log��<br />
�<br />
I<br />
��<br />
…(2)<br />
� � 2.<br />
303<br />
�x<br />
A � …(3)<br />
2.<br />
303<br />
Known as log (Io / I) absorbance A<br />
� 2.<br />
303 �<br />
� � � �A<br />
…(4)<br />
� x �<br />
The amount of radiation absorbed depends on<br />
the type and thickness of the absorbent material.<br />
The relationship between the energy gap<br />
(Eopt) and the absorption coefficient (�) and<br />
incident photon energy (E) are given by the<br />
following relationship[Tauc et. al., 1966]:<br />
1 / 2<br />
� E � const E � E …(5)<br />
� � � �<br />
566<br />
opt<br />
2-2- Radiation Damage In The Glass:<br />
There are two types of radiation damages, a<br />
damage resulting from direct collisions between<br />
the ionizing radiation (charged particles such as<br />
proton (p), (�) and neutral particles such as<br />
neutrons (n)) and the targeted atoms where<br />
permanent displacement of the atoms occurs<br />
when receiving a higher energy level of the<br />
energy threshold. If less energy than that of the<br />
threshold is received by the atoms no<br />
displacement exists or simple displacement<br />
could take place and atoms will quickly return to<br />
their original place [Wong, 1998, Norgett et.al.,<br />
1975]. The second type is the damage caused by<br />
the ionization reactions as a result of beta<br />
particles and gamma rays interactions with glass<br />
resulting in covalent bonding break, changes of<br />
the parity, the disintegration of H2O and OH<br />
(water content atoms), and the disintegration of<br />
the unstable molecular ions [Wong, 1998, Burns<br />
et. al. ,1982, Ernisse and Norris, 1974].<br />
Phenomenon of radiation damage has been<br />
interpreted on the basis that some sort of damage<br />
centers is prevalent, and changes the place of the<br />
electrons, when the electrons leave their<br />
position. These electrons are more stable in<br />
some areas of the gap, which are close to the<br />
positive ions, called the center coloration (F-<br />
Center) and this defect is responsible for the<br />
change that occurs in coloring glass so, there<br />
will be many levels of energy available that<br />
occupied by these electrons, This multiplicity of<br />
levels of energy absorption of light makes it<br />
almost identical without appearing absorption in<br />
a certain range of wavelength and this lead to a<br />
dark [Tittel and Kamel, 1967, Yamamoto et. al.,<br />
1969, Pye et. al., 1972, Holbert, 1995 , Ghoneim<br />
et. al., 2006, Baccaro et. al., 2008]. Radiation<br />
damage were studied through measurements of<br />
changes in optical absorbance, density,<br />
mechanical strength and knowledge of the<br />
amount of energy stored and behavioral study of<br />
helium liberation, as well as microscopic studies<br />
of the changed composition flour and structural<br />
changes as disappearance transparency and<br />
transformation of crystal structure to the random<br />
structures, and the transformation of amorphous<br />
to crystalline structure of random structures for<br />
the random such as glass[Al Ameli, 1988]. The<br />
structural changes resulting from radiation<br />
damage represent a semi-permanent state but<br />
could restore its original state when properly<br />
heated for a certain time representing the<br />
proportion of radiation damage repair function<br />
of both time and temperature. When the<br />
temperature is constant reform time increase and<br />
vice versa when the time is stable reform rate<br />
increases with increasing temperature [Al Ameli,<br />
1988, Holbert, 1995].<br />
3-THE PRACTICAL SIDE<br />
In this study, the glass used in the procession<br />
optical (Slides), thickness (1) mm is used. Glass<br />
was divided into to a number of pieces of equal<br />
size, each (3.75x1.25) cm2. Glass samples were<br />
exposed to gamma-ray irradiation using a cell<br />
(SPECIFICATION-1982) Gamma Cell-220,<br />
which is located in (the University of Mosul /<br />
College of Science). The irradiation cell<br />
containing 60 Co radioactive source with the<br />
effectiveness of radiation (6430) Ci at date<br />
manufactured (5 / 1982). The absorption dose<br />
rate measurements taken at the final is (0.0331)<br />
Mrad / hr. The time of irradiation is (10, 20, 30,<br />
40, 50, 70, 80) hrs. Seven samples irradiated of<br />
each time period of irradiation. Six samples was<br />
heated at temperatures (50, 100, 150, 200, 250,<br />
300) o C by using electric furnace (Thermoline) of<br />
range of thermal (30-1200) o C have been used.<br />
The optical absorbance was measured for all
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
samples irradiated and heated in addition to the<br />
standard sample (non-irradiated and non-heated)<br />
by using spectrometer (type SECIL 1021) at the<br />
range (300 - 540) nm.<br />
4- CALCULATIONS<br />
4-1- Absorption Coefficient (�) And Incident<br />
Photon Energy E (Ev):<br />
Absorption coefficient has been calculated by<br />
using the equation (4) for the samples irradiated<br />
at the times period irradiations (10, 20, 30, 40,<br />
50, 70, 80) hrs, and heated at the range of<br />
temperature (20.-350) o C. As well as, the incident<br />
photons energy have been calculated at the range<br />
(300-540)nm by the following relationship<br />
[Wong, 1998, Patel, 2006]:<br />
1.<br />
241�10<br />
E �eV � �<br />
…(6)<br />
�<br />
�nm� �6<br />
4-2- Energy Gap Eopt:<br />
Energy gap Eopt is calculated using equation<br />
(5) by drawing the relationship between � � 2 / 1<br />
� E<br />
and the incident photon energy (E) as shown in<br />
fig. 1, 2, 3. The tangent line of the curve with the<br />
x-axis has been determined, which represents the<br />
value of the optical energy gap. The previous<br />
procedures adopted by other authors.[Soulignac<br />
and Lamotte, 1987]<br />
5- RESULTS AND DISCUSSION<br />
Fig. 1, 2 and 3 below show examples of the<br />
relationship between the incident photons energy<br />
and for period time of irradiation (10, 40, 80)hrs<br />
at different temperatures. It is found that (�E) 1/2<br />
increases with increasing of the photon energy<br />
and decreasing with less heating. The tangent<br />
line of the curve with the x-axis (E) has been<br />
determined, which represents the value of the<br />
optical energy gap (Eopt). Table (1) shows the<br />
values of the energy gap at period times of<br />
irradiation at different temperatures.<br />
Fig.4 shows that the absorption coefficient is<br />
increasing with photon energy at the range (2.6 -<br />
4)eV and increases with time of irradiation, and<br />
decreases with the increasing of temperatures.<br />
Electrons in the glass samples were removed<br />
from the position of stability when glass is<br />
exposed to gamma rays. These electrons have<br />
centered in (color center or F-center) and these<br />
electrons absorb the photons incident[Sharma et.<br />
al., 2006]. Absorbance increases with increasing<br />
time of gamma-ray irradiation. The absorbance<br />
or optical absorption coefficient decreases with<br />
the increasing temperature due to the electrons<br />
get back to their original positions by heating.<br />
Table (1): The values of the energy gaps at different period time of irradiation at different temperatures.<br />
Time Tirr. (hrs)<br />
10<br />
20<br />
30<br />
40<br />
50<br />
70<br />
80<br />
T o C<br />
20 o C 50 o C<br />
1.685<br />
1.588<br />
1.479<br />
1.207<br />
1.108<br />
1.259<br />
1.31<br />
1.855<br />
1.899<br />
1.689<br />
1.484<br />
1.602<br />
1.580<br />
1.81<br />
100 o C<br />
2.107<br />
1.828<br />
1.650<br />
1.531<br />
1.609<br />
1.580<br />
1.88<br />
When plotting the relationship between the<br />
energy gap versus the time period of irradiation,<br />
the energy gap decreases initially to its minimum<br />
value and then increases with time period of<br />
irradiation. The minimum value is at the time<br />
ranges of irradiation (40-60) hrs, these are<br />
caused by transferring of the electrons from<br />
atom to another and create which is called Fcenter<br />
(center colorations), or transfer of the<br />
electron from valance band to conduction<br />
band[Baccaro et. al., 2008, Ghoneim et. al.,<br />
2006, Holbert, 1995, Pye et. al., 1972,<br />
150 o C<br />
2.29<br />
2.231<br />
2.127<br />
2.092<br />
2.075<br />
2.093<br />
2.204<br />
200 o C<br />
2.378<br />
2.356<br />
2.238<br />
2.248<br />
2.324<br />
2.376<br />
2.467<br />
250 o C<br />
2.496<br />
2.433<br />
2.554<br />
2.321<br />
2.545<br />
2.589<br />
2.571<br />
300 o C<br />
2.605<br />
2.533<br />
2.561<br />
2.134<br />
2.746<br />
2.533<br />
2.668<br />
500 o C<br />
2.687<br />
2.584<br />
2.540<br />
2.396<br />
2.648<br />
2.559<br />
2.799<br />
Yamamoto et. al., 1969] as shown in Fig.5.<br />
When plotting the relationship between the<br />
energy gap and temperature, the energy gap<br />
increases with temperature, as shown in Fig.6.<br />
Changes in values of energy gap may be related<br />
to the structural changes due to gamma-ray<br />
irradiation (radiation damage) and these changes<br />
are semi-permanent and could be returned<br />
to original state (repair damage). By<br />
using sufficient heat this process is<br />
reversible[Holbert, 1995].<br />
561
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
Fig. (1): The relationship between � � 2 / 1<br />
E<br />
561<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
t irrad. = 10 hrs , Room Temperature<br />
y = 2.1014x - 3.5419<br />
R 2 = 0.9792<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
y = 2.4555x - 5.1738<br />
R 2 = 0.9923<br />
E (eV)<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
5<br />
4.5<br />
4<br />
3.5<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
0<br />
3.5<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
t irrad. = 10 hrs , T = 100 o C<br />
E (eV)<br />
y = 2.4657x - 5.864<br />
R 2 = 0.9856<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
y = 2.0775x - 5.4132<br />
R 2 = 0.9422<br />
t irrad. = 10 hrs , T = 200 o C<br />
E (eV)<br />
t irrad. = 10 hrs , T = 300 o C<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
E (eV)<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(�E) 1/2 (eV/cm) 1/2<br />
y = 2.1785x - 4.0419<br />
R 2 = 0.9677<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
� and the incident photon energy for period time of irradiation 10 hrs at<br />
different annealing for 15 minutes of thermal heating.<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
t irrad. = 10 hrs , T = 50 o C<br />
E (eV)<br />
t irrad. = 10 hrs , T =150 o C<br />
y = 2.619x - 5.9977<br />
R 2 = 0.9761<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
4.5<br />
4<br />
3.5<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
E (eV)<br />
t irrad. = 10 hrs , T =250 o C<br />
y = 2.3727x - 5.9236<br />
R 2 = 0.9676<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
E (eV)<br />
t irrad. = 10 hrs , T = 350 o C<br />
y = 1.6555x - 4.4495<br />
R 2 = 0.8851<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5<br />
E(eV)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(m E) 1/2 (eV/cm) 1/2<br />
9<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
t irrad. = 40 hrs , Room Temperature<br />
y = 2.7663x - 3.3398<br />
R 2 = 0.9844<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
E (eV)<br />
y = 2.7851x - 4.2625<br />
R 2 = 0.9953<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
t irrad. = 40 hrs , T = 100 o C<br />
E (eV)<br />
y = 3.3058x - 7.4346<br />
R 2 = 0.9967<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
4<br />
3.5<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
t irrad. = 40 hrs , T = 200 o C<br />
E (eV)<br />
t irrad. = 40 hrs , T = 300 o C<br />
y = 1.856x - 3.9614<br />
R 2 = 0.9291<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
E (eV)<br />
Fig. (2): The relationship between � � 2 / 1<br />
E<br />
Dose = 40<br />
hrs , T =<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(m E) 1/2 (eV/cm) 1/2<br />
y = 2.7696x - 4.1124<br />
R 2 = 0.9929<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
� and the incident photon energy for period time of irradiation 40 hrs at<br />
different annealing for 15 minutes of thermal heating.<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
t irrad. = 40 hrs , T = 50 o C<br />
E (eV)<br />
t irrad. = 40 hrs , T = 150 o C<br />
y = 3.3836x - 7.0817<br />
R 2 = 0.9939<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
E (eV)<br />
t irrad. = 40 hrs , T = 250 o C<br />
y = 2.7767x - 6.4432<br />
R 2 = 0.9937<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
3.5<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
E (eV)<br />
t irrad. = 40 hrs , T = 350 o C<br />
y = 1.7379x - 4.1647<br />
R 2 = 0.9769<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
E (eV)<br />
561
Dose =<br />
80 hrs ,<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
Fig (3): The relationship between � � 2 / 1<br />
E<br />
511<br />
10<br />
9<br />
9<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
0<br />
t irrad. = 80 hrs , Room Temperature<br />
y = 3.2026x - 4.1956<br />
R 2 = 0.9878<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
E (eV)<br />
y = 3.7353x - 7.0218<br />
R 2 = 0.9684<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
t irrad. = 80 hrs , T = 100 o C<br />
E (eV)<br />
y = 4.3406x - 10.706<br />
R 2 = 0.9776<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
t irrad. = 80 hrs , T = 200 o C<br />
E (eV)<br />
t irrad. = 80 hrs , T = 300 o C<br />
y = 3.6443x - 9.7232<br />
R 2 = 0.9374<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
E (eV)<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
(� E) 1/2 (eV/cm) 1/2<br />
� and the incident photon energy for period time of irradiation 80 hrs at<br />
different annealing for 15 minutes of thermal heating.<br />
9<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
t irrad. = 80 hrs , T = 50 o C<br />
y = 3.662x - 6.6279<br />
R 2 = 0.9653<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
9<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
E (eV)<br />
t irrad. = 80 hrs , T = 150 o C<br />
y = 4.1098x - 9.0564<br />
R 2 = 0.9721<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
E (eV)<br />
t irrad. = 80 hrs , T = 250 o C<br />
y = 3.9386x - 10.124<br />
R 2 = 0.9611<br />
0<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
5<br />
4.5<br />
4<br />
3.5<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
0<br />
y = 3.4312x - 9.603<br />
R 2 = 0.9048<br />
E (eV)<br />
t irrad. = 80 hrs , T = 350 o C<br />
0 0.3 0.6 0.9 1.2 1.5 1.8 2.1 2.4 2.7 3 3.3 3.6 3.9 4.2 4.5 4.8<br />
E (eV)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
� (1/cm)<br />
� (1/cm)<br />
� (1/cm)<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
0<br />
14<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
14<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
tirrad.=10 hrs<br />
1.5 2 2.5 3 3.5 4 4.5 5<br />
E(eV)<br />
tirrad.=20 hrs<br />
1.5 2 2.5 3 3.5 4 4.5 5<br />
E(eV)<br />
tirrad.=30 hrs<br />
1.5 2 2.5 3 3.5 4 4.5 5<br />
E(eV)<br />
without<br />
annealing<br />
T=50 oC<br />
T=100 oC<br />
T=150 oC<br />
T=200 oC<br />
T=250 oC<br />
T=300 oC<br />
T=350 oC<br />
without<br />
annealing<br />
T=50 oC<br />
T=100 oC<br />
T=150 oC<br />
T=200 oC<br />
T=250 oC<br />
T=300 oC<br />
T=350 oC<br />
without<br />
annealing<br />
T=50 oC<br />
T=100 oC<br />
T=150 oC<br />
T=200 oC<br />
T=250 oC<br />
T=300 oC<br />
T=350 oC<br />
Fig. (4a): The relationship between the absorption coefficient and incident photon energy for period time of<br />
irradiation (10, 20, 30) hrs at different annealing (20-350) o C for 15 minutes of thermal heating<br />
515
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
511<br />
� (1/cm)<br />
� (1/cm)<br />
� (1/cm)<br />
16<br />
14<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
16<br />
14<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
18<br />
16<br />
14<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
tirrad.=40 hrs<br />
1.5 2 2.5 3 3.5 4 4.5 5<br />
E(eV)<br />
tirrad.=50 hrs<br />
1.5 2 2.5 3 3.5 4 4.5 5<br />
E(eV)<br />
tirrad.=70 hrs<br />
1.5 2 2.5 3 3.5 4 4.5 5<br />
E(eV)<br />
without<br />
annealing<br />
T=50 oC<br />
T=100 oC<br />
T=150 oC<br />
T=200 oC<br />
T=250 oC<br />
T=300 oC<br />
T=350 oC<br />
without<br />
annealing<br />
T=50 oC<br />
T=100 oC<br />
T=150 oC<br />
T=200 oC<br />
T=250 oC<br />
T=300 oC<br />
T=350 oC<br />
without<br />
annealing<br />
T=50 oC<br />
T=100 oC<br />
T=150 oC<br />
T=200 oC<br />
T=250 oC<br />
T=300 oC<br />
T=350 oC<br />
Fig. (4b): The relationship between the absorption coefficient and incident photon energy for period time of<br />
irradiation (40, 50, 70) hrs at different annealing (20-350) o C for 15 minutes of thermal heating
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
Eg (eV)<br />
Eg (eV)<br />
Eg (eV)<br />
Eg (eV)<br />
� (1/cm)<br />
20<br />
18<br />
16<br />
14<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
tirrad.=80 hrs<br />
1.5 2 2.5 3 3.5 4 4.5 5<br />
E(eV)<br />
without<br />
annealing<br />
T=50 oC<br />
T=100 oC<br />
T=150 oC<br />
T=200 oC<br />
T=250 oC<br />
T=300 oC<br />
T=350 oC<br />
Fig. (4c): The relationship between the absorption coefficient and incident photon energy for period time of<br />
irradiation (80) hrs at different annealing (20-350) o C for 15 minutes of thermal heating<br />
T = R. T.<br />
2<br />
1.8<br />
1.6<br />
1.4<br />
1.2<br />
1<br />
0.8<br />
0.6<br />
0.4<br />
0.2<br />
0<br />
0 20 40 60 80 100<br />
2.4<br />
2<br />
1.6<br />
1.2<br />
0.8<br />
0.4<br />
Period time of iraadiation (hrs)<br />
0<br />
0 20 40 60 80 100<br />
2.8<br />
2.4<br />
2<br />
1.6<br />
1.2<br />
0.8<br />
0.4<br />
T = 100 o C<br />
`<br />
Period time of iraadiation (hrs)<br />
0<br />
0 20 40 60 80 100<br />
2.8<br />
2.4<br />
2<br />
1.6<br />
1.2<br />
0.8<br />
0.4<br />
T = 200 o C<br />
`<br />
Period time of iraadiation (hrs)<br />
T = 300 o C<br />
`<br />
0<br />
0 20 40 60 80 100<br />
Period time of iraadiation (hrs)<br />
Eg (eV)<br />
Eg (eV)<br />
Eg (eV)<br />
Eg (eV)<br />
0<br />
0 20 40 60 80 100<br />
Fig. (5): The relationship between the energy gap (Eg) and period time of irradiation<br />
2<br />
1.5<br />
1<br />
0.5<br />
2.8<br />
2.4<br />
2<br />
1.6<br />
1.2<br />
0.8<br />
0.4<br />
T = 50 o C<br />
Period time of iraadiation (hrs)<br />
T = 150 o C<br />
`<br />
0<br />
0 20 40 60 80 100<br />
2.8<br />
2.4<br />
2<br />
1.6<br />
1.2<br />
0.8<br />
0.4<br />
Period time of iraadiation (hrs)<br />
T = 250 o C<br />
`<br />
0<br />
0 20 40 60 80 100<br />
2.8<br />
2.4<br />
2<br />
1.6<br />
1.2<br />
0.8<br />
0.4<br />
Period time of iraadiation (hrs)<br />
T = 350 o C<br />
`<br />
0<br />
0 20 40 60 80 100<br />
Period time of iraadiation (hrs)<br />
511
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
Eg (eV)<br />
Eg (eV)<br />
Eg (eV)<br />
Eg (eV)<br />
511<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
tirrad. = 10 hrs<br />
y = 0.391Ln(x) + 0.3468<br />
R 2 = 0.989<br />
0<br />
0 50 100 150 200 250 300 350 400<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
T o C<br />
y = 0.4633Ln(x) - 0.1655<br />
R 2 = 0.8896<br />
0<br />
0 50 100 150 200 250 300 350 400<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
tirrad. = 30 hrs<br />
T o C<br />
y = 0.6315Ln(x) - 1.0124<br />
R 2 = 0.942<br />
0<br />
0 50 100 150 200 250 300 350 400<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
tirrad. = 50 hrs<br />
T o C<br />
tirrad. = 80 hrs<br />
y = 0.5549Ln(x) - 0.5057<br />
R 2 = 0.9677<br />
0<br />
0 50 100 150 200 250 300 350 400<br />
T o C<br />
y = 0.3882Ln(x) + 0.2792<br />
R 2 = 0.9241<br />
0<br />
0 50 100 150 200 250 300 350 400<br />
Fig. (6): The relationship between the energy gap Eg (eV) and annealing T o C<br />
Eg (eV)<br />
Eg (eV)<br />
Eg (eV)<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
tirrad. = 20 hrs<br />
T o C<br />
tirrad. = 40 hrs<br />
y = 0.4718Ln(x) - 0.3853<br />
R 2 = 0.9025<br />
0<br />
0 50 100 150 200 250 300 350 400<br />
3<br />
2.5<br />
2<br />
1.5<br />
1<br />
0.5<br />
T o C<br />
tirrad. = 70 hrs<br />
y = 0.5588Ln(x) - 0.6673<br />
R 2 = 0.9196<br />
0<br />
0 50 100 150 200 250 300 350 400<br />
T o C
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
6- CONCLUSIONS<br />
1. There is a change in the color of glass (or<br />
darkness) as a result if gamma-ray irradiation.<br />
The darkness increase with the increase of<br />
irradiation and decrease with heating.<br />
2. Absorption coefficient of the glass increase<br />
with increasing time of irradiation and decreases<br />
with increasing heating.<br />
3. Energy gap decrease and then increases with<br />
time of irradiation and increases with<br />
temperature heating.<br />
4. Glass can be used as a measure of radiation<br />
dose of gamma rays<br />
REFERENCES<br />
-Al Ameli M. A. (1988).The Physics Properties Study of<br />
the Glass Used in Treatment of Nuclear Waste.<br />
M.Sc. thesis submitted to Council of College of<br />
Science. University of Baghdad.<br />
-Al Sadoon S. H. (2004). Using Glass and Polymer in a<br />
measurement of radiation dose for gamma ray.<br />
M.Sc. thesis submitted to Council of College of<br />
Education. University of Mosul.<br />
-Baccaro S., Monika, Sharma G., Thind K.S., and Singh<br />
D.P. (2008). Variation of optical band gap with<br />
radiation dose in PbO–B2O3 glasses. Nuclear<br />
Instruments and Methods in Physics Research<br />
Section B: Beam Interactions with Materials and<br />
Atoms, V. 266, Issue 4, P.594-598.<br />
-Brekhovaskish S.M. (1959). Resistance of Industrial<br />
Glasses to the Action of Radioactive Radiations.<br />
Proceeding of the 3rd All-Union Conference on the<br />
Glassy State, Vol. 2, P. 314, USSR.<br />
-Burns W.G. et al (1982). Effects of Radiation on the Leach<br />
Rates of Vitrified Radioactive Waste. Journal of<br />
Nuclear Materials, 107(245-270).<br />
-Ernisse E.P., Norris G.B. (1974). Introduction Rates and<br />
Annealing of Defects in Ion-Implanted SiO Layers<br />
on Si. Journal of Applied Physics, Vol. 45, No. 12.<br />
-Friebele E.J., Griscom D.L. and Marrone M.J. (1985). The<br />
Optical Absorption and Luminescence Bands Near<br />
2eV in Irradiated and Drawn Synthetic Silica.<br />
Journal of Non-Crystalline Solids, 71:133-144.<br />
-Ghoneim N. A., Moustaffa F. A., Zahran A. H., Ezz El din<br />
F. M. (2006). Gamma-Ray Interaction with Lead<br />
Borate and Lead Silicate Glasses Containing<br />
Manganese. Journal of the American Ceramic<br />
Society, V. 66, Issue 6, P. 447-451.<br />
-Herman Cember (1969). Introduction to Health Physics.<br />
Northwestern University.<br />
-Holbert K. E. (1995). Radiation Effects and Damage, from<br />
http://holbert.faculty.asu.edu/eee560/<br />
RadiationEffectsDamage.pdf<br />
-Maged A. F., Amin G. A. M., Semary M.and Borham E.<br />
(2009). Some physical properties of Se0.8Te0.2<br />
amorphous chalcogenide system. Journal of Non-<br />
Oxide Glasses, V. 1, No. 1, P. 53-60.<br />
-Norgett M.J. Robinson, M.T. and Torrens I.M. (1975). A<br />
Proposed Method of Calculating Displacement<br />
Dose Rates. Nuclear engineering and Design,<br />
33(50-54).<br />
-Norris G.B., Ernisse E.P. (1974). Ionization Dilation<br />
Effects in Fused Silica from 2 to 18 KeV Electron<br />
Irradiation. Journal of Applied Physics, Vol. 54,<br />
No. 9.<br />
-Patel S. B. (2006). Nuclear physics: An Introduction. New<br />
Age International, India.<br />
-Pye L.D., Stevens H.J. and LaCourse W.C. (1972).<br />
Introduction to Glass Science. New York.<br />
-Sharaf El-Deen L.M., Al-Salhi M.S.and Elkholy M.M.<br />
(2008). Radiation induced color centers in 50PbO–<br />
50P2O5 glass. Journal of Non-Crystalline Solids,<br />
V. 354, Issues 52-54, P. 5453-5458.<br />
-Sharma G., Thind K.S., Manupriya, Klare H.S., Narang<br />
S.B., Gerward L.and Dangwal V.K. (2006). Effects<br />
of gamma-ray irradiation on optical properties of<br />
ZnO–PbO–B2O3 glasses. Nuclear Instruments and<br />
Methods in Physics Research Section B: Beam<br />
Interactions with Materials and Atoms, V.243, P.<br />
345-348.<br />
-Soulignac J.C., Lamotte M. (1987). A UV-VIS<br />
Spectrophotometer for Absorbance Measurements<br />
of Weakly Transparent Light Scattering Samples.<br />
Applied Spectroscopy, V.41, P.1101-1261.<br />
-Tauc J., Grigorovici R. and Vancu A. (1966), Optical<br />
Properties and Electronic Structure of Amorphous<br />
Germanium. Phys. Stat., Sol.15, P.627.<br />
-Tittel F., Kamel N. (1967). Radiation Effects in Glass<br />
Lasers. Interaction of Radiation with Solids,<br />
Bishay, P. 261.<br />
-Urbano A., Scarminio J.& Gardes B. (1999). The Beer-<br />
Lambert law for electrochromic tungsten oxide thin<br />
films. Materials Chemistry and Physics, V. 61, P.<br />
143-146<br />
-Wong S. M. (1998). Introductory Nuclear Physics. 2nd<br />
Edition, John Wiley and Sons, USA.<br />
-Yamamoto T., Sakka S.and Tashiro M. (1969). Effect of<br />
pressure on radiation-induced color centers in<br />
silicate glasses. Journal of Non-Crystalline Solids,<br />
V. 1, Issue 6, P. 441-454.<br />
-Yin Cheng, Hanning Xiao, Wenming Guo and Weiming<br />
Guo(2007). Structure and crystallization kinetics of<br />
PbO–B2O3 glasses. Ceramic International, V. 33,<br />
Issue.7, P. 1341-1347.<br />
-Yuwen Ou, Stefania Baccaro, Yaping Zhang, Yunxia<br />
Yang and Guorong Chen(2009). Effect of Gamma-<br />
Ray Irradiation on the Optical Properties of PbO–<br />
B2O3–SiO2 and Bi2O3–B2O3–SiO2 Glasses.<br />
Journal of the American Ceramic Society. V. 93,<br />
Issue.2, P. 338-341.<br />
511
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 165-176, 2011<br />
516<br />
َىشيوش اي ىةشوو ايايلااظ زةطل َىنسك مزةطو اماط اكشيت انسكَيتزاك<br />
َىشيوش ايةشوو ايتلااظو َىهيرلمةي ةكلوكظةي زةطل َىيتامزةط ايزةض<br />
ةزاضو اماط اكشيت انسكَيتزاك ادَيهيلوكةظ َىظد<br />
،001<br />
،011<br />
،01<br />
،01(<br />
وَيلث وب َىيتامزةطب ىسكةلةمامو تعةض ) 01 ،01<br />
،01<br />
،01<br />
،01<br />
،01<br />
،01(<br />
ب َىنادكشيت َىمةد انسكةدَيش ب ووبد ةديش َىهيرلمةي َىكلوكظةي وك<br />
ب ووبد مَيك يةشوو ايلااظ وك ووبزايد اضةوزةي<br />
.<br />
ةتخوث<br />
َىناداكشيت وَيمةد وب<br />
وبزايد اديتيلوكةظ َىظد ) 001 ،011<br />
،001<br />
،011<br />
َىيتاموةط وَيلب انسكةدَيش ب ووبد مَيك ويرلمةيو َىياماط اكشيت<br />
َىتامزةط ب ىسكةلةمام وك ووبزايد اضةوزةي ، َىنادكشيت َىمةدل سكزاموت تضائ ويترمصنو َىنادكشيت َىمةد انسكةدَيش<br />
انووضكَيت وب ةتيسظشد اد َىةشوو ايلااظد ىووبةدَيشو ىووب مَيك ظةئ . ىةشيوش اي َىةشوو ايلااظ انووبدَيش َىزةطةئ ةتيبد<br />
َىتفةك انووضكَيت انسككاض ىزةطةئ ووبد مزةط َلىةب ، زةطب َىنادكشيت انسكَيتزام َىزةطةئ ذ ىةشيوش اتاًكَيث<br />
جاجزلل ةقاطلا ةوجف ىلع نيخستلاو اماك ةعشأ ريثأت<br />
. اد ىةشيوش اتاًكَيبدةي<br />
ةنمزلأو جاجزلل ةقاطلا ةوجفو صاصتملاا لماعم ىلع ةيرارحلا ةجلاعملاو اماك ةعشأ ريثأت ةسارد ثحبلا اذه يف نمضتي<br />
ثيح ،<br />
(20, 50, 100, 150, 200, 250, 300, 350) o C<br />
ةرارح تاجردو<br />
(10, 20, 30, 40, 50, 70, 80) hrs<br />
ةصلاخلا<br />
ةوجف ميق اندجوأ امك ، ةرارحلا تاجرد ةدايزب ةيصاصتملاا هذه لقتو اماك ةعشأ ةدايزب دادزت صاصتملاا لماعم نا اندجو<br />
دنع دادزت كلذ دعبو<br />
40-50 hrs<br />
عيعشت<br />
عيعشت نمز نيب ام يأ عيعشتلا نمز ةدايزب لقت ةقاطلا ةوجف ميق نأ دجوو ، ةقاطلا<br />
يف ناصقنلاو ةدايزلا هذه ، جاجزلل ةقاطلا ةوجف ميق ةدايزب موقت ةيرارحلا ةجلاعملا نأ دجو نيح يف ، عيعشتلا نمز ةدايز<br />
.<br />
فلتلا حلاصإ ةيلمعب موقي نيخستلا نأ نيح يف اهيلع عاعشلإا طيلست ةجيتن فلتلا وه اهببس ةقاطلا ةوجف ميق
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
EFFECT OF LONG-TERM ADMINISTRATION OF MELATONIN, VITAMIN<br />
E, VITAMIN C AND THEIR COMBINATIONS ON SOME LIPID PROFILES<br />
AND RENAL FUNCTION TESTS IN RATS EXPOSED TO LEAD TOXICITY<br />
ALMAS M.R. MAHMUD<br />
Dept. of Biology, College of Science, University of Salahaddin, Kurdistan Region- Iraq<br />
(Received: October 16, 2010; Accepted for publication: February 27, 2011)<br />
ABSTRACT<br />
Lead (Pb) is a natural element and widespread in the environment. Lead poisoning affect numerous organ<br />
systems. This study was carried out to investigate long-term administration of melatonin, vitamin C, vitamin E and<br />
their combinations, on some serum biochemical parameters in Pb-induced toxicity. Fifty-four female albino rats were<br />
used in this study. Animals were divided into nine groups. The groups are: control, sodium acetate (0.1mg/L drinking<br />
water), Pb-acetate (0.1 mg/L in drinking water), Pb-acetae+melatonin (60 mg of melatonin/Kg diet), Pbacetate+vitamin<br />
E (1000 IU of vitamin E/Kg diet), Pb-acetae+vitamin C (1mg of vitamin C/ L in drinking water),<br />
combinations: Pb-acetae+melatonin+vitamin E, Pb-acetae+melatonin+vitamin C, and Pb-acetate+vitamin E+vitamin<br />
C. Results show significant increases in serum total cholesterol (TC) and triacylglycerol (TAG) in Pb-acetae group<br />
compared to the control rats. Administration of melatonin, vitamin E, melatonin+vitamin E and vitamins C+E<br />
combinations caused significant reductions in serum TC and TAG, while, serum total protein increased significantly<br />
in melatonin and melatonin+vitamin E groups compared with Pb-acetate treated rats. Serum creatinine, urea and<br />
uric acid exhibited significant increases in Pb-acetae treated rats in comparision with controls. On the other hand,<br />
melatonin, melatonin+vitamin E combination decreased serum creatinine, urea, uric acid, and total bilirubin in<br />
comparision with Pb-acetate treated rats. In conclusion, long-term lead treated rats exhibited marked elevation of<br />
serum TC,TAG, creatinine, urea, uric acid and total bilirubin levels. Most of these abnormal changes were<br />
ameliorated with melatonin+ vitamin E combination much more than with melatonin, vitamin E or C alone or<br />
vitamins E and C in combination.<br />
KEYWORDS: Melatonin, vitamin E, vitamin C, lipid profile, renal function tests, lead toxicity<br />
L<br />
INTRODUCTION<br />
ead is a toxic, heavy metal widely<br />
distributed in the environment and<br />
chronic exposure to low levels of this agent is a<br />
matter of public concern in many countries.<br />
Lead is frequently found in air, drinking water,<br />
soil, and industrial by-products. It is also found<br />
in lead-associated work place such as smelting,<br />
battery manufacture, stained glass industrial, and<br />
lead-based paint production (Vaglenov et al.,<br />
2001). Lead poisoning may affect numerous<br />
organ systems and is associated with a number<br />
of morphological, biochemical and physiological<br />
changes, including cardiovascular, kidney<br />
dysfunction and impairment of liver function<br />
(Ghorbe et al., 2001).<br />
Microscopic analysis of lead-intoxicated animals<br />
has indicated fatty degeneration of the<br />
myocardium and sclerotic changes in the aortic<br />
and walls of the small arteries especially the<br />
renal, cerebral and coronary arteries (Yokoyama<br />
et al., 2000) and atrophy of elastic fibers in the<br />
aorta (Al-Ashmawy et al., 2005).<br />
Renal functions are altered upon lead<br />
exposure, serum urea and creatinine also<br />
increased in mice after oral administration of<br />
lead acetate in the diet and in rats after chronic<br />
lead exposure (Al-Ashmawy et al., 2005).<br />
In the liver tissues, lead is known to produce<br />
oxidative damage by enhancing peroxidation of<br />
membrane lipids (Chaurasia and Kar, 1997) a<br />
deleterious process solely carried out by free<br />
radicals (Halliwell et al., 1990).<br />
Melatonin, the main secretary product of the<br />
pineal gland, is known to be a powerful<br />
antioxidant with its high free radical scavenging<br />
activity and it has been reported to be more<br />
efficient than vitamin E in scavenging peroxy<br />
radicals (Karbownik and Reiter, 2001; Bettahi et<br />
al.,1996). Melatonin also augments production<br />
and regeneration of glutathione, one of the major<br />
intracellular antioxidant molecules, besides,<br />
melatonin increases the activity of catalase and<br />
catalyzes the formation of nitric oxide synthase<br />
which catalyzes the formation of nitric oxide<br />
(NO) (Wakatsuki and Okatani Y,2000).<br />
Vitamin C exerts its physiological function<br />
mainly through oxido-reduction (Wintergerst et<br />
al.,2006). Vitamin E (α-tocopherol) which is an<br />
important chain-breaking antioxidant in the lipid<br />
phase of different cell membranes (Al-Ashmawy<br />
et al., 2005). It scavenges peroxy radicals by<br />
donating to them the phenolic hydrogen. In<br />
addition, it is highly reactive toward singlet<br />
177
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
oxygen (Chaurasia and Kar, 1997). Considering<br />
the antioxidant properties of melatonin, vitamins<br />
C and E, the present study was undertaken to<br />
investigate the effects of long-term<br />
administration of melatonin, vitamin E, vitamin<br />
C and their combinations on some lipid profiles<br />
and renal function tests in rats exposed to lead<br />
toxicity.<br />
178<br />
MATERIALS AND METHODS<br />
Animals and housing<br />
Fifty four adult female albino rats (Rattus<br />
norvigicus) weighting initially 240-280 g were<br />
included in this study. Rats were obtained from<br />
the Animal House of Biology Department-<br />
College of Science/University of Salahaddin-<br />
Erbil/Iraq and maintained at 22 ± 2 ºC under a<br />
photoperiod of 12:12-h light-dark cycle. All<br />
animals had free access to tap water and standard<br />
rat chow.<br />
Experimental design<br />
This experiment was designed to determine<br />
the effects of melatonin, vitamin E, vitamin C,<br />
and their combinations on serum TC, TAG, total<br />
protein, creatinine, urea, uric acid and total<br />
bilirubin in rats treated with lead acetate. The<br />
experimental rats were divided into nine groups,<br />
each of six individuals and the treatments were<br />
continued for 10 weeks as follow:<br />
Group1: Control. The rats were given standard<br />
rat chow and tap water ad libitum.<br />
Group 2: Sodium acetate. The rats were given<br />
standard rat chow and sodium acetate at a dose<br />
of 0.1 mg/L drinking water.<br />
Group 3: Lead acetate. The rats were given<br />
standard rat chow and lead acetate at a dose of<br />
0.1 mg/L drinking water.<br />
Group 4: Lead acetate + Melatonin. The rats<br />
were supplied with standard rat chow contain<br />
melatonin (60 mg/kg diet) and Pb acetate (0.1<br />
mg/L drinking water).<br />
Group 5: Lead acetate + Vitamin E. the rats<br />
were supplied with standard rat chow contain<br />
vitamin E (1000 I.U/kg diet) and Pb acetate (0.1<br />
mg/L drinking water).<br />
Group 6: Lead acetate+Vitamin C. The rats<br />
were given standard rat chow and Pb acetate at a<br />
dose of 0.1 mg/ L drinking water and vitamin C<br />
at a dose of 1mg/L drinking water.<br />
Group 7: Lead acetate + Melatonin + Vitamin<br />
E. The rats were supplied with standard rat chow<br />
contain melatonin (60 mg/kg diet) and vitamin E<br />
(1000 I.U /kg diet), Pb acetate (0.1 mg/L<br />
drinking water).<br />
Group 8: Lead acetate + Melatonin + Vitamin<br />
C. The rats were supplied with standard rat chow<br />
with melatonin (60 mg/kg diet), Pb acetate at a<br />
dose of 0.1 mg/L drinking water.<br />
Group 9: Lead acetate + Vitamin E + Vitamin<br />
C. The rats were supplied with standard rat chow<br />
contain vitamin E (1000 I.U/kg diet), vitamin C<br />
(1 mg/L drinking water) and Pb acetate (0.1<br />
mg/L drinking water).<br />
Collection of blood samples<br />
At the end of the experiment, the rats were<br />
anesthetized with ketamine hydrochloride (50<br />
mg/kg body weight). Blood samples were taken<br />
by cardiac puncture into chilled tubes and<br />
centrifuged at 3000 rpm for 20 minutes; then<br />
sera were stored at -85 ºC until assay.<br />
Biochemical determination<br />
Serum TC, TGA, total protein, ceratinine,<br />
urea, uric acid and total bilirubin were<br />
determined by enzymatic and colorimetric<br />
methods (Biolabo reagents, France).<br />
Statistical analysis<br />
All data were expressed as mean ± standard<br />
error (SE) and statistical analysis was carried out<br />
using available soft ware (SPSS version 15).<br />
Data analysis was made using one-way analysis<br />
of variance (ANOVA). The comparisons among<br />
groups were done using Duncan post hoc<br />
analysis. P values < 0.05 were considered as<br />
significant.<br />
RESULTS<br />
As shown in Table (1), serum TC (mg/dl)<br />
increased significantly (P< 0.05) in Pb acetate<br />
group (90.114 ± 5.7025) compared to the control<br />
rats (60.485 ± 2.8548).<br />
Administration of melatonin, vitamin E,<br />
melatonin in combination with vitamin E or<br />
vitamin E in combination with vitamin C caused<br />
significant reductions (P< 0.05) in serum TC<br />
(65.942 ± 3.0039), (65.485 ± 8.0576), (68.200 ±<br />
4.3310) and (67.028 ± 9.8489), respectively,<br />
compared with Pb-acetate group. On the other<br />
hand, vitamin C or melatonin in combination<br />
with vitamin C caused non-significant reductions<br />
in serum TC compared with the Pb acetate<br />
treated rats.<br />
Table (1) shows that serum TAG (mg/dl)<br />
increased significantly (P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
in serum TAG (65.818 ± 4.5846), (69.714 ±<br />
7.4733), (64.976 ± 7.0014) and (60.727 ±<br />
8.3543) respectively as compared with the lead<br />
acetate group.<br />
Table(1):- Effects of melatonin, vitamin E, vitamin C and their combinations on some serum lipid profiles<br />
and total protein in lead treated rats<br />
Treatments Serum total<br />
cholesterol<br />
( mg/dl)<br />
Parameters<br />
Serum triacylglycerol<br />
(mg/dl)<br />
Serum total protein<br />
(gm/dl)<br />
Control 60.485±2.8548 a 68.597±5.6391 a 6.3552±0.2372 ab<br />
Sodium acetate 66.857±3.5398 a 63.750±7.3428 a 5.0928±0.3264 a<br />
Pb-acetate 90.114±5.7025 b 95.480±4.5514 b 5.3808±0.1373 a<br />
Pb-acetate + Mel 65.942±3.0039 a 65.818±4.5846 a 8.8272±2.5387 b<br />
Pb-acetate + Vit E 65.485±8.0576 a 69.714±7.4733 a 7.0224±0.7045 ab<br />
Pb-acetate + Vit C 75.714±7.7084 ab 77.142±4.3579 ab 5.1744±0.1445 a<br />
Pb-acetate+Mel +Vit E 68.200±4.3310 a 64.976±7.0014 a 8.6064±0.2102 b<br />
Pb-acetate+ Mel +Vit C 74.457±6.6563 ab 76.005±7.4016 ab 5.5056±0.1291 a<br />
Pb-acetate +Vit E +Vit<br />
C<br />
67.028±9.8489 a 60.727±8.3543 a 4.8144±0.2682 a<br />
Similar letters indicate no significant difference. Pb=lead<br />
Different letters indicate significant difference at P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
Table (2):- Effects of melatonin, vitamin E, vitamin C and their combinations on some renal function tests in<br />
lead treated rats.<br />
180<br />
Treatments Serum<br />
creatinine<br />
(mg/dl)<br />
Serum urea<br />
(mg/dl)<br />
Prameters<br />
Serum uric acid<br />
( mg/dl)<br />
Serum total<br />
bilirubin ( mg/dl)<br />
Control 0.480±0.1323 ab 20.309±1.9380 ab 1.241±0.0852 a 0.385±0.0765 ab<br />
Sodium acetate 0.300±0.0774 a 23.163±1.9315 abc 2.191±0.4627 ab 0.592±0.0815 bc<br />
Pb-acetate 0.733±0.0471 b 34.963±0.6163 d 4.865±0.7307 c 0.583±0.0565 bc<br />
Pb-acetate + Mel 0.426±0.1087 a 17.181±1.8521 a 2.934±0.1130 b 0.446±0.0975 abc<br />
Pb-acetate + Vit E 0.493±0.0805 ab 27.890±2.8675 bcd 2.483±0.3442 ab 0.517±0.0479 abc<br />
Pb-acetate + Vit C 0.500±0.1125 ab 29.272±2.2180 cd 2.560±0.1964 b 0.604±0.0734 bc<br />
Pb-acetate+Mel +Vit E 0.346±0.0679 a 22.763±2.2848 abc 2.121±0.2576 ab 0.364±0.0563 a<br />
Pb-acetate+ Mel +Vit C 0.380±0.0800 a 26.981±2.5006 bc 2.228±0.2726 ab 0.643±0.0481 c<br />
Pb-acetate +Vit E +Vit C 0.460±0.0266 ab 25.563±4.1510 bc 2.192±0.6017 ab 0.519±0.0469 abc<br />
Similar letters indicate no significant difference. Pb=lead<br />
Different letters indicate significant difference at P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
or indirectly by regenerating vitamin E. It has<br />
been reported that vitamin C may protect lowdensity<br />
lipoproteins (Jialal et al.,1991) and<br />
plasma lipids against free-radical-mediated<br />
oxidation. Previous data have indicated that<br />
vitamin C deficiency increased CCl4- induced<br />
lipid peroxidation in vivo in guinea pigs and that<br />
vitamin C supplementation decreases lipid<br />
peroxidation in vivo in rats that have an iron<br />
overload (Harri, 1992). In man, it has been<br />
reported that people with low vitamin C levels<br />
have high amounts of lipid peroxides in plasma.<br />
Accordingly, vitamin C could also affect<br />
cholesterol metabolism through the antioxidant<br />
effect (Rath and Pauling, 1991). On the other<br />
hand, Sokoloff et al.,1966 suggested that effects<br />
of vitamin C on plasma levels of triglyceride<br />
may return to its effect on lipoprotein. Vitamin C<br />
also affects fatty acids metabolism through its<br />
effect on the transport of long-chain fatty acids<br />
into mitochondria. Therefore, the effects of<br />
melatonin, vitamin E or melatonin in<br />
combination with vitamin E and vitamin E with<br />
C combination may due to the antioxidant<br />
properties of the three and to the effect of<br />
vitamin C on the metabolism of lipoprotein<br />
(A) which has been proven to be linked<br />
with atherosclerosis (Mbewu and<br />
Durrington, 1990).<br />
Adminstration of melatonin and melatonin in<br />
combination with vitamin E caused significant<br />
increases in serum total protein compared to the<br />
Pb-acetate group. Melatonin adminstration<br />
releases growth hormone both in rats and man<br />
(Forsling et al.,1999). Furtheremore, Lima et<br />
al.,(2001) showed that melatonin, in addition to<br />
acting on tissue sensitivity to insulin, affects the<br />
secretory action of beta cells.<br />
Table (2) shows that serum creatinine and<br />
total bilirubin increased non-significantly, while<br />
serum urea and uric acid increased significantly<br />
in Pb acetate treated rats compared with the<br />
control animals. The observed increase in serum<br />
urea after Pb acetate administration is consistent<br />
with those reported by Hassan and Jassim,<br />
(2010); Wojtchak-Jaroszowa and Kubow,<br />
(1989). Also, elevation in uric acid is reported<br />
by McBride et al., (1998). The increase in uric<br />
acid concentration may be due to degradation of<br />
purines or to an increase of uric acid levels by<br />
either overproduction or inability of excretion<br />
(Wolf et al.,1972).<br />
Administration of melatonin, combination of<br />
melatonin with vitamin E and melatonin with<br />
vitamin C decreased significantly serum<br />
creatinine, urea and uric acid. In addition serum<br />
uric acid decreased significantly in combination<br />
of melatonin with vitamin E and vitamin E with<br />
vitamin C groups and serum total bilirubin only<br />
in melatonin with vitamin E combination as<br />
compared with the Pb acetate treated rats. The<br />
mechanism of improvement may be in part due<br />
to the melatonin’s antioxidative actions that<br />
reduces tissue damage (Darwish, 2007). Song et<br />
al,1997 concluded that the presence of melatonin<br />
receptors in proximate tubules suggests that it<br />
plays a significant role in mediating the renal<br />
action of melatonin.<br />
Vitamin C and E when used in combination<br />
or used in combination with melatonin decreased<br />
or affected the renal function tests: urea, uric<br />
acid and creatinine. Antioxidants are frequently<br />
used for different diseases e.g diabetes and their<br />
complicattions. Plasma vitamin C and E<br />
concentrations are reduced in diabetes (Murugan<br />
and Pari, 2006). Vitamin C plays a central role<br />
in the antioxidant protective system, protecting<br />
all lipids undergoing oxidation and diminishing<br />
the number of apoptotic cells (Sadi et al., 2008).<br />
Furthermore, vitamin C regenerates the oxidized<br />
vitamin E. Vitamin E, on the other hand, acts as<br />
a non-enzymatic antioxidant and reduces lipid<br />
peroxidation and glutathione (Lee et al., 2007).<br />
Therefore, in this study, these two vitamins<br />
through their antioxidant properties with<br />
melatonin could decrease serum urea, uric acid<br />
and creatinine in Pb acetate treated rats.<br />
Results show a non-significant increase in<br />
serum total bilirubin in Pb-acetate group<br />
compared to the control, while, it was decreased<br />
significantly (P
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
improves serum enzymes most likely is through<br />
its free radical scavenger effects, and its action<br />
on stabilizing cell membranes which assists<br />
them in reducing oxidative damage (Lena and<br />
Subramani, 2003). Additionally, Pedreanez et<br />
al., (2004) concluded that melatonin has antiapoptotic<br />
effects in part independent of the<br />
modulation of the oxidative damage.<br />
On the other hand, vitamin E acting as an<br />
antioxidant may increase the half life of<br />
melatonin because it scavenges different types of<br />
free radicals helping by melatonin to maintain its<br />
own structure without scavenging free radicals.<br />
Melatonin does not undergo redox cycling and,<br />
thus, does not promote oxidation as shown under<br />
a variety of experimental conditions. From this<br />
point of view, melatonin can be considered as a<br />
terminal antioxidant which distinguishes it from<br />
the apportunistic antioxidants like vitamins C<br />
and E.<br />
In conclusion, oral exposure of Pb-acetate<br />
caused alterations in serum lipid profiles and<br />
renal function tests and the results indicate that<br />
melatonin and vitamin E could be protective<br />
agents against Pb-toxicity in rats, most likely<br />
through their antioxidant and free radical<br />
scavenger effects.<br />
REFERENCES<br />
-Al-Ashmawy, I. M.; El-Nahas, A. F. and Salama, O. M.<br />
(2005). Protective effect of volatile oil, alcoholic<br />
and aqueous extracts of Origanum majorana on lead<br />
acetate toxicity in mice. Basic Clin Pharmacol<br />
Toxicol. 97:238-243.<br />
-Aoyama, H.; Mori, N. and Mori, W. (1988). Effects of<br />
melatonin on genetic hypercholesterolemia in rats.<br />
Atherosclerosis. 69: 269-272.<br />
-Bettahi, I.; Pozo, D.; Osuna, C.; Reiter, R. J.; Acuna-<br />
Castroviejo, D. and Guerrero, J. M. (1996).<br />
Physiological concentrations of melatonin inhibit<br />
nitric oxide synthase activity in the rat<br />
hypothalamus. J. Pineal Res. 20:205-210.<br />
-Chaurasia, S. S. and Kar, A. (1997). Protective effects of<br />
Vitamin E against lead induced deterioration of<br />
membrane associated type-1 iodothyronine 5monodeiodinase<br />
(5D-I) activity in male mice.<br />
Toxicology. 124:203-209.<br />
-Darwish, D.F. (2007). Effect of exogenous melatonin on<br />
some haematological and biological parameters in<br />
induced-thyrotixic and hypothyroid male albino<br />
rats. University of Sulaimani. College of Science.<br />
Mc. Thesis.<br />
-Dillard, C. J. and Tappel A. L. (1984). Flueresent damage<br />
products of lipid peroxidation. Methods Enzymol.<br />
105:337-348.<br />
-Esterbauer, H.; Gebicki, J.; Puhl, H. and Jurgens, G.<br />
(1992). The role of lipid peroxidation and<br />
182<br />
antioxidants in oxidative modification of LDL. Free<br />
Radic Biol Med. 13:341-390.<br />
-Forsling, M.L.; Wheeler, M.J. and Williams A.J. (1999).<br />
The effect of melatonin adminstration on pituitary<br />
hormone secretion in man. Clin Endocrinol (Oxf);<br />
51:637-642.<br />
-Frei, B.; Stocker, R. and Ames, B. (1988). Antioxidant<br />
defenses and lipid peroxidation in human blood<br />
plasma. Proc. Natl. Acad. Sci. U.S.A. 85,9748.<br />
-Ghorbe, F.; Boujelbene, M.; Makni-Ayadi, F. et al. (2001).<br />
Effect of chronic lead exposure on kidney function<br />
in male and female rats, determination of lead<br />
exposure biomarker. Arch Physiol Biochem.<br />
109:457-463.<br />
-Halliwell, B. and Gutteridhe, J. M. C. (1990). Free radicals<br />
and catalytic metal ions in human disease: an over<br />
view. Meth. Enzymol. 186:1-86.<br />
-Hami, J.; Dashti, Gh. R.; Nemat-Bakhsh, M.; Afshar, M.<br />
and Ghafffari, H. R. (2006). The relation between<br />
high dose lead exposure and serum lipids and<br />
lipoprotein levels. Shiraz E-Medical J. 7(2).<br />
-Harding, A. H.; Wareham, N.J.; Bingham, S, A.; Khaw,<br />
K.; Luben, R; Welch, A. and Forouhi, N. G. (2008).<br />
Plasma vitamin C level, fruit and vegetable<br />
consumption and the risk of new-onset type 2<br />
diabetes mellitus: The European prospective<br />
investigation of cancer-Norfolk prospective study.<br />
Arch. Inter. Med. 168:1485-1486.<br />
-Harri, H. (1992). Vitamin C and plasma cholesterol.<br />
Department of public Health, University of<br />
Helsinki, Haartmaninkatu 3,00290 Helsinki,<br />
Finland.<br />
-Hassan, A. A. and Jassim, H. M. (2010). Effect of treating<br />
lactating rats with acetate and its interaction with<br />
vitamin E or C on neurobehavior, development and<br />
some biochemical parameters in their pups. Iraqi J<br />
of Veterinary Science. 24(1): 45-52.<br />
Hoyos, M.; Guerrero, J. M.; Perez-Cano, R. et al. (2000).<br />
Serum cholesterol and lipid peroxidation are<br />
decreased by melatonin in diet-induced<br />
hypercholesterolemic rats. J Pineal Res. 28:150-<br />
155.<br />
-Ito, Y.; Niijya, Y.; Shima, S. and Sarai, S. (1985). Serum<br />
lipid peroxide level and blood superoxide dismutase<br />
activity in workers with occupational exposure to<br />
lead. Int Arch Occp Environ Health. 56:119-127.<br />
-Jialal, I.; Vega, G. L. and Grundy, S. M. (1990).<br />
Physiologic levels of ascorbate inhibit the oxidative<br />
modification of low density lipoprotein.<br />
Atherosclerosis. 82,185.<br />
-Karbownik, A. L. and Reiter, J. R. (2001).<br />
Anticarcinogenic actions of melatonin which<br />
involve antioxidative processes: comparison with<br />
other antioxidants. Int. J. Biochem. Cell Biol.<br />
33:735-753.<br />
-Lena, P.J. and Subramani, P.(2003). Evaluatuion of the<br />
antiperoxidative effects of melatonin in ammonium
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
acetate-treated Wistar rats. Pol. J pharmacol.<br />
55(6):1031-6.<br />
-Mbewu, A. D. and Durrington, P. N.(1990).<br />
Lipoprotein(a): structure, properties and possible<br />
involvement in thrombogenesis and atherogenesis,<br />
Atherosclerosis. 85,1.<br />
-McBride, M. B.; Rigden, S.; Haycock, G. B. et al. (1998).<br />
Presympathetic detection of familial juvenile<br />
hyperuricaemic children. Pediatr Nephrol. 12:357-<br />
364.<br />
-Niki, E. (1991). Vitamin C as an antioxidant, world Rev.<br />
Nutr. Diet. 64,1.<br />
-Pedreanez, A.; Rincon, J.; Romero, M.; Viera, N. and<br />
Mosquera, J. (2004). Melatonin decrease apoptosis<br />
and expression of apoptosis-associated proteins in<br />
acute puromycin aminonucleoside nephrosis.<br />
Nephros. Dial. Transplant. 19:1098-1105.<br />
-Pita, M. L.; Hoyos, M.; Martin-Lacave I et al. (2002).<br />
Long-term melatonin administration increases<br />
polyunsaturated fatty acid percentage in plasma<br />
lipids of hypercholestrimic rats. J. Pineal Res.<br />
32:179-186.<br />
-Rath, M. and Pauling, L. (1991). Solution to the puzzle of<br />
human cardiovascular disease: its primary cause is<br />
ascorbate deficiency leading to the deposition of<br />
lipoprotein(a) and fibrinogen/fibrin in the vascular<br />
wall. J. Orthomolecular Med. 6,125.<br />
-Sadi,G.; Yilmaz, O. and Güray, T. (2008). Effect of<br />
vitamin C and lipoic acid on streptozotocin-induced<br />
diabetes gene expression: mRNA and protein<br />
expressions of Cu-Zn SOD and catalase. Mol. Cell<br />
Biochem. 309:109-16.<br />
-Sokoloff, B.; Hori, M.; Saelhof, C. C.; Wrzolek, T. and<br />
Imai, T. (1966). Aging, atherosclerosis and ascorbic<br />
acid metabolism. J. Am. Geriat. Sos. 14,1239.<br />
-Song, Y.; Chan, C. W.; Brown, G. M.; Pang, S. F. and<br />
Silverman, M. (1997). Studies of the renal action of<br />
melatonin: evidence that the effects are mediated by<br />
the Kda receptors of the Melia subtype localized<br />
primarity to the basolateral membrane of the<br />
proximal tubule. J. FASEB. 11, 93-100.<br />
-Vaglenov, A.; Creus, A.; Latchev, S. Petcova, V.; Pavlova,<br />
S. and Marcos, R. (2001). Occupational exposure to<br />
lead and induction og genetic damage. Environ<br />
health Perspect. 109:295-298.<br />
-Wakatsuki, A. and Okatani, Y. (2000). Melatonin protects<br />
against the free radical-induced impairment of nitric<br />
oxide production in the human umbilical artery. J<br />
Pineal Res. 28:172-178.<br />
-Wang, H.; Wei, W.; Shen, Y.; Dong, C.; Zhang, L.; Wang,<br />
N.; Yue, L. and Xu, S. (2004). Protective effect of<br />
melatonin against liver injury in mice induced by<br />
Bacillus Calmette-Guerin plus lipopolysaccharide.<br />
World J Gastroenterol. 10(18):2690-2696.<br />
-Wintergerst, E. S.; Maggini, S. and Hornig, D. H. (2006).<br />
Immune-enhancing role of vitamin C and zinc and<br />
effect on clinical conditions. Ann Nutr Metab.<br />
50:85-94.<br />
-Wojtchak-Jaroszowa, J. and Kubow, S. (1989). Carbon<br />
monoxide, carbon disulfide, lead and cadmium-four<br />
examples of occupational toxic agents linked to<br />
cardiovascular disease. Med Hypotheses. 30:141-<br />
150.<br />
-Wolf, P. L.; Williams, D.; Tsudaka, T. et al. (1972).<br />
Methods and Technique in Clinical Chemistry. New<br />
York: Wiley-Interscience a division of John Wiley<br />
and Sons.<br />
-Yokoyama, K.; Araki, S. et al. (2000). Alteration of<br />
glucose metabolism in the spinal cord of<br />
experimental lead poisoning rats: micro<br />
determination of glucose utilization rate and<br />
distribution volume. Ind Health. 38:221-223.<br />
183
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
ةميضزوط ىٌاوسف ىٌاكةتسَيت ةو ىزوةض ىكَيزؤج دٌةض زةسةل ُايٌادةوةكَيث ةو C ينواتيظ ،E<br />
184<br />
يشوقزوق ةب واسكيواسِةذ<br />
ىجزوج ةل<br />
ينواتيظ ،ينٌوتلايو ىَلؤز<br />
يشوقزوق ىةدداو ةب ُووب ىواسِةذ . ةيةِ ادةطٍيذ ةل ُاواسفزةب ىكةيةوَيش ةب ةو ةيتشوسس ىكةيةدداو يشوقزوق<br />
ىزةةطيزاك ىٍيٍكشث ةيةوةٍيرَيوت ًةل تسةبةو . تَيبةِ شةل ىٌاكةوادٌةئ ةل كيزؤش زةسةل ىزةطيزاك<br />
ة ة ل ك َي د ة ٌ ة ِ ز ة ة س ة ل ُ ا ي ٌ د س ك َل ة ة ك َي ت ة ة ب و ا ي ٌ ة ة ت E ةينواةتيظ ة ب ،<br />
C<br />
ةتخوث<br />
ةيةٌاوةل<br />
ينواتيظ و ينٌؤتلايو ةل كةيزةِ ىٌةياخرَيزد<br />
ىجزوج زاوض وانجةث . يشوقزوق ىةدداو ةب واسكىواسِةذ<br />
ىجزوج ةل ََيوخ ىوادزةش ةل ىٌايذ ىايىيك ىٌاكةزةتيوازاث<br />
ثوسط شةش زةِ ،شاوايج ىثوسط ؤٌ ؤب ُاسك شةباد ُاكةووتاِزاكةب ةجزوج تاِزاكةب ادةوةٍيرَيوت ًةل ىجس ىةيَيو<br />
ًةوود ىةثوسط ،)<br />
هؤِترٌؤك ىجزوج(<br />
ًةكةي ىثوسط : ةوةزاوخ ىةٌاوةئ وكةو ةتفةِ<br />
01<br />
ىةواو ؤب كَيجزوج زةِ ؤب<br />
ىواةئ ترل / يطمو 1.0()<br />
يشوقزوق ىتاتيسةئ(<br />
ًةيئس ىثوسط ،)<br />
ةوةٌدزاوخ ىوائ ترل/<br />
يطمو 1.0(<br />
) ًؤيدؤس ىتاتيسةئ(<br />
ًةةحٍَيث ىةثوسط ،)<br />
كازؤةخ يةطك / ينٌؤةتلايو ةل يطمو 01(<br />
) ينٌؤتلايو + يشوقزوق(<br />
ًةزاوض ىثوسط ،)<br />
ةوةٌدزاوخ<br />
يطمو 0(<br />
) C ينواتيظ + يشوقزوق(<br />
ًةشةش ىثوسط ،)<br />
كازؤخ يطك / E ينواتيظ ةل شةب 0111(<br />
E ينواتيظ + يشوقزوق(<br />
ًةتشةِ ىثوسط ،)<br />
E ينواتيظ + ينٌؤتلايو + يشوقزوق ( ىيةَلةكَيت ًةتوةح ىثوسط ،)<br />
ةوةٌدزاوخ ىوائ ترل / ينواتيظ ةل<br />
.)<br />
C<br />
ينواتيظ +<br />
E<br />
ينواتيظ +<br />
يشوقزوق (<br />
ىيةَلةكَيت ًةيؤٌ ىثوسط ، ) C<br />
ينواتيظ + ينٌؤتلايو + يشوقزوق ( ىةَلةكَيت<br />
ََيوخ ىوادزةش لىؤيرسيمط نياسةئ ىاست و هؤيرتسيلؤك ةل واضزةب ىةوةٌووبشزةب ةب ُةدةد ُاشيٌ او ُاكةوانجةئ<br />
) Eينواتيظ<br />
+ ينٌؤتلايو(<br />
،Eينواتيف<br />
،ينٌؤتلايو ىٌاٍَيِزاكةب<br />
نياةسةئ ىاسةت و هؤترةسيلؤك ةةل واةضزةب ىةوةةٌدسك<br />
ًةك ىؤِ ةووب ىيةَلةكَيت ةب<br />
. هؤترٌؤك ىثوسط َهةط ةل دزوازةب ةب يشوقزوق ىثوسط ةل<br />
)<br />
C ينواتيظ + E ينواتيظ(<br />
ىؤِةةب ،ةوؤبشزةةب واضزةب ىكةيةوَيش ةب ََيوخ ىوادزةش ىتشط ىٍيتؤسث ىةتاك وةل ،ََيوخ ىوادزةش لىؤيرسيمط<br />
و ينٍيتايسك . وازدَيث يشوقزوق ىتاتيسسةئ ىثوسط َهةطةل دزوازةب ةب ىيةَلةكَيت ةب<br />
E<br />
ةو<br />
ينواتيظ + ينٌؤتلايو و ينٌؤتلايو<br />
ةب ووبازدَيث ُايشموقزوق ةك ىةٌاجزوج وةل ةوةتَيببشزةب واضزةب ىكةيةوَيش ةب ةك توةكزةد او كيزوي ىشست<br />
و ايزوي<br />
و ايزوي و ينٍيتايسك ىيةَلةكَيت ةب E ينواتيظ + ينٌؤتلايو ،ينٌؤتلايو ةوةست ىكةيلاةل . هؤترٌؤك يثوسط َهةطةل دزوازةب<br />
ةةل<br />
. يةشوقزوق ةةب وازدةَيث ىجزوج َهةط ةل دزوازةب ةب ةوةدسكوةك<br />
ََيوخ ىوادزةش ةل ينبؤيرميب و كيزوي ىشست<br />
نياسةئ ىاست و هؤيرتسلؤك ىتسائ ىةوةٌووبشزةب ىؤِ ةتَيبةد يشوقزوق ىٌةياخرَيزد ىٌادَيث تَيوةكةدزةد ادوانجةزةد<br />
ىٌادَيث ىؤِةب<br />
ةوةتَيبةد ًةك ةٌاٌوضكَيت ًةئ . ًَيوخ ىوادزةش ةل ىتشط ىٍيبؤيرميب و كيزوي ىشست و ايزوي و هؤيرسيمط<br />
ينواتيظ ُاي اٌّةت ةب ، C ينواتيظ ،E<br />
ينواتيظ ،ينٌؤتلايو ةل ستايش ىكةيةوَيش ةب<br />
E<br />
ينواتيظ َهةطةل ىيةَلةكَيت ةب ينٌؤتلايو<br />
.<br />
ىيةَلةكَيتةب E وC
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 177-185, 2011<br />
ناذرجلا يف ةيلكلا ةفيظو تارابتخاو موحشلا عاونا ضعب ىلع مهتلاخادتو C نيماتيف ،E<br />
صاصرلاب ممستلل ةضرعملا<br />
نيماتيف ،نينوتلايملا ءاطعا ريثأت<br />
صخلملا<br />
ءار عا نرم دريدع ىرلع رثىري نا نركمي صارصرلا ب ارمب ممرستلا نا . ةر يبلا يرف برريكب ررشترم و يرعيبع رر رع صارصرلا رربتعي<br />
و مهرريب خادرتلاو<br />
E نيمارتيف ، C نيمارتيف ،نينورتلايملا ءارطعا ريثأرت ةرفرعمل ورم ةريلاحلا ةر اردلا نرم درهلا نا . مسجلا<br />
و ةرعبرا مدختر ا . صارصرلاب ممرستلا ةثدحترسملا ناذررجلا يرف مدرلا مل ةيئايميكويبلا سيياقملا ضعب ىلع ةليوع بدمل<br />
،برطيرسلا تارناويح : يرم يمارجملا<br />
تاتيرر أ ،)<br />
ررشلا ءاررم ررتل / مررغلم 1.0(<br />
مررغك/<br />
ةرريلو بدررحو 0111(<br />
رريكرتب<br />
+ نينورتلايم + صارصرلا تاتير أ(<br />
: تلاخادرتلا ،)<br />
E<br />
.<br />
يمارجم رست ىرلع تارناويحلا رعزو . ةر اردلا<br />
ريكرتب صاررصرلا تاتير<br />
أ ،)<br />
نيماررتيف + صاررصرلا تاتيرر أ ،)<br />
ررشلا ءام رتل/<br />
مغلم 0(<br />
رررشلا ءارم رررتل / مرغلم0<br />
. 1(<br />
ررلع مررغك/<br />
مررغلم 01(<br />
رم يرف هارنفا نرم اذررر نورسمخ<br />
رريكرتب موي ور لا تاتير أ<br />
رريكرتب نينوررتلايم + صاررصرلا<br />
يكرتب C نيماتيف + صاصرلا تاتي أ ،)<br />
.) C نيماتيف + E نيماتيف + صاصرلا تاتي أ(<br />
ةعومجم و ) C نيماتيف + نينوتلايم + صاصرلا تاتي أ(<br />
،)<br />
E<br />
ب اررمب ةررلماعملا ةررعومجم رر م يررف ةرريثلايلا موحررشلا و يررلكلا وورتررسلوكلا وتررسم يررف ةرريورعم تا ارريز ائاررترلا رررهظت<br />
و<br />
E<br />
نيمارتيف+<br />
نينورتلايم نيرب خادرتلاو<br />
E<br />
نيمارتيف ،نينورتلايملا<br />
ءارطعا ت ا<br />
لع<br />
نيماتيف<br />
. برطيرسلا ةرعومجمب ةرنراقم صارصرلا تلارخ<br />
وتررسم ررلا رر ولا يررف ،ةرريثلايلا موحررشلاو يررلكلا وورترسلوكلا وتررسم يررف ةرريورعم تاررضافخنا ىررلا<br />
ريرويلا ضمارحو اريروي ،نيريتاريركلا وترسم نا<br />
C<br />
+<br />
E<br />
نيمارتيف<br />
. صارصرلا تلارخب ةرلماعملا ةرعومجملا يرف اريورعم ت ا زا ىرلكلا نيتورربلا<br />
ةرلماعملا نارف ررخا ةرهر نرمو . برطيرسلا تارناويحب ةرنراقم صارصرلا تاتير أب ةلماعملا ناذرجلا يف ةيورعم تا ايز ترهظا<br />
نيبورريلبلاو ريرويلا ضمارح ،اريروي ،نيتاريركلا وترسم يرف ايورعم اضافخنا بب اعم<br />
E<br />
نيماتيف + نينوتلايم ،نينوتلايملاب<br />
ب ارمب ةرلماعملا ناذررجلا نأرب ةريلاحلا ة اردلا نم اترتست . صاصرلا تاتي أب ةلماعملا<br />
ناذرجلاب ةنراقم ملا يف يلكلا<br />
اررريرويلاو نيريتاررريركلاو ةررريثلايلا موحرررشلاو يرررلكلا وورترررسلوكلا وترررسم يرررف ةرررظوحلم ب اررريز تررررهظا ةرررليوع بدرررمل صارررصرلا<br />
ةررريعيبطلا ارررهتلاح ىررلا ت ارررع تارررريغتلا<br />
ررم مرررظعم نا<br />
دررح ىررلع ررك C<br />
نيماررتيف ،<br />
E<br />
نيماررتيف ،نينوررتلايم ءاررطعا يررف ررريكا<br />
. مدرررلا ررر م يررف يرررلكلا نيبورررريلبلا وتررسمو ررريرويلا ضماررح و<br />
اررعم<br />
E<br />
نيماررتيف<br />
+<br />
نينوررتلايم ءاررطعا ةطرر اوب<br />
.<br />
اعم Cو<br />
Eتاريماتيفلا<br />
وا<br />
185
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 186-190, 2011<br />
Hyalomma aegyptium AS A DOMINANT TICK ON CERTAIN TORTOISES<br />
OF THE Testudo graeca IN ERBIL PROVINCE-KURDISTAN REGION-IRAQ<br />
186<br />
QARAMAN MAMAKHIDR KOYEE<br />
Dept. of Biology, College of Science, University of Salahaddin, Kurdistan Region-Iraq<br />
(Received: October 30, 2010; Accepted for publication: June 4, 2011)<br />
ABSTRACT<br />
Ticks are obligatory blood-sucking arachnid arthropods infecting mammals, birds, reptiles and amphibians.<br />
Hyalomma aegyptium parasites tortoises and other animals. The main objective of the current study was to determine<br />
and identify prevalence of ticks on certain tortoises in Erbil province-Kurdistan Region, Iraq. The study was carried<br />
out over a four months period from the beginning of March to the beginning of July 2010. A total of 18 tortoises were<br />
sampled from certain places of Erbil province (Koya, Bastora, Kalak and Graw). The captured tortoises were<br />
inspected closely for the presence of ticks with naked eyes, magnifying lens, dissecting microscope and light<br />
microscope. And also, sites of tick attachment were recorded. Out of 18 examined tortoises, 14 of them were infested<br />
with ticks. A total of 123 ticks were collected from infested tortoises. The infestation rates and mean intensity of male<br />
and female tortoises was 75%, 80% and 9.5, 8.25 respectively. According to the gender of the isolated ticks, male ticks<br />
(71) were found from more tortoises than were females (52). Ticks were attached to the neck and axilla of fore and<br />
hind legs of tortoises. All ticks were determined to be H. aegyptium, it was considered as a first record on the tortoises<br />
in Kurdistan Region.<br />
KEYWORDS: Hyalomma aegyptium, Ticks, Tortoises, Kurdistan Region-Ebil-Iraq<br />
M<br />
INTRODUCTION<br />
any species of reptiles are prevalent in<br />
the Iraqi ecosystems. Which include<br />
many categories like lizards, snakes, tortoises<br />
and turtles. However, very little attention has<br />
been paid by Iraqi and non-Iraqi biologists to the<br />
parasites of any group of them (Al-Barwari and<br />
Saeed, 2007).<br />
Testudo graeca Linnaeus 1758, or the<br />
spurthighed tortoise, is an endangered species<br />
with a broad distribution range. It can be found<br />
