Download PDF - Zoological Studies - Academia Sinica

More documents

Recommendations

Info

208 <strong>Zoological</strong> <strong>Studies</strong> 51(2): 204-212 (2012) difference was found between sexes (Mann- Whitney U-test, p = 0.31). Average home-range sizes in the reproductive season were 1826.1 ± 1463.9 m 2 (n = 23) for adult males and 1684.2 ± 1256.7 m 2 (n = 19) for adult females. The average home-range sizes in the non-reproductive season were 2072.7 ± 1637.7 m 2 (n = 11) for adult males and 1125.0 ± 874.6 m 2 (n = 8) for adult females. No significant difference in home-range sizes was found between sexes (Mann-Whitney U-test, p = 0.74 for the reproductive season and p = 0.16 for the non-reproductive season). The sample size for the non-reproductive season was small. We separated the reproductive season into 3 periods of 3 mo each and compared the homerange overlap among resident individuals (Fig. 1). Only those with ranges that overlapped ranges of the opposite sex are shown. There were 21 pairwise combinations of home ranges overlapping those of the opposite sex. Eleven (52.4%) showed exclusive home-range overlap between 1 male and 1 female (Fig. 1). Eight (38.1%) of these 21 pairwise combinations between male and female ranges were detected as sexually paired partners. Six (75%) of these 8 reproductive pairs had exclusive, overlapping home ranges. The average overlap of a male’s range with a female’s range did not statistically differ from the average overlap of a female’s range by a male’s range (Wilcoxon rank-sum test, p = 0.126). Average percentages of a female’s home range overlapped by a male’s were significantly larger in mated pairs (77.1%, n = 8) than in pairs not found to produce offspring (41.8%, n = 11) (Mann-Whitney U-test, p = 0.0372). Average percentages of a female’s home range overlapped by a male’s were also significantly larger than a male’s home range overlapped by his sexual female partner’s (42.4%, Wilcoxon ranksum test, p = 0.0499, n = 8). In other words, a female’s home range tended to overlap more with that of her sexual partner, but males did not show this trend. In total, 14 social units were recognized based on overlapping home ranges involving Table 1. Microsatellites used in the study of Microtus kikuchii at Hehuan Mt., Taiwan, from June 2004 to Sept. 2005. Microsatellite variations include the annealing temperature (Ta), number of alleles, observed heterozygosity (Ho), expected heterozygosity (He), inbreeding coefficient (F), Hardy-Weinberg equilibrium (H-W), and p value (p) Locus Core sequence Ta (°C) Sequence (5'-3') Allele size range (bp) Number of alleles Ho He F H-W p MSMM-2 a (CA)21 52 TAACCACAACCCCTCCAACTG TCATTTGGAGTTGCTGAGAAC MSMM-3 a (CA)15 52 TACGCCCTTCAAACTCATGTG TCCTTTATCTTAGGTGATGGAG MSMM-4 a (CA)19 52 TGTTTCAAGGCAATAAGGTGG TCGTTTCCCTGGAGATTGGG MSMM-5 a (CA)17 52 TCTAATACCCTCTTCCTTGGG TCCTATCAAGGGGCATTCATCT MSMM-6 a (CA)20 52 TCCTATCAAGGGGCATTCATCT TACAAAGCCATTGTTCCCTGCT MSMM-7 a (CA)18 56 TAAGAAGGGCCACTAAGACCC TGGGATTAAAGGTGTGCACCA MSMM-8 a (CA)17 50 TGCTTAGTTCACTGCTGAACC TCTTACTATCTGTCATTGAAGA Moe1 b (GT)18 60 TGGTTGTTCTGTGGTGAATACAG ACAGTAAGCAGTTTATCCACAAACC Moe2 b (GT)17 60 CATCTGATGAGTCCCTGAGG GCAACCTTCTTCTGACTTTTAC Moe5 b (TC)25 60 GGTCATGCTCCAAGAAGCTC AAAACCAAGGGTGCTGCTC Moe6 b (GT)25 60 GGTTTTCTGATTCAGGCAGG CCTCTTCTGGCCTCTCCAG 163-197 15 0.893 0.900 0.007 NS 0.627 102-136 14 0.833 0.827 -0.008 NS 0.279 143-187 18 0.913 0.872 -0.047 NS 0.512 69-111 19 0.900 0.910 0.011 NS 0.247 145-167 12 0.873 0.857 -0.019 NS 0.987 105-123 8 0.820 0.830 0.012 NS 0.915 170-196 13 0.927 0.886 -0.046 NS 0.246 93-133 15 0.847 0.890 0.049 NS 0.770 145-185 15 0.887 0.889 0.002 NS 0.480 108-138 14 0.833 0.866 0.037 NS 0.663 210-246 14 0.913 0.998 -0.017 NS 0.420 a Ishibashi et al. (1999). b Van de Zande et al. (2000). NS, non-significant.
