Revealing the Mechanism of HSP104 Transcription Initiation in the ...

More documents

Recommendations

Info

1 1 1 1 1 1 A) 34bp 5’ ttttctttcgttgttcttgtagatatatatttttcc 3’ putative HSE putative TATA box B) 500.00 SP1 (WT) cells 30 o C 39 o C 450.00 400.00 350.00 300.00 250.00 200.00 150.00 100.00 50.00 0.00 334 328 317 311 305 300 334 317 311 305 300 300Stre3m ∆78 ∆78 ∆78 ∆78 ∆78 ∆78 1800 1600 1400 1200 1000 800 600 400 200 0 C) D) ras2∆ cells 334 328 317 311 305 300 30 o C 39 o C 800 700 600 500 400 300 200 100 0 ras2∆msn2∆msn4∆ cells 334 328 317 311 305 300 30 o C 39 o C 160 140 120 100 30 o C 39 o C 300 250 200 30 o C 39 o C 80 60 150 40 100 20 0 50 334 317 311 305 300 300stre3m ∆78 ∆78 ∆78 ∆78 ∆78 ∆78 msn2∆msn4∆ cells 0 334 317 311 305 300 300stre3m ∆78 ∆78 ∆78 ∆78 ∆78 ∆78 30 o C E) 300 250 39 o C 200 150 100 50 0 334 328 317 311 305 300 334 317 311 305 300 300Stre3m ∆78 ∆78 ∆78 ∆78 ∆78 ∆78 Figure 8. Deletion analysis of the 34bp fragment. A) Sequence of the 34bp fragment of HSP104 required for proper basal activity. B) Activity of the various deletions of the 34bp and their ∆78 counterparts (missing enhancer elements) in wild type SP1. C) Same as in B but measured in ras2∆ cells. Note the difference in scale used in upper and lower graphs. D) Same as above but in ras2∆msn2∆msn4∆. Note the difference in scale used in upper and lower graphs. E) Same as above but measured in msn2∆msn4∆ cells. These are the results of duplicates in a single assay; hence no STD could be calculated. 25
The systematic 5’ deletion analysis of the upstream 34bp pointed at the sequence between -305 and -300 as important. This 5bp contains a single HSE site. Although HSEs are normally active in response to heat shock, this site seems to partially contribute to the basal transcription activities of the promoter and even to its Ras2-mediated response. It may also be part of the HSE cluster residing (according to our original mapping) between -300 and -285. To test the role of these 5bp and the downstream cluster of HSEs in a most fine tuned manner, we continued and proceeded with additional 5’deletions in which we systematically deleted a single nucleotide at a time from -305 to -286 (Fig. 9A). In wild type cells, deletions between -305 and -302 had no effect. The -302LacZ construct still contains the full putative HSE sequence. The -301LacZ construct, which lacks only one nucleotide of the perfect HSE cis-element, demonstrated reduced activity that was actually similar to that of -300LacZ. We further verified the activity of these deletions in msn2∆msn4∆ cells (Fig 9B). Thus, we were able to map most properties of the 34bp to the single HSE element at -302. In other words, the HSE positioned at -302 is essential for the high basal activity of the HSP104 promoter. This result could also be interpreted by suggesting that the HSE cluster (-302 to -285) should be intact to support basal transcription. Since Hsf1 is known to be the sole regulator in the absence of Msn2/4 [Fig. 5 and (47)], we also measured the ability of the various constructs to respond to heat shock in the absence of Msn2/4. Our previous, somewhat crude, mapping showed that this heat shock response requires the HSE cluster residing between -300 to -285. Our current, fine tuned mapping showed, quite strikingly, that HSEs upstream to -294 are essential for the heat shock response of HSP104. Additional constructs downstream to -294bp displayed no activity even though still containing some HSEs (Fig. 9B). As mentioned in the “Introduction”, the activity of the - 334LacZ reporter in ras2∆msn2∆msn4∆ cells was similar if not identical to that in ras2∆ cells, but -300LacZ showed very low activity in ras2∆msn2∆msn4∆ and high in ras2∆ (47). We tested therefore the activity of -302LacZ in ras2∆msn2∆msn4∆ cells. As shown in Fig 9C, the pattern of activity of the -301LacZ and -302LacZ reporters is quite similar to that in wild type cells but levels are slightly higher. Importantly, in ras2∆msn2∆msn4∆ cells, the activity of the -302LacZ reporter is about 10 fold higher than the activity of -300LacZ. In fact, results obtained in ras2∆msn2∆msn4∆ certainly suggest a role for the HSE at -302 in explaining the high spontaneous activity of the promoter in ras2∆ cells. Namely, in cells lacking Ras2, and in the 26
Page 1 and 2: Revealing the Mechanism of HSP104 T
Page 3 and 4: This thesis is dedicated to my fami
Page 5 and 6: genetic approach, we identified com
Page 7 and 8: INTRODUCTION The cellular stress re
Page 9 and 10: for their transcription, some 16% o
Page 11 and 12: Transcription under stress in S.cer
Page 13 and 14: In mammalian cells, Hsf1 is a monom
Page 15 and 16: Hsf1 and Msn2/4 can exclusively or
Page 17 and 18: A) 5’-XhoI -713 BamHI-3’ ATG La
Page 19 and 20: 1 We first noticed that the activit
Page 21 and 22: 1 1 A) B) 700 600 500 ras2∆msn2
Page 23 and 24: Table 1. Summary of the role of var
Page 25 and 26: same enzymes. BS-HA-HSF was obtaine
Page 27 and 28: β-Galactosidase assay Overnight cu
Page 29: to the fact that the HSEs are prese
Page 33 and 34: 1 A) units 100.00 90.00 80.00 70.00
Page 35 and 36: nucleosome disassembly involving sp
Page 37 and 38: A) Strain W.T. msn2∆msn4∆ ras2
Page 39 and 40: Hsf1 constitutively binds the HSP10
Page 41 and 42: Next, we attempted to directly meas
Page 43 and 44: Table 3. List of mutants in which r
Page 45 and 46: Table 4. Strains required for posit
Page 47 and 48: Overall, the results nevertheless s
Page 49 and 50: Regulation of Hsf1 As explained in
Page 51 and 52: Table 7. Comparison between HSE-Lac
Page 53 and 54: promoter. III) The identification o
Page 55 and 56: to stress. This change in nucleosom
Page 57 and 58: perhaps not surprisingly, overexpre
Page 59 and 60: 21. Chandy, M., J. L. Gutierrez, P.
Page 61 and 62: 56. Hietakangas, V., J. K. Ahlskog,
Page 63 and 64: 89. Miyao, T., J. D. Barnett, and N
Page 65 and 66: 121. Stanhill, A., N. Schick, and D

Revealing the Mechanism of HSP104 Transcription Initiation in the ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?