in northern Africa (e.g. Morocco, Algeria,<br />
Tunisia and Libya), the Middle East (e.g.<br />
Lebanon, Jordan, Syria, and Iraq), Europe<br />
(Bulgaria, Romania, Turkey, Greece, and<br />
multiple introductions into Spain and Greece),<br />
and in Asia (e.g. Armenia, Azerbaijan, Georgia,<br />
Turkmenistan, Iran, and possibly Afghanistan)<br />
(Beshkov and Nanev, 2002; Boyan et al., 2003).<br />
Reptiles act as hosts to a variety of parasitic<br />
organisms. Ectoparasites in the form of ticks and<br />
mites are particularly conspicuous and may be<br />
commonly found on reptiles (Stafford and<br />
Meyer, 2000).<br />
Ticks are obligatory blood-sucking arachnid<br />
arthropods infecting mammals, birds, reptiles<br />
and amphibians. They possess tremendous<br />
potential for transmitting organisms that may<br />
cause disease in humans and other animals<br />
(Anderson and Harrington, 2008).<br />
Species of the genus Hyalomma are mediumsized<br />
or large ticks, with eyes and long<br />
mouthparts. The males have ventral plates on<br />
each side of the anus. They are most commonly<br />
found on legs, udder, and tail or perianal region.<br />
About 20 species are found, usually in semidesert<br />
lowlands of central Asia, southern Europe<br />
and North of Africa. They can survive<br />
exceptionally cold and dry conditions. Adults of<br />
a number of species parasitize domestic<br />
mammals. H. aegyptium may be introduced on<br />
tortoises (Wall and Shearer, 2001).<br />
The vast literature regarding ticks has centered<br />
mostly around 10% of the world tick fauna,<br />
which have been well recognized for their<br />
medical and veterinary significance (Hoogstraal,<br />
1985).<br />
Out of 77 statistically comparable tick<br />
collections, comprising 792 specimens were<br />
made from adults of the Russian spur-thighed<br />
tortoise, T. g. nikolskii, at 4 sites along Russia's<br />
Black Sea coast. The first tick collections<br />
reported from T. g. nikolskii. All ticks were<br />
determined to be Hyalomma aegyptium (Robbins<br />
et al., 1998).<br />
In the spring 2001, 6 ticks (4 male, 2 female)<br />
were observed and collected in 2 turtles, Testudo<br />
graeca in Kerman province at south part of Iran.<br />
This confirmed that they have been Hyalomma<br />
aegyptium, a common turtle parasite (Nabian<br />
and Mirsalimi, 2002).<br />
Testudo graeca tortoises were collected in the<br />
northern and southern Golan Heights and<br />
various locations in Israel and Palestine.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 186-190, 2011<br />
Hyoalomma oegyptium ticks were found only on<br />
Golan Height tortoises (Paperna, 2006).<br />
From 211 tortoises belonging to three<br />
species, Testudo marginata Schoepff, T. graeca<br />
Linnaeus, and T. hermanni Gmelin were<br />
sampled throughout Greece, Bulgaria, Romania<br />
and Croatia (Balkan countries), revealed the<br />
presence of four species of ixodid ticks (1327 in<br />
number), namely Hyalomma aegyptium<br />
(Linnaeus), Haemaphysalis sulcata Canestrini<br />
and Fanzago, H. inermis Birula and<br />
Rhipicephalus sanguineus (Latreille). It was<br />
confirmed the strong dominance of all life stages<br />
of H. aegyptium among ticks parasitizing west<br />
Palaearctic tortoises of genus Testudo Linnaeus<br />
(Siroký et al., 2006).<br />
Tavassoli et al. (2007) collected 117 ticks<br />
from 14 infested tortoises out of 32 examined in<br />
Urmia Region, Iran.<br />
The study of tortoises tick is a neglected field<br />
of zoological study in Iraq. To date as far as it is<br />
discernible from the review of the literature,<br />
there were no studies on tortoise's tick in Erbil;<br />
therefore the present study was aimed to record<br />
the incidence of ticks among tortoises in a<br />
certain places of the studied area (Kaya, Bastora,<br />
Kalak and Graw), and to determine the intensity<br />
of infestation.<br />
MATERIALS AND METHODS<br />
Total samples of 18 tortoises (Testudo graeca<br />
Linnaeus, 1758) were collected and classified<br />
according to Khalaf (1959) during the beginning<br />
of March to the beginning of July 2010, from<br />
different locations of Erbil province-Iraq. The<br />
selections of the samples (two sexes) were at<br />
randomly (10 females and 8 males), and then<br />
they were brought alive into the animal house of<br />
Science College, Biology Department for further<br />
examination.<br />
The captured tortoises were inspected closely<br />
for the presence of ticks with naked eyes,<br />
magnifying lens, dissecting microscope and light<br />
microscope. And also sites of tick attachment<br />
were recorded.<br />
Ticks were collected by using thin tweezers<br />
and immediately placed into screw–capped vials<br />
containing several minute holes; vials were<br />
properly identified and conditioned under room<br />
temperature few days or weeks for species<br />
identifications (Tavassoli et al., 2007). The ticks<br />
were identified using standard text by Wall and<br />
Shearer (2001) as follow:<br />
1. Gnathosoma projecting anteriorly and visible<br />
whene specimen seen from above: scutum<br />
present, covering the dorsal surface completely<br />
(Male); stigmata plates large; situated posteriorly<br />
to the coxae of the fourth pair of<br />
legs……………..Ixodidae.<br />
2. Anal groove entirely posterior to the anus.<br />
3. Eyes present.<br />
4. Palps much longer than wide.<br />
5. Palps with second segment less than twice as<br />
long as third segment, scutum without<br />
pattern…………….. Hyalomma sp.<br />
RESULTS AND DISCUSSION<br />
Table 1, out of 18 tortoises were collected, 14<br />
of them (6 males and 8 females) were infested<br />
with Hyalomma aegyptium (Fig. 1, 2, 3, 4 and 5)<br />
as a first record on the tortoises in Kurdistan<br />
Region. The observation of H. aegyptium on<br />
tortoises is in agreement with Robbins et al.<br />
(1998) in Russia, Nabian and Mirsalimi (2002)<br />
in Iran, Paperna (2006) in Israel, Siroký et al.<br />
(2006) in Balkan countries and Tavassoli et al.<br />
(2007) in Iran.<br />
The infestation rates and mean intensity of<br />
male and female tortoises was 75%, 80% and<br />
9.5, 8.25 respectively. Statistically there were no<br />
significant differences between infestation rates<br />
of both sexes (P>0.05). This indicates that<br />
whatever influences the reptilian sex hormones<br />
exert on their parasites, they are not profoundly<br />
reflected on the levels of parasitization (Al-<br />
Barwari and Saeed, 2007). This result is in<br />
disagreement with those reported by Robbins et<br />
al. (1998), they mentioned that more ticks<br />
parasitized male tortoises than females.<br />
According to the gender of the isolated ticks<br />
male ticks (71) were found from more tortoises<br />
than were females (52). This is may be due to<br />
the fact that the males remain on their host and<br />
mate with several females; they will eventually<br />
drop from their host, while the female upon<br />
obtaining a blood meal detach and drop into the<br />
leaf litter to lay a single batch of eggs, they dies<br />
shortly after laying her eggs (Anderson and<br />
Harrington, 2008).<br />
Some factors of the host that affecting the<br />
ticks for seeking them, include detection of<br />
carbon dioxide and ammonia. The front legs of<br />
the ticks have specialized organs on them to<br />
detect carbon dioxide gradients from<br />
approaching hosts (Sonenshine, 1993). As it is<br />
obvious that the outcome of respiration and<br />
urination processes is carbon dioxide and<br />
ammonia respectively, this is explained the sites<br />
of tick attachments, collected ticks of the current<br />
study were attached to the neck and axillae of<br />
fore and hind legs of the tortoises, and this is in<br />
agreement with that revealed by Tavassoli et al.<br />
(2007) in Iran, that they mentioned the same tick<br />
infestation sites on the T. gareca.<br />
187
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 186-190, 2011<br />
188<br />
Table (1):- Prevalence, mean intesity and preference sites of Hyaloma aegyptium in relation to gender of<br />
Testudo graeca collected from Erbil province.<br />
Tortoises'<br />
gender<br />
Male<br />
Female<br />
2<br />
No. of<br />
examined<br />
tortoises<br />
No. of<br />
positive<br />
tortoises<br />
8 6 32 25<br />
No. of isolated ticks Site of tick<br />
Male Female<br />
attachment<br />
Neck and axilla of<br />
fore and hind legs<br />
Prevalence<br />
(%)<br />
Mean<br />
intensity<br />
75 9.5<br />
10 8 39 27<br />
Neck and axilla of<br />
fore and hind legs<br />
80 8.25<br />
18 14 71 52 - 77.77 8.87<br />
1<br />
Fig. (1):- H. aegyptium ticks attached to axilla of hind legs.<br />
Fig. (2):- H. aegyptium female tick, dorsal view. Fig. (3):- H. aegyptium female tick, ventral view.<br />
4 5<br />
Fig. (4):- H. aegyptium male tick, dorsal view. Fig. (5):- H. aegyptium male tick, ventral view.<br />
3
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 186-190, 2011<br />
REFERENCES<br />
-Al-Barwari, S.E. and Saeed, I. (2007). On the helminth<br />
founa of some Iraqi Reptiles. Türkiye Parazitoloji<br />
Derneği, 31 (4): 330-336.<br />
-Anderson, R.R. and Harrington, L.C. (2008). Tick Biology<br />
for the Homeowner. Entomology at Ithaca-College<br />
of Agriculture and Life Science at Cornell<br />
University. 11pp, from<br />
www.entomology.cornell.edu/.../TickBioFS.html;<br />
last updated: February 25, 2008).<br />
-Beshkov, V.l. and Nanev, K. (2002). Amphibians and<br />
Reptiles in Bulgaria.-Pensoft, p. 120.<br />
-Boyan, P.; Vladimir, P.; Popgeorgiev, B.G. and Plachyiski,<br />
D. (2003). National Action Plan for Tortoises<br />
Conservation in Bulgaria, Vers.1, BSPB, NMNHS-<br />
BAS, Sofia.<br />
-Hoogstraal, H. (1985). Argasid and Nuttalliellid ticks<br />
as parasites and vectors. Advance Parasitology,<br />
24: 135-138.<br />
-Khalaf, K.T. (1959). Reptiles of Iraq with some notes on<br />
the Amphibians. Published by a Grant from the<br />
Ministry of Education of Iraq. Ar-Rabitta Press.<br />
Baghdad. 96pp (87p).<br />
-Nabian, S. and Mirsalimi, S.M. (2002). First Report of<br />
Presence of Hyaloma aegyptium Tick From Testudo<br />
graeca Turtle In Iran. Journal of Veternary<br />
Research; 57 (3): 61-63.<br />
-Paperna, I. (2006). Hemolivia mauritanica<br />
(Haemogregarinidae: Apicomplexa) infection in the<br />
tortoise Testudo graeca in the Near East with data<br />
on sporogonous development in the tick vector<br />
Hyalomna aegyptium. Parasite, 13 (4): 267-73.<br />
-Robbins, R.G., Karesh, W.B., Calle, P.P., Leontyeva,<br />
O.A., Pereshkolnik, S.L. and Rosenberg, S. (1998).<br />
First records of Hyalomma aegyptium (Acari:<br />
Ixodida: Ixodidae) from the Russian spur-thighed<br />
tortoise, Testudo graeca nikolskii, with an analysis<br />
of tick population dynamics. Journal of<br />
Parasitology., 84 (6): 1303-1305.<br />
-Siroký, P.; Petrzelková, K.J.; Kamler, M.; Mihalca, A.D.<br />
and Modrý, D. (2006). Hyalomma aegyptium as<br />
dominant tick in tortoises of the genus Testudo<br />
in Balkan countries, with notes on its host<br />
preferences. Experimental Application Acarology,<br />
40 (3-4): 279-90.<br />
-Sonenshine, D. E. (1993). Biology of ticks. Vol. 2. Oxford<br />
University Press, New York.<br />
-Stafford, P.J. and Meyer, J.R. (2000). A guide to the<br />
Reptiles of Belize. The Natural History Museum,<br />
London. Academic Press. London. 356pp.<br />
-Tavassoli, E.; Rahimi-Asiabi, N. and Tavassoli, M. (2007).<br />
Hyalomma aegyptium on spur-tighed tortoise<br />
(Testudo graeca) in Urmia region West Azarbaijan,<br />
Iran. Iranian Journal of Parasitololgy, 2: 40-47.<br />
-Wall, R. and Shearer, D. (2001). Veterinary Ectoparasites:<br />
Biology, Pathology and Control. 2 nd edn., Blackwell<br />
Science. Oxford. 262pp.<br />
189
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 186-190, 2011<br />
ياطشَيراثةه<br />
190<br />
Testudo graeca<br />
يخموت يناكةَهةضيكةه مَيدنةي رةصةه َياس يكةيةنِزق وكةو<br />
قازَيع-ىاتصدروك<br />
يٌَيرةي-زَيهوةي<br />
Hyaloma aegyptium<br />
و ىاكةكؤصخ و ىاكةدهَهاب و ىاكةرةديرش يشووت ةك راضان يذً وَيوخ ييةكؤَهاجَهاج يرادةطًوج َيث ةه ينتزبةنِزق<br />
مةه يكةرةص ينجاًائ . ةزت ينارةوةنايط و ىاكةَهةضيك يرؤخةصً Hyaloma aegyptium . وبةد ىاكةي يكةوالشوو<br />
مَيدنةي ةه ىاكةنِزق يرؤخةصً ةب ىووب سووت يةذَيِر يندزلناصين تصةد و ىدزليرايد ةه ووب تييزب ادةيةوةهيذَيوت<br />
دتناياخ يطناتً راوتض يةواتً ةتكةوةهيَهؤلَيه . قازتَيع-ىاتتصدروك<br />
يٌَيرةي -زَيهوةي<br />
ياطشَيراث يناكةَهةضيك ةه<br />
ةه مَيدنةي ةه ةوةنازكؤك َيةضيك<br />
01 يؤك . 0202<br />
ةتخوث<br />
يَهاص يسوًةت يطناً ياتةرةص وكات تراً يطناً ياتةرةصةه<br />
يواضةب ىازهَيلصث ةوةليشنةه ىاكةوايرط َيةضيك .) زَيوط و نةهةك و ةرؤتصةب و ةيؤك(<br />
زَيهوةي ياطشَيراث يناكةضوان<br />
ىاكةنِزق يناصوون نيَيوش ايةورةي ةو . ىاكةنِزق ينووب تيصةبةً ةب يياهشؤِر نييبدروو و يرالَيوت نييبدروو و يياصائ<br />
وةزَين يِزضةدنةوان و ىووب شووت يةذَيِر . ىاكةووب شووت ةَهةضيك ةه ةوةنازكؤك ةنِزق 001 تيصط يؤك . ىازكراًؤت<br />
ةنِزق يناكةخموت يةزَيوطةب . ادكةي ياودةب 1.03 , 5.3 ةو % 12 , % 53 ةه ووب تييزب ىاكةووب<br />
شووت ةَهةضيك يةي َيً<br />
.) 30(<br />
ىاكةتي َيتً ةتنِزقَ َيةطةه دروارةبةب ىاكةَهةضيك يةبرؤسةه ىازهيب و ىووب<br />
50 ىاكةزَين ةنِزق , ىاكةوازكايج<br />
ةه ةك ىازناداو ىاكةنِزق ووًةي . ىاكةَهةضيك يةواود يهةث وةوةصَيث يهةث يَوطنةًهب و ىً ةب ىووباصوون ىاكةنِزق<br />
يٌَيرةي ةه ىاكةَهةضيك رةصةه وازك ساب يرؤخةصً يراًؤت مةكةي ادةيةوةهيذَيوت مةه . ىووب<br />
H. aegyptium<br />
. ازكراًؤت<br />
ةظفاخم يف Testudo graeca سنج نم فحلاس ضعب ىلع دئاس<br />
دارقك Hyaloma aegyptium<br />
و فيحاوزلا و روييطلا و تايديثلا<br />
قارعلا-<br />
ناتسدروك ميلقا-ليبرا<br />
يخمووت<br />
ىاتدروك<br />
ةصلاخلا<br />
ييصي لفطتلا يرابجا يليفط و مدلل ةصاملا<br />
لجرلااةيلصفم تايتوبكنعلا نم دارقلا<br />
ربتعي<br />
نايك ةيساردلا هذه نم يساسلاا فدهلا<br />
. ىرخلاا تاناويخلا و فحلاسلا ىلع Hyaloma aegyptium لفطتي . تايئامربلا<br />
تزيجنا . قاريعلا-ناتيسدروك<br />
مييلقا-لييبرا<br />
ةيظفاخم ييف فحلايسلا ضيعب يلع ةلفطتملا<br />
طاينم ضيعب نيم ةفخليس<br />
01<br />
يمج ايهللاخ ميت , 0202<br />
دارقب ةباصلاا ةبسن صيخشتو داجيا<br />
ويمت<br />
رهيش ةييادب ىيلا رااا رهيش ةييادب نيم رهيشا ةعبرا للاخ ةساردلا<br />
رييبكت تايسدع و ةدريجملا نييعلا ةطيساوب ةيقيقد ةرويصب<br />
ريق نيع يصخف ) ريويك و يلك و ةرؤتسب و ةيؤك(<br />
ليبرا<br />
ةظفاخم<br />
فحلاييس 01 نيييب نييم . ةافخلييسلا مييسج ىييلع دارييقلا قاييصتلا ييقوم ليجييست مييت اييضياو . يئويي رييهجم و جيرييشت رييهجمو<br />
روكذييلا فحلاييسلل ةباييصلاا ةدييش و ةباييصلاا<br />
ةبييسن . ة دارييق 001 عومجماييهنم<br />
ييمج<br />
. دارقلاييب ةباييصم<br />
نيم يعمج<br />
يذيلاو ريكا 50 نايك لوزيعملا داريقلا سنيجل ةبيسنلاب ايما . يلاويتلا ىلع 1.03 , 5.3 و % 12 , % 53<br />
و . ةييفلخلا و ةييماملاا ليجرلاا<br />
و<br />
يبلاا يختو نعلايب اقيصتلم لوزيعملا داريقلا ناك .) 30(<br />
ييناك 02 , ةييصوفخم<br />
ناك ثانلاا<br />
ثانلااب ةنراقم فحلاسلا ةيرثكا<br />
ةافخليسلا ىيلع روكذيلا ييليفطلل ليجيست لوا ةييلاخلا ةيسارد ريبتعت و . H. aegyptium عوين نيم لوزعملا دارقلا<br />
يمج ناك<br />
.<br />
ناتسدروك ميلقا يف
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
ON DETECTIONOF FEEDBACK IN THE TIME SERIES<br />
SAMEERA ABDULSALAM OTHMAN<br />
School of Basic Education, Faculty of Educational Sciences, University of Duhok, Kurdistan Region-Iraq<br />
(Received: November 27, 2010; Accepted for publication: June 26, 2011)<br />
ABSTRACT<br />
This research has characterized is the detection of feedback between output series and input series. The<br />
importance of detective appearance of feedback when has the adequate model is known, it also has applied to some<br />
method for detecting the feedback by using two methods. The first method is testing of cross-correlation function<br />
between prewhitening to the input and output series, where it has founded cross-correlation between prewhitening of<br />
the input series ( � ) and residual series (at) .The second method is uses to F test between two series of input and<br />
t<br />
output. It is appearing that the Dynamical Regression models have no adequacy in feedback, then the Multivariate<br />
Autoregressive should be used in the case.<br />
KEYWORDS: feedback, output series, input series, residual series, Dynamic Regression<br />
T<br />
INTRODUCTION<br />
his research includes the application of<br />
some statistical technique for studying<br />
the time series of the average monthly humidity<br />
as an output series with one of the variables<br />
which affect on it, that series of the average<br />
monthly relative rainfall as an input which is<br />
measured at the meteorological station of Dohuk<br />
the techniques used are the modeled by<br />
an(ARIMA) model as well as the dynamic<br />
regression model. Relatively the dynamic<br />
regression models ( are that models take the<br />
time into account),the modeling of the dynamic<br />
regression shows how are that output result and<br />
the input and are depending on each other:<br />
1- the relation of the lag time with the input and<br />
output.<br />
2-The time composition for the turbulence<br />
series.<br />
And for getting an economic model, the<br />
relative model was identified by identifying the<br />
linear transformation function was of the degree<br />
(1,0,1), and when the values of turbulence series<br />
were examined by using autocorrelation and<br />
partial autocorrelation coefficients, it is found<br />
that all of the coefficients were insignificant and<br />
that is proved that the turbulence series is a<br />
series of random residuals, so that: Nt =at .<br />
1- THE BASIC CONCEPTS<br />
1-1 Stationary And Non Stationary Time<br />
Series:<br />
If the underlying generating process for a time<br />
series is based on a constant mean and a constant<br />
variance, then the time series is stationary. More<br />
formally, a series is stationary if its statistical<br />
properties are independent of the particular time<br />
period during time in which it is observed. And<br />
time series exhibit non stationary if the<br />
underlying generating process does not have a<br />
constant mean and a constant variance. In<br />
practice, a visual inspection of the plotted time<br />
series can help to determine if either or both of<br />
these conditions exist. And the set of<br />
autocorrelations for the time series can be used<br />
to confirm the presence of stationary or not [4]<br />
& [6].<br />
1-2 Mean Squared Error (Mse):<br />
The mean squared error is a measure of<br />
accuracy computed by squaring the error for<br />
each item in a data set and then finding the<br />
average or mean value of those squares, the<br />
mean squared error gives greater weight to large<br />
errors than to small errors because the errors are<br />
squared before being summed [4].<br />
1-3 Autocorrelation Functio (Acf):<br />
This term is used to describe the correlation<br />
between values of the same time series at<br />
different time periods. It is similar to crosscorrelation<br />
but relates the series to different time<br />
lags, thus there may be an autocorrelation for a<br />
time of lag 1, another autocorrelation for a time<br />
of lag 2, and so on. And the pattern of<br />
autocorrelations for lags 1, 2, 3,… is known as<br />
the autocorrelation function. A plot of the ACF<br />
against the lag is known as the correlogram. It is<br />
frequently used to identify whether or not<br />
seasonality is present in a given time series (and<br />
the length of that seasonality), to identify<br />
191
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
appropriate time series models for specific<br />
situations, and to determine if data are stationary<br />
or not. The autocorrelation function at lag k is<br />
defined by:<br />
E [( z t ��)( z t �k<br />
��)]<br />
�k<br />
�<br />
(1)<br />
2 2<br />
E [( z ��) ] E [( z ��)<br />
]<br />
192<br />
t t �k<br />
Where zt : Observation at time t.<br />
μ: Mean of observations.<br />
ρk: autocorrelation function of lag k<br />
[4]&[6]&[7].<br />
1-4 Partial Autocorrelation Function (Pacf):<br />
This measure of correlation is used to<br />
identify the extent of relationship between<br />
current values of a variable with earlier values of<br />
the same variable (values for various time lags)<br />
while holding the effects of all other time lags<br />
constant. Thus it is completely analogous to<br />
partial correlation but refers to a single variable.<br />
The standard formula for calculating partial<br />
autocorrelation function is:<br />
ˆ � � r<br />
ˆ �<br />
11 1<br />
k �1<br />
r � ˆ � r<br />
k k �1, j k �j<br />
kk �<br />
j �1<br />
k �1<br />
1�<br />
�<br />
�<br />
j �1<br />
ˆ �<br />
r<br />
k �1,<br />
j k<br />
(k=2, 2,3,…)<br />
ˆ � � ˆ � � ˆ � ˆ �<br />
Where k j �1 k, j � k1 k�, k k j<br />
ˆ � kk : partial autocorrelation function<br />
of lag k.<br />
rk: estimated value of ρk [4]&[7] .<br />
1-5 Autoregressive (Ar) Model:<br />
Model autoregression is a form of regression,<br />
but instead of the variable to be forecasted being<br />
related to other explanatory variables, it is<br />
related to past values of itself at varying time<br />
lags. Thus an autoregressive model would<br />
express the forecast as a function of previous<br />
values of that time series. Suppose that {at} is a<br />
purely random process with mean zero and<br />
variance σ 2 a then the process {Zt} is said to be an<br />
autoregressive process of order p, AR(p), if it<br />
satisfies the difference equation:<br />
Zt = C +� 1 Zt-1 +� 2 Zt-2 + . . .+ � pZt-p + at<br />
Where Zt: The value of time series at time t.<br />
C : Constant.<br />
� j : jth autoregressive parameter.<br />
at : White noise<br />
the necessary condition that the AR(p) be<br />
stationary is � j
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
relationship between the forecast variable and<br />
the explanatory variable is model using a<br />
transfer function. A DR model states how an<br />
output (Yt ) is linearly related to current and past<br />
value of one or more input (X1,t , X2,t , X3,t ,…) it<br />
is usually assumed that observations of the<br />
various series occur at equally spaced time<br />
intervals. While the output may be affected by<br />
the inputs, a crucial assumption is that the inputs<br />
are not affected by the outputs this means that<br />
we are limited to single equation models [6].<br />
2.2 Transfer Function<br />
For simplicity we will discuss just one input.<br />
The ideas we develop here are easily extended to<br />
multiple inputs if Yt depends on Xt in some way<br />
we may write this as<br />
Yt = f(Xt ) (2)<br />
Where f(.) is some mathematical function. The<br />
function f(.) is called a transfer function. The<br />
effect of a change in Xt is transferred to Yt in<br />
some way specified by the function f(.).In<br />
general, however, there are other factors causing<br />
variation in Yt besides changes in the specified<br />
input, we capture those other factors with an<br />
additives stochastic disturbance (Nt) that may be<br />
auto correlated . Nt represents the effects of all<br />
excluded inputs on the variability of Yt .The<br />
input – output relationship may also have an<br />
additive the constant term (C) .This is a buffer<br />
term that captures the effect of excluded inputs<br />
on the overall level of Yt , thus we are<br />
considering models of the form<br />
Yt = C + f(Xt) + Nt (3)<br />
Where Yt : is the output<br />
Xt: is the input<br />
C: is the constant term.<br />
f(Xt): is the transfer function<br />
Nt : is the stochastic disturbance which may be<br />
auto correlated<br />
Nt is assumed to be independent of Xt<br />
Input Nt<br />
output Xt → [ transfer function] → Yt<br />
[1]&[2]&[6]<br />
2-3 Impulse Response Function<br />
We can write a linearly distributed lag<br />
transfer function in back shift form by defining<br />
v(B) as<br />
v(B) = v0 + v1B + v2B 2 + v3B 3 + … (4)<br />
where B is the backshift operator defined such<br />
that<br />
B k Xt = Xt-k<br />
We can write the transfer function f(Xt) as a<br />
liner combination of current and past Xt value:<br />
Yt = f(Xt )<br />
= v0 Xt + v1 Xt-1 + v2 Xt-2 + v3 Xt-3 + … (5)<br />
Using equation (4),(5) may be rewritten as<br />
Yt = v(B) Xt (6)<br />
Equation (6) is a compact way of saying that<br />
there is a linearly distributed lag relationship<br />
between change in Xt and changes in Yt .The<br />
individual vk weights in v(B), (v0 , v1, v2, v3, … )<br />
are called the impulse response weights we can<br />
estimate that the vk weights as follows<br />
^<br />
� � ^<br />
Vk = � ( k )<br />
^ ��<br />
(7)<br />
�<br />
Where<br />
�<br />
^<br />
� ( k ) estimates the cross<br />
��<br />
correlation between �� ,<br />
^<br />
� � : standard deviation of �<br />
^<br />
� � : standard deviation of � [5]&[6]<br />
2-4 Dead Time<br />
Yt might not react immediately to a change in Xt<br />
, some initial v weights may be zero. The<br />
number of v weights equal to zero (starting with<br />
v0 ) is called dead time denoted as b, starting<br />
with v0, there is one v weight equal to zero (v0 =<br />
0), so b=1. Alternatively if v0 = v1 = v2 = 0 and<br />
v3 � 0 then b=3 [5]&[6]<br />
2-5 The Rational Distributed Lag Family<br />
The Koyck impulse response function is just one<br />
member of the family of rational polynomial<br />
distributed lag models. This family is a set of<br />
impulse response functions v(B) given by<br />
b<br />
v(B) =<br />
w ( B ) B<br />
(8)<br />
� ( B )<br />
where<br />
w(B) = w0 + w1B + w2B 2 + …+whB h (9)<br />
and<br />
2<br />
r<br />
� ( B ) �1 ��1B��2B�... � �r<br />
B (10)<br />
Where h: represents the order of (w)<br />
r: represents the order of (� )<br />
Extending this frame work to m inputs,<br />
i=1,2,…,m, is straight forward. The result may<br />
be written compactly as<br />
Yt =<br />
m<br />
�<br />
i �1<br />
v ( B ) X<br />
i i , t<br />
m<br />
bi<br />
= w i ( B ) B<br />
� X (11) [5]&[6]<br />
it ,<br />
� ( B )<br />
i �1<br />
i<br />
2-6 Building Dynamic Regression Models(Dr)<br />
A dynamic regression (DR) model with one<br />
input consists of a transfer function plus a<br />
disturbance. This may be written as<br />
Yt = c + v(B) Xt + Nt<br />
193
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
Where<br />
s<br />
�( B ) �(<br />
B)<br />
Nt =<br />
a<br />
s D d t<br />
�( B ) �( B)<br />
�s� and<br />
at : is zero mean and normally distributed white<br />
noise [3]&[5]& [6].<br />
2-7 Preparation And Prewhitening Of The<br />
Inputs And Outputs Series<br />
Rewriting this process, we may think of AR and<br />
MA operators as a filter that, when applied to<br />
Xt , produces an uncorrelated residual series<br />
�1<br />
� � � ( B ) � ( B ) X<br />
t x x t<br />
^<br />
The series � t (in practice � t ) is called the<br />
pre whitened Xt series now suppose we apply the<br />
same filter to Yt : this will produce another<br />
residual series<br />
�1<br />
� � � ( B ) � ( B ) Y [1]&[2]&[5]<br />
t x x t<br />
2-8 Identifiction<br />
A) Estimation Of The Impulse Response<br />
Weights<br />
Equation (8) shows that if we prewhiten the<br />
input, and apply the same filter to the output,<br />
then the v weights are proportion to the cross<br />
correlations of the residuals from these two<br />
filtering procedures. in practice we don’t<br />
know the parameters on the right side of<br />
equation (8). instead we substitute estimates of<br />
these parameters obtained from the data to arrive<br />
at the following estimated v weights<br />
^<br />
r ( )<br />
^ �� k � �<br />
v k � [5]<br />
^<br />
�<br />
194<br />
�<br />
b) Identifiction of (r,s,b) for the transfer<br />
function<br />
We obtain the identity<br />
v � 0<br />
j b + s<br />
j 1 j �1 2 j �2 ... r j �r<br />
C) Disturbance Series<br />
We generate an estimate of the Nt series<br />
denoted by N ^ t, the estimate disturbance series<br />
and it is computed as:<br />
N ^ t= Yt - v(B) Xt<br />
w s ( B) b<br />
= Yt - B X t<br />
�r<br />
( B )<br />
This disturbance series ( Nt ) in a dynamic<br />
regression will often be autocorrelated.<br />
�N( B ) N t � �N(<br />
B ) at<br />
where<br />
at : is zero mean and normally distributed white<br />
noise [5]<br />
2-9 Estimation<br />
At the identification stage we tentatively<br />
specify a rational from transfer function model<br />
of orders(b,r,s), and a disturbance series ARIMA<br />
model of orders (p,d,q) We identified the<br />
following DR model<br />
b<br />
w ( B ) B �N<br />
( B )<br />
Y t � X t � at<br />
(12)<br />
�( B) �N(<br />
B)<br />
At the second stage of our modeling strategy<br />
we estimate the parameters of the identified DR<br />
model using the available data. To estimate (12)<br />
we will use initial values to refer to coefficient<br />
values can often be found from identification<br />
stage information to estimate the coefficients in<br />
w(B) and � ( B ) the next step in estimation is to<br />
compute the SSR(sum of squared residuals)<br />
SSR =<br />
n<br />
�<br />
i �1<br />
a<br />
2<br />
i<br />
Is used to choose better model coefficients,<br />
by taking the minimum SSR [2]&[3]&[4]<br />
2-10 Check for feedback<br />
Serious model inadequacy can usually be<br />
detected by examining<br />
r k of the<br />
a) the autocorrelation function ^ ( ) a<br />
^<br />
residuals at from the fitted model<br />
b) certain cross correlation function are<br />
involving input and residuals: in particular the<br />
cross correlation function r ^ ( k)<br />
between<br />
�a<br />
^<br />
prewhitened input �t and the residuals a t .An<br />
important assumption in building a singleequation<br />
DR model is that there is no<br />
feedback from earlier values of the output to<br />
current values of the inputs. The possibility of<br />
feedback arises whenever the inputs<br />
are stochastic. Essentially the same results may<br />
be obtained using single-equation feedback, each<br />
input series is regressed on its own past, on the
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
past of each other input, and on the past of the<br />
output series. The following equation may be<br />
estimated to check for feedback from. The past<br />
of Yt to Xt<br />
Xt = c+ b1Xt-1 + b2Xt-2 +…+ bkXt-k + d 1y t-1 + d 2y<br />
t-2 +…+ d ky t-k + at ( 13)<br />
The estimated coefficients<br />
^<br />
d k , k=1,2,3,…K<br />
in (13) contain information about possible<br />
feedback from past values of Yt to the current<br />
values of Xt ,one way to check for feedback is<br />
to examine the individual t values of the<br />
^<br />
d coefficients. If they are all insignificant, we<br />
may conclude that there is no statistical feedback<br />
from the past of Yt to Xt , and we may include<br />
Xt as an explanatory variable in a single-equation<br />
DR model. We should not insist on a complete<br />
^<br />
lack of significant d coefficient in models like<br />
(13) we should make a reasonable allowance for<br />
sampling variation and recognize that the results<br />
from a model like(13) are only a guideline<br />
linearity can produce unreliable t values. It may<br />
also be argued that possible feedback from Yt to<br />
Xt is represented in(13) by all d ky t-k terms,<br />
k=1,2,…,K as a set, thus it is helpful to perform<br />
a joint test using the hypotheses Ho : d1 =d2<br />
=…=dk =0<br />
HA : d1 � d2 � … � dk � 0 at least two of<br />
them not equal zero<br />
This joint Ho may be tested with the<br />
following F statistic<br />
D.RH<br />
20<br />
10<br />
0<br />
-10<br />
-20<br />
-30<br />
20<br />
40<br />
( Ess1�Ess0) / k<br />
F �<br />
Rss /( n � k )<br />
1 1 1<br />
(14)<br />
Where Ess1 : is the explained sum of squares<br />
from estimating (13)<br />
Ess0 : is the explained sum of squares from<br />
estimating (13) with the lagged y<br />
K :is the maximum lag on the right side<br />
Rss1 : is the residual sum of squares , n1 : n-k<br />
n: original number of observations [1]&[6]<br />
3- APPLICATION<br />
3-1 Introduction<br />
This section contains applying some methods<br />
for detecting the feedback by using two<br />
methods. The first method is testing of crosscorrelation<br />
function between prewhitening of the<br />
input denoted by rainfall and of the output<br />
denoted by humidity (RH). We take the monthly<br />
average of the meteorological station of Dohuk<br />
for the period (1992) to (2006), all data are<br />
shown in the tables(1) in the appendix (A). The<br />
second method is it used to test F between two<br />
series of input and output by using equation (14)<br />
3-2 Detection Of The Feedback<br />
1)Detecting of the feedback by using crosscorrelation<br />
between output RH(Yt) and input<br />
rainfall (Xt). we plot the time series of it by<br />
using software of Minitab (13.2) as in<br />
figures(1),(2) respectively we show that the<br />
series is stationary in mean and variance<br />
Fig.(1):The time series plot of(RH) Fig. (2): The time series plot of rainfall<br />
We plot (Autocorrelation function) ACF for<br />
the RH and rainfall series in figures (3),(4) we<br />
show that the seasonality period (8) months.<br />
60<br />
80<br />
100<br />
D.ranfall<br />
200<br />
100<br />
0<br />
-100<br />
-200<br />
20 40 60 80 100<br />
195
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
196<br />
Autocorrelation<br />
1.0<br />
0.8<br />
0.6<br />
0.4<br />
0.2<br />
0.0<br />
-0.2<br />
-0.4<br />
-0.6<br />
-0.8<br />
-1.0<br />
5<br />
LBQLag Corr T LBQ Lag Corr T LBQ Lag Corr T<br />
Autocorrelation<br />
1<br />
2<br />
3<br />
4<br />
5<br />
6<br />
7<br />
8<br />
9<br />
1<br />
2<br />
3<br />
4<br />
5<br />
6<br />
7<br />
8<br />
9<br />
0.53<br />
0.05<br />
-0.33<br />
-0.51<br />
-0.32<br />
0.00<br />
0.44<br />
0.66<br />
0.36<br />
1.0<br />
0.8<br />
0.6<br />
0.4<br />
0.2<br />
0.0<br />
-0.2<br />
-0.4<br />
-0.6<br />
-0.8<br />
-1.0<br />
0.17<br />
-0.00<br />
-0.23<br />
-0.27<br />
-0.09<br />
0.04<br />
0.32<br />
0.21<br />
0.15<br />
5.77<br />
0.47<br />
-2.90<br />
-4.14<br />
-2.33<br />
0.01<br />
3.02<br />
4.21<br />
2.04<br />
1.80<br />
-0.05<br />
-2.40<br />
-2.71<br />
-0.87<br />
0.41<br />
3.03<br />
1.85<br />
1.31<br />
34.15<br />
34.50<br />
48.26<br />
80.45<br />
93.72<br />
93.72<br />
118.40<br />
174.27<br />
191.49<br />
3.33<br />
3.34<br />
9.68<br />
18.61<br />
19.66<br />
19.91<br />
33.04<br />
38.74<br />
41.80<br />
Autocorrelation Function for RH Yt<br />
10<br />
11<br />
12<br />
13<br />
14<br />
15<br />
16<br />
17<br />
18<br />
-0.05<br />
-0.40<br />
-0.49<br />
-0.37<br />
-0.10<br />
0.33<br />
0.55<br />
0.32<br />
-0.11<br />
-0.28<br />
-2.16<br />
-2.57<br />
-1.81<br />
-0.46<br />
1.58<br />
2.60<br />
1.43<br />
-0.48<br />
191.84<br />
212.95<br />
245.45<br />
263.59<br />
264.84<br />
279.74<br />
321.90<br />
336.26<br />
337.97<br />
20<br />
21<br />
22<br />
23<br />
24<br />
25<br />
26<br />
27<br />
Fig. (3): (Autocorrelation function) ACF for the RH<br />
Fig. (4): (Autocorrelation function) ACF for rainfall<br />
19<br />
15<br />
-0.41<br />
-0.54<br />
-0.44<br />
-0.07<br />
0.32<br />
0.52<br />
0.34<br />
-0.04<br />
-0.32<br />
-1.81<br />
-2.32<br />
-1.78<br />
-0.28<br />
1.26<br />
2.06<br />
1.28<br />
-0.16<br />
-1.21<br />
362.49<br />
405.18<br />
432.99<br />
433.72<br />
448.77<br />
490.27<br />
507.66<br />
507.94<br />
524.34<br />
Autocorrelation Function for ranfall x1<br />
Lag<br />
28<br />
29<br />
Corr<br />
-0.42<br />
-0.32<br />
We take first difference for the data as shown<br />
in the figures(5),(6) and plot ACF again for the<br />
differenced time series about rainfall and<br />
(PACF) in a figures(7),(8)<br />
25<br />
T<br />
-1.57<br />
-1.15<br />
5 15 25<br />
10<br />
11<br />
12<br />
13<br />
14<br />
15<br />
16<br />
17<br />
18<br />
-0.00<br />
-0.03<br />
-0.21<br />
-0.09<br />
-0.07<br />
0.17<br />
0.32<br />
0.15<br />
0.03<br />
-0.04<br />
-0.27<br />
-1.77<br />
-0.77<br />
-0.56<br />
1.36<br />
2.61<br />
1.14<br />
0.24<br />
41.81<br />
41.95<br />
47.86<br />
49.03<br />
49.67<br />
53.48<br />
68.08<br />
71.23<br />
71.37<br />
19<br />
20<br />
21<br />
22<br />
23<br />
24<br />
25<br />
26<br />
27<br />
-0.18<br />
-0.22<br />
-0.15<br />
0.01<br />
0.21<br />
0.16<br />
0.29<br />
0.03<br />
-0.19<br />
-1.39<br />
-1.64<br />
-1.07<br />
0.09<br />
1.51<br />
1.14<br />
2.05<br />
0.19<br />
-1.25<br />
76.27<br />
83.39<br />
86.58<br />
86.60<br />
93.20<br />
97.12<br />
110.31<br />
110.43<br />
115.80<br />
28<br />
29<br />
-0.20<br />
-0.21<br />
-1.36<br />
-1.35<br />
LBQ<br />
552.67<br />
568.79<br />
Lag Corr T LBQ Lag Corr T LBQ Lag Corr T LBQ Lag Corr T LBQ<br />
122.42<br />
129.18
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
D.RH<br />
20<br />
10<br />
0<br />
-10<br />
-20<br />
-30<br />
20<br />
40<br />
60<br />
80<br />
100<br />
Fig. (5): the plot for differenced time series of(RH) Fig. (6): the plot for differenced time series of(rainfall)<br />
Autocorrelation<br />
Partial Autocorrelation<br />
1<br />
2<br />
3<br />
4<br />
5<br />
6<br />
7<br />
8<br />
9<br />
1.0<br />
0.8<br />
0.6<br />
0.4<br />
0.2<br />
0.0<br />
-0.2<br />
-0.4<br />
-0.6<br />
-0.8<br />
-1.0<br />
-0.12<br />
0.03<br />
-0.18<br />
-0.02<br />
0.05<br />
0.07<br />
0.25<br />
-0.51<br />
0.03<br />
-1.28<br />
0.30<br />
-1.88<br />
-0.24<br />
0.49<br />
0.75<br />
2.50<br />
-4.84<br />
0.25<br />
Fig. (7): (Autocorrelation function) ACF for differenced time series of( rainfall)<br />
Fig. (8): (PACF)differenced time series of( rainfall)<br />
D.ranfall<br />
200<br />
100<br />
0<br />
-100<br />
-200<br />
20 40 60 80 100<br />
5 15 25<br />
Lag Corr T LBQ Lag Corr T LBQ Lag Corr T LBQ Lag Corr T LBQ<br />
1.0<br />
0.8<br />
0.6<br />
0.4<br />
0.2<br />
0.0<br />
-0.2<br />
-0.4<br />
-0.6<br />
-0.8<br />
-1.0<br />
Lag<br />
1<br />
2<br />
3<br />
4<br />
5<br />
6<br />
7<br />
8<br />
9<br />
PAC<br />
1.67<br />
1.77<br />
5.58<br />
5.65<br />
5.94<br />
6.60<br />
14.12<br />
45.90<br />
46.01<br />
T<br />
0.16<br />
-1.88<br />
-0.73<br />
0.46<br />
0.60<br />
2.78<br />
-5.14<br />
-0.38<br />
5<br />
10<br />
11<br />
12<br />
13<br />
14<br />
15<br />
16<br />
17<br />
18<br />
-0.06<br />
0.14<br />
-0.01<br />
0.05<br />
-0.05<br />
-0.14<br />
0.15<br />
-0.15<br />
0.00<br />
Lag<br />
-0.46<br />
1.08<br />
-0.05<br />
0.39<br />
-0.37<br />
-1.11<br />
1.19<br />
-1.12<br />
0.02<br />
PAC<br />
46.43<br />
48.76<br />
48.77<br />
49.09<br />
49.37<br />
51.99<br />
55.10<br />
57.97<br />
57.97<br />
T<br />
0.75<br />
-0.15<br />
-0.63<br />
0.29<br />
0.12<br />
1.10<br />
-1.33<br />
-2.62<br />
-0.56<br />
19<br />
20<br />
21<br />
22<br />
23<br />
24<br />
25<br />
26<br />
27<br />
Lag<br />
-0.04<br />
0.03<br />
0.03<br />
0.01<br />
0.08<br />
-0.14<br />
0.20<br />
0.05<br />
0.01<br />
15<br />
PAC<br />
-0.31<br />
0.20<br />
0.26<br />
0.08<br />
0.57<br />
-1.08<br />
1.48<br />
0.37<br />
0.06<br />
58.20<br />
58.30<br />
58.46<br />
58.48<br />
59.29<br />
62.26<br />
67.96<br />
68.35<br />
68.36<br />
T<br />
0.96<br />
-0.71<br />
0.76<br />
-0.00<br />
1.04<br />
-0.33<br />
0.66<br />
0.32<br />
-0.16<br />
Lag<br />
28<br />
0.03<br />
PAC<br />
-0.12 -1.28 10 0.07<br />
19 0.09<br />
28 0.08<br />
0.01<br />
-0.18<br />
-0.07<br />
0.04<br />
0.06<br />
0.26<br />
-0.49<br />
-0.04<br />
11<br />
12<br />
13<br />
14<br />
15<br />
16<br />
17<br />
18<br />
-0.01<br />
-0.06<br />
0.03<br />
0.01<br />
0.10<br />
-0.13<br />
-0.25<br />
-0.05<br />
20<br />
21<br />
22<br />
23<br />
24<br />
25<br />
26<br />
27<br />
-0.07<br />
0.07<br />
-0.00<br />
0.10<br />
-0.03<br />
0.06<br />
0.03<br />
-0.02<br />
0.21<br />
25<br />
T<br />
0.83<br />
68.49<br />
197
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
The figures (7) and (8) suggest that the<br />
tentative model for the differenced series is<br />
ARMA(1,1) as shown in the equation below:<br />
(1 ��B ) X � (1 � �B ) �<br />
t<br />
198<br />
t t<br />
X ��X �� � ��<br />
t t �1 t t �1<br />
� � X ��X � ��<br />
t t t �1 t �1<br />
X � � where<br />
1 1<br />
X0 = 0<br />
The researcher writes the program through<br />
the use of macro within Minitab just as program<br />
(1) in the appendix (B).we can find the results of<br />
series( � ) are the same as in the table (1).<br />
Table(1) : The values of ( � ) variable input (rainfall) with (� =0.7955)and (� =0.9142)<br />
^<br />
t<br />
^<br />
� T ^<br />
t<br />
� t ^<br />
t<br />
� t ^<br />
t<br />
� t ^<br />
t<br />
� t ^<br />
t<br />
� t<br />
1 -88.000 21 -15.491 41 20.914 61 3.090 81 13.621 101 17.454<br />
2 -166.95 22 -19.263 42 -57.810 62 0.825 82 181.321 102 -10.213<br />
3 -6.126 23 -177.78 43 45.285 63 57.945 83 -11.341 103 -110.586<br />
4 68.599 24 -199.08 44 -43.399 64 124.244 84 -14.421 104 44.623<br />
5 176.766 25 114.991 45 11.351 65 -151.397 85 19.309 105 18.369<br />
6 63.841 26 -60.162 46 -40.951 66 73.494 86 23.930 106 83.730<br />
7 -29.107 27 -12.916 47 -39.515 67 8.862 87 64.763 107 -14.519<br />
8 -158.20 28 -44.079 48 -111.860 68 21.545 88 -71.480 108 130.171<br />
9 26.933 29 -16.623 49 -71.630 69 8.559 89 38.555 109 -14.929<br />
10 -6.771 30 -13.595 50 -38.523 70 3.025 90 -110.418 110 111.542<br />
11 104.042 31 -20.304 51 -88.810 71 -35.216 91 -113.352 111 42.656<br />
12 49.465 32 183.923 52 -54.554 72 -81.143 92 43.921<br />
13 -180.41 33 -146.21 53 -52.158 73 58.409 93 5.146<br />
14 -46.325 34 52.027 54 -20.257 74 -52.560 94 -19.396<br />
15 66.593 35 -82.858 55 -18.910 75 96.214 95 58.087<br />
16 148.764 36 8.166 56 25.589 76 31.220 96 -98.705<br />
17 -48.434 37 -12.367 57 155.796 77 13.113 97 45.794<br />
18 40.497 38 25.794 58 -39.659 78 16.667 98 8.398<br />
19 -1.822 39 12.152 59 6.239 79 7.493 99 25.509<br />
20 -64.697 40 -99.762 60 21.392 80 120.885 100 -73.079<br />
by same method we can find the output series<br />
(RH) as below:<br />
(1 ��B ) Y � (1 � �B ) �<br />
t t<br />
Y ��Y � � � ��<br />
t t �1 t t �1<br />
� �Y ��Y � ��<br />
t t t �1 t �1<br />
1 1<br />
^<br />
t<br />
Y � � where<br />
Y � 0<br />
0<br />
^<br />
We can find the series ( � t ) by using program<br />
(2) in the appendix (B)
t<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
(<br />
� )<br />
^<br />
t<br />
t<br />
(<br />
� )<br />
^<br />
t<br />
Table (2): values ( � ) for output (RH)<br />
t<br />
(<br />
� )<br />
^<br />
t<br />
1 -1.0000 21 1.9371 41 11.5237 61 -2.7684 81 -0.8323 101 -4.9184<br />
2 3.8813 22 -15.411 42 12.9664 62 -4.3263 82 23.2391 102 -5.1099<br />
3 10.3663 23 -19.951 43 3.4899 63 -1.1596 83 19.1532 103 -26.2850<br />
4 -2.4781 24 -14.717 44 0.7815 64 15.3489 84 4.9863 104 -12.9377<br />
5 6.9165 25 -3.4988 45 -6.1036 65 -1.2871 85 7.7630 105 -2.4636<br />
6 4.5500 26 0.2104 46 -15.6249 66 7.6189 86 5.9149 106 -8.6388<br />
7 9.7732 27 12.2148 47 -13.9653 67 12.6012 87 14.8164 107 -18.7156<br />
8 4.5706 28 -3.5612 48 -27.6301 68 12.9740 88 1.7947 108 -1.9728<br />
9 0.5875 29 2.3354 49 -16.5764 69 11.1103 89 7.0272 109 -3.9855<br />
10 6.1281 30 6.9530 50 -13.6081 70 9.7931 90 -2.9622 110 8.5610<br />
11 -17.579 31 -1.0076 51 -12.0766 71 11.1798 91 -17.1396 111 8.4849<br />
12 -4.1614 32 15.8744 52 -12.2674 72 0.6521 92 0.2410<br />
13 -17.622 33 0.7843 53 -19.4418 73 5.7781 93 5.2203<br />
14 -0.5868 34 -0.4875 54 -6.4322 74 -8.3086 94 -7.2051<br />
15 3.8725 35 -4.8546 55 -5.6759 75 -10.0498 95 6.7771<br />
16 -3.2328 36 2.3349 56 0.0156 76 0.3585 96 -13.3729<br />
17 -4.3644 37 11.5436 57 1.2413 77 -7.6722 97 -10.0885<br />
18 -21.603 38 16.8026 58 -5.6382 78 -4.6500 98 -9.0634<br />
19 0.1602 39 15.4285 59 -7.5635 79 -7.0690 99 9.2828<br />
20 2.9644 40 7.5587 60 -6.7325 80 4.3105 100 -9.0597<br />
^<br />
^<br />
2)correlation coefficient between ( � t )and ( � t )<br />
by using equation (1) we can find the values of<br />
correlation coefficient in the table (3)<br />
t<br />
^<br />
t<br />
(<br />
� )<br />
^<br />
t<br />
t<br />
(<br />
� )<br />
Table (3): the values of correlation coefficient between ( � ) and ( � )<br />
t r �� t r �� t r �� t r ��<br />
0 0.378 6 -0.004 12 0.025 18 -0.214<br />
1 0.147 7 0.110 13 -0.011 19 -0.135<br />
2 0.068 8 -0.090 14 -0.078 20 -0.062<br />
3 0.122 9 0.038 15 -0.071 21<br />
4 0.118 10 0.148 16 -0.019 22<br />
5 0.171 11 0.048 17 -0.128 23<br />
sample crosscorrelation<br />
0.4<br />
0.3<br />
0.2<br />
0.1<br />
0.0<br />
-0.1<br />
-0.2<br />
-0.3<br />
-10 0<br />
lag<br />
10<br />
^ ^<br />
Fig.(9): correlation coefficient between ( � t ) and ( � t ) determines the dead time for input(RH).<br />
^<br />
t<br />
^<br />
t<br />
^<br />
t<br />
t<br />
(<br />
� )<br />
^<br />
t<br />
-15 0.031<br />
199
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
It is clear from the figure (9) that the dead<br />
time is (b=0) close to zero which explains<br />
��� (0) � 0 significant and all of values near to<br />
zero, we can say that there is feedback between<br />
output series (Yt) and input (Xt). We find ACF<br />
^<br />
between residual series and series ( � t ).we can<br />
clear that below<br />
200<br />
3)IDENTIFICTION<br />
1- Estimation Of The Impulse Response<br />
Weights<br />
We estimate of the impulse response weights<br />
between input (Xt ) and output series (Yt ) in the<br />
table (4) below<br />
Table (4): the values of the impulse response of input variable (rainfall Xt)<br />
t v t v t v t v<br />
0 0.0499 6 -0.0005 12 0.0033 18 -0.0282<br />
1 0.0194 7 0.0145 13 -0.0014 19 -0.0178<br />
2 0.0089 8 -0.01188 14 -0.0103 20 -0.00819<br />
3 0.0161 9 0.0050 15 -0.0093 21<br />
4 0.01558 10 0.0195 16 -0.0025 22<br />
5 0.0225 11 0.00634 17 -0.0169 23<br />
2) Identification Of (R,S,B) For The Transfer<br />
Function<br />
It is clear from the figure (9)<br />
taking one change point will continue toward<br />
itself for a few periods(s=5). It transfer to the<br />
other side thus than (r=1) .the pattern can be<br />
written as:<br />
( w �w B �w B �w B �w B �w<br />
B )<br />
Y X N<br />
2 3 4 5<br />
t � 0 1 2 3<br />
(1 ��1B<br />
)<br />
4 5<br />
t � t<br />
t Nt ^<br />
(15)<br />
4)Disturbance Series<br />
Table(5) :estimate values of disturbance series Nt<br />
t Nt ^<br />
t Nt ^<br />
We find disturbance series by using the<br />
equation<br />
N t �Y t �v 0X t �v 1X t �1�... � v 20X t �20(16)<br />
By using equation (16) we can obtain the<br />
number of disturbance series which their values<br />
less than the input and output series values(t=21)<br />
so, we can apply them in program (3) in<br />
appendix(B) the values in the table (5)<br />
t Nt ^<br />
t Nt ^<br />
1 8.3067 19 8.4527 37 1.8966 55 -17.218 73 -27.8116<br />
2 -13.3977 20 10.6442 38 11.867 56 11.4734 74 2.2931<br />
3 -20.1134 21 -6.2558 39 -10.634 57 5.6367 5 -2.0726<br />
4 0 22 -6.8021 40 6.6606 58 -7.2843 76 2.2749<br />
5 -0.3655 23 4.6793 41 14.2883 59 -2.0547 77 -6.8147<br />
6 13.8634 24 13.9806 42 -1.8847 60 -7.7965 78 14.2572<br />
7 0.8759 25 -21.235 43 -3.686 61 -2.2512 79 -5.2206<br />
8 24.6778 26 -12.021 44 -3.2112 62 8.8708 80 -3.3320<br />
9 15.1076 27 -14.395 45 0.5373 63 28.049 81 -1.8584<br />
10 1.3322 28 7.7617 46 1.8966 64 -9.6713 82 -11.5726<br />
11 15.0231 29 2.2580 47 11.867 65 -10.100 83 7.4928<br />
12 7.1083 30 -0.346 48 -12.615 66 8.5172 84 2.5678<br />
13 3.5126 31 1.6847 49 -4.1235 67 -4.315 85 -19.049<br />
14 -1.2732 32 -10.0583 50 7.4006 68 4.4084 86 -6.5645<br />
15 11.7306 33 7.6015 51 1.6043 69 6.57 87 -0.8425<br />
16 -16.373 34 2.5706 52 3.009 70 -14.985 88 5.2194<br />
17 -4.3515 35 4.4363 53 4.5073 71 -11.229 89 5.5882<br />
18 9.382 36 -7.8483 54 -5.3716 72 8.9425 90 -11.5726
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
We plot ACF and PACF from the disturbance series ( t ) , as in the figures (10) and (11)<br />
Autocorrelation Function for Nt^<br />
Autocorrelation<br />
Partial Autocorrelation<br />
Lag<br />
1.0<br />
0.8<br />
0.6<br />
0.4<br />
0.2<br />
0.0<br />
-0.2<br />
-0.4<br />
-0.6<br />
-0.8<br />
-1.0<br />
Corr<br />
It is clear from the figure(11) that the<br />
disturbance series ( t) is equal residual series<br />
Nt = at , thus the model of dynamic<br />
regression as shown in the equation below:<br />
( w �w B �w B �w B �w B �w<br />
B )<br />
Y X a<br />
2 3 4 5<br />
t � 0 1 2 3<br />
(1 ��1B<br />
)<br />
4 5<br />
t � t<br />
Fig. (10): ACF and from the disturbance series ( t )<br />
Fig. (11): PACF and from the disturbance series ( t ^ )<br />
(17)<br />
We estimate the values of the model by using<br />
equation (17)<br />
By using table(4) we find<br />
v0 = �1 v1 + w0 j =b<br />
T<br />
2<br />
LBQ<br />
Lag<br />
Corr<br />
T<br />
LBQ<br />
1 -0.02 -0.15 0.02 8 -0.32 -2.94 15.13 15 0.03 0.23 21.15 22 0.15 1.16<br />
2<br />
3<br />
4<br />
5<br />
6<br />
7<br />
-0.13<br />
0.05<br />
-0.00<br />
0.02<br />
0.13<br />
-0.10<br />
1.0<br />
0.8<br />
0.6<br />
0.4<br />
0.2<br />
0.0<br />
-0.2<br />
-0.4<br />
-0.6<br />
-0.8<br />
-1.0<br />
Lag<br />
2<br />
3<br />
4<br />
5<br />
6<br />
7<br />
-1.23<br />
0.51<br />
-0.00<br />
0.21<br />
1.22<br />
-0.88<br />
PAC<br />
-0.13<br />
0.05<br />
-0.02<br />
0.04<br />
0.13<br />
-0.09<br />
2<br />
1.60<br />
1.88<br />
1.88<br />
1.93<br />
3.63<br />
4.55<br />
T<br />
9<br />
10<br />
11<br />
12<br />
13<br />
14<br />
0.17<br />
0.01<br />
0.02<br />
0.11<br />
0.00<br />
-0.12<br />
Lag<br />
1.42<br />
0.11<br />
0.15<br />
0.89<br />
0.01<br />
-0.98<br />
PAC<br />
18.12<br />
18.14<br />
18.18<br />
19.45<br />
19.45<br />
21.06<br />
T<br />
Lag<br />
16<br />
17<br />
18<br />
19<br />
20<br />
21<br />
Lag<br />
12<br />
Corr<br />
0.03<br />
-0.12<br />
-0.01<br />
-0.05<br />
-0.06<br />
-0.04<br />
12<br />
PAC<br />
v0 = w0<br />
v1 = �1 v0 – w1<br />
v2 = �1 v1 – w2 j =b +1,…,b+s<br />
v3 = �1 v2 – w3<br />
v4 = �1 v3 – w4<br />
v5 = �1 v4 – w5<br />
v6 = �1 v5<br />
T<br />
0.25<br />
-0.98<br />
-0.08<br />
-0.43<br />
-0.48<br />
-0.32<br />
LBQ<br />
21.27<br />
22.97<br />
22.98<br />
23.32<br />
23.76<br />
23.97<br />
Partial Autocorrelation Function for Nt^<br />
1 -0.02 -0.15 8 -0.31 -2.93 15 -0.07 -0.70 22 0.11<br />
-1.23<br />
0.48<br />
-0.15<br />
0.35<br />
1.23<br />
-0.83<br />
9<br />
10<br />
11<br />
12<br />
13<br />
14<br />
0.14<br />
-0.05<br />
0.09<br />
0.10<br />
0.06<br />
-0.07<br />
1.36<br />
-0.49<br />
0.84<br />
0.95<br />
0.53<br />
-0.68<br />
16<br />
17<br />
18<br />
19<br />
20<br />
21<br />
-0.08<br />
-0.05<br />
-0.06<br />
-0.00<br />
0.02<br />
-0.08<br />
T<br />
-0.76<br />
-0.47<br />
-0.58<br />
-0.02<br />
0.17<br />
-0.72<br />
Lag<br />
Lag<br />
Corr<br />
PAC<br />
LBQ<br />
� 1 = v6 / v5 = -0.0005/0.0225 =-0.222<br />
w0 = v0 = 0.0499<br />
T<br />
T<br />
1.07<br />
26.62<br />
22<br />
22<br />
201
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
w1 = �1 v0 – v1 = (-0.222)(0.0499)- (0.0194)=<br />
-0.0304778<br />
w2 = �1 v1 – v2 = (-0.222)(0.0194)-( 0.0089)=<br />
-0.0132066<br />
w3 = �1 v2 – v3 = (-0.222)(0.0089)-( 0.0161)=<br />
-0.01808<br />
w4 = �1 v3 – v4 =(-0.222)(0.0161)-( 0.01558)=<br />
-0.01915<br />
202<br />
w5 = �1 v4 – v5 =(-0.222)(0.01558)-<br />
( 0.0225)=-0.025958<br />
Search to Minimize Sum of Squared<br />
Residuals<br />
The next step in estimation is to compute the<br />
SSR (Sum of Squared Residuals)<br />
SSR =<br />
2 3 4 5<br />
(0.0499 � 0.0305B � 0.0132066B � 0.01808B � 0.01915B � 0.02595 B )<br />
t � t � t<br />
Y X a<br />
(1� 0.222 B )<br />
^<br />
a t = Yt +0.222Yt-1 -0.0499 Xt -0.0305 Xt-1-<br />
0.0132066 Xt-2 -0.01808 Xt-3 -0.01915 Xt-4-<br />
0.02595 Xt-5-0222at-1 (18)<br />
t<br />
n<br />
�<br />
t �1<br />
a<br />
2<br />
t<br />
Table (6): the values of series ( a )<br />
^<br />
We find the values of series ( a t ) by using<br />
equation (18) and program (4) in appendix (B),<br />
The value as in the table(6)<br />
^<br />
a t ^<br />
t<br />
a t ^<br />
t<br />
a t ^<br />
t<br />
a t ^<br />
t<br />
a T ^<br />
t<br />
a t<br />
1 0.0000 20 -0.9160 39 -3.3955 59 1.1386 78 14.6687 97 -1.4370<br />
2 0.7422 21 1.6774 40 -8.4087 60 13.2296 79 2.0145 98 -4.4783<br />
3 9.5889 22 5.2860 41 -17.9861 61 1.9000 80 1.8387 99 -20.4011<br />
4 4.9520 23 19.1778 42 -11.8717 62 8.1710 81 1.2348 100 -8.0027<br />
5 -3.4498 24 1.2919 43 -23.2960 63 9.5838 82 7.7183 101 2.3374<br />
6 0.9387 25 5.5449 44 -8.0296 64 10.0785 83 0.3255 102 -6.7431<br />
7 -21.9821 26 5.3637 45 -6.5819 65 6.9647 84 4.0698 103 -14.3211<br />
8 -5.2100 27 0.0144 46 -2.2575 66 8.3027 85 -4.2324 104 1.3423<br />
9 -9.8956 28 9.9616 47 -2.6486 67 6.7636 86 -14.4481 105 -2.1231<br />
10 4.5466 29 0.5953 48 -9.9744 68 -0.7813 87 -0.0109 106 9.6593<br />
11 3.3031 30 -1.6047 49 2.2018 69 1.2307 88 5.9083 107 6.6924<br />
12 -8.3265 31 -6.0637 50 1.4054 70 -11.0673 89 -6.6499<br />
13 -2.3224 32 2.3747 51 5.6577 71 -13.1957 90 7.5821<br />
14 -17.5623 33 8.6837 52 0.3474 72 -1.6501 91 -11.2824<br />
15 2.1247 34 16.8753 53 -3.4559 73 -7.6427 92 -10.1545<br />
16 6.3294 35 10.2357 54 -4.2761 74 -5.8736 93 -8.6454<br />
17 3.7500 36 6.8976 56 -5.5386 75 -6.2127 94 11.4132<br />
18 -12.1944 37 6.9511 57 -1.1261 76 0.7505 95 -6.8504<br />
19 -11.5427 38 8.7745 58 -3.1218 77 -1.9606 96 14.6687<br />
We plot cross correlation between series (<br />
^<br />
^<br />
� t ) and series ( a t ) as in the figure (12), it is<br />
clear that there are significant values, this means<br />
^<br />
t<br />
that the correlation between two series (<br />
^<br />
� t )<br />
^<br />
and series ( a t ) is significant, then the building<br />
(DR) models impossible.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
sample crosscorrelation_1<br />
Fig. (12): cross correlation between series ( � ) and series ( a )<br />
Check For Feedback By Using F Test<br />
The maximum lag k in model (16) K= 15,we<br />
estimate this equation to check for feedback<br />
Table (7): The estimated values of the ck coefficients with t values<br />
^<br />
t<br />
Xt = c+ b1Xt-1 + b2Xt-2 +…+ b15Xt-15 + c 1y t-1 +<br />
c 2y t-2 +…+ c 15y t-15 + at<br />
The estimated values of the c ^ coefficients are<br />
shown in the table (7)<br />
k 1 2 3 4 5<br />
c ^<br />
k -2.260 2.798 -1.479 -1.243 2.906<br />
t -2.09 2.41 -1.23 -1.08 2.58<br />
k 6 7 8 9 10<br />
c ^ k -0.760 -1.511 -0.2837 -1.687 1.862<br />
t -0.65 -1.36 -0.29 -1.54 1.67<br />
k 11 12 13 14 15<br />
c ^ k -0.015 -1.476 3.480 -2.327 -0.719<br />
t -0.01 -1.31 2.99 -1.93 -0.65<br />
F = ((314620 -218133)/15)/(511669/80)<br />
= 1.0057<br />
We see that the value of (F) by using<br />
equation (14) is significant if we in contrast with<br />
the value of (table F=3.46) at the 5% level<br />
for(15,80) degrees of freedom we have evidence<br />
that there is important feedback from the output<br />
and in the input.<br />
Conclusion<br />
1)To detection of feedback by using cross –<br />
correlation function between two series input<br />
and output has been found significant in some<br />
lag .Although the dead time is (b=0) close to<br />
zero which explains ��� (0) � 0 which is<br />
significant, too and all of values near to zero, is<br />
said to be a feedback between output series (Yt)<br />
and input (Xt).<br />
0.3<br />
0.2<br />
0.1<br />
0.0<br />
-0.1<br />
-0.2<br />
-10<br />
0<br />
lag<br />
10<br />
^<br />
t<br />
0.026<br />
2)After using cross- correlation between series (<br />
^<br />
^<br />
� t ) and series ( a t ) , it is clear that there are<br />
significant values, which mean that the<br />
^<br />
correlation between the two series ( � t ) and<br />
^<br />
series ( a t ) is significant, then the building (DR)<br />
models is impossible, therefore, we use<br />
Multivariate Autoregressive model.<br />
3)To check feedback is to examine the<br />
individual t values of the c ^ k coefficients. If they<br />
are all insignificant, we may conclude that there<br />
is no statistical feedback. This is clear when we<br />
find the F test.<br />
-15<br />
203
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
REFERENCES<br />
- Box, G.E.P., and Jenkins, G.M. (1976). Time Series<br />
Analysis. Forecasting and Control, Holden- Day,<br />
San Francisco.<br />
- Liu, L. - M. (1994). Forecasting and Time Series Analysis<br />
Using the SCA Statistical System, Scientific<br />
computing Associates, U.S.A.<br />
- Liu, L. –M. (2006).Time Series Analysis and<br />
Forecasting. 2 nd edit, Scientific computing<br />
Associates U. S. A.<br />
204<br />
- Makridakis, S, Wheelwright, S. C. and Hyndman, R.<br />
(1998). Forecasting methods and Applications,<br />
Wiley, New York.<br />
- Pankratz, A. (1983). Forecasting with Univariate Box-<br />
Jenkins Model.Concepts and cases, John Wiley &<br />
sons INC. New York.<br />
- ���� (1991). Forecasting with Dynamic Regression<br />
Model, John Wiley & sons INC. , New York.<br />
- Wei, W.W.S. (1990). “Time Series Analysis- Univariate<br />
and Multivariate Method”.,Addison –Wesley<br />
publishing company,Inc., The Advanced book<br />
program, California,USA.<br />
Appendix (A)<br />
monthly average of the humidity and rainfall of the meteorological station of Dohuk for the period (1992) to<br />
(2006)<br />
year month humidity rainfall year month RH rainfall year month RH rainfall<br />
1992 Oct. 72 164.0 1997 Oct. 67 53.0 2002 Oct. 69 103.8<br />
Nov. 69 234.7 Nov. 60 133.7 Nov. 54 48.0<br />
Des. 60 32.8 Des. 64 82.0 Des. 52 186.8<br />
Jan. 63 18.2 Jan. 61 74.5 Jan. 59 72.1<br />
Feb. 47 19.8 Feb. 55 0.5 Feb. 33 4.3<br />
Mar. 42 0.0 Mar. 56 39.1 Mar. 40 16.1<br />
Apr. 52 159.9 Apr. 60 33.0 Apr. 50 23.7<br />
May. 66 198.4 May. 75 108.8 May. 75 204.9<br />
1993 Oct. 71 76.0 1998 Oct. 74 86.6 2003 Oct. 69 96.8<br />
Nov. 73 78.2 Nov. 68 83.5 Nov. 78 211.3<br />
Des. 70 54.8 Des. 62 140.2 Des. 69 139.6<br />
Jan. 59 109.9 Jan. 57 36.0 Jan. 60 30.5<br />
Feb. 53 206.8 Feb. 45 20.9 Feb. 37 3.7<br />
Mar. 45 51.0 Mar. 38 4.0 Mar. 42 21.9<br />
Apr. 60 113.0 Apr. 46 3.0 Apr. 61 71.2<br />
May. 68 29.5 May. 49 9.2 May. 72 112.0<br />
1994 Oct. 69 113.2 1999 Oct. 62 38.0 2004 Oct. 72 126.8<br />
Nov. 77 76.4 Nov. 60 71.8 Nov. 71 89.5<br />
Des. 50 163.6 Des. 56 77.3 Des. 49 30.3<br />
Jan. 55 150.8 Jan. 51 12.6 Jan. 60 91.1<br />
Feb. 36 13.7 Feb. 32 0.0 Feb. 42 16.9<br />
Mar. 47 16.0 Mar. 39 14.8 Mar. 34 8.3<br />
Apr. 66 194.1 Apr. 47 11.2 Apr. 68 136.2<br />
May. 66 181.9 May. 55 58.6 May. 58 11.9<br />
1995 Oct. 66 50.0 2000 Oct. 68 209.7 2005 Oct. 63 183.2<br />
Nov. 57 110.9 Nov. 58 26.3 Nov. 64 100.9<br />
Des. 54 152.2 Des. 52 83.6 Des. 61 57.2<br />
Jan. 61 78.7 Jan. 48 33.3 Jan. 52 16.1<br />
Feb. 40 0.0 Feb. 33 0.0 Feb. 39 41.5<br />
Mar. 33 0.0 Mar. 38 12.8 Mar. 31 1.7<br />
Apr. 49 21.2 Apr. 49 66.8 Apr. 44 29.7<br />
May. 56 7.8 May. 73 174.1 May. 50 72.9<br />
1996 Oct. 68 208.5 2001 Oct. 67 36.6 2006 Oct. 66 209.3<br />
Nov. 62 71.7 Nov. 66 100.5 Nov. 60 188.6<br />
Des. 70 163.1 Des. 64 84.3 Des. 47 35.9<br />
Jan. 59 55.1 Jan. 59 47.3 Jan. 56 142.6<br />
Feb. 44 4.9 Feb. 41 0.0 Feb. 40 8.2<br />
Mar. 41 5.5 Mar. 44 8.0 Mar. 44 100.4<br />
Apr. 48 17.7 Apr. 56 25.0 Apr. 55 48.9<br />
May. 72 207.5 May. 69 91.9 May. 103.8
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
Appendix (B)<br />
The software Minitab(13.2) is used in the following macro programs.<br />
Program (1): the values of ( � ) variable input (rainfall)<br />
^<br />
t<br />
gmacro<br />
aa.macro<br />
let c4(1)=-88<br />
do k3=2:111<br />
let c4(k3)=c2(k3)- 0.7955*c2(k3-1)+ 0.9142*c4(k3-1)<br />
enddo<br />
endmacro<br />
Program (2): values ( � ) for output (RH)<br />
^<br />
t<br />
gmacro<br />
aa.macro<br />
let c5(1)=-1<br />
do k3=2:111<br />
let c5(k3)=c1(k3)- 0.7955*c1(k3-1)+ 0.9142*c4(k3-1)<br />
enddo<br />
endmacro<br />
Program (3): estimate values of disturbance series Nt by using matlab program<br />
For i=1:111<br />
For k=1:21<br />
Z(I,k)= v(k)*ul(i+21)-k);<br />
end;<br />
end<br />
for i=1:111<br />
s(i)=0;<br />
for j=1:21<br />
s(i)=s(i)-z(i,j);<br />
end<br />
end<br />
for i=22:111<br />
n(i)=y(i)+s(i-20)<br />
end<br />
program (4): the values of series ( a )<br />
^<br />
t<br />
gmacro<br />
aa.macro<br />
let c3(5)=0<br />
do k1=6:111<br />
let c3(k1)=c1(k1)+ 0.222*c1(k1-1)- 0.0499*c2(k1)-0.0304778*c2(k1-1)-<br />
0.0132066*c2(k1-2)- 0.01808*c2(k1-3)-0.01915*c2(k1-4)- 0.025958*c2(k1-5)-<br />
0.222*c3(k1-1)<br />
enddo<br />
let k4=sum(c3(k1)**2)<br />
print k4<br />
endmacro<br />
205
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 191-206, 2011<br />
تةكد اي وخ ايتاهد ايرنجشو ادسكزةد ايرنجش ازةبظاند ةناوةضَيث انادَيث وك ةي ادَ ىدنةض َىود َىنيلَوكةظ َىظ ايطنسط<br />
ينَيَيز انسك ةصيتكاسث<br />
206<br />
^ . ) at<br />
Dynamic<br />
)<br />
ةتخوث<br />
. ةيانجوط َىي ةنوونم ناريك ينناصب اد ةياد َىدنةض َىود ةناوةضَيث انادَيث َىظ انسك ايوخ ايطنسطو<br />
^<br />
( نايامازةب ايرنجشو ) �t<br />
َىوونم وك ووباسكشائو ازادسكسلةدو<br />
: نانيئ زاكب ةنَيهد َىز ود وك تةكدزايد<br />
ةناوةضَيث انادَيث انسكايوخ<br />
( ايرنجش ايتاهاد ازةبظاند ) cross-correlation function(<br />
ذ تَيهدكَيث َىكَيئ اكَيز<br />
ايتاهاد ازةنظاند<br />
) F(<br />
انسكيقات انانيئزاكبذ تَيهدكَيث َىوود اكَيز<br />
multivariate Autoregressive ( َىنوونم َىدنه زةبذ تيبةه ةناوةضَيث انادَيث زةطةئ ةنين نايش وةئ<br />
صنانيئزاكب ةتَيوب<br />
Dynamic Regression<br />
فشكلا ةيمها زربت ثيح تلاخدم ةلسلسو تاجرخم ةلسلس نيب ةيسكعلا ةيذغتلا<br />
نع<br />
مادختساب ةيسكعلا ةيذغتلا نع فشكلا<br />
داجيا مت<br />
ثيح ةاقنملا تاجرخملاو<br />
Regression<br />
َىنوونم تيبانو نانيئزاكب ةتََيهد<br />
ةصلاخلا<br />
فشكلاب ثحبلا اذه زيمتي<br />
قئارط قيبطت تلوانت كلذك مئلاملا جذومنلا ةفرعم يف ةيسكعلا ةيذغتلا نع<br />
: نيتقيرط<br />
تلاخدملا يتلسلس نيب عطاقتملا طابترلاا ةلاد رايتخا يه ىلولاا ةقيرطلا<br />
^<br />
^<br />
رابتخا مادختسا يه ةيناثلا ةقيرطلا اما . ) at<br />
( يقاوبلا ةلسلسو ) �t<br />
( ةاقنملا تلاخدملا ةلسلس نيب عطاقتملا طابترلاا<br />
دوج و ةلاح يف ةءافكلا كلتميلا<br />
يكرحلا رادحنلاا جذومن ناب رهظ دقو تاجرخملاو تلاخدملا نيتلسلس نيب ) F (<br />
.<br />
يكرح ردحنا جذومن ماردختسا زوجي لاو تاربغملا ددعنملا<br />
يتاذلا رادحنلاا جذومن مادختسا<br />
متيف ةيسكع ةيذغت
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
