Cancer du sein et micro-environnement tumoral: rôle de la protéase ...

Université Montpellier I UFR MédecineThèse présentée pour obtenir le grade deDOCTEUR DE LUNIVERSITE MONTPELLIER IDiscipline : Biochimie, Biologie Cellulaire et MoléculaireEcole doctorale : Sciences Chimiques et Biologiques pour la SantéCancer du sein et micro-environnementtumoral: rôle de la protéase cathepsine Dadipocytaire et de son récepteur LRP1ParOlivier MASSONSoutenue le 15 janvier 2009JURY :Mme Martine BIARD-PIECHACZYK, Directeur de recherche, MontpellierMr Frédéric BOST, Chargé de recherche, NiceMr Gilles LALMANACH, Professeur, ToursMme Emmanuelle LIAUDET-COOPMAN, Chargé de recherche, MontpellierExaminateurRapporteurRapporteurDirecteur de thèse1

RemerciementsJe voudrais en premier lieu madresser aux membres du jury : Martine Biard-Piechaczyk, Gilles Lalmanach et Frédéric Bost pour les remercier davoir accepté de lire etdévaluer ce travail.Je tiens à remercier chaleureusement le Dr Emmanuelle Liaudet-Coopman pourmavoir accueilli dans son laboratoire et sans qui ce travail naurait pu voir le jour. Merci pourton encadrement, ton engouement, ta disponibilité, ta joie de vivre et ta gentillesse. Grâce àtes grandes qualités de scientifique et de pédagogue tu mas amené à toujours plus de rigueuret de précision dans mon travail. Tu mas formé, appris à mener à bien un projet. Tu maségalement offert la chance de partir 3 mois à Vancouver ; cette expérience fut trèsenrichissante tant sur le plan professionnel que personnel. Je te remercie enfin de mavoirpermis de travailler dans des conditions matérielles et humaines optimales.Bien-sûr, je remercie lensemble de léquipe. Durant ces 3 années de thèse, jai eu lachance de travailler avec des personnes merveilleuses. Dès mon arrivée dans léquipe, vousmavez accueilli à bras ouvert et avez tout fait pour que cette thèse se passe dans lesmeilleures conditions.Christine, tu mas beaucoup appris en ce qui concerne la culture cellulaire et la biochimie,mais je noublierai pas non plus ta gentillesse et tes talents de cuisinière (sacrée mousse auchocolat !) ainsi que nos discutions sur les expressions en patois (à bisto de nas)!Danielle, je te remercie pour tout ce que tu mas appris dans le domaine de la biologiemoléculaire, mais je garderai également en mémoire tes encouragements, tes conseils toujoursplein de bons sens et nos discutions touchant à tous les sujets Valérie, merci davoir toujours prêté une oreille attentive à mes questions, de têtre intéresséeà mon travail et davoir agrémenté le tout dune bonne dose dhumour.Mélanie, je noublierai pas ta gentillesse, ta spontanéité et ton dynamisme.Sophie, la « Top Top Woman », tu es arrivée depuis moins dun an, pourtant jai limpressionde te connaître depuis le début de ma thèse. Une complicité sest rapidement installée entrenous, et tu as su mécouter dans les moments ou jen avais le plus besoin. Merci pour tesconseils avisés (sur le plan professionnel mais aussi personnel), ta sympathie, ton amitié.Anne-Sophie, merci pour ta gentillesse et ta bonne humeur.Jai beaucoup appris à vos côtés, je ne vous oublierai pas, jai passé 3 années merveilleuses,on ne peut pas rêver dun meilleur environnement de travail, cest la « dream team » !

