2009 Vienna - European Society of Human Genetics

Clinical genetics and Dysmorphology
optimized and clinically applied the protocol permitting molecular genetic
analysis to amplify a specific region on the beta-globin gene for
a couple, carriers of two mutations c.-78A>G and c.52A>T. Among a
total of eight embryos were obtained after ovarian stimulation, a single
blastomere per embryos were biopsied.
Results: The PCR fragments (364 bp) encompassing the both mutation
sites were successfully amplified. A single base mismatch resulted
in a melting temperature (Tm) shift of 8 °C for c.-78A>G mutation and 5
°C for c.52A>T mutation, allowing distinguish a wild type allele from the
mutate allele. Genetic diagnosis showed that four embryos were unaffected
embryos and two embryos were selected to transfer achieving
pregnancy. Finally, a healthy boy was born.
Conclusion: Based on our results, this strategy can be successfully
performed for PGD by using single-cell PCR. It is suitable as a noninvasive
clinical tool for monogenic diseases.
P02.175
National campaign for the control of thalassemia in iran
S. Zeinali 1,2 ;
1 Dep’t of Mol. Med, Biotech Research Cntr.,Pasteur Institute of Iran, Tehran,
Islamic Republic of Iran, 2 Medical Genetics Lab., Kawsar Human Genetics
Research Cntr., Tehran, Islamic Republic of Iran.
Thalassemia is regarded a major health problem in many parts of the
world. Population migration from thalassemia endemic regions to North
and South America as well as Europe has made it a world problem.
In Iran National Thalassemia Screening Program for prevention of
transfusion dependent thalassemia began in 1997. Premarital screening
became compulsory and at risk couples are dealt with a comprehensive
program. The program includes test confirmation, iron therapy,
hematological consultation, genetic tests, prenatal diagnosis (PND)
and legal therapeutic abortion of the affected fetuses. PND is covered
by health insurance. National guidelines have been devised for every
steps including for PND. Laboratories in the program are connected to
each other as networks including prenatal diagnosis laboratories network.
Their performances are monitored and regular inspections are
carried out by members of Experts Committee. Every case of PND has
to be reported to the Genetics Office, Ministry of Health. National Reference
Laboratory for PND was created. In provinces with no medical
genetics center, new centers have been created by tech-transfer using
the experience and expertise from National Reference Laboratories.
More than 10,000 prenatal diagnoses have been performed by these
laboratories. In our center more than 3500 PNDs have been performed
with only one misdiagnosis. Majority of referred cases were tested for
beta-thalassemia. ARMS and RFLP techniques are used for most
cases. In other cases direct DNA sequencing, Real-time, MLPA, SNPs
and newly developed STR markers are used to come to a final conclusion.
P02.176
Developing a new stR marker to aid prenatal diagnosis of beta
thalassemia
R. Vahidi 1 , F. Rahiminejad 1 , S. Frouoghi 1 , M. Feizpour 1 , P. Fouladi 1 , M. Heidari 1 ,
M. Raeisi 1 , S. Ghahremani 1 , M. Hashemi 1 , Z. Shahab Movahed 1 , M. Vahidi 1 , S.
Mousavi 1 , M. S. Fallah 2,1 , S. Zeinali 3,1 ;
1 Kawsar Human Genetics Research Center, Tehran, Islamic Republic of Iran,
2 National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran,
Islamic Republic of Iran, 3 Dep’t of Mol. Med., Biotech Research Center, Pasteur
Institute of Iran, Tehran, Islamic Republic of Iran.
Thalassemia is the most prevalent genetic disorder in Iran. Mutation
in beta globin gene, in homozygote state, may causes severe clinical
picture of thalassemia major. Here we report a case of combined
alpha-beta mutation which couldn’t be diagnosed with conventional
molecular studies.
A couple was referred to us for prenatal diagnosis (PND). The couple’s
hematological parameters were: (husband: MCV: 67.9; MCH: 21.0;
HbA2: 5.3%; wife: MCV: 72.9; MCH: 22.2; HbA2: 5.3%).
The mutation in the husband was found to be IVSII-nt1 in the beta
globin gene. Our investigation on the wife’s DNA using ARMS, MLPA,
Real-time PCR techniques and DNA sequencing revealed no mutation.