THE SINGULARITY OF M-CONNECTED GRAPH<br />
PAYMAN A.RASHED<br />
Dept. of Mathematics, College of Basic Education, University of Salahaddin, Kurdistan Region-Iraq<br />
(Received: November 28, 2010; Accepted for publication: May 8, 2011)<br />
ABSTRACT<br />
In this paper we construct a new m-connected graph by the operation joins of two special graphs and the idea of<br />
the high-zero sum weighting of vertices is generalized and applied to find the singularity (nullity) of the news mconnected<br />
graphs, the new graph constructed by join path with itself and path with cycle of deferent orders, thus<br />
some properties are studies of the new m-connected graph and proved that the singularity of a new m-connected<br />
graph is the number of non zero distinct independent variables in any of it’s high-zero sum weightings, our goad is to<br />
characterizing the singularity of the new m-connected graphs (Pn � Pk) , (Pn � Ck) and special cases by the new<br />
technique of zero sum weighting which studied by cvetkovic and others in [7] and M.Brown in[6].<br />
KEYWORDS: - Graphs, Connectedness, m-connected graphs, Singularity<br />
M<br />
1-INTRODUCTION<br />
ost of the following concepts are found<br />
in [1,5,6,7] and [8], in mathematics<br />
and computer science , connectivity is one of the<br />
basic concepts of graph theory. It is closely<br />
related to the theory of network flow problems.<br />
The connectivity of a graph together with a zero<br />
eigenvalue of a connected graph is an important<br />
measures of it’s robustness as a network.<br />
The connectivity (or vertex connectivity)<br />
m(G) of a connected graph G (other than a<br />
complete graph) is the minimum number of<br />
vertices whose removal disconnects G. a graph<br />
G is said to be m-connected if there does not<br />
exist a set of m-1 vertices whose removal<br />
disconnects the graph, i.e, the vertex<br />
connectivity of G is ≥ k (11, P.177)<br />
A vertex weighting of graph G is a function,<br />
f : V(<br />
G)<br />
� R.<br />
Where R is the set of real numbers.<br />
A weighting of G is said to be non-trivial if there<br />
is at least one vertex v, v�V (G)<br />
for<br />
which f ( v)<br />
� 0 .<br />
The neighborhood of a vertex v in a graph G<br />
is the set of all vertices w such that v is adjacent<br />
with w, N(v,G) denotes it.<br />
A non-trivial vertex weighting of a graph G is<br />
called a zero sum weighting provided that, for<br />
v� V (G)<br />
, � f (w)<br />
� 0<br />
Each<br />
. Where the summation<br />
is taken over all w, w� N(<br />
v,<br />
G)<br />
.<br />
In [6] M.Brown and others uses a new<br />
technique introducing a vertex weighting of a<br />
graph in order to characterize the singularity of a<br />
graph it is not that every graph has a non-trivial<br />
zero sum weighting because the graph Kp is<br />
such graphs. [10] K.Rasho an Rashid [6]<br />
M.Brown and other characterized singular graph<br />
by the next theorem.<br />
Theorem 1-1:<br />
A graph G is singular if and only if there is a<br />
non-trivial zero sum weighting (if zero is an<br />
eigenvalue of the adjacent matrix of G) for G.<br />
And this is a very applicable technique to<br />
characterize whether a graph is singular or not. It<br />
was proved by Th.1of [3] that a graph G is<br />
singular if and only if ( 0� S p ( G),<br />
S p ( G)<br />
is the<br />
spectra of a graph G. the set of all eigenvalues of<br />
the adjacency matrix A(G) ) .[1,P.168] then the<br />
multiplicity of zero is characterized by<br />
generalizing the above new technique, which<br />
does not includes the solution of the<br />
characteristic polynomial det( A � � I)<br />
� 0 of a<br />
graph. If G be a singular graph, then by Th.1-3<br />
of [10], G possesses a non-trivial zero sum<br />
weighting, which leads to the existence of at<br />
least a non-zero weighted vertex (v1) with non<br />
zero-weight x1, f ( v1)<br />
� x1<br />
� 0is<br />
a zero sum<br />
weighting for G [9] .<br />
And the set of all non-zero sum weighting of<br />
G is denoted by W(G) and denote Mv(G) to be<br />
the maximum number of non-zero distinct<br />
independent variables that can be used for a zero<br />
sum weighting of G.<br />
Lemma 1.2:<br />
0 � M G P<br />
For a graph G of order P,<br />
v ( ) �<br />
the<br />
left equality holds if and only if G is nonsingular,<br />
and the right holds if and only if G has<br />
no edges.<br />
Note: In this paper we denote the singularity<br />
of m-connected graph by � m (G) and � m<br />
(G)=Mv(G)<br />
207
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
208<br />
2-GENERALIZATION<br />
A graph G is said to be m-connected if there<br />
does not exist a set of m-1 vertices whose<br />
removal disconnects the graph, [2] and [11]. The<br />
connectivity m(G) of G is the maximum value<br />
of m for which G is m-connected. Thus, for non<br />
trivial graph G ,<br />
m(G)=min{ P( u,<br />
v)<br />
: u,<br />
v�<br />
V,<br />
u � v},<br />
P(u,v) is<br />
path between two distinct vertices u and v.<br />
We construct a new m-connected graphs<br />
(G1,G2,G3,G4) by the operation joins � of two<br />
special graphs P � Pn<br />
, P � Pn<br />
, Pn<br />
� P and<br />
2 3<br />
k<br />
(G * ,G ** ,G *** ) by the operation join between<br />
C � P C � P , C � P<br />
, 4<br />
cycle and path 3 n<br />
n k n<br />
respectively. By the new technique of zero sum<br />
weighting of vertices of the graph which used in<br />
[7],[8] and [10].<br />
We need more methods to generate graphs,<br />
we present the important operation in a graph.<br />
Definition 2-1: The Complete Product join<br />
G1 � G2 of graphs G1 and G2 is the graph<br />
obtained from G1 & G2 by joining every vertex<br />
of G1 with every vertex of G2.<br />
i.e. V(G1 � G2) = V(G1) � V(G2)<br />
E(G1 � G2) = E(G1) E(G2) � {uv : u� G1 and v� G2}<br />
We illustrate G3 � C4 in figure (1)<br />
C3<br />
C4<br />
Path Graph Pn<br />
The path graph Pn with order n has size n-1. It<br />
has two vertices with degree 1 and n-2 vertices<br />
with degree 2.<br />
Theorem 2-2: [10] if Pn is a path graph, then<br />
( 1�<br />
( �1)<br />
)<br />
� m( Pn<br />
) �<br />
2<br />
n<br />
Fig (1)<br />
C � C<br />
i.e. Path graph Pn is singular iff n is odd.<br />
In this case � m ( Pn<br />
) �1<br />
Suppose that the vertices 0f Pn are labeled v1,<br />
v2, … , vn in natural order starting from a vertex<br />
v1 of degree 1.Then for n≥3 a minimum zero<br />
sum weighting has non-zero weights,<br />
f(vi) = -f(vi+2) = 0 , i � 1 mod 4<br />
3<br />
4<br />
Theorem 2-3<br />
� (P2 � P2) = 0<br />
m<br />
the proof is omitted since P2 � P2 = K4 and<br />
K4 is complete graph of order 4 which is not<br />
singular graph.[5]and[9], as shown in fig(2).<br />
Theorem 2-4<br />
Let n P P G � � 1 2 ( Pn is a path with n<br />
vertices)<br />
�1 � m (P2 � Pn) = �<br />
�0<br />
iff n �1<br />
� 0<br />
otherwise<br />
mod 4<br />
Proof: Suppose that G1 = P2 � Pn<br />
Let v1, v2 be the vertices of P2<br />
and u1, u2, … , un be the vertices of the path Pn<br />
for each vertex in (P2 � Pn), let f(v1) and f(v2)<br />
be the weight of vertices of P2 , and f(ui) be the<br />
weight of ui in Pn for i = 1, … , n<br />
To apply the zero sum weighting of the graph<br />
G1 to be singular we must prove that<br />
f ( w ) � 0 for each vertex v in G<br />
�<br />
wi�N<br />
( v)<br />
i<br />
Fig (2)<br />
The distinct independent variables used for<br />
weighting the vertices ui is of the form x1,0,-x1,0,<br />
x1,… , 0,-x and f(vi) = 0 for i=1,2, that shown in<br />
Fig (3)<br />
f(v1) f(v2)<br />
f(u1) f(u2) f(u3) f(un-1) f(un)<br />
x1 0 -x 0 -x<br />
Fig (3): The zero sum weighting for G = P2� Fig (3): The zero sum weighting for G = P2<br />
Pn<br />
� Pn<br />
1) If n+1 � 0 mod 4, then f(un) must be –x and<br />
this posses the zero sum weighting, Then a high<br />
zero-sum weighting for G1 exists. that uses only<br />
one independent variable. then � m (G)=1<br />
2) If n+1≠0 mod 4, f(un) may be 0 or x in this<br />
case a non trivial the zero sum weighting for G1<br />
does not exist Then the singularity be zero.<br />
i.e. � m (G1)=0
Pn<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
Theorem 2-5<br />
�<br />
�2 � P ) � �<br />
�1<br />
iff n � 1 � 0 mod 4<br />
otherwise<br />
P P G � � 2 3<br />
P by 1 , v2,<br />
v3<br />
P by n u u u u ,...., , , 1 2 3 .<br />
m(<br />
P3 n<br />
Proof: Let n<br />
Labeled the vertices of 3<br />
v and<br />
the Vertices of n<br />
For each vertex v in G2,f(v) is the weight of v<br />
Such that f ( v1<br />
) � x1,<br />
f ( v2)<br />
� � , f ( v3)<br />
� �x<br />
and the<br />
1<br />
Weights of the other vertices of G be of the<br />
form x2, �, � x2,<br />
�,<br />
x2,.....<br />
, then to apply the<br />
condition<br />
�� f ( w)<br />
� 0 for each vertex in the<br />
w N ( v)<br />
graph G2 we have two case :<br />
i) If n+1 � 0mod4 (i.e n=3,7,11,….) as shown<br />
in fig(4)<br />
X2<br />
P3<br />
Fig (4)<br />
The neighborhood of each vi , i �1,<br />
2,<br />
3<br />
contains n+1mod4 vertices i.e. (3,7,11,…) and<br />
f ( w ) � x ��<br />
� x ��<br />
� ...... � 0 , then posses<br />
�<br />
w j�<br />
f ( vi<br />
)<br />
j<br />
2<br />
2<br />
the zero sum weighting and the high zero-sum<br />
weighting for G2 exists.<br />
And the number of non-zero distinct<br />
independent variables used to obtain the zero<br />
sum weighting for a m-connected graph G2 are<br />
x1 and x2<br />
We get � m(<br />
G2)<br />
� 2<br />
ii) If n �1�<br />
0mod<br />
4 (i.e n=2,4,5,6,…<br />
Then the weight of u n which is in the<br />
neighborhood of i v is � or x2<br />
f ( un)<br />
� 0 if n is even and<br />
odd (Note n �1�<br />
0mod<br />
4)<br />
f ( un)<br />
� x2<br />
if n is<br />
Case 1: if f ( u ) � 0 if n is even<br />
�<br />
wi<br />
�N<br />
( un<br />
)<br />
X<br />
1<br />
n<br />
f ( w ) � x ��<br />
� x � x � ...... � 0<br />
i<br />
ο<br />
1<br />
ο<br />
-x2<br />
1<br />
-X1<br />
2<br />
ο .............<br />
-x2<br />
or ο<br />
or x2<br />
� � x � x<br />
2<br />
0 and 2<br />
� 0<br />
Then the high zero sum weighting for G<br />
exists which uses only one variable x1 , so<br />
� ( G)<br />
� 1<br />
m<br />
Case 2: if f ( un)<br />
� x2<br />
if n is odd<br />
f ( w ) � x ��<br />
� x ��<br />
� x ........ � 0 to satisfy<br />
�<br />
wj�N<br />
( vi<br />
)<br />
j<br />
2<br />
2<br />
the zero sum weighting<br />
� x 2 � 0,<br />
then the high zero sum weighting<br />
exist of G2 and we get<br />
�� m ( G)<br />
� 1 Since use only one variable<br />
In general if two m-connected graph<br />
G 3 and G4<br />
, where G3 � ( P2<br />
n�1<br />
� P2<br />
n�1)<br />
and<br />
G � ( P � P ) we have the Following results<br />
4 n m<br />
about 3 G and G 4<br />
Theorem 2-6<br />
Singularity of the m-connected graph<br />
3 2 �1 2 �1<br />
� � G P n P n equal to 2 if and only if<br />
2n+2 � 0mod4<br />
Proof: Let the weights of the vertices of 3 G<br />
be of the form as shown in figure(5)<br />
X1<br />
X2<br />
Fig (5)<br />
To apply the condition ��<br />
2<br />
wi<br />
N ( ui<br />
)<br />
f ( w ) � 0 and since<br />
the order of P 2n�1 has odd subscribed of n<br />
Such that f ( u1<br />
) � x1,<br />
f ( u2)<br />
� 0,<br />
f ( u3)<br />
� �x3<br />
and so on, then<br />
f w ) � x � � x ��<br />
� x ��<br />
� x ........ � 0<br />
�<br />
( i 2 � 2<br />
�<br />
2<br />
wi�N<br />
( ui<br />
)<br />
�<br />
And f y ) � x ��<br />
� x ��<br />
� x ��<br />
� x � .... � 0<br />
( i 1 1 1 1<br />
yi�N<br />
( vi<br />
)<br />
It shown that we are used exactly 2 non-zero<br />
distinct independent variables to obtain a high zero<br />
sum weighting of the m-connected graph G 3<br />
And we get � ( G3)<br />
� 2<br />
Proposition 2-7<br />
( 3) 0 � G � if n is even<br />
m<br />
ο<br />
ο<br />
m<br />
-<br />
x1<br />
-x2<br />
i<br />
209
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
Proof: it is obvious since f ( v ) � 0 and<br />
( x v f n �<br />
210<br />
1 1 ) � � so<br />
��<br />
w N ( v )<br />
i<br />
f ( w ) � 0 which is not<br />
posses The zero sum weighting, and G3 has no highzero<br />
sum weighting.<br />
Theorem 2-8<br />
The singularity of the m-connected graph<br />
G4 � ( Pn<br />
� Pk<br />
) is defined as follow<br />
i)<br />
�m<br />
( G4)<br />
� 2 if both ( n,<br />
k)<br />
�1<br />
� 0mod<br />
4<br />
ii)<br />
�m<br />
( G4)<br />
� 1 if n �1<br />
� 0mod<br />
4 or k �1<br />
� 0mod<br />
4<br />
iii)<br />
�m<br />
( G4)<br />
� 0 otherwise<br />
Proof:<br />
Case i: since n+1=0 mod 4 and<br />
k+1=0 mod 4, so the weights of the<br />
vertices of Pn and Pk are of the form<br />
i<br />
x1, o,<br />
� x1,<br />
o,.......<br />
and x2,<br />
o,<br />
�x2,<br />
o,.....<br />
respectively and the condition<br />
f ( w ) � 0 is hold for each ui �G4 � Pn<br />
� Pk<br />
�<br />
wi�N<br />
( ui<br />
)<br />
i<br />
Which implies that G4 posses the zero sum<br />
weighting and has a high zero sum weighting which<br />
uses only two non-zero distinct independent variables<br />
x1 and x2 (shown in Fig (6)).<br />
Pk<br />
Pn<br />
Fig (6): High zero-sum weighting of G4=Pn<br />
So we get ( 4 ) 2 � G � m<br />
Case ii: If n+1 � 0 mod 4 , then the only variable<br />
f ( w ) � 0 and take<br />
used is x1 and to apply<br />
��<br />
w N ( u )<br />
f ( uk<br />
) � 0 (the weights of last vertex) Since<br />
where n+1 � 0 mod 4 → n=3,7,11,.... ,<br />
f ( v1<br />
) � x2<br />
� o � x2<br />
� o � x2<br />
�.....<br />
� x2<br />
by the<br />
subscribed of K which equal to 5,9,13,…<br />
� x1 � x2<br />
Since f(v1)=x1<br />
In the same way<br />
if n �1 � 0mod<br />
4<br />
Then<br />
, k �1<br />
� 0mod<br />
4<br />
f ( u ) � x � o � ( �x<br />
) � o � x � .... � x<br />
1<br />
� x<br />
2<br />
f(v1)<br />
X2<br />
X<br />
1<br />
1<br />
� x<br />
1<br />
o<br />
o<br />
sin ce<br />
1<br />
-<br />
x1<br />
-<br />
x2<br />
1<br />
o<br />
o<br />
i<br />
1<br />
f ( u ) � x<br />
i<br />
2<br />
i<br />
i<br />
1<br />
n<br />
f(uk)<br />
Then G4 has a high zero sum weighting<br />
which used exactly one variable x for weights of<br />
vertices of G4 to obtain the zero sums weighting<br />
for the graph G4.<br />
�� m(<br />
G4)<br />
�1<br />
Case iii: If ( n , m)<br />
�1<br />
� 0mod<br />
4<br />
Then ( v ) � 0<br />
f i or x1 in Pn<br />
f ( ui<br />
) � or x2 in Pk<br />
And 0<br />
And we can not have the zero sum weighting<br />
in any way<br />
( 4) 0 � � � m G<br />
Theorem 2-9<br />
If G5 � Pn<br />
� Pk<br />
where Pn & P k are path of<br />
order n,k respectively , n and k are odd , then<br />
� ( G ) � 2 if both ( n,<br />
k)<br />
�1<br />
� 0mod<br />
4<br />
m<br />
� ( G ) � 1<br />
m<br />
� ( G ) � 0<br />
m<br />
5<br />
5<br />
5<br />
if<br />
n �1<br />
� 0mod<br />
4<br />
otherwise<br />
or<br />
k �1<br />
� 0mod<br />
4<br />
Proof<br />
i) It is obvious and similar as in Th.2-8<br />
( 5) 2 � G � , shown in figure (7).<br />
m<br />
Pm<br />
Fig(7)<br />
f ( vn)<br />
� 0 or � x<br />
And<br />
f ( w ) � x � 0 � ( �x<br />
) � 0 � x � ........ � 0 or x<br />
ii) If n+1 � 0mod4, then 1<br />
�<br />
Pn<br />
X2<br />
wi�N<br />
( vn<br />
)<br />
i<br />
2<br />
2<br />
Since k �1<br />
� 0mod<br />
4<br />
Then x 2 � 0 to apply zero sum weighting<br />
( 5) 1 �<br />
� � m G<br />
In the same way if k+1=0mod4 and n is not<br />
in case three<br />
iii) If ( n , k)<br />
�1<br />
� 0mod<br />
4<br />
Does not posses the zero sum weighting the<br />
high zero sum weighting of G2 is zero<br />
� � ( G)<br />
� 0<br />
m<br />
X<br />
1<br />
O<br />
o<br />
-x1<br />
-<br />
x2<br />
o<br />
..................<br />
............<br />
2<br />
2<br />
o
X<br />
1<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
3- SINGULARITY OF M-CONNECTED<br />
GRAPH CK � PN<br />
Cycle graph: Is a simple graph whose vertices<br />
can be arranged in a cyclic sequence in such<br />
away that two vertices are adjacent if they are<br />
consecutive in the sequence and are non adjacent<br />
otherwise.<br />
C3 is a cycle graph with three vertices and three<br />
edges, where it is non-singular graph.<br />
i.e. � ( C3)<br />
� 0 . see[8 ]<br />
we construct an m-connected graphs<br />
G * ,G ** ,G *** by join C3,C4,Ck with path Pn<br />
,n=1,2,3,… and we get the following result<br />
theorem.<br />
Theorem 3-1<br />
i) � m (C3 � Pn)=1 if n+1 � 0mod4<br />
ii) � m (C3 � Pn)=0 otherwise<br />
Proof:<br />
To apply join operation between two graphs<br />
C3 and Pn we must join each vertex of C3 with all<br />
vertices of Pn and we get m-connected graph G *<br />
Shown in fig (8), we give the weighting of<br />
the Vertices of Pn by the form x1,o,-x1,.... and<br />
zero for the vertices of C3,<br />
i) if n+1 � 0mod4, then<br />
�<br />
wi�(<br />
ui<br />
)<br />
vi�C3<br />
f (un)=-x1 implies that<br />
f ( w ) � x � o � ( �x<br />
) � .... � 0 ( since n has an<br />
i<br />
1<br />
Odd subscripted)<br />
And<br />
�� ( x ) � o � o � o � ... � 0<br />
f<br />
xi�N<br />
( ui<br />
)<br />
ui<br />
Pn<br />
i<br />
1<br />
Then we obtain the zero sum weighting<br />
*<br />
which Implies that G � ( C3<br />
� Pn<br />
) has a high<br />
zero sum weighting then it is singular, and we<br />
used exactly one variable, then � m (G * )=1<br />
iii) If n �1�<br />
0mod<br />
4,<br />
then f(ui)=0 or x1<br />
and we cannot get the zero sum weighting for<br />
o<br />
any vertex of G * then � m (G * )=0<br />
O<br />
o<br />
-X1<br />
O<br />
Fig (8)<br />
Fig (8)<br />
o<br />
-X1<br />
Now for the graph C4 (the cycle of four<br />
vertices and four edges) where it is singular as<br />
shown in the following lemma.<br />
Lemma 3-2 [6] and [7]<br />
The singularity of the cycle graph C4 is 2.<br />
Proof: It is obvious since we used two<br />
independent variables to get the zero sum<br />
weighting x and y, so<br />
� m (C4) =2<br />
-z<br />
Fig(9)<br />
While the construction m-connected graph C4<br />
with Pn get a new result.<br />
Theorem 3-3<br />
The singularity of m-connected G ** �<br />
(C4 � Pn), n=2,3,… , is defined as follow:<br />
i) � m (C4� Pn)=3 if n+1=0mod4<br />
ii) � m (C4� Pn)=2 otherwise<br />
X<br />
12<br />
o<br />
-x1<br />
y<br />
-y<br />
Fig (10)<br />
-z<br />
z<br />
o<br />
y<br />
-y<br />
-X1<br />
Or<br />
O<br />
Or<br />
X1<br />
z<br />
211
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
proof: to construct the m-connected graph<br />
G ** = C4 � Pn we must join every vertex<br />
{v1,v2,v3,v4}of C4 with all vertices {u1,u2,…..,un}<br />
in Pn<br />
Now we weights the vertices of new graph<br />
G ** by the variables shown<br />
In fig (10)<br />
i)If n+1=0mod4 then the number of vertices of<br />
Pn must be (3,7,11,…in each case<br />
�<br />
wi�N<br />
( vi<br />
)<br />
212<br />
f ( w ) � x � o � ( �x<br />
) � .... � x � o � ( �x<br />
) � 0<br />
i<br />
and ��<br />
1<br />
xi<br />
N ( ui<br />
)<br />
1<br />
f ( x ) � y � z � ( �y)<br />
� ( �z)<br />
� o � 0<br />
i<br />
For each vertex ui of Pn<br />
then G ** has a high zero sum weighting.<br />
And we get easily the zero sum weighting<br />
which used exactly three non zero distinct<br />
independent variable y,z,x1<br />
Then � m (C4+Pn)=3<br />
ii)If n �1�<br />
0mod<br />
4,<br />
then the number of<br />
vertices of Pn is 2,4,5,6,8,…. And doesn't<br />
posses the zero sum weighting since<br />
f ( w ) � 0<br />
�<br />
i<br />
wi�N<br />
( vi<br />
)<br />
Since f(vn)=0 or x1 and � f<br />
i�2,<br />
3,<br />
4,....<br />
But ��<br />
xi<br />
N ( ui<br />
)<br />
1<br />
1<br />
( v ) � 0<br />
f ( x ) � z � y � ( �z)<br />
� ( �y)<br />
� 0 , then<br />
i<br />
we used exactly two variables , y and z<br />
� � m ( C4<br />
� Pn<br />
) � 2 if n �1�<br />
0mod<br />
4<br />
In general Ck is a cycle graph of k vertices<br />
and the condition to make Ck singular is proved<br />
in the theorem below.<br />
Theorem3-4 [1] and [8] Singularity of Ck<br />
k<br />
� ( C ) � 1�<br />
( �1)<br />
, k=3,4,….<br />
k<br />
Theorem3-5<br />
For m-connected graph G *** � (Ck+Pn) we<br />
have the following results<br />
i) � ( Ck � Pn<br />
) � 3if<br />
k � 0mod<br />
4 and n �1<br />
� 0mod<br />
4<br />
ii) � ( Ck � Pn<br />
) � 2if<br />
k � 0mod<br />
4 and n �1<br />
� 0mod<br />
4<br />
iii) � ( � P ) �1if<br />
k � 0mod<br />
4 and n � 1 � 0mod<br />
4<br />
Ck n<br />
iv)<br />
� ( Ck � Pn<br />
) � 0if<br />
k � 0 mod 4 and n �1<br />
� 0 mod 4<br />
Proof:<br />
Let u1,u2,….,uk and v1,v2,….,vn be the<br />
labeled vertices of Ck and Pn respectively after<br />
given<br />
The weighting of each vertex of m-connected<br />
graph G ***<br />
Be having the following cases:<br />
If k=0mod4 and n+1=0mod4 then<br />
i) from<br />
�� f ( w)<br />
� 0,<br />
x1+o+(-x1)+o+…=0<br />
w N ( ui<br />
)<br />
i<br />
Since we have (n+1=0mod4).<br />
i.e v ( p ) � 3,<br />
7,<br />
11,...<br />
in each case the sum<br />
n<br />
of the weights equal to zero.<br />
And from �� f ( w)<br />
� 0 , y1+y2+….+yk=0<br />
w N ( vi<br />
)<br />
Then f(uj)=y1 for odd subscript j and f(up)=y2<br />
for even subscript p<br />
� y1 � y3<br />
� y5<br />
and y 2 � �y6<br />
� �y8<br />
� .....<br />
Then a high zero-sum weighting for G ***<br />
exists as shown in fig (11)<br />
Thus uses exactly x1,y1 and y2 non-zero<br />
distinct independent variables<br />
Therefore � m (G *** )=3<br />
ii) if n �1<br />
� 0mod<br />
4<br />
Then<br />
k<br />
( v ) � 0<br />
� f since f(vn)=0 or x1<br />
i<br />
i�1<br />
To apply x1+(-x1)+o+x1+….=0 we must have<br />
x1=-x1=0<br />
And the only distinct independent variables<br />
are used to given a high zero sum weighting of<br />
G *** are y1 and y2<br />
Therefore m<br />
� (G *** )=2<br />
Now if k � 0mod<br />
4 we have<br />
iii) if n+1 � 0mod 4<br />
from<br />
�� f ( w)<br />
� 0,<br />
x � ( �x<br />
) � o �....<br />
� 0<br />
w N ( ui<br />
)<br />
1<br />
And it is true since we have n=3,7,11,….<br />
And from �� f ( w)<br />
� 0 we have<br />
w N ( vi<br />
)<br />
y1+y2+y3+…+yn=0 implies that<br />
y1=y2=y3=……=yn=0<br />
to obtain the high zero sum weighting .<br />
And we used exactly one variables x1 that is<br />
� m (G *** )=1<br />
iv) if n �1<br />
� 0mod<br />
4<br />
it is obvious that x1=-x1=0 and y1=y2=…..=yk<br />
to get the high zero sum weighting<br />
That is � m (G *** )=0<br />
1
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
Pn<br />
Fig (11): A high zero-sum weighting for Ck � Pn<br />
4-SINGULARITY OF COMPLETE<br />
BIPARTITE GRAPH<br />
In this section we shall extend the idea of<br />
zero-sum weighting defined in [5,6] and [8] and<br />
the new technique of evaluating the singularity<br />
of a graph by determining the number of distinct<br />
independent variables in a high zero-sum<br />
weighting for the connected bipartite graph<br />
G(V1,V2) and complete bipartite graph Kp,n , the<br />
graph Kp,n defined in [4].<br />
Definition4-1:<br />
A bipartite graph G=(V, E) in which V can be<br />
partitioned into two subsets V1 and V2 so that<br />
each edge in G connects some vertex in V1 to<br />
some vertex in V2.<br />
In the mathematical field of graph theory, a<br />
complete bipartite graph or biclique is a special<br />
kind of bipartite graph where every vertex of the<br />
first set is connected to every vertex of the<br />
second set. i.e. each vertex in V1 is connected to<br />
each vertex in V2. If /V1/=p and /V2/=n, then<br />
corresponding complete bipartite graph is<br />
represented Kp,n fig(12).<br />
p<br />
a<br />
b<br />
c<br />
X1<br />
yk<br />
o<br />
y1<br />
-<br />
x1<br />
o<br />
q<br />
r<br />
s<br />
Ck<br />
Fig (12): Complete bipartite graph K3,4<br />
y2<br />
y3<br />
y4<br />
In the remaining part of this paper, we<br />
assume that the vertices of V1 and V2 are labeled<br />
{v1,v2,v3,….,vp}, and {u1,u2,u3,….,un}<br />
respectively.<br />
Notation: A complete bipartite graph has p+n<br />
vertices (of order p+n)and size np (edges),for<br />
any k , K1,k is called a Star graph. All complete<br />
bipartite graphs which are trees are Stars, and the<br />
graph K1,3 is called a Claw, and used to defined<br />
the Claw-free graphs, where the graph K3,3 is<br />
called the utility graph. While Kp,p called Moor<br />
graph and Kp,p+1 is a Turan graph.<br />
Lemma4-2:<br />
The adjacency matrix of a complete bipartite<br />
graph Kp,n has eigenvalues np ,- np ,0 ;with<br />
multiplicity 1,1,n+p-2 respectively.[8].<br />
It comes from the fact that for a symmetric<br />
real matrices A the total multiplicity of non zero<br />
eigen values is the rank. Since the adjacency<br />
matrix of Kp,n has rank 2, it has two non zero<br />
eigenvalues � 1 and � 2 . With the sum of all<br />
eigenvalues is equal to 0 , so � 1 � �2<br />
� c for<br />
some positive constant c. Hence the<br />
characteristic polynomial of Kp,n is<br />
2 2 p�n�2<br />
p�n<br />
2 p�n�2<br />
( �)<br />
� ( � � c ) � � � � c �<br />
PK p,<br />
n<br />
and proved in [8] the sum eigenvalues of any<br />
2<br />
graph is zero and �� � 2q<br />
(q is the number<br />
i<br />
of edges of G) , then –c 2 is equal to -1 times the<br />
number of edges of Kp,n.<br />
i.e. –c 2 =-np. We can obtain that c � np .<br />
Therefore the spectrum of the complete bipartite<br />
graph Kp,n consists of np , � np and<br />
(p+n-2) eigenvalues equal to zero.<br />
Theorem4-3:<br />
the singularity of complete bipartite graph<br />
Kp,n is p+n-2<br />
i.e. � ( , ) � p � n � 2<br />
m K p n<br />
x1<br />
y1<br />
x2<br />
y2<br />
x3<br />
Fig(13)<br />
y3<br />
yp<br />
xn<br />
213
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
Proof:<br />
For each vertex in G let y1,y2,…..,yp be the<br />
weights of the other vertices of V1 and the<br />
weights of the other vertices of V2<br />
x1,x2,…..,xn.<br />
be<br />
For each vi of V1 there are n vertices in<br />
neighborhood of vi . i=1,2,…p , and<br />
f ( w ) � x � x �.....<br />
� x to apply the<br />
�<br />
w �N<br />
( v )<br />
i<br />
214<br />
i<br />
i<br />
1<br />
2<br />
condition � f ( wi<br />
) � 0<br />
wi�N<br />
( vi<br />
)<br />
x1+x2+…..+xn=0 , put xn= -x1-x2-……-xn-1<br />
and for each uj of V2 there are p vertices in<br />
neighborhood of each uj , j=1,2,….,n , and<br />
f ( s ) � y � y �....<br />
� y to apply the<br />
�<br />
s �N<br />
( u )<br />
j<br />
j<br />
condition �<br />
s �<br />
j<br />
j<br />
1<br />
N ( u )<br />
2<br />
f ( s ) � 0<br />
j<br />
j<br />
y1+y2+….+yp=0 put yp=-y1-y2-……-yp-1<br />
then a high zer-sum weighting for G1 exist ,<br />
that uses exactly (n-1)+(p-1) non-zero distinct<br />
independent variables.<br />
Therefore � ( , ) � n � p � 2 .<br />
Theorem<br />
K1,n is n-1<br />
4<br />
-3:<br />
m K p n<br />
n<br />
p<br />
The singularity of Star Graph<br />
i.e. S(K1,n) =n-1<br />
Proof: It is obvious from the above theorem,<br />
since Star graph is a special type of complete<br />
bipartite graph Kp,n. Let f(v1) =0,and the<br />
weights of the other vertices are as shown in<br />
fig(14), we get<br />
�<br />
f<br />
( i 1 2<br />
n<br />
w ) � x � x � ..... � x � 0<br />
X1<br />
X2<br />
Xn<br />
Fig (14)<br />
Implies that xn=-x1-x2-x3 ……-xn-1,then the<br />
high zero sum weighting exist and used exactly<br />
n-1 non zero distinct independent variables.<br />
X3<br />
f(v1)=0<br />
X4<br />
5- APPLICATION<br />
Graph spectra (The set of eigenvalues of the<br />
adjacency matrix A(x) which is symmetric,<br />
square, zero diagonal and (0, 1) matrix of the<br />
graph G) has been applied and has become<br />
important in some scientific fields, such as<br />
combinatory, quantum chemistry, physics and<br />
computational algorithms. The first<br />
mathematical literature discussing the spectra of<br />
graphs is the fundamental papers of L.M.<br />
Lihtenbaum (1956) and of L. Collatz and V.<br />
Sinogowints (1957) and D.M. Cvetcovic after<br />
them. Mathematicians study the spectra of<br />
graphs because they hope by combining graphs<br />
with linear algebra, in particular the welldeveloped<br />
theory of matrices, to investigate the<br />
properties of graph s and further classify graphs.<br />
We can use eigenvalue to deduce an easy result<br />
about bipartite graphs. If G has bipartition (V1,<br />
V2) and if x is an eigenvector with corresponding<br />
eigenvalue� , then we can replace the label xi<br />
with –xi for each vertex in V1 to get an<br />
eigenvector with corresponding eigenvalue - � .<br />
Hence � and - � have the same multiplicity,<br />
and the spectrum that is symmetric about 0, then<br />
the trace of A and A 2k+1 is 0 and the graph<br />
contains no odd cycles, and so G is bipartite.<br />
This fields one of the oldest results concerning<br />
the spectra of graphs. [7] and [8].<br />
Theorem 5-1: A graph is bipartite if and only if<br />
its spectrum is symmetric about 0.<br />
Suppose that Vi and Vj are non-adjacent vertices<br />
with the same neighbors, and suppose that x is<br />
an eigenvector with eignvalue� . If ∑ is the sum<br />
of the labels vertices on the neighbors of vi and<br />
vj, then clearly � xi=(Axi) = ∑=(Ax)j= � xj.<br />
And hence � (xi-xj)=0.see[4] and[7]<br />
Theorem 5-2: If V and U are non-adjacent<br />
vertices with the same neighbors, and if x is an<br />
eigenvector with eignvalue� , then v and u have<br />
the same label or � =0.<br />
5-3 Lower bounds for the eigenvalues:<br />
Finding lower bounds for the eigenvalues of<br />
graphs has been a recurring theme in the study of<br />
graph spectra.<br />
In this section we use � (G) to denote the<br />
smallest eignvalue.<br />
[4,p.40]<br />
Lemma 5-4: Let G be a connected graph with<br />
least eignvalue � (G), then<br />
i- � (G) ≤0 with equality for a null graph<br />
(without any edge)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
i- if G is not null, then � (G) ≤ -1, with equality<br />
iff G is complet<br />
ii- if G is neither complete nor null,then � (G) ≤<br />
-√2 with equality iff G= K1,2<br />
iii- if G is neither complete nor K1,2 and if<br />
� (G)≥ -1.5, then G is<br />
Fig (15)<br />
proof: Since the trace of any adjacent matrix is<br />
0, � (G) ≤ 0 iff a graph has an edge, then that<br />
edge is a two-vertex induced sub graph with<br />
least eignvalue -1, implies � (G) ≤ -1 .<br />
if G is not complete graph, then K1,2 is an<br />
induces sub graph with least eignvalue -√2 ,<br />
Among the graphs G with four vertices the one<br />
given in the last statement is the only one with<br />
least eignvalue � (G)≥ -1.5<br />
5-5 Upperbound of the eignvalue<br />
How we find graphs with eignvalues bounded<br />
from below by -2, similarly we can find graphs<br />
with eignvalues bounded from above by 2.<br />
i<br />
j<br />
k<br />
Fig (16 ) the graph T(i,j,k)<br />
we define the graph T( i, j, k), shown in<br />
fig(16 ) take three paths pi, pj and pk and add a<br />
new vertex adjacent to one end vertex of each<br />
path. The graph is then a tree with i+j+k+1<br />
vertex, tree pendant vertices and one vertex of<br />
degree 3.<br />
Now we form a matrix X from a set of<br />
vectors, where the inner product of any two<br />
vectors is 0 or 1.<br />
We can then define the adjacent matrix of G<br />
by equal XX T = 2I – A(G)<br />
And we will have a graph whose eignvalues<br />
are bounded from above by 2.<br />
Theorem 5-5: If G is a graph with largest<br />
eignvalue � 1=2, then G is one of the following<br />
graphs Cn, K1,4 , T(2,2,2), T(3,3,1), T(5,2,1) or<br />
Fig (17)<br />
Corollary 5-6: If G is a graph with largest<br />
eignvalue � 1< 2, then G is a path Pn, T(1,1,r),<br />
T(1,2,4), T(1,2,3) or T(1,2,2)<br />
5-5 An application in chemistry:<br />
Cayley in Beineke [ 3, p.434] found the<br />
earliest application of graph theorem (spectra) to<br />
chemistry in 1857 when he enumerated the<br />
number of rooted trees with a given number of<br />
vertices. Chemical molecule can be represented<br />
by a graph by taking each atom of the molecule<br />
as a vertex of the graph, and the edges of the<br />
graph represent atomic bonds between the end<br />
atoms property [3, p.420] such that two<br />
isomorphic graphs must either both have the<br />
property, or both lack it , is said to be a graph<br />
invariant.<br />
H<br />
H<br />
H<br />
H<br />
H<br />
Fig (18): isomers of C5H12<br />
The question of isomorphism is a particular<br />
interest to chemists. The necessary condition for<br />
a molecule to be stable (means have no zero<br />
eigenvalue in the spectra, i.e. Singularity of such<br />
graphs is zero) is that it must have an even<br />
number of atoms. However the singularity of the<br />
Isomer in figure (18) is 7.Thus as a chemical<br />
property, we mention that the isomer is stable<br />
more than any other molecular has the<br />
singularity more than 7. As a general case ,<br />
paraffin's have the molecular formula<br />
CkH2k+2.They have 3k+2 atoms(vertices) of<br />
which k is carbon and 2k+2 are hydrogen atoms.<br />
They have 3k+1 bonds (edges), hence, for large<br />
k, many isomers of the same compound are<br />
determined.<br />
H<br />
H<br />
H<br />
H<br />
H<br />
H<br />
215<br />
H
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 207-216, 2011<br />
As a mater of fact, isomers with minimum<br />
singularity will appear mostly in nature. Apply<br />
weighting technique, we can show that<br />
� m ( CkH2k+2) ≥ k+2 ,equality holds for all<br />
paraffin compounds whose shape is like Figure<br />
(15). That is, the straight shape is the most stable<br />
isomer out of all. In [7] it is proved that the<br />
necessary condition for a molecule to be<br />
stable(to have no zero eigenvalue in the spectra,<br />
i.e. the singularity is zero) is that it must have an<br />
even number of atoms(vertices).<br />
REFRENCES<br />
- B.Andras Fay, Graph theory: Flows, Matrices, Adam<br />
Hilger,Bristol,1991.<br />
- S.Axler and K.A.Ribet , Graph theory, Graduate texts in<br />
Mathematics,1993.<br />
- L.w.Beineke and R.J.Wilson; Selected Topics in Graph<br />
Theory, Academic press, Inc, London,1978 .<br />
- L.W.Beineke,R.J.Wilson and P.J.Cameron,Topics in<br />
Algebraic Graph theory,2004.<br />
216<br />
m<br />
ىةلث ةب ووتسطكةي ىفاسط ؤب وابان ىةلث<br />
- Bondy, John Adrian; Murty; U.S.R. ,Graph theory with<br />
Applications,1976.<br />
- M.Broun, J.W.Kennedy and B.Servatins ; Graph<br />
Singularity, Graph Theory notes of<br />
NewYork,vol.25(1993) 23-32.<br />
- D.M.Cvetcovic ,M.Doob ,I.Gutman and A.Torgasev;<br />
Recent Result in the Theory of Graph Spectra,<br />
North Holland, Amsterdam,1988.<br />
- D.M.Cvetkovic, M.Doob and Sachs; Spectra of Graphs,<br />
Academic Press, New York, 1979.<br />
- Kh.R.Sharaf and D.H.Mohammed; Degree of Singularity<br />
of Product of graphs, Jornal of Duhok University,<br />
vol.9,no.1,(2006) 39-50.<br />
- Kh.R.Sharaf and P.A.Rashed; On the Degree of the<br />
Singularity of a graph, Journal of Dohuk<br />
University, vol.5,no.2,(2002) 133-138.<br />
- Skiena,S.Implementing Discreat, Mathematics:<br />
Combinatories and Graph Theory with<br />
Mathematica. Addison-Wesely, 1990.<br />
ةتخوث<br />
ىىكَيفاسفاسط دنةض ةل َىون ىووتسطكةي ىفاسط دنةض ىةوةهيشؤد ؤب ةيةوةهيرَيوت مةل ةواهَيهزاكةب � ىزادسك<br />
ةووتسطكةي , ةفاسط ىوابان ىةلث ىةوةهيشؤد ؤب ةووتاهزاكةب ىناكةزةس ؤب ىسفسان ىشزةب ىندسكشَيك ةو , تةبيات<br />
ىةزامذ ةتاكةد فاسط ىوابان ىةلث ةك ةواسهَيلمةس اهةوزةه , ةووب<br />
اديةث ناكةفاسط ىندسكؤك ىمانجةئ ةل ةك ناكةيَيون<br />
شيهيَلؤكَيل اهةوزةه . َىسهَيهةدزاكةب ىشزةب ىندسكشَيك ةل ةك شاوايج ىؤخةبزةس ىسفسان ىناكةواِزؤط ةل تسيوَيث<br />
و ( Pn � P<br />
k<br />
) � ( Pn<br />
� C<br />
k<br />
) ةل ينتيسب ةك ةناي َىون ةووتسطكةي ةفاسط ةزؤج مةئ ىوابان ىةلث ىندسكزامذةه ؤب ةواسك<br />
[6] ةىل M.Brown و [7] ةىل Cvet Kovic ةك شزةب ىندسكشَيك ىكيهكةت ىندسكَيجةب َىج ةب نايناكةيتةبيات ةزاب<br />
. ةواهَيه نايزاكةب<br />
) تلااصتلأا نم m ( ةلصتملا<br />
تانايبلل ذوذشلا ةجرد<br />
: ةصلاخلا<br />
ةت لتخم تاجردتب ةتصاب تاتنايب نتم ةلتصتم تاتنايب اتنتتسلأ نينايب لاصتأ<br />
� ةيئانثلا ةيلمع انمدختسا ثحبلا اذه ىف<br />
ةتتيلمع نتتع ةتتاتانلا ودتتىدالا تاتتنايبلل ذوذتتشلا ةتتجرد داتتاىلأ سوذتتتلل جت تتصلا تتتيللا ىلاتتيلا نىزاتتتلا وتتتةف انمدختتتسأو ،<br />
ةىت تصلالا ةلةتتسملا تاتتيلتملا ددع جواست تانايبلا كلتل ذوذشلا ةجرد نأب انتبثأو ةلصتم تانايب نع ورابع ىهو لاصتلأا<br />
. ىلايلا هنىزات ىف مدختست ىتلا ة لتخملا<br />
تلااتتحلاو ( Pn � C<br />
k<br />
) و ( Pn � P<br />
k<br />
) لاتصتلأا<br />
ةتتيلمع نتم ةتتاتانلا ودتىدالا تاتنايبل ذوذتتشلا ةتجرد اتتستبأ تتت كلذتك<br />
.<br />
[6] ىفM.Brawnو<br />
[7] ىف ىقابلاو cvetkovic اهمدختسأ جذلا ىلايلا نىزاتلا ةينةت تيميتو قيبطتب اهنم لةل ةصاخلا
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 217-222, 2011<br />
A STUDY OF NAUPLIAR STAGES OF Mesocyclops edax FORBES,<br />
1891(COPEPODA: CYCLOPOIDA)<br />
LUAY A. ALI * and KAZHAL H. H. RAHIM **<br />
* Dept. of Biology, College of Education-Scientific Dept, University of Salahaddin, Kurdistan Region-Iraq<br />
** Dept. of Basic Science, College of Nursing, Hawler Medical University, Kurdistan Region-Iraq<br />
(Received: December 22, 2010; Accepted for publication: May 5, 2011)<br />
ABSTRACT<br />
The present study conducted to define the naupliar stages of Mesocyclops edax (Copepoda: Cyclopoida) in the<br />
laboratory. Eggs of adult females were isolated and incubated in sterile petridish at 25±1C ◦ . During the follow up of<br />
the development of these eggs for 5 to 6 days, all six nauplius stages were observed. The study was included the<br />
descriptions of obtained naupliar stages.<br />
KEYWORDS: Nauplius, Mesocyclops edax, Copepoda, Cyclopoida<br />
C<br />
INTRODUCTION<br />
opepods are very small crustaceans,<br />
most ranging from less than one<br />
millimeter to several millimeters in length. Freeliving<br />
freshwater copepods can be distinguished<br />
from other small aquatic invertebrates by a<br />
variety of morphological characteristics.<br />
Knowledge of naupliar morphology is indispensable<br />
for the investigation of stagedependent<br />
biological and ecological phenomena<br />
and the elucidation of phylogenetic<br />
relationships. As part of present study of the life<br />
cycle of fresh-water Cyclopoida, is describe the<br />
naupliar stages of Mesocyclops edax.<br />
Many previous studies have been done on<br />
the life cycles of copepoda in different parts of<br />
the world. A study of the development of larval<br />
stages of seven species of marine copepoda<br />
made by Oberg (1906). These species included<br />
representatives of four different families in all<br />
these species and he found six naupliar. While,<br />
Byrnes (1921) described the metamorphosis of<br />
Cyclops americanus and C. signatus, but only<br />
gave three naupliar stages, which correspond<br />
very closely to stage II, IV and VI. However,<br />
Manfredi (1923) investigated the development of<br />
Cyclops bicuspidatus, C. serrulatus and C.<br />
prasinus and found five naupliar. A study of the<br />
life cycle of C. bicuspidatus was made by<br />
Armitage and Tash (1967). A revision of the<br />
African species of the genus Mesocyclops was<br />
published by Velde (1984), he recorded twelve<br />
species of Mesocyclops in his study, four of<br />
them were described as new species, in addition<br />
to recording of M. leuckarti for the first time in<br />
Africa. On the other hand, naupliar development<br />
of Mesocyclops edax was described by Dahmas<br />
and Ferrnando (1995).<br />
In Iraq generally and in Kurdistan<br />
particularly, most previous studies on copepod<br />
were mainly restricted to surveying different<br />
species in different aquatic environment, there<br />
are no study on life cycles of copepoda, this<br />
study become the first study of naupliar stage of<br />
free copepod in Iraq in general and in Kurdistan<br />
region in particular.<br />
MATERIAL AND METHODS.<br />
Greater Zab River is a large river (392 km)<br />
in Iraq. This river is one of the main tributary of<br />
the Tigris, it originates mainly from<br />
mountainous area of Iran and Turkey. It is<br />
situated between 36 ◦ -37 ◦ north latitudes and 43 ◦ -<br />
44 ◦ east longitude (Grabda, 1963). During this<br />
study, the samples were collected near Khabat<br />
sub district far about (40 km) to the west of Erbil<br />
city (Fig. 1), during the period of June 2009.<br />
Samples were collected by filtering, 50 liter of<br />
the river water by using planktonic net, with 55<br />
µm pore size then the samples were concentrated<br />
to 10 ml of river water.<br />
After returning to the laboratory the adult<br />
female of copepods is began to produce the eggs<br />
were placed in small petridish with little amount<br />
of distal water at 25±1 C º and drop of water at 25<br />
C º were added every six hour by using small<br />
syringe reparation. Then they were placed in<br />
incubator at 25 ±1 C º (Grabda, 1963 and<br />
Tsotetsi, 2005). Every day plastic cups checked<br />
under dissecting microscope and the nauplius<br />
stage observation made daily. Photos taken for<br />
217
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 217-222, 2011<br />
each stage by using Olympus compound<br />
microscope and digital camera model (Sony,<br />
DSC-W55).<br />
RESULTS AND DISCUSSION<br />
Mesocyclops edax was originally described<br />
from Lake Superior of North America (Forbes,<br />
1891). Generally, cyclopoida exhibit complex<br />
life cycles and relatively long generation times<br />
compared with other zooplankton. The lifecycle<br />
consists of six nauplius stages, followed by five<br />
218<br />
copepodid larval stages before final molt into<br />
adult. The eggs typically hatch as nauplius<br />
larvae which are not resemble their parents.<br />
They are much smaller, broader in proportion,<br />
have only a few pairs of limbs, and possess no<br />
tail end to their body, they may be colorless, the<br />
only conspicuous part of them being their eye<br />
(Sommer, 1989 and Marshall and Williams,<br />
2002). In this study, the naupliar stages of<br />
Mesocyclops edax has been descibed.<br />
Fig. (1): Map of Iraq, insert location of sampling sites of Greater Zab, River (Map info. Vers. 9).<br />
Nauplius I<br />
This stage was demonstrated after 6-12<br />
hours immediately after egg hatching at<br />
25 � 1°C body length 72-82 µm, width 62<br />
µm (Fig. 2). This instar more nearly<br />
spherical in cross section than later stages.<br />
Labrum bearing spinule row along caudal<br />
margin, 2 larger spinules at either<br />
laterocaudal corner. Ventral body wall<br />
bearing groups of spinules along both lateral<br />
margins. Hind body bearing medial row of<br />
long spinules and 2 rows of small spinules<br />
laterally. Long seta on either side of hind<br />
body. Antennule consisting of 5 segments.<br />
Proximal 2 segments devoid of conspicuous<br />
armature. Third segment bearing 1 anterior<br />
seta plus spinule and row of spinules along<br />
outer margin; 1 of these much longer than<br />
other spinules throughout phase. Fourth<br />
segment bearing 2 setae throughout phase,<br />
proximal seta small, distal seta large and<br />
spinulose, more than 3 times as long as<br />
proximal seta. Distal fifth segment bearing 2<br />
spinulose setae terminally; outer crest of<br />
spinules at base of setae.<br />
Coxa of antenna bearing large swordshaped<br />
masticatory element furnished with<br />
row of strong spinules along outer margin<br />
and shorter spinules on inner distal third.<br />
Basis furnished with 3 small setae along<br />
inner margin, 2 grouped proximally and 1<br />
distally; 2 or 3 anterior surface spinules on<br />
outer portion. Endopod 1-segmented and<br />
armed with 2 inner setae midway, distal 1<br />
much stronger and spinulose; 2 long<br />
spinulose setae terminally. Exopod distinctly<br />
5-segmented, with 1 spinulose seta at inner
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 217-222, 2011<br />
tip of segments 1-4 and 2 spinulose terminal<br />
setae on segment five.<br />
Coxa of mandible bearing one inwardly<br />
curved unfurnished seta. Basis armed with 2<br />
setae proximally, proximal most without<br />
spinules throughout naupliar phase and<br />
distal one stronger and spinulose. Endopod<br />
two segmented. First segment unornamented<br />
and bearing saddle like lobe carrying 2<br />
strong setae ornamented with stiff spinules.<br />
Second segment bearing 2 smaller smooth<br />
lateral setae midway and two setae<br />
terminally. Exopod four segmented with 1<br />
spinulose seta at tip of inner margin of<br />
segments 1-3, but 2 spinulose setae<br />
terminally on distal segment.<br />
The description of nauplius1 was<br />
similar to that reported by Dahmas and<br />
Ferrnando (1995) in their studies on<br />
Mesocyclops edax in Pinehurst Lake.<br />
Fig. (2): Nauplius I.<br />
A. Photomicrograph(200X) B. Camera lucida drawing (scal bar=0.011mm)<br />
Nauplius II<br />
Nauplius stage I molted to liberate this<br />
stage after 20-24 hour body length, 110 -115<br />
µm, width 75- 80µm (Fig. 3). On ventral body<br />
wall of nauplius II, three lateral sickle shaped<br />
rows of spinules close to caudal edge of labrum.<br />
In respect to ornamentation of hind body, 1<br />
abbreviated row of spinules on each<br />
ventrolateral side at base of both caudal setae.<br />
Antennule adding third terminal seta and inner<br />
row of spinules on proximal third of distal<br />
segment. Antenna consist of endopod and<br />
exopod, third seta terminally on its endopod<br />
Exopod becoming 6-segmented, segments 1-5<br />
each with seta at inner distal tip, distal segment<br />
with 2 spinulose setae. Mandible acquiring third<br />
seta distally on basis. Endopodal lobe of first<br />
segment developing 2 additional (equal 4 in all)<br />
medial spinulose setae. Distal segment of<br />
endopod with third spinulose seta terminally.<br />
Second proximal most seta of first exopodal<br />
segment. Naupliar mandible reaching final<br />
structure and not changing until nauplius VI<br />
except in size. Incipient maxillule indicated by<br />
strong plumose seta originating from<br />
protuberance.<br />
The same measurement and disruptions<br />
was reported by Dahmas and Ferando<br />
(1992), from samples of Mesocyclops<br />
collected from Awasa Lake in Ethiopia.<br />
Fig. (3): Nauplius II.<br />
A. Photomicrograph(400X) B. Camera lucida drawing (scal bar=0.015mm)<br />
219
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 217-222, 2011<br />
Nauplius III<br />
Nauplius stage II molted to liberate this<br />
stage after 25-30 hour body length 125-130 µm,<br />
width 80-85 µm (Fig. 4). Hind body bearing<br />
second caudal seta posteriorly on either side,<br />
both setae similar in length, posterior seta<br />
articulated. Third pair of short setae at this stage<br />
between outer pairs of setae. Antennules<br />
acquiring fourth seta at terminal third of distal<br />
segment. Antenna; developing second strong,<br />
club-shaped, spinulose masticatory seta. Basis<br />
220<br />
having fourth seta in group of 3 proximal setae.<br />
Endopod bearing fourth subterminal<br />
unornamented seta Second small naked proximal<br />
seta developed on first exopodal segment; third<br />
spinulose seta sub terminally on distalmost<br />
segment of exopod .<br />
The size and shape of this stage was close<br />
to that reported by Dahmas and Ferrnando<br />
(1995). They followed and described both adult<br />
and nauplius stages of two species of<br />
Mesocyclops.<br />
Fig. (4): Nauplius III.<br />
A. Photomicrograph(400X) B. Camera lucida drawing (scal bar=0.023mm)<br />
Nauplius IV<br />
Nauplius stage III molted to liberate this<br />
stage after 22-24 hour Body length about 155-<br />
160 µm, width 90-96 µm (Fig. 5). Two spin<br />
form elements indicated at either outer sides of<br />
hind body. Antennule with 4 additional setae<br />
developed on distal segment. Antenna bearing<br />
proximal third, small seta, on inner margin of<br />
endopod. Exopod becoming 7-segmented, and<br />
Proximal seta developed at nauplius III situated<br />
at inner distal tip of newly developed proximal<br />
seventh segment. Maxillule becoming bilobed<br />
limb bud with 4 spinulose setae on inner lobe.<br />
Prospective endopod and exopod having 3 and 4<br />
spinulose setae respectively. Row of spinules at<br />
base of middle of 3 exopodal setae, outermost<br />
seta of exopod by far longest, reaching beyond<br />
tip of longest caudal seta.<br />
Generally, similar body size and<br />
characteristic of nauplius IV was published by<br />
Dahmas and Ferrnando (1995).<br />
Fig. (5): Nauplius IV.<br />
A. Photomicrograph(400X) B. Camera lucida drawing (scal bar=0.016mm)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 217-222, 2011<br />
Nauplius V<br />
The description of this stage were as follow<br />
as ; the Body length 200-210 µm, width 120-125<br />
µm (Fig. 6). Hind body grooved medially and<br />
minute acutiform imagination on inner sides of 2<br />
inner setae. Antennule bearing 10 setae on distal<br />
segment. Antenna bearing five seta sub<br />
.<br />
terminally on endopod. Nauplius stage IV<br />
molted to liberate this stage after 20-24 hour<br />
This description of NV was agreed with that<br />
reported by Dahmas and Fernando (1993) that<br />
they studied and described Mesocyclops sp. and<br />
Thermocyclops (copepoda) from Beria Lake in<br />
Sirelanka<br />
Fig. (6): Nauplius V.<br />
A. Photomicrograph(400X) B. Camera lucida drawing (scal bar=0.033mm<br />
Nauplius VI<br />
Nauplius stage V molted to liberate this<br />
stage after 18-24 hour. The body length of this<br />
stage were 270 -285µm, and width 135-145 µm<br />
(Fig. 7). Inner of 2 outer spinules on hind body<br />
becoming distinctly spinulose, both spinules<br />
become more longer. Antennule bearing 14 setae<br />
plus 2 spinular indications of setae not counted<br />
as such on distal segment. Antenna bearing<br />
fourth seta midlength on endopod. distal<br />
segment. Antenna bearing fourth seta midlength<br />
on endopod.<br />
No indication externally of maxilla or<br />
maxilliped in any stage. Precursors of legs 1 and<br />
2 appearing at sixth nauplius stage as medial flap<br />
like limb buds armed with setae and a cutiform<br />
imaginations on exopod and endopod.<br />
Fig. (7): Nauplius VI.<br />
A. Photomicrograph(400X) B. Camera lucida drawing (scal bar=0.038mm)<br />
A1= Antennule, A2= Antenna, ps= Posterior seta<br />
221
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 217-222, 2011<br />
REFERENCES<br />
Armitage, B. K. and Tash, C. J. (1967). The life cycle of<br />
Bicuspidatus Thomasi, S. A. Forbes in<br />
Leavenworth county state lake, Kansas, USA.<br />
Department of zoology, of Kansas, crustacean,<br />
Vol.13, 94-102.<br />
Byrnes, E. F. (1921). The metamorphosis of Cyclops<br />
americanus and Cyclops signatus var. tenuicornis,<br />
cold spring Harbor monograph 1x, the Brook lyn,<br />
institute for Arts and sciences 4:3-53.<br />
Dahmas, U, H. and Ferando C. H. (1992). Naupliar<br />
development of Mesocyclops aequatorialis<br />
similis and Thermocyclops consimilis (Co pepoda:<br />
Cyclopoida) from Lake Awasa, a tropical rift valley<br />
lake in Ethiopia.-Canadian Journal of Zoology 70:<br />
2283-2297.<br />
Dahmas,U. H. and Fernando C. H. (1993). Naupliar<br />
development of Mesocyclops cf. Thermocyclops<br />
oidesHarada, 1931 and Thermocyclops decipiens<br />
(Kiefer, 1929) (Copepoda: Cyclopoida) from Beira<br />
Lake, SriLanka. Journal of Plankton Research 15:<br />
9-26.<br />
Dahmas. U. H, Ferrnando, H. C. (1995). Naupliar<br />
development of Mesocyclops edax Forbes,<br />
1891(copepoda: cyclopoida). Crustacean biology,<br />
15(2):329-340<br />
Forbes, S. A. (1891). On some Lake Superior Ento-<br />
mostraca.-Report of the United States Commission<br />
of Fish and Fisheries for 1887: 701-718.<br />
222<br />
Grabda, J. (1963). Life cycle and morphogenesis of<br />
Lernaea cyprinacea L. Acta Parasitol. Polonica,<br />
11: 169- 198.<br />
Manfredi, P. (1923). Etude sur le development larvaire de<br />
quelques especes du genre Cyclops. Annales de<br />
Biologic lacster, 12: 3-4.<br />
Marshall, A.J. and Williams, W. D. (2002). Textbook of<br />
zoology invertebrates. 7 th ed., CBS publishers and<br />
distributors, NewDelhi. India.<br />
Oberg, M. (1906). Die metamorphose der plankton<br />
copepoden der Kiefer buch. wiss. Meere<br />
suntersuchun herausgeg, V. D. Komm, Z. wiss.<br />
Unter such, D.deutsh-Meere in Kiel,U.D,<br />
Biol,Anstallt, Helgoland.Neue. (Sited by The larval<br />
development of fresh water copepod.The Oho state<br />
Ewers, L. A. (1930).<br />
Sommer, U. (1989). Plankton ecology, succession in<br />
plankton communities. Springer-verlage, Newyork,<br />
USA.<br />
Tsotetsin, A. M. (2005). Aspect of the ecology, life cycle<br />
and patho- logy of Lamproglena clarae (Copepoda:<br />
Lernaidae), collectedfrom the gills of Clarias<br />
gariepinus from the Vaal river system, South<br />
Afrika. Coll. Faculty Sci., Univ. Rand Afrikaans.<br />
101pp.<br />
Velde, L. V. (1984). Revision of the African species of the<br />
genus Wilson, C. B. (1911). Nort America Parasitic<br />
Copepods. The Lernmopodidm. Proc. U. S. Nat.<br />
Mus., 39: 189-226.<br />
ةل ةواركايج ىناكةكاَيه ةو ةطيقات ةل ةكؤمرك ىناكةغانؤق ىندرك ناشين تسةد ؤب ارد مانجةئ ةيةوةهيلؤكَيل<br />
مةئ<br />
ناكةكلَيه ىةشةط ىنوضاداودةب ىوامةل ةو<br />
. ارهَيلهةه ىدةس ىةلث<br />
َ1±<br />
52<br />
وومةه ىدروو ىفسةو ةكةوةهيلؤكَيل<br />
اهةورةهةو توةك تسةدةب ةكؤمرك ىناكةغانؤق وومةه<br />
نضح مت . ربتخملا يف<br />
ةتخوث<br />
ىمرةط ىةلث ةل ووتشيةطيث ىَىم ةل<br />
. ذؤر 6-2<br />
ىوامةل<br />
. ىؤخ ةتَيرطةد ناكةغانوق<br />
Mesocyclops edax Forbes, 1891 لجرلاا يفاذجملل ةيقريلا لحارملا<br />
ةسارد<br />
Mesocyclops edax<br />
لجرلاا يفاذجملل ةيقريلا لحارملا ىلع فرعتلل ةيلاحلا ةساردلا تيرجأ<br />
2 نم تحوارت ةرتفل ضويبلا ومن<br />
ةعباتم للاخو . ◦م<br />
َ±<br />
52 ةرارح ةجرد يف يرتب قابطا يف ةجضان<br />
ثانا نم<br />
ةذه نم ةلحرم لكل يليصفت فصو ةساردلا تنمضت دقو<br />
. ةتسلا ةيقريلا لحارملا ىلع لوصحلا مت<br />
ثيح<br />
ةصلاخلا<br />
تلزع ضويب<br />
مايأ<br />
6<br />
ىلا<br />
.<br />
لحارملا
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
EFFECT OF SALICYLIC ACID ON SOME BIOMASS AND<br />
BIOCHEMICAL CHANGES OF DROUGHT- STRESSED<br />
WHEAT (Triticum aestivum L. var. Cham 6) SEEDLINGS*<br />
FAKHRIYA M. KARIM and MOHAMMED Q. KHURSHEED<br />
Dept. of Biology, College of Education -Scientific dept, University of Salahaddin, Kurdistan Region-Iraq<br />
(Received: January 6, 2011; Accepted for publication: May 2, 2011)<br />
ABSTRACT<br />
This study was carried out to examine the effect of salicylic acid on growth of winter wheat plants (Triticum<br />
aestivum L. var. Cham 6) under water stress conditions. The experiment consisted of pre-treated grains with salicylic<br />
acid solution with concentration of (100ppm) via soaking for three hours and spray of the seedlings with salicylic acid<br />
at the level of (200ppm), and the plants were put under drought stress conditions at different levels (0.75FC, 0.50FC,<br />
0.25FC). Shoot and root biomass characteristics as well as some biochemical changes of shoot were studied. Statistical<br />
analysis were accomplished for the gained results using the completely randomized design for all of the experiments<br />
with four replications for each treatment and mean treatments were compared using Least Significant Difference Test<br />
(L.S.D.) at the level of 0.05 to the characteristics of plants that have been registered in the greenhouse, and the level of<br />
0.01 to the chemical characteristics of the plants which were done in the laboratory. The plant treating with salicylic<br />
acid led to significant increases in the most of shoot and root biomass characteristics under water deficit stress<br />
conditions which were included fresh weight and water content of shoot, as well as dry root/dry shoots per plant and<br />
the relative growth rate of leaf, but the water content of root and dry weight of root and shoot were decreased<br />
compared with untreated plants. Proline and salicylic acid content of shoot showed an increase in plants treated with<br />
salicylic acid under drought stress comparing with untreated plants.<br />
KEYWORDS: Salicylic acid, Drought, Wheat<br />
C<br />
INTRODUCTION<br />
ereals are the main source of nutrition,<br />
energy, protein and dietary fibers for<br />
human and animals (Gooding and Davies, 1997).<br />
It is well believed that Iraqi Kurdistan Region is<br />
the mother land of wheat on basis of some<br />
archaeological evidences that has been found in<br />
Tel-jarmo which belongs to 8000 years B.C<br />
(Harlan, 1991). Wheat represents the largest<br />
average among all other field crops in Iraqi<br />
Kurdistan in such away; it covers 78% of rainfed<br />
area (Al-Najafi, 1989). In both natural and<br />
agricultural conditions, plants are frequently<br />
exposed to environmental stresses. It has been<br />
reported that only 10% of the world’s arable<br />
lands are free from environmental stresses, with<br />
drought and salinity being the wide spread<br />
(Ashraf, 1999). Biotic and abiotic stresses are<br />
factors that adversely affect plant growth and<br />
development (Ansari and Misra., 2007).<br />
However, in Mediterranean countries, plants are<br />
subjected to water deficient, high and low<br />
temperatures that are a major factors limiting<br />
growth and development in plants (Kozlowski et<br />
al., 2000). Water is a central molecule in all<br />
* Part of M.Sc. thesis of the first author<br />
physiological processes in plants, comprising<br />
between 80 and 95% of the biomass of<br />
herbaceous plants. Plant water deficit occurs<br />
when insufficient moisture prevents a plant from<br />
growing adequately and completing its life<br />
cycle. Insufficient moisture can be the<br />
consequence of a shortage in rainfall (drought),<br />
coarse textured soils that retain little water in the<br />
root zone, or drying winds. Water deficit is not<br />
only caused by lack of water but also by<br />
environmental stresses like low temperature or<br />
salinity.<br />
Salicylic acid is a naturally occurring<br />
phenoloic that is widely found throughout the<br />
plant kingdom, it was recognized as an<br />
endogenous regulator in plants after finding that<br />
it is involved in many plant physiological<br />
processes such as photosynthesis, transpiration,<br />
nutrient uptake, chlorophyll synthesis, protein<br />
synthesis and transport (Raskin, 1992). SA<br />
induces changes in leaf anatomy and chloroplast<br />
structure, it is involved in endogenous signaling;<br />
mediating in plant defense mechanisms against<br />
biotic and abiotic stresses (Hayat and Ahmad,<br />
2007). Application of exogenous SA enhanced<br />
the drought stress resistance of wheat plants<br />
223
224<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
(Gomez et al., 1997; Hamada and Al-Hakimi,<br />
2001; Sakhabutdinova et al., 2003; Waseem et<br />
al., 2006), and (Bandurska and Stroi, 2005) on<br />
barely. Proline plays a major role in the antioxidative<br />
stress as a hydroxyl radical scavenger,<br />
it regulate the NAD + /NADH ratio, and as a<br />
protein-compatible hydrotrope (Matysik et al.,<br />
2002). Proline also protects membranes and<br />
proteins against the effects of high<br />
concentrations of inorganic ions (Srinivas and<br />
Balasubramanian, 2000). On the other hand, the<br />
accumulation of low molecular weight solutes<br />
and/or compatible osmolytes may help to<br />
maintain the relatively high water content<br />
necessary for plant growth by balancing the<br />
osmotic pressure of cytosol with that of vacuole<br />
and external environment. It has been reported<br />
that the higher accumulation of proline could be<br />
due to inhibition of proline catabolizing<br />
enzymes, such as proline oxidase and proline<br />
dehydrogenase (Delauney and Verma, 2001).<br />
Since wheat cultivation in Iraq might be<br />
exposed to many damages resulted from the<br />
physical factors such as temperature, salinity and<br />
drought at different periods of growth.<br />
Therefore, the objective of this study is i) to<br />
study the vegetative characteristics, yield<br />
components and biochemical changes induced<br />
by SA under normal and drought conditions ii)<br />
to asses whether exogenous application of SA<br />
could improve the action of drought on plant and<br />
could ameliorate the adverse effects of these<br />
factors, iii) to estimate the changes that occur in<br />
some compatible solute accumulations under<br />
water and stress such as proline and SA, which<br />
are important marker in abiotic stress resistance<br />
as well as some others biochemical constituents.<br />
MATERIALS AND METHODS<br />
The experiment was carried out in<br />
uncontrolled glasshouse of Biology department,<br />
College of Science Education, University of<br />
Salahaddin during the period from November<br />
23, 2009 to March 10, 2010 to determine<br />
whether SA application could enhance growth in<br />
drought stressed plants. The plastic pots with<br />
diameter of 24cm and 21cm in depth with<br />
drainage holes in the bottom were used. Sandy<br />
loam soil was sieved through 4mm pore size<br />
siever, and sterilized by formalin 40% then 7kg<br />
of dried loamy sand soil was put in each pot.<br />
Some chemical and physical properties of the<br />
soil are shown in table (1). Seeds of the wheat<br />
were pre-soaked in neutralized 100ppm SA for<br />
3hrs. Seven grains were placed into each pot and<br />
after germination the plants were thinned to two<br />
per pot. Urea fertilizer (CO(NH 2 ) 2 containing<br />
46.66% N, Phosphorus and Potassium fertilizer<br />
(KH 2 PO 4 ) containing 22.70 %P and % 28.60 K<br />
were added to the pots as solutions after 02days<br />
from sowing at the rates of 75, 75 , 94.5 mg/Kg<br />
for N,P and K, respectively. Seedlings were<br />
sprayed twice with 200ppm SA solution after<br />