Un grand merci à tous mes collaborateurs, pour mavoir conseillé et fait partager leurconnaissances sur les adipocytes et sans qui cette thèse ne serait pas ce quelle est, et toutparticulièrement à Carine Chavey, Catherine Mueller et Philippe Valet.Merci aussi à tous mes collègues et amis du laboratoire qui se reconnaîtront ici. Je leurexprime ma profonde sympathie et leur souhaite beaucoup de bien. Jai une pensée pour tousmes collègues et amis étudiants avec qui jai partagé de bons moments : Cycy, Iréna, Emilie,Marie, Stef, Didier, et le clan de la cantine, Hayat, Mayssa, Aurélie (Louloute), Elsa,Laurence, Vincent (la cantine cest lécole de la vie!), ainsi que Max et Samir (même si vousen avez gros, je vous considèrerai toujours en tant que tel!).Je tiens également à remercier les personnes qui mont encadré durant mes stages demaster et qui mont donné le goût de la recherche. Un grand merci au Dr Martine Biard-Piechaczyk, pour mavoir accueilli lors de mon Master2, ainsi quà toute léquipe de la mortcellulaire, et tout particulièrement à Lucile qui ma soutenu et poussé à faire cette thèse aumoment où jen avais le plus besoin et où je doutais le plus de moi.David, mon premier encadrant (tu mas laissé te vouvoyer pendant 2 semaines mais je ne tentiens pas rigueur), tu occupes une place particulière car tu mas permis de découvrir le mondede la recherche et si jen suis là aujourdhui, cest aussi grâce à toi. Jai également une penséepour mes anciens collègues qui sont devenus par la suite des partenaires de jorki et enfin desamis qui me sont chers, Patrick et Stephan (mon Patou et mon Poussin).Jai également une pensée pour tous ceux que jai rencontrés et qui mont suivi duranttoutes ces années détudes. Je pense notamment à Ben, David, Georges, Arnaud, Olivier (leMaury, un sacré coureur de fond), Adri, Amandine, et au Sanders, une sacrée bande decopains! Merci pour tous ces bons moments et ces soirées danthologies !!!!!Enfin, je tiens à remercier ma famille (Maman, Papa, Mamie, Juju, Tatie) qui masoutenu sans relâche durant toutes ces années détudes dans les bons et les mauvais moments.Merci pour lamour que vous me témoignez chaque jour, votre présence et pour mavoirtoujours encouragé dans mes choix. Merci à toute la petite famille, en espérant quellesagrandisse encore (Juju et Sophie...). Merci à vous tous pour mavoir offert ces momentsuniques qui nous rappellent qui on est et doù lon vient.3

RésuméLaspartyl protéase cathepsine D, surexprimée et hyper-sécrétée par les cellulesépithéliales cancéreuses mammaires est un facteur de mauvais pronostic des cancers du sein etstimule la prolifération des cellules cancéreuses et la formation des métastases. Elle affecteégalement le micro-environnement tumoral en induisant la croissance invasive desfibroblastes. Les travaux de léquipe ont montré que le LDL-receptor related protein 1, LRP1,est le récepteur fibroblastique de la cathepsine D. LRP1 est fortement exprimé par lesadipocytes. Les études cliniques indiquent que lobésité est un facteur de risque dans denombreux cancers, dont le cancer du sein chez la femme ménopausée.Dans cette thèse, nous avons étudié le rôle de la cathepsine D et du LRP1 dans les adipocytes,type cellulaire prédominant du micro-environnement tumoral mammaire. Nos résultatsindiquent une surexpression de la cathepsine D et du LRP1 dans le tissu adipeux humain etmurin obèse. De plus, lexpression de la cathepsine D est augmentée pendant ladifférenciation adipocytaire. Finalement, lextinction de lexpression de la cathepsine D et duLRP1 inhibe ladipogenèse indiquant leurs rôles clefs dans ce processus.Lensemble de ces résultats suggère que la cathepsine D et son récepteur LRP1 pourraient êtredes cibles thérapeutiques potentielles dans le traitement de lobésité.Mots-clésAdipocytes, cancer du sein, cathepsine D, LRP1, micro-environnement tumoral, obésité.Laboratoire daccueilINSERM U896 cathepsines, autophagie et cancerInstitut de Recherche en Cancérologie de Montpellier208 rue des apothicaires34298 Montpellier France4

TitleBreast cancer and tumoral micro-environment : Role of the cathepsin-D protease and its LRP1receptor in adipocytes.SummaryThe aspartyl protease cathepsin D, overexpressed and hyper-secreted by epithelialbreast cancer cells is a poor prognosis factor in breast cancers and stimulates cancer cellgrowth and metastasis formation. It also affects the tumor microenvironment, inducing thefibroblasts invasive outgrowth. Our works have shown that the LDL receptor-related protein1,LRP1, is the fibroblastic receptor for cathepsin D. LRP1 is highly expressed in adipocytes.Clinical studies indicate that obesity is a risk factor in many cancers, including breast cancerin postmenopausal women.During this thesis, we studied the role of cathepsin D and LRP1 in adipocytes, which are theprominent cell type in the tumor microenvironment of breast cancers. Our results indicate thatcathepsin D and LRP1 are overexpressed in human and mouse obese adipose tissue.Furthermore, the expression of cathepsin D is increased during adipocyte differentiation.Finally, the inhibition of the cathepsin D and LRP1 expression inhibits adipogenesisindicating their key role in this process.All these results suggest that cathepsin D and its receptor LRP1 could be potential therapeutictargets in the treatment of obesity.5