Repeated hematological analysis gave similar results (i.e. low
MCV, MCH and high HbA2). We also investigated her alpha-globin
gene for possible mutation using similar techniques as above. No mu-
tation was detected either. We then anticipated that the mutation causing
imbalance in beta-globin synthesis may lie elsewhere. We tried to
use known SNP or RFLP markers to use indirect methods for PND. No
site was informative. We used a newly developed globing -gene linked
STR markers to do so. Her father was carrier as well (i.e. MCV: 74.5;
MCH: 18.8; A2: 4.6%). The primers for this STR are given below: F=T
GCTAAGTAGATGTCTGAGTGGC, R=GCCAATACTGCTGCATCATG.
The sizes were: M:253/256; MM: 249/253; MP: 253/256. In this regard
the mutant gene is linked with alleles 253. Use of STR markers are
preferred compared with SNPs since STRs are usually multi allelic and
there is more probability of being informative.
P02.177
Arrayed Primer Extension (APEX) and sNP Analysis for the Non-
Invasive Prenatal Diagnosis (NIPD) of β-thalassaemia
T. Papasavva1 , A. Kyrri2 , L. Kythreotis2 , H. Roomere3 , M. Kleanthous1 ;
1 2 The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus, Cyprus
Thalassaemia Center, Nicosia, Cyprus, 3Genorama Ltd, Tartu, Estonia.
β-thalassaemia is the most common autosomal recessive single gene
disorder in Cyprus. Prenatal diagnosis of β-thalassaemia is based on
chorionic villus sampling that poses an abortion risk to the fetus. The
discovery of cell-free fetal DNA in maternal plasma has opened up
new possibilities for Non-Invasive Prenatal Diagnosis. The development
of a NIPD assay for β-thalassaemia is based on the analysis
of maternal plasma DNA for the detection of the paternally inherited
fetal alleles using Single Nucleotide Polymorphisms (SNPs) and the
Arrayed Primer Extension (APEX) assay.
A SNP genotyping analysis was performed on 75 random samples
from the Greek-Cypriot population using 130 SNPs located across the
β-globin cluster for the determination of heterozygosity. 48 SNPs with
more than 10% heterozygosity were selected for the development of
NIPD. Moreover, 55 families at risk for carrying a β-thalassaemic fetus
were analyzed using 11 SNPs in order to determine which were informative
for NIPD.
For the development of the APEX assay we designed a DNA microarray
chip called “thalassochip” containing 60 β-thalassaemia mutations
and 18 SNPs located across the β-globin locus. The sensitivity and
specificity of the approach was determined. 24 maternal plasma samples
were analyzed using the APEX assay for 2 SNPs. NIPD was successfully
performed on 17 samples, 2 were misdiagnosed, whereas 5
analyses failed.
The APEX assay is a promising technique for NIPD and more tests
with additional SNPs need to be performed in order to render the assay
100% reliable for NIPD.
P02.178
simultaneous alpha and beta carriers may caused severe H-
Disease
F. Rahiminejad 1 , p. Fouladi 1 , S. Foroughi 1 , m. Hashemi 1 , R. Vahidi 1 , F. Mollazadeh
1 , M. Sharafi 1 , S. Zeinali 2 ;
1 Kawsar Human Genetics Research Center,, Tehran, Islamic Republic of Iran,
2 Kawsar Human Genetics Research Center, Dep’t of Mol. Med., Biotech Research
Center, Pasteur Institute of Iran, Tehran, Islamic Republic of Iran.
Thalassemia is a major health issue in Iran. Premarital screening has
been in effect since 1997. Couples with low MCV and/or MCH are
detected and if needed are referred to one of several medical genetics
laboratories throughout the country.
A couple was referred to our center for prenatal diagnosis of thalassemia.
The male partner had low hematological data comparable with
thalassemia (i.e. MCV: 63.5 Fl, MCH:19.8 Pg ,Hb:15 g/dl and HbA 2 :2.5
g/dl). He was diagnosed to be carrier of alpha thalassemia with Med
mutation (-- Med / αα). The female partner’s hematological data was:
MCV:80 Fl , MCH:25.6 Pg , Hb:14.2 g/dl , HbA 2 :5.4 g/dl , HbF:6.6 g/dl.
At first glance she would be diagnosed as being a carrier of beta-thal.
Molecular analysis showed she was both carrier of alpha and beta
thalassemia. The high level of HbA 2 was indicative of beta-carrier and
near normal MCV and MCH was indicative of being carrier of both beta
and alpha-thal. We could detect 3.7 kb deletion in alpha globin gene.
The risk of H-disease for the fetus is 25% though it would be mild.
The parents should become aware of this fact. Another point is that
since point mutation in alpha-genes can give similar hematological result
and then in such case a transfusion dependent H-disease may