30days from sowing and were sprayed with<br />
week interval. Three days after second spray the<br />
seedlings will subject to water deficit for 45days.<br />
They were watered as follow; 0.75, 0.50 or<br />
0.25FC (field capacity). Some pots were<br />
untreated regarded as control and SA treatment<br />
with 100% FC. After drought stress the plants<br />
returned to normal irrigation for plants recovery<br />
and plants survival ability that assessed after<br />
20days. The experiment was designed as<br />
completely randomized design that consisted of<br />
8 treatments with 4 replicates.<br />
Table (1): Some Physical and Chemical properties of<br />
the soils used in the experiment:<br />
Properties Values<br />
Sand% 69.11<br />
Silt% 24.23<br />
Clay% 6.66<br />
Soil texture Sandy Loam<br />
Field Capacity% 13.87<br />
Organic matter% 0.83<br />
Electrical Conductivity (dSm -1 at<br />
25 °C)<br />
0.40<br />
pH 7.42<br />
Total Nitrogen% 0.05<br />
Available Phosphorus (mg Kg-1 1.24<br />
soil)<br />
Soluble Potassium(mg Kg -1 soil) 24.18<br />
Soluble Sodium(mg Kg -1 soil) 19.78<br />
Soluble Chloride(mg Kg -1 soil) 36.75<br />
Biomass changing measurements Shoot and<br />
root dry weight (g/plant)<br />
The roots and shoots of plants in each<br />
replication were dried at 70°C until reaching a<br />
constant weight, then root and shoot dry weights<br />
were measured and the dry weight of root and<br />
shoot per plant was calculated by dividing the<br />
total weight by the number of plants (Ekiz and<br />
Yilmaz, 2003).<br />
Ratio of dry root/ dry shoot per plant<br />
The whole plant was uprooted by pouring<br />
water into the plant's pot to be rinsed from the<br />
soil, and then separated into shoot and root.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
After that, the shoot and the root were oven- dried for 48hrs at 72 °C. The root and shoot dry<br />
weights were measured with weighing<br />
balance. Root: shoot ratio was computed<br />
according to (Luvaha et al., 2008), as follow:<br />
Water content (g/ plant)<br />
After F.W. (fresh weight) measure, shoots<br />
were dried at 110°C for 1hrs to kill tissues then<br />
dried at 70°C for 24hrs. Dry shoots obtain after<br />
being cooled to room temperature for half an<br />
hour (He et al., 2008).<br />
Water content = F.W. – D.wt<br />
Relative growth rate (RGR)<br />
The formula to calculate the relative leaf<br />
growth rate was according to (Liang et al., 2002)<br />
as follow:<br />
RGR = 1/ L � . dL / dt<br />
Lo = Stand for the leaf lengths of selected plants<br />
at the beginning of the treatment.<br />
dL/ dt = Stand for the length increments of<br />
selected leaves per day during the treatment.<br />
Biochemical Determination<br />
Proline determination (µg/g F.wt.)<br />
Proline was determined according to the<br />
method described by Bates et al., (1993).<br />
Approximately 0.5g of fresh leaf material was<br />
homogenized in 10ml of 3% aqueous<br />
sulfosalicylic acid and filtered through<br />
Whatman’s No. 2 filter paper. Two ml of the<br />
filtrate was mixed with 2ml acid-ninhydrin and 2<br />
ml of glacial acetic acid in a test tube. The<br />
mixture was placed in a water bath for 1h at<br />
100°C. The reaction mixture was extracted with<br />
4 ml toluene and the chromophore containing<br />
toluene was aspirated, cooled to room<br />
temperature, and the absorbance was measured<br />
at 520nm Spectrophotometer. Appropriate<br />
proline standards were included for the<br />
calculation of proline in the samples.<br />
Salicylic acid determination (µg/ Kg F.wt.)<br />
Salicylic acid was measured in fresh leaf<br />
extracts as described by Ahmad and Vaid<br />
(2009), with some modifications. 2.0g of sample<br />
was warmed with 25ml ethanol (96%) to melt an<br />
extracted with the solvent it was further<br />
extracted with 25ml twice of ethanol (96%). SA<br />
was prevented by the addition of 1ml of 0.2M<br />
NaOH and the samples were centrifuged<br />
(Heraeus sepatech model) for 15min at 13000g.<br />
The combined extracts were filtered and made<br />
up to 100ml with ethanol (96%). Then 25ml of<br />
the extract was diluted to 50ml in a volumetric<br />
flask with ethanol (96%) and the absorbance<br />
measurements were carried out at 303nm.<br />
Statistical Analysis<br />
All data were analyzed using ANOVAs and<br />
subsequent comparison of means was performed<br />
using Fischer , s Least Significant Differences<br />
(LSD) at p≤ 0.05 for greenhouse experiment<br />
measurements with four replicates and p≤ 0.01<br />
for Laboratory chemical measurements with<br />
three replicates (Snedecor and Cochran, 1989).<br />
Statistical Package for the Social Sciences<br />
(SPSS) and Microsoft Excel Statistical<br />
Programmer were used for all statistical analysis.<br />
RESULTS AND DISCUSSIONS<br />
Biomass changes of shoot and root<br />
Table (2), refers to different levels of drought<br />
stress caused significant decreases in shoot fresh<br />
weight as compared with untreated controls. As<br />
well as, there were not significant differences<br />
between the different levels of drought stress<br />
pre-treated with SA as compared with control.<br />
However, it was observed that the levels of<br />
drought stress pre-treated with SA had higher<br />
shoot fresh weight than those did not pre-treat<br />
with SA. The significant increases in shoot fresh<br />
weight were 5.27 and 4.31g respectively that<br />
gained from 0.25FC + SA and 0.50FC + SA.<br />
The fresh weight of root was significantly<br />
reduced under different levels of drought stress<br />
at the averages of 8.79 and 6.33g root fresh<br />
weight were significantly lowered that obtained<br />
from the levels of 50FC and 25FC respectively<br />
as compared with well watered control. It was<br />
further noted that the levels of drought stress<br />
pre-tread with SA showed significant decreases<br />
as compared with control plants. However, the<br />
different levels of drought stress pre-treated with<br />
SA showed insignificant differences as<br />
compared with those did not pre-treated with SA<br />
except the value of 17.61g from the level of FC<br />
+ SA which was significantly increased.<br />
The dry weight of shoot was significantly<br />
decreased with increasing the levels of drought<br />
stress in comparison with control (table 2). In<br />
addition, it was observed that dry weight of<br />
shoot was decreased under the different levels of<br />
drought stress pre-treated with SA as compared<br />
with control. Moreover, it was found that the<br />
different levels of drought stress pre-treated with<br />
225
226<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
SA showed insignificant effect as compared to<br />
those did not pre-treat with SA except the value<br />
of 1.4g was the significant difference decrease<br />
that obtained from the level of 0.75FC + SA<br />
compared with 0.75FC. From the same table it<br />
was shown that the dry weight of root was<br />
significantly decreased under difference levels of<br />
drought as compared with control. The<br />
maximum decrease in root dry weight was 3.79g<br />
recorded at 0.25FC treatment. It was further<br />
observed that the different levels of drought<br />
stress pre-treated with SA showed significant<br />
decrease in comparison with control except the<br />
level of FC + SA showed insignificant difference<br />
which was 7.18g. Furthermore, the different<br />
levels of drought stress pre-treated with SA<br />
showed insignificant differences as compared<br />
with those did not pre-treated with SA except the<br />
value of 5.06 was significant that obtained from<br />
level of 0.25FC + SA comparing to 0.25FC.<br />
The application of different levels of drought<br />
stress was resulted in significant increases in<br />
ratio of dry root/dry shoot per plant biomass of<br />
wheat plant (table 2). The higher values were<br />
0.73 and 0.78 that obtained from the levels of<br />
0.50FC and 0.25FC respectively as compared<br />
with the well watered control. While, it was<br />
found that the different levels of drought stress<br />
pre-treated with SA showed significant increase<br />
as compared with control except both the<br />
treatments of FC + SA and 0.75FC + SA. Table<br />
(3), refers to insignificant differences of shoot<br />
water content under different levels of drought<br />
stress as compared with control, but the effect of<br />
different levels of drought stress pre-treated with<br />
SA showed significant increases comparing with<br />
control. Furthermore, it was found that the<br />
different levels of drought stress pre-treated with<br />
SA showed significant increase at both<br />
treatments 0.50FC + SA and 0.25FC + SA which<br />
were 21.83 and 22.2g respectively as compared<br />
to those did not pre-treat with SA. The results<br />
found in the same table, demonstrate that water<br />
content of root was shows insignificant<br />
differences except the level of 0.25FC as<br />
compared with control. In addition the different<br />
levels of drought stress pre-treated with SA<br />
showed significant decrease at both 0.50 FC +<br />
SA and 0.25FC + SA levels in comparison to<br />
control.<br />
The relative growth rate of leaf was gradual<br />
decreased significantly as the drought stress<br />
levels increased (table 3). In addition, it was<br />
observed that the different levels of drought<br />
stress pre-treated with SA showed significant<br />
increases on the relative growth rate of leaf. As<br />
well as, it was found that the different levels of<br />
drought stress pre-treated with SA showed<br />
significant increase except the value of<br />
0.28mm/day at the level of 0.25FC + SA was not<br />
significant as compared to those did not pretreated<br />
with SA. The data showed significant<br />
decreases in shoot fresh weight, relative growth<br />
rate of leaf and shoot dry weight as compared<br />
with untreated controls, but it was noted that the<br />
levels of drought stress pre-treated with SA<br />
significantly increased the shoot fresh weight,<br />
relative growth rate of leaf and water content of<br />
shoot in comparison with those did not pre-treat<br />
with SA. These finding results agreed with<br />
(Gomez et al., 1997; Hamada and Al-Hakimi,<br />
200;Waseem et al., 2006) in wheat plants. The<br />
significant decreases in the above mentioned<br />
biomass changes of shoot under drought stress<br />
could be interpreted that as plant undergoes<br />
water stress the water pressure inside the leaves<br />
is decreased, therefore the plant wilts and further<br />
development of water stress symptoms reduced<br />
(Lambers et al., 2008). To survive under these<br />
conditions the plants undertake various<br />
mechanisms adaptations to maintain their growth<br />
and development (Chaves et al., 2003). Decline<br />
in photosynthetic rate might be due to stomatal<br />
closure which reduces CO2/O2 ratio in leaves and<br />
inhibits photosynthesis (Janson et al., 2004).<br />
Stomatal closure is one of the earliest responses<br />
to drought protecting the plant from extensive<br />
water loss so drought stress led to a noticeable<br />
decrease in stomatal conductance (Chaves et al.,<br />
2003). Whereas, a common adverse effect of low<br />
water potential stress is the reduction in fresh<br />
and dry biomass of shoot production occurred<br />
probably due to the ABA action in which it is<br />
produced in the cells under abnormal conditions<br />
and this way inhibit the cell division and/or<br />
DNA synthesis (Lobato et al., 2008). The<br />
significant increases in the biomass changes of<br />
shoot those previously mentioned may be due to<br />
the role of exogenously applied of SA through<br />
foliar spray caused an increase in photosynthetic<br />
rate under the drought stress conditions and SA<br />
induced increase in photosynthesis can be<br />
associated with stomatal factors (Athar and<br />
Ashraf, 2005). Application of SA induce<br />
increase in leaf water content has been<br />
emphasized as better indicater of water status of<br />
a plant so that they may have a good chance to<br />
survive in the dry period. Effect of SA on<br />
biomass changes of root caused significant<br />
decreases in the root fresh weight and root dry<br />
weight under different levels of drought<br />
conditions as compared with control. Whereas,<br />
both parameters mentioned above as well as
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
water content of root were decreased<br />
significantly under different levels of drought<br />
stress pre-treated with SA in comparison with<br />
control. These results agree with (Gomez et al.,<br />
1997; Waseem et al., 2006) in wheat plants. The<br />
significant decrease in the root fresh weight and<br />
root dry weight can be interpreted accordingly<br />
the main reason which creates decrease in<br />
growth parameters due to chemical signals from<br />
the root system may affect the stomatal<br />
responses to water stress. Stomatal conductance<br />
is often much more closely related to soil water<br />
status than to leaf water status and affected by<br />
soil water status is the root system, in the fact<br />
dehydrating only part of the root system may<br />
cause stomatal closure, so the stomata can<br />
respond to conditions sensed in the roots by<br />
ABA hormone (Taiz and Zeiger, 2003). Whereas<br />
significant reduction of biomass changes<br />
parameters of root by SA may be interpreted that<br />
primary consequence of drought is osmotic<br />
stress led to high concentration of Na +<br />
negatively affected the inter cellular K +<br />
accumulation presumably either by competing<br />
for sites through which influx of both cations<br />
occurs or affecting membrane stability causing<br />
leakage of K + may lead to water deficit in root<br />
tissues and loss of turgor (Wated et al., 1991).<br />
The application of different levels of drought<br />
stress was led to significant increases in ratio of<br />
dry root/dry shoot per plant as compared with<br />
the control, and was found that the different<br />
levels of drought stress pre-treated with SA<br />
showed significant increase as compared with<br />
control. These increases in ratio of dry root/dry<br />
shoot per plant could be due to the different<br />
response of root and shoot growth of this<br />
cultivar wheat plant to water stress. Therefore<br />
there was an increase in root/shoot ratio under<br />
water deficit conditions (Hamblin et al., 1990).<br />
Such variation have been due to increased<br />
accumulation of assimilates diverted to root<br />
growth differential sensitivities of the roots and<br />
shoots to endogenous ABA or to a greater<br />
osmotic adjustment in roots compared with<br />
shoots (Sharp and Davies, 1989). However, SA<br />
treatments was manifested in the present<br />
investigation with respect to ionic balance which<br />
is considered as one of the most complicated and<br />
integral parts of plant activities the action<br />
imbalance is one of the most basic disorders due<br />
to drought stress (Al-Hakimi, 2006). This may<br />
be happened because of osmotic adjustment<br />
which occurs in roots although compared to<br />
leaves the process is less well understood as with<br />
leaves, these changes may increase water<br />
extraction from the previously explored soil only<br />
slightly. However osmotic adjustment can occur<br />
in the root meristems enhancing turgor and<br />
maintaining root growth (Taiz and Zeiger,<br />
2003).<br />
Table (2): Effect of different levels of drought stress (%field capacity) with or without pre-treated with (SA) on<br />
biomass changes of wheat plant:<br />
Treatments<br />
Control(FC)<br />
0.75FC<br />
0.50FC<br />
0.25FC<br />
FC+SA<br />
0.75FC+SA<br />
0.50FC+SA<br />
0.25FC+SA<br />
L.S.D<br />
p≤ 0.05<br />
Fresh wt.<br />
(g/plant)<br />
29.13<br />
26.13<br />
23.64<br />
22.10<br />
31.45<br />
28.54<br />
27.95<br />
27.37<br />
2.25<br />
Shoot Root Ratio of dry root/<br />
Dry wt.<br />
(g/plant)<br />
Fresh wt.<br />
(g/plant)<br />
11.04 13.97<br />
8.95<br />
6.27<br />
5.16<br />
10.96<br />
7.55<br />
6.11<br />
5.16<br />
0.49<br />
10.61<br />
8.79<br />
6.33<br />
17.61<br />
Dry wt.<br />
(g/plant)<br />
SA: Grains pre-soaked in 100ppmSA for 3hrs and the seedlings were sprayed twice with 200ppmSA<br />
9.83<br />
8.71<br />
7.24<br />
3.43<br />
6.45<br />
4.73<br />
4.38<br />
3.79<br />
7.18<br />
4.90<br />
4.98<br />
5.06<br />
0.94<br />
dry shoot per plant<br />
0.61<br />
0.54<br />
0.73<br />
0.78<br />
0.66<br />
0.63<br />
0.86<br />
0.96<br />
0.11<br />
227
228<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
Table (3): Effect of different levels of drought stress (%field capacity) with or without pre-treated with (SA) on water<br />
content of shoot and root and relative growth rate of leaf after 20days from SA treatment:<br />
Treatments<br />
Control(FC)<br />
0.75FC<br />
0.50FC<br />
0.25FC<br />
FC+SA<br />
0.75FC+SA<br />
0.50FC+SA<br />
0.25FC+SA<br />
L.S.D<br />
p≤ 0.05<br />
Water content of<br />
shoot(g/plant)<br />
Biochemical Characters<br />
Proline content of shoot (µg/g shoot fresh wt.)<br />
As illustrated in Table (4), the different levels<br />
of drought stress led to significant increase in<br />
proline content of shoot as compared with<br />
control, and there were significant differences<br />
between drought stress levels. The maximum<br />
value was 11.61µg/g shoot fresh weight at the<br />
level of 0.25FC, also the different levels of<br />
drought stress pre-treated with SA showed<br />
significant increases on proline content as<br />
compared to their controls. As well as, it was<br />
found that the different levels of drought stress<br />
pre-treated with SA showed higher proline<br />
content than those did not pre-treated with SA in<br />
which the maximum value was 22.88µg/g shoot<br />
fresh weight at the level of 0.50FC+SA. These<br />
results are agreement with (Sakhabutdinova et<br />
al., 2003) on wheat plant. According to<br />
suggestment of (Kaiser, 1982) that proline<br />
accumulation may be associated with stress<br />
tolerance in wheat it was found many species<br />
that changes in metabolic activities due to<br />
decrease in water potential disappear when rates<br />
are compared on the basis of equal relative water<br />
content. In addition, application of SA also<br />
induced accumulation of proline in seedlings.<br />
Endogenous SA content of shoot (µg/Kg shoot<br />
fresh wt.)<br />
The results presented in Table (4) indicate<br />
that the effect of drought stress showed<br />
Water content of root<br />
(g/plant)<br />
Relative growth of leaf<br />
(mm/day)<br />
18.09 7.64 0.43<br />
17.18 5.88 0.41<br />
16.96 4.41 0.35<br />
16.94 2.54 0.28<br />
20.48 10.43 0.49<br />
20.99 4.92 0.45<br />
21.83 3.73 0.40<br />
22.20 2.18 0.28<br />
2.38 3.28 0.02<br />
significant differences on endogenous SA<br />
content of shoot. Endogenous SA content of<br />
shoot was 3.60µg/g shoot fresh weight observed<br />
on the control; increased significantly to<br />
11.81µg/g shoot fresh weight with the drought<br />
level of 0.25FC. While the different levels of<br />
drought stress pre-treated with SA showed<br />
significant increases as compared with their<br />
controls. However, the different levels of<br />
drought stress pre-treated with SA showed<br />
higher than those did not pre-treated with SA in<br />
which the higher values were 98.79 and<br />
118.19µg/g shoot weight at the level of 0.50FC<br />
+ SA and 0.25FC + SA respectively. This<br />
finding result observed for the first time in wheat<br />
plant; agree with (Bandurska and Stroi, 2005) in<br />
barley. Therefore, further studies may be<br />
required to test this parameter. These increases<br />
might be due to that treatments with SA greatly<br />
alleviate the harmful effect of drought stress on<br />
wheat plants by increasing levels of endogenous<br />
growth hormone salicylic acid and induced the<br />
appearance of water defense proteins. Therefore<br />
induction of specific protein is a common<br />
response of plants to various environmental<br />
stresses (El-Khallal et al., 2009). On the other<br />
hand activation of antioxidant enzymatic system<br />
induced by pre-treat with SA may contribute to<br />
its anti stress effects in plants and contribute<br />
substantially to SA induced adaptation to<br />
subsequent stress conditions (Sakhabutdinova et
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
al., 2003).<br />
Table (4): Effect of different levels of drought stress (%field capacity) with or without pre-treated with (SA) on<br />
the proline and endogenous SA content of wheat plant:<br />
Treatments<br />
Control(FC)<br />
0.75FC<br />
0.50FC<br />
0.25FC<br />
FC+SA<br />
0.75FC+SA<br />
0.50FC+SA<br />
0.25FC+SA<br />
Proline content<br />
(µg/Kg shoots fresh wt.)<br />
Salicylic acid content<br />
(µg/Kg shoots fresh wt.)<br />
2.05 3.60<br />
6.53 8.86<br />
6.91 11.42<br />
11.61 11.81<br />
10.62 43.32<br />
16.46 67.84<br />
22.88 98.79<br />
17.58 118.19<br />
L.S.D p≤ 0.01 2.36 7.90<br />
REFERENCES<br />
- Ahmad, I. and F.H.M. Vaid. (2009). Determination of<br />
benzoic acid and salicylic acid in commercial<br />
benzoic and salicylic acids ointments by<br />
spectrophotometric method. Pak. J. Pharm. Sci., 22,<br />
18-22.<br />
- Al-Hakimi, A.M.A. (2006). Counteraction of drought<br />
stress on soybean plants by seed soaking in salicylic<br />
acid. J. Bot., 2, 421-426.<br />
- Al-Najafi, S.T. (1989). Rainfed Agricultural Production<br />
Economics. University of Mosel, Iraq, (1989).<br />
- Ansari, M.S. and N. Misra. (2007). Miraculous role of<br />
salicylic acid in plant and animal system. Am. J.<br />
Plant Physiol., 2, 51-58.<br />
- Ashraf, M. (1999). Breeding for salinity tolerance in<br />
plants. Critical Reviews in Plant Sci., 13, 17-42.<br />
- Athar, H. and M. Ashraf. (2005). Photosynthesis under<br />
drought stress. In: Hand Book of Photosynthesis,<br />
2nd (Ed.) by M. Pessarakli. C.R.C. Press, New<br />
York, USA, 795-810.<br />
- Bandurska, H. and A. Stroi. (2005). The effect of salicylic<br />
acid on barley response to water deficit. Springer<br />
Berlin / Heidelberg. J. Acta Physiol. Plant, 27, 379-<br />
386.<br />
- Bates L. S., Waldern R. P. and D. Teare. (1993). Rapid<br />
determination of free proline for water stress<br />
studies. Plant and Soil, 39, 205-207.<br />
- Chaves, M.M., J.P. Macroco and J.S. Pereira. (2003).<br />
Understanding plant response to drought: From<br />
genes to the whole plant. Plant Biol., 30, 239-264.<br />
- Delauney, A.J. and D.P.S. Verma. (2001). Proline<br />
biosynthesis and osmoregulation in plants. Plant J.,<br />
4, 215-223.<br />
- Ekiz, H. and A. Yilmaz. (2003). Determination of the salt<br />
tolerance of some barley genotypes and the<br />
characteristics affecting tolerance. Turk. J. Agric.<br />
For., 27, 253-260.<br />
- El-Khallal, S.M., T.A. Hathout, A.A. Ahsour and A.A.<br />
Kerrit. (2009). Brassinolide and salicylic acid<br />
induced antioxidant enzymes, hormonal balance<br />
and protein profile of maize plants grown under salt<br />
stress. Res. J. Agric. Biol. Sci., 5, 391-402.<br />
- Gomez, L., L. Blanca and C.S. Antonio. (1997). Evidence<br />
of the beneficent action of the Acetylsalicylic acid<br />
on wheat genotypes yield under restricted irrigation.<br />
Livestock and Agriculture Mexico, 112, 432-441.<br />
- Gooding, M.J. and W.P. Davies. (1997).. Wheat<br />
Production and Utilization System, Quality and<br />
Environment. CBA International Cambridge Univ.<br />
UK.<br />
- Hamada, A.M. and A.M.A. Al-Hakimi. (2001). Salicylic<br />
acid versus salinity- drought-induced stress on<br />
wheat seedling. Rostl. Výr., 47, 444-450.<br />
- Hamblin, A., D. Tennant and M.W. Perry. (1990). The<br />
cost of stress: Dry matter partitioning changes with<br />
seasonal supply of water and nitrogen to dry land<br />
wheat. Plant and Soil, 122, 217-258.<br />
- Harlan, G.R. (1991). The Early History of Wheat. Wheat<br />
science, today and tomorrow. Cambridge Univ. UK.<br />
- Hayat, S. and A. Ahmad. (2007). Salicylic Acid. A plant<br />
229
230<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
Hormone. Springer. (Ed). Dortrecht, Netherlands.<br />
- He, Y., Y. Liu, W. Cao, M. Huai, B. Xu and B. Huang.<br />
(2005). Effects of salicylic acid on heat tolerance<br />
associated with antioxidant metabolism in<br />
Kentucky bluegrass. Am. Crop Sci. Soci., 45, 988-<br />
995.<br />
- Janson, J.G., G.R. Thomas and D. Mason-phar. (2004).<br />
Heat and drought influence photosynthesis, water<br />
relations, and soluble carbohydrates of two<br />
ecotypes of redbud (Cercis Canadensis). J. Am.<br />
Soc. Hort. Sci., 129, 497-502.<br />
- Kaiser, W.M. (1982). Correlation between changes in<br />
photosynthetic activity and changes in total<br />
protoplast volume in leaf tissue from hygrophytes,<br />
mesophytes and xerophytes under osmotic stress.<br />
Planta, 154, 538-545.<br />
- Kozlowski, T.T., P.J. Kramer and S.G. Pallardy.<br />
(2000).The Physiological Ecology of Woody<br />
Plants. Acad. Press, San Diego.<br />
- Lambers, H., F.S. Chapin and T. L. Pons. (2008). Plant<br />
Physiological Ecology. Springer Sci. Bus. Media.<br />
2 nd edition, 297.<br />
- Liang, Z., F. Zhang, M. Shao and J. Zhang. (2002). The<br />
relations of stomatal conductance, water<br />
consumption, growth rate to leaf water potential<br />
during soil drying and rewatering cycle of wheat<br />
(Triticum aestivum). Bot. Bull. Acad. Sin., 43, 187-<br />
192.<br />
- Lobato, A.K.S., R.C.L. Costa, C.F.O. Neto, B.G.S. Filho,<br />
F.J.R. Cruz, J.M.N. Freitas and F.C. Cordeiro.<br />
(2008). Morphological changes in soybean under<br />
progressive water stress. Intern. J. Bot., 4, 231-235.<br />
- Luvaha, E., G.W. Netondo and G. Ouma. (2008). Effect<br />
of water deficit on the physiological and<br />
morphological characteristics of mango (Manigifera<br />
indica) rootstock seedlings. Am. J. Plant Physiol.,<br />
3, 1-15.<br />
- Matysik, J.A, B. Bhalu and P. Mohanty. (2002).<br />
Molecular mechanisms of quenching of reactive<br />
oxygen species by proline under stress in plants.<br />
Current Science, 82, 5-10.<br />
- Raskin, I. (1992). Salicylate, a new plant hormone. Plant<br />
Physiol., 99, 799-803.<br />
- Sakhabutdinova, A.R., D.R. Fatkhutdinova, M.V.<br />
Bezrukova and F.M. Shakirova. (2003). Salicylic<br />
acid prevents damaging action of stress factors on<br />
wheat plants. Bulg. J. Plant Physiol., 43, 214-319.<br />
- Sharp, R.E. and W.J. Davies. (1989). Regulation of<br />
growth and development of plants with a restricted<br />
supply of water. In: Plants under stress. (Eds.): H.G.<br />
Jone et al. Cambridge Univ. Press, Cambridge,<br />
England, 71-93.<br />
- Snedecor, G.W. and W.G. Cochran. (1989). Statistical<br />
Methods. Seventh edition. The Iowa State<br />
University Press U.S.A, 215-298.<br />
- Srinivas, V. and D. Balasubramanian. (2000). Proline is a<br />
protein-compatible hydrotrope. Langmuir, 11,<br />
2830-2833.<br />
- Taiz, L. and E. Zeiger. (2003). Plant Physiology, 3 th<br />
edition, Sinauer Associ., Inc. Publ., 671-677.<br />
- Waseem, M.; H.U.R. ALhar and M. Ashraf. (2006). Effect<br />
of salicylic acid applied through rooting medium on<br />
drought tolerance of wheat. Pakistan, J. of Bot., 38,<br />
1127-1136.<br />
- Wated, A.E., M. Reuveni, R.A. Bressan and P.M.<br />
Hasegawa. (1991). Enhanced net K + uptake<br />
capacity of NaCl adapted cells. Plant Physiol., 95,<br />
1265-1269.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 223-231, 2011<br />
ة اتـضش ىزةـط ىـكةوووز ىةـشةط زةضةل كيليطيلاض ىشست ىكَيلزاك ىةزابةل<br />
ةتـخوــث<br />
ةوازدمانجةئ ةيةوةنيرَيوت مةئ<br />
شَيث ىوؤت ةل ةووتاوكَيث<br />
ةكةوة دسكيقات . ى اكشوو ىزاشف ىخؤدوزاب سَيذ ةل 6 ماش ىنشةض (Triticum aestivum L.)<br />
َىض ىةوام ؤب ىمقو ىاطَيوز ةب ) نؤيلم ةل شةب 011(<br />
ىتضةخ ةب كيليطيلاض ىشست ىةوايرط ةب واسكةَلةمام تخةو<br />
سَيذ ة اسخ ةوة دسكيقات ى اكةكةوووز .) نؤيلم ةل شةب 011(<br />
ىتضائ ةب كيليطيلاض ىشست ةب َلاةط ى د اذوسث ةو سَيمرتاك<br />
زةـض ةـل ةوةـنيرَيوت ةو ) 0.25FC ،0.50FC<br />
،0.75FC(<br />
شاواـيو ىتـضائ ةـب واوةـتا<br />
ى ادواـئ ىزاـشف ىخؤدوزاـب<br />
ة د ـ ن ي ش ة ـ ي ز ا ك ا وز ؤ ط َى د ـ ة ه ة و ة وز و ى ط ة ش و ة ـ ض ى ة ـ ل ة م ؤ ك ة ـ ل ة ـ ي ز ة ه ؤ ب ا س ك ة ت ض ز ا ب ة د ن ي ش ى ا ك ة ت ة َل ض ة خ<br />
ةـب ازدمانجةئ<br />
ؤب ناي ىزامائ ىزاكيش ناكةمانجةئ<br />
. ازدمانجةئ ناكةكةوووز ةل ىطةشوةض ىةلةمؤك ؤب ناكةييوايميك<br />
ن ا ك ة ـ َل ة م ا م ى ا س ـ ك َي ت ى م ا نج ة ـ ئ ة و ة ـ ي ة َل ة م ا م ز ة ـ ه ؤ ـ ب ة ز ا ـ ب و و د ز ا و ـ ض ة ـ ب و ا و ة ت ى ك ة م ة وز ة ه ى ن ي ا ص ي د ى ا ن َي ه ز ا ك ة ب<br />
ىوو اخ وا ةل ىكةوووز ى اكةتةَلضةخ ؤب 1010 ىتضائ ةل ) L.S.D. ( ىتةوزةنب ىشاوايو نيترمةك ىؤه ةب ناسكدزووازةب<br />
. نووباسك ؤب نايزاكيش ةطيقات ةل ةك ةكةوووز ى اكةييوايميك ةتةَلضةخ ؤب 1010 ىتضائ ةو . نووباسكزامؤت ىيةشوش<br />
ى ا ك ة ت ة َل ـ ض ة خ ى ة ـ ن ي ز ؤ ش ة ـ ل ز ة ـ ط ي ز ا ك ى و و ب د ا ـ ي ش ى ؤ ـ ه ة و ـ ب ك ي ل ي ـ ط ي ل ا ض ى ـ ش س ت ة ب ة ك ة ك ة و و وز ى د س ك ة َل ة م ا م<br />
ىوزةت ىشَيك<br />
ةل نووب تييسب ةك واوةتا ى ادوائ ىزاشف ىخؤدوزاب سَيذ ةل ةوز و ىطةشوةض ىةلةمؤك ىةتضزابةدنيش<br />
ةو ىطةشوةض ىةلةمؤك ىكشوو ىشَيك زةض ةل ةوز ىكشوو ىشَيك ىةرَيوز و ىطةشوةض ىةلةمؤك ىوائ ىةرَيوز و<br />
ىمةك ىطةشوةض ىةلةمؤك ىكشوو ىشَيك و ةوز ىكشوو ىشَيك و ةوز ىوائ ىةرَيوز ىضةك َلاةط ىيةرَيوز ىةشةط<br />
ى ووبداـيش كيليـطيلاض ىـشست و لؤوسـث ىوسب ةو نووباسكة ةَلةمام تخةو شَيث ةك ىة اوةئ ةب دزووازةب دسك<br />
واوةـت ا ى ادوائ ىخؤدواب سَيذ ةل كيليطيلاض ةب نووباسكةَلةمام ةك ىة اكةوووز وةئ ةل ووبزايد ةوَيث ىزةطيزاك<br />
. كيليطيلاض ةب نووباسكة ةَلةمام تخةو شَيث ةك ىة اوةئ ةب دزووازةب<br />
نةص ) Triticum aestivum L. ( ةيويةتلا ةةطنحلا تابن ومن يف كيلسلاسلا ضماح<br />
ريثات ةساردل<br />
يةةف ف ةةج 011(<br />
يةةةف ف ةةج 011(<br />
لا<br />
ةصلاخلا<br />
ةساردلا هذه تيرجأ<br />
ةةي ريض كيلةةسلاسلا ضماةةح سوةلحمض اقبةةسم رلاذةةبلا ةةةلماةم اةةت دةقل . ي اةةملا ئاةةاجدا جلارةةو تةةحت 6 اةش<br />
ةةي ريض كيلةةسلاسلا ضماةةح سوةةلحمض لارلادا ر اةةث حةةم لا تاااةةس ةةةثلاث عدةةمل رةةم لا ةةةقيرطض ) وةةيلملا<br />
.) 0.25FC ، 0.50FC ، 0.75FC(<br />
ةةةليخم تايويةسمض يقسلا يف صقنلا ئااجا جلارظل تاتابنلا تضرا<br />
ةةةي امي ويابلا تارةةي يلا ضةةةض كلذةة لا ررذةةولا لا ررةةلخلا بوةةموملا حةةم يةةيل ةةةيويحلا ةةةلييلا ص اةةتك يةةف خةةحبلا اةةت<br />
. تاتابنلل ررلخلا بوموملل<br />
يةيل تارارةيم ةةةضركض يةمايلا ي اوةتةلا ايمةتيلا ادخيةساض اةايلا سوةتحلا اةت ييلا ج اينلل ي اتحدا<br />
ييلحيلا ررجأ<br />
ااةسايق اةت يةيلا ةةيتابنلا ص اةتخلل 1010 ويةسم تحت ) L.S.D. ( رونةم لرف يقأ رابيكا ادخيساض ج اينلا تنروقلا ةلماةم<br />
ضماةةحض تاةةبنلا ةةةلماةم تئأ . رةةبيخملا يةةف اةةاليلحت<br />
اةةت يةةيلا ةةةيلاايمييلا ص اةةتخلل 1010 ويةةسم لا يجاةةج لا تةةيبلا يةةف<br />
ي اةملا ئاةاجدا جلارةو تحت رذولا لا ررلخلا بوموملل ةيويحلا ةلييلا ص اتك اظةم يف ةيونةم عئايز ىلا كيلسلاسلا<br />
بوةموملل جاةولا زلا ىةلا رذةولل جاةولا زلا ةبةسنلا ررةلخلا بوةموملل ي اةملا وةيحملالا ررةطلا زوةلا تنمةلت ييلالا<br />
ةةنراقم رذةولالا ررةلخلا بوةموملل جاةولا زوةلا لا رذةولل ي اةملا وةيحم ضةةخنا اةمنيض ةةقرولل يبةسنلا<br />
وةمنلالا ررةلخلا<br />
اقبةسم ةةلماةملا تاةتابنلا يةف كيلةسلاسلا ضماح لا حيللاربلا ويحم يف ةيونةم عئايز تراوا دقللا<br />
. ةلماةملا ري لا تاتابنلاض<br />
.<br />
ةلماةملا ريغ تاتابنلاض<br />
ةنراقم يقسلا يف صقنلا ئااجا جلارو تحت كيلسلاسلا ضماحض<br />
.)<br />
ويلملا<br />
231
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
232<br />
BACTERIOLOGICAL STUDY AND ANTIBACTERIAL ACTIVITY OF<br />
HONEY AGAINST SOME PATHOGENIC BACTERIA ISOLATED<br />
FROM BURN INFECTIONS<br />
SUHAILA N. DAROGHA * and AHMED A.Q.A.S. AL-NAQSHBANDI **<br />
* Dept. of Biology, College of Education, Scientific Dept., University of Salahaddin, Kurdistan Region-Iraq<br />
** Dept. of Laboratory, Rizgary Teaching Hospital, Ministry of Health, Kurdistan Region-Iraq<br />
(Received: January 31, 2010; Accepted for publication: December 30, 2010)<br />
ABSTRACT<br />
This study was conducted at Emergency Management Center (EMC) in Erbil city to analyze (Isolation and<br />
Identification) the bacterial isolates from infected burn wounds of patients admitted to the burns unit and to<br />
determine the sensitivity pattern of the cultured bacteria to some commonly antibiotics and different honeys as<br />
antibacterial agent. A total of 50 samples (surface swab) were analyzed, 45 positive samples yielding 73 isolates, of<br />
which 59 (80.82%) were Gram-negative bacteria and 14 (19.18%) Gram-positive bacteria. The mean age was 21.51<br />
years (range: 1-45 years) and infection was most prevalent in age group 21-25 (37.77%). Among the patients, 32<br />
(71.11%) were female and 13 (28.89%) male with highest percentage of staying in the hospital occur for (6-10) days.<br />
Flame 35 (77.78%) was the most common cause of burn injuries and 25 (55.56%) of a total patients had third degree<br />
burns. The most common bacterial isolates were Pseudomonas aeruginosa 33 (45.21%), Klebsiella pneumoniae 23<br />
(31.51%), Staphylococcus aureus 11 (15.06%), Staphylococcus epidermidis 3 (4.11%), Proteus mirabilis 2 (2.74%) and<br />
Escherichia coli 1 (1.37%). The results of the antibiotics susceptibility showed that Gram-negative bacteria were<br />
highly sensitive to Amikacin 76.65%, Chloramphenicol 75.79%, Gentamicin 69.70% and Ciprofloxacin 68.87% while<br />
Gram-positive bacteria were more sensitive to Vancomycin 100% and Clindamycin 90.90%. Different honey samples<br />
investigated for their in vitro antibacterial activity against antibiotic resistant bacterial isolates showed that excellent<br />
antibacterial activity against Gram-negative and Gram-positive bacteria at 20% concentration for Qandel and<br />
Peshtashan honey (except K. pneumoniae and S. aureus, the MIC was at 30% concentration of Peshtashan honey)<br />
while 30% concentration for Sunbulah honey.<br />
KEYWORDS: Burn wound infection, Gram-positive and negative bacteria, Antibiotic sensitivity, honey as antibacterial agent.<br />
B<br />
INTRODUCTION<br />
urn is a type of injury that might be<br />
caused by a wide variety of substances<br />
and external sources such as exposure to<br />
chemicals, friction, electricity, heat and<br />
radiation. Burns remain a significant public<br />
health problem in term of morbidity, long-term<br />
disability and mortality throughout the world,<br />
especially in economically developing countries,<br />
it has been estimated that 75% of all deaths<br />
following burn injuries are related to infection<br />
(Singh et al., 2003 and Nasser et al., 2003).<br />
Thermal injury destroys the skin barrier that<br />
normally prevents invasion of microorganisms,<br />
making the burn wound the most frequent origin<br />
of sepsis in these patients (Vindenesm and<br />
Bjerknes, 1995). Burn patients become<br />
susceptible to infection due to the loss of this<br />
protective barrier and decreased cellular and<br />
humoral immunity (Wong et al., 2002). The<br />
organisms that predominate as causative agents<br />
of infection in any burn treatment facility change<br />
over time. Gram-positive bacteria are initially<br />
prevalent, then gradually become superceded by<br />
the Gram-negative opportunistic that appear to<br />
have a greater propensity to invade (Manson et<br />
al., 1992). The common pathogens isolated from<br />
burn wounds include aerobic organism like S.<br />
aureus, P. aeruginosa, Klebsiella spp. and<br />
various coliform bacilli, anaerobic organisms<br />
like Bacteroides fragilis and Fusobacterium<br />
spp. and fungi like Candida albicans and<br />
Aspergillus spp. (Revathi et al., 1998 , Macedo<br />
and Santos 2005). Multi-drug resistant bacteria<br />
have been reported as the cause of nosocomial<br />
outbreaks of infection in burn units or as<br />
colonizers of the wounds of burn patients<br />
(Agnihotri et al., 2004).<br />
Anti-infective drugs are critically important<br />
in reducing the global burden of infectious<br />
disease. Antibiotic-resistant bacteria pose a very<br />
serious threat to public health. For all kinds of<br />
antibiotics, including the major last-resort drugs,
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
the frequencies of bacterial resistance are<br />
increasing worldwide and the effectiveness of<br />
the drugs is diminished, therefore alternative<br />
antimicrobial strategies are urgently needed<br />
(World health organization 1999 , Levy and<br />
Marshall 2004).<br />
Since ancient times, honey has been used for<br />
its medicinal properties to treat a wide variety of<br />
ailments. In particular, it has been used as a<br />
dressing for wounds (including surgical<br />
wounds), burns, respiratory and gastrointestinal<br />
infections, skin ulcers and various other<br />
diseases. Microbial resistance to honey has never<br />
been reported, which makes it a very promising<br />
topical antimicrobial agent (Cooper et al., 2002<br />
and Mulu et al., 2004).<br />
Recently, many researchers have reported the<br />
antibacterial activity of honey against S. aureus,<br />
P. aeruginosa, E. coli, P. mirabilis, Shigella<br />
dysenteriae and Klebsiella spp. (Cooper et al.,<br />
2002, Agbaje et al 2006 and Adebolu, 2005).<br />
The ability of honey to kill microorganisms have<br />
been attributed to its high osmotic effect, high<br />
acidic nature, hydrogen peroxide concentration<br />
and its phytochemical nature such as flavinoids<br />
and phenolic acids (Bang et al., 2003). A<br />
number of reasons for this have been suggested:<br />
shrinkage disruption of the bacterial cell wall<br />
due to the osmotic effect of the sugar content,<br />
induction of an unfavorable environment with<br />
low-water activity, thereby inhibiting bacterial<br />
growth (Anand and Shanmugam, 1998).<br />
The aim of this study was to determine the<br />
occurrence of some pathogenic bacteria in burn<br />
wound infection and their sensitivity pattern to<br />
commonly used antibiotics, also to investigate<br />
the activity of different honeys against some<br />
pathogenic bacteria were isolated from burn<br />
wound infections.<br />
MATERIALS AND METHODS<br />
Sample collection<br />
This study was done on 50 patients admitted<br />
to Emergency Management Center (EMC) in<br />
Erbil city between 1 / July / 2009 and 15 /<br />
September / 2009. Surface wound swabs<br />
obtained from the burn patients aseptically by<br />
sterile swabs and collected in sterile capped<br />
tubes contained normal saline (0.9%), then<br />
directly transferred to the bacteriological<br />
department in Hawler Teaching Hospital.<br />
Bacterial isolation and identification<br />
Samples were inoculated on Blood agar and<br />
MacConkey agar by streaking method and<br />
incubated at 37 ° C for 18-24 hours. Cultures<br />
were carried according to Brooks et al (2007).<br />
Susceptibility test<br />
Mueller-Hinton agar was used for<br />
determining the sensitivity of bacteria by single<br />
disk diffusion method using Kirby Bauer method<br />
(Morello et al., 2003). The antibiotics tested for<br />
Gram-positive cocci were: Amoxicillin +<br />
Clavulanic acid (30µg + 10µg), Erythromycin<br />
(15µg), Trimethoprim (10µg), Ceftriaxone<br />
(10µg), Clindamycin (2µg), Cephalexin (30µg)<br />
and Penicillin (10µg); for Gram-negative bacilli<br />
were: Piperacillin (100µg), Nitrofurantion<br />
(300µg), Nalidixic acid (30µg), Cephalothin<br />
(30µg), Amikacin (30µg), Ceftazidime (30µg)<br />
and Deoxycycline (10µg); and for both of them:<br />
Ciprofloxacin (10µg), Chloromphenicol (30µg)<br />
and Vancomycin (30µg).<br />
Preparation of bacterial suspension<br />
Transfer loopful of highest antibiotic resistant<br />
bacteria to the test tube containing 5 ml nutrient<br />
broth, then incubated at 37 °C for 24 hours, then<br />
the bacterial number adjusted using a standard<br />
curve (Morello et al., 2003).<br />
Determination of minimum inhibitory<br />
concentration (MIC) of honey<br />
The MIC of different type of honey determined<br />
by turbidity method (spectrophotometer method)<br />
at 600 nm. The different concentrations of honey<br />
(v/v) were prepared in 5 ml nutrient broth<br />
medium to give final concentration of 10%,<br />
20%, 30%, 40%, 50%, 60%, 70% and 80%, then<br />
added 0.05 ml of bacterial suspension to each<br />
test tube which contains nutrient broth with<br />
different concentration of honey, then incubated<br />
in shaker incubator over night at 37 °C.<br />
RESULTS AND DISCUSSION<br />
The Burn wound is considered one of the<br />
major health problems in the world, and<br />
infection is one of the most frequent and sever of<br />
complications in patients who have sustained<br />
burns (Zorgani et al., 2009). In the present study,<br />
we recovered 73 isolates from 50 surface swabs<br />
which were taken from burn wound infection<br />
and 45(90%) of these swabs were positive, of<br />
which 59(80.82%) were Gram-negative bacteria<br />
and 14(19.18%) Gram-positive bacteria (Table<br />
1). This finding is supported by many<br />
investigators which found that initially there is<br />
colonization by Gram-positive bacteria from the<br />
patients resident cutaneous flora which is<br />
replaced later by Gram-negative bacteria, mainly<br />
from the patients gastrointestinal flora (Jinfu et<br />
233
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
al., 1997, Macedo and Santos, 2005 and Ahmed<br />
et al., 2006). Single isolate was found in 23<br />
cases (46%), and multiple isolates were found in<br />
22 cases (44%). Five samples (10%) showed<br />
absence of bacterial pathogens (Table 2). This is<br />
in agreement with other studies (Revathi et al.,<br />
1998 and Atoyebi et al., 1992) while is contrast<br />
to other reported study where multiple isolates<br />
have been seen in up to 78% of cases (Kaushik<br />
et al., 2001). Burns provide a suitable site for<br />
bacterial multiplication. It is richer and more<br />
persistent source of infection than the surgical<br />
wounds because a readily accessible damaged<br />
tissue and nutrient rich exudates of burns<br />
constitute an excellent bacterial culture medium<br />
(Shaikh et al., 2004).<br />
Table (1): Frequency of type of microorganisms<br />
isolated.<br />
Type of microorganisms Number Percentage<br />
234<br />
Gram-negative bacteria 59 80.82%<br />
Gram-positive bacteria 14 19.18%<br />
Table (2): Frequency of type of cultures isolated out<br />
of 50 burn samples.<br />
Type of cultures Number Percentage<br />
Single 23 46%<br />
Double 16 32%<br />
Triple 6 12%<br />
Nil 5 10%<br />
P. aeruginosa was the most common isolate 33<br />
(45.21%) in this study (Table 3) as has been<br />
reported by other authors (Akhi and Hasanzadeh,<br />
2005, Ekrami and Kalantar, 2008), where this<br />
organism was held responsible for the majority<br />
of invasive burn wound infections in burntreatment<br />
facilities. Prevalence of Pseudomonas<br />
spp. in the burn wards may be due to the fact<br />
that this organism thrives in a moist environment<br />
(Atoyebi et al., 1992). The second most common<br />
isolate was K. pneumoniae 23 (31.51%). This<br />
result is in agreement with Nagoba et al (1999)<br />
and Al-Akayleh (1999) which recorded that the<br />
K. pneumoniae were 27.6% and 42.6%<br />
respectively. K. pneumoniae is a major cause of<br />
nosocomial infection leading to morbidity and<br />
mortality among patient population (Malik and<br />
Chhibber, 2009). S. aureus also been considered<br />
as one of the common bacteria and frequency of<br />
isolation in this study was 11 (15.06%). This<br />
result is in a ccordance with other studies<br />
(Mehta et al., 2007 and Revathi et al., 1998)<br />
which recorded that the rate of S. aureus were<br />
17% and 19% respectively. S. aureus is the most<br />
frequently isolated microorganism from body<br />
surface because it is normal flora of skin and this<br />
could easily be introduced into the wound either<br />
by the patients dressing materials or through the<br />
object that causes the injury (Hardy, 2003). In<br />
our study S. epidermidis was isolated only from<br />
three patients (4.11%) followed by P. mirabilis<br />
and E. coli (2.74% and 1.37%) respectively.<br />
Table (3): Frequency of different microorganism<br />
isolated out of 50 burn samples.<br />
Microorganisms Number of<br />
Pseudomonas<br />
aeruginosa<br />
Klebsiella<br />
pneumoniae<br />
Staphylococcus<br />
aureus<br />
Staphylococcus<br />
epidermidis<br />
Isolates<br />
Percentage<br />
33 45.21%<br />
23 31.51%<br />
11 15.06%<br />
3 4.11%<br />
Proteus mirabilis 2 2.74%<br />
Escherichia coli 1 1.37%<br />
Table (4) show frequency of burn infection<br />
according to different parameters with<br />
relationship of Gram-positive and Gramnegative<br />
bacterial isolates, accident burn wound<br />
infection was most prevalent in the age group<br />
21-25 (37.77%) and the rate of burn infection<br />
was observed highly, Gram-negative 30.14%<br />
and Gram-positive 6.85%, while infection was<br />
less prevalent in the age group over 41 years old<br />
(2.22%). Other studies has shown that most<br />
infection were recorded among age > 10, 20-30<br />
years (Kehinde et al., 2004 and Chalise et al.,<br />
2008) respectively. Among 45 burn patients, 32<br />
of them were female and 13 were male and<br />
burns predominated in female (71.11%) than<br />
male (28.89%). This may be because of the<br />
reason that accidental burns are more common in<br />
females as they tend to spend more time near fire<br />
(Kaur et al., 2007). These results were agreed<br />
with Negeri (2005) ; Ganatra and Ganatra,<br />
(2007) and disagree with Ann (1976) which<br />
showed that burn was more prevalent in male<br />
than female by working in industry or factory<br />
and increased risk-taking behavior. During the<br />
study we observed that the burn infection with<br />
highest percentage of staying in the hospital<br />
occurs in 1-5 and 6-10 was (26.67% and<br />
31.11%) respectively. Gram-negative bacteria
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
which isolated in duration (1-5 and 6-10) days<br />
were 24.66% and 23.29% respectively, as a<br />
highest percentage, while Gram-positive bacteria<br />
which isolated in the same duration were 4.11%<br />
and 6.85% respectively. This has been shown in<br />
other studies in which was more infection occurs<br />
within duration (1-10) days (Brunicardi et al.,<br />
2005). In this study, flames are the most<br />
common cause of burn 35 (77.78%) followed by<br />
hot water 5 (11.11). These results were in<br />
agreement with other studies which reported that<br />
the flame was most common cause of burn<br />
infection 80.5%, 50% and 48.7% respectively<br />
(Negeri (2005); Kehinde et al., 2004 and<br />
Brunicardi et al., 2005). Flame burn is the most<br />
common mechanism in thermal injury (Kaur et<br />
al., 2007).<br />
Table (4): Frequency of burn infections and relationship between types of microorganisms according<br />
to different parameters.<br />
Age (Years)<br />
Sex<br />
Duration of hospital stay (Day)<br />
Cause of burn<br />
Degree of burn<br />
Parameters Number (%) Gram-negative<br />
This study indicates that 4.44% of the burn<br />
patients were first-degree, 40% had seconddegree<br />
burns and 55.56% had third-degree burns<br />
and 56.16% of burn wound infection patients<br />
had third-degree burns which infected by Gramnegative<br />
bacteria and 5.48% was by Grampositive<br />
bacteria. This result is in contrast with<br />
the result of Al-Akayleh (1999) who indicates<br />
that 53.90% of the burn patients was second<br />
bacteria<br />
Gram-positive<br />
bacteria<br />
1-5 5 (11.11%) 5 (6.85%) 3 (4.11%)<br />
6-10 2 (4.44%) 3 (4.11%) 1 (1.37%)<br />
11-15 3 (6.67%) 2 (2.73%) 1 (1.37%)<br />
16-20 8 (17.78%) 12 (16.44%) 1 (1.37%)<br />
21-25 17 (37.77%) 22 (30.14%) 5 (6.85%)<br />
26-30 3 (6.67%) 3 (4.11%) 0<br />
31-35 3 (6.67%) 5 (6.85%) 1 (1.37%)<br />
36-40 3 (6.67%) 5 (6.85%) 2 (2.73%)<br />
54 1 (2.22%) 2 (2.73%) 0<br />
Female 32 (71.11%) 44 (60.27%) 8 (10.96%)<br />
Male 13 (28.89%) 15 (20.55%) 6 (8.22%)<br />
1-5 12 (26.67%) 18 (24.66%) 3 (4.11%)<br />
6-10 14 (31.11%) 17 (23.29%) 5 (6.85%)<br />
11-15 5 (11.11%) 7 (9.59%) 1 (1.37%)<br />
16-20 4 (8.89%) 5 (6.85%) 1 (1.37%)<br />
21-25 3 (6.67%) 3 (4.11%) 1 (1.37%)<br />
26-30 6 (13.33%) 7 (9.59%) 3 (4.11%)<br />
40 1 (2.22%) 2 (2.73%) 0<br />
Flame 35 (77.78%) 48 (65.75%) 12 (16.44%)<br />
Electric 2 (4.44%) 4 (5.48%) 0<br />
Hot water 5 (11.11%) 4 (5.48%) 2 (2.74%)<br />
Oil 1 (2.22%) 1 (1.37%) 0<br />
Explosion 2 (4.44%) 2 (2.74%) 0<br />
First 2 (4.44%) 3 (4.11%) 1 (1.37%)<br />
Second 18 (40%) 15 (20.55%) 9 (12.33%)<br />
Third 25 (55.56%) 41 (56.16%) 4 (5.48%)<br />
degree while 32.46%, 13.87% was first and third<br />
degree respectively.<br />
The pattern of bacterial sensitivities is subject<br />
to frequent modification. Its assessment is<br />
important for epidemiological and clinical<br />
purpose. Table 5 and 6 illustrates the different<br />
activity against isolated bacteria by the<br />
antibiotics in most frequent use in our country.<br />
Presently, the most active drugs against Gram-<br />
235
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
positive bacteria (S.aureues and S. epidermidis )<br />
are Vancomycin 100% followed by Clindamycin<br />
90.90% and 63.63% to Ceftriaxone, Cephalexin,<br />
Gentamicin,Ciprofloxacin and Chloramphenicol.<br />
This was similar to reports elsewhere (Revathi et<br />
al., 1998 and Atoyebi et al., 1992). Gramnegative<br />
bacteria were more sensitive to<br />
Amikacin 76.65%, Chloramphenicol 75.79%,<br />
Gentamicin and Ciprofloxacin 69.70% and<br />
68.87% respectively. We found in our results<br />
that P. aeruginosa which was the commonest<br />
isolate was highly resistant to Ceftazidime and<br />
Nalidixic acid (96.97% and 93.94%)<br />
respectively and sensitive to Amikacin (84.84%)<br />
followed Vancomycin and Gentamicin<br />
(78.78%), in contrast to a study in India by<br />
Revathi et al (1998) which showed 82.8%<br />
sensitivity to Ceftazidme. A study done by<br />
Mehta et al (2007) showed that P. aeruginosa<br />
was moderately resistant to Piperacillin<br />
(41.42%) whereas resistance was more marked<br />
236<br />
for Amikacin (85.81%), Gentamicin (89.22%)<br />
and Ciprofloxacin (78.81%). K. pneumoniae was<br />
found to be highly resistant (100%) to<br />
Vancomycin, Gentamicin, Cephalothin and<br />
Piperacillin, while P. mirabilis was absolutely<br />
sensitive to Piperacilli, Cephalothin, Gentamicin,<br />
Vancomycin, Amikacin, Chloramphenicol and<br />
Ciprofloxacin. A similar results of multidrug<br />
resistant Gram-positive and negative bacteria has<br />
been reported from several studies (Singh et al.,<br />
2003, Agnihotri et al., 2004, Kaushik et al.,<br />
2001 and Dhar et al., 2007). The high percentage<br />
of multi-drug resistant isolate is probably due to<br />
empirical use of broad-spectrum antibiotics and<br />
non adherence to hospital antibiotic policy.<br />
These multi-resistant strains establish<br />
themselves in the hospital environment in areas<br />
like sinks, taps, mattress, toils and thereby<br />
spread from one patient to another (Mehta et al.,<br />
2007).<br />
Table (5): Percentage of sensitivity of Gram-positive bacteria isolated from burn patients in response to different antibiotic.<br />
Isolates AMC<br />
Staphylococcu<br />
s aureus<br />
(n=11)<br />
Staphylococcu<br />
s epidermidis<br />
(n=3)<br />
30 µg<br />
18.18<br />
%<br />
Percentage 59.09<br />
C<br />
30 µg<br />
27.27<br />
%<br />
CIP<br />
10 µg<br />
27.27<br />
%<br />
CL<br />
30 µg<br />
27.27<br />
%<br />
CN<br />
10 µg<br />
27.27<br />
%<br />
CRO<br />
10 µg<br />
27.27<br />
%<br />
DA<br />
2 µg<br />
81.81<br />
%<br />
E<br />
15 µg<br />
36.36<br />
%<br />
P<br />
10 µg<br />
18.18<br />
100% 100% 100% 100% 100% 100% 100% 0% 66.66<br />
%<br />
63.63<br />
%<br />
63.63<br />
%<br />
63.63<br />
%<br />
63.63<br />
%<br />
63.63<br />
%<br />
90.90<br />
%<br />
18.18<br />
AMC= Amoxicillin+Clavulanic Acid, E= Erythromycin, TMP= Trimethoprim, CRO= Ceftriaxone, DA= Clindamycin,<br />
CL= Cephalexin, P= Penicillin, CN= Gentamicin CIP= Ciprofloxacin, C= Chloramphenicol, VA= Vancomycin.<br />
%<br />
%<br />
%<br />
42.42<br />
Table (6): Percentage of sensitivity of Gram-negative bacteria isolated from burn patients in<br />
response to different antibiotic.<br />
Isolates AK<br />
Pseudomona<br />
s aeruginosa<br />
(n=33)<br />
Klebsiella<br />
pneumoniae<br />
(n=23)<br />
Proteus<br />
mirabilis<br />
(n=2)<br />
Esherichia<br />
coli<br />
(n=1)<br />
30 µg<br />
84.84<br />
%<br />
21.74<br />
%<br />
Percentage 76.65<br />
C<br />
30 µg<br />
CAZ<br />
30 µg<br />
CIP<br />
10 µg<br />
72.73 3.03% 36.36<br />
30.43<br />
%<br />
%<br />
4.35% 39.13<br />
%<br />
CN<br />
10 µg<br />
78.78<br />
%<br />
DO<br />
10 µg<br />
75.75<br />
%<br />
F<br />
300 µg<br />
42.42<br />
%<br />
0% 4.35% 56.52<br />
%<br />
KF<br />
30 µg<br />
66.66<br />
%<br />
NA<br />
%<br />
30 µg<br />
0% 21.74<br />
TMP<br />
10 µg<br />
63.63<br />
%<br />
VA<br />
30<br />
µg<br />
100<br />
%<br />
0% 100<br />
31.81<br />
%<br />
PRL<br />
100µg<br />
6.06% 42.42<br />
%<br />
%<br />
%<br />
100<br />
%<br />
VA<br />
30 µg<br />
78.78<br />
%<br />
0% 0%<br />
100% 100% 50% 100% 100% 0% 0% 100% 50% 100% 100%<br />
100% 100% 0% 100% 100% 0% 100% 0% 100% 0% 0%<br />
%<br />
75.79<br />
%<br />
14.35<br />
%<br />
68.87<br />
%<br />
69.70<br />
%<br />
20.02<br />
%<br />
49.74<br />
%<br />
41.67<br />
PRL= Piperacillin, F= Nitrofurantoin, NA= Nalidixic Acid, KF= Cephalothin, AK= Amikacin, CAZ=Ceftazidime,<br />
DO= Doxycycline, CN= Gentamicin, CIP= Ciprofloxacin, C= Chloramphenicol, VA= Vancomycin.<br />
%<br />
44.45<br />
%<br />
35.61<br />
%<br />
44.70<br />
%
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
Several laboratory studies have evidence to<br />
support the use of honey as a wound dressing.<br />
Honey has been shown to stimulate cytokine<br />
production by monocytes, which inturn initiates<br />
tissue repair. Honey has broad-spectrum<br />
antibacterial activity; however, different honeys<br />
vary substantially in the potency of their<br />
antibacterial activity (Tonks et al., 2001 and<br />
Honey<br />
Concentration of honey %<br />
Qandel<br />
Peshtashan<br />
Sunbulah<br />
Isolates<br />
Tonks et al., 2003). In this study, both locally<br />
and commercially honey obtained have showed<br />
antibacterial activity against different bacterial<br />
species which were isolated from burn wound<br />
infections. The MIC of honey samples was<br />
determined through reading the optical density<br />
by spectrophotometer at 600 nm, as shown in<br />
table (7).<br />
Table (7): The MIC of different honey for highest antibiotic resistant isolated bacteria.<br />
10%<br />
Pseudomonas<br />
aeruginosa<br />
Klebsiella<br />
pneumoniae<br />
Proteus<br />
mirabilis<br />
Esherichia<br />
coli<br />
Staphylococcus<br />
aureus<br />
Staphylococcus<br />
epidermidis<br />
* 0.646 0.557 0.327 0.411 0.785 0.320<br />
20% 0.006 0.245 0.058 0.036 0.218 0.133<br />
30% 0 0 0.014 0.028 0.016 0<br />
40% 0 0 0 0 0 0<br />
10% 0.303 0.317 0.231 0.43 0.120 0.66<br />
20% 0.016 0.54 0.003 0.027 0.58 0.06<br />
30% 0 0.001 0 0 0.07 0.007<br />
40% 0 0 0 0 0 0<br />
10% 0.735 0.762 0.522 0.450 0.761 0.834<br />
20% 0.124 0.144 0.031 0.210 0.017 0.490<br />
30% 0.022 0.008 0.027 0.013 0.016 0.114<br />
40% 0 0 0 0 0 0<br />
* spectrophotometer reading<br />
Reading decreased from 0.646 to 0.006 for P.<br />
aeruginosa, from 0.557 to 0.245 for K.<br />
pneumoniae, from 0.327 to 0.058 for P.<br />
mirabilis, from 0.411 to 0.036 for E. coli, from<br />
0.785 to 0.218 S. aureus and from 0.320 to 0.133<br />
for S. epidermidis at the concentration 10% to<br />
20% and this mean that the concentration of<br />
20% was the MIC for all tested bacteria. No<br />
difference was observed in the antibacterial<br />
activity of Peshtashan honey. The concentration<br />
of 20% was seen to be the MIC for all tested<br />
bacteria except for K. pneumoniae (reading<br />
decreasing from 0.317 to 0.001) and S. aureus<br />
(reading decreased from 0.120 to 0.07) at the<br />
concentration 10% to 30%, this means that the<br />
MIC for K. pneumoniae and S. aureus was 30%<br />
while for Sunbulah honey, the MIC was at the<br />
concentration of 30% for all tested bacteria.<br />
Researchers working on honey, showed that pure<br />
honey is bactericidal for many pathogenic<br />
organisms including various Gram-negative and<br />
Gram-positive bacteria. (Subrahmanyam et al.,<br />
2003a) used honey to determine antibacterial<br />
activity against different pathogenic bacteria<br />
which were isolated from burn and they have<br />
shown that 100% inhibition was observed at<br />
25% (v/v) honey concentration for P.<br />
aeruginosa, coagulase-negative staphylococci<br />
and S. aureus, K. pneumoniae at 30%<br />
concentration and P. vulgaris at 20% honey<br />
concentration. Another study done by the same<br />
researchers (Subrahmanyam et al., 2003b)<br />
showed that of all 28 isolates of coagulasepositive<br />
S. aureus which were isolated from<br />
infected burn wounds showed inhibition with<br />
honey at concentration of 25% while French et<br />
al (2005) showed that the growth of both S.<br />
aureus and coagulase-negative Staphylococci<br />
isolates were inhibited by manuka and pasture<br />
honeys at concentrations of 2.7-5%. Study done<br />
by Agbaje et al (2006) showed inhibitory effects<br />
of honey at 50% and 100% concentrations on the<br />
various pathogenic bacteria (S. aureus, P.<br />
mirabilis, E. coli, P. aeruginosa, Klebsiella<br />
spp., S. albus and Streptococcus faecalis).<br />
Honey may inhibit bacterial growth due to a<br />
number of different mechanisms, presence of an<br />
“inhibine” factor in honey, which is hydrogen<br />
peroxide is a well-known antimicrobial agent<br />
(Bang et al., 2003). High sugar concentration<br />
237
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
exert an osmotic pressure which makes little or<br />
no water available for the microorganisms to<br />
survive, low PH, proteinaceaus compounds or<br />
other unidentified components present in the<br />
honey may all provide antimicrobial activity<br />
(Mundo et al., 2004). Because of its high<br />
viscosity, it forms a physical barrier and the<br />
presence of enzyme catalase gives honey an<br />
antioxidant property. These properties of honey<br />
make it an ideal and coast-effective dressing for<br />
burn patients (Bangroo et al., 2005).<br />
REFERENCES<br />
�Adebolu, T.T. (2005). Effect of natural honey on local<br />
238<br />
isolates of diarrhea causing bacteria in south<br />
western Nigeria. African Journal of Biotechnology.<br />
4(10):1172-1174.<br />
�Agbaje, E.O.; Ogunsanya, T. and Aiwerioba, O.I.R.<br />
(2006). Conventional use of honey as antibacterial<br />
agent. Annals of African Medicine. 5(2):78-81.<br />
�Agnihotri, N.; Gupta, V. and Joshi, R.M. (2004). Aerobic<br />
bacterial isolates from burn wound infections and<br />
their antibiograms-a five year study. Burns.<br />
30(3):241-243.<br />
�Ahmad, M.; Shahid, H.S.; Ibrahim, K.M. and Malik, S.A.<br />
(2006). Pattern of bacterial invasion in burn patients<br />
at the Pakistan institute of medical sciences,<br />
islamabad. Annals of Burns and Fire Disasters.<br />
19(1):1-7.<br />
�AI-Akayleh, A.T. (1999). Invasive burn wound infection.<br />
Annals of Burns and Fire Disasters. 12(4):23-27.<br />
�Akhi, M.T. and Hasanzadeh, A.R. (2005). Bacteriology<br />
and sensitivity pattern of isolated strains from burn<br />
infection. Journal of Tabriz University of Medical<br />
Sciences. 27(2):7-11.<br />
�Anand, A. and Shanmugam, I. (1998). Antistaphylococcal<br />
properties of natural honey. Biomedicine. 18:15-18.<br />
�Ann, W.L.C. (1976). The use of silver sulfadiazine in the<br />
treatment of burns- a review of 179 cases.<br />
Singapore Medical Journal. 17(4):211-215.<br />
�Atoyebi, O.A.; Sowemimo, G.O.S. and Odugbemi, T.<br />
(1992). Bacterial flora of burn wounds in lagos,<br />
Nigeria: A prospective study. Burns. 18(6):448-451.<br />
�Bang, L.M.; Phil, M.; Buntting, C. and Molan, P. (2003).<br />
The effect of dilution on the rate of hydrogen<br />
peroxide production in honey and its implications<br />
for wound healing. The Journal of Alternative and<br />
Complementary Medicine. 9(2):267-273.<br />
�Bangroo, A.K.; Khatri, R. and Chauhan, S. (2005). Honey<br />
dressing in pediatric burns. Journal Indian<br />
Association of Pediatric Surgery. 10(3):172-175.<br />
�Brooks, G.F.; Butel, J.S. and Mores, S.A. (2007). Jawetz,<br />
melnick and adelberg̉s medical microbiology. 24 th<br />
Ed. McGraw−Hill companies. New York.<br />
�Brunicardi, F.C.; Anderson, D.K.; Billiar, T.R.; Dunn,<br />
D.L.; Hunter, J.G. and Pollock, R.E. (2005).<br />
Schwartz ُs principles of surgery. 8 th Ed.<br />
McGraw−Hill companies. New York.<br />
�Chalise, P.R.; Shrestha, S.; Sherpa, K.; Nepal, U.;<br />
Bhattachan, C.L. and Bhattachary, S.K. (2008).<br />
Epidemiological and bacteriological profile of burn<br />
patients at Nepal medical college teaching hospital.<br />
Nepal Medical College Journal. 10(4)233-237.<br />
�Cooper, R.A.; Molan, P.C.and Harding, K.G. (2002). The<br />
sensitivity to honey of gram-positive cocci of<br />
clinical significance isolated from wounds. Journal<br />
of Applied Microbiology. 93(5):857-863.<br />
�Dhar, S.; Saraf, R.; Singh, K. and Raina, B. (2007).<br />
Microbiological profile of chronic burn wounds<br />
among patients admitted in burn unit. Journal of<br />
Medical Education and Researches. 9(4):182-185.<br />
�Ekrami, A. and Kalantar, E. (2008). Bacterial infections in<br />