PUBLICATIONS INCLUSES DANS LA THESE1. Olivier Masson, Carine Chavey, Cédric Dray, Aline Meulle, Danielle Daviaud, DidierQuilliot, Catherine Muller, Philippe Valet, Emmanuelle Liaudet-Coopman: LRP1 receptorcontrols adipogenesis and is up-regulated in human and mouse obese adipose tissue. (PLoSOne. 2009 Oct 12;4(10):e7422.)2. Olivier Masson, Christine Prébois, Carine Chavey, Cédric Dray, Aline Meulle, DanielleDaviaud, Didier Quilliot, Catherine Muller, Philippe Valet, Emmanuelle Liaudet-Coopman:Cathepsin D, a key factor in breast cancer, controls adipogenesis and is up-regulated in obeseadipose tissue. (soumis pour publication)6

Cancer du sein et micro-environnementtumoral: rôle de la protéase cathepsine Dadipocytaire et de son récepteur LRP17

TABLE DES MATIERESA. BUT DE LA THESE ....................................................................................................... 10But de la thèse ............................................................................................................................. 11B. INTRODUCTION ........................................................................................................... 12I. Le tissu adipeux ....................................................................................................................... 131) Généralités ........................................................................................................................................ 132) Ladipocyte ....................................................................................................................................... 15a. Morphologie .................................................................................................................................. 15b. La lipogenèse ................................................................................................................................ 16c. La lipolyse..................................................................................................................................... 19d. Ladipocyte : une cellule sécrétrice ................................................................................................ 223) Ladipogenèse ................................................................................................................................... 24a. Les différentes étapes .................................................................................................................... 24b. Les facteurs de transcription .......................................................................................................... 26c. Rôle des protéases dans ladipogenèse ........................................................................................... 284) Obésité, micro-environnement et cancer ............................................................................................. 30a. Le micro-environnement ................................................................................................................ 30b. Obésité et cancer ........................................................................................................................... 32II. La cathepsine-D ..................................................................................................................... 341) Synthèse, maturation et adressage lysosomal de la cath-D .................................................................. 34a. Régulation de la transcription de la cath-D ..................................................................................... 34b. Structure et maturation protéolytique de la cath-D .......................................................................... 35c. Adressage lysosomal ..................................................................................................................... 372) Fonctions de la cath-D ....................................................................................................................... 40a. Dans la physiologie ....................................................................................................................... 40b. Dans les pathologies ...................................................................................................................... 423) Rôle de la cath-D dans le cancer du sein ............................................................................................. 42a. Expression dans les lignées de cancer du sein ................................................................................. 42b. Facteur pronostic ........................................................................................................................... 43c. Rôles et mécanismes daction dans le cancer .................................................................................. 444) Substrats et partenaires ...................................................................................................................... 48a. Les substrats et partenaires de la cath-D ......................................................................................... 48b. Identification de nouveaux substrats de la cath-D ........................................................................... 48III. Le récepteur LRP1 ............................................................................................................... 541) Organisation structurale ..................................................................................................................... 542) Trafic intra-cellulaire ......................................................................................................................... 563) Mécanismes daction ......................................................................................................................... 56a. La phosphorylation ........................................................................................................................ 56b. Le RIP .......................................................................................................................................... 574) Fonctions ........................................................................................................................................... 588

C. PRESENTATION DU TRAVAIL DE THESE ............................................................... 61I. Etude du rôle de la cathepsine D dans les adipocytes ............................................................. 621) Introduction :..................................................................................................................................... 622) Article 1: ........................................................................................................................................... 63II. Etude du rôle du LRP1 dans les adipocytes .......................................................................... 641) Introduction :..................................................................................................................................... 642) Article 2: ........................................................................................................................................... 66D. CONCLUSION ET PERSPECTIVES ............................................................................ 67CONCLUSION ........................................................................................................................... 68PERSPECTIVES ........................................................................................................................ 70E. REFERENCES ............................................................................................................... 75F. ANNEXE......................................................................................................................... 98Article 3: ............................................................................................................................................... 999