Wu et al. – Monogamy of Taiwan Voles 209 June-Aug. 2004 Mar.-May 2005 June-Aug. 2005 58F 41M 44M 42F 60M 41M 80F 44M 60M 25F 135F 80F 44M 60M 102M 138F 132F 8F 136F 41M 34F 52M 91F 120M 65F 45M 36F 50M 101M 72F 109M 108M 64F 36F 50M Fig. 1. Overlapping home ranges of adult Microtus kikuchii at Hehuan Mt., Taiwan, during 3 consecutive reproductive periods. Numbers indicate different individuals. Letters indicate the sex (M for males and F for females). Male home ranges are illustrated with solid-line boundaries and lightly shaded interiors. Female home ranges have bold dotted boundaries. Only overlapping home ranges between opposite sexes are shown. Table 2. Parentage analysis of M. kikuchii at Hehuan Mt., Taiwan Offspring a Date offspring captured Parents a between offspring and parents Number of mismatched loci (female/male) LOD b ΔLOD c * 15M 2004 June 2F and 16M 1 / 1 8.06 4.84 4M 2004 June 17F and 13M 0 / 0 8.36 0.55 83F 2004 Sept. 0 / 0 9.64 7.79 5M 2004 June 10F and 50M 0 / 0 11.40 6.31 37M 2004 July 12F and 22M 0 / 0 9.66 7.26 42F 2004 July 24F and 35M 0 / 0 9.59 2.17 46M 2004 July 0 / 0 8.89 3.15 58F 2004 July 19F and 30M 0 / 0 8.03 3.03 43F 2004 July 48F and 49M 0 / 0 9.96 6.77 77M 2004 Sept. 65F and 54M 0 / 0 8.93 4.98 140F 2005 June 1 / 1 8.69 6.40 144M 2005 June 0 / 0 6.14 1.10 82F 2004 Sept. 74F and 90M 1 / 0 8.05 4.74 110F 2005 Mar. 0 / 0 7.39 1.64 70F 2004 Aug. 93F and 68M 1 / 0 9.07 0.46 81F 2004 Sept. 0 / 0 9.65 2.30 91F 2004 Oct. 0 / 0 10.20 2.91 102M 2005 Jan. 18F and 40M 0 / 0 6.84 4.62 111F 2005 Mar. 0 / 0 11.70 10.40 135F 2005 May 80F and 44M 0 / 0 12.80 9.21 136F 2005 May 0 / 0 8.86 4.20 146M 2005 June 91F and 109M 0 / 0 10.10 2.67 157M 2005 July 0 / 0 11.60 3.03 148F 2005 June 58F and 49M 1 / 1 8.45 6.70 150M 2005 June 72F and 101M 1 / 1 8.46 3.80 160F 2005 July 1 / 0 8.03 1.90 153M 2005 July 36F and 50M 0 / 0 9.96 5.52 158F 2005 July 25F and 60M 0 / 0 9.87 7.89 156F 2005 July 152F and 100M 0 / 0 10.50 5.17 164M 2005 Aug. 111F and 102M 0 / 0 6.47 1.08 167F 2005 Aug. 142F and 210M 0 / 0 10.50 8.23 a Sex indicated by M (male) and F (female). b LOD score, log of product of likelihood ratios at each locus. c ΔLOD, difference in LOD score between the most likely candidate parent and the 2nd most likely candidate parent. *All ΔLOD values were significant (p < 0.05).
Page 1 and 2:
ISSN: 1021-5506 Zoological Studies
Page 3 and 4:
Zoological Studies 51(2): 137-142 (
Page 5 and 6:
Page 7 and 8:
Page 9 and 10:
Page 11 and 12:
Page 13 and 14:
Page 15 and 16:
Page 17 and 18:
Wang et al. - Coral-Terpios Interac
Page 19 and 20:
Page 21 and 22:
Page 23 and 24: Wang et al. - Coral-Terpios Interac
Page 25 and 26: Wang et al. - Coral-Terpios Interac
Page 27 and 28: Dahms et al. - Lanyang River Copepo
Page 41 and 42: Zoological Studies 51(2): 175-184 (
Page 71 and 72: Wu et al. - Monogamy of Taiwan Vole
Page 73: Wu et al. - Monogamy of Taiwan Vole
Page 77 and 78: Wu et al. - Monogamy of Taiwan Vole
Page 89 and 90: Young et al. - Study of Simocephalu
Page 99 and 100: Azman and Othman - A New Genus and
Page 115 and 116: Naderloo and Apel - Hiplyra in Nort
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
II. Title Page The title page shoul
Page 142:
Indexed/Abstracted in: Biological A
show all

Download PDF - Zoological Studies - Academia Sinica

Create successful ePaper yourself

Delete template?

Save as template?