burn patients. Indian Journal of Medical<br />
Researches. 127:415-416.<br />
�French, V.M.; Cooper, R.A. and Molan, P.C. (2005). The<br />
antibacterial activity of honey against coagulase-<br />
negative Staphylococci. Journal of Antimicrobial<br />
Chemotherapy. 56(1):228-231.<br />
�Ganatra, M.A. and Ganatra, H.A. (2007). Method of<br />
quantitative bacterial count in burn wound. Pakistan<br />
Journal of Medical Sciences. 23(3):415-419.<br />
�Hardy, S.P. (2003). Human microbiology. Taylor and<br />
Francis group. New York.<br />
�Jinfu, Y.; Peiren, L. and Rubin, Q. (1997). A comparative<br />
analysis of 221 strains of bacteria on infected burn<br />
wound surface. The Chinese Journal of Burns<br />
Wounds and Surface Ulcers. (1):14-18.<br />
�Kaur, H.; Bhat, J.; Anvikar, A.R.; Rao, S. and Gadge, V.<br />
(2007). Bacterial profile of blood and burn wound<br />
infection in burn patients. Proceeding of National<br />
Symposium on Tribal Health. 89-95.<br />
�Kaushik, R.; Kumar, S.; Sharma, R. and Lai, P. (2001).<br />
Bacteriology of burn wounds- the first three years<br />
in a new burn unit at the Medical College<br />
Chandigarh. Burns. 27(6): 595-597.<br />
�Kehinde, A.O.; Ademola, S.A.; Okesola, A.O.;<br />
Oluwatosin, O.M. and Bakare, R.A. (2004). Pattern<br />
of bacterial pathogens in burn wound infections in<br />
Ibadan. Annals of Burn and Fire Disaster. 17(1):12-<br />
15.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
�Levy, S.B. and Marshall, B. (2004). Antibacterial<br />
resistance worldwide: causes, challenges and<br />
responses. Nature Medicine Supplement.<br />
10(12):S122-S129.<br />
�Macedo, J.L.S.D. and Santos, L.B. (2005). Bacterial and<br />
fungal colonization of burn wounds. Mem inst<br />
oswaldo cruz, rio de Janeiro. 100(5):535-539.<br />
�Malik, R. and Chhibber, S. (2009). Protection with<br />
bacteriophage KØ1 against fatal Klebsiella<br />
pneumoniaee induced burn wound infection in<br />
mice. Journal of Microbiology, Immunology and<br />
Infection. 42(2):134-140.<br />
�Manson, W.L.; Pernot, P.C.J.; Fidler, V.; Sauer, E.W. and<br />
Klasen, H.J. (1992). Colonization of burns and the<br />
duration of hospital stay of severely burned<br />
patients. Journal of Hospital Infection. 22:55-63.<br />
�Mehta, M.; Dutta, P. and Gupta, V. (2007). Bacterial<br />
isolates from burn wound infections and their<br />
antibiograms: a eight year study. Indian Journal of<br />
Plastic Surgery. 40(1):25-28.<br />
�Morello, J.A.; Granato P.A. and Mizer H. E. (2003).<br />
Laboratory manual and workbook in microbiology<br />
(Applications to patient care). 7th Ed.<br />
McGraw−Hill companies. New York.<br />
�Mulu, A.; Tessema, B. and Derbie, F. (2004). In vitro<br />
assessment of the antimicrobial potential of honey<br />
on common human pathogens. Ethiopian Journal of<br />
Health Development. 18(2):107-111.<br />
�Mundo, M.A.; Padilla-Zakour, O.I. and Worobo, R.W.<br />
(2004). Growth inhibition of foodborne pathogens<br />
and spoilage organisms by select raw honeys.<br />
International Journal of Food Microbiology. 97:1-8.<br />
�Nagoba, B.S.; Deshmukh, S.R.; Wadher, B.J. and Pathan,<br />
A.B. (1999). Bacteriological analysis of burn sepsis.<br />
Indian Journal of Medical Sciences. 53(5):216-219.<br />
�Nasser, S.; Mabrouk, A. and Maher, A. (2003).<br />
Colonization of burn wounds in Ain-shams<br />
university burn unit. Burns. 29(3):229-233.<br />
�Negeri, C. (2005). Microbiology of burn unit at yakatit 12<br />
hospital, addis ababa. M. Sc. Thesis, Collage of<br />
Science, Addis Ababa University.<br />
�Revathi, G.; Puri, J. and Jain, B.K. (1998). Bacteriology of<br />
burns. Burns. 24(4):347-349.<br />
�Shaikh, D.; Zaidi, S.A.H.; Shaikh, K.; Shaikh, M.; Naqvi,<br />
B.S.; Shaikh, M.R. and Shoaib, M.H. (2004).<br />
Incidence and resistance pattern of bacteria<br />
associated with burn wound sepsis. Pakistan Journal<br />
of Pharmacology. 21(2):39-47.<br />
�Singh, N.P.; Goyal, R.; Manchanda, V.; Das, S.; Kaur, I.<br />
and Talwar, V. (2003). Changing trends in<br />
bacteriology of burns in the burns units, Delhi,<br />
India. Burns. 29(2):129-132.<br />
�Subrahmanyam, M.; Hemmady, A.R. and Pawar,<br />
S.G. (2003a). Antibacterial activity of honey<br />
on bacterial isolated from wounds. Annals of<br />
Burn and Fire Disaster. 16(1):1-4.<br />
�Subrahmanyam, M.; Hemmady, A.R. and Pawar,<br />
S.G. (2003b). Multidrug-resistant Staphylococcus<br />
aureus isolated from infected burns sensitive to<br />
honey. Annals of Burns and Fire Disasters.<br />
16(4):22-24.<br />
�Tonks, A.; Cooper, R.A.; Price, A.J.; Molan, P.C. and<br />
Jones, K.P. (2001). Stimulation of TNF-α release in<br />
monocytes by honey. Cytokine. 14(4):240-242.<br />
�Tonks, A.J.; Cooper, R.A.; Jones, K.P; Blair, S.; Parton, J.<br />
and Tonks, A. (2003). Honey stimulates<br />
inflammatory cytokine production from monocytes.<br />
Cytokine. 21(5):242-247.<br />
�Vindenesm H. and Bjerknes, R. (1995). Microbial<br />
colonization of large wounds. Burns. 21(8):<br />
575-579.<br />
�Wong, T.H.; Tan, B.H.; Ling, M.L. and Song, C. (2002).<br />
Multi-resistant Acinetobacter baumannii on a burns<br />
unit-clinical risk factors and prognosis. Burns.<br />
28(4):349-357.<br />
�World Health Organization (1999). Drug infection. WHO,<br />
Geneva. 13(4):230-233.<br />
�Zorgani, A.; Shawerf, O.; Tawil, K.; El-Turki, E. and<br />
Ghenghesh, K.S. (2009). Inducible clindamycin<br />
resistance among Staphylococci isolated from burn<br />
patients. Libyan Journal of Medicine. 4:104-106.<br />
239
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
ةل<br />
242<br />
) ىاتوس ىةكةي(<br />
ىزاشوطايسف ىزةسةزاض ىزةتنةس ىةناخشَوخةن ةل ازدنايةط مانجةئةب ةي ةوةهيلَوكَيل مةئ<br />
ةتخوث<br />
ةو . تَيبةد اديةث ىاتوس ىمانجةئ ةل ةك ىاكةشَوخةن ىهيسب ةل ىاكةواسكايج ةيايتركةب ىةوةندسكيش َوب سَيلوةي ىزاش<br />
ىاوَين ةل ةنايايتركةب مةئ َوب ويوطنةي ةل ةشاوايج ىزَوج و ىتسَلةيزةبةدهيش ىزايتسةي ىزةطيزاك ىندسك ىزايد<br />
َلى ىيايتركةب ىةشةط ىايةنوونم<br />
51<br />
َوب ىووب ظيتةطَين ةك ىةنايايتركةب وةئ<br />
،ةواسكيش ىةنوونم<br />
10<br />
ىَوك<br />
ةل<br />
. 9002<br />
. ةوةناسك كَيل ىيايتركةب ىةواسكايج<br />
لوليةئ<br />
37<br />
51<br />
ات شوومةت ىطنام ىاتةزةس<br />
ةناشةط مةئ ىَوك ةل ةو اسك ىدةب<br />
ىةيَوب َوب وظيتةسَوث<br />
ةك ةنايايتركةب وةئ ةو )% 00,09(<br />
ىووب ةواسكايج 12 ) Negative for Gram stain(<br />
ماسط ىةيَوب<br />
ىووب شووت . ىاكةييايتركةب ةواسكايج ىتشط ىَوك ةل )% 52،50(<br />
ةيةواسكايج 55 ) Positive for Gram stain(<br />
،ىاكةشَوخةن ىتشط ىَوك ةل .)% 73،33(<br />
ىةرَيز ةب ووب وَلابزةب َلاس<br />
91-95<br />
ماسط<br />
ىناكةنةمةت ىاوَين ةل زَوش ىكةيةرَيز ةب<br />
-6<br />
ةل ىايةبزَوش ىاكةشَوخةن ةل ىوايرطزةو ةك ةنانوونم وةئ ةو )% 90،02(<br />
ىةسَين ىاي<br />
57و<br />
)% 35،55(<br />
91 ىةرَيز ةو )% 33،30(<br />
71<br />
ىزاكَوي ةك ىاكةوَلابزةب<br />
زَوش ةنوونم<br />
ىةرَيز ةب ووب ىاكةناتوس ىكةزةس ىزاكَوي سطائ ةك اسك ىزايد ةو<br />
ىةيي َىم ىاي<br />
. ةوةنووبام ذَوز<br />
. ووب مةي َىس ىةلث ةل ىايناتوس ةك ىاكةشَوخةن تشط ى<br />
79<br />
50<br />
)% 11،16(<br />
97 Klebsiella pneumoniae و )% 51.95(<br />
77 Pseudomonas aeruginosa -:<br />
ةل ينتيسب وناكةواتوس ىندسكوةي<br />
Proteus<br />
و )% 5.55(<br />
7 Staphylococcus epidermidis و )% 51.06(<br />
55 Staphylococcus aureus و )% 75.15(<br />
ىايةزوةط ىكةيزايتسةي ماسط ىةيَوب َوب ىاكةظيتةطَين ايتركةب<br />
.)% 5.73(<br />
5 Escherichia coli و )% 9.35(<br />
% 60,03 Ciprofloxacin ةو % 62,30 Gentamicin ،%<br />
31,32 Chloramphenicol ،%<br />
36,61<br />
% 500<br />
وةئ ىذد<br />
Vancomycin<br />
) ادبويت وانةل(<br />
Amikacin<br />
9 mirabilis<br />
َوب ووبةي<br />
َوب ادناشين ىايةزوةط ىكةيزايتسةي ماسط ىةيَوب َوب ىاكةظيتةشَوث ايتركةب ادتاك ىامةي ةل مَلاةب<br />
ىيايتركةب ةذد وكةو اسهَييزاكةب ويوطنةي ةل شاوايج ىزَوج<br />
.% 20.20<br />
Clindamycin<br />
و ظيتةشَوث ىايتركةب ىذد َوب ةيةي ىايةزوةط ىكةياناوت ةو ،ىاكةتسَلةيزةب ةدهيش َوب ةيةي ىايسطزةب ةك ىةنايايتركةب<br />
K.<br />
ةل ةطج(<br />
ىزَوج ةل ويوطنةي َوب<br />
Peshtashan<br />
% 70<br />
و<br />
Qandel<br />
ىزَوج ةل ويوطنةي َوب<br />
% 90<br />
ىتيةث ةل ةي ىتيسب ةشةط ىهتسطَيز ىتيةث ويترمةك<br />
،<br />
ةو<br />
ىتيةث ةل ماسط ىةيَوب َوب ظيتةطَين<br />
S. aureus<br />
و<br />
Pneumoniae<br />
.<br />
Sunbulah ىهيوطنةي َوب % 70 ىتيةث ةب ةو ) Peshtashan
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 232-241, 2011<br />
قورحلا جمخ نم ةلوزعملا ةيضرملا ميثارجلا ضعب ىلع لسعلل<br />
) صيخشتو لزع(<br />
ليلحتل<br />
ليبرأ ةنيدم يف<br />
ةلوزعملا<br />
نم . 9002<br />
ميثارجلا<br />
ميثارجلا<br />
/ لوليأ /<br />
ةيساسح طمن ديدحتو<br />
51<br />
. ةيموثرج ةلزع<br />
و<br />
37<br />
9002<br />
/ زومت /<br />
يموثرجلا داضتلا ةيلاعفو ةيموثرج ةسارد<br />
– قورحلا تادحو – ئراوطلا ىفشتسم يف ةساردلا هذه ءارجأ مت<br />
تادحولا هذه يف نيدقارلا قورحلا جمخب نيباصملا نم<br />
5<br />
لزع<br />
مت اهنمو ةيباجيا تناك ةنيع<br />
ةصلاخلا<br />
ةيموثرجلا تلازعلا<br />
نيب ةرتف للاخ لسعلا نم ةفلتخم عاونأو ةعئاشلا ةيويحلا تاداضملا ضعبل<br />
51<br />
،اهليلحت مت ىتلا<br />
. ةيموثرجلا تلازعلا عومجم نم )% 52.1.<br />
( 55 مارغ ةغبصل ةبجوملا ميثارجلا<br />
و )% 00.09(<br />
) ةيحطس ةحسم(<br />
12<br />
ةنيع<br />
10<br />
عومجم<br />
تناك مارغ ةغبصل ةبلاسلا<br />
ثانلإا<br />
يف تاباصلأا تناك تانيعلا عومجم نمو .)% 73.33(<br />
91-95<br />
ةيرمعلا ةئفلا يف تناك ًاراشتنأ رثكلأا تاباصلأاو<br />
) 50-6(<br />
نيب ام تلصح ىفشتسملا ىف دوقرلل ةبسن ىلعأو ،روكذلا يف )% 90.02(<br />
57 و )% 35.55(<br />
79 ًاراشتنا رثكأ<br />
ىضرملل ىلكلا عومجملا نم )% 11.16(<br />
91 و )% 33.30(<br />
71 قورحلا تاباصلإ<br />
ًاعويش رثكلأا تناك بهللا نأ نيبت . مايأ<br />
Pseudomonas<br />
) 51.05(<br />
5<br />
55<br />
Escherichia coli<br />
و % 31.32<br />
: تناك قورحلا جمخل ةببسملاو ًاعويش رثكلأا تلازعلا<br />
Staphylococcus aureus<br />
و<br />
)% 9.53(<br />
9<br />
و<br />
)% 75.15(<br />
proteus mirabilis<br />
97 Klebsiella pneumoniae<br />
و<br />
)% 5.55(<br />
. ةثلاثلا ةجردلا نم قورحلا مهيدل تناك<br />
7<br />
و<br />
) 51.95(<br />
77<br />
aeruginosa<br />
Staphylococcu epidermidis<br />
Chloramphenicol و % 36,61 Amikacin ـل ةيلاع ةيساسح تاذ تناك مارغ ةيبلاس ميثارج .)% 5.73(<br />
ةيساسح رثكأ تناك مارغ ةبجوم<br />
يف(<br />
ميثارج نيح يف<br />
يموثرج داضمك<br />
لسعلا نم<br />
ةفلتخم عاونأ مادختسأ مت<br />
دنع مارغلا<br />
ثيح ،S.<br />
% 60.03<br />
.% 20.20<br />
Ciprofloxacin<br />
و<br />
Clindamycinو<br />
% 62.30<br />
% 500<br />
Gentamicin<br />
Vancomycin<br />
ةيباجيإو<br />
مارغلا<br />
ةيبلاس ميثارج دض ةيلاع ةءافك ترهظأو<br />
،ةيويحلا<br />
تاداضملل ةمواقملا ميثارجلا دض<br />
aureus<br />
و<br />
K.<br />
Pneumoniae<br />
ادعام(<br />
Peshtashan<br />
و<br />
Qandel<br />
ةقطنم نم جتنملا لسعلل<br />
ـل<br />
) جاجزلا<br />
% 90زيكرت<br />
.<br />
Sunbulahو<br />
Peshtashan يتقطنم يف جتنملا لسعلا نم % 70 زيكرتل امهيتلكت<br />
باجتسا<br />
242
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
242<br />
ANN-BASED STATIC SLIP POWER RECOVERY<br />
CONTROL OF WRIM DRIVE<br />
ALI A. RASOOL and HILMI F. AMEEN<br />
Dept. of Electrical Engineering, College of Engineering, University of Salahaddin, Kurdistan Region-Iraq<br />
(Received: October 17, 2010; Accepted for publication: August 14, 2011)<br />
ABSTRACT<br />
This paper presents a novel ANN-based slip power recovery drive system of WRIM, which estimates the<br />
appropriate firing angle of the thyristors in the inverter circuit for any given operation condition. Adjusting the speed<br />
or electromagnetic torque of the WRIM can be achieved by controlling the slip energy through slip power recovery in<br />
rotor side. The performance characteristics of drive system are determined using simple DC equivalent circuit. The<br />
obtained results are satisfactory and promising. The proposed controller operates on open loop, so it does not require<br />
speed sensor. Another advantages of such controller are it’s simplicity of the configuration and high accuracy. The<br />
effectiveness of these controllers is demonstrated for different operation conditions of the drive system.<br />
KEY WORDS: Artificial Neural Network (ANN), Wound Rotor Induction Motor (WRIM), Slip Power Recovery, Speed<br />
Control<br />
A<br />
INTRODUCTION<br />
n induction motor is used for many<br />
applications and several driving<br />
schemes were proposed. In recent power<br />
electronics development, slip power recovery<br />
system is one of the driving methods [1]. A slip<br />
power recovery system is composed of doubly<br />
excited machine and power electronic converters<br />
in the rotor circuit which is very attractive for<br />
variable speed constant frequency power<br />
generation. It was found that there are increasing<br />
applications of such motor control such as wind<br />
energy generation, hydro power, aerospace and<br />
novel power generation. The advantages of slip<br />
power recovery systems are high efficiency and<br />
lower converter rating.<br />
Control speed of WRIM with slip power<br />
recovery is important in higher power rating.<br />
The speed at sub-synchronous can be controlled<br />
by adjusting the resistance in the rotor circuit,<br />
which causes the slip power loss in external rotor<br />
resistance. The losses can be converted and<br />
returned back to AC mains by using line<br />
commutated inverter, where the three phase rotor<br />
currents are rectified with diode rectifier to feed<br />
power to intermediate DC current and to make<br />
the power unidirectional. The speed is controlled<br />
by changing the back DC voltage at the<br />
intermediate DC link. If this voltage is increased,<br />
the speed is supposed to decrease in order that<br />
the rotor rectified voltage can drive the current<br />
through DC circuit [2]. Usually the current<br />
inverter is a six thyristors rectifier working with<br />
firing angles greater than 90 degrees [3]. Many<br />
studies were done for simulating the slip power<br />
recovery. E. Akpinar and P. Pilly had made<br />
detailed studies for the rotor performance<br />
including the rectifier behavior and overlap<br />
problem [4]. Amr M. A. Amin, used ANN-based<br />
on tracking control techniques that are evolving<br />
to serve high performance drives such as<br />
sliding mode and the adaptive control [5].<br />
S. Tunyasrirut, et. al. used a fuzzy logic<br />
control for speed control of WRIM at self tuning<br />
by keeping the speed constant and adjusting the<br />
rotor current appropriated to the load [6]. A K<br />
Mishra, simulated the slip power recovery by<br />
spice simulation using equivalent circuit model<br />
of wound rotor induction motor [7]. Sateen<br />
Tunyasirut and Jongkol Nayamwiwit proposed<br />
an adaptive fuzzy nero controller to control the<br />
speed of wound rotor induction motor with slip<br />
energy recovered. In their model the simulation<br />
and experimental results showed that the<br />
adaptive fuzzy-nero controller gives a good<br />
controlled system by keeping the speed constant<br />
and good transient responses without overshoot<br />
can be obtained [8]. M. Y. Abdelfattah presented<br />
a novel ANN based chopper controller, which<br />
generate the appropriate chopper duty cycle for<br />
any given operation condition [9].<br />
This paper presents an ANN based slip power<br />
recovery of WRIM drive in which the<br />
appropriate firing angle of the inverter is found<br />
as a function of required motor speed and load<br />
torque. The ANN based drive controller is faster<br />
than another algorithm because of their parallel
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
structure, it does not require solution of any<br />
mathematical model, with the absence of the<br />
speed sensor.<br />
DEVELOPMENT OF DC EQUIVALENT<br />
CIRCUIT MODEL<br />
AND PERFORMANCE EQUATIONS<br />
The electrical model of Slip Power Recovery<br />
Controlled of wound rotor induction motor drive<br />
is shown in figure (1) which consists of three<br />
phase wound rotor induction motor, a three<br />
phase uncontrolled rectifier, smoothing inductor,<br />
a three phase controlled converter and a three<br />
phase recovery transformer. For using the DC<br />
equivalent circuit model in [10], the following<br />
assumptions should be made:<br />
1. The DC link current is ripple free by<br />
connecting a high value of conductor.<br />
2. The Commutation distortion due to leakage<br />
inductance of the motor is neglected.<br />
3. The flux can be assumed sinusoidal.<br />
4. The recovery transformer is assumed to be<br />
ideal.<br />
5. The effect of magnetizing current being very<br />
small and negligible.<br />
Figure (2) shows the DC equivalent circuit of<br />
Slip Power Recovery of WRIM, where all the<br />
parameters of AC side are referred to DC link<br />
side [11].<br />
Fig. (1): Power circuit diagram of Slip Power Recovery for WRIM<br />
Fig. (2): DC Equivalent circuit of slip power recovery of WRIM<br />
The expression of output DC voltage (Vd) of<br />
uncontrolled rectifier is given by: [4]<br />
V<br />
d<br />
3<br />
�<br />
6SV<br />
�n<br />
1<br />
SL<br />
� � � � �<br />
( 1)<br />
Where n1 is the stator to rotor turn ration, S is<br />
the slip and VSL is the stator line voltage at<br />
standstill. Also the DC voltage for controlled<br />
converters (Vi) is: [4]<br />
243
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
3 6 VSLCos�<br />
Vi<br />
�<br />
� � � � � �(<br />
2)<br />
� n2<br />
Where n2 is the transformer line side to inverter<br />
side turns ratio and α is the inverter firing angle<br />
( 90 � � �180�<br />
). The copper loss of rotor is<br />
determined by:<br />
/<br />
Xls � Xlr<br />
/<br />
Pcu<br />
� [ Vd<br />
�{<br />
3S(<br />
) � 2SR<br />
S}<br />
Id<br />
] Id<br />
� ( 3)<br />
�<br />
3 /<br />
/<br />
Assuming that rS � ( XL S � XLr<br />
) � 2RS<br />
,<br />
�<br />
then the equation (3) is simplified to:<br />
2<br />
P rcu �Vd Id<br />
� SrS<br />
Id<br />
� � � � �(<br />
4)<br />
The air gap power is:<br />
rotor loss 1<br />
2<br />
P g � � ( Vd<br />
Id<br />
� SrS<br />
Id<br />
) � � � ( 5)<br />
S S<br />
In steady state operation, the torque is<br />
proportional to rectified rotor DC link current Id,<br />
which in turns, is equal to the difference between<br />
the rectified rotor voltage Vd and the voltage<br />
back emf of the inverter Vi, divided by the<br />
resistance of the DC link inductor. At no load,<br />
the motor torque is negligible and for a certain<br />
rectified rotor current Id, which is almost zero,<br />
the two direct voltages Vd and Vi will be<br />
balanced. It can be noticed from the derivation<br />
that the voltage Vd will be proportional to the<br />
slip and the torque will be proportional to the<br />
current Id.<br />
The electromagnetic developed torque =<br />
Pg<br />
Te<br />
� , then:<br />
�s<br />
6 VSL<br />
2<br />
( 3 Id<br />
� rS<br />
Id<br />
)<br />
� n1<br />
Te<br />
�<br />
� � � � � �(<br />
6)<br />
�s<br />
The DC link current for specified value of<br />
delay angle (α) of the inverter is given by:<br />
3 6VSL<br />
S Cos�<br />
[ ( � )<br />
� n1<br />
n2<br />
Id<br />
�<br />
� � � � � ( 7)<br />
SrS<br />
� 2Rr<br />
� Rd<br />
Equation (7) gives the relation between the<br />
DC link current and firing angle α of the<br />
inverter.<br />
244<br />
ARTIFICIAL NEURAL NETWORK<br />
Artificial Neural Networks (ANN) are a<br />
computational modeling tools that have recently<br />
emerged and found extensive acceptance in<br />
many disciplines for modeling complex real<br />
world problems. ANNs may be defined as<br />
structures comprised of densely interconnected<br />
adaptive simple processing elements called<br />
artificial neurons or nodes that are capable of<br />
performing massively parallel computations for<br />
data processing. The attractiveness of ANNs<br />
comes from the remarkable information<br />
proceeding characteristics of the biological<br />
system [12].<br />
The simplest form of ANN is known as the<br />
perecptron Figure (3). Multi Layer Perceptron<br />
(MLP) is a collection of simple processing units<br />
highly interconnected which process the<br />
information fed to the input units, these units are<br />
organized by layers. Typically the neurons in the<br />
input layer serve only for transforming the input<br />
pattern to the network without any processing.<br />
The information is processed by the hidden and<br />
output neurons. Each neuron has a certain<br />
number of inputs, but only one output [12].<br />
Fig. (3): Internal Structure of the Neuron<br />
To solve more complicated problems, MLP is<br />
used which is trained using the back propagation<br />
algorithm Figure (4) represents the MLP<br />
structure. For practical reasons, ANNs<br />
implementing the back propagation algorithm do<br />
not have too many layers, since the time for<br />
training the networks grows exponentially [12].<br />
Fig. (4): Structure of MLP<br />
The backpropagation algorithm is used in<br />
layered feed-forward ANNs. The artificial<br />
neurons are organized in layers, and send their<br />
signals “forward”, and then the errors are<br />
propagated backwards. The network receives<br />
inputs by neurons in the input layer, and the<br />
output of the network is given by the neurons on<br />
an output layer. There may be one or more
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
intermediate hidden layers. The backpropagation<br />
algorithm uses supervised learning, in which we<br />
provide the algorithm with examples of the<br />
inputs and outputs we want the network to<br />
compute, and then the error (difference between<br />
actual and expected results) is calculated. The<br />
idea of the backpropagation algorithm is to<br />
reduce this error, until the ANN learns the<br />
training data. The training begins with random<br />
weights, and the goal is to adjust them so that the<br />
error will be minimal. The activation function of<br />
the artificial neurons in ANNs implementing the<br />
backpropagation algorithm is a weighted sum<br />
(the sum of the inputs xi multiplied by their<br />
respective weights wji) [13]:<br />
A ( x,<br />
w)<br />
j<br />
n<br />
� �i�0 x w<br />
i<br />
ji<br />
� � � � � � �<br />
(<br />
8)<br />
We can see that the activation function<br />
depends only on the inputs and the weights. If<br />
the output function would be the identity (output<br />
= activation), then the neuron would be called<br />
linear. But these have severe limitations. The<br />
most common output function is the<br />
tansigmoidal function:<br />
2<br />
O j ( x,<br />
w)<br />
� �1�<br />
� � � � � � ( 9)<br />
�2 Aj<br />
( x,<br />
w)<br />
1�<br />
e<br />
It is clear that the output depends only in the<br />
activation function, which in turn depends on the<br />
values of the inputs and their respective weights.<br />
Now the goal of the training process is to obtain<br />
a desired output when certain inputs are given.<br />
Since the error is the difference between the<br />
actual and the desired output, the error depends<br />
on the weights, and we need to adjust the<br />
weights in order to minimize the error. We can<br />
define the error function for the output of each<br />
neuron:<br />
2<br />
E ( x,<br />
w,<br />
d)<br />
( O ( x,<br />
w)<br />
� d ) � � � � �(<br />
10)<br />
j<br />
� j<br />
j<br />
We take the square of the difference between<br />
the output and the desired target because it will<br />
be always positive, and because it will be greater<br />
if the difference is big and lesser if the difference<br />
is small. The error of the network will simply be<br />
the sum of the errors of all the neurons in the<br />
output layer:<br />
2<br />
E ( x,<br />
w,<br />
d)<br />
O ( x,<br />
w)<br />
� d ) � � � � � ( 11)<br />
� � j<br />
j<br />
The backpropagation algorithm now<br />
calculates how the error depends on the output,<br />
inputs, and weights. After we find this, we can<br />
j<br />
adjust the weights using the method of gradient<br />
descendent:<br />
�E<br />
�wji<br />
� ��<br />
� � � � � � � �(<br />
12)<br />
�w<br />
ji<br />
Where η is the learning rate which is a small<br />
positive number represents the step size we need<br />
to take for the next step. Equation (12) can be<br />
interpreted in the following way: the adjustment<br />
of each weight (Δwji) will be the negative of a<br />
constant (η) multiplied by the dependence of the<br />
previous weight on the error of the network,<br />
which is the derivative of error (E) in respect to<br />
Wji. Equation (12) is used until we find<br />
appropriate weights (the error is minimal). ANN<br />
model is used for estimating an appropriate<br />
firing angle in two cases (constant speed and<br />
constant torque operation), Tansigmoidal<br />
function is used as an activation function<br />
between the hidden layers and input to hidden<br />
layers.<br />
The proposed architecture of the neural<br />
network contains two hidden layers of<br />
tansigmoidal neurons and broadcasts their output<br />
to a layer of linear neurons which computes the<br />
network output. The back propagation training<br />
algorithm is used for feed forward neural<br />
networks. Levennerg Marguardt back<br />
propagation algorithm for feed forward neural<br />
networks is used as it’s much faster than<br />
standard back propagation algorithm. The<br />
training is achieved with Matlab simulation<br />
program which uses a given number of inputs –<br />
output examples patterns [13].<br />
THE PROPOSED CONTROL MODEL<br />
A control system is proposed by which a<br />
three phase WRIM can be controlled with the<br />
flexibility of control as constant DC current<br />
(torque) operation or constant speed operation, a<br />
neural network is involved in the model to<br />
estimate the proper firing angles for both modes<br />
of operation. By good training of the ANN,<br />
satisfactory results were obtained. In case of<br />
constant current operation, the input to the ANN<br />
is the slip, constant current and the output is the<br />
firing angle, but in case of constant speed<br />
operation the input to the ANN is the DC<br />
current, constant speed and the output is the<br />
firing angles. This firing angle is linked as an<br />
estimator to control converter circuit to adjust it.<br />
245
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
The motor speed and DC link current (or Te)<br />
are inputs to the MATLAB Neural Network<br />
model and the corresponding values of thyristor<br />
inverter firing angle (α) are calculated<br />
systematically. After normalization all data, The<br />
ANN model was implemented by software in the<br />
drive system program as shown in fig. (5). Both<br />
the reference speed (nref) and DC link current (Id)<br />
are inputs to the ANN model, which estimates<br />
the appropriate firing angle (α). A firing circuit<br />
generates pulses to the thyristors of the inverter<br />
with the corresponding requirement; the neural<br />
network program was run in several cases,<br />
constant speed operation and constant torque<br />
operation. The WRIM motor parameters and<br />
drive system are: 3 hp, 380/220 V, Y/ Δ, three<br />
phase, 50 Hz, 4 pole, n1 = 1.13, n2 = 2.06, 3.5/ 6<br />
A, stator resistance RS = 4.12 Ω, rotor resistance<br />
R / r = 3.2 Ω, mutual inductance Lm = 316<br />
mH, self inductance L / r= LS = 332 mH, J (for<br />
motor & load) = 0.06 kg.m 2 , B (viscous friction<br />
of motor & Load) = 0.05 kg.m 2 /sec.<br />
246<br />
SIMULATION RESULTS<br />
Experimental Data was used to train the<br />
ANN. The architecture of the ANN is selected<br />
after many trial and error and, it was concluded<br />
that for constant speed operation an ANN of two<br />
hidden layers of tansigmoidal activation function<br />
is the best and gives most accurate results, each<br />
hidden layer contains four neurons, but in case<br />
of constant current operation the best<br />
configuration of the ANN was two hidden layers<br />
each one contains three neurons with tansigmidal<br />
activation function. The Mean Absolute<br />
Percentage Error MAPE % is calculated<br />
according to the equation 13.<br />
MAPE<br />
1<br />
N<br />
N<br />
� �<br />
i�1 i<br />
Fig. (5): Modified Control System Diagram<br />
xi<br />
� yi<br />
( ) �100%<br />
� � � � � ( 13)<br />
x<br />
Where xi represents the actual value and Vi is<br />
ANN output. For Constant speed operation the<br />
MAPE fluctuates between 0.001973 at 750 rpm<br />
and 0.010626 at 1200 rpm, while for constant<br />
DC current operation it fluctuates between<br />
0.014944 at 5.4 A and 0.035245 at 2 A which is<br />
satisfactory. Figure (6) shows the variation of<br />
firing angle (α) of the inverter with DC link<br />
current (which is directly proportional to the<br />
electromagnetic torque) for actual value and<br />
ANN based model. The curves show that the<br />
designed ANN model is near to the actual values<br />
for different rotor speeds 1440 rpm, 1200 rpm<br />
and 1050 rpm. It is shown that when the load<br />
torque on the motor shaft is increased, the firing<br />
angle must be decreased to balance between<br />
them and keeping the rotor speed constant.<br />
Figure (7) shows the firing angle (α) of the<br />
inverter against the motor speed for different<br />
load torques (or DC link current) for actual value<br />
and ANN based model. The curves show that the<br />
designed ANN model is encouraging to satisfy<br />
the actual value for different load torque (I = 2<br />
A, 4 A and 5.4 A). Figure (7) shows that as the<br />
speed of the motor decreased the firing angle is<br />
increased to maintain the load torque at desired<br />
value.<br />
The system was tested for two different<br />
modes, variable speed drive and constant speed<br />
drive operation. Figure (8) illustrates the<br />
simulation results when the reference speed<br />
increased suddenly from 1050 rpm to 1350 rpm<br />
with constant torque of 14.5 N.m. It is obvious<br />
that increasing the reference speed decreases the<br />
firing angle of inverter bridge, which results in<br />
decreasing the rotor effective resistance and<br />
consequently increasing the motor<br />
electromagnetic torque during the acceleration<br />
period. Since the load torque is kept constant, an<br />
acceleration torque appears which results in<br />
accelerating the speed of the motor until it<br />
reaches the desired value. Figure (9) shows the<br />
simulation results for constant speed operation.<br />
The desired speed is kept constant at 1400 rpm,
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
while the load torque is changed directly from<br />
13.5 N.m to 5.6 N.m. It is noticed that the motor<br />
speed has increased by 3% at the instant of the<br />
Firing Angle α<br />
95<br />
94.5<br />
94<br />
93.5<br />
93<br />
92.5<br />
92<br />
91.5<br />
91<br />
90.5<br />
N=1440 rpm<br />
load decrease then it recovers to its desired<br />
value.<br />
Actual ANN<br />
90<br />
0.2 1.06 1.85 3.04 3.43 5.2<br />
I d (dc link Current) A<br />
Fig. (6): Firing angle against DC link current for different motor speeds<br />
247
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
248<br />
Firing Angle α<br />
Firing Angle α<br />
180<br />
160<br />
140<br />
120<br />
100<br />
80<br />
60<br />
40<br />
20<br />
180<br />
160<br />
140<br />
120<br />
100<br />
Actual ANN<br />
Id=2 Amp<br />
0<br />
0.06 0.1 0.2 0.3 0.4 0.5<br />
80<br />
60<br />
40<br />
20<br />
Id=2 Amp<br />
S (Slip)<br />
Actual ANN<br />
0<br />
0.06 0.15 0.25 0.35 0.4 0.5<br />
S (Slip)<br />
Fig. (7): Firing angle against the slip at different DC link current
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
Fig. (8): Variable speed drive ANN based simulation results<br />
249
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
250<br />
Fig. (9): Constant Speed Drive ANN Based Simulation Results
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
CONCLUSION<br />
In this paper a novel method of adjusting the<br />
firing angle of the thyristor inverter of slip power<br />
recovery drive system has been investigated.<br />
This method depends on training two Neural<br />
Networks, one for adjusting the firing angle at<br />
constant speed operation and the other for<br />
constant torque operation. A practical data where<br />
used for training and testing these networks, the<br />
best design, layers and neurons in each layer<br />
were found by many trail and error testing<br />
through the Matlab simulation program. The<br />
data are electromagnetic torque and the rotor<br />
speed at different operation condition as an input<br />
and their corresponding firing angle of thyristor<br />
inverter as an output of the ANN model. The<br />
results of the comparison between the actual and<br />
ANN output were encouraging, for Constant<br />
speed operation the MAPE was between<br />
0.001973 and 0.010626, while for constant DC<br />
current operation it fluctuates between 0.014944<br />
and 0.035245. The performance and robustness<br />
of the proposed controllers have been evaluated<br />
under a variety of operating conditions of the<br />
drive systems and the results demonstrate the<br />
effectiveness of these control structures.<br />
REFERENCES<br />
- Kenshi, N. Hoshi, Nakagawa and Junpei H. (2000). A<br />
Compact Type Slip Power Recovery System with<br />
Sinusoidal Rotor Current for Large Pump / Fan<br />
drive. Power Electronics and Motion Control<br />
Conference, Proceeding of IPEMC, 2, (pp. 774-<br />
779).<br />
- Lavi, A. and Polge, R. J. (1996). Induction Motor Speed<br />
Control with Static Inverter in the Rotor. IEEE<br />
Trans. on Power Apparatus and System, 274-282.<br />
- Marques, G. D. (1996). Performance Evaluation of the<br />
Slip Power Recovery System with a DC Voltage<br />
Intermediate Circuit and LC filter on the Rotor.<br />
Industrial Electronics Conference, ISIE 96<br />
Proceeding of the IEEE. 2, (pp. 862-866).<br />
- Akpinar, E. and Fillay, P. (1990). Modeling and<br />
Performance of Slip Energy Recovery Induction<br />
Motor Drive. IEEE Trans. on Energy Conversion.<br />
5, (pp. 203-210)<br />
- Amr, M. and Amin, A. Neural Network-based Tracking<br />
Control System for Slip Power Energy Recovery<br />
Drive. IEEE Catalog Number 97Tlt8280, ISIE 97-<br />
Guimaraes, Portugal, (pp 1247-1252).<br />
- Tunyasrirut, S., Kanchanathep, A. Ngamwiwit, J., Furuya,<br />
T. (1999). Fuzzy Logic Control for Speed of WRIM<br />
with Slip Power Energy Recovery. SICE Mrioka, (<br />
pp 119-1203).<br />
- Mishra, A. K., Wahi, A K. (2004). Performance Analysis<br />
and Simulation of Inverter-fed Slip-Power<br />
Recovery Drive. IE (I) Journal-EL, 85, (pp 89-95).<br />
- Tunyasrirut, Satean and Ngamwiwit, Jngkol (2000).<br />
Adaptive Fuzzy-Neuro Controller for Speed of<br />
Wound Rotor Induction Motor with Slip Energy<br />
Recovery. Tencho proceedings, publisher country<br />
IEEE (MY) 3, (pp. 329-33).<br />
- Abdelfattah, M. Y. and Ahmed, M. M. (2002). An<br />
Artificial Neural Network-Based Chopper-<br />
Controlled Slip-Ring Induction Motor. IEEE<br />
MELECON, (pp. 142-146).<br />
[10] Sen, PC. and Ma, K. HJ. (1975). Rotor Chopper<br />
Control for Induction Motor Drive, TRC Strategy.<br />
IEEE Tran. on Industry Application, IA-11, (pp. 43-<br />
49).<br />
- Dubey, G. K. (2001). Power Semiconductor Controlled<br />
Drives. Alpha Science International Ltd, 2 nd ed.<br />
New Hersey: Prentice –Hall, Inc.<br />
- Basheer, I. A. and Hajmeer, M. (2000). Artificial Neural<br />
Networks: Fundamentals, Computing, Design, and<br />
Application. Journal of Microbiological Method,<br />
(pp. 3-31).<br />
- Fausett, L. (2000). Neural Networks Algorithms,<br />
Applications, and Programming Techniques. Person<br />
Education, Inc, 2 nd ed. New York.<br />
251
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 242-252, 2011<br />
252<br />
يزؤت ناهَييزااةبةب واسككيي يزااةهطوو يةولاوخ<br />
يزةهَيوصب ؤب كيتاتض ياناوت ةكطيلخ يةوةندناِزةط<br />
نااةدسكتضةد ةزاوةد يةناخ<br />
وةتطيض َوب نااةدسكتضةد يةناخ يِزؤت ةب تنضةب تصي ةب تااةد ىون اةياطَيِز ةل ساب يةوةهيرَيوت مةئ<br />
ةتخوي<br />
يةوةندناِزةط كيهاةت<br />
ناهَييزااةبةب يزااةنسطوو ىواسككيي يةولاووخ يزَوج يزةهَيوصب ياسَيخ ندسا َلَوترنوا<br />
. ةولاووخ ياناوت ةكطيلخ<br />
ندسازاا خَودوزاب سَيذ ةل ةوةزةككَيي يِزوض نااةزةتضوسياض َوب َنيَيلوةخةد نووبيي يةشَوط ةياطَيِز مةئ<br />
نةيلاةل ةولاووخ ياناوتةكطيلخ يؤيةب ةزةهَيوصب ةزَوج مةئ يزااةهطوو يسبةش وةولاووخ ياسَيخ<br />
يِزَوطةن يِزوض ناهَييزااةبةب ةووتاي تضةدةب ةوةتطيض مةئ نااةتةفيض و ندسا زااةو<br />
لووخ ةل تااةد ضيئ ةواسا زايهصيي ةوةتطيض مةئ<br />
. ادشاوايج<br />
. ةواسا َلوترنؤا<br />
ادةولاووخ<br />
. زةكشَولخد طاب نااةووتاي تضةدةب ةوانجةئ ةو ةوَيشواي<br />
و ندسكصيئ ناضائ ةوةتطيض مةئ ؤب ةكيهاةت مةئ يست نااةدووض ةو ةيين ياسَيخ يةوةندهَيوخةب تيطيويي ةو ادةواسا<br />
. ادشاوايج ندسكصيئ خؤدوزاب سَيذةل ةوةتيض مةئ ؤب ةوةتةنواسكنووز ةنايزةطيزاا مةئ و شزةب يدزوو<br />
ةيعانصلا ةيبصعلا ايلاخلا ةكبش مادختساب فوفلملا راودلا كرحمل نكاسلا ةيقلازنلاا ةردقلا عاجرتسا<br />
كرحملا ةعرسب مكحتلا ةموظنمل ةيعانصلا ةيبصعلا ايلاخلا ةكبش ىلع دامتعلااب ةثيدح ةقيرط ثحبلا اذه لوانتي<br />
ةصلاخلا<br />
تاروتسرياثلل ةبسانملا حدقلا ايوز ةقيرطلا هذه نمخت . ةيقلازنلاا ةردقلا عاجرا ةينقت مادختساب فوفلملا راودلا ىذ ىثحلا<br />
كرحملا اذهل ىسيطانغمورهكلا مزعلا وا ةعرسلا طبض متي<br />
ةرئادلا مادختساب مكحتلا ةموظنمل ءادلاا صئاصخ ىلع لوصحلا مت<br />
لاف اذل ةحوتفم<br />
ةراد ىف لمعي حرتقلا رطيسملا<br />
. ةفلتخم<br />
لمع فورظ تحت سكاعلا ةرئاد ىف ةدوجوملا<br />
. راودلا فرط ىف ةيقلازنلاا ةردقلا ىلع ةرطيسلاب<br />
. ةدعاوو ةيضرم تناك ةلصحتسملا جئاتنلاو ةطيسبلا ةرمتسملا ةئفاكملا<br />
حيضوت مت امك.<br />
ةيلاعلا ةقدلا و نيوكتلا ةطاسب ىه رطيسملا اذهل ىرخلاا تازيمملا نم و ةعرسلا تاساسح ىلا جاتحن<br />
.<br />
ةفلتخملا ليغشتلا فورظ تحت رطيسملا اذه ةيلاعف
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 253-259, 2011<br />
LOWER BOUND OF T-BLOCKING SETS IN PG(2, q ) AND EXISTENCE<br />
OF MINIMAL BLOCKING SETS OF SIZE 16 AND 17 IN PG(2,9) *<br />
ABSTRACT<br />
ABDUL KHALIK L. YASSEN * and CHINAR A. AHAMED **<br />
* Dept. of Math., College of Science, University of Mosul, Mosul -Iraq<br />
** Dept. of Math., Faculty of Science, University of Zakho, Kurdistan Region-Iraq<br />
(Received: November 16, 2010; Accepted for publication: August 14, 2011)<br />
In this paper we introduce the projective plane PG(2, q), q square the lower bound of 5 – blocking set when q ><br />
25 and q = 16. Then we improved the lower bound of 5 – blocking set when q � 10.<br />
Also we find the lower bound of a<br />
6 -blocking set when q > 36 and q = 16. Specially in projective plane PG(2, 9), we show that the minimal blocking set<br />
of size 16 with a 6 – secant and the minimal blocking set of size 16 of Rédei-type are exists and we classify the minimal<br />
blocking sets of size 17.<br />
KEYWORDS: blocking set, minimal blocking set, n-arc, Projective plane, affine plane.<br />
I<br />
1. INTRODUCTION<br />
n a finite projective plane of order q, a t-<br />
blocking set is a set of points such that<br />
each line contains at least t points of B and some<br />
lines contains exactly t points of B. A t –<br />
blocking set B is minimal or irreducible when no<br />
proper subset of it is a t – blocking set. In<br />
particular when t = 1 then B is called a blocking<br />
set.The name blocking set was originated in<br />
Game Theory, Richardson [6] was the first one<br />
to look at larger planes, he showed that the<br />
minimal size of a blocking set in PG( 2,3) is 6,<br />
and noted that Baer sub planes are examples of<br />
blocking sets of size q � q �1in<br />
projective<br />
planes of square order. Di Paola [4] introduced<br />
the idea of a projective triangle , which give an<br />
example of a blocking sets of size 3(q+1)/2 in<br />
Desargusian planes of odd order. That projective<br />
planes exist in these planes was shown by Bruen<br />
who also obtained the general lower bound<br />
q � q �1for<br />
the size of a blocking set in<br />
projective plane of odd order q . Bruen [3] gave<br />
the upper bound q q �1<br />
for a minimal<br />
blocking set in any projective plane of order q,<br />
and make the connection with Rédei's work on<br />
lacunary polynomials and small blocking sets in<br />
Desargusian planes.<br />
Specially in the projective plane PG(2, 9):<br />
First: We show that the minimal blocking set<br />
of size 16 with a 6 – secant and the minimal<br />
blocking set of size 16 of Rédei-type exists.<br />
Second: We classify the minimal blocking<br />
sets of size 17.<br />
* This paper is based on M.Sc Thesis of the second author.<br />
2. PRELIMINARIES<br />
This Section briefly summarizes some of the<br />
basic notions concerning projective spaces and tblocking<br />
sets. We begin by the following<br />
definitions . A finite filed, is a field with a finite<br />
number of elements. A field E is an extension of<br />
a field F if there is an injective ring<br />
homomorphism from F into E.A non constant<br />
polynomial f(x) is an irreducible polynomial in<br />
F[x] if f(x) cannot be expressed in F[x] as a<br />
product g(x) . h(x) of non constant of each of<br />
degree less than the degree of f(x) .Let GF(p) =<br />
Z / pZ Zp, p prime number, and let f(x) be an<br />
irreducible polynomial<br />
GF(p),then<br />
of degree h over<br />
h<br />
GF(p ) �GF(p)[x]/ (F(x)) �<br />
h�1 � i<br />
�<br />
��aiλ :a i�GF(p);F(λ)<br />
�0�<br />
i�0 � �<br />
is called a Galois Field of order q ; q=p h .<br />
The elements of GF(q) satisfy the equation x q =<br />
x, and there exist λ in GF(q)={0,1,�,� 2 ,… ,� q-2 }.<br />
A (k,n) –arc K in PG(2,q) is a set of k points<br />
such that there is some n points but no n+1points<br />
are collinear . A t – blocking set B in a projective<br />
plane PG(2, q) is a set of points such that each<br />
line in PG(2, q) contains at least t points of B<br />
and some line contains exactly t points of B.<br />
A t-blocking set is trivial when it contains a<br />
line of PG(2,q). Specially If t=1, then B is called<br />
blocking set. If t=2, then B is called Double<br />
Blocking set. A t – blocking set B is minimal or<br />
irreducible when no proper sub set of it is a t –<br />
blocking set. A t-blocking set B of size b is<br />
small if b < t q + (q+3)/2.<br />
253
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 253-259, 2011<br />
Theorem 2.1[1]. Let B be t- blocking set in a<br />
projective plane PG(2,q) , p > 3 where p is<br />
prime then :<br />
1 . if t � (p�1)/2, then (2t �1)<br />
(p �1)<br />
B �<br />
2<br />
2. if t � (p+1)/2, then B � ( t �1)<br />
p , B is the<br />
number of the points of B.<br />
Theorem 2.2[1]. Let B be t- blocking set in a<br />
projective plane PG(2,q), then :<br />
q�1<br />
1. 2<br />
�r �q<br />
� q �1,<br />
254<br />
i<br />
i�0<br />
q 1<br />
2. � �<br />
i�1<br />
q 1<br />
i�2<br />
q 1<br />
i r �b(<br />
q �1)<br />
,<br />
i<br />
�<br />
3. �i ( i �1)<br />
r �b<br />
( b �1)<br />
,<br />
�<br />
4.<br />
� � v<br />
i�1<br />
q�1<br />
5. �<br />
i�2<br />
q<br />
6. ��<br />
7. ��<br />
i q<br />
i<br />
�1,<br />
,<br />
( i �1)<br />
vi<br />
�b<br />
�1<br />
u �q<br />
�1<br />
,<br />
i<br />
i 0<br />
q<br />
iui<br />
i 1<br />
�b<br />
.<br />
where b : the number of the points of B.<br />
r i : the total number of i-secant of B, and isecant<br />
is the line of PG(2,9) that intersect B in i<br />
points.<br />
v i : the total number of i-secant through a point<br />
p of B.<br />
u i : the total number of i-secant through a point<br />
q of PG(2, q)\B.<br />
Theorem 2.3[4]. Let B be a t-blocking set B in<br />
PG(2,q), where t 3,q= p 2d ,then<br />
B � t(<br />
q � q �1)<br />
.<br />
Theorem2.4[2]. Let B be a t-blocking set B in<br />
PG(2,q),where<br />
�1/<br />
3 1/<br />
6 1/<br />
4<br />
t � min( 2 q , q / 2)<br />
, if q = p 2d ,p<br />
= 2,3, d � 2,then B � t(<br />
q � q �1)<br />
.<br />
Theorem 2.5[2]. Let B be a t-blocking set in<br />
PG(2,q), and B contains no line, then<br />
B � tq<br />
� tq<br />
�1.<br />
Definition 2.6[5]. A unital in PG(2,q) is a set U<br />
of q q �1points, that every line joining two<br />
points of U intersect U in precisely q � 1.<br />
Theorem 2.7[4]. Let B be a minimal blocking<br />
set in PG(2,q). Then B �q<br />
q �1with<br />
equality if and only if B is a unital in PG(2,q), q<br />
is square .<br />
Theorem 2.8[5]. Let B be a minimal blocking<br />
set in PG(2,q). If q=p is a prime then �B ��<br />
(3p+1)/2.<br />
3. Lower Bounds of 5-Blocking and 6-Blocking<br />
Sets in a projective Plane PG(2,q) , where q<br />
is a square.<br />
In this section we find in the projective plane<br />
PG(2, q), q square the lower bound of 5 –<br />
blocking set when q > 25 and q = 16. Then we<br />
improved the lower bound of 5 – blocking set<br />
when q � 10 . Also we find the lower bound of<br />
a 6 – blocking set when q > 36 and q = 16.<br />
Theorem 3.1. Let B be a 5-blocking set in<br />
PG(2,q), such that through each of its points<br />
there are q �1<br />
lines, containing at least<br />
q � 5points<br />
of B and forming a dual Baer sub<br />
line :<br />
1. For q>25, B has at least<br />
5q � 2 q � 5points.<br />
2. For q = 16, B has at least<br />
5q � q �8<br />
points.<br />
Proof1. Call the lines meeting B in q � 5 or<br />
more points basic lines .If two basic lines meet<br />
outside of B, then B has at<br />
least:<br />
2( q � 5)<br />
� 5(<br />
q �1)<br />
� 5q<br />
� 2 q � 5 poi<br />
nts and the desired bound is obtained . So<br />
assume that two basic line meet in B. Take � , a<br />
basic line and P a point of B not on � . Then the<br />
basic line through P contain a dual Baer sub line<br />
meet � in a Baer sub line. Let Q be a point on<br />
this Baer sub line . Consider basic lines through<br />
a point on a 5-secant to Q these meet � in a<br />
another Baer sub line not containing Q. Two<br />
Baer sub lines meet in at most two points and so<br />
� has at least 2 q points. Since � was<br />
arbitrary, every basic line has at least<br />
2 q points and it follow that B has at least<br />
1� ( q �1)(<br />
2 q �1)<br />
� 4(<br />
q � q)<br />
� 6q<br />
�3<br />
q.<br />
But<br />
6q � 3 q � 5q<br />
� 2 q � 5for<br />
q �25<br />
so<br />
B �5q � 2 q � 5.□<br />
Proof2. If two long lines meet outside of B ,<br />
then B has at least
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 253-259, 2011<br />
2 ( q � 5)<br />
� 5(<br />
q �1)<br />
� 5q<br />
� 2 q � 5<br />
points. Let P � B , through B, since there are<br />
q �1<br />
long lines through P. B has at least<br />
( q �1)( q � 4) �1� 4( q �1 � ( q �1)) �<br />
5q � q �5<br />
points. Now if B �89<br />
then ( k,12)-arc has 184<br />
points and it is impossible.<br />
If B �5q � q � 6 then k = 183, it is<br />
impossible . If B �5q � q � 7 ,then k<br />
=182, and it is impossible. Since k �� 181, hence<br />
B �5q � q � 8.□<br />
The next theorem is an improvement to the<br />
lower bound of 5-blocking set in PG(2,q)<br />
when q �10<br />
.<br />
Theorem 3.2. Let B be a 5-blocking set in<br />
PG(2,q), having through every point at least<br />
q �1<br />
lines, containing at least<br />
q � 5 points of B and forming a dual Baer<br />
sub line. Then B has at least<br />
5q � 3 q � 5 points.<br />
Proof . Assume that B has at least<br />
5q � 3 q � 5 points. Call the lines meeting B<br />
in q � 5 or more points long lines. Take 15<br />
points of B, all lying on a long line � . there are<br />
at least 15 q( q � 4)<br />
points of B\ � lying on<br />
the long lines through these 15 points. Since<br />
B\ � has more than 5q � 2 q points .There<br />
exist more than<br />
15 q( q � 4)<br />
� 3(<br />
5q<br />
� 2 q)<br />
� 54 q<br />
points on four or more of the long lines through<br />
these 15 points counting with multiplicity .Let Pi<br />
be a point of B\ � joined to at least four of these<br />
15 points of � by long lines . Let Si be the points<br />
of � at which the long lines through Pi meet � .<br />
The set Si has at most q � 2 points otherwise Pi<br />
lies on at least q � 3 long lines and B has at<br />
least1+( q +3)( q +4)+4(q- q -<br />
2)=5q+3 q +5 points also Si contains a Baer<br />
sub line bi by hypothesis .Since there exist<br />
54 q points of B\ � [B\ � is the set of all points<br />
of B without points of the line � ] meeting at<br />
least four of the 15 points there exist<br />
54 q points the corresponding bi of which<br />
meet at least three of the 15 points. There are<br />
455 different sets of three points among these 15<br />
points and so there are points P1 and P2<br />
corresponding b1 and b2 of which meet in at least<br />
three points. Since two Baer sub line meeting at<br />
least two points b1 and b2are the same. If three<br />
long lines meet in a point outside of B, then B<br />
has at least<br />
3( q � 5)<br />
� 5(<br />
q � 2)<br />
� 5q<br />
� 3 q � 5<br />
points . So at most two long lines meet in a point<br />
outside of B. This implies that the long lines<br />
through P1 and P2 meet � in at most one point<br />
outside of B and that point lies on the long line<br />
joining P1 and P2 .<br />
Let S be the set of points of � � B at which<br />
b1 = b2 meet � � B then S has q or<br />
q �1<br />
points .We shall now prove that � has<br />
at least q � 7 points. Assume, firstly that it<br />
has less than q � 7 points. Let T be the set of<br />
points in B\ � that lie on a non-long line meeting<br />
S. By considering the points on non – long lines<br />
through a point of S, it follows that there are at<br />
least 4( q � q �1)<br />
points in T.<br />
Suppose that � has exactly q � 5 points of B.<br />
the long lines through a point of T can meet at<br />
most two points of S and so at most seven points<br />
of � � B. This follows from the fact that two<br />
different Baer sub lines meet in at most two<br />
points. Let n be maximal such that n points of T<br />
are collinear. Each point of B lies on at least<br />
q �1<br />
long lines and so each point of T has at<br />
least q � 6 long lines meeting � \B. There<br />
are q �1 � ( q � 5)<br />
points in � \B and so<br />
n ( q � 6)<br />
�q<br />
� q � 4 , which implies that<br />
n� q � 6 for q �19<br />
.<br />
Now , since every point of T has at least<br />
q � 6 long lines meeting � outside B and at<br />
most<br />
that<br />
q � 6 of them are collinear , it follow<br />
4( q � q �1)<br />
q � 6<br />
�q<br />
�<br />
q � 6<br />
q � 4 �q<br />
� q �1<br />
for q �10<br />
, since � was arbitrary , every long<br />
line contains at least q � 6 points of B .Now<br />
255
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 253-259, 2011<br />
if<br />
then<br />
q � 2of<br />
these long lines meet in a point<br />
B �1 � ( q � 2)( q � 5) � 4( q � q �1) �<br />
5q �3q �7<br />
So assume that every point of B lies on exactly<br />
q �1<br />
long lines. Let � be a line meeting<br />
exactly q � 6 points of B. Define S, T and n<br />
as before. n(<br />
q � 6)<br />
�q<br />
� q � 4as<br />
before,<br />
4( q � q �1)<br />
q � 6<br />
�q<br />
�<br />
q � 6<br />
q � 5 �q<br />
� q �1<br />
For q �10<br />
, since � was arbitrary , it has<br />
shown that every long line has at<br />
least q � 7 points . By counting the points of<br />
B on lines through a point of B. It follow that<br />
B �1� ( q �1)(<br />
q � 6)<br />
� 4(<br />
q � q)<br />
� 5q<br />
�3<br />
q � 7<br />
and the result follows . □<br />
Theorem 3.3.[6]. Let B be a 6-blocking set in<br />
PG(2,q) such that through each of it is points<br />
there are q �1<br />
lines , containing at least<br />
q � 6 points of B and forming a dual Baer<br />
sub line :<br />
1. For q �36<br />
, B has at least 6q � 2<br />
points.<br />
q � 6<br />
2. For q = 16, B has at least<br />
6q � q �<br />
256<br />
9points<br />
.<br />
4.The Minimal Blocking set of size 16 in a<br />
projective plane PG(2,9).<br />
Let B be a minimal blocking set of size 16 in<br />
PG(2,9)<br />
Theorem 4.1.[1].Let V be a vector space of<br />
dimension n over a finite field GF(q) , then any<br />
sub set of V intersect every prime of V contain<br />
at least n(q – 1)+1of points .<br />
Theorem 4.2. Any point of B lies on at least<br />
three tangents.<br />
Proof .Let P and let � be a tangent line to B<br />
at P. Consider PG(2,9)\ � and call this AG(2,9).<br />
Then a set B\ � of size 15 remains. A minimal<br />
blocking set in AG(2,9) contains at least 17<br />
points [3]. This means that we have to add at<br />
least two points to B\ � to get a blocking set in<br />
AG(2,9). The external lines to B\ � in AG(2,9)<br />
are the tangent to B at P, different from � .<br />
Hence P lies on at least three tangents to B. □<br />
Lemma 4.3 Gács [1]. In PG(2,q) , let B be a<br />
minimal blocking set of size q +k , and suppose<br />
there is a line L intersecting B in exactly k-1<br />
points. Then there is a point O � B such that<br />
every line joining O to a point of L\B contains<br />
two points of B . Hence k � ( q � 3)<br />
\ 2.<br />
The following theorem proves the existence of<br />
minimal Blocking sets of size 16 in PG(2,9) .<br />
Theorem 4.4.There is a minimal blocking set of<br />
size 16 in PG(2,9) having 6-secant.<br />
Proof . Let (x,y,z) denote the coordinates of a<br />
projective point. Let � be a 6-secant . Let � be<br />
the line at infinity of the corresponding affine<br />
plane [If � n�1<br />
is any prime in PG(2,9), then the<br />
affine plane AG(2,9) = PG(2,9)\ � n�1<br />
], and let<br />
� B�{<br />
P , P , P , P } . By lemma 4.3 , there is<br />
\ 1 2 3 4<br />
an affine point for which the lines O Pi ,<br />
i= 1,2,3,4, are bisecant. These lines contain eight<br />
affine points of B. Let U1 and U2 are the 9 th and<br />
10 th affine points .Since the points Pi lie on one<br />
2-secant and eight tangents , the lines U1Pi are<br />
tangents for i= 1, 2, 3 ,4. Furthermore , the line<br />
OU1 is a line passing through the point<br />
(1,1,0).We select the reference system in the<br />
following way. Let P1 = (0, 1, 0), P2 = (1, 0, 0),<br />
P3 = (1, 2� 3 , 0) , with � 2 = � + 1. Since the sub<br />
group of PGL(2,9) [PGL(2,9) is the set of all<br />
projectivities of PG(1, 9)] stabilizing {P1, P2,<br />
P3}, acts transitively on the seven other points of<br />
� , let OU1 pass through ( 1, 1 ,0) . We will set<br />
P4 = (1, � 3 , 0) . Let O = (0,0,1). Using the<br />
perspectivities with axis � and center O,we can<br />
assume that U1 = (1, 1, 1).<br />
Consider now the affine plane PG(2, 9)\ � . Let<br />
B' = B\(� � �{U1, U2}). Then two points of B' lie<br />
on the line X = 0, and two points lie on the line<br />
Y = 0, and two on the line Y = 2� 3 X , and two<br />
on the line Y = � 3 X .Since these are the lines O i<br />
, i= 1,2,3,4. Moreover , on every horizontal line<br />
Y =k , and on vertical line X = k ,and on every<br />
line Y = 2� 3 X + k and Y = � 3 X + k , with k �<br />
0there is one point on B . In piratical on the lines<br />
X= 1, y = 1, Y = 2� 3 X + 2� 2 ,Y = 2� 3 X +<br />
2� 2 ,Y=X which all pass through U1 there are no<br />
points of B'.this cancels a lot of points of AG<br />
(2,9).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 253-259, 2011<br />
(0, 0) (0, 1) (0, 2) (0, �) (0, 2�) (0, � 2 ) (0, 2� 2 ) (0, � 3 ) (0, 2� 3 )<br />
(1, 0) (1, 1) (1, 2) (1, �) (1, 2�) (1, � 2 ) (1, 2� 2 ) (1, � 3 ) (1, 2� 3 )<br />
(2, 0) (2, 1) (2, 2) (2, �) (2, 2�) (2, � 2 ) (2, 2� 2 ) (2, � 3 ) (2, 2� 3 )<br />
(�, 0) (�, 1) (�, 2) (�, �) (�, 2�) (�, � 2 ) (�, 2� 2 ) (�, � 3 ) (�, 2� 3 )<br />
(2�,0) (2�, 1) (2�,2) (2�,�) (2�, 2�) (2�,� 2 ) (2�, 2� 2 ) (2�,� 3 ) (2�, 2� 3 )<br />
(� 2 , 0) (� 2 , 1) (� 2 ,2) (� 2 ,�) (� 2 , 2�) (� 2 ,� 2 ) (� 2 , 2� 2 ) (� 2 ,� 3 ) (� 2 , 2� 3 )<br />
(2� 2 ,0) (2� 2 ,1) (2� 2 ,2) (2� 2 ,�) (2� 2 ,2�) (2� 2 ,� 2 ) (2� 2 ,2� 2 ) (2� 2 ,� 3 ) (2� 2 ,2� 3 )<br />
(� 3 , 0) (� 3 , 1) (� 3 , 2) (� 3 , �) (� 3 , 2�) (� 3 , � 2 ) (� 3 , 2� 2 ) (� 3 , � 3 ) (� 3 , 2� 3 )<br />
(2� 3 ,0) (2� 3 ,1) (2� 3 ,2) (2� 3 ,�) (2� 3 ,2�) (2� 3 ,� 2 ) (2� 3 ,2� 2 ) (2� 3 ,� 3 ) (2� 3 ,2� 3 )<br />
On Y = 2� 3 Xwe need to select two points from<br />
the set:<br />
2 3 2 3 2 3<br />
� �{(2�,<br />
2), (λ , λ), (λ , λ ), (2λ , 2λ ), (2, λ )}<br />
1<br />
These points with the six points of B � � :<br />
2<br />
{(1,1,0),(1,2,0),(1, �,0),(1,2 �,0),(1, � ,0),<br />
On Y = � 3 X we need to select two points from<br />
the set:<br />
3<br />
2<br />
2 3 2<br />
� 2 �{(2,<br />
2�<br />
), ( �,<br />
2), (λ ,2λ<br />
), (2λ , λ ), ( � , 2λ<br />
)}<br />
On X = 0 we need to select two points from the<br />
set:<br />
{(0, 2), (0, 2λ),<br />
(0, λ<br />
2<br />
), (0, λ<br />
3<br />
), ( 0, 2λ<br />
3<br />
)}.<br />
3 � �<br />
We also need to select two points on the line Y<br />
=0 to be in B 'this gives the following ten<br />
possibilities:<br />
1. (�, 0)<br />
and ( 2�<br />
, 0)<br />
. This choice<br />
eliminates ( 2�,<br />
2)<br />
of � 1and (�, 2)<br />
of � 2.<br />
Since we cannot have two points of B' on the<br />
same horizontal line different from the first line .<br />
On Y = � 3 X+1, Y = � 3 X+2, Y = 2� 3 X+1, Y =<br />
2� 3 X+2, the two lines through P3, P4 and (λ,0) ,<br />
(2λ,0) , we cannot select any other point of B'<br />
since lines must be tangents to B .This<br />
eliminates two other points (2λ,2) of � 1 and<br />
(λ,0)of � 2 and (0,2) from � 3 . Hence this choice<br />
give us the points (λ,0) , (2λ,0) and the points<br />
(� 3 , � 2 ), (2� 3 , 2� 2 ) , (� 2 , �) , (2, � 3 ) from 1 � and<br />
(� 3 , 2� 2 ), (2� 2 , �),(� 2 , 2�), (2, 2� 3 ) from � 2 and<br />
(0, 2�) ,(0, � 2 ),(0, � 3 ), (0, 2� 3 ) from � 3 . If we<br />
choose two points from Y =0 and two points<br />
from � 1 and two points from � 2 and two points<br />
from � 3 . We will have 216 possibilities for<br />
eight point of B'. So we choose (λ,0) , (2λ,0)<br />
from Y=0 and (� 3 , � 2 ), (2� 3 , 2� 2 ) from � 1 and<br />
(2� 2 , �),(� 2 , 2�) from � 2 and (0, � 3 ) , (0, 2� 3 2<br />
(1,2 � ,0)} with the point U1 = (1, 1, 1),this<br />
give us 15 points of B and with the point U2 =<br />
(1, 1, 2) ,we have a minimal blocking set of size<br />
16 having 6-secant. □<br />
Definition4.5. An elation of PG(2,q) is an<br />
automorphism that fixes all points on a line � ,<br />
and that fixes all lines through a certain point P<br />
of � is called the axis of the elation, and the<br />
point P is the center of the elation .<br />
The order of an elation � of PG(2,q), q=p<br />
)<br />
from � 3 .To be eight affine points from B'. Since<br />
theses points are affine we change these points<br />
to the projective points:<br />
3 3 3 2<br />
{(0, � ,1),(0,2 � ,1),( �,0,1),(2 �,0,1),( � , � ,1),<br />
3 2 2 2<br />
(2 � ,2 � ,1),( � ,2 �,1),(2 � , � .1)}<br />
h , p<br />
prime, is equal to the prime p.<br />
Theorem4.6. There is minimal blocking 16-set<br />
of Re'dei – type in PG(2,9).<br />
Proof . Let ( x, y , z) denote the coordinates of a<br />
projective point Let � : Z = 0 be the Re'dei- Line<br />
and let Pi = (xi, yi, 1) �� (xi, yi), i= 1,2,…,9 , be<br />
the affine points of the blocking set B .<br />
Let A = ( 0,1,0) , B = ( 1,0,0) and C = ( 1,2,0) be<br />
the three points of � \ B . Since all affine line<br />
X = aZ through A and Y = bZ through B contain<br />
exactly one affine point of the blocking set, we<br />
have xi � xj , yi � yj if i � j. Since C does not<br />
belong to B, all affine lines X + Y + aZ = 0<br />
contain exactly one point (xi, yi, 1) of B, So all<br />
the sum xi + yi = a , are different so for every a<br />
in GF(9) , there is one solution xi + yi = ��a , So<br />
xi + yi � xj + yj , if i � j. These three condition<br />
will be used in the search for minimal blocking<br />
set of Re ' dei-type of size 16 .We now select the<br />
first three affine points. Suppose the 9 points of<br />
B\ � from a 9-arc, since they only lie on tangents<br />
to B \ � but a 9-arc in PG(2,9), consists of 9<br />
point conic so can only be extended by the tenth<br />
point of this conic to a 10-arc in one way. So<br />
there are at least three collinear points in B\ � .<br />
The line containing these collinear points<br />
intersects � in a point of B. We can assume that<br />
(0,0,1) lies in the blocking set B'. We can again<br />
assume that at least three of the nine remaining<br />
points of the blocking set ( not lying on Z=0) are<br />
257
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 253-259, 2011<br />
collinear. Assume that such a line contains at<br />
least three of those collinear points passes<br />
through (0,0,1). They are collinear with one of<br />
the points on Z=0 different from (1,0,0), (0,1,0),<br />
(1,2,0). We can assume that they are collinear<br />
with a point Since the subgroup fixing {A1, A2,<br />
A3} contain at most six elelment which is the<br />
group � S3 where :<br />
T1: (x, y, z) � (y + z, x + 2z, 0)<br />
T2: (x, y, z) � (2y + z, x +y, 0)<br />
This give us two elations the first one contain<br />
the set of points:<br />
2 2 3<br />
{(1, �,0),(1,2 �,0),(1, � ,0),(1,2 � ,0),(1, � ,0),<br />
3<br />
(1,2 � ,0)} and the second one contain the set<br />
� 1,<br />
1,<br />
0)<br />
�<br />
( . We choose the point (1,�,0) from first<br />
elation and we assume that this point lie on the<br />
same line that the three points lie on it with the<br />
point (0,0,1). Now let P1 = (0,0). Using<br />
perceptivities with axis � and center P1, we can<br />
set P2 = (1,�) also using percepectivities with<br />
axis � and center P2 we can set P3 = (2, 2�) .<br />
Using the elation:<br />
� : (x, y, z) � (x + z, y + �z, z) with axis � and<br />
center (1,�, 0)which interchanges P1, P2, P3. It<br />
also interchanges (�,� 2 ), (� 2 , � 3 ), (2� 3 , 1) and<br />
interchanges the points (2�,2� 2 ), (� 3 , 2), (2� 2 ,<br />
2� 3 ).Now we assume that the points P1, P2, P3<br />
B', and P4 � {(�,� 2 ), (2�, 2� 2 )}. First we choose<br />
P4 = (�,� 2 ) and it is similar in the case of P4 =<br />
(2�,2� 2 ) .The criteria for selecting a next point<br />
Pi = (xi, yi), i= 5,…, 9 to be points of B' is that :<br />
1. xi � {x1, … , xi�1}<br />
2. yi � {y1, … , yi�1}<br />
3. xi + yi � {x1 + y1, … , xi�1 + yi�1}.<br />