A. BUT DE LA THESE10

But de la thèseLa cathepsine-D (cath-D) est une aspartyl protéase lysosomale surexprimée et hypersécrétéepar un grand nombre de carcinomes (sein, ovaire, prostate, endomètre, colon, squameux).Cest un marqueur de mauvais pronostic des cancers du sein associé à un risque augmenté derécidive. Nos travaux indiquent que la cath-D surexprimée par les cellules cancéreusesmammaires agit à différentes étapes de la progression tumorale métastatique. Elle stimule defaçon autocrine la prolifération des cellules cancéreuses et la formation des métastases. Deplus, elle joue un rôle déterminant dans le micro-environnement tumoral puisquelle agit defaçon paracrine en stimulant la croissance invasive des fibroblastes. Des travaux récentsréalisés dans le laboratoire ont montré que la cath-D interagit avec le domaine extracellulairede la chaîne b du récepteur LRP1 (LDL receptor related protein1). De façon intéressante,LRP1 est fortement exprimé par les adipocytes, un des types cellulaires prédominant dumicro-environnement tumoral dans le cancer du sein. De plus LRP1 est un récepteurdendocytose appartenant à la famille des LDL-récepteurs. Cette interaction est responsablede leffet mitogène de la cath-D sur la croissance invasive des fibroblastes. Des travauxrécents indiquent des rôles fondamentaux des cystéines cathepsines dans la biologie deladipocyte. Par ailleurs, les enquêtes épidémiologiques révèlent que lobésité est un facteurde mauvais pronostic dans de nombreux cancers dont le cancer du sein chez la femmeménopausée. De nombreuses études suggèrent que les adipocytes, via leur capacité à sécréterdes facteurs de croissance, de nombreuses cytokines et/ou des composés de la matrice extracellulaire,favorisent la progression tumorale mammaire et pourraient jouer un rôledéterminant dans les étapes précoces de la carcinogénèse mammaire.Le but de ce travail de thèse a été détudier le rôle de la cath-D et de son récepteur LRP1 dansla biologie de ladipocyte, avec un aspect orienté vers lobésité vu le rôle clef de la cath-Ddans le cancer et le lien entre obésité et cancer.11

B. INTRODUCTION12

I. Le tissu adipeux1) GénéralitésLe tissu adipeux dérive embryologiquement des cellules souches mésenchymateuses.Ces cellules souches sont pluripotentes et possèdent la capacité de se différencier enadipocyte, en myocyte, en osteocyte, et en chondrocyte (Figure 1) (Markert et al., 2009; Parket al., 2008).MSC(Mesenchymal Stem Cell)White adipocyteprecursorBrown adipocyte/muscleprecursorOsteoblastChondroblastWhite adipocyte Brown adipocyte Myocyte OsteocyteChondrocyteFigure 1 : Origine du tissu adipeux (Adapté de Park et al., 2008)Les cellules souches mésenchymateuses sont pluripotentes et possèdent la capacité de se différencieren différents types cellulaires. Sous linfluence de différents facteurs de transcription (PPAR, Myo D,Run X2, ), ces cellules se différencieront en adipocyte blanc ou brun, en myocyte, en ostéocyte, ouen chondrocyte.On distingue généralement 2 types de tissu adipeux qui diffèrent de par leur fonction et leurlocalisation (Figure 1). On retrouve ainsi :1)-le tissu adipeux blanc, qui est un organe de réserve énergétique. Lorsque les apportsénergétiques sont supérieurs aux dépenses de lorganisme, ce tissu permet le stockage delexcès calorique sous forme de triglycérides (également appelés triacylglycérols) par le13