We choose the points P1, P2, P3, P4 in B' then<br />
xi: 0, 1, 2, �and yi :0, �,2�,� 2 , xi + yi: 0, � 2 , 2� 2 ,<br />
� 3 .For the point P5=(2�,y5) we have y5�{1, 2,<br />
2� 2 , � 3 , 2� 3 },and 2� + y5� {� 3 , 2� 2 , 2� 3 , � 2 , 2}<br />
and by the three condition we have either P5 =<br />
(2�, 2� 2 ) or P5 = (2�, 2� 3 ) . we choose<br />
P5=(2�,2� 3 ) then xi : 0, 1, 2, �, 2� and yi:<br />
0, �,2�,� 2 , 2� 3 and xi + yi: 0, � 2 , 2� 2 , � 3 , 2.<br />
For the point P6 = (� 2 , y6) we have y6 � {1, 2,<br />
258<br />
2� 2 , � 3 } and � 2 + y6�{2� 3 , �, 0, 2}by the three<br />
condition we have two possibility for P6 which<br />
are P6 = (� 2 , 1) and P6 = (� 2 , 2) we choose P6 =<br />
(� 2 , 2) then the used xi are 0, 1, 2, �, 2�, � 2 and<br />
the used yi are 0, �,2�,� 2 , 2� 3 ,2 and the used xi +<br />
yi are 0, � 2 , 2� 2 , � 3 , 2, � , for the point P7 =<br />
(2� 2 , y7) we have y7 � {1, 2� 2 , � 3 }and 2� 2 + y7<br />
� {2�, � 2 , �},by the three condition we have<br />
only one possibility for P7 which is P7 = (2� 2 ,<br />
1).If we take P7 = (2� 2 , 1) then xi are 0, 1, 2, �,<br />
2�, � 2 ,2 � 2 and the used yi are 0, �,2�,� 2 ,<br />
2� 3 ,2,1and the used xi + yi are 0, � 2 , 2� 2 , � 3 , 2,<br />
�,2� . For the point P8 = (� 3 , y8) we have<br />
y8�{2� 2 , � 3 }and � 3 + y8�{�, 2� 3 }by the<br />
three condition we have only one possibility for<br />
P8 which is P8 = (� 3 , � 3 ) . If we take P8 = (� 3 , � 3 )<br />
then the used xi are 0, 1, 2, �, 2�, � 2 ,2 � 2 , � 3 and<br />
the used yi are 0, �,2�,� 2 , 2� 3 ,2,1,� 3 ,and the used<br />
xi + yi are 0, � 2 , 2� 2 , � 3 , 2, �,2�,2� 3 .By the three<br />
condition we have only one possibility for P9<br />
which is P9 = (2� 3 , 2� 2 ) . So the used xi are 0, 1,<br />
2, �, 2�, � 2 ,2 � 2 , � 3 ,and the used yi are 0,<br />
�,2�,� 2 , 2� 3 ,2,1,� 3 ,and the used xi + yi are 0, � 2 ,<br />
2� 2 , � 3 , 2, 2� 3 . Hence we get to the nine affine<br />
points: P1 = (0, 0), P2 = (1, �), P3 = (2, 2�), P4 =<br />
(�, � 2 ),<br />
P5 = (2�, 2� 3 ), P6 = (� 2 , 2), P7 = (2� 2 , 1), P8 =<br />
(� 3 , � 3 ), P9 = (2� 3 , 2� 2 ) .<br />
These points together with seven points of<br />
B � � give us a minimal blocking 16-set of<br />
Re'dei – type in PG(2,9).□<br />
REFERENCES<br />
- J. Barát and S. Innamorati ,Largest minimal blocking sets<br />
in PG(2, 8), J. Combin. Designs. (2003), 11: 162-<br />
169.<br />
- A. Blokhuis ,Note on the size of a blocking set in PG(2,<br />
p), Combinatorica. 14, (1994), 111-114.<br />
- A.A. Bruen, Arcs and multiple blocking sets,<br />
Combinatorica, Symposia, Mathematic 28,<br />
Academic Press, (1986),15-29.<br />
- J. Di Paola,On minimum blocking coalitions in small<br />
projective plane games, SIAM J. Appl. Math., 17,<br />
(1969), 378-392.<br />
- J.W.P.Hirschfeld,Projective Geometries over Finite<br />
Fields Oxford University Press, Oxford, (1979).<br />
- M. Richardson, On finite projective games, Proc. Amer.<br />
Math. Soc., 7, (1956), 458-465.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 253-259, 2011<br />
َىمةد ىرك كؤمب-5<br />
نَيرونس<br />
ةم اسةورةه<br />
انووبةه اد<br />
ىطاقسا<br />
اموك ؤب ىرَيذ نَيرونس ،راجوود<br />
.<br />
q �10<br />
q<br />
َىمةد ىرك كؤمب-5<br />
َىتخةتور د نركرايد ةم د ىتةبيات ب<br />
،<br />
PG(2, q)<br />
اد ىطاقسا َىتخةتور د ةم ،ادَىنيلوكةظ َىظد<br />
ذ ىرَيذ نَيرونس اد فيود ل<br />
. q=16<br />
Redei َىروج ذ 66 َىرابةق ذ ىرك كؤمب اموك نيتركوضب و رةرب-6<br />
ةيييجيلاقلا ةييع ي ي ل ىييار ا ميييجقلا رايي داق اييجيا ييق ع رميييع<br />
.<br />
q �10<br />
. نرك ينلوث ةناد<br />
PG(2,q)<br />
و<br />
لةطد<br />
q>36<br />
ةيلا ذيف ةجيسايخلا ةيجيلاقلا ةيع ي ي ل ىيار ا ميجقلا لجي ق ايجيا يث .<br />
ي يلا ذيف ةيصاص خ يصقو .<br />
q = 16<br />
ةيجيلاا ةيع ي ع ر يدوو داجيسامس داياطاا ي يت<br />
.<br />
67<br />
و<br />
q > 36<br />
66<br />
q<br />
،<br />
67<br />
66<br />
. ينساين ةناد<br />
َىمةد ىرك كؤمب-6<br />
q=16<br />
و<br />
ةتخوث<br />
q>25<br />
اموك ذ ىرَيذ<br />
َىرابةق ذ ىرك كؤمب اموك نيتركوضب<br />
َىرابةق ذ ىرك كؤمب نَيموك نيتركوضب ةم و<br />
ةصلاخلا<br />
ذطاقييس ا يي يلا ذيييفو سيي يلا احيي ذييف<br />
q = 16<br />
اعميجع ةجيسام لا ةيجيلاقلا ةيع ي ي ل ىيار<br />
ي ا ةد تيصأ ةيجيلاا ةيع ي ع ر يدو ايج يثأ ،<br />
ا ةد تصلأا ةجيلاقلا جعا يلا فججص ق اجيا ايك.<br />
مد<br />
و<br />
– ع ا لع<br />
q > 25<br />
اعميجع ةجيسايخلا<br />
ا ميجقلا راي داق ايجيا اييك<br />
PG(2, 9)<br />
66<br />
ذطاقيس ا<br />
ا ةد تصأ<br />
259
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
062<br />
A MULTIPLE CLASSIFIER SYSTEM FOR SUPERVISED<br />
CLASSIFICATION OF REMOTELY SENSED DATA<br />
AHMED AK. TAHIR<br />
Dept. of Physics, Faculty of Science, University of Duhok, Kurdistan Region-Iraq<br />
(Received: February 2, 2011; Accepted for publication: August 14, 2011)<br />
ABSTRACT<br />
In this paper a new scheme of multiple classifier system (MCS) for remote sensing data classification is proposed.<br />
It includes four member classifiers; maximum likelihood, minimum distance and two differently trained supervised<br />
artificial neural networks of type adaptive resonance theory ART_II. The system is based on newly developed method<br />
of integration, named Local Ranking (LK). This method is categorized as dynamic classifier selection (DCS) approach<br />
and based on ranking the classifiers for each class on the basis of pre-estimation of the class mapping accuracy from<br />
training data. The system is applied to multi-spectral image, taken by landsat-7 with ETM+ sensor, of Duhok city in<br />
Kurdistan region to classify seven cover types (residential area, water surface, dense vegetation, less dense vegetation,<br />
spars vegetation, wet soil and dry soil). The results have shown the superiority of the system performance over the<br />
performance of the individual classifiers in term of class and average accuracy. The increase in system performance<br />
for the seven classes compared to the highest class accuracy provided by any of the individual classifiers was 1.59%,<br />
0.0%, 0.7%, 5.14%, 13.21%, 4.67%, 2.02% respectively. While the increase in the average accuracy compared to the<br />
highest average accuracy provided by maximum likelihood classifier was 4.30%. This increase correspond to an area<br />
of (10.15) km 2 . The efficiency of the local ranking (LR) method is compared to the well known methods, local<br />
accuracy (LA) and majority voting (MV). The results have shown the superiority of the developed method (LR) over<br />
LA and MV in terms of average and class accuracy. The average accuracies of LR, LA and MV were (94.68%),<br />
(91.54%) and (91.57%) which correspond to (3.14%) and (3.11%) improvements in the favor of LR over LA and MV.<br />
These improvements are equivalent to areas of (7.4) km 2 and (7.34) km 2 . For individual class accuracy, LR method<br />
provided highest accuracy for three classes, LA method provided highest accuracy for two classes and MV provided<br />
highest accuracy for only one class, while all three methods provided same accuracy for one class.<br />
KEYWORDS: remote sensing, image classification, multiple classifier system, statistical methods, artificial neural network.<br />
S<br />
1. INTRODUCTION<br />
upervised classification of remotely<br />
sensed data, namely satellite images, is a<br />
technique of potential use in applications<br />
concerning the mapping of earth surfaces (e.g.<br />
land cover, vegetation areas and forest areas) and<br />
in environmental and atmospheric studies (e.g.<br />
monitoring of burned areas and cloud<br />
classification). Methods of supervised<br />
classification ranges from statistical methods,<br />
such as maximum likelihood, minimum distance<br />
and k-nn neighbor, [Dengsheng et al., 2004 and<br />
Jain et al., 2000], to non-statistical methods such<br />
as artificial neural networks (ANN), [Mather et<br />
al., 1998 and Ashish et al., 2009], support vector<br />
machine,(SVM), [Chi et al., 2008 ] and expert<br />
system, [Kahya et al., 2010]. The point of most<br />
concern in applying any of the classification<br />
methods is the accuracy of the classifier.<br />
Previous studies, e.g. [Benediktsson et al., 1990,<br />
Wilkinson and Kanellopoulos, 1995 and Serpico<br />
et al., 1996] concerning comparisons between<br />
statistical and non-statistical methods, have<br />
shown that there is no such a classifier that<br />
performs well in all situations because of the<br />
unstable nature of the data distribution. For<br />
instance, methods of statistical approach,<br />
specifically Maximum likelihood method,<br />
perform well for data of simple distribution<br />
while non-statistical methods, specifically<br />
artificial neural networks, perform well for data<br />
of complex distribution. Those studies have also<br />
shown that non-statistical methods suffer one<br />
major limitation concerning the understanding of<br />
their behaviors. The outcomes of these studies<br />
brought the attention of remote sensing<br />
community towards the concept of multiple<br />
classifier system (MCS). The idea of MCS is<br />
based on integrating the performance of two or<br />
more classifiers to achieve better classification<br />
accuracy. Several systems of multiple classifiers<br />
have been developed using different<br />
combinations of classifiers. Examples of these
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
systems can be found in [Giacinto et al., 2000,<br />
Liu et al., 2002, Pasquariello et al., 2002, Qiu<br />
and Jensen 2004, Meher et al 2006, Shankar et al<br />
2006, El-Melegy and Ahmed, 2007, Maulik and<br />
Chakraborty, 2010 and Ghosh et al., 2010]. The<br />
performance of any MCS depends on two main<br />
factors, selection of member classifiers and<br />
integration of their outputs. Member classifiers<br />
are preferred to be based on fundamentally<br />
different approaches, [Wilkinson and<br />
Kanellopoulos, 1995 ]. Two approaches are used<br />
for the integration of the classifiers, combined<br />
based and dynamic classifier selection based<br />
approaches. In the combined based approach all<br />
the outputs from the member classifiers<br />
contribute to the final decision of MCS. In the<br />
selection based approach the output of only one<br />
classifier is selected as a final decision of MCS.<br />
The success of either approach is determined by<br />
the nature of outputs produced by the member<br />
classifiers and the errors scored by the<br />
classifiers. Methods of combined based<br />
approach are based on the assumption that the<br />
member classifiers score independent errors.<br />
This may represent a serious shortcoming of this<br />
approach, since in real applications the selection<br />
of member classifiers that produce independent<br />
errors is rather a difficult task and may require<br />
large number of classifiers. On the other hand,<br />
methods of dynamic classifier selection based<br />
approach are not based on this assumption.<br />
However they are based on k-nn strategy.<br />
Therefore their successes are constraint by a<br />
proper selection of K value and improper<br />
selection may cause undesired results. In<br />
addition, dynamic classifier selection based<br />
Classifier 1<br />
Sample<br />
Classifier 2<br />
Integration of classifier outputs<br />
Final decision<br />
Fig. (1): General Scheme of MCS<br />
approach suffers the shortcoming of the<br />
appearance of many tie cases, that is more than<br />
one classifier may share the same rank.<br />
However, this shortcoming can be limited by<br />
using small number of member classifiers,<br />
[Benediktsson et al., 2007].<br />
The aim of this paper is to develop a multiple<br />
classifier system (MCS) consisting of four<br />
member classifiers, (maximum likelihood,<br />
minimum distance and two ART-II neural<br />
networks). The system is based on a newly<br />
developed method for classifier integration,<br />
named local ranking (LR) which is categorized<br />
as dynamic classifier selection based method.<br />
The paper is organized as follows: section-2<br />
covers general scheme of MCS and description<br />
of the most commonly used of integration<br />
methods, section-3 covers the proposed MCS<br />
and describes the components of the proposed<br />
system, section-4 presents the results and<br />
section-5 covers the outcome conclusions.<br />
2. GENERAL SCHEME OF MCS<br />
The general scheme of MCS is shown in<br />
figure (1). The sample (image pixel) is entered to<br />
all member classifiers then the outputs of the<br />
classifiers are integrated to produce the final<br />
result as to which class the pixel should be<br />
assigned. Usually two or more classifiers are<br />
incorporated in MCS. However, incorporating<br />
many classifiers should not slow down the<br />
process of classification.<br />
Classifier M<br />
062
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
The most important issue in developing MCS<br />
is the integration method, which must take<br />
advantage of the strengths of the individual<br />
classifiers and avoid their weaknesses. Several<br />
methods of both approaches are available. The<br />
applicability of any method is determined by the<br />
nature of the outputs produced by the involved<br />
classifiers. Generally speaking, there are three<br />
levels of output information, abstract level, rank<br />
level and measurement level. In the abstract<br />
level, each classifier produces a unique label. In<br />
the rank level, each classifier produces a set of<br />
labels in a queue with the label at the top being<br />
the first choice. In the measurement level each<br />
classifier produces a set of measurements which<br />
can be arranged according to their values.<br />
2.1 Combined Based Approach<br />
The most commonly methods of the<br />
combined based approach are:<br />
1) Majority voting rule, [Maulik and<br />
Chakraborty, 2010], which assigns the label<br />
scored by majority of the classifiers to the test<br />
sample. It can be applied to abstract and rank<br />
levels outputs. 2) Bayesian function, [Giacinto et<br />
al., 2000] which calculates the average posterior<br />
probabilities produced by the classifiers for each<br />
class and assigns the test sample to the class that<br />
has maximum average posterior probability.<br />
This method is applied to outputs at<br />
measurement level. 3) Belief function, [Smits,<br />
2002] which is knowledge based method. It is<br />
based on probability estimation provided by the<br />
confusion matrix derived from training data set.<br />
The test sample is assigned to the class that<br />
maximized the scalar product of these<br />
probabilities. However, Bayesian and belief<br />
function methods require comparable outputs,<br />
[Maulik and Chakraborty, 2010].<br />
2.2 Dynamic Classifier Selection (DCS) Based<br />
Approach<br />
The most commonly methods of the selection<br />
based approach are:<br />
1)Behavior-Knowledge Space (BKS) method,<br />
[Huang and Suen, 1995] which divides the Ndimensional<br />
space made by the decisions of the<br />
classifiers into units representing all possible<br />
combinations of the individual classifier<br />
decision. Then for each class, training samples<br />
are classified by the individual classifiers and<br />
accumulated in these units. When a test sample<br />
is passed over the classifiers, the decisions of<br />
individual classifiers index a unit and the sample<br />
is assigned to the class with most of the training<br />
samples in that unit. It can be applied to abstract<br />
and rank level outputs. 2) Classifier Rank (CR)<br />
060<br />
approach, [Sabourin et al., 1993] takes the<br />
decision of the classifier that correctly classifies<br />
most of the training samples neighboring the test<br />
sample. It is applied to both abstract and rank<br />
level outputs. 3) Dynamic classifier selection<br />
based Local Accuracy (DCS-LA), [Smits, 2002<br />
and Woods et al., 1997] which is based on an<br />
estimation of local accuracy in the local region<br />
of feature space surrounding the test sample. The<br />
decision is made by selecting the output of the<br />
classifier that produces maximum local<br />
accuracy.<br />
3. THE PROPOSED MCS<br />
In the present work a multiple classifier<br />
system for supervised classification of multispectral<br />
dataset is proposed. The system includes<br />
four individual classifiers, maximum likelihood<br />
and minimum distance classifiers and two ART-<br />
II networks trained with two different values of<br />
vigilance parameter. These classifiers are<br />
selected because they perform differently for<br />
surfaces of different homogeneity. Maximum<br />
likelihood is effective for classifying surfaces<br />
whose spectral signatures reside the Gaussian<br />
distribution in the feature space. Minimum<br />
distance is effective for very homogeneous<br />
surfaces whose spectral signature reside a point<br />
in the feature space. On the other hand ART-II is<br />
effective for surfaces whose spectral signature<br />
distribute randomly in the feature space. The<br />
system is based on newly developed method for<br />
classifier integration, named the Local Ranking<br />
method which is of dynamic classifier selection<br />
type. The components of the proposed system<br />
are described in the following sections.<br />
3.1. Maximum Likelihood Classifier (MLC)<br />
MLC is a statistical method which is based<br />
on Bayesian probability theory which makes use<br />
of statistical measurement (mean and<br />
variance/covariance matrix). It provides good<br />
results for classes of simple distribution.<br />
Mathematically, for equal priori probabilities of<br />
the classes, it is represented according to<br />
[Shankar et al., 2006] by the following equation.<br />
1<br />
P(<br />
x | ci<br />
) �<br />
( 2�<br />
) n/<br />
2<br />
� i<br />
1/<br />
2<br />
�[(<br />
x��<br />
) T �1<br />
i � i ( x��i<br />
)]<br />
e<br />
Where;<br />
Р(x | ci) is the conditional probability.<br />
ci is the i th class where i refers to class number, i<br />
= 1,2,…n and n is the total number of classes<br />
/ 2<br />
( 1)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
x is the testing sample (sample to be classified).<br />
µi is the mean vector for class i<br />
Σi is the covariance matrix.<br />
For computation purpose, equation (1) is<br />
usually modified to a form of discriminate<br />
function, [Chen and Ho, 2008] by applying the<br />
natural logarithmic (ln) which is a monotonic<br />
function on both sides and discarding the<br />
constant term. This will require changing the<br />
rule to choose minimum instead of maximum:<br />
T �1<br />
Fi ( x)<br />
� ln( �<br />
i ) � ( x � �i ) �<br />
i ( x � �i<br />
)<br />
( 2)<br />
Where, Fi(x) is substituted for ln(P(x|ci)). The<br />
rule of classification is to choose x that<br />
minimizes Fi as follows:<br />
x Є class i, if Fi (x)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
3.3.1. ART-II Training Phase<br />
1. Read training data (feature vectors a t (i),<br />
i=1…M) each with its class code b t ., where M is<br />
the number of spectral images used in the<br />
classification and t is the index of the feature<br />
vector in the data file.<br />
2. Normalize the feature vectors and take its<br />
complement to produce 2M length input vectors<br />
A t (i), i=1…2M.<br />
3. Select the first input vector A 0 (i) at t = 0 and<br />
its class code b 0 . Set the initial value of the<br />
Wijk , k<br />
dynamic learning rate parameter β and the<br />
choice parameter α.<br />
4. Use the current input as the initial weights of<br />
the newly committed category node jk at stake<br />
k=b as follows:<br />
Where C(k) is the number of committed node in<br />
stack number k and L is the total number of<br />
stakes (output classes)<br />
5. Set the initial values of the Vigilance<br />
parameter ρ.<br />
6. Set t = t+1 and select the next input vector<br />
At(i) with its associated class code bt, if the end<br />
of file is reached goto step 14.<br />
7. Calculate the choice value of the committed<br />
nodes (<br />
T<br />
) in all the stakes using the<br />
j k<br />
k<br />
following equation:<br />
2M<br />
� (<br />
i<br />
Ai<br />
�W<br />
)<br />
ijk<br />
k<br />
T k<br />
�<br />
�1<br />
; j � 1...C(k);<br />
k � 1...L<br />
(5)<br />
jk 2M<br />
k<br />
α � �<br />
i�1 Wijk k<br />
The symbol ^ means take-minimum-of.<br />
8. Select the node of maximum choice value Tjk<br />
of each stack using the following relation:<br />
T jk<br />
� max{ T k<br />
; j �1...<br />
C(<br />
k);<br />
k �1...<br />
L}<br />
jk k<br />
These maximum values are the candidates of<br />
their stacks<br />
9. The maximum of all maximums is chosen to<br />
represent winning node, that is:<br />
T JK<br />
� max{ T Jk<br />
; Jk<br />
� J1<br />
... J L<br />
}<br />
10. The match value is computed for the winning<br />
node using the following equation:<br />
MV ( � i W<br />
062<br />
0<br />
�<br />
A ( t);<br />
jk<br />
2M<br />
� �<br />
i�1<br />
�<br />
1...<br />
A iJK<br />
C(<br />
k);<br />
k<br />
) / M<br />
1...<br />
(6)<br />
11. Perform match value and class matching:<br />
�<br />
L<br />
if {(MV >= Vigilance parameter ρ).and.(the<br />
class of current input b = the<br />
class of winning node K)} then<br />
//Update the weights of the winner node<br />
as follow:<br />
new old<br />
old<br />
WiJK<br />
� � ( Ai<br />
�W<br />
iJK<br />
) � ( 1�<br />
� ) WiJK<br />
; i � 1...<br />
2M<br />
(7)<br />
Return to step 6<br />
Else perform match tracking<br />
goto step12<br />
end if<br />
12. Perform match tracking<br />
If {(MV < Vigilance parameter ρ .or. input<br />
class b ≠ output class K ) then<br />
Put the current node out of<br />
competition<br />
Select the node with the next<br />
maximum choice value of the winning stack<br />
Set the value of ρ to the match value plus ε<br />
then go to step 9<br />
end if<br />
13. Match tracking failure<br />
If the match tracking is failed for all the<br />
committed nodes in all stakes then<br />
The number of committed nodes in the stack<br />
is increased by 1<br />
C ( b)<br />
� C(<br />
b)<br />
�1<br />
goto step 5<br />
else<br />
current input pattern; W � A ; i �1...<br />
2M<br />
i,<br />
C(<br />
b),<br />
b i<br />
//set the initial weights as input pattern, this<br />
means that initial weight values are not<br />
required.<br />
Goto step 5<br />
end if<br />
14. Stop<br />
3.3.2. ART-II Testing Phase<br />
1. The input pattern vector is submitted to the<br />
network and the choice values for all committed<br />
nodes in all stacks are computed using equation<br />
(5).<br />
2. The node with highest Tjk k is selected as<br />
winner.<br />
3. The MV of the winning node is computed<br />
using equation (6).<br />
4. Check vigilance test<br />
If {MV >= ρ} then<br />
The current input pattern belongs to class K<br />
else<br />
The network fails to classify the input pattern<br />
end if.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
3.4. Local Ranking (LR) method<br />
The outputs of the member classifiers used in<br />
the proposed MCS are not comparable. ART-II<br />
network produces only one class at a time<br />
(output of abstract level) while maximum<br />
likelihood and minimum distance produce<br />
measurement outputs for all possible classes.<br />
Therefore, among the combined based methods<br />
only majority voting rule can be adapted to the<br />
system. However, this rule may show one of<br />
two major shortcomings depending on the<br />
degree of correlation among the errors made by<br />
individual classifiers. When these errors are<br />
correlated, that is when all classifiers produce<br />
incorrect but similar outputs the rule of majority<br />
will lead to incorrect decision. When these errors<br />
are uncorrelated, that is when each classifier<br />
produces a unique output, the rule of majority<br />
leads to a failure. On the other hand, most of the<br />
previous methods of dynamic classifier selection<br />
based approach use nearest neighboring samples<br />
for selecting the best classifier. Therefore their<br />
performance depend the size of neighboring<br />
samples (K) and the choice of an appropriate<br />
size is rather a difficult task.<br />
The new dynamic classifier selection based<br />
method developed in this study takes the<br />
effectiveness of individual classifiers into<br />
account. It is named Local Ranking (LR) and<br />
Table (1): A model of ARM<br />
based on ranking the classifiers for each class<br />
according to the mapping accuracy of the class<br />
by each classifier. The mapping accuracy of the<br />
class is measured through the confusion matrix<br />
of the training data taking into account the<br />
omission and commission errors using the<br />
following equation:<br />
pcorr<br />
MA � (8)<br />
p � p � p<br />
corr<br />
om<br />
com<br />
Where Pcorr represents samples classified<br />
correctly to the current class, Pom is omission<br />
error representing samples from the current class<br />
but classified as other classes and Pcom is<br />
commission error representing samples from<br />
other classes falsely classified to the current<br />
class. Then for each class a rank of (1) is given<br />
to the classifier that offers highest mapping<br />
accuracy and a rank of (m) is given to the<br />
classifier that offers least mapping accuracy,<br />
where m is the number of member classifiers.<br />
The mapping accuracy and the classifier ranks<br />
are arranged in a table named the accuracyranking<br />
map (ARM) which is used for the<br />
implementation of Local Ranking method. A<br />
model of this map for m classifiers and n classes<br />
is shown in table (1), where MA and R,<br />
respectively are the mapping accuracy and<br />
ranking of the classifiers.<br />
Classifier Class 1 Class 2 . . . . . Class n<br />
Classifier 1 MA11 R11 MA12 R12 MA1n R1n<br />
Classifier 2 MA21 R21 MA22 R22 MA2n R2n<br />
.<br />
.<br />
In order to reduce the occurrence of tie cases,<br />
the classifier rank and the mapping accuracy are<br />
used in the process of classifier selection.<br />
However, the first priority is given to the<br />
classifier rank within each class while the<br />
mapping accuracy of the classifiers is given the<br />
second priority. This strategy is adopted in order<br />
to prevent the domination of classes that have<br />
high accuracy over those having low accuracy.<br />
The rule of local ranking (LR) method is as<br />
follows:<br />
Let m represents the number of member<br />
classifiers and n is the number of classes, then,<br />
x Є class j if Rij < Rkl for all i ≠ k<br />
.<br />
.<br />
Classifier m MAm1 RM1 MAmn Rmn<br />
.<br />
.<br />
.<br />
.<br />
Where, i & k refer to the classifier number (i&k<br />
= 1,2,,,,m) and j &l refer to the class number<br />
(j&l =1,2,,,,n).<br />
To limit the occurrence of ties, the following<br />
cases are considered during the execution of the<br />
rule:<br />
1. When two or more classifiers share the<br />
highest rank and produce same output class, the<br />
image pixel is assigned to that class, that is:<br />
x Є class j if Rij = Rkl and j = l.<br />
2.When more than one classifier share the<br />
highest rank but produce different output classes,<br />
the accuracy of the classifiers are considered.<br />
The output class of the classifier with highest<br />
accuracy will be taken as the winner class to<br />
.<br />
.<br />
062
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
which the image pixel should be assigned, that<br />
is:<br />
if Rij = Rkl and j ≠ l. then<br />
x Є class j if Aij > Akl<br />
else if Aij < Akl<br />
x Є class l<br />
end if<br />
3.When the member classifiers produce different<br />
output classes but have same rank and same<br />
accuracy, the image pixel is assigned arbitrarily<br />
to one of the output classes, that is.<br />
if Rij = Rkl and Aij = Akl while j ≠ l. then<br />
066<br />
Fig. (3): The six original bands of Duhok City<br />
Seven classes were identified through the<br />
visual interpretation of two false color composite<br />
images (band4, band3, band2 as RGB) and<br />
Table (2): Class Identities in Duhok City<br />
Class No. Identity<br />
1 Residential area<br />
2 Duhok Dam<br />
3 Dense vegetation<br />
In order to achieve better classification<br />
confidence, two sets of training data representing<br />
these classes are selected interactively through<br />
two false color composite images. The first<br />
training data set is used for training two ART-II<br />
classifiers and calculating the statistical<br />
measurements for minimum distance and<br />
4 Less dense vegetation<br />
5 Sparse vegetation<br />
6 Wet soil<br />
7 Dry soil<br />
Classify x arbitrarily either to class j or class l.<br />
4. RESULTS WITH APPLICATION TO<br />
ETM+ IMAGES of DUHOK CITY<br />
The developed MCS is applied to 512 by 512<br />
ETM+ images of Duhok city in the Kurdistan<br />
Region of Iraq. These images were taken in June<br />
(the summer season) of 2001. Figure (3) shows<br />
the six bands used in this study (band1, band2,<br />
band3, band4, band5, band7).<br />
(band7, band5, band1 as RGB). These classes<br />
are shown in table (2).<br />
maximum likelihood classifiers. The second<br />
training data set is used to calculate the<br />
accuracy-ranking map. The size of the first<br />
training data set is (2400) samples with class<br />
samples ranging from 230 to 450. The size of<br />
the second training data set is (2423) samples<br />
with class samples ranging from 280 to 494.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
However, ART-II is trained twice, once using<br />
the control parameters (α=0.02, β=0.1 and<br />
ρ=0.96) and another using the control parameters<br />
(α=0.02, β=0.1 and ρ=0.96). Increasing the<br />
vigilance parameters (ρ) will change the<br />
Fig. (4): Classification results, A- Maximum Likelihood,<br />
B- Minimum Distance, C- ART-II ρ = 0.96, D- ART-II ρ = 0.92<br />
These results show that the majority of the<br />
differences between the four classification<br />
results are manifested in the classes of less dense<br />
vegetation, spars vegetation, wet soil and dry<br />
soil. This can be realized by comparing the four<br />
Table (3): Confusion matrices of the individual classifiers<br />
A: Maximum likelihood<br />
behaviors of ART-II and higher number of nodes<br />
in the stake will be generated.<br />
4.1 Results of the Four Individual Classifiers<br />
Figure (4) shows the results of the four<br />
classifiers when applied separately.<br />
images for the colors yellow, cyan, magenta and<br />
brown. The confusion matrices of the four<br />
classifiers using the second set of the training<br />
data are shown in table (3).<br />
Residential Water Dense V. L. dense V. Sparse V. Wet soil Dry soil<br />
Residential 429 0 0 0 7 1 2<br />
Water 0 280 0 0 0 0 0<br />
Dense V. 0 0 276 6 0 0 0<br />
L. dense V. 0 0 6 465 19 2 0<br />
Sparse V. 0 0 1 12 310 24 5<br />
Wet soil 2 0 0 0 3 261 18<br />
Dry soil 0 0 0 0 0 14 278<br />
062
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
062<br />
B: Minimum distance<br />
Residential Water Dense V. L. dense V. Sparse V. Wet soil Dry soil<br />
Residential 408 0 0 2 13 9 7<br />
Water 0 280 0 0 0 0 0<br />
Dense V. 0 0 256 16 10 0 0<br />
L. dense V. 0 0 2 461 28 2 1<br />
Sparse V. 8 0 0 8 296 40 0<br />
Wet soil 3 0 0 2 6 260 13<br />
Dry soil 0 0 0 0 1 28 263<br />
The diagonal elements represent the number<br />
of pixels that are correctly classified. The offdiagonal<br />
elements in the row of the class<br />
represent the number of pixels that are<br />
incorrectly classified to other classes, known as<br />
omission error. The off-diagonal elements in the<br />
column of the class represent pixels that are<br />
falsely classified to the current class, known as<br />
commission error.<br />
The accuracy ranking map is derived from<br />
the Mapping Accuracy (MA) of the classes. First<br />
the Mapping Accuracy of the class is calculated<br />
using equation (8). The derived accuracy ranking<br />
map is shown in table (4). For each class the<br />
highest accuracy provided by one of the four<br />
C: ART-II with ρ=0.96<br />
Residential Water Dense V. L. dense V. Sparse V. Wet soil Dry soil<br />
Residential 428 0 0 0 3 5 3<br />
Water 0 280 0 0 0 0 0<br />
Dense V. 0 0 279 3 0 0 0<br />
L. dense V. 0 0 3 428 63 0 0<br />
Sparse V. 1 0 0 59 275 16 1<br />
Wet soil 0 0 0 0 10 245 29<br />
Dry soil 0 0 0 0 0 8 284<br />
D: ART-II with ρ=0.92<br />
Residential Water Dense V. L. dense V. Sparse V. Wet soil Dry soil<br />
Residential 427 0 0 0 2 7 3<br />
Water 0 280 0 0 0 0 0<br />
Dense V. 0 0 272 8 2 0 0<br />
L. dense V. 1 0 1 419 73 0 0<br />
Sparse V. 0 0 0 90 231 28 3<br />
Wet soil 1 0 0 0 1 250 32<br />
Dry soil 0 0 0 0 0 20 272<br />
classifiers is shown in bolt font. According to<br />
this table, class 2 which represents the water<br />
surface of Duhok dam has a rank of (1) for all<br />
classifiers. This means that all classifiers have<br />
performed equally. This can be attributed to the<br />
homogeneity of water surface. A part from class<br />
2, maximum likelihood classifier shows the best<br />
performance, rank (1) for four classes and ART-<br />
II with (ρ = 0.96) shows the best performance<br />
rank (1) for two classes However, when talking<br />
on the pixel level, the performance of other<br />
classifiers (minimum distance and ART-II with<br />
ρ = 0.92) should not be underestimated during<br />
the integration operation.<br />
Table (4): The accuracy-ranking map of the four classifiers<br />
Class No./Color MLC MDC ART-II ρ = 0.96 ART-II ρ = 0.92<br />
1/Red 97.05% (2) 90.66% (4) 97.27% (1) 96.82% (3)<br />
2/Blue 100.0% (1) 100.0% (1) 100.0% (1) 100.0% (1)<br />
3/Green 95.50% (2) 90.14% (4) 97.90% (1) 96.11% (3)<br />
4/Yellow 90.82% (1) 88.13% (2) 76.97% (3) 70.77% (4)<br />
5/Cyan 81.36% (1) 72.19% (2) 63.80% (3) 53.72% (4)<br />
6/Magenta 80.30% (1) 71.62% (4) 78.27% (2) 73.74%0 (3)<br />
7/Brown 87.69% (1) 84.02% (4) 87.38% (2) 82.42% (3)<br />
Average 90.38% 85.25% 85.94% 81.94%
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
4.2 Results of Applying the Proposed MCS<br />
The proposed system of MCS is applied to<br />
the same multi-spectral image using three<br />
methods of integration, local Ranking (LR),<br />
method developed in this study, and two of<br />
previous methods, local accuracy (LA) and<br />
majority voting methods. For LA<br />
implementation, several values of K were tested<br />
and the value of (12) was found to provide the<br />
best results. For MV implementation, maximum<br />
voting of (2 out of 4) was taken for the decision<br />
making. However, for the cases when the four<br />
individual classifiers produce four different<br />
outputs, the decision is made arbitrarily. The<br />
classified images are shown in figure (5).<br />
Fig. (5): The results of the proposed MCS Using LR, LA and MV methods of integration<br />
The distribution of all classes in all three<br />
classified images show more homogeneity than<br />
in any of the individual classifiers which gives<br />
the sense of better performance of MCS with all<br />
three methods of integration. The increase in the<br />
performance of the developed MCS for the<br />
seven classes compared to the highest class<br />
accuracy provided by any of the individual<br />
classifiers was (1.59%, 0.0%, 0.7%, 5.14%,<br />
13.21%, 4.67%, 2.02%) respectively. While the<br />
increase in the average accuracy compared to the<br />
highest average accuracy provided by maximum<br />
likelihood classifier was 4.30%. This increase<br />
correspond to an area of (10.15) km 2 out of total<br />
area of (236 km 2 ), taking into account the image<br />
size (512 by 512) pixels and each pixel<br />
representing (900) m 2 . The execution time of the<br />
system for six multi-spectral bands of size 512<br />
by 512 , using P4 computer with 1.75 MHZ and<br />
Visual C++ programming language (version<br />
6.0), is shown in table (5). The total time is<br />
around 40 sec. The training time includes only<br />
the time required to train two (ART-II), which<br />
was around 2 minutes. Where as maximum<br />
likelihood and minimum distance classifiers do<br />
not need training.<br />
Table (5): The execution time of MCS<br />
classifiers<br />
Classifier Time (sec)<br />
Minimum distance 3<br />
Maximum likelihood 15<br />
ART-II (ρ = 0.96) 10<br />
ART-II (ρ = 0.92) 8<br />
Accuracy Map + LR method 4<br />
sum 40<br />
To compare the accuracy performance<br />
provided by the three methods of integration are<br />
shown in table (6).<br />
062
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
022<br />
Table (6): The class mapping accuracy of the proposed MCS<br />
Using LR, LA and MV methods of integration<br />
Class No. MCS by LR MCS by<br />
LA<br />
MCS by MV<br />
1 98.86% 96.68% 98.41%<br />
2 100% 100% 100%<br />
3 98.60% 99.29% 98.58%<br />
4 95.96% 90.11% 89.65%<br />
5 94.57% 77.18% 76.22%<br />
6 84.97% 87.29% 85.80%<br />
7 89.71% 90.23% 92.39%<br />
Average l 94.68% 91.54% 91.57%<br />
The average accuracy provided by the<br />
developed method (LR) is higher than that<br />
provided by (LA) and (MV). The improvement<br />
reached (3.14%) and (3.11%) over LA and MV<br />
respectively. These improvements correspond to<br />
areas of (7.4) km2 and (7.34) km2. In terms of<br />
class mapping accuracy, except class (2) for<br />
which all methods provided 100%, the<br />
performances of the three methods of integration<br />
are as follow: LR method provided highest<br />
accuracy for classes (1, 4 and 5). LA method<br />
provided highest accuracy for classes (3 and 6).<br />
MV method provided highest accuracy only for<br />
class (7). These results indicate superiority of<br />
LR method over LA and MV methods.<br />
5. CONCLUTIONS<br />
This study has shown that the combination of<br />
artificial neural network and statistical methods<br />
is an efficient method to improve the accuracy of<br />
the classification. Among the individual<br />
classifiers maximum likelihood produced<br />
highest average accuracy. However, in terms of<br />
class level, both maximum likelihood and ART-<br />
II with (ρ = 0.96) produced the best results. The<br />
proposed multiple classifier system with all three<br />
methods of integration performed better than the<br />
individual classifiers in terms of average and<br />
class mapping accuracy. In terms of average<br />
accuracy, the proposed system with the<br />
developed local ranking (LR) method of<br />
integration, performed better than the system<br />
with (LA) and (MV) methods. However, in<br />
terms of individual classes, the developed<br />
method (LR) showed highest mapping accuracy<br />
for three classes while (LA) showed highest<br />
mapping accuracy for two classes and (MV)<br />
showed highest mapping accuracy for only one<br />
class. This result urges the attention towards the<br />
development of new approach of multiple<br />
classifier systems that uses two levels of<br />
integrations, one for integrating the outputs of<br />
member classifiers and another for integrating<br />
the outputs of integration methods.<br />
ACKNOWLEDGEMENT<br />
This work was supported by the University of<br />
Duhok as a part of the scientific research plan of<br />
Physics Department for the year 2009/2010<br />
REFERENCES<br />
- Al-Rawi K. R., Gonzalo C. and Arquero A., 1999:<br />
Supervised ART-II; A new neural network<br />
architecture, with quicker learning algorithm, for<br />
learning and classifying multivalued input patterns,<br />
ESANN'1999 proceedings - European Symposium<br />
on Artificial Neural Networks, Bruges (Belgium),<br />
21-23 April 1999, D-Facto public., ISBN 2-600049-<br />
9-X, (pp. 289-294).<br />
- Ashish D., McClendon R.W. and Hoogenboom G., 2009:<br />
Land-use classification of multispectral aerial<br />
images using artificial neural networks, Int. Journal<br />
of Remote Sensing, Vol. 30, Issue 8, 1989-2004.<br />
- Benediktsson J. A. Swain P. H. and Erosy O.K., 1990:<br />
Neural network approaches versus statistical<br />
methods in classification of multisource remote<br />
sensing data, IEEE Transaction on Geoscience and<br />
Remote Sensing, Vol. 28, No. 4, 540-552.<br />
- Benediktsson J. A., Chanussot J. and Fauvel M., 2007:<br />
Multiple classifier systems in remote sensing: from<br />
basics to recent developments, Proceedings of the<br />
7th international conference on Multiple classifier<br />
systems, (pp. 501-512).<br />
- Chen C. H., and Ho P., 2008: Statistical pattern<br />
recognition in remote sensing, Pattern Recognition,<br />
Vol. 41, pp (2731 – 2741)<br />
- Chi M., Feng R. and Bruzzone L., 2008: Classification of<br />
hyperspectral remote-sensing data with primal<br />
SVM for small-sized training dataset problem,<br />
Advances in Space Research, Vol. 41, 1793-1799.<br />
- Dengsheng L., Paul M., Mateus B. and Emilio M., 2004:<br />
Comparison of land-cover classification methods in<br />
the Brazilian Amazon Basin, Photogrammetric
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
Engineering & Remote Sensing Vol. 70, No. 6, 723-<br />
731.<br />
- El-Melegy M. T. and Ahmed S. M., 2007: Neural<br />
networks in multiple classifier system for remote<br />
sensing image classification, Studies in Fuzziness<br />
and soft computing, Vol. 210, 65-94.<br />
- Ghosh A., Shankar B. U., Bruzzone L. and Meher S. K,<br />
2010: Neuro-fuzzy-combiner: an effective multiple<br />
classifier system, International Journal of<br />
Knowledge Engineering and Soft Data Paradigms,<br />
Vol. 2, No. 2, 107-129.<br />
- Giacinto G., Roli F. and Bruzzone L., 2000: Combination<br />
of neural and statistical algorithms for supervised<br />
classification of remote-sensing images, Pattern<br />
Recognition Letters, Vol. 21, 385-397.<br />
- Huang Y.S. and Suen C.Y., 1995: A method of combining<br />
multiple experts for the recognition of<br />
unconstrained handwritten Numerals, IEEE Trans.<br />
Pattern Analysis and Machine Intelligence, Vol. 17,<br />
No. 1, pp.(90-94).<br />
- Jain A. K., Duin R. P. W. and Mao J., 2000: Statistical<br />
pattern recognition: An overview, IEEE transaction<br />
on pattern analysis and machine intelligence, Vol.<br />
22, No. 1, 4-37.<br />
- Kahya O., Bayram B. and Reis S., 2010: Land cover<br />
classification with an expert system approach using<br />
Landsat ETM imagery: a case study of Trabzon,<br />
Environ Monit Assess, Vol. 160, No. 1-4, 431-438.<br />
- Liu Xue-Hua, Skidmore A. K. and H. Oosten H. Van,<br />
2002: Integrated artificial neural networks statistical<br />
methods of classification for remote sensing, ISPRS<br />
Journal of Photogrammetry and Remote Sensing,<br />
Vol. 56, Issue 4, 257-268.<br />
- Mather P. M., TSO B. and Koch M., 1998: An Evaluation<br />
of Landsat TM spectral data and SAR-Derived<br />
Textural information for lithological Discrimination<br />
in the Red Sea Hills, Sudan, Int. Journal of Remote<br />
Sensing, vol. 19, No. 4, 587-607.<br />
- Maulik U. and Chakraborty D., 2010: A Robust Multiple<br />
Classifier System for Pixel Classification of Remote<br />
Sensing Images, Journal of Fundamental<br />
Informatica, Vol. 101, Issue 4, 286-304.<br />
- Meher S. K., Ghosh A., Shankar B.U., Bruzzone, L. and<br />
MIU, K., 2006: Neuro-Fuzzy Fusion: A New<br />
Approach to Multiple Classifier System, , ICIT '06,<br />
9 th International Conference on Information<br />
Technology, (12-18 Dec, 2006), (pp. 209-212).<br />
- Pasquariello G., Ancona N., Blonda P., Tarantino C.,<br />
Satalino G. and D'Addabbo A., 2002: Neural<br />
Network Ensemble and Support Vector Machine<br />
Classifiers for the Analysis of Remotely Sensed<br />
Data: a Comparison, 0-7803-7536-X/$17.00 (C)<br />
2002 IEEE, (pp. 509-511).<br />
- Perumal K. and Bhaskaran R., 2010: Supervised<br />
classification performance of multispectral images,<br />
Journal of Computing, Vol. 2, Issue 2, 124-129.<br />
- Qiu F. and Jensen J.R., 2004: Opening the black box of<br />
neural networks for remote sensing image<br />
classification, Int. Journal of Remote Sensing, Vol.<br />
25, No. 9, 1749–1768.<br />
- Sabourin M., Mitiche A., Thomas D. and Nagy G., 1993:<br />
Classifier Combination of handprinted digit<br />
recognition, Proceeding of Second International<br />
Conference on Document Analysis and Recognition,<br />
Tsukuba Saenie City, Japan, 20-22-Oct-1993, (pp.<br />
163-166).<br />
- Serpico S.B, Bruzzone L. and Roli F., 1996: An<br />
experimental comparison of neural and statistical<br />
non-parametric algorithm for supervised<br />
classification of remote sensing images, Pattern<br />
Recognition Letters, 17, 1331-1341.<br />
- Shankar B.U., Meher S.K., Ghosh A, and Bruzzone L.,<br />
2006: Remote Sensing Image Classification: A<br />
Neuro-fuzzy MCS Approach, Computer Vision,<br />
Graphics and Image Processing: 5th Indian<br />
conference, pp (128-139).<br />
- Smits P. C., 2002: Multiple classifier systems for<br />
supervised remote sensing image classification<br />
based on dynamic classifier selection, IEEE<br />
Transactions on Geoscience and Remote Sensing,<br />
Vol. 40, Issue 4, 801-813.<br />
- Wilkinson G. G., Kanellopoulos I., 1995: Integration of<br />
neural and statistical approach in spatial data<br />
classification, Geographical Systems, Vol. 2, 1-20.<br />
- Woods K., Kegelmeyer Jr. and Bowyer K., 1997:<br />
Combination of Multiple classifiers using Local<br />
Accuracy Estimates, IEEE, Transaction on Pattern<br />
Recognition and Machine Intelligence, Vol. 19, No.<br />
4., 405-410.<br />
022
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
020<br />
ةتخوث<br />
ًيترىشةم ايتزاظاظ ؛ةىاكَيئ ًَييتزاظاظ زاوض ذ ةيتاَكَيب وك ٌسكَيض ةتاٍ ىوى َىي ىيةسف َىكةمةتطيض ادَيييلوكةظ َىظ د<br />
ب ) ART-II(<br />
ٌاضائ اييشزةل َىزوج ذ زايتضةٍ ًَيزوت ذ ىتاَكَيث ًَييتزاظاظ وود و ىتاسيود ًيترنيك ايتزاظاظ و ظىةض<br />
ةتاٍ و ىتفةكزةد ًَييتزاظاظ اىسكموك ؤب ٌاىاد ةتاٍ ىوى اكةكَيز . (�) َىيضستةم َىكلوكفةٍ<br />
ذ زوج و ةزوج ًَيياَب وود<br />
ل ٌاييئزاكب ةييتاٍ ًَييتزاظاظ ذ َىكةيتزاظاظ زةٍ ؤب ٌسكصَيز ةيتاٍ ًتزاظاظ َىكَيز َىظ ب<br />
. ىيوخفاى اىسكصَيز ب ٌسكظاى<br />
ًتزامذةٍ ةتيٍ َىد ًيترشاب ،ٌووب ظةٍ كةو ًتزاظاظ وود زةطةئ . ايتزاظاظ تَيي ىكَيجضةد ًَيىادَيث ذ وانجةئ ًيترشاب فيود<br />
تَيي ) LANDSAT 7(<br />
تسكضةد اظيةٍ ًَيطىةبةش ًَييَيو زةطل ٌاييئزاكب ةتاٍ ةمةتطيض ظةئ<br />
. اَب ًيترشاب فيود ل<br />
،ةىةظةئ ىذ وةئ وك ىدزةئ زةطل ًَيزوج تفةح ايتزاظاظ ؤب َىقايرع اىاتضدزوك انَيزةٍ ل َىكوٍد َىسَيذاب ؤبيتسط ةييتاٍ<br />
. كشٍ اخائ و زةت اخائ ،هَيك اىدىاض ًَيَج ،ىدىةظاى اىدىاض ينَج ،ىرت اىدىاض ينَج ،دزةئ زةض اظائ ،َىىدىاوةح ًَيَج<br />
ايشاب ذ امانجةئزةد اياسكَيت ايشاب و ايتزاظاظ ايشاب ذ َىكةيتزاظاظ زةٍ ؤب ٌاييئ ةظضةدب شاب ًَيمانجةئزةد ىوى َىمةتطيض ىظ<br />
ظيودل ايتزاظاظ تفةح زةٍ ؤب ) 3503%<br />
, 55.0%<br />
, 92539 % , .595%<br />
, 050%<br />
, 050%<br />
, 95.1%<br />
(<br />
َىيشاب ارَيز ايتزاظاظ<br />
ًَييتزاظاظ ًَيمانجةئزةد ذ . وانجةئ ًيترشاب ذ ) 4.30% ( َىيشاب ارَيز َىيشاب اياسكيت َىتضائ زةض ل اضةو زةٍ . ٌووب كَيئ<br />
2<br />
لةةطد ٌسكدزةوازةةب ةتاٍ ةكَيز ظةئ .) هك10.14(<br />
َىزةبَيز زةبمازةب ةتيظةكد ةيٍةدَيش ظةئ . تنفةكتضةد ةتاٍ ةىاكَيئ<br />
اةي َىيترةشاب اةياسكَيت ادةَييدزوازةب َىةظد . زايضاى تَيي ٌادطىةد ًيترشاب و وانجةئ ًيترشاب اىسكموك ًَيكَيز وودزةٍ<br />
) 91.54% (<br />
ىزةطل ىسكزايد ًَيوةئ ًظةك ًَيكَيز وودزةٍ َلىةب ،تفةكتضةد ىوى اكَيز ؤب<br />
) 94.68% (<br />
ىتفةكتضةد<br />
3 و ) هك7.4(<br />
اىووبةدَيش َىزةطةئ ةتيب وك ) 3.11% ( و ) 3.15% ( ارَيز اىووبةدَيش وكىائ ،اىووب تفةك تضةد ) 91.57% (<br />
ادةىةبصَيز اةكَيز ب اةيتزاظاظ َىض زةض ل تفةكزةض ىوى اكَيز ادوج ادوج ًَييتزاظاظ ايشاب ذ اضةو زةٍ<br />
3 .) هك7.34(<br />
ؤب ٌووبظةٍ كةو كَيز َىض زةٍ َلىةب . َىيتزاظاظ كَيئ ؤب َىىادطىةد<br />
اكَيز و ايتزاظاظ وود ؤب ىيوخفاى ايترشاب و ىيوخفاى<br />
.<br />
ىيام ايتزاظاظ
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 260-273, 2011<br />
,<br />
بذ ولا ةذعثكترا دتذ<br />
نعذذت تتخ نعذذتمعو<br />
:<br />
ART-II<br />
ةصلاخلا<br />
ذه ص تذ يذ تا نذ عبذأ ذي ك ذدت دعتذ ف نصذ م ظا ثتذحت إذثحلا ااذه نمضتي<br />
ذذ عأتلا<br />
نعم ذذلا بذذم يذذلكبملا ةعحذذ دلا صأحذذتلا نذذ نع تذذ و<br />
ذف . ةذعتثملا ذف لا ةوي ط تعمح ص ت ملا هاه صك خ ل صأتل ة ي ك ةوي ط ظا ثتحت مف ذت . (�)<br />
,<br />
ذذم را ةلأصذذحملا دتذذ<br />
ةتبطخلا ل صدمل<br />
ص تذ ملا هاذلل ةك ختحملا ةق لا قفو دعت تلا ف ةتخا لا فصتصرا ن دتص لأل ص ت ملا عف ف متي ةوي طلا هاه<br />
مذفو . ةذق لا معذق ذلت بك لصذ ل صدتلا<br />
ا ذدلا عصتذح تبك معذتقا ذف بذه ةتي مل 7-<br />
ةطذذحبت ةذذععاتا قطصذذت<br />
, ةذذ عثك ةذذععاتا قطصذذت<br />
حك متي دت ن ثكر ف لا يوصحف لصلأ فو . فصتصرا نع ةعلوا صعطد ن<br />
صح ملا عصتط لا مولص ةطوتت فصعطرا ة دت ةتبص تع نص تلا قعحطف<br />
, ةعثطذذح هصذذع<br />
, ةعتأذذح قطصذذت<br />
:<br />
ذذه ذذ لا صذذطضلا نذذ ابذذما يحذذح دعتذذ تل<br />
نصذذذ تتل دعتذذذ تلا ةذذذق نذذذحثف نذذذع نسصذذذتتلا ذذذلظاو . ةذذذح صي ةذذذ فو , ةذذذحطت ةذذذ ف , ةذذذفصثألا ةذذذتعتق ةذذذععاتا قطصذذذت<br />
, ةذذذفصثألا<br />
ذحم تذمصك فصتذصرا ةذق إعلأ نمف . ةق لا ل د و فصتصرا ةق إحلأ ن ة تملا ص ت ملا ن لك نع ظ ثتحملا<br />
ذذذتع صذذذ ا .<br />
لابذذذتلا ذذذتع ةدحذذذحلا<br />
فصتذذذصلأل ) 3.03%<br />
, 5..7%<br />
, 92.39 % , ..95%<br />
, 0.7%<br />
, 0.0%<br />
, 9..1%(<br />
ة صذييلا هاذهو . ة ذ تملا ص تذ ملا نسصذتم نعذ نذ ةذمعتم لذضفا نذع<br />
(4.30%)<br />
3<br />
نذ نعتتم ذ صذلتمتصو مذف لذ صأتتل ةم ثتذحملا ةذعتثملا ذف لا ةذوي ط ة صذ ك تصذحتخلإ . مذك ) 90.9. (<br />
ةذوي طلا بذ ف نذع ةمتصوملا لظاو . ةعحتغرا تيب ت ل صأتلا ةوي طو ةعتثملا ةق لص ل صأتلا ةوي ط<br />
ذتوي طل ةذق لا ل ذد عصذك صذمتع ةم ثتذحملا ةذوي طتل<br />
ذتلاو<br />
(3.11%)<br />
و<br />
(3.14%)<br />
صهتا ذو ة صيي يا .<br />
(94.68%)<br />
لابتلا<br />
تع<br />
نذذذحثتلا<br />
نذحثتلا ةحذحم تذمصك ةذق لا ل ذد بتذح<br />
صهتا ذو ةلأصذح ل صذدف<br />
هو ةو صحلا قسا طلا<br />
ةذق لا ل ذد عصذك ذت , ةذق لا ل ذد إذعلأ نذ ةم ثتذحملا<br />
(91.57%)<br />
3<br />
ةذوي طتل بذ تلا عصذأف ذ ت لأذت فصتذصرا ةذق إذعلأ نذ صذ ا . مذك<br />
صذمتع<br />
,<br />
و<br />
(91.54%)<br />
3<br />
(7.34) و مذك<br />
ذلأاو دتذ ةذعحتغرا تيبذ ف ةذوي طلو نع ت ةعتثملا ةق لا ةوي طل و فصتصا ةملاث<br />
ةعحتغرا تيب فو ةعتثملا ةف لا<br />
(7.4)<br />
صهتا ذو ةلأصذح ل صذدف<br />
) ةعتثملا ف لا(<br />
ةم ثتحملا<br />
.<br />
لأاو دت ل ةملاثلا قسا طلا ة ص ك وصحف<br />
022
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 274-280, 2011<br />
274<br />
EXPERIMENTAL DETERMINATION OF PASCHEN CURVE AND FIRST<br />
TOWNSEND COEFFICIENT OF NITROGEN PLASMA DISCHARGE<br />
SABAH IBRAHIM WAIS<br />
Dept. of Physics, Faculty of Science, University of Duhok, Kurdistan Region, Iraq<br />
(Received: February 27, 2011; Accepted for publication: August 10, 2011)<br />
ABSTRACT<br />
In the present work, an experimental study is performed to determine the first Townsend coefficient and Paschen<br />
curve for N2 gas using a parallel plate geometrical configuration. Paschen curve coefficients are derived by<br />
exponential fitting of first Townsend coefficients data of plasma discharge. The experimental data are acquired at<br />
different working pressure and various electrode gap separations. Furthermore, the amplification process of the gas<br />
gain in a uniform electric field is realized.<br />
KEYWORDS: Paschen Curve, Townsend Coefficients, Plasma discharge, Nitrogen gas<br />
T<br />
INTRODUCTION<br />
he average distance of an electron travels<br />
between ionizing collision is called the<br />
mean free path � for ionization, its inverse, the<br />
number of ionization collision per centimeter, is<br />
called the first Townsend coefficient α. This is a<br />
fundamental parameter, which determines the<br />
gas gain [Lieberman M. A., and Lichtenberg A.<br />
J. (2005)].<br />
If No is the number of primary electrons in a<br />
uniform electric field, the number of electrons<br />
after distance d, under avalanche conditions, is<br />
given by [Sharma A. and Sauli F. (1993)]:<br />
N � NO<br />
exp( �d)<br />
………………. (1)<br />
In presence of a continuous source of<br />
ionization, the current is given by:<br />
I � IO<br />
exp( �d)<br />
………………. (2)<br />
where Io is the current produced by No<br />
primary electrons produced per unit time. The<br />
multiplication factor or gas gain G is obtained<br />
over a distance d by:<br />
G �<br />
N<br />
N<br />
O<br />
�<br />
I<br />
I<br />
O<br />
� exp( �d)<br />
………………. (3)<br />
The first Townsend coefficient α depends<br />
upon many parameters, the main ones being<br />
nature of the gas, electric field and pressure<br />
[Sharma A. and Sauli F. (1993), Burm K. T.<br />
(2007)].<br />
The Townsend coefficient α is increased with<br />
electric field E. It depends on the pressure P. It<br />
can<br />
be demonstrated that in a wide range of E and P<br />
the ratio α/P is a unique function of E/P. The<br />
first Townsend coefficient describes the success<br />
rate for accelerated electrons to collide and<br />
ionize the background gas. The created positive<br />
ions may collide with the cathode creating new<br />
electrons, so-called secondary electrons, out of<br />
the electrode. The probability of a successful<br />
event is described with the second Townsend<br />
coefficient γ. As might be expected from the<br />
analogy of cross-sections, the first Townsend<br />
coefficient α is a function of pressure and<br />
accelerating field. The coefficient α is expected<br />
to behave conform [Burm K. T. (2007)]:<br />
const Eion<br />
� � exp( � )<br />
� E�<br />
e<br />
e<br />
………………. (4)<br />
where λe is the mean free path for electron<br />
scattering off neutrals, Eλe is the energy gain in<br />
the electric field, and Eion is the energy needed to<br />
ionize the atoms. Note that the mean free path<br />
for electron scattering is inversely related with<br />
pressure. Further, voltage V equals the electric<br />
field multiply by the gap distance d. This yield<br />
� �<br />
Bpd<br />
Ap exp( � )<br />
V<br />
………………. (5)<br />
where A and B are called Paschen coefficients<br />
and found to be roughly constant over a range of<br />
voltages and pressures for any given gas.<br />
Combining this result with the breakdown<br />
condition yields [Burm K. T. (2007)]:<br />
V breakdown<br />
Bpd<br />
�<br />
1<br />
ln( Apd ) � ln(ln( 1�<br />
))<br />
�<br />
………. (6)
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 274-280, 2011<br />
This useful relation suggests that for a given<br />
gas the voltage at which the breakdown occurs<br />
depends on the product of pressure and electrode<br />
separation (that is, Pd). It is generally known as<br />
Paschen’s law and a curve drawn from this<br />
equation between Pd and Vbreakdown is referred to<br />
as Paschen curve. The Paschen curve has a<br />
minimum below which breakdown cannot occur.<br />
The Paschen curve is a function of the gas and<br />
weakly of the electrode material [Shuping Z.,<br />
Bruyndonckx P., Goldberg M. and Tavernier S.<br />
(1994)].<br />
Many efforts have been done for the<br />
determination of α and a lot of current-voltage<br />
(I-V) characteristics data exist for a wide variety<br />
of gases and mixtures using different<br />
geometrical configuration of the electrodes. The<br />
data that exist for high field have been obtained<br />
with chambers having non-uniform electric field<br />
[Sharma A. and Sauli F. (1993), Burm K. T.<br />
(2007)].<br />
The present work is devoted to determine<br />
Paschen coefficients A and B and first<br />
Townsend α of a plasma discharge in pure<br />
nitrogen for different parallel plate gap<br />
separation d and small data spacing. In order to<br />
satisfy this requirement through a suitable<br />
design, fast automatic data acquisition system is<br />
built to acquire the experimental data with high<br />
current-voltage sampling density. To access the<br />
values of α/P experimentally, and avoid having<br />
excessively high working voltage, the data have<br />
been acquired at low electric field and high<br />
Fig. (1): Schematic diagram of the measurement system.<br />
working pressure. A Matlab program was<br />
performed for fitting the acquired data.<br />
EXPERIMENT SET-UP AND<br />
TECHNIQUE<br />
The experimental setup is shown in figure<br />
(1). It consists of 50 cm long, 4 cm diameter<br />
Pyrex glass tube fitted with a 3.2 cm fixed planer<br />
circular electrode on both sides (Parallel plate<br />
geometry). The electrode fittings are capable of<br />
withstanding up to three atmospheric pressures<br />
inside the tube. The tube has one gas in and one<br />
gas out ports. The high tension ac voltage supply<br />
consists of a 110/33000 volts transformer of the<br />
type used in mains grid utilities. This HT<br />
transformer is activated from the mains 220<br />
voltage line through a 220/110 transformer. This<br />
later transformer also serves as an isolation<br />
transformer which eliminates double earthing<br />
problems between the HT circuit and the<br />
computer. The discharge polarity can be<br />
switched by simply reversing the direction of the<br />
HT diode connected in series between the HT<br />
transformer output and the discharge tube. This<br />
setup allows the voltage to sweep between zero<br />
and the transformer peak output voltage during<br />
each cycle lasting 1/50 sec. Such relatively fast<br />
measurements result in less external and internal<br />
effects.<br />
275
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 274-280, 2011<br />
The voltage sampling is carried out through<br />
100:1 R1 and R2 resistors potential divider<br />
connected across the HT transformer primary.<br />
This divider ensures that the maximum value of<br />
the voltage sample used for data acquisition not<br />
to exceed one volt. Current sampling is made by<br />
a series resistor R connected to the fixed<br />
electrode. Here again, the value of the resistor is<br />
chosen such that the peak voltage across this<br />
resistor is always less than one volt. These one<br />
volt limits are dictated by the fact that computer<br />
sound card used as our data acquisition analog to<br />
digital converter device has a maximum input<br />
voltage rating of one volt. The voltage and<br />
current data acquired by the sound card through<br />
the use of Matlab data acquisition tool box are<br />
calibrated using ordinary digital voltmeter and<br />
ammeter readings prior to operation. Calibration<br />
parameters are invoked into the Matlab software<br />
written for the purposes of both data acquisition<br />
and data presentation. The data sampling rate<br />
used is 8000 Hz. This means that over the entire<br />
voltage sweep between 0 and 60 kV, at 50 Hz,<br />
160 data points are acquired. This gives an<br />
average voltage data point’s separation of about<br />
375 volts. Such relatively small data spacing<br />
enabled us to perform more reliable fits to the<br />
data. The tube is flushed with nitrogen gas<br />
99.9% purity for five minutes before each run.<br />
Acquired data for each run are directly saved by<br />
the program on hard disc for further analysis.<br />
All measurements are made at room<br />
temperature (T=24-27◦C) and humidity of about<br />
(50-55 %) with different nitrogen pressure<br />
276<br />
RESULTS AND DISCUSSION<br />
Many investigations have been published to<br />
report the influence of several parameters such<br />
as pressure, temperature, type of electrode and<br />
nature of gas on the behavior of discharge (I-V)<br />
characteristic and their shifting in determination<br />
the Paschen curve and the first Townsend<br />
coefficient [Sharma A. and Sauli F. (1993)].<br />
In present work, the experimental data of the<br />
first Townsend coefficient α is calculated using<br />
equation (2). The current of the discharge is<br />
measured with a meter having a sensitivity of the<br />
order 10 -12 A. One plate is kept at ground<br />
potential while the amplification field is<br />
provided by HV on another Plate. The drift field<br />
is kept constant during the measurements. The<br />
discharge current is measured and after<br />
subtraction of the leakage current (current before<br />
breakdown) the value of current at no gain Io is<br />
determined. As the applied voltage goes up, one<br />
gets into the multiplication region, the ratio of<br />
the two current is the absolute gain (equation 3).<br />
As well known breakdown appears at a certain<br />
amount of charge, the breakdown voltage is<br />
decreased, the current is measured again at the<br />
same field for normalization and the<br />
measurement is continued. With the geometry<br />
described above, the electric field intensity E<br />
was calculated as a function of the distance<br />
between the plate electrodes as E (d) =V/d<br />
[Raizer Y. P. (1991)].<br />
The electric field in the chamber is maximal<br />
on the surface of the cathode and decreases<br />
rapidly, as d-1 toward the anode. Due to the<br />
electric field between the electrodes, the charges<br />
quickly gain energy between collisions. If the<br />
total energy of an electron or an ion becomes<br />
higher than the ionization potential of the gas<br />
atoms, it can ionize an atom, thus creating<br />
another charge pair.<br />
The experimental data are exposed by means<br />
of the ionization coefficient per the working<br />
pressure P, (α/P), as a function of reduced<br />
electric field, (E/P), for a fixed value of applied<br />
voltage V between the electrodes. Accordingly,<br />
the influence of the working pressure expresses<br />
the effect of (α/P) versus (E/P) variation in<br />
different gap separation as shown in figure (2).<br />
The variation of the first Townsend coefficient α<br />
is attributed to the ion mean free path length λ in<br />
the ionization region and drift region which in<br />
turn have a significant consideration of the<br />
working pressure and electrode gap separation<br />
[Drakoulakos D. G. (1997)].