processus de lipogenèse (Figure 2). A linverse, lorsque les apports caloriques sontinsuffisants, lorganisme mobilise ces triglycérides libérant ainsi des acides gras, cest lalipolyse. Ces derniers sont alors relargués dans la circulation pour être acheminés vers lestissus consommateurs en énergie (muscles, cur) afin dêtre oxydés dans les mitochondriesvia le processus de boxydation des acides gras.ESTERIFICATIONGlycérol + 3 acides gras Triglycéride + 3 H2OFigure 2 : Schéma de la formation dun triglycérideDurant la formation dun triglycéride, les trois fonctions alcools portées par le glycérol sestérifientavec la fonction acide de trois acides gras. Cette réaction conduit à la formation dun triglycéride et àla libération de trois molécules dH20.Le tissu adipeux blanc joue également un rôle majeur au niveau de lorganisme puisquilsécrète différents facteurs (hormones) impliqués dans de nombreux processus physiologiquescomme la régulation de lappétit, la réponse inflammatoire, langiogenèse (Lefterova andLazar, 2009).Chez lhomme, il est essentiellement situé sous la peau (graisse sous-cutanée) et dans la cavitéabdominale (graisse abdominale) et dans certains organes tels la prostate et le sein.2)-le tissu adipeux brun, qui contrôle le processus de thermorégulation.Ce tissu contient moins de lipides que le tissu adipeux blanc. Cependant les adipocytes brunssont riches en mitochondries qui possèdent un pigment respiratoire de couleur brune quiconfère sa couleur au tissu. Ces dernières expriment la protéine UCP1 (Uncoupling protein-1), un transporteur situé dans la membrane interne mitochondriale, qui leur permet deproduire de la chaleur au lieu de fournir uniquement de lénergie sous forme dATP14

(Adenosine triphosphate). Cette protéine UCP1 permet lentrée des protons dans la matricemitochondriale et dissipe le gradient de protons généré par la chaîne respiratoire. L'énergielibérée par ce découplage entre la respiration cellulaire et la phosphorylation de l'ATP estdissipée sous forme de chaleur. Ce tissu est important chez le nouveau né car il permet derésister au choc thermique dû à la naissance. Chez ladulte il est très faiblement présent et sesitue autour de certains organes comme les reins, le cur ou encore le creux de laisselle.2) Ladipocytea. MorphologieLes adipocytes du tissu adipeux blanc sont des cellules sphériques, d'un diamètre de100 micromètres voire plus. On retrouve à lintérieur de ces cellules une volumineuse vacuolelipidique unique composée de triglycérides (Schaefer et al., 1983), repoussant à la périphériede la cellule le noyau, le cytoplasme ainsi que certains organites cellulaires (appareil de Golgi,réticulum endoplasmique granulaire, réticulum endoplasmique lisse, mitochondries) (Figure3). Les adipocytes présentent une seule grande goutte lipidique et de ce fait le tissu adipeuxblanc est aussi appelé uniloculaire à linverse du tissu adipeux brun qui est multiloculaire.VacuolelipidiquenoyaumitochondrieFigure 3 : Schéma de microscopie électronique représentant un adipocyte blanc(Daprès Histologie, les tissus, Poirier et al., Masson 2006)Les adipocytes blancs possèdent une volumineuse et unique vacuole lipidique qui occupe la majeurepartie du cytoplasme, repoussant à la périphérie de ces cellules le noyau ainsi que les organitescellulaires.15

Le tissu adipeux blanc est organisé en lobules délimités par des septa de tissu conjonctif lâcherichement vascularisés et innervés. Dans chaque lobule, les adipocytes sont serrés les uns auxautres et ils présentent une forme polygonale (Figure 4).Figure 4 : Coupe histologique de tissu adipeux blancLe tissu adipeux blanc est divisé en lobules par de fines cloisons de tissu conjonctif fibreux lâche. Ceslobules qui contiennent les adipocytes sont richement innervés et vascularisés. Dans le tissu adipeuxblanc, les adipocytes, tassés les uns contre les autres, prennent une forme polyédrique.b. La lipogenèseLa lipogenèse correspond à lensemble des voies métaboliques conduisant à laformation des triglycérides dans les adipocytes (Figure 7). En effet, les adipocytes accumulentlessentiel des graisses sous forme de triglycérides (Arner, 2005; Barbaras et al., 1985). Cestriglycérides sont constitués de trois molécules dacides gras reliées à un glycérol par desliaisons esters (Figure 2). Ils constituent une forme de mise en réserve hautement concentréeen énergie. En effet, lors de la lipolyse, le rendement de loxydation complète des acides grasest denviron 9 kcal/g, par comparaison au 4 kcal/g environ des glucides et des protéines.Les acides gras proviennent majoritairement de la circulation via les apports alimentaires, etdans une faible proportion de la synthèse de novo