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 274-280, 2011<br />
/P (cm -1 Torr -1 )<br />
/P (cm -1 Torr -1 )<br />
0.0012<br />
0.001<br />
0.0008<br />
0.0006<br />
0.0004<br />
0.0002<br />
0<br />
0 2 4 6 8 10 12 14 16 18 20 22 24<br />
E/P (V cm -1 Torr -1 )<br />
P=760 Torr<br />
d= 5 cm<br />
d= 10 cm<br />
d= 15 cm<br />
d= 20 cm<br />
d= 25 cm<br />
d= 30 cm<br />
d= 35 cm<br />
d= 40 cm<br />
Fig. (2): Measured (α/P) versus (E/P) curves for various working pressure P and different<br />
electrode gap separation d.<br />
Paschen curve coefficients A and B are<br />
derived from the exponential fitting of equation<br />
(5) by means of the experimental data of α.<br />
Figure (3) shows the behavior of the Paschen<br />
coefficients with electrode gap separation at<br />
different gas pressures. As the pressure goes up,<br />
A and B increase, thus producing a lower<br />
ionization rate close the cathode. Consequently,<br />
the current generated by the discharge decreased<br />
[Shuping Z., Bruyndonckx P., Goldberg M. and<br />
Tavernier S. (1994),]. It is found that the<br />
calculated Paschen coefficients, A and B, are<br />
good first estimates for the experimentally<br />
A (cm -1 Torr -1 )<br />
0.0007<br />
0.0006<br />
0.0005<br />
0.0004<br />
0.0003<br />
0.0002<br />
0.0001<br />
0<br />
0 2 4 6 8 10 12 14 16 18<br />
0.0018<br />
0.0016<br />
0.0014<br />
0.0012<br />
0.001<br />
0.0008<br />
0.0006<br />
0.0004<br />
0.0002<br />
E/P (V cm -1 Torr -1 )<br />
P1=760 Torr<br />
P2=1140 Torr<br />
P3=1520 Torr<br />
P4=1900 Torr<br />
P=1520 Torr<br />
d= 5 cm<br />
d=10 cm<br />
d=15 cm<br />
d=20 cm<br />
d=25 cm<br />
d=30 cm<br />
d=35 cm<br />
d=40 cm<br />
0<br />
0 5 10 15 20 25 30 35 40 45<br />
Electrodes Seperation d (cm)<br />
0<br />
0 2 4 6 8 10 12 14 16 18<br />
obtained Paschen coefficients as found in<br />
literature.<br />
An important consideration while choosing<br />
filling gas for a proportional chamber is the<br />
maximum attainable gain or multiplication<br />
factor. In the uniform field, the Townsend<br />
coefficient becomes a function of electrode gap<br />
separation. In that case the multiplication factor<br />
for an electron that drifts from point d1 to d2 can<br />
be calculated from [Burm K. T. A. L. (2007)]:<br />
� �<br />
� ��<br />
�<br />
��<br />
��<br />
2 d<br />
G exp �(<br />
x)<br />
dx<br />
d1<br />
………………. (7)<br />
Fig. (3): Paschen curve coefficients A and B versus electrode gap separation d at various working pressure P.<br />
/P(V cm -1 Torr -1 )<br />
B (V cm -1 Torr -1 )<br />
/P (cm -1 Torr -1 )<br />
0.0009<br />
0.0008<br />
0.0007<br />
0.0006<br />
0.0005<br />
0.0004<br />
0.0003<br />
0.0002<br />
0.0001<br />
0.0006<br />
0.0005<br />
0.0004<br />
0.0003<br />
0.0002<br />
0.0001<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
E/P (V cm -1 Torr -1 )<br />
0<br />
0 2 4 6 8 10 12<br />
E/P (V cm -1 Torr -1 )<br />
P1=760 Torr<br />
P2=1140 Torr<br />
P3=1520 Torr<br />
P=1140 Torr<br />
d= 5 cm<br />
d= 10 cm<br />
d= 15 cm<br />
d= 20 cm<br />
d=25 cm<br />
d=30 cm<br />
d= 35 cm<br />
d=40 cm<br />
P=1900 Torr<br />
d=5 cm<br />
d=10 cm<br />
d=15 cm<br />
d=20 cm<br />
d=25 cm<br />
d=30 cm<br />
d=35 cm<br />
d=40 cm<br />
P4=1900 Torr<br />
0<br />
0 5 10 15 20 25 30 35 40 45<br />
Electrodes Seperation d (cm)<br />
277
Gain (%)<br />
Gain (%)<br />
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 274-280, 2011<br />
Hence if it desires to compute the<br />
multiplication factor, the spatial profile of the<br />
first Townsend coefficient should be known.<br />
Although it is quite challenging to determine this<br />
profile analytically, it has been shown that the<br />
reduced Townsend coefficient has a dependence<br />
on the reduced electric field intensity (equation<br />
5). The multiplication factor (gain) that achieved<br />
in the present work for the N2 chamber and<br />
parallel plate geometry is expressed in figure (4).<br />
The experimental results showed a maximum<br />
gain is achieved at the short electrode gap<br />
160<br />
120<br />
80<br />
40<br />
278<br />
P=760 Torr<br />
0<br />
0 100 200 300 400 500 600<br />
160<br />
120<br />
80<br />
40<br />
0<br />
d= 10 cm<br />
d= 20 cm<br />
d= 30 cm<br />
d= 40 cm<br />
P=1520 Torr<br />
Applied Voltage (V)<br />
d=10 cm<br />
d=20 cm<br />
d=30 cm<br />
d=40 cm<br />
0 100 200 300 400 500 600<br />
Applied Voltage (V)<br />
separation and high pressure. However it is<br />
desired to achieve higher gain before the<br />
breakdown that is before the onset of multiple<br />
avalanches caused by a single primary<br />
avalanche. When the voltage is raised to high<br />
values to increase the gain, the free electrons can<br />
get enough energy to cause multiple avalanches.<br />
Therefore one must ensure that the active<br />
volume gets continuously depleted of these low<br />
energy free electrons [Rossnagel S. M., Guomo J.<br />
J., Westwood W. D. (1990)].<br />
Fig. (4): Gain in N2 chamber operated at different working pressure and various electrodes gap separations.<br />
The large number of ions created during the<br />
avalanche drifts much slower than the electrons<br />
and therefore takes longer to reach the cathode.<br />
When these heavy positive charges strike the<br />
cathode wall, they can release more ions from<br />
the cathode material into the gas. The efficiency<br />
γ of this process is generally less than 10%. At<br />
moderate voltages, γ is not high enough to make<br />
significant increase in charge population<br />
[Drakoulakos D. G. (1997) and Ahmed S. N.<br />
(2007)]. A best fitting curve and high R2 value<br />
in this study is obtained at γ=0.025 which is<br />
chosen arbitrary. However at higher voltages the<br />
secondary ion emission probability increases,<br />
deteriorating the linearity of the output pulse<br />
with applied voltage. Further voltage increase<br />
Gain (%)<br />
Gain (%)<br />
160<br />
120<br />
80<br />
40<br />
P=1140 Torr<br />
d=10 cm<br />
d=20 cm<br />
d=30 cm<br />
d=40 cm<br />
0<br />
0 100 200 300 400 500 600<br />
160<br />
140<br />
120<br />
100<br />
80<br />
60<br />
40<br />
20<br />
P=1900 Torr<br />
d=10 cm<br />
d=20 cm<br />
d=30 cm<br />
d=40 cm<br />
Applied Voltage (V)<br />
0<br />
0 100 200 300 400 500 600<br />
Applied Voltage (V)<br />
may start discharge in the gas. At this point the<br />
current goes to very high values and is limited<br />
only by the external circuitry, that is, the height<br />
of the pulse becomes independent of the initial<br />
number of electron ion pairs. To understand the<br />
breakdown quantitatively, equation (6) is used<br />
with determined coefficients A, B and α to<br />
express the Paschen curve (Vbreakdown versus<br />
Pd) as shown in figure (5).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 274-280, 2011<br />
Fig. (5): Paschen curve for N2 gas enclosed between pin-to-plane electrodes separated by distance d. The gas<br />
pressure is P and the second Townsend coefficient has been arbitrarily chosen to be 0.025.<br />
CONCLUSION<br />
The present work reflects the well-known<br />
fact that the function α /P = f (E/P) is saturated at<br />
a high reduced electric field. At a high reduced<br />
electric field, where drifting electrons have large<br />
energy and scatter mostly in the forward<br />
direction, the first Townsend coefficient should<br />
almost entirely depend on the electron mean free<br />
path. It is experimentally demonstrated that gas<br />
gain in parallel plate chamber at different<br />
working pressure becomes higher at the short<br />
electrode gap separations of the same applied<br />
voltage. It is found that the calculated Paschen<br />
coefficients, A and B, are good first estimates<br />
for the experimentally obtained Paschen<br />
coefficients as found in literature. The<br />
parameters A and B are mainly determined by<br />
fitting the experimental data of the first<br />
Townsend coefficient.<br />
REFERENCES<br />
� Ahmed S. N. (2007). Physics and Engineering of<br />
Radiation Detection. (Elsevier: UK).<br />
� Burm K. T. A. L. (2007), Calculation of the Townsend<br />
Discharge Coefficients and the Paschen Curve<br />
Coefficients. Contrib, Plasma Phys, 47, 177–182.<br />
� Drakoulakos D. G. (1997), The Townsend Coefficient<br />
and Optimization of the Gas Gain in MDT-Muon<br />
Chambers, Atlas Internal Note, No-140. 1-21.<br />
� Lieberman M. A., and Lichtenberg A. J. (2005),<br />
Principles of Plasma Discharge and Material<br />
Processing, Second Edition, (New Jersey: Wiley).<br />
� Raizer Y. P. (1991), Gas Discharge Physics, (Springer-<br />
Verlag: Germany).<br />
� Rossnagel S. M., Guomo J. J., Westwood W. D. (1990),<br />
Handbook of Plasma Processing Technology, (New<br />
Jersey: Noyes).<br />
� Sharma A. and Sauli F. (1993), First Townsend<br />
Coefficient Measured in Argon based Mixture at<br />
High Field, Cern-PPE/93-50.<br />
� Shuping Z., Bruyndonckx P., Goldberg M. and Tavernier<br />
S. (1994), A measurement of the First Townsend<br />
Coefficient as a Function of the Electric Field for a<br />
TMAE-He Mixture, IEEE TRANSACTIONS ON<br />
NUCLEAR SCIENCE. 41, 2671.<br />
279
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 274-280, 2011<br />
280<br />
ازاط امزلاث انركلاتةب وب ىكَيئ َىي نوسنوات ىكلوكفةهو َىنشاث نَيفرَيك انانيهرةد وب ىكيتكارث اكةندناوخ<br />
ىنيجوترَين<br />
وب ىكَيئ َىي نوسنوات ىكلوكفةهو<br />
َىنشاث نَيفرَيك انانيهرةد وب نرك ةتاه ىكيتكارث اكةندناوخ َىنيلوكةظ َىظ ل<br />
نَيي ىكيتكارث نَيتاد ايناوتب تنيد ةنتاه َىنشاث نَيفرَيك<br />
ةتخوث<br />
. بيرةتفةه نَيرةسموج انانيئراكب ىنيجوترَين ازاط امزلاث<br />
اسيسورث َىدنه ىةرارةس . زاويج نَييتاريدو وتسيبةلاث نيدنةج وب نترطرةو ةنتاه اتاد . َىكَيئ نَيي ىنوسنوات َىكلوكفةه<br />
. ىتسخكَير ابةراك َىراوب انانيئراكب تنيد هنتاه ىانيئراكب ازاط نَيتفةكسةد<br />
نيجورتنلا زاغ امزلاب غيرفتل يلولاا نوسنوات لماعمو نشاب تاينحنم داجيلا ةيبيرجت ةسارد<br />
نيجورتينلا زاغ امزلاب غيرفتل<br />
نشاب تاينحنمو يلولاا نوسنوات لماعم داجيلا يبيرجت لمع زاجنا ةساردلا هذه يف مت<br />
ةيبيرجتلا تانايبلل ةيسوا ةمئلام للاخ نم نشاب تاينحنم داجيا مت<br />
طوغض دنع تبستكا لمعلا اذه يف ةيبيرجتلا تانايبلا<br />
انركنزةم<br />
ةصلاخلا<br />
. ةيزاوتم حاولا ةئيه ىلع باطقا مادختساب<br />
. يلولاا نوسنوات تلاماعمل يمزلابلا غيرفتلا نم ةصلختسملا<br />
مدختسملا زاغلا حبرل ميخضت ةيلمع نا , كلذ ىلا ةفاضلااب . ةيزاوتلا باطقلال ةفلتخم تافاسمو<br />
نيجورتنلا زاغل ةفلتخم<br />
.<br />
مظتنملا يئابرهكلا لاجملا يف دجوا دق
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
NUMERICAL SOLUTION OF GRAY-SCOTT<br />
MODEL BY A.D.M. AND F.D.M.<br />
SAAD A. MANAA and CHULLY M. R.<br />
Faculty of Science, University of Zakho, Kurdistan Region - Iraq<br />
(Received: March 7, 2011; Accepted for publication: September 20, 2011)<br />
ABSTRACT<br />
In this paper, Gray-Scott model has been solved numerically for finding an approximate solution by Adomain<br />
decomposition method and Finite difference method. Example showed that Adomain decomposition method is much<br />
faster and effective for this kind of problems than Finite difference method.<br />
M<br />
INTRODUCTION<br />
any physical, chemical and engineering<br />
problems mathematically can be<br />
modeled in the form of system of partial<br />
differential equations or system of ordinary<br />
differential equations. Finding the exact solution<br />
for the above problems which involve partial<br />
differential equations is difficult in some cases.<br />
Here we have to find the numerical solution of<br />
these problems using computers which came<br />
into existence. [8]<br />
In [7] a linear adaptive control strategy was<br />
applied to the Gray-Scott model in order to<br />
control the formation of patterns in a onedimensional<br />
domain, while an experimental<br />
application of linear modal feedback control for<br />
suppressing chaotic temporal fluctuation of<br />
spatiotemporal thermal pattern on a catalytic<br />
wafer was reported in [3].<br />
MATHEMATICAL MODEL:<br />
A general class of nonlinear-diffusion system<br />
is in the form<br />
�u<br />
� d1�u<br />
� a1u<br />
� b1v<br />
� f ( u,<br />
v)<br />
� g1(<br />
x)<br />
�t<br />
�v<br />
� d2�v<br />
� a2u<br />
� b2v<br />
� f ( u,<br />
v)<br />
� g2<br />
( x)<br />
�t<br />
with homogenous Dirchlet or Neumann<br />
boundary condition on a bounded domain Ω ,<br />
n≤3, with locally Lipschitz continuous boundary.<br />
It is well known that reaction and diffusion of<br />
chemical or biochemical species can produce a<br />
variety of spatial patterns. This class of reaction<br />
diffusion systems includes some significant<br />
pattern formation equations arising from the<br />
modeling of kinetics of chemical or biochemical<br />
reactions and from the biological pattern<br />
formation theory.<br />
In this group, the following four systems are<br />
typically important and serve as mathematical<br />
models in physical chemistry and in biology:<br />
a. Brusselator model:<br />
where a and b are positive constants.<br />
b. Gray-Scott model:<br />
where F and k are positive constants. [9]<br />
c. Glycolysis model:<br />
d. Schnackenberg model:<br />
[9]<br />
Then one obtains the following system of two<br />
nonlinearly coupled reaction-diffusion<br />
equations,<br />
�u<br />
2<br />
� d1<br />
�u<br />
� ( F � k)<br />
u � u v , t �0<br />
�t<br />
x ��<br />
�v<br />
2<br />
� d1<br />
�v<br />
� F(<br />
1�<br />
v)<br />
� u v , t �0<br />
�t<br />
x ��<br />
(1)<br />
Where the boundary condition<br />
And the initial condition<br />
�u<br />
�v<br />
� � 0<br />
�x<br />
�x<br />
.<br />
172
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
Where d 1 , d2,<br />
F and k<br />
constants [9].<br />
are positive<br />
Most chemical reactions can present rich<br />
phenomena in vessels, such as chemical<br />
oscillations, periodic doubling, chemical waves,<br />
and chaos. Analysis of forced nonlinear<br />
oscillations plays an important role in<br />
understanding their dynamical phenomena of<br />
electronic generators, mechanical, chemical and<br />
biological systems. Even small external<br />
disturbances are likely to change behaviors of<br />
dynamical systems [6].<br />
171<br />
Finite difference methods are found to be<br />
discrete technique, when in the domain of point<br />
interest is represented by a set of points or nodes<br />
and information between these points is<br />
commonly obtained using Taylor series<br />
expansions [4].<br />
The finite difference Scheme, generally<br />
reduces a linear, nonlinear partial differential<br />
equations into system of linear , nonlinear<br />
equations and various methods were developed<br />
to find the numerical solution and acceleration<br />
the convergence [5].<br />
FINITE DIFFERENCE APPROXIMATIONS [5]<br />
The grid spacing is uniform in every row: p�1� p � x � x �h<br />
), and it is uniform<br />
in every column: 1<br />
�u<br />
ui,<br />
j�1<br />
� ui,<br />
j<br />
�<br />
�t<br />
�t<br />
�v<br />
vi,<br />
j�1<br />
� vi,<br />
j<br />
�<br />
�t<br />
�t<br />
2<br />
� u ui�1,<br />
j � 2ui,<br />
j � u<br />
� 2<br />
2<br />
�x<br />
( �x)<br />
x x h and ( �1 tq��tq �k<br />
and ( tq�1�tq �k<br />
).<br />
i�1,<br />
j<br />
2<br />
� v vi�1,<br />
j � 2vi,<br />
j � vi�1,<br />
j<br />
� 2<br />
2<br />
�x<br />
( �x)<br />
Then the system ( 1 ) can be written as:<br />
ui,<br />
j�1<br />
� ui,<br />
j ui�1,<br />
j � 2ui,<br />
j � ui�1,<br />
j<br />
� d1<br />
� ( F � k)<br />
u<br />
2<br />
�t<br />
( �x)<br />
v<br />
u<br />
v<br />
i,<br />
j�1<br />
i,<br />
j�1<br />
i,<br />
j�1<br />
� v<br />
�t<br />
� u<br />
i,<br />
j<br />
i,<br />
j<br />
i,<br />
j<br />
� ( u<br />
d2�t<br />
� vi,<br />
j � [ v 2 i�1,<br />
j<br />
( �x)<br />
� 2vi,<br />
j � vi�1,<br />
j ] � �tF<br />
( 1�<br />
v<br />
d1�t<br />
r1<br />
�<br />
( �x)<br />
d2�t<br />
and r2<br />
� then 2<br />
( �x)<br />
Let 2<br />
u<br />
v<br />
u<br />
v<br />
u<br />
v<br />
i,<br />
j�1<br />
i,<br />
j�1<br />
i,<br />
j�1<br />
i,<br />
j�1<br />
i,<br />
j�1<br />
i,<br />
j�1<br />
� u<br />
� v<br />
� v<br />
i,<br />
j<br />
i,<br />
j<br />
� u<br />
i,<br />
j<br />
i,<br />
j<br />
)<br />
2<br />
i,<br />
j<br />
vi�1,<br />
j � 2vi,<br />
j � vi�1,<br />
j<br />
� d2<br />
� F(<br />
1�<br />
vi,<br />
j ) � ( u )<br />
2<br />
( �x)<br />
d1�t<br />
� [ ui<br />
1,<br />
j 2ui,<br />
j ui<br />
1,<br />
j ] t(<br />
F k)<br />
u<br />
2 � � � � � � �<br />
( �x)<br />
� r [ u<br />
1<br />
� r [ v<br />
2<br />
� ru<br />
� r v<br />
i�1,<br />
j<br />
i�1,<br />
j<br />
1 i�1,<br />
j<br />
2 i�1,<br />
j<br />
� 2u<br />
� 2v<br />
i,<br />
j<br />
i,<br />
j<br />
� 2ru<br />
1 i,<br />
j<br />
� 2r<br />
v<br />
2 i,<br />
j<br />
� u<br />
� v<br />
� [ 1�<br />
2r<br />
� �t(<br />
F � k)]<br />
u<br />
1<br />
i�1,<br />
j<br />
i�1,<br />
j<br />
� ru<br />
� r v<br />
i,<br />
j<br />
� �tF<br />
�[<br />
1�<br />
2r<br />
� �tF<br />
] v<br />
For j=1, 2, 3… and i=2, 3, 4,….<br />
And by boundary conditions<br />
2<br />
i,<br />
j<br />
] � �t(<br />
F � k)<br />
u<br />
] � �tF<br />
( 1�<br />
v<br />
1 i�1,<br />
j<br />
2 i�1,<br />
j<br />
� r [ u<br />
1<br />
� r [ v<br />
2<br />
i,<br />
j<br />
i,<br />
j<br />
� �t(<br />
F � k)<br />
u<br />
� �tF<br />
� �tFv<br />
i�1,<br />
j<br />
i�1,<br />
j<br />
� u<br />
� v<br />
i�1,<br />
j<br />
i�1,<br />
j<br />
2<br />
i,<br />
j<br />
i,<br />
j<br />
i,<br />
j<br />
v<br />
) � �t(<br />
u<br />
v<br />
i,<br />
j<br />
i,<br />
j<br />
� �t(<br />
u<br />
) � �t(<br />
u<br />
� �t(<br />
u<br />
i,<br />
j<br />
i,<br />
j<br />
] � �t(<br />
u<br />
2<br />
i,<br />
j<br />
)<br />
2<br />
i,<br />
j<br />
� �t(<br />
u<br />
� �t(<br />
u<br />
] � �t(<br />
u<br />
)<br />
2<br />
i,<br />
j<br />
2<br />
i,<br />
j<br />
)<br />
2<br />
i,<br />
j<br />
)<br />
v<br />
v<br />
i,<br />
j<br />
)<br />
2<br />
i,<br />
j<br />
)<br />
)<br />
2<br />
i,<br />
j<br />
v<br />
2<br />
i,<br />
j<br />
i,<br />
j<br />
v<br />
i,<br />
j<br />
i,<br />
j<br />
v<br />
)<br />
v<br />
i,<br />
j<br />
v<br />
i,<br />
j<br />
p p<br />
v<br />
i,<br />
j<br />
i,<br />
j
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
�u<br />
ui,<br />
j � u<br />
�<br />
�x<br />
�x<br />
u � u<br />
i�1,<br />
j<br />
�u<br />
1,<br />
j<br />
i�1,<br />
j<br />
�u<br />
11,<br />
j<br />
i,<br />
j<br />
� u<br />
2,<br />
j<br />
i,<br />
j<br />
� u<br />
10,<br />
j<br />
i�1,<br />
j<br />
And<br />
�u<br />
ui�1,<br />
j � u<br />
�<br />
�x<br />
�x<br />
u � u<br />
And also for v<br />
�v<br />
vi,<br />
j � vi�<br />
�<br />
�x<br />
�x<br />
v � v<br />
i�1,<br />
j<br />
�v<br />
1,<br />
j<br />
i�1,<br />
j<br />
�v<br />
11,<br />
j<br />
i,<br />
j<br />
� v<br />
2,<br />
j<br />
And<br />
�v<br />
vi�1,<br />
j � v<br />
�<br />
�x<br />
�x<br />
v � v<br />
u<br />
v<br />
1,<br />
1<br />
1,<br />
1<br />
i,<br />
j<br />
� v<br />
10,<br />
j<br />
i,<br />
j<br />
1,<br />
j<br />
i,<br />
j<br />
� 0<br />
� 0<br />
� 0<br />
� 0<br />
By initial condition:<br />
� u � u � u � u<br />
� v<br />
2,<br />
1<br />
2,<br />
1<br />
� v<br />
3,<br />
1<br />
3,<br />
1<br />
� v<br />
4,<br />
1<br />
4,<br />
1<br />
� v<br />
5,<br />
1<br />
5,<br />
1<br />
We define the operator [1]<br />
� u<br />
� v<br />
6,<br />
1<br />
6,<br />
1<br />
� u<br />
� v<br />
7,<br />
1<br />
7,<br />
1<br />
� u<br />
� v<br />
8,<br />
1<br />
8,<br />
1<br />
� u<br />
� v<br />
9,<br />
1<br />
9,<br />
1<br />
� u<br />
� v<br />
10,<br />
1<br />
10,<br />
1<br />
� u<br />
� v<br />
11,<br />
1<br />
11,<br />
1<br />
� u ( x)<br />
0<br />
0<br />
� v ( x)<br />
ADOMAIN DECOMPOSITION METHOD<br />
L t<br />
�<br />
�1<br />
� � Lt<br />
�<br />
�t<br />
�<br />
system (1) can be written as:<br />
2<br />
a) Ltu � d1<br />
Lxxu<br />
� ( F � k)<br />
u � u v}….<br />
(2)<br />
2<br />
b) v � d L v � F(<br />
1�<br />
v)<br />
� u v<br />
Lt 2 xx<br />
t<br />
2<br />
(.) dt and Lxx 2<br />
0<br />
�<br />
� then<br />
�x<br />
By applying the inverse of operator L t on a system (2) we get:<br />
�1<br />
�1<br />
�1<br />
2<br />
a) u( t,<br />
x)<br />
� u(<br />
0,<br />
x)<br />
� d1Lt<br />
( Lxxu)<br />
� ( F � k)<br />
Lt<br />
u � Lt<br />
( u v)<br />
�1<br />
�1<br />
�1<br />
2<br />
b) v( t,<br />
x)<br />
� v(<br />
0,<br />
x)<br />
� d2Lt<br />
( Lxxv)<br />
� FLt<br />
( 1�<br />
v)<br />
� Lt<br />
( u v)<br />
By initial conditions in system (1) then system (3) can be written as:<br />
�1<br />
�1<br />
�1<br />
2<br />
a) u( t,<br />
x)<br />
� u0(<br />
x)<br />
� d1Lt<br />
( Lxxu)<br />
� ( F � k)<br />
Lt<br />
u � Lt<br />
( u v)<br />
�1<br />
�1<br />
�1<br />
2<br />
b) v( t,<br />
x)<br />
� v0(<br />
x)<br />
� d2Lt<br />
( Lxxv)<br />
� FLt<br />
( 1�<br />
v)<br />
� Lt<br />
( u v)<br />
By using Adomian decomposition method:<br />
u ( t,<br />
x)<br />
u ( t,<br />
x)<br />
and � �<br />
}…. (3)<br />
}…. (4)<br />
v ( t,<br />
x)<br />
v ( t,<br />
x)<br />
�<br />
� �<br />
�<br />
n�0<br />
n<br />
�<br />
n�0<br />
�<br />
n<br />
�1<br />
�1<br />
�1<br />
a) �u<br />
n ( t,<br />
x)<br />
� u0<br />
( x)<br />
� d1Lt<br />
( Lxx�<br />
un<br />
) � ( F � k)<br />
Lt<br />
�un<br />
� Lt<br />
� An<br />
n�0<br />
n�0<br />
n�0<br />
n�0<br />
}…. (5)<br />
�<br />
�<br />
172
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
�1<br />
�1<br />
�1<br />
b) �v<br />
n(<br />
t,<br />
x)<br />
� v0(<br />
x)<br />
� d2Lt<br />
( Lxx�<br />
vn)<br />
� FLt<br />
( 1�<br />
�vn<br />
) � Lt<br />
� B<br />
173<br />
�<br />
n�0<br />
�<br />
n�0<br />
Where n A and B n are Adomian polynomials.<br />
But n A = 2<br />
B n because both non-linear terms are u v<br />
Where<br />
A<br />
n<br />
n n 1 d � i �<br />
� ( )<br />
!<br />
�F<br />
��<br />
u<br />
n<br />
i<br />
n d�<br />
�<br />
� i�0<br />
�<br />
��0<br />
[2]<br />
n n n<br />
1 d � i i �<br />
But here An � ( , )<br />
!<br />
�F<br />
�� ui<br />
��<br />
vi<br />
�<br />
� because non-linear term have two functions u ( t,<br />
x)<br />
n<br />
n d � i�0<br />
i�0<br />
� ��0<br />
and v ( t,<br />
x)<br />
then by equation (5 a):<br />
u0<br />
� u0(<br />
x)<br />
… (6a)<br />
�1<br />
�1<br />
�1<br />
uk<br />
�1<br />
� d1Lt<br />
( Lxxuk<br />
) � ( F � k)<br />
Lt<br />
uk<br />
� Lt<br />
Ak<br />
where k � 0<br />
And by equation (5 b):<br />
v0<br />
� v0(<br />
x)<br />
…(6b)<br />
�1<br />
�1<br />
�1<br />
vk�1<br />
� d2Lt<br />
( Lxxvk<br />
) � FLt<br />
( 1�<br />
vk<br />
) � Lt<br />
Bk<br />
where k � 0<br />
0 0 0<br />
1 d � i<br />
i �<br />
A0<br />
� F(<br />
u , v )<br />
0<br />
i i<br />
0!<br />
d<br />
� �� ��<br />
�<br />
�<br />
� i�0 i�0<br />
�<br />
� F(<br />
u , v ) � u v<br />
0<br />
0<br />
0<br />
0<br />
2<br />
0<br />
0<br />
0<br />
2<br />
0<br />
2<br />
� ( u ( x))<br />
v ( x)<br />
� A<br />
� u<br />
k � 0<br />
u � d L<br />
1<br />
� d L<br />
�1<br />
1 t<br />
1<br />
�u<br />
1<br />
( L<br />
0<br />
v<br />
�1<br />
1 t<br />
( L<br />
by equation<br />
� [ d L<br />
1<br />
� B<br />
6<br />
Let : U1<br />
� d L<br />
1<br />
0<br />
u<br />
0<br />
0<br />
0<br />
0<br />
u ) � ( F � k)<br />
L u<br />
u ) � ( F � k)<br />
L u<br />
� ( F � k)<br />
u<br />
u<br />
0<br />
0<br />
�1<br />
t<br />
2<br />
0<br />
0<br />
�1<br />
t<br />
� d L u t � ( F � k)<br />
u t � u v t<br />
xx<br />
xx<br />
xx<br />
xx<br />
xx<br />
0<br />
0<br />
� ( F � k)<br />
u<br />
0<br />
0<br />
2<br />
0<br />
��0<br />
�1<br />
t<br />
� u v ] t<br />
0<br />
� u<br />
� L<br />
2<br />
0<br />
v<br />
... (7)<br />
�1<br />
t<br />
0<br />
2<br />
0<br />
A<br />
0<br />
� L ( u v )<br />
�u1<br />
� U1t<br />
By equation (6a , 6b) and An � B n<br />
v<br />
�1<br />
� d L ( L<br />
�1<br />
�1<br />
v ) � FL ( 1�<br />
v ) � L B<br />
1<br />
� d<br />
� d<br />
�v<br />
1<br />
Let : V1<br />
� d<br />
�v<br />
1<br />
2<br />
2<br />
L<br />
L<br />
2<br />
�1<br />
t<br />
xx<br />
t<br />
( L<br />
� [ d<br />
2<br />
v t � Ft � Fv t � u v t<br />
0<br />
2<br />
� V1t<br />
xx<br />
L<br />
�1<br />
�1<br />
2<br />
v ) � FL ( 1�<br />
v ) � L ( u v )<br />
xx<br />
2<br />
xx<br />
0<br />
v<br />
L<br />
0<br />
0<br />
xx<br />
� F � Fv<br />
v<br />
0<br />
t<br />
0<br />
t<br />
0<br />
0<br />
0<br />
� F � Fv<br />
2<br />
� u v ] t<br />
0<br />
0<br />
0<br />
0<br />
0<br />
� u<br />
t<br />
2<br />
0<br />
v<br />
0<br />
t<br />
0<br />
0<br />
0<br />
0<br />
... ( 8)<br />
… (9)<br />
�<br />
n�0<br />
�<br />
n�0<br />
n
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
174<br />
)<br />
10<br />
(<br />
...<br />
]<br />
1<br />
1<br />
2<br />
[<br />
1<br />
)<br />
1<br />
(<br />
2<br />
2<br />
9<br />
8<br />
,<br />
6<br />
]<br />
2<br />
2<br />
[<br />
)]<br />
)(<br />
2<br />
[(<br />
)]<br />
(<br />
)<br />
[(<br />
)]<br />
,<br />
(<br />
[<br />
)<br />
,<br />
(<br />
!<br />
1<br />
1<br />
1<br />
2<br />
0<br />
0<br />
0<br />
1<br />
2<br />
0<br />
0<br />
0<br />
1<br />
2<br />
0<br />
0<br />
1<br />
0<br />
0<br />
1<br />
2<br />
1<br />
3<br />
1<br />
1<br />
0<br />
2<br />
1<br />
2<br />
0<br />
0<br />
2<br />
1<br />
2<br />
0<br />
1<br />
0<br />
0<br />
2<br />
0<br />
0<br />
1<br />
0<br />
2<br />
1<br />
2<br />
1<br />
0<br />
2<br />
0<br />
0<br />
1<br />
0<br />
2<br />
1<br />
0<br />
0<br />
1<br />
0<br />
1<br />
0<br />
0<br />
1<br />
0<br />
1<br />
0<br />
1<br />
1<br />
1<br />
B<br />
t<br />
V<br />
u<br />
U<br />
v<br />
u<br />
A<br />
t<br />
V<br />
u<br />
v<br />
t<br />
U<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
and<br />
equation<br />
By<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
d<br />
d<br />
v<br />
v<br />
u<br />
u<br />
u<br />
u<br />
d<br />
d<br />
v<br />
v<br />
u<br />
u<br />
d<br />
d<br />
v<br />
v<br />
u<br />
u<br />
F<br />
d<br />
d<br />
v<br />
u<br />
F<br />
d<br />
d<br />
A<br />
i i<br />
i<br />
i<br />
i<br />
i<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
� �<br />
� �<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
For 1<br />
�<br />
k and by using equations 8, 9 and 10 we get:<br />
4<br />
3<br />
]<br />
)<br />
(<br />
)<br />
(<br />
2<br />
1<br />
)<br />
(<br />
2<br />
1<br />
3<br />
)<br />
(<br />
2<br />
3<br />
[<br />
2<br />
]<br />
2<br />
)<br />
2<br />
3<br />
(<br />
2<br />
)<br />
(<br />
)<br />
(<br />
)<br />
(<br />
)<br />
(<br />
)<br />
(<br />
[<br />
4<br />
3<br />
)]<br />
(<br />
2<br />
1<br />
3<br />
)<br />
(<br />
2<br />
2<br />
[<br />
2<br />
]<br />
2<br />
)<br />
2<br />
3<br />
(<br />
2<br />
[<br />
!<br />
3<br />
)<br />
(<br />
2<br />
]<br />
)<br />
(<br />
)<br />
(<br />
)<br />
(<br />
[<br />
3<br />
]<br />
)<br />
(<br />
[<br />
2<br />
)]<br />
(<br />
)<br />
(<br />
[<br />
)<br />
11<br />
...(<br />
]<br />
)]<br />
(<br />
2<br />
1<br />
3<br />
)<br />
(<br />
2<br />
2<br />
[<br />
]<br />
2<br />
)<br />
2<br />
3<br />
(<br />
2<br />
[[<br />
)<br />
2<br />
]<br />
)<br />
(<br />
([<br />
)<br />
(<br />
)]<br />
2<br />
]<br />
)<br />
(<br />
([<br />
[<br />
)<br />
(<br />
)<br />
(<br />
4<br />
3<br />
0<br />
2<br />
3<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
2<br />
2<br />
0<br />
0<br />
3<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
2<br />
0<br />
4<br />
0<br />
2<br />
0<br />
3<br />
0<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
1<br />
0<br />
2<br />
0<br />
1<br />
0<br />
1<br />
0<br />
2<br />
1<br />
4<br />
3<br />
0<br />
2<br />
3<br />
2<br />
0<br />
2<br />
2<br />
0<br />
0<br />
3<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
2<br />
0<br />
4<br />
0<br />
2<br />
0<br />
3<br />
0<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
3<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
1<br />
3<br />
2<br />
0<br />
0<br />
0<br />
1<br />
2<br />
0<br />
2<br />
0<br />
1<br />
0<br />
1<br />
0<br />
2<br />
1<br />
3<br />
3<br />
0<br />
2<br />
2<br />
2<br />
0<br />
2<br />
2<br />
0<br />
0<br />
3<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
0<br />
4<br />
0<br />
2<br />
0<br />
3<br />
0<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
1<br />
2<br />
2<br />
0<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
1<br />
2<br />
2<br />
0<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
1<br />
1<br />
1<br />
1<br />
1<br />
1<br />
1<br />
1<br />
1<br />
2<br />
t<br />
u<br />
F<br />
t<br />
u<br />
L<br />
u<br />
k<br />
F<br />
F<br />
Fu<br />
F<br />
u<br />
v<br />
Fu<br />
u<br />
k<br />
F<br />
F<br />
u<br />
FL<br />
u<br />
d<br />
t<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
k<br />
F<br />
v<br />
L<br />
u<br />
d<br />
u<br />
L<br />
v<br />
u<br />
d<br />
v<br />
u<br />
k<br />
F<br />
u<br />
k<br />
F<br />
u<br />
L<br />
k<br />
F<br />
d<br />
v<br />
u<br />
L<br />
d<br />
u<br />
L<br />
k<br />
F<br />
d<br />
u<br />
L<br />
d<br />
t<br />
u<br />
F<br />
t<br />
Fu<br />
F<br />
u<br />
v<br />
Fu<br />
u<br />
k<br />
F<br />
F<br />
u<br />
FL<br />
u<br />
d<br />
t<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
k<br />
F<br />
v<br />
L<br />
u<br />
d<br />
u<br />
L<br />
v<br />
u<br />
d<br />
t<br />
u<br />
k<br />
F<br />
F<br />
t<br />
v<br />
u<br />
k<br />
F<br />
u<br />
k<br />
F<br />
u<br />
L<br />
k<br />
F<br />
d<br />
t<br />
u<br />
L<br />
u<br />
L<br />
u<br />
F<br />
d<br />
t<br />
v<br />
u<br />
L<br />
d<br />
u<br />
L<br />
k<br />
F<br />
d<br />
u<br />
L<br />
d<br />
t<br />
u<br />
F<br />
t<br />
Fu<br />
F<br />
u<br />
v<br />
Fu<br />
u<br />
k<br />
F<br />
F<br />
u<br />
FL<br />
u<br />
d<br />
t<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
k<br />
F<br />
v<br />
L<br />
u<br />
d<br />
u<br />
L<br />
v<br />
u<br />
d<br />
L<br />
t<br />
Fu<br />
t<br />
v<br />
u<br />
u<br />
k<br />
F<br />
u<br />
L<br />
d<br />
L<br />
k<br />
F<br />
t<br />
Fu<br />
t<br />
v<br />
u<br />
u<br />
k<br />
F<br />
u<br />
L<br />
d<br />
L<br />
L<br />
d<br />
A<br />
L<br />
u<br />
L<br />
k<br />
F<br />
u<br />
L<br />
L<br />
d<br />
u<br />
x<br />
xx<br />
xx<br />
xx<br />
xx<br />
xx<br />
xx<br />
xxxx<br />
xx<br />
xx<br />
xx<br />
xx<br />
x<br />
xx<br />
xx<br />
xx<br />
xxxx<br />
xx<br />
xx<br />
xx<br />
t<br />
xx<br />
t<br />
xx<br />
xx<br />
t<br />
t<br />
t<br />
xx<br />
t<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
)<br />
12<br />
...(<br />
4<br />
3<br />
]<br />
)<br />
(<br />
)<br />
(<br />
2<br />
1<br />
3<br />
)<br />
(<br />
2<br />
5<br />
3<br />
[<br />
2<br />
]<br />
2<br />
)<br />
3<br />
4<br />
(<br />
)<br />
(<br />
)<br />
(<br />
)<br />
(<br />
2<br />
[<br />
4<br />
3<br />
0<br />
2<br />
2<br />
2<br />
0<br />
2<br />
0<br />
2<br />
2<br />
0<br />
0<br />
3<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
2<br />
0<br />
4<br />
0<br />
0<br />
3<br />
0<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
2<br />
0<br />
1<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
0<br />
2<br />
1<br />
2<br />
t<br />
u<br />
F<br />
t<br />
u<br />
L<br />
Fu<br />
F<br />
u<br />
v<br />
Fu<br />
u<br />
k<br />
F<br />
F<br />
u<br />
FL<br />
u<br />
d<br />
t<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
k<br />
F<br />
u<br />
k<br />
F<br />
v<br />
u<br />
L<br />
d<br />
v<br />
L<br />
u<br />
d<br />
u<br />
L<br />
v<br />
u<br />
k<br />
F<br />
d<br />
u<br />
L<br />
d<br />
u<br />
x<br />
xx<br />
xx<br />
xx<br />
xx<br />
xxxx<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
By the same way
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
175<br />
4<br />
6<br />
)]<br />
(<br />
6<br />
)<br />
(<br />
4<br />
4<br />
[<br />
2<br />
]<br />
2<br />
)<br />
2<br />
4<br />
(<br />
)<br />
(<br />
)<br />
2<br />
(<br />
2<br />
[<br />
4<br />
3<br />
)]<br />
(<br />
2<br />
1<br />
3<br />
)<br />
(<br />
2<br />
2<br />
[<br />
2<br />
]<br />
2<br />
)<br />
2<br />
3<br />
(<br />
2<br />
[<br />
6<br />
)<br />
(<br />
2<br />
]<br />
[<br />
3<br />
)<br />
)<br />
(<br />
(<br />
2<br />
)]<br />
(<br />
[<br />
]<br />
)]<br />
(<br />
2<br />
1<br />
3<br />
)<br />
(<br />
2<br />
2<br />
[<br />
]<br />
2<br />
)<br />
2<br />
3<br />
(<br />
2<br />
[[<br />
)<br />
2<br />
)<br />
(<br />
]<br />
([<br />
)]<br />
2<br />
)<br />
(<br />
]<br />
([<br />
[<br />
)<br />
(<br />
4<br />
3<br />
0<br />
2<br />
3<br />
2<br />
0<br />
2<br />
2<br />
0<br />
0<br />
3<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
2<br />
0<br />
2<br />
3<br />
2<br />
0<br />
4<br />
0<br />
2<br />
0<br />
3<br />
0<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
0<br />
2<br />
2<br />
2<br />
4<br />
3<br />
0<br />
2<br />
3<br />
2<br />
0<br />
2<br />
2<br />
0<br />
0<br />
3<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
2<br />
0<br />
4<br />
0<br />
2<br />
0<br />
3<br />
0<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
3<br />
2<br />
0<br />
2<br />
3<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
2<br />
3<br />
2<br />
0<br />
0<br />
0<br />
2<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
2<br />
2<br />
3<br />
3<br />
0<br />
2<br />
2<br />
2<br />
0<br />
2<br />
2<br />
0<br />
0<br />
3<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
0<br />
4<br />
0<br />
2<br />
0<br />
3<br />
0<br />
0<br />
2<br />
0<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
1<br />
1<br />
2<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
2<br />
1<br />
2<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
0<br />
0<br />
2<br />
1<br />
2<br />
1<br />
1<br />
1<br />
1<br />
1<br />
1<br />
2<br />
2<br />
t<br />
u<br />
F<br />
t<br />
Fu<br />
F<br />
u<br />
v<br />
Fu<br />
u<br />
k<br />
F<br />
F<br />
u<br />
FL<br />
u<br />
d<br />
u<br />
F<br />
F<br />
t<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
k<br />
F<br />
v<br />
F<br />
v<br />
u<br />
L<br />
d<br />
v<br />
L<br />
u<br />
F<br />
d<br />
u<br />
L<br />
v<br />
u<br />
d<br />
v<br />
L<br />
d<br />
v<br />
t<br />
u<br />
F<br />
t<br />
Fu<br />
F<br />
u<br />
v<br />
Fu<br />
u<br />
k<br />
F<br />
F<br />
u<br />
FL<br />
u<br />
d<br />
t<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
k<br />
F<br />
v<br />
L<br />
u<br />
d<br />
u<br />
L<br />
v<br />
u<br />
d<br />
t<br />
u<br />
F<br />
F<br />
t<br />
v<br />
L<br />
Fd<br />
v<br />
Fu<br />
v<br />
F<br />
t<br />
u<br />
L<br />
u<br />
L<br />
u<br />
F<br />
d<br />
t<br />
v<br />
u<br />
L<br />
d<br />
v<br />
FL<br />
d<br />
v<br />
L<br />
d<br />
t<br />
u<br />
F<br />
t<br />
Fu<br />
F<br />
u<br />
v<br />
Fu<br />
u<br />
k<br />
F<br />
F<br />
u<br />
FL<br />
u<br />
d<br />
t<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
k<br />
F<br />
v<br />
L<br />
u<br />
d<br />
u<br />
L<br />
v<br />
u<br />
d<br />
L<br />
t<br />
Fu<br />
F<br />
t<br />
v<br />
u<br />
Fv<br />
v<br />
L<br />
d<br />
FL<br />
t<br />
Fu<br />
F<br />
t<br />
v<br />
u<br />
Fv<br />
v<br />
L<br />
d<br />
L<br />
L<br />
d<br />
B<br />
L<br />
v<br />
FL<br />
v<br />
L<br />
L<br />
d<br />
v<br />
xx<br />
xx<br />
xx<br />
xx<br />
xxxx<br />
xx<br />
xx<br />
xx<br />
xx<br />
x<br />
xx<br />
xx<br />
xx<br />
xxxx<br />
xx<br />
xx<br />
xx<br />
t<br />
xx<br />
t<br />
xx<br />
xx<br />
t<br />
t<br />
t<br />
xx<br />
t<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
… (13)<br />
0<br />
2<br />
1<br />
2<br />
2<br />
0<br />
1<br />
1<br />
0<br />
0<br />
2<br />
0<br />
2<br />
2<br />
2<br />
0<br />
1<br />
1<br />
0<br />
0<br />
2<br />
1<br />
0<br />
2<br />
0<br />
0<br />
2<br />
2<br />
2<br />
6<br />
2<br />
2<br />
1<br />
5<br />
2<br />
2<br />
1<br />
4<br />
2<br />
2<br />
0<br />
4<br />
2<br />
1<br />
0<br />
3<br />
2<br />
2<br />
0<br />
2<br />
1<br />
2<br />
2<br />
5<br />
1<br />
2<br />
1<br />
4<br />
1<br />
2<br />
1<br />
3<br />
1<br />
2<br />
0<br />
3<br />
1<br />
1<br />
0<br />
2<br />
1<br />
2<br />
0<br />
0<br />
2<br />
2<br />
4<br />
0<br />
2<br />
1<br />
3<br />
0<br />
2<br />
1<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
1<br />
0<br />
0<br />
2<br />
0<br />
2<br />
2<br />
0<br />
2<br />
2<br />
1<br />
0<br />
2<br />
2<br />
4<br />
2<br />
1<br />
3<br />
2<br />
1<br />
2<br />
2<br />
0<br />
2<br />
1<br />
0<br />
2<br />
0<br />
2<br />
2<br />
0<br />
2<br />
2<br />
1<br />
0<br />
2<br />
2<br />
2<br />
1<br />
2<br />
2<br />
1<br />
0<br />
2<br />
0<br />
2<br />
2<br />
0<br />
2<br />
2<br />
1<br />
0<br />
2<br />
2<br />
2<br />
1<br />
0<br />
2<br />
2<br />
0<br />
2<br />
2<br />
1<br />
0<br />
2<br />
2<br />
1<br />
0<br />
2<br />
2<br />
0<br />
2<br />
0<br />
2<br />
0<br />
2<br />
2<br />
2<br />
2<br />
2<br />
)<br />
2<br />
4<br />
2<br />
4<br />
(<br />
2<br />
1<br />
]<br />
2<br />
2<br />
2<br />
2<br />
2<br />
2<br />
2<br />
2<br />
2<br />
[<br />
!<br />
2<br />
1<br />
)]<br />
)(<br />
2<br />
2<br />
2<br />
[(<br />
!<br />
2<br />
1<br />
)]<br />
](<br />
)<br />
(<br />
)<br />
(<br />
2<br />
[[<br />
!<br />
2<br />
1<br />
)]<br />
(<br />
)<br />
[(<br />
!<br />
2<br />
1<br />
)]<br />
,<br />
(<br />
[<br />
!<br />
2<br />
1<br />
)<br />
,<br />
(<br />
!<br />
2<br />
1<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
u<br />
A<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
u<br />
v<br />
u<br />
d<br />
d<br />
v<br />
v<br />
v<br />
u<br />
u<br />
u<br />
u<br />
u<br />
u<br />
u<br />
u<br />
u<br />
d<br />
d<br />
v<br />
v<br />
v<br />
u<br />
u<br />
u<br />
u<br />
u<br />
u<br />
d<br />
d<br />
v<br />
v<br />
v<br />
u<br />
u<br />
u<br />
d<br />
d<br />
v<br />
v<br />
v<br />
u<br />
u<br />
u<br />
F<br />
d<br />
d<br />
v<br />
u<br />
F<br />
d<br />
d<br />
A<br />
i i<br />
i<br />
i<br />
i<br />
i<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
� �<br />
� �<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�<br />
�
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
NUMERICAL APPLICATION<br />
Example:<br />
�u<br />
2<br />
� d1<br />
�u<br />
� ( F � k)<br />
u � u v , t �0 x ��<br />
�t<br />
�v<br />
2<br />
� d1<br />
�v<br />
� F(<br />
1�<br />
v)<br />
� u v , t �0 x ��<br />
�t<br />
U(x, 0) = Us + 0.01 sin(�x/ L) for 0 ≤x ≤ L<br />
V (x, 0) = Vs – 0.12 sin(�x/ L) for 0 ≤x ≤ L<br />
We will take<br />
d1=d2=0.01 , F= 0.09 , k=-0.004 , Us=0 , Vs=1<br />
We use MatLab 8 for finding the following tables and figures.<br />
Table:- (1) for ( V )<br />
t=0.2 t=0.3 t=0.4<br />
X<br />
AD Finite AD Finite AD Finite<br />
0 0.9998 1.0000 0.9996 1.0000 0.9994 1.0000<br />
0.1 1.0013 1.0014 1.0010 1.0014 1.0007 1.0013<br />
0.2 1.0026 1.0027 1.0022 1.0026 1.0018 1.0024<br />
0.3 1.0037 1.0039 1.0032 1.0035 1.0026 1.0032<br />
0.4 1.0046 1.0048 1.0039 1.0043 1.0031 1.0038<br />
0.5 1.0054 1.0055 1.0044 1.0048 1.0034 1.0041<br />
0.6 1.0059 1.0061 1.0048 1.0052 1.0036 1.0043<br />
0.7 1.0064 1.0065 1.0050 1.0054 1.0037 1.0044<br />
0.8 1.0066 1.0068 1.0052 1.0056 1.0037 1.0044<br />
0.9 1.0068 1.0070 1.0052 1.0056 1.0036 1.0044<br />
1.0 1.0068 1.0070 1.0053 1.0057 1.0036 1.0044<br />
1.1 1.0068 1.0070 1.0052 1.0056 1.0036 1.0044<br />
1.2 1.0066 1.0068 1.0052 1.0056 1.0037 1.0044<br />
1.3 1.0064 1.0065 1.0050 1.0054 1.0037 1.0044<br />
1.4 1.0059 1.0061 1.0048 1.0052 1.0036 1.0043<br />
1.5 1.0054 1.0055 1.0044 1.0048 1.0034 1.0041<br />
1.6 1.0046 1.0048 1.0039 1.0043 1.0031 1.0038<br />
1.7 1.0037 1.0039 1.0032 1.0035 1.0026 1.0032<br />
1.8 1.0026 1.0027 1.0022 1.0026 1.0018 1.0024<br />
1.9 1.0013 1.0014 1.0010 1.0014 1.0007 1.0013<br />
2.0 0.9998 1.0000 0.9996 1.0000 0.9994 1.0000<br />
Fig.:-(1) t=0.2 Fig.:-(2) t=0.3 Fig.:-(3) t=0.4<br />
176
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
177<br />
Table:-( 2 ) for ( U )<br />
t=1 t=2 t=3<br />
X<br />
AD Finite AD Finite AD Finite<br />
0 0.0003 0 0.0012 0 0.0023 0<br />
0.1 -0.0162 -0.0163 -0.0134 -0.0139 -0.0108 -0.0119<br />
0.2 -0.0317 -0.0317 -0.0266 -0.0271 -0.0221 -0.0230<br />
0.3 -0.0459 -0.0461 -0.0384 -0.0390 -0.0316 -0.0331<br />
0.4 -0.0586 -0.0589 -0.0484 -0.0495 -0.0390 -0.0419<br />
0.5 -0.0697 -0.0700 -0.0568 -0.0585 -0.0444 -0.0493<br />
0.6 -0.0789 -0.0793 -0.0635 -0.0659 -0.0480 -0.0553<br />
0.7 -0.0861 -0.0867 -0.0685 -0.0716 -0.0502 -0.0600<br />
0.8 -0.0913 -0.0920 -0.0720 -0.0757 -0.0514 -0.0633<br />
0.9 -0.0945 -0.0952 -0.0741 -0.0782 -0.0520 -0.0653<br />
1.0 -0.0955 -0.0962 -0.0748 -0.0790 -0.0522 -0.0659<br />
1.1 -0.0945 -0.0952 -0.0742 -0.0782 -0.0523 -0.0653<br />
1.2 -0.0914 -0.0920 -0.0722 -0.0757 -0.0519 -0.0633<br />
1.3 -0.0861 -0.0867 -0.0687 -0.0716 -0.0509 -0.0600<br />
1.4 -0.0789 -0.0793 -0.0637 -0.0659 -0.0488 -0.0553<br />
1.5 -0.0697 -0.0700 -0.0570 -0.0585 -0.0451 -0.0493<br />
1.6 -0.0587 -0.0589 -0.0486 -0.0495 -0.0395 -0.0419<br />
1.7 -0.0459 -0.0461 -0.0385 -0.0390 -0.0319 -0.0331<br />
1.8 -0.0317 -0.0317 -0.0267 -0.0271 -0.0223 -0.0230<br />
1.9 -0.0162 -0.0163 -0.0134 -0.0139 -0.0108 -0.0119<br />
2.0 0.0003 -0.0000 0.0012 -0.0000 0.0023 -0.0000<br />
Fig.:-(4) t=1 Fig.:-(5) t=2 Fig.:-(6) t=3<br />
DISCUSSION OF TABLES AND FIGURES<br />
From the tables ( 1 - 2 ) and figures ( 1 – 6 ) it<br />
is clear that the ADM more faster, more accurate<br />
and more efficient for solving the Gray-Scott<br />
model.<br />
Conclusion: We saw that Adomain<br />
decomposition method is more accurate than<br />
finite difference method for solving Gray-Scott<br />
model especially when we increase t as shown in<br />
figure 1-6 and tables 1-2.<br />
REFERENCE<br />
- Adomian G., (1988), A Review of the Decomposition<br />
Method in Applied Mathematics, Cenfer for<br />
Applied Mathematics, University OJ Georgia,<br />
Athens, Georgia 30602 Submitted by George<br />
Adomian.<br />
- Adomian G., (1994), Solving frontier problems of<br />
physics: the decomposition method, Boston:<br />
Kluwer Academic Publishers.<br />
- Charkravarti S., Marek M., and Ray W.H., Phys. Rev. E<br />
52, 2407(1995).<br />
- Leon G. and George, F.D., (1982) “Numerical Solution of<br />
Partial Differential Equations In Science and<br />
Engineering" John Wiely and Sons, Inc., Canada.<br />
- Mathews, J. H. and Fink, K. D., (1999)" Numerical<br />
Methods Using Matlab", Prentice- Hall, Inc.<br />
- Mingjing Sun. Yuanshun Tan. Lansun Chen, 2007<br />
Dynamical behaviors of brusselator system with<br />
impulsive input J. Math Chem.<br />
- Petrov V., Metens S., Borckmans P., Dewel G. and Showalter<br />
K., Phys.Rev. Lett.75,2895 (1995)<br />
-Shanthakumar M., (1989), Computer Based Numerical<br />
Analysis , Khanna publisher, Neisaraic Delhi-<br />
110006 India.<br />
-Yuncheng You , (2007), Global Dynamics of the<br />
Brusselator Equations ,<br />
Dynamics of PDE, Vol.4, No.2, 167-196,.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 281-289, 2011<br />
FDM<br />
و<br />
ADM<br />
نَيكَير ب<br />
Gray-Scott<br />
َىمةتشيس وب ىيةرامذ انركراكيش<br />
ا ىن اَ ي ةنت ىس ة ب وىب ى ي ةراىمذ اك ةن رك راك ي ىش ي رك راك ي ىش ةىي ي اا Gray-Scott َى ىي<br />
وىب ةرىيتاو ةريتةىن ب<br />
FDM<br />
ةييبًا و<br />
ADM<br />
ADM<br />
FDM<br />
اىكَير وىك ووىب راىيدو<br />
و<br />
ADM<br />
FDM<br />
اىكَير و<br />
. سد َىنوونم د ةرايد اي ةظة و<br />
مادختساب<br />
Gray-Scott<br />
ةيبًا مادختيساب هيتًابتلا لييحلا دايدًج لإاًدديع<br />
ADM<br />
FDM<br />
َىمةتىشيس سد َىَينوكةىظ َىىظ د<br />
ةتخوث<br />
اىكَير اىناَي راك ب كيزين اكةراكؤيش<br />
اكَير ذ امةتشيس نَيروج ياظة انركراكيش<br />
ةموظنمل يددعلا لحلا<br />
Gray-Scott<br />
.<br />
لاثملا هف حضوم امكو FDM ةبًا نم لئاسملا نم عونلا الا لحل قدأو عاسأ<br />
ةصلاخلا<br />
ةيموظنم ليية ويم ليحتلا اليا هيف<br />
ADM<br />
ةبًا نا نيتمو<br />
178
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
290<br />
ANATOMICAL COMPARISON BETWEEN CISSUS REPENS, CAYRATIA<br />
JAPONICA (VITACEAE) AND LEEA AEQUATA (LEEACEAE)<br />
ABSTRACT<br />
CHNAR NAJMADDIN, KHATIJA HUSSIN, and HAJA MAIDEEN<br />
Dept. of Biology, School of Environmental and Resource Sciences, Faculty of Science and Technology,<br />
University of Kebangsaan – Malaysia<br />
(Received: March 10, 2011; Accepted for publication: September 28, 2011)<br />
This study was conducted to evaluate anatomical comparison between three species belonging to two families<br />
(Vitaceae and Leeaceae). Two genera of the family Vitaceae (Cissus repens and Cayratia japonica) and one species of<br />
Leeaceae family (Leea aequata) were investigated. Anatomically it has been shown that the shape of stem, petiole,<br />
midrib, margin and lamina were different. There were druses and raphid crystals in stem, petiole, midrib, margin of<br />
Cissus repens and Cayratia japonica, however, in Leea aequata there was only druses crystals, except in lamina of<br />
Cissus repens , Cayratia japonica and Leea aequata in which there were druses and raphide crystals. Leaf epidermis of<br />
Cissus repens, Cayratia japonica and Leea aequata were investigated by using light microscope and scanning electron<br />
microscope. The shapes of leaf epidermal cells were usually polygonal; the types of anticlinal walls are straight and<br />
arched. The stomatal apparatus presented on the both side of the leaf (abaxial and adaxial). Cissus repens and<br />
Cayratia japonica had different types of stomatal apparatus such as cyclocytic and paracytic, and Leea aequata had<br />
anisocytic type.<br />
KEY WORDS: Anatomy of Vitaceae, Leeaceae family, Cissus repens, Cayratia species, Leea species.<br />
V<br />
INTRODUCTION<br />
itaceae family includes woody<br />
climbers, sometimes vines, trees, and<br />
also involve shrubs and succulents (Timmons et<br />
al., 2007). Vitaceae leaves are simple, lobed or<br />
unlobed, or compound; 1-3 pinnately compound<br />
and alternate (Chen and Wen, 2007). Leaf<br />
opposed tendrils (Rossetto et al., 2002) with<br />
unarmed stems, and the inflorescence is panicles<br />
and corymbs (Lombardi, 2007 and Chen and<br />
Wen, 2007). The flowers are small regular and<br />
usually are bisexual (Rossetto, et al., 2001).<br />
Leeaceae includes shrubs, stem is unarmed,<br />
tendrils absent. The leaf is simple or compound;<br />
1-4 pinnate to trifoliate with stipular petiole.<br />
Inflorescence is paniculate, frequently<br />
corymbiform, terminal or axillary.<br />
Hermaphrodite flowers (Wen, 2007).<br />
The stomata are apertures in the epidermis,<br />
bounded by two guard cells. Their main function<br />
is to allow gases such as carbon dioxide, water<br />
vapours and oxygen to move rapidly into and out<br />
of the leaf (Perveen et al, 2007 and Tay and<br />
Furukawa, 2008). In the green leaves they occur<br />
either on both surfaces or on one only, either the<br />
upper surface or more commonly on the lower<br />
surface (Perveen et al, 2007). On the basis of<br />
arrangement of the epidermal cell neighbouring<br />
the guard cell, more than 25 main types of<br />
stomata in dicots have been recognized (Perveen<br />
et al, 2007).<br />
MATERIAL AND METHODS<br />
T. S. of stem, petiole, midrib, margin, lamina,<br />
and types of stomata were used to describe the<br />
anatomy of the various species. Plant materials<br />
of Cissus repens, Cayratia japonica and Leea<br />
aequata were collected from Malaysia forests.<br />
The stem, middle part of petioles, midrib, lamina<br />
and margins were embedded in polystyrene, and<br />
sectioned transversely on a sliding microtome<br />
(model Richard Jung-1972) or Microtome<br />
Reichert (model Leica Jung histolide 200).<br />
Transverse sections were cut at 20 µm thick,<br />
depending on the texture of the specimen.<br />
Sections were presoaked in (Clorox) for 5-15<br />
minutes to clear the tissues and getting white,<br />
and the sample sections were rinsed by distilled<br />
water 2-3 times and were steeped in Safranin<br />
solution for approximately 5 minutes, rinsed
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
with water, then stained for approximately 5-10<br />
minutes in Alcian blue, dehydrated in a series of<br />
alcohol concentrations starting from 50%, 70%,<br />
95% and 100% (approximately 2 minutes each),<br />
one or two drops of concentrated HCl<br />
(hydrochloric acid ) were added to 70%<br />
treatment to change the colour of leaves to<br />
purplish. Finally, the samples were mounted on<br />
microscope slides in Euparal as permanent<br />
medium, carefully covered with slide covers,<br />
and then kept in drying oven at 60°C for a week.<br />
Samples were observed and viewed with light<br />
microscope (Johansen, 1940 and Sass, 1958).<br />
Leaf samples were collected from various<br />
locations in Malaysia. Coated samples were<br />
viewed under Scanning Electron Microscope<br />
(SEM) operated in 10 to 15 Kv at various<br />
magnifications to obtain the best images.<br />
Normally 500 to 10,000 magnifications were<br />
used, and epidermal peels were prepared by<br />
mechanical scraping, samples were cut<br />
approximately 1cm², then the small parts were<br />
soaked in Jeffrey’ solution (10% nitric acid +<br />
10% chromic acid, 1:1) at room temperature for<br />
1-3 hours, sometimes for 1 day after the solution<br />
was diluted with distilled water, until the<br />
mesophyll tissue could be separated easily from<br />
both epidermis, stained, dehydrated and mounted<br />
in the same way. Samples were observed and<br />
viewed with light microscope.<br />
RESSULTS AND DISCUSSION<br />
The present study has shown anatomical<br />
differences between the two families (Vitaceae<br />
and Leeaceae). Leeaceae are most closely related<br />
to Vitaceae however most workers have now<br />
separated Leeaceae from Vitaceae (Wen 2007a).<br />
As revealed by the present study, the shape of<br />
the stem or twig in Cissus repens, Cayratia<br />
japonica and Leea aequata were different<br />
between species; the vascular bundle is closed<br />
and surrounded by fiber layer (sclerenchymatous<br />
tissue), secretory cells were present, raphid and<br />
druses crystals were also present, and in the<br />
cortex there was also a layer of collenchyma<br />
tissue. Collenchyma tissue is far from epidermal<br />
layer and continues as in Cissus repens. The<br />
wood of Vitaceae has simple, large rays, with<br />
vessel ray of parenchyma (Metcalfe, and Chalk,<br />
1950). The vessels were large in comparison<br />
with those in the close relatives in Leeaceae<br />
(Wen, 2007b) as in (Fig.1).<br />
291
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
Fig.1: A- Cissus repens stem showing vascular bundle (v), collenchyma tissue (small black arrow) (4X), B-<br />
Cayratia japonica stem showing vascular bundle, collenchyma tissue (small black arrow) (v), fiber (large white<br />
arrow), secretory cell (small white arrow) (4X),, C- raphid crystals (r) (40X), D- druses crystals (d) (40X), E-<br />
Leea aequata stem showing vascular bundle (v), collenchyma tissue (small black arrow) (4X), accessory<br />
vascular bundle (large black arrow) (4X), F- magnification of E show druses crystal (d), collenchyma tissue<br />
(small black arrow) (40X).<br />
292<br />
E<br />
A<br />
v<br />
r<br />
C D<br />
v<br />
B<br />
F<br />
v<br />
d<br />
d
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
The present investigation also revealed that the<br />
petiole of Cissus repens, Cayratia japonica and Leea<br />
aequata have different shapes depending on the<br />
species (Fig.2), the vascular bundle was closed and<br />
surrounded by fiber, with secretory cells (Tannins)<br />
which were specialized as parenchymatous cells and<br />
frequently observed beneath the epidermis. The<br />
raphides and druses crystals were present in<br />
parenchymatous cells and usually observed in the pith<br />
and under the epidermis. In Vitaceae this was<br />
characteristic of the family, while in the Leeaceae<br />
only druses crystals were observed. Collenchyma<br />
A<br />
C<br />
v c<br />
c<br />
tissues (angular collenchyma) were present in the<br />
petiole, they were usually occurred as wide bands<br />
below the epidermis, and in Cissus, collenchyma was<br />
little developed, however in other genera it was very<br />
conspicuous as in Petrisanthas, Tetrastigma, and<br />
Northoscissus, and in Cayratia, collenchyma reveals<br />
as isolated patches and this was particularly obvious<br />
in Cayratia japonica and Cayratia trifolia.<br />
Seclerenchyma tissues were easily observed as fibers;<br />
they had thick cell wall and small lumen (Latiff,<br />
1980).<br />
Fig.2: A- Cissus repens petiole showing vascular bundle (v), secretory cell (small black arrow), collenchyma<br />
tissue (c) (4X), B- Cayratia japonica petiole showing trichomes (large black arrow), secretory cell (small black<br />
arrow), vascular bundle (v) (4X), C- Magnification of B show the trichomes (large black arrow), secretory cell<br />
(small black arrow), collenchyma tissue (c) (10X). D-Leea aequata petiole showing vascular bundle (v),<br />
secretory cell (small black arrow), accessory vascular bundle (large white arrow) (4X).<br />
B<br />
D<br />
v<br />
v<br />
293
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
The present study has shown that the midrib of<br />
Cissus repens, Cayratia japonica and Leea aequata<br />
have the following characteristics: the outline of the<br />
adaxial surface was slightly humped, and the abaxial<br />
surface was arc shaped, and collenchyma was present<br />
294<br />
A<br />
v<br />
C<br />
v<br />
in both epidermal layers. The druses and raphide<br />
crystals were present in Vitaceae, but in Leeaceae,<br />
only druses crystals were present and there were a lot<br />
of vascular bundles (Fig.3).<br />
Fig.3: A- Cissus repens midrib showing vascular bundle (v), secretory cell (small black arrow) (4X), B-<br />
Cayratia japonica midrib trichomes (large black arrow), vascular bundle (v), secretory cell (arrow), secretory<br />
cell (small black arrow) (4X),, C- Leea aequata midrib show vascular bundle (v), secretory cell (small black<br />
arrow), accessory vascular bundle (large white arrow) (4X).<br />
B<br />
v
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
Figure (4) shows that Cissus repens, Cayratia<br />
japonica and Leea aequata mesophyll layer contains<br />
calcium oxalate (druses) crystals and mucilage cells<br />
or secretory cells with raphides inside the bundle<br />
(Metcalfe and Chalk, 1950). Druses idioblasts and<br />
raphide idioblasts present in inner layer of biseriate<br />
epidermis (Kannabiran and Pragasam 1994).<br />
Fig.4: A- Cissus repens Lamina showing trichomes (large black arrow), palisaid layer (pa), spongy layer (sp),<br />
upper epidermis (ue), lower epidermis (le), secretory cell (arrow) (4X), B- Cayratia japonica lamina show<br />
druses (small black arrow), raphid crystal (large white arrow) (4X), C- Leea aequata lamina show druses (small<br />
black arrow) (4X).<br />
The present study has also shown that the margin<br />
of Cissus repens, Cayratia japonica and Leea<br />
aequata there are straight with slightly curved<br />
inward, and the tip was rounded or tapering.<br />
Vascular bundle was present, fibers nil, secretory<br />
A<br />
A<br />
C<br />
C<br />
ue<br />
pa<br />
sp<br />
le<br />
cells, raphides and druses crystals were present,<br />
however trichomes were either present or absent. In<br />
Leea aequata the margin was slightly downwards and<br />
the tip was rounded or tapering. Fiber nil, secretory<br />
cells were present with no trichomes (Fig.5).<br />
Fig.5: A- Cissus repens margin showing raphid crystal (large white arrow) (10X), B- Cayratia japonica margin<br />
showing trichomes (large black arrow), secretory cell (small black arrow) (10X), C- Leea aequata margin show<br />
secretory cell (small black arrow) (10X).<br />
B<br />
B<br />
295
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
The stem, petiole, midrib, lamina and margin of<br />
Cissus repens, Cayratia japonica and Leea aequata<br />
have the following features: the outline of these<br />
sections in some species was smooth, however in<br />
some species trichomes were present which were<br />
either glandular secretory trichome or non glandular<br />
(normal hair) and commonly present and were very<br />
important for species determination. The trichome<br />
complement of a particular organ can consist entirely<br />
of unbranched or branched hairs (Lombardi 2007).<br />
The present study has shown that in Cissus repens<br />
and Leea aequata the outline is smooth, but in<br />
Cayratia japonica trichomes were present and also in<br />
some species of Leea rubra; the number of trichomes<br />
were different from one species to another. The<br />
trichomes were non glandular and unbranched as<br />
show in (Fig.1, 2, 3, 4).<br />
296<br />
Vitaceae leaf epidermal characteristics have been<br />
studied by Ren et.al, (2003), they used light and scan<br />
electron microscope, the shape of leaf epidermal cells<br />
were usually irregular or polygonal; the anticlinal<br />
walls are straight, arched. The present study has<br />
shown that the stomata types of Vitaceae leaf<br />
epidermis were paracytic (Fig.6, D, E, I) (Hui, et al,<br />
2003 and Kannabiran and Pragasam, 1994) The<br />
stomata usually present in abaxial epidermis,<br />
however in some species the stomata present in both<br />
sites of leaf epidermis (abaxial and adaxial) as in<br />
Cissus repens (Fig.6, A, D), and in Leeaceae the<br />
stomata were anomocytic (Fig.6, F, J) (Wen, 2007a).
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
A<br />
C<br />
E<br />
I<br />
G<br />
Fig.6: A-C, Adaxial (10X, 40X, 40X respectively). D-F, Abaxial (100X, 10X, 40X respectively), G-H, Adaxial<br />
SEM, I-K, Abaxial SEM. D-E-I, Paracytic. F-J, Anomocyte SEM.<br />
B<br />
D<br />
F<br />
H<br />
J<br />
297
J. Duhok Univ., Vol. 14, No.1 (Pure and Eng. Sciences), Pp 290-298, 2011<br />
298<br />
ACKNOLODGEMENT<br />
I would like to express my gratitude and<br />
sincere thanks to my supervisors, my thanks to<br />
Anatomical lab. staffs. and Scanning Electron<br />
microscope staffs. We grateful thank the<br />
University Kebangsaan Malaysia for financial<br />
support via FRGS grant UKM-ST-08-<br />
FRGS0013-2009.<br />
REFERENCE<br />
- Chen, Z. and Wen, J. (2007). Leeaceae. Published by<br />
Science press (Beijing) and Missouri Botanical<br />
Garden press, Flora of china, Vol. 12, p: 115-169.<br />
- Chen, Z., Ren, H. and Wen, J. (2007). Vitceae. Published<br />
by Science press (Beijing) and Missouri Botanical<br />
Garden press, Flora of china, Vol. 12, p:<br />
33,115,173.<br />
- Hui, R., Kai-Yu, P., Zhi-Duan, C., and Ren-Qing, W.<br />
(2003). Structural characters of leaf epidermis and<br />
their systematic significance in Vitaceae. Acta<br />
Phytotaxonomica Sinica, 41 (6): 531-544.<br />
- Johansen, D.A. (1940). Plant microtechnique. New<br />
Yourk: MC Graw,Hill.<br />
- Kannabiran, B. and Pragasam, A. (1994). Foliar epidermal<br />
features of Vitaceae and taxonomic position of<br />
Leea. Journal of India Botanical Society. Vol. 73:<br />
81-87.<br />
- Lombardi, J. A. (2007). Systematic of Vitaceae in South<br />
America. Can. Jou. Bot., 85, p: 712- 721.<br />
- Metcalfe, C.R., and Chalk, L. (1950). Anatomy of the<br />
dicotyledons. Clarendon Press, Oxford. Vol. 2: 413-<br />
419.<br />
CAYRATIA JAPONICA (VITACEAE) LEEA<br />
،<br />
- Rossetto, M., Jackes, B.R., Scott, K.D., and Henry, R.J.<br />
(2001). Intergeneric relationships in the Australian<br />
Vitaceae: new evidence from cpDNA analysis.<br />
Genetic Resources and Crop Evolution, Vol. 48, p:<br />
307-314.<br />
- Rossetto, M., Jackes, B.R., Scott, K.D., and Henry, R.J.<br />
(2002). Is the Genus Cissus (Vitaceae)<br />
Monophylatic? Evidence from Plastid and Nuclear<br />
Ribosomal DNA. Systematic Botany, Vol. 27 (3),<br />
P: 522-533.<br />
- Perveen, A., Abid, R., and Fatima,R. (2007). Stomatal<br />
types of some dicots within flora of Karachi,<br />
Pakistan. Pak. J. Bot., 39(4): 1017-1023.<br />
- Sass, J.E. (1958). Botanical microtechnique. 3 rd edition.<br />
Ames: lowa state university.<br />
- Tay, A., and Furukawa,A. (2008). Variations in leaf<br />
stomata density and distribution of 53 Vine species<br />
in Japan. Plant species Biology 23, 2-8.<br />
- Timmons, S.A., Posluszny, U. and Gerrath, J.M. (2007).<br />
Morphological and anatomical development in the<br />
Vitaceae. X. Comparative ontogeny and<br />
phylogenetic implications of Cissus quadrangularis<br />
L. Can. J. Bot., Vol.85: 860-872.<br />
- Wen, J. (2007b) The Families and Genera of Vascular<br />
Plants; Leeaceae. Leeaceae Dumortier, Anal. Fam.<br />
Pl.: 27 (1829), nom. Cons. Springer- verlag Berlin<br />
Heidelberg Vol.9. p. 221- 225.<br />
- Wen, J. (2007a) The Families and Genera of Vascular<br />
Plants: Vitaceae. Vitaceae Juss, Gen. Pl.: 267<br />
(1789), nom. Cons. Springer- verlag Berlin<br />
Heidelberg Vol.9. p. 467-479.<br />
CISSUS REPENS<br />
AEQUATA (LEEACEAE) و<br />
وود . Leeaceae, Vitaceae ينلامةهب وودرةي ارةةبظاند ىراكيوت انركدروارةب وبذ ىاد مانجةئ<br />
كامةشهب ذ ذةروشج و ) Cayratia japonica, Cissus repens(<br />
ىذوةشئ Vitaceae<br />
ارةبظاند ىراكيوت اكنركدروارةب<br />
ةتخوث<br />
ةيتاي ةهيلوكةظ ظةئ<br />
ىاشهتئراكب كامةشهبذ ذشظن<br />
, ىكلةب اكيتسب , ىدةق ىويش<br />
د ىووبرايد ىظةي ذةوةن اديراكيوت اهيلوكةظد . Leea aequata ىذوئ ) Leeaceae(<br />
ايةر,<br />
ىطلةب اكيتسب , دةقد تنيد ةهتاي ىايزرةد و رَيتس َىروج ذ وَيلاتسيرك<br />
. ىطلةب وَيظَيل , ىكلةب اهتسارةظان ايةر<br />
ذ وَيلاتشسيرك و , اد Cissus repens , Cayratia japonica ىاشنظن وودرةشي اشي ىطلةب وَيظتَيل , ىطلةب اتسارةظان<br />
Leea aequata ,<br />
اشي اد ىطلةشب اكيتشسب دوشك ىشلب ذ<br />
Leea aequata َىرَوشجد َىهتبةشهتيد<br />
ةهتاي ىارَيتس ىروج<br />
. تنيد ةهيتاي ىزرةد و رَيتس َىرؤج ذ وَيلاتسيرك وك<br />
َىكةوَينب , ىنوتركيلةئ اينوبريوي و َىييانور اهيوبريوي اناهيئراكب ىرك ةهتاي ىانظن ىاظ َىشوثوور رةسل ينلوك ةظ<br />
Cayratiajaponica , Cissus repens<br />
َىهيلوكةشظ , ىوب تسارد ىاناخ وَيواتسةو وَيراويد , Polyglonal َىروج ذ ىطلةب ىشؤثوور وَيناخ َىرؤج ىتنط<br />
وَيَىشسانةي وَيةشلينةد Vitaceae كامةهب , ةنةي ىاطلةب وَيي ىهب<br />
و ىرةس وَييك وودرةله َىساهي وَيلَينةد وك ركرايد<br />
anisocytic َىروشج ذ َىشسانةي َىشيلَينةدLeeaceae<br />
كامةشهب و<br />
parocytic , cyclocgtic<br />
ذةو ةشنةي روشج واروج<br />
.<br />
ىووبةي
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 299-306, 2011<br />
EFFECTS OF ACETAMIPRID AND GLYPHOSATE PESTICIDES ON<br />
TESTIS AND SERUM TESTOSTERONE LEVEL IN MALE MICE<br />
MAHMOUD AHMED CHAWSHEEN<br />
Dept. of General Sciences, School of Basic Education, Faculty of Education,University of Soran, Kurdistan Region-Iraq<br />
(Received: March 29, 2011; Accepted for publication: September 21, 2011)<br />
ABSTRACT<br />
This research is carried out to evaluate the potential toxicity of the acetamiprid and glyphosate pesticides<br />
individually and in combination through studying histology of testis, diameters and thicknesses of seminiferous<br />
tubules and serum testosterone levels in male albino mice. The study was conducted on thirty five male mice<br />
distributed randomly into seven groups. The first group served as control group, received tap water. The second and<br />
the third groups received 0.16 ml/L and 0.22 ml/L of acetamiprid, respectively. The fourth group received 3.125 ml/L<br />
of glyphosate, and the fifth group received 4.166 mg/L of glyphosate as well. Group six received combination of equal<br />
volumes of 0.16 ml/L acetamiprid and 3.125 ml/L glyphosate. Group seven received a combination of equal volumes of<br />
0.22 ml/L acetamiprid and 4.166 ml/L glyphosate. The pesticides were applied in mice drinking water for a period of<br />
four weeks. The separate tested doses of acetamiprid and glyphosate pesticides induced alterations in serum<br />
testosterone levels. The alterations that were caused by acetamiprid were in expected manner, the adverse effects were<br />
increased by increasing the exposure doses. While for glyphosate the results were different by the fact that the second<br />
dose of glyphosate caused significant increase in comparison with the first one. Histological examinations showed that<br />
the alterations in architecture of seminiferous tubules, their diameters and thicknesses, caused by both pesticides<br />
separately, were increased by increasing the exposure doses. Regard the combinations of the two pesticides,<br />
histological sections revealed severe changes in both combinations especially in group seven, while serum testosterone<br />
showed that the first combination did not cause significant changes in comparison with both pesticides, and the second<br />
combination caused significant changes in comparison with acetamiprid alone. It can be concluded from this study<br />
that acetamiprid and glyphoste are responsible for the alterations in serum testosterone, diameters and thicknesses<br />
of the seminiferous tubules, and combinations of both pesticides have synergistic effects on testis histology in<br />
male albino mice.<br />
KEYWORDS: Acetampird, Glyphosate, Toxicity, Testosterone, Seminiferous Tubules<br />
W<br />
INTRODUCTION<br />
ith the increasing demand for food<br />
production as a result of dramatic<br />
increases in human population, a large number<br />
of chemical substances have been used either for<br />
increasing or maintaining the productivity of<br />
agricultural farm lands (Cooper and Dobson,<br />
2007; Erisman et. al., 2008). Meanwhile many<br />
of these chemical substances cause<br />
environmental and health related problems. For<br />
this reason researchers around the world try to<br />
evaluate the potential toxicity of these chemicals<br />
and their impact on public health. Among much<br />
used chemicals in agricultural activities are<br />
pesticides (Hock et al., 1991; USDA, 2005). In<br />
this study we focus on acetamiprid insecticide<br />
and glyphosate herbicide as they have been used<br />
in large quantities by farmers in Erbil city.<br />
Indiscriminate use of both pesticides find their<br />
way into the food chain, eventually reaching<br />
human or domestic animals.<br />
Acetamiprid ((E)-N1-[(6-chloro-3-pyridyl)<br />
methyl]-N2- cyano-N1-methylacetamidine) is a<br />
neonicotinoid insecticides with a systemic effect<br />
(Tomizawa and Yamamoto, 1993; Anderson et<br />
al., 2005; Chiyozo, 2008). It has been widely<br />
used since the 1990s as an alternative for<br />
organophosphorus, organochlorine, and<br />
pyrethroid compounds (Elzen, 2001; Grafton-<br />
Cardwell and Gu, 2003; Kovganko and<br />
Kashkan, 2004). Acetamiprid is effective against<br />
piercing-sucking insects like: Hemiptera,<br />
Thyasnoptera and Lepidoptera. These insects are<br />
found on various crops such as leafy vegetables,<br />
citrus fruits, pome fruits, grapes, cotton, cole<br />
crops, and ornamental plants (Mateu-Sánchez et<br />
al., 2003; Tomizawa and Casida, 2005).<br />
Acetamiprid targeting nicotinic acetylcholine<br />
receptor (nAChR) and by the persistence at the<br />
binding sites of nAChR will lead to overstimulation<br />
of cholinergic synapses eventually<br />
causing hyperexcitation and paralysis of the<br />
insect (Tomizawa and Casida, 2003; Matsuda et<br />
al., 2005; Yu, 2008).<br />
Glyphosate [N-(phosphonomethyl) glycine]<br />
is a post-emergence, non-selective, broadspectrum,<br />
systemic herbicide (Hetherington et<br />
al., 1999; Alibhai and Stallings, 2001; Roberts et<br />
al., 2002). It has been marketed since 1974 and<br />
299
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 299-306, 2011<br />
it is still largely used around the world with an<br />
effective role against a broad range of plants<br />
including annual and perennial grasses and<br />
broadleaves, it also plays an important role in<br />
farm production practices in maintaining weed<br />
control (Hetherington et al., 1999; Williams et<br />
al., 2000; Solomon et al., 2007). Glyphosate is<br />
absorbed through foliage and translocated<br />
throughout plants. Glyphosate inhibits plant<br />
growth through interference with the production<br />
of essential aromatic amino acids and phenolic<br />
compounds that are necessary for plant growth<br />
and development (Steinrucken and Amrhein,<br />
1980; Alibhai and Stallings, 2001).<br />
In spite of many researches that were<br />
undertaken on both pesticides (acetamiprid and<br />
glyphosate) separately or with other chemicals,<br />
there was no information available on their<br />
toxicity to male reproductive system when they<br />
introduced as a mixture or in combination. This<br />
research is carried out to evaluate the potential<br />
toxicity of acetamiprid and glyphosate pesticides<br />
individually and in combination through<br />
studying the alterations in histology of testis and<br />
serum testosterone levels in male albino mice.<br />
MATERIALS AND METHODS<br />
The Tested Pesticides<br />
The two tested pesticides, acetamiprid and<br />
glyphosate, were purchased from agricultural<br />
market in Erbil. Acetamiprid concentration in<br />
the bottle was 20%. As labeled on the bottle,<br />
preparation for field uses was instructed to be<br />
70-120ml /20 L of water. While glyphosate<br />
concentration in the bottle was 48%, a label on<br />
the bottle instructed not to be mixed with<br />
other solutions.<br />
Experimental Animals<br />
Male albino mice weighing 28 – 30 gm, 12<br />
weeks of age, were provided by Animal House<br />
at Department of Biology, College of Science,<br />
University of Salahaddin-Erbil. They were fed<br />
standard mouse diet. The mice were housed in<br />
an average room temperature of 24C ₀ ±2 with<br />
light, alternate 12hr light/dark cycles, during the<br />
study period of four weeks.<br />
Experimental Design<br />
Thirty five male albino mice were distributed<br />
randomly to seven groups (n=5); the first group<br />
served as control, received tap water. The second<br />
group received 0.16 ml/L acetamiprid, equals<br />
50% of LD50 of acetamiprid which is 200mg/kg<br />
for male mice (Yamamoto and Casida, 1999).<br />
The third group received 0.22 ml/L acetamiprid,<br />
75% of LD50 of acetamiprid. The fourth and the<br />
300<br />
fifth groups received doses of 3.125 ml/L, and<br />
4.166 mg/L of glyphosate, respectively, that is<br />
50% and 75% of LD50 of glyphosate, which is<br />
10000 mg/kg in mice (U.S. National Library of<br />
Medicine, 1995), correspondingly . Group six<br />
received combination of 0.16 ml/L acetamiprid<br />
and 3.125 ml/L glyphosate. Group seven<br />
received a combination of 0.22 ml/L acetamiprid<br />
and 4.166 mL/L glyphosate together. The<br />
pesticides were applied in mice drinking water<br />
for a period of four weeks.<br />
Sample Collection<br />
After completion of the experiment period,<br />
animals were anesthetized (ketamine<br />
hydrochloride 100mg/ kg body weight) then<br />
blood samples were collected from the mice by<br />
cardiac puncture, and samples of testis were<br />
removed from the anesthetized animals.<br />
Histological Analysis<br />
After their removal, testes were immediately<br />
fixed in Bouin′s fluid for 24 hours (Benson et<br />
al., 2001), then they were dehydrated through<br />
ascending concentrations of ethanol (70%, 95%,<br />
and 100%), cleared in xylol, followed by<br />
infiltration and then embedded in paraffin wax.<br />
Four micrometer thick paraffin sections were<br />
stained by haematoxylin and eosin (Prophet et<br />
al., 1992). All slides were analyzed by light<br />
microscope. Seminiferous tubules diameter and<br />
thickness were measured in micrometers by<br />
using stage micrometer under magnification<br />
power 400X.<br />
Estimation of Serum Testosterone<br />
Serum testosterone level was measured using<br />
Testosterone Enzyme Immunoassay Test Kit<br />
(Biocheck Inc, Made in USA, BC-1115).<br />
STATISTICAL ANALYSIS<br />
All data were expressed as means ± standard<br />
error of mean (M±SE) and statistical analysis<br />
was carried out using SPSS version 16.0. Oneway<br />
analysis of variance (ANOVA) was<br />
performed to test the significance followed by<br />
Duncan’s multiple range comparison tests for<br />
comparisons between the groups. P values
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 299-306, 2011<br />
serum testosterone level in mice of group 3<br />
showed significant decrease in comparison with<br />
mice treated with 0.16 ml/L acetamiprid (Group<br />
2). Mice treated with 4.166 ml/L glyphosate<br />
(Group 5) showed significant difference in<br />
comparison with mice treated with 3.125 ml/L<br />
glyphoste (Group 4). Group 6, combination of<br />
0.16 ml/L acetamiprid and 3.125ml/L<br />
glyphosate, did not show significant difference<br />
in comparison with group 4 and group 2. Group<br />
7, combination of 0.22 ml/L acetamiprid and<br />
4.166 ml/L glyphosate, showed significant<br />
difference in comparison with group 3, while no<br />
significant difference was observed in<br />
comparison with group 5, as shown in Table (1).<br />
Histological Analysis<br />
Measured seminiferous tubules diameter of<br />
the mice from control group showed significant<br />
differences in comparison with groups 2, 3 and<br />
5, while no significant differences were observed<br />
between control group and other remaining<br />
groups. Group 3 showed significant difference in<br />
comparison with group 2. Group 5 showed<br />
significant difference in comparison with group<br />
4. Group 6 showed significant differences in<br />
comparison with group 2. Group 7 showed<br />
significant difference in comparison with groups<br />
3 and 5. Meanwhile, results from the measured<br />
seminiferous tubules thickness showed<br />
significant differences between control group<br />
and groups 2, 4, and 5, while no significant<br />
differences were observed in comparison with<br />
the other groups. On the other hand, group 3<br />
showed significant difference in comparison<br />
with group 2.<br />
Table (1): Effects of acetamprid and glyphosate pesticides individually and in combination on serum<br />
testosterone, seminiferous tubule diameter and seminiferous tubules thickness of the treated mice (Mean ±SE)<br />
Groups Treatments Mean ±SE of Serum<br />
Testosterone(ng/ml)<br />
Mean ±SE of<br />
Seminiferous Tubule<br />
Diameter(µm)<br />
Mean ±SE of<br />
Seminiferous Tubule<br />
Thickness(µm)<br />
Group 1 0 ml/L 1.0398±0.0031 bcd 186.25±5.68 b 44.69±2.33 b<br />
Group 2 0.16 ml/L Acetamprid 1.0497±0.0012 cd 156.11±5.19 a 32.78±1.92 a<br />
Group 3 0.22 ml/L Acetamprid 1.0009±0.0095 a 226.94±11.67 c 50.00±3.65 b<br />
Group 4 3.125 ml/L Glyphosate 1.0079±0.0051 ab 203.33±10.89 bc 59.86±2.25 cd<br />
Group 5 4.166 ml/L Glyphosate 1.0561±0.0197 d 270.18±15.49 d 68.57±5.30 d<br />
Group 6 (0.16 ml/L +3.125ml/L)<br />
Acetamprid+Glyphosate<br />
Group 7 (0.22 ml/L+4.166 ml/L)<br />
Acetamprid+Glyphosate<br />
1.0192±0.0124 abc 201.71±9.01 bc 53.68±2.64 bc<br />
1.0349±0.0091 bcd 178.19±12.30 ab 51.81±3.65 bc<br />
Different letters indicate significant differences at p
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 299-306, 2011<br />
Fig( 1_:- Photomicrographs of sections of mice testis H&E 400X, A: normal testis (control), showing<br />
spermatogonia (thick arrow), spermatocytes (long arrows), spermatids (short arrow), flagella (triangle), and<br />
lumen (aster); B: Group 2, showing slight degeneration in the germ layers of seminiferous tubules (ST) with<br />
slight dilation of the lumen; C: Group 3, showing more obvious changes in lumen and germ layers of ST ; D:<br />
Group 4, showing degeneration and space formation in the germ layers of ST with dilation of the lumen and<br />
degeneration in the connective tissue between ST ; E: Group 5, showing sever degeneration and space formation<br />
in the germ layers of ST with clear dilation of the lumen of these tubules also less spermatocytes could be seen;<br />
F: Group 6, showing depletion in the germ layers of ST with dilation of the lumen and degeneration of the<br />
connective tissue between ST; G: Group 7, showing dramatic depletion in the germ layers of ST in which<br />
spermatogonia is hardly seen, vacuolization of these layers, and degeneration of connective tissue between ST<br />
302<br />
B C<br />
D<br />
F G<br />
A<br />
E
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 299-306, 2011<br />
DISCUSSION<br />
Separate tested doses of acetamiprid and<br />
glyphosate pesticides induced alterations in<br />
serum testosterone levels. The alterations that<br />
caused by acetamiprid were in expected manner,<br />
the adverse effects were increased by increasing<br />
the exposure doses. While for glyphosate the<br />
results were different by which the second dose<br />
of glyphosate caused significant increase in<br />
comparison with the first one. Histological<br />
examinations showed that the alterations in<br />
architecture of seminiferous tubules, their<br />
diameters and thicknesses, caused by both<br />
pesticides separately were increased by<br />
increasing the exposure doses.<br />
In regard to the combinations of the two<br />
pesticides, histological sections revealed severe<br />
changes in both combinations especially in the<br />
second one, while serum testosterone, diameters<br />
and thicknesses of seminiferous tubules were not<br />
in the same manner. Serum testosterone showed<br />
that the first combination did not cause<br />
significant changes in comparison with both<br />
pesticides; while the second combination caused<br />
significant change, in comparison with<br />
acetamiprid alone. For seminiferous tubules<br />
diameter, the first combination of pesticides<br />
caused significant changes in comparison with<br />
acetamiprid alone, while the second combination<br />
of pesticides caused significant changes in<br />
comparison with both pesticides. And for<br />
seminiferous tubules thickness, the first<br />
combination caused significant changes in<br />
comparison with acetamiprid alone, while the<br />
second combination caused significant changes<br />
in comparison with glyphoste alone.<br />
Previous researches showed that some<br />
insecticides, including the neonicotinoids, inhibit<br />
the non-specific esterase activity in leydig cells<br />
that, in turn, result in reduced testosterone<br />
production (Chapin et al., 1990; Bustos and<br />
González, 2003). Testosterone, through<br />
modulation of P-mod-S in the peritubular cells,<br />
could affect sertoli cell function (Kackar et al.,<br />
1999; Stanfield and Germann, 2008). Any<br />
malfunction in sertoli cells eventually may lead<br />
to degeneration in germinal cells of seminiferous<br />
tubules (Saiyed et al., 2003). Also it has been<br />
reported that structural changes in major<br />
endocrine glands, including testis,were<br />
associated with the exposure to glyphosate.<br />
Dallegrave et al. (2007) and Romano et al.<br />
(2009) reported some pathological changes in<br />
the testis of male rats including: elongated<br />
spermatid, vacuolization and degeneration of<br />
seminiferous tubules germ layers, and increase<br />
in seminiferous tubules diameter after exposure<br />
to glyophosate. Most of the above come in<br />
agreement with our results.<br />
On the other hand, it’s well documented that<br />
both acetamiprid and glyphoste inducing<br />
oxidative stress in vivo (in bacteria, fishes, rats,<br />
and human) (Peixoto, 2005; Yao et al., 2006;<br />
Mishchuk and Stoliar, 2008; El-Shenawy, 2009;<br />
Najafi et al., 2010). Oxidative stress leads to<br />
generation of reactive oxygen species (ROS) that<br />
affect both the antioxidant levels and the activity<br />
of the scavenging enzyme system. Excessive<br />
ROS can compromise cellular integrity through<br />
oxidative damage of lipids, proteins and<br />
deoxyribonucleic acid (DNA) (El-Shenawy,<br />
2009; Astiz et al., 2009) as a consequence<br />
cellular injury, necrosis, inflammation and<br />
degeneration of the tissues may take place<br />
(Schonherr, 2002; Kumar et al., 2007; Duzguner<br />
and Erdogan, 2010). According to this,<br />
acetamiprid and glyophosate may separately<br />
exert oxidative stress through production of<br />
ROS, and more clearly if these compounds are<br />
introduced in combination.<br />
It can be concluded from this study that<br />
acetamiprid and glyphoste are responsible for<br />
the alterations in serum testosterone, diameters<br />
and thicknesses of the seminiferous tubules, and<br />
combinations of both pesticides have synergistic<br />
effects on testis histology, in male albino mice.<br />
ACKNOWLEDGMENT<br />
I would like to thank all who helped me to<br />
complete this work, especially, Dr. Falah<br />
Mohammed Aziz, Hedy Ahmed Chawsheen,<br />
Zana Rafiq Majeed, and Ahmed Abdul-Qader.<br />
REFERENCES<br />
- Astiz, M., Alaniz, M., and Marra, CA. (2009). Effect of<br />
pesticides on cell survival in liver and brain rat<br />
tissues. Ecotoxicology and Environmental Safety,72<br />
, 2025–2032.<br />
- Alibhai, M., and Stallings, W. (2001). Closing down on<br />
glyphosate inhibition-with a new structure for drug<br />
discovery. Proceedings of the National Academy of<br />
Sciences, 98, 2944–6.<br />
- Anderson, B., de Peyster, A., Gad, S., Bert Hakkinen, P.,<br />
Kamrin, M., Locey, B., Mehendale, H., Pope, C.,<br />
Shugart, L., and Wexler, P. (2005). Encyclopedia of<br />
Toxicology. 2 nd Ed. Elsevier Inc. pp.18.<br />
- Benson, MA., Newey, SE., Martin-Rendon, E., Hawkes,<br />
R., and Blake, DJ. (2001). Dysbindin, a novel<br />
coiled-coil-containing protein that interacts with the<br />
303
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 299-306, 2011<br />
dystrobrevins in muscle and brain. Journal of<br />
Biological Chemistry, 276, 24232–24241.<br />
- Bustos, OE., and González, HP. (2003). Effect of a single<br />
dose of malathion on spermatogenesis in mice.<br />
Asian Journal of Andrology, 5, 105-107.<br />
- Chapin, RE., Phelps, J., Somkuti, S., Heindel, J., and<br />
Burka, L. (1990). The interaction of Sertoli and<br />
Leydig cells in the testicular toxicity of tri-o-cresyl<br />
phosphate. Toxicology and Applied Pharmacology,<br />
104, 483-495.<br />
- Chiyozo, T. (2008).The history of insecticides and the<br />
transition of their production. Japanese Journal of<br />
Toxicology , 21, 123–131.<br />
- Cooper, J., and Dobson, H. (2007). The benefits of<br />
pesticides to mankind and the environment. Crop<br />
Protection, 26, 1337-1348.<br />
- Dallegrave, E., Mantese, F., Oliveira, R., Andrade, A.,<br />
Dalsenter, P., and Langeloh, A. (2007). Pre- and<br />
Postnatal Toxicity of the Commercial Glyphosate<br />
Formulation in Wistar Rats. Archives of Toxicology<br />
, 81(9), 665-73.<br />
- Duzguner, V., and Erdogan, S. (2010). Acute oxidant and<br />
inflammatory effects of imidacloprid on the<br />
mammalian central nervous system and liver in rats.<br />
Pesticide Biochemistry and Physiology, 97, 13–18.<br />
- El-Shenawy, N. (2009). Oxidative stress responses of rats<br />
exposed to Roundup and its active ingredient<br />
glyphosate. Environmental Toxicology and<br />
Pharmacology, 28, 379-385.<br />
- Elzen, GW. (2001). Lethal and sublethal effects of<br />
insecticide residues on Orius insidiosus<br />
(Hemiptera:Anthocoridae) and Geocoris punctipes<br />
(Hemiptera: Lygaeidae). Journal of Economic<br />
Entomology, 94, 55–59.<br />
- Erisman, JW., Sutton, M., Galloway, J., Klimont, Z., and<br />
Winiwarter, W. (2008). How a century of ammonia<br />
synthesis changed the world. Nature Geosciences,<br />
1, 636 – 639.<br />
- Grafton-Cardwell, EE. and Gu, P. (2003). Conserving<br />
vedalia beetle, Rodolia cardinalis (Mulsant)<br />
(Coleoptera: Coccinellidae), in citrus: a continuing<br />
challenge as new insecticides gain registration.<br />
Journal of Economic Entomology, 96, 1388–1398.<br />
- Hetherington, P., Reynolds, T., Marshall, G., and<br />
Kirkwood, R. (1999). The absorption, translocation<br />
and distribution of the herbicide glyphosate in<br />
maize expressing the CP-4 transgene. Journal of<br />
Experimental Botany, 50(339), 1567–1576.<br />
- Hock, WK., Day, LG., and Morley, AW. (1991). Farm<br />
Chemicals Manual: A Guide to Safe Use and<br />
Handling. The Agriculture and Veterinary<br />
Chemistry Association, Aust. Ltd.<br />
- Kackar, R., Srivastava, M., and Raizada, R. (1999).<br />
Assessment of toxicological effects of mancozeb in<br />
male rats after chronic exposure. Indian Journal of<br />
Experimental Biology, 37, 553- 559.<br />
- Kovganko, NV., and Kashkan, ZhN. (2004). Advances in<br />
the synthesis of neonicotinoids. Russian Journal of<br />
Organic Chemistry, 40, 1709–1726.<br />
- Kumar, V., Abbas, AK., Fausto, N., and Mitchell, R.<br />
(2007). Robbins Basic Pathology. 8th Ed. Saunders<br />
Elsevier Inc. U.S.A.<br />
- Matsuda, K., Shimomura, M., Ihara, M., Akamatsu, M.,<br />
and Sattelle, DB. (2005). Neonicotinoids show<br />
selective and diverse actions on their nicotinic<br />
receptor targets: Electrophysiology, moledular<br />
304<br />
biology and receptor modeling studies. Bioscience,<br />
Biotechnology, and Biochemistry, 69, 1442–52.<br />
- Mishchuk, OV., and Stoliar, OB. (2008). The effect of<br />
pesticide acetamiprid on biochemical markers in<br />
tissues of fresh water bivalve mussels Anodonta<br />
cygnea L. (Unionidae). Ukr Biokhim Zh Journal,<br />
80(5), 117-24.<br />
- Najafi, G., Razi, M., Hoshyar, A., Shahmohamadloo, S.,<br />
and Feyzi, S. (2010). The Effect of Chronic<br />
Exposure with Imidacloprid Insecticide on Fertility<br />
in Mature Male Rats. International Journal of<br />
Fertility and Sterility, 4, 9-16.<br />
- Peixoto, F. (2005). Comparative effects of the Roundup<br />
and glyphosate on mitochondrial oxidative<br />
phosphorylation. Chemosphere, 61, 1115–1122.<br />
- Prophet, E., Mills, B., Arrington, J., and Sobin, L. (1992).<br />
Laboratory methods in Histotechnology.<br />
Washington DC: armed forces institute of<br />
pathology.<br />
- Roberts, C., Roberts, F., Lyons, R., Kirisits, M., Mui, E.,<br />
Finnerty, J., Johnson, J., Ferguson, D., Coggins, J.,<br />
Krell, T., Coombs, G., Milhous, W., Kyle, D.,<br />
Tzipori, S., Barnwell, J., Dame, J., Carlton, J., and<br />
McLeod, R. (2002). The shikimate pathway and its<br />
branches in apicomplexan parasites. Journal of<br />
Infectious Diseases, 185, S25–S36.<br />
- Romano, RM., Romano, MA., Bernardi, MM., Furtado,<br />
PV., and Oliveira, CA. (2009). Prepubertal<br />
exposure to commercial formulation of the<br />
herbicide glyphosate alters testosterone levels and<br />
testicular morphology. Reproductive Toxicology,<br />
84(4), 309-317.<br />
- Saiyed, H., Dewan, A., Bhatnagar, V., Shenoy, U.,<br />
Shenoy, R., and Rajmohan, H. (2003). Effect of<br />
endosulfan on male reproductive development.<br />
Environmental Health Perspectives, 111(16), 1958-<br />
1962.<br />
- Mateu-Sánchez, M., Moreno, M., Arrebola, F., and Vidal,<br />
J. (2003). Analysis of acetamiprid in vegetables<br />
using gas chromatography-tandem mass<br />
spectrometry. International journal of the Japan<br />
Society for Analytical Chemistry, 19, 701-704.<br />
- Schonherr, J. (2002). Uncoupling of oxidative<br />
phosphorylation and inhibition of hepatic mixed<br />
function oxidases. A mechanistic analysis of<br />
penetration of glyphosate salts across astomatous<br />
cuticular membranes. Pest Management Science,<br />
58(4), 343-351.<br />
- Solomon, K., Anadon, A., Carrasquilla, G., Cerdeira, A.,<br />
Marshall, J., and Sanin, L. (2007). Coca and poppy<br />
eradication in Colombia: environmental and human<br />
health assessment of aerially applied glyphosate.<br />
Reviews of Environmental Contamination &<br />
Toxicology, 190, 43–125.<br />
- Stanfield, C., and Germann, W. (2008). Principles of<br />
Human Physiology. 3 rd Ed. Pearson Education Inc.<br />
U.S.A. pp. 638.<br />
- Steinrucken, H., and Amrhein, N. (1980). The herbicide<br />
glyphosate is a potent inhibitor of 5-enolpyruvylshikimic<br />
acid-3-phosphate synthase. Biochemical<br />
and Biophysical Research Communications, 94,<br />
1207-1212. Cited from: Anadona, A., Martinez-<br />
Larra nagaa, M., Martineza, M., Castellanoa, V.,<br />
Martineza, M., Martinb, M., Nozalb, M., and<br />
Bernalb, J. (2009). Toxicokinetics of glyphosate<br />
and its metabolite aminomethyl phosphonic acid in<br />
rats. Toxicology Letters, 190, 91-95.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 299-306, 2011<br />
- Tomizawa, M., and Casida, JE. (2003). Selective toxicity<br />
of neonicotinoids attributable to specificity of insect<br />
and mammalian nicotinic receptors. Annual Review<br />
of Entomology, 48, 339-364.<br />
- Tomizawa, M., and Casida, JE. (2005). Neonicotinoid<br />
insecticide toxicology: mechanism of selective<br />
action. Annual Review of Pharmacology and<br />
Toxicology, 45, 247-268.<br />
- Tomizawa, M., and Yamamoto, I. (1993). Structureactivity<br />
relationships of nicotinoids and<br />
imidacloprid analogs. Journal of Pesticide Science,<br />
18, 91-8.<br />
- U.S. National Library of Medicine. (1995). Hazardous<br />
Substances Databank. Bethesda, MD. 10-9.<br />
Retrieved from: Extension Toxicology Network,<br />
Pesticide Information Profiles, Glyphosate, 1996.<br />
Retrieved March 11, 2011, from:<br />
http://extoxnet.orst.edu/pips/reflist10.htm.<br />
- USDA (United States Department of Agriculture) (2005).<br />
Agricultural Chemical Usage Field and Vegetable<br />
Crops Chemical Distribution Rate. National<br />
Agricultural Statistics Service, Ag Ch 1 (05).<br />
Retrieved June 24, 2011, from:<br />
http://usda.mannlib.cornell.edu<br />
- Williams, GM., Kroes, R., and Munro, IC. (2000). Safety<br />
evaluation and risk assessment of the herbicide<br />
Roundup and its active ingredient, glyphosate, for<br />
humans. Regulatory Toxicology and Pharmacology,<br />
31, 117-65.<br />
- Yamamoto, I., and Casida, JE. (1999). Nicotinoid<br />
Insecticides and the Nicotinic Acetylcholine<br />
Receptor. Springer-Verlag, Tokyo. pp.150.<br />
- Yao, XH., Min, H., and Lv, ZM. (2006). Response of<br />
Superoxide Dismutase, Catalase, and ATPase<br />
Activity in Bacteria Exposed to Acetamiprid.<br />
Biomedical and Environmental Sciences, 19, 309-<br />
314.<br />
- Yu, S. (2008). The Toxicology and Biochemistry of<br />
Insecticides. CRC Press, Taylor & Francis Group,<br />
Boca Raton. pp. 115-142.<br />
ىجس يرَين يكشم ةل ىؤيرتسؤتسَيت ىتسائ و ىوط رةسةل تَيسَوفيلاط و درجيماتيسةئ يرةطيراك<br />
و درجيماتيسةئ ،ىاكةرةكِرق<br />
ةدام ةل وود ىواريةذ<br />
ىاناوت ىندناطنةسلةي ىتسةبةم ةب ةواردمانجةئةيةوةهيَلَوكَيل<br />
ؤت ىروتسةئ و ةيرت ،ىوط<br />
ىناكةييةناش<br />
ةيراكنارؤط ىةوةهيلؤكَيل<br />
ىاطَير ةل ةوةكَيث و اًنةت ةب<br />
اردهَيي راكةب كشم خهَيث و ىيس<br />
ةيةوةندركيقات مةل . ىجس يرَين يكشم ةل مةيرس ىنؤيرتسؤتسَيت<br />
ةتخوث<br />
مةئ<br />
،تَيسَوفيلاط<br />
ىتسائ و ،ىاكةكضيرؤب<br />
َىس و مةوود ىثورط . ةواردَيث ى ةعوولةب يوائ ةلؤترنؤك ةك مةكةي يثورط . ثورط توةح رةس ةنووبارك شةباد ةك<br />
3.125 ml/L مةحهَيث<br />
و مةراوض ىثورط<br />
3.125<br />
4.166 mg/L<br />
. كةي ياودةب ،ووب<br />
اردَيث<br />
ىاي درجيماتيسةئ ةل<br />
0.22 ml/L<br />
و<br />
0.16 ml/L<br />
و درجيماتيسةئ 0.16 ml/L ةل كةيةَلةكَيت مةشةش ىثورط . كةي ىاودةب ،َييوبارد<br />
ىايتَيسَوفيلاط 4.166 mg/Lو<br />
و<br />
. ةتفةي راوض ىةوامَوب<br />
درجيماتيسةئ<br />
0.22 ml/L<br />
ةل كةيةَلةكَيت مةتوةح ىثورطو<br />
ىاكةكشم ىةوةندراوخ ىوائ وانةنارخةد<br />
ىؤي ؤب درجيماتيسةئ . ىؤيرتسؤتسَيت ىتسائ ةل ىراكناِرؤط<br />
مَلاةب<br />
. ةوةكَيث<br />
ىاكةرةكِرق ةدام<br />
ىَيوبارد<br />
ىايتَيسَوفيلاط<br />
. ةوةكَيث<br />
مةي<br />
ml/L<br />
, َىوبارد<br />
ىايتَيسَوفيلاط<br />
ىؤي ةنوب ،اًنةت ةب ، ةكةرةكِرق ةدام وود رةي ادمانجةئةل<br />
. ةكرةرةكِرق ةدام ىِرب<br />
ىنووبدايز ةب ىووبةد رتايز ىاكةيراكنِرؤط ةك كَيزاوَيش ةب ىراكناِرؤط ىنادوِر<br />
ىندركدايز ىؤي ةووب ةرةكِرق ةدام مةئ ىمةوود ىتيةث ةك ادمانجةئ ىؤخ ىرةطيراك زاويج ىكَيزاوَيش ةب<br />
ىاكةييةناش<br />
ةوةهيلؤكَيل<br />
،ىاكةلةكَيت<br />
ىمانجةئ<br />
ىةرابرةد<br />
. ادمةكةي ىتيةث لةطةل ىدركدروارةب ةب<br />
ىاكةرةكِرق ةدام ىةلةكَيت ىندركَيلراك<br />
ىةرابرةد و ادمةتوةح<br />
ىثورط ةل ىتةبياتةب تسخرةد ىايدنوت<br />
ىؤيرتسؤتسَيت<br />
تَيسَوفيلاط<br />
ىتسائ<br />
رؤز يراكنارؤط<br />
ىدركدروارةب ةب تسةضرةب ىراكناِرؤط ىندركتسورد ىؤي ةووب ةن مةكةي ىةَلةكَيت ،ىؤيرتسؤتسَيت ىتسائ<br />
ىراكناِرؤط ىندركتسورد ىؤي ةووب مةوود ىةَلةكَيت ادتاك ىامةي ةل<br />
اًنةتةب<br />
رةسةل<br />
ىاكةرةكِرقةدام<br />
وودرةي لةطةل<br />
و درجيماتيسةئ ةك َىهَيةطةد ةوةئ ةكةوةهيَلَوكَيل ىمانجةئرةد . اًنةت ةب درجيماتيسةئ لةط ةل ىندركدروارةب ةب تسةضرةب<br />
ةيرت ،ىةناش<br />
ىةتاًكَيث و ادمةيرس<br />
ةل<br />
ىؤيرتسؤتسَيت ىتسائ ةل ةوادنايوِر ةك ىةنايراكناِرؤط وةل وسرثرةب تَيسَوفيلاط<br />
ىنووبدايز ىراكؤي ةنووب ةكةرةكِرق ةدام وودرةي ىةَلةكَيت و ىجس يرَين يكشم ىنوط ،ىاكةكضيرؤب ؤت ىروتسةئ و<br />
.<br />
ةنايراكناِرؤط مةئ<br />
305
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 299-306, 2011<br />
306<br />
ضيبلا نارئف روكذ يف لصملا نوريتسوتسيت ىوتسم و ىصخلا ىلع تيسوفيلاغ دربماتيسا نيديبملاريثأت<br />
للاخ نم جيزمك و ةدح ىلع لك ،تيسوفيلاغ<br />
و دربماتيسا ،تاديبملا نم نينثا ةيمس مييقتل ثحبلا اذه ءارجا<br />
مت<br />
ةصلاخلا<br />
تيرجا . ضيبلا نارئف روكذ<br />
يف لصملا نوريتسوتسيت ىوتسم و ،ةيونملا تابيبنلا كمس و رطق ،ىصخل<br />
ةيجيسن ةسارد<br />
ةعومجم يه ىلولاا ةعومجملا<br />
ىلع ،دربماتيسا<br />
ةعومجملا اما<br />
نم<br />
0.22 ml/L<br />
. تاعومجم عبس<br />
ىلع ةعزوم ضيبلا<br />
و<br />
0.16 ml/L<br />
. يلاوتلا ىلع،تيسوفيلاغ<br />
نم 4.166 mg/Lو<br />
تيطعا ةعباسلا ةعومجملاو . تيسوفيلاغ<br />
روكذلا<br />
نارئفلا نم<br />
نوثلاث<br />
و ةسمخ ىلع ةبرجتلا<br />
نم عرج اتيطعا ةثلاثلاو ةيناثلا ةعومجملا . ةيفنحلا ءام تيطعا ةرطيسلا<br />
3.125 ml/L<br />
ةدمل نارئفلا برشلا ءام ىلا تاديبملا ةفاضا مت . تيسوفيلاغ<br />
. لصملا<br />
نوريتسوتسيت ىوتسم يف<br />
تيسوفيلاغ اهتببس يتلا تاريغتلا<br />
،نيديبملا<br />
يجيزمب قلعتي اميف و . ىلولاا<br />
تاريغت ثودح<br />
نا نيح يف<br />
و<br />
ىلا تدا<br />
3.125 ml/L<br />
دربماتيسا 0.16 ml/L<br />
نم<br />
،ةدح<br />
ىلع<br />
4.166 mg/L<br />
لك<br />
. تاعرجلا زيكرت<br />
ا ةدايزب تدازا<br />
نوريتسوتسيت ىوتسم جئاتن تنيب نيح يف ،ةعباسلا<br />
ةعومجملا<br />
يف<br />
تاريغت<br />
تثدحا<br />
يناثلا جيزملا<br />
اتببس ،تيسوفيلاغ و دربماتيسا ،نيديبملا نأب<br />
نارئفلا روكذ ىصخل<br />
اتيطعا ةسماخلاو ةعبارلا ةعومجملا<br />
. يلاوتلا<br />
نم لك نم جيزم تيطعا دقف ةسداسلا<br />
و دربماتيسا<br />
،نيديبملا<br />
نأب<br />
نم 0.22 ml/L<br />
جئاتنلا تنيب<br />
دربماتيسا اهتببس ىتلا<br />
نم جيزم<br />
. عيباسا ةعبرا<br />
تاريغتلا نا ثيح<br />
ةعرجلاب ةناقم ًايونعم ًاعافترا تببس ةيناثلا ةعرجلا نا ثيح ةفلتخم ةروصب تناك<br />
ةصاخ ةداح تاريغت ثودح ةيجيسنلا ةساردلا تنيب<br />
امأ ةدح ىلع لك نيديبملاب ةنراقم ةيونعم تاريغت ثدحي مل لولاا جيزملا نأب<br />
ثحبلا اذاه نم جتنتسن نا نكمي . طقف<br />
،ةيونملا تابيبنلا كمس و رطق ،يجيسنلا<br />
بيكرتلا<br />
و<br />
لصملا<br />
دربماتيسا ديبملاب ةنراقم ةيونعم<br />
لصملا نوريتسوتسيت ىوتسم<br />
.<br />
تاريغتلا هذه ةدح نم تدادزا<br />
يف<br />
تاريغت<br />
نيديبملا جزم نأ و ضيبلا
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
PMINIMAL BLOCKING SETS IN PG(2,7) AND LOWER BOUNDS<br />
OF THE SIXTH AND SEVENTH BLOCKING SETS.<br />
ABSTRACT<br />
CHINAR A. KAREEM<br />
Dept. of Math., Faculty of Education, University of Zakho, Kurdistan Region-Iraq<br />
(Received: April 30, 2011; Accepted for publication: August 14, 2011)<br />
In this paper the minimal blocking sets of size 13 in PG(2,7) is classified we find an example of minimal blocking<br />
sets of size 13 with at most 5-secant and the existence of the minimal blocking sets of Rédei-type of size 13 is<br />
proved some important properties of the blocking set of size 13 in PG(2,7) is given. Also we find the lower bounds of<br />
sixth and seventh blocking sets in PG(2,16).<br />
KEYWORDS: blocking set, minimal blocking set, n-arc, Projective plane, affine plane.<br />
B<br />
INTRODUCTION<br />
locking sets were first studied in details<br />
in 1969 by Di Paola [10], who<br />
determined the minimum size of a non trivial<br />
blocking set in the projective planes of orders 4,<br />
5, 7, 8 and 9. They were originally defined as a<br />
game theory problem in [16]. A survey of<br />
blocking sets in projective planes can be found<br />
in [4]. Double blocking sets were first studied<br />
by Bruen in 1986 [6], properties of triple<br />
blocking sets of type (3, n) derived by de<br />
Resmini in 1987 [8]. Hill in [12] provided<br />
examples of triple blocking sets of size 4q -1 for<br />
q even and 4q for q odd.<br />
In a finite projective plane of order q, where<br />
q is the number of the elements of the Galois<br />
field a t- blocking set is a set of points such that<br />
each line contains at least t point of B and some<br />
line contains exactly t points of B [5]. A t –<br />
blocking set B is minimal or irreducible when no<br />
proper subset of it is a t – blocking set. In<br />
particular when t = 1 then B is called a blocking<br />
set. The name blocking set was originated in<br />
Game theory, Richardson[17], was the first one<br />
to look at larger planes, he showed that the<br />
minimal size of a blocking set in PG( 2,3) is 6,<br />
and noted that Baer sub-planes are examples of<br />
blocking set of size q � q �1in<br />
projective<br />
planes of square order. After that things were<br />
quiet for 13 years until Di Paola [10] introduced<br />
the idea of a projective triangle , which give an<br />
example of a blocking set of size 3(q+1)/2 in<br />
Desargusian planes of odd order[4]. That<br />
projective planes exit in these planes was shown<br />
by Bruen who also obtained the general lower<br />
bound q � q �1<br />
for the size of a blocking set<br />
in projective plane of odd order q. Bruen [7]<br />
gave the upper bound q q �1<br />
for a minimal<br />
blocking set I any projective plane of order q,<br />
and make the connection with Rédei's work on<br />
lacunary polynomials and small blocking sets in<br />
Desargusian planes.<br />
PRELIMINARIES<br />
This Section briefly summarize some of the<br />
basic notions concerning projective spaces, tblocking<br />
sets. We begin by the following<br />
definitions: A finite filed is a field with a finite<br />
number of elements. A field E is an extension<br />
field of a field F if there is an injective ring<br />
homomorphism F into E [11].A non constant<br />
polynomial f(x) is an irreducible polynomial in<br />
F[x] if f(x) cannot be expressed in F[x] as a<br />
product g(x) h(x) of non constants each of<br />
degree less than the degree of f(x) .Let GF(p) =<br />
Z / pZ Zp, p prime number, and let f(x) be an<br />
irreducible polynomial of degree h over<br />
GF(p),then<br />
h<br />
GF(p ) �GF(p)[x]/ (F(x)) �<br />
h�1 � i<br />
�<br />
��aiλ :a i�GF(p);F(λ)<br />
�0�<br />
i�0 � �<br />
is called a Galois Field of order q ; q=p h [ ].<br />
The elements of GF(q) satisfy the equation x q =<br />
x, and there exists λ in<br />
GF(q)=GF(q)={0,1,�,� 2 ,… ,� q-2 }.<br />
A projective plane PG(2, q) is an incident<br />
structure of points and lines which consists of<br />
2<br />
2<br />
q � q �1points<br />
and q � q �1<br />
lines and every<br />
line contains q+1 points and every point pass<br />
q+1 lines. A (k, n) –arc K in PG(2,q) is a set of k<br />
307
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
points such that there is some n but no n+1 of<br />
them are collinear . A t – blocking set B in a<br />
projective plane PG(2, q) is a set of points such<br />
that each line in PG(2, q) contains at least t<br />
points of B and some line contains exactly t<br />
points of B.<br />
A t-blocking set is trivial when it contains<br />
only a line of PG(2,q).In specially If t=1, then<br />
B is called blocking set. If t=2, then B is called<br />
Double Blocking set. A t – blocking set B is<br />
minimal or irreducible when no proper sub set of<br />
it is a t – blocking set. A t-blocking set B of size<br />
b is small if b < t q + (q+3)/2.<br />
In this paper we work on the projective plane<br />
PG(2, 7) where the existence of the minimal<br />
blocking sets of size 13 and minimal blocking<br />
sets of Rédei-type of size 13 are proved and we<br />
give some important properties on minimal<br />
blocking sets and we find the lower bounds of<br />
sixth and seventh blocking sets in PG(2,16), and<br />
this is the difference between this work and the<br />
work of Di Paola , who determined the minimum<br />
size of a non trivial blocking set in the projective<br />
planes of orders 4, 5, 7, 8 and 9.<br />
Theorem 2.1[3]. Let B be t- blocking set in a<br />
projective plane PG(2, p) , p > 3 where p is<br />
prime , if t � (p+1)/2, then B � ( t �1)<br />
p.<br />
Theorem 2.2[4]. Let B be t- blocking set of size<br />
b in projective plane PG(2,q), then :<br />
q�1<br />
1. 2<br />
�r �q<br />
�q<br />
�1<br />
308<br />
i<br />
i�0<br />
q 1<br />
2. � �<br />
i�1<br />
q 1<br />
i�2<br />
q 1<br />
i r �b(<br />
q �1)<br />
i<br />
�<br />
3. �i ( i �1)<br />
r �b<br />
( b �1)<br />
�<br />
4.<br />
� � v<br />
i�1<br />
q�1<br />
5. �<br />
i�2<br />
q<br />
6. ��<br />
7. ��<br />
i q<br />
i<br />
�1<br />
( i �1)<br />
vi<br />
�b<br />
�1<br />
u �q<br />
�1<br />
i<br />
i 0<br />
q<br />
iui<br />
i 1<br />
�b<br />
.<br />
where r i : the total number of i-secant of B<br />
v i : the total number of i-secant through a point<br />
p of B.<br />
u i : the total number of i-secant through a point<br />
q of PG(2, q)\B.<br />
Theorem 2.3[14]. Let B be a t-blocking set B in<br />
PG(2,q) , where t <br />
3, q = p 2d ,then B � t(<br />
q � q �1)<br />
.<br />
Theorem2.4[5]. Let B be a t-blocking set B in<br />
�1/<br />
3 1/<br />
6 1/<br />
4<br />
PG(2,q),where t � min( 2 q , q / 2)<br />
, if q<br />
= p 2d ,p = 2,3, d � 2,then � t(<br />
q � q �1)<br />
B .<br />
Theorem 2.5[9]. Let B be a t-blocking set B in<br />
PG(2,q), of size t(q+1)+c , let c2 = c3 = 2 -1/3 and<br />
cp = 1,if q = p 2 , where p is prime and p > 3,and<br />
t
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
then<br />
i<br />
0<br />
1<br />
2<br />
3<br />
4<br />
5<br />
6<br />
7<br />
8<br />
9<br />
10<br />
11<br />
12<br />
13<br />
14<br />
pi<br />
(1, 0, 0)<br />
(0, 1, 0)<br />
(0, 0, 1)<br />
(1, -3, 1)<br />
(1, 1, 3)<br />
(1, 3, 0)<br />
(0, 1, 3)<br />
(1, -3, 0)<br />
(0, 1, -3)<br />
(1, -3, 2)<br />
(1, -1, 2)<br />
(1, -1, -1)<br />
(1, 0, -2)<br />
(1, 2, 1)<br />
(1, 1, 2)<br />
Table (1): Points of the projective plane PG(2,7)<br />
i p i p<br />
i<br />
15<br />
16<br />
17<br />
18<br />
19<br />
20<br />
21<br />
22<br />
23<br />
24<br />
25<br />
26<br />
27<br />
28<br />
29<br />
i<br />
(1, -1, 3)<br />
(1, 3, 2)<br />
(1, -1, 0)<br />
(0, 1, -1)<br />
(1, -3, -3)<br />
(1, -2, -2)<br />
(1, 2, -2)<br />
(1, 2, -3)<br />
(1, -2, 3)<br />
(1, 3, 3)<br />
(1, 3, -2)<br />
(1, 2, 2)<br />
(1, -1, -2)<br />
(1, 2, 3)<br />
(1, 3, -1)<br />
Let L 1 be the line which contains the points ,<br />
i�1<br />
L i � L T [13], i=1, . . ., 57, are the lines<br />
1.<br />
Table (2): Lines of PG(2,7)<br />
Lines Points<br />
L1 0 1 5 7 17 35 38 49<br />
L2 1 2 6 8 18 36 39 50<br />
L3 2 3 7 9 19 37 40 51<br />
L4 3 4 8 10 20 38 41 52<br />
L5 4 5 9 11 21 39 42 53<br />
L6 5 6 10 12 22 40 43 54<br />
L7 6 7 11 13 23 41 44 55<br />
L8 7 8 12 14 24 42 45 56<br />
L9 8 9 13 15 25 43 46 0<br />
L10 9 10 14 16 26 44 47 1<br />
L11 10 11 15 17 27 45 48 2<br />
L12 11 12 16 18 28 46 49 3<br />
L13 12 13 17 19 29 47 50 4<br />
L14 13 14 18 20 30 48 51 5<br />
L15 14 15 19 21 31 49 52 6<br />
L16 15 16 20 22 32 50 53 7<br />
L17 16 17 21 23 33 51 54 8<br />
L18 17 18 22 24 34 52 55 9<br />
L19 18 19 23 25 35 53 56 10<br />
L20 19 20 24 26 36 54 0 11<br />
L21 20 21 25 27 37 55 1 12<br />
L22 21 22 26 28 38 56 2 13<br />
L23 22 23 27 29 39 0 3 14<br />
L24 23 24 28 30 40 1 4 15<br />
L25 24 25 29 31 41 2 5 16<br />
L26 25 26 30 32 42 3 6 17<br />
L27 26 27 31 33 43 4 7 18<br />
L28 27 28 32 34 44 5 8 19<br />
30<br />
31<br />
32<br />
33<br />
34<br />
35<br />
36<br />
37<br />
38<br />
39<br />
40<br />
41<br />
42<br />
43<br />
44<br />
i<br />
(1, 0, 3)<br />
(1, 3, 1)<br />
(1, 1, -1)<br />
(1, 0, -3)<br />
(1, -2, 1)<br />
(1, 1, 0)<br />
(0, 1, 1)<br />
(1, -3, -2)<br />
(1, 2, 0)<br />
(0, 1, 2)<br />
(1, -3, 3)<br />
(1, 3, -3)<br />
(1, -2, -3)<br />
(1, -2, -1)<br />
(1, 0, 2)<br />
45<br />
46<br />
47<br />
48<br />
49<br />
50<br />
51<br />
52<br />
53<br />
54<br />
55<br />
56<br />
pi<br />
(1, -1, 1)<br />
(1, 1, -3)<br />
(1, -2, 2)<br />
(1, -1, -3)<br />
(1, -2, 0)<br />
(0, 1, -2)<br />
(1, -3, -1)<br />
(1, 0, -1)<br />
(1, 0, 1)<br />
(1, 1, 1)<br />
(1, 1, -2)<br />
(1, 2, -1)<br />
of PG(2,7) , then the 57 lines Li are given by the<br />
following two table:<br />
L29 28 29 33 35 45 6 9 20<br />
L30 29 30 34 36 46 7 10 21<br />
L31 30 31 35 37 47 8 11 22<br />
L32 31 32 36 38 48 9 12 23<br />
L33 32 33 37 39 49 10 13 24<br />
Table (3): Lines of PG(2,7)<br />
Lines Points<br />
L34 33 34 38 40 50 11 14 25<br />
L35 34 35 39 41 51 12 15 26<br />
L36 35 36 40 42 52 13 16 27<br />
L37 36 37 41 43 53 14 17 28<br />
L38 37 38 42 44 54 15 18 29<br />
L39 38 39 43 45 55 16 19 30<br />
L40 39 40 44 46 56 17 20 31<br />
L41 40 41 45 47 0 18 21 32<br />
L42 41 42 46 48 1 19 22 33<br />
L43 42 43 47 49 2 20 23 34<br />
L44 43 44 48 50 3 21 24 35<br />
L45 44 45 49 51 4 22 25 36<br />
L46 45 46 50 52 5 23 26 37<br />
L47 46 47 51 53 6 24 27 38<br />
L48 47 48 52 54 7 25 28 39<br />
L49 48 49 53 55 8 26 29 40<br />
L50 49 50 54 56 9 27 30 41<br />
L51 50 51 55 0 10 28 31 42<br />
L52 51 52 56 1 11 29 32 43<br />
L53 52 53 0 2 12 30 33 44<br />
L54 53 54 1 3 13 31 34 45<br />
L55 54 55 2 4 14 32 35 46<br />
L56 55 56 3 5 15 33 36 47<br />
L57 56 0 4 6 16 34 37 48<br />
309
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
310<br />
MINIMAL BLOCKING SETS<br />
OF SIZE 13 IN PG(2,7).<br />
Let B be a minimal blocking set of size 13 in<br />
PG(2,7).<br />
Theorem 4.1[13]. Let V be a vector space of<br />
dimension n over a finite field GF(q), then any<br />
sub set of V intersect every prime of V contain<br />
at least n(q – 1)+1of points.<br />
Lemma 4.2.[18]. In PG(2,q), let B be a minimal<br />
blocking set of size q +k, and suppose there is a<br />
line L intersecting B in exactly k-1 points. Then<br />
there is a points O � B such that every line<br />
joining O to a point of L\B contains two points<br />
of B. Hence k � ( q � 3)<br />
\ 2.<br />
Lemma 4.3. Any point of B lies on at least two<br />
tangents<br />
Proof . Let p �B<br />
and let L be a tangent line to<br />
B at p. Consider PG(2,7)\L and call this<br />
AG(2,7). Then a set B\L of size 12 remains .A<br />
minimal blocking set in AG(2,7) contains at<br />
least 13 points . This means that we have to add<br />
at least one point to B\L to get a blocking set in<br />
AG(2,7). The external lines to B\L in AG(2,7)<br />
are the tangents to B at p , different from L.<br />
Hence p lies on at least two tangents to B.<br />
Lemma 4.4. In PG(2,q), let B be a minimal<br />
blocking set of size q +k, and suppose there is a<br />
line L intersecting B in exactly k-1 points. Then<br />
there is a points O � B such that every line<br />
joining O to a point of L\B contains two points<br />
of B. Hence k � ( q � 3)<br />
\ 2.<br />
Theorem 4.5. There is minimal blocking set of<br />
size 13 in PG(2,7), having 5-secant, but no 6secant.<br />
Proof. Let (x, y, z) denote the coordinates of a<br />
projective point . Let L be a 5-secant to B, let L<br />
be the line at infinity of the corresponding affine<br />
plane, and let { p 1 , p2<br />
, p3<br />
} = L\B. By lemma<br />
4.4, there is an affine point O � B for which the<br />
lines Op i , i=1,2,3 are bisecants. These lines<br />
contain six affine points of B. Let U1 and U2<br />
be<br />
the remaining affine points. Since the points<br />
p only lie on one 2-secant and six tangents , the<br />
i<br />
lines U1 pi<br />
are tangents for i=1,2,3. Furthermore<br />
the line OU1is a line passing through a point of<br />
B � L .We select the reference system in the<br />
following way Let<br />
p1 � ( 0,<br />
1,<br />
0)<br />
, p2<br />
� ( 1,<br />
0,<br />
0)<br />
, p3<br />
� (1,3,0) . Since the<br />
subgroup of PGL(2,7) stabilizing<br />
{ p1, p2<br />
, p3}<br />
acts transitively on the 5 other<br />
points of L , let<br />
OU passthrough<br />
(1,1,0) . Let O � (0,0,1), we can assume<br />
1<br />
that 1<br />
U =(1,1,1) .Consider now the affine plane<br />
PG(2,7)\L. Let B� � B \ ( L �{<br />
U<br />
1<br />
, U<br />
2<br />
}. Then two<br />
points of B� lie on X=0, two on Y=0, and two on<br />
Y=3X, since these are the lines OP i , i=1,2,3.<br />
Moreover on every horizontal line Y = k ,<br />
vertical line X=k, and on every line Y=3X +k<br />
with k≠0, there is one point of B. In particular on<br />
the lines X=1, Y=1, Y=3X-2 , Y=X which all<br />
pass through U 1 , there are no points of B� , this<br />
cancels already a lot of points of AG(2,7).<br />
(0,0) (0,1) (0,-1) (0,2) (0,-2) (0,3) (0,-3)<br />
(1,0) (1,1) (1,-1) (1,2) (1,-2) (1,3) (1,-3)<br />
(-1,0) (-1,1) (-1,-1) (-1,2) (-1,-2) (-1,3) (-1,-3)<br />
(2,0) (2,1) (2,-1) (2,2) (2,-2) (2,3) (2,-3)<br />
(-2,0) (-2,1) (-2,-1) (-2,2) (-2,-2) (-2,3) (-2,-3)<br />
(3,0) (3,1) (3,-1) (3,2) (3,-2) (3,3) (3,-3)<br />
(-3,0) (-3,1) (-3,-1) (-3,2) (-3,-2) (-3,3) (-3,-3)<br />
On the line Y=3X,we will select two points<br />
from the set<br />
L 1 � {( �1,<br />
�3),<br />
( 2,<br />
�1),<br />
( 3,<br />
2),<br />
( �3,<br />
�2)}<br />
, and on<br />
the line X=0 , we need to select two points from<br />
the set L 2 � {( 0,<br />
�1),<br />
( 0,<br />
2),<br />
( 0,<br />
3),<br />
( 0,<br />
�3)}.<br />
Also<br />
we need to select two points on the line Y=0 to<br />
be in B� . This gives the following six<br />
possibilities. We choose (2,0) and (-3,0) from<br />
line Y=0. This choice eliminates (2,-1) and (-3,-<br />
2) of L 1.<br />
Since we cannot have two points of<br />
B� on the same horizontal line different from the<br />
first line .On Y=3X+1 and Y=3X+2 , the two<br />
lines through p3 and (2,0),(-3,0) we cannot<br />
select any other point of B� , since these lines<br />
must be tangents to B , this eliminates (0,2) of<br />
L 2 . Hence this choice will gives us (2,0), (-3,0)<br />
from Y=0 , and the point (-1,-3), (3,2) from<br />
L 1 and the points (0,-1), (0,3),(0,-3) from L 2 . If<br />
we choice two points from Y=0, two points from<br />
L 1,<br />
and two points from L 2 , we will get to the<br />
three possibilities to six points of B� . So we will<br />
choice (2,0), (-3,0) from Y=0, and (-1,-3), (3,2)<br />
from 1 L , and (0,-1), (0,3) from L 2 to be six<br />
affine points of B� . By identify the projective<br />
points (x ,y) with (x,y,1) we get the following<br />
points {(1,0,-3), (1,0,2), (1,3,-1), (1,3,-2), (0,1,-
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
1),(0,1,2)}, take these points with the points<br />
from B � L :{(1,1,0), (1,-1,0), (1,2,0), (1,-<br />
2,0),(1,-3,0)}, and with the points U 1 =(1,1,1)<br />
and U 2 =(1,1,3) we get the minimal blocking<br />
sets of size 13 with 5-secant but no 6-secant.<br />
Definition 4.6 [16 ]. An elation of PG(2,7) is an<br />
automorphism that fixes all points on a line l,<br />
and that fixes all lines through a certain point p<br />
of l is called the axis of the elation , and the<br />
point p is the center of the elation .<br />
The order of an elation alpha of PG(2,q), q=p h , p<br />
prime , is equal to the prime p.<br />
Definition 4.7. [ 17]. A minimal t- blocking set<br />
B is of Rédei-type in PG(2, q) if there is a line<br />
contains k points of B such that B \ L = q.<br />
Theorem 4.8. There is minimal blocking 13-set<br />
of Rédei-type in PG(2,7).<br />
Proof. Let (x, y ,z) denote the coordinates of a<br />
projective point.Let L:Z=0, be the Rédei-line<br />
and let pi � ( xi<br />
, yi<br />
, 1)<br />
� ( xi<br />
, yi<br />
) , i=1,…,7, be<br />
the affine points of the blocking set B� . Let A=<br />
(0,1,0), B=(1,0,0), since all affine lines X=a,<br />
through A and Y=b through B contain exactly<br />
one affine point of the blocking set, we have<br />
x i � x j and yi<br />
� y j if i � j.<br />
These two conditions will be used in the search<br />
for minimal blocking set of Rédei -type, let p 1 =<br />
(0,0), using perceptivities with axis L and center<br />
p 1 , we can set p 2 =(1,1). Again using<br />
perceptivities with axis L and center p 2 ,we can<br />
set p 3 =(2,2). The criteria for selecting a next<br />
point<br />
pi<br />
� ( xi<br />
, yi<br />
) , x i �{<br />
x1,...,<br />
xi�1},<br />
yi<br />
�{<br />
y1<br />
,..., y j�1}<br />
. In the discussion of the different cases , when<br />
selecting p i . We will always talk about the used<br />
xi and the used y . For this choice of<br />
i<br />
p p , p , the used x are : 0,<br />
1,<br />
2 the used<br />
1,<br />
2 3<br />
i<br />
y are 0,1,2, the above mentioned criterion gives<br />
i<br />
four possibilities for p 4 namely p 4 �{(3,-<br />
1),(3,-2),(3,3),(3,-3)}. We choice p 4 =(3,-2).<br />
Then the used x i are 0,1,2,3 and the used yi are<br />
0,1,2,-2. For 5 p =(-3, y 5 ).By the above two<br />
conditions, we have y �{<br />
�1,<br />
3,<br />
�3}<br />
we choice<br />
p 5 =(-3,3). Then the used i<br />
5<br />
x are 0,1,2,3,-3, and<br />
the used y i are 0,1,2,-2. For 6 p =(-2, 6<br />
y ) and by<br />
the two conditions we have y �{<br />
�1,<br />
�3},<br />
we<br />
choice 6 p =(-2,-1). Then the used x i are<br />
0,1,2,3,-3,-2, the used yi are 0,1,2,-2,3,-1, for 7 p<br />
=(-1, y 7 ), by the two above condition we have<br />
p 7 =(-1,-3). Hence we get to the seven affine<br />
points :(0,0) , (1,1) , (2,2) , (3,-2) , (-3,3) , (-2,-1)<br />
, (-1,-3). By identify the projective points (x,y)<br />
with (x, y, 1) we get the following points {(0, 0,<br />
1), (1, 1, 1), (1, 1, -3), (1, -3, -2), (1, -1, 2), (1, -<br />
3, 3), (1, 3, -1)}. These points with the six points<br />
of B � L ={(1,1,0), (1,-1,0), (1,2,0),(1,-<br />
2,0),(1,3,0), (1,-3,0)} form the minimal blocking<br />
set of Rédei-type.<br />
SOME PROPERTIES OF MINIMAL BLOCKING<br />
SETS OF SIZE 13 IN PG(2,7).<br />
Lemma 5.1. There are no minimal blocking sets<br />
of size 13 with 1-, 2-, 4-secants but without<br />
3-secant .<br />
Proof. Suppose there are only 1-,2-,and 4secants<br />
. Let the numbers of them denoted by a,<br />
b, d, respectively. Then the following equations<br />
must hold by standard counting arguments .<br />
a + b + d =57 . . . (1)<br />
a + 2b +4d = 104 . . . (2)<br />
2b + 12d = 156 . . . (3)<br />
From these equations we get 6d= 62 which is<br />
not possible for 6 does not divide 62.<br />
Lemma 5.2. If B has no 2-secant, then B has at<br />
least one 4-secant.<br />
Proof. Suppose there are only 1-,3-,and 4secants<br />
.Let the number of them denoted by a, c,<br />
d, respectively. Then the following equations<br />
must hold by standard counting arguments.<br />
a + c + d =57 . . . (1)<br />
a + 3c +4d = 104 . . . (2)<br />
6c + 12d = 156 . . . (3)<br />
From these equations we get d = 5.<br />
Lemma 5.3. There are at most six point of B on<br />
any line of it.<br />
Proof. Let L be a 7- secant to B, since the seven<br />
lines through p, where p � L \ B,<br />
contains at<br />
least one point of B, hence there is one line from<br />
the other seven lines not contains any point of B,<br />
which contradicts the fact that B is a blocking<br />
set.<br />
Lemma 5.4. Every blocking set of size 13 in<br />
PG(2,7), has at least four points on a line.<br />
6<br />
311
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
Proof. Suppose there are only 1-,2-,and 3secants<br />
. Let the number of them denoted by a , b<br />
, c , respectively . Then the following equations<br />
must hold by standard counting arguments.<br />
a + b + c =57 . . . (1)<br />
a + 2b +3c = 104 . . . (2)<br />
2b + 6c = 156 . . . (3)<br />
From these equations, we get b= -15, which<br />
is impossible.<br />
Lemma 5.5. Let B have at most four points on a<br />
line . Let the number of 1-,2-,3- and 4- secants<br />
be denoted by a , b , c, d, respectively. Then<br />
these numbers satisfy one of the following<br />
possibilities<br />
312<br />
a b c d Possibilities<br />
31 15 1 10 (i)<br />
32 12 4 9 (ii)<br />
33 9 7 8 (iii)<br />
34 6 10 7 (iv)<br />
35 3 13 6 (v)<br />
36 0 16 5 (vi)<br />
Proof. The standard counting arguments give:<br />
a + b + c + d =57 . . . (1)<br />
a + 2b +3c + 4d = 104 . . . (2)<br />
2b + 6c + 12 d = 156 . . . (3)<br />
From these equations we can deduce:<br />
a = 41 – d;<br />
b = -15 + 3d;<br />
c = 31 -3d;<br />
Since c ≥ 0 , we get d ≤ 0.<br />
Lemma 5.6. If B has at most 5-secant, then any<br />
point not belong to B has at most six tangents.<br />
Proof. If a point p � B,<br />
lies on seven tangents<br />
then the eighth line contains the 6 remaining<br />
points of B, which contradicts. Since B has at<br />
most 5 –secants.<br />
Lemma 5.7. Any point not belonging to B has<br />
at most seven tangents.<br />
Proof. If p � B,<br />
lies on eight tangents ,then<br />
B � 8* 1 � 8,<br />
which contradicts the size of<br />
B. Lemma 5.8. Let L 1 be a 6-secant to B<br />
and L 2 , be a 5-secant to B then L1 � L2<br />
, in a<br />
point in B.<br />
Proof. Assume L1 � L2<br />
={p}, and p � B,<br />
then<br />
B � 6 � 5 � 6 � 17,<br />
which contradicts the size<br />
of B.<br />
Lemma 5.9. Let L be a 6-secant of L � B , there<br />
is at most one 5-secant .<br />
Proof. Let p be a point of L � B , and assume<br />
there are two 5-secants through p, then<br />
B � 6 � 2*<br />
4 � 14,<br />
which contradicts the size<br />
of B.<br />
Lemma 5.10. Let L be a 4-secant to b , then<br />
through any point of L � B , there is at most<br />
four 3-secant.<br />
Proof. Let p be a point of L � B , and assume<br />
there are five 3-secant through p, then<br />
B � 4 � 5*<br />
2 �14,<br />
which contradicts the size<br />
of B.<br />
Lemma 5.11. Every two 6-secants to B are<br />
intersected in a point on B .<br />
Proof. If two 6-secants intersect in p � B,<br />
then<br />
B � 2* 6 � 6 � 18,<br />
which is contradicts the size<br />
of B.<br />
Lemma 5.12. There are at most two 6-secants<br />
through any point of B.<br />
Proof. By lemma 5.11.every two 6-secants to B<br />
are intersected in a point on B. Now assume<br />
there are three 6-secants through a point p � B,<br />
then B � 3* 5 �1<br />
� 16,<br />
and that is impossible.<br />
So through every point of B , there are at most<br />
two 6-secants.<br />
LOWER BOUNDS OF SIXTH AND<br />
SEVENTHBLOCKING SETS<br />
IN PROJECTIVE PLANEPG(2, 16)<br />
In this section we find the lower bound in the<br />
projective plane PG(2, q), q square the of 6 –<br />
blocking set when q > 36 and q = 16. Also we<br />
find the lower bound of a 7 – blocking set when<br />
q > 49 and q = 16.<br />
6.1. The projective plane PG(2, 16).<br />
Let F(x) = x 3 + x 2 + x +λ be a conic polynomial<br />
over GF(16) then the companion matrix of F(x)<br />
�0<br />
1 0�<br />
T=<br />
� �<br />
�<br />
0 0 1 , is cyclic projectivity onPG(2,<br />
�<br />
��<br />
� 1 1��<br />
16) , {λ= -λ}, let π = GF(16) = {0, 1, λ i }<br />
where i and λ 15 =1. The number of point<br />
in the PG(2, 16) are 273 points and 273 lines and<br />
every line passes through 17 points.<br />
6.2. Sixth and seventh blocking sets in PG(2,<br />
16)<br />
The object of this section is to obtain good<br />
lower bounds for the size of sixth blocking sets<br />
in PG(2, q), q is square integer[12 ].<br />
The following are the Table of the largest (k,<br />
n)- arc in PG(2, q) for small q.
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
Table 4: The size of the largest (k, n) – arc in PG(2, q) for small q.<br />
q n 3 4 5 7 8 9 11 13 16<br />
2 4 6 6 8 10 10 12 14 18<br />
3 9 11 15 15 17 21 23 28 … 33<br />
4 16 22 28 28 32 … 34 38 … 40 52<br />
5 29 33 37 43 … 45 49 … 53 65<br />
6 36 42 48 56 64 …66 78…82<br />
7 49 55 67 79 93…97<br />
8 65 77 … 78 92 120<br />
9 89 … 90 105 128…131<br />
10 100 -102 118 …119 142…148<br />
11 132…133 159…164<br />
12 145…147 180…181<br />
13 195...199<br />
14 210…214<br />
15 231<br />
16<br />
Theorem 6.3. Let B be sixth blocking set in<br />
PG(2, q) , q is square such that through each<br />
of it is points there are +1 lines, each line<br />
contains at least +6 points of B and<br />
forming a dual Baer sub line. Then:<br />
1. For q > 36, B has at least 6q + 2 +6<br />
points.<br />
2. For q =16, B has at least 6q + +9<br />
points.<br />
Proof.1. Call the lines meeting B in +6<br />
or more points long lines. If two long line<br />
meet outside of B, then B has at least 2 (<br />
+6) + 6(q -1) = 6q + 2 points and the<br />
desired bound is obtained [18 ]. Hence<br />
B � 6q + 2 . So to assume that two<br />
long lines meet in B. Take l, a long line, and<br />
p, a point of B not on l. Then the long lines<br />
through p contain a dual Baer sub line and<br />
meet l in a Baer sub line. Let Q be a point on<br />
this Baer sub line. Consider long lines<br />
through a point on a 6-secant to Q. These<br />
meet l in another Baer sub line not<br />
containing Q. Two Baer sub lines meet in at<br />
most two points and so l has at least 2<br />
points. Since l was arbitrary every long line<br />
has at least 2 and it follow that B<br />
has at least ( (2 -1) +1 +5(q- )<br />
= 7q - 4 points. Since 7q - 4 6q +<br />
2 for all so that B � 6q +<br />
2 .<br />
Proof.2. If two long lines meet outside of B,<br />
then B has at least 2( ) +6( q-1) = 6 q<br />
+2 points. Hence B � 6 q + 2 .<br />
Let p B, through B, since there are +1<br />
long lines through p. So B has at least (<br />
+1)( +5)+1+5(q+1- ( +1)= 6q + +6<br />
points. Now B � 106. If this bound is a<br />
chafed then (k, 11) – arc has k = 167 and<br />
that impossible. [ See Table in 5.1.]. If B =<br />
6q + +7 then k = 166, that impossible.<br />
Since k 164, hence B � 6q +<br />
Corollary 6.4. There exists (k,11) – arc in<br />
PG(2, 16) ,where k .<br />
Proof. Finding a maximum ( k, 11) –arc is<br />
equivalent to finding the minimum sixth<br />
blocking sets by considering complements.<br />
From theorem 6.3, the lower bound of sixth<br />
blocking set is 6 q + 2 So B must<br />
have at least 110 points and since n = q +1-t<br />
, then (k, 11) –arc have at most 163 points<br />
.<br />
Theorem 6.5. Let B be seventh blocking set<br />
in PG(2, q) , q is square such that through<br />
each of it is points there are +1 lines,<br />
313
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
each line contains at least +7 points of B<br />
and forming a dual Baer sub line. Then:<br />
1. For q > 49, B has at least 7q + 2 +7<br />
points.<br />
2. For q =16, B has at least 7q + +9<br />
points.<br />
Proof.1. Call the lines meeting B in +7<br />
or more points long lines. If two long lines<br />
meet outside of B, then B has at least 2 (<br />
+7) + (q -1) = 7q + 2 points and the<br />
desired bound is obtained. Hence B � 7 q +<br />
2 . So to assume that two long lines<br />
meet in B. Take l, a long line, and p, a point<br />
of B not on l. Then the long lines through p<br />
contain a dual Baer sub line and meet l in a<br />
Baer sub line. Let Q be a point on this Baer<br />
sub line. Consider long lines through a point<br />
on a 7-secant to Q. These meet l in another<br />
Baer sub line not containing Q. Two Baer<br />
sub lines meet in at most two points and so l<br />
has at least 2 points. Since l was arbitrary<br />
every long line has at least 2 and<br />
it follow that B has at least ( (2 -<br />
1) +1 +6(q- ) = 8q - 5 points. Since 8q<br />
- 5 7q + 2 for all so that<br />
B � 7q + 2 .<br />
Proof .2. If two long lines meet outside of B,<br />
then B has at least 2( ) +7( q-1) = 7q<br />
+ 2 points. Hence B � 7q + 2 .<br />
Let p B, through B, since there are +1<br />
long lines through p. So B has at least (<br />
+1)( +6)+1+6(q+1- ( +1)= 7q + +7<br />
points. Now B � 123. If this bound is hold<br />
then (k, 10) – arc has k = 150 and that<br />
impossible. [ See Table 4 in 6.2.]. If B = 7q<br />
+ +8 then k = 149, that impossible. Since<br />
k 148, hence B � 7q +<br />
Corollary 6.6. There exists (k,10) – arc in<br />
PG(2, 16) ,where k .<br />
Proof. Finding a maximum ( k, 10) –arc is<br />
equivalent to finding the minimum seventh<br />
blocking sets by considering complements.<br />
314<br />
From theorem 5.4., the lower bound of<br />
seventh blocking set is 7q + 2 So B<br />
must have at least 127 points and since n = q<br />
+1-t , then (k, 10) –arc have at most 146<br />
points.<br />
REFERENCES<br />
- S. Ball, An Introduction to Finite Geometry, (2004), 1-<br />
63.<br />
- J. Barát and S. Innamorati ,Largest minimal blocking sets<br />
in PG(2, 8), J. Combin. Designs. (2003), 11: 162-<br />
169.<br />
- A. Barlotti, Su{k, n} – archi di un piano lineare finite,<br />
Boll. Un. Mat.Ital.,11,(1956),553-556.<br />
- A. Blokhuis, Blocking sets in Desargues an planes,<br />
Bolyai Soc. Math.Studies, (1993), 1-20.<br />
- A. Blokhuis, Blocking sets in Desargues an planes,<br />
Bolyai Sco . Math . Studies<br />
2., (1996),133 – 156.<br />
- M. Blokler , K.Metsch , On the smallest minmal blocking<br />
sets, In Contribution to algebra and geometry ,<br />
Vol.43(2004), 43-53.<br />
- A. A.Bruen,, Arcs and multiple blocking sets,<br />
Combinatorial, Symposia, Mathematica 28.,<br />
Academic Press,(1986), 15-29<br />
- M. J. De Resmini, On 3-blocking sets in<br />
projectiveplanes,Ann.Discr.Math.,34,(1987), 145-<br />
152.<br />
- G.V. De Voorde, Blocking sets in finite projective spaces<br />
and coding theory, Ph.D thesis(2010).<br />
- J. di Paola, On minimum blocking coalitions in small<br />
projective plane games, SIAM J. Appl. Math.,<br />
17.,(1969), 378-392.<br />
- N. Hamilton, More maximal arcs in Desargues an<br />
projective planes and their geometric structure, Ad .<br />
Geom. 3,(2003) 251 – 261 .<br />
- R. Hill, On (k, n)-arcs and the falsity of the Lunelli –Sce<br />
conjecture, London Math. Soc. Lecture Note<br />
Series., 49,(1981), 153-168.<br />
- J. W. P, Hirschfield, Projective Geometries over Finite<br />
Field, Oxford University Press, Oxford, (1979).<br />
- J. W. P, Hirschfield, The packing problem in statistics,<br />
coding theory and finite projective spaces, update<br />
2001 , in : Finite Geometries , Developments in<br />
Mathematic 3., (2001), 201 - 246<br />
- S. Innamorate, Minimal blocking sets in PG(2, 8) and<br />
maximal partial spreads in PG(3,8), Designs, Codes<br />
and Cryptography, 13.,(2004) 15-26.<br />
- L. Re ' dei, Lacunary Polynomial over Finite Field,<br />
Birkhuser Verlag, Basel,(1973).<br />
- M. Richardson, On finite projective games, Proc. Amer.<br />
Math. Soc., 7, (1956), 458-465.<br />
- A. L. Yasin, Cubic Arcs in Projective Plane of Order<br />
Eight, Ph. D. Thesis, University of Sussex,<br />
England,(1986).
J. Duhok Univ., Vol.14, No.1 (Pure and Eng. Sciences), Pp 307-315, 2011<br />
انيئ كةنوونم ةم . نرك ينلوث ةنيتاه اد<br />
PG(2, 7)<br />
ذ ىرك كؤمب نَيمؤك نيتركوضب انووبةه و رةرب<br />
د 31 َىرابةق ذ ىرك كؤمب نَيمؤك نيتركوضب ،ادَىنيلوكةظ َىظد<br />
5<br />
ةظيترث َىيلا لةطد<br />
PG(2,7) د 31 َىرابةق ذ ىرك كؤمب اموك ذ طنرط نَيتةخؤلاس كةدنه . ندنالمةس ةيتاه<br />
نيج<br />
. اد<br />
PG(2,q)<br />
PG(2, 7)<br />
31<br />
ةتخوث<br />
َىرابةق ذ ىرك كؤمب نَيمؤك نيتركوضب ذ<br />
31<br />
َىرابةق ذ<br />
د ىتفةح و ىشةش نَييىرك كؤمب نَيمؤك ؤب نرك اديةث ىرَيذ نَيرونس ةم اسةورةه<br />
نلأيطاا لاا يتبلا يف<br />
داي ن ىيلع ةيتذ ثبف نيت ث ان نجيطنبي نيخ ن يثراا ىيلع يل بت<br />
ييخف دنييا نف نييتب نييبر .<br />
دنييا نف نيتب نييض ا .<br />
.<br />
يف ل د ع<br />
PG(2, 7)<br />
PG(2, 7)<br />
q<br />
نل تع<br />
31<br />
Redei<br />
َىروج<br />
. ناد ةنتاه اد<br />
ةصلاخلا<br />
يا ا ة ميصتا ةيجثلنلألا يجلنيابلا اجتيا ف نيتب ني ثلا ا يذ يف<br />
31<br />
نلأييطاا لاا ييتبلا ييف لا يي ر –<br />
نلأيطاا لاا ييتبلا<br />
PG(2,q)<br />
يف<br />
31<br />
ا ا ة مصأ ةجثلن ةعابال ىلع لنثل دنا نف نتب<br />
اييع نييل<br />
31<br />
ييا ا ة مييصأ ةييجثلن ةييعابال<br />
يا ا ة مييصاا ةيجثلنلألا ةييعابابلل ةيبةبلا ا نياخلا<br />
نلأطاا لاا تبلا ف ةجطا تلان ةجطنبخلا ةجثلنلألا يجلنابلل نجع لا داجلألا<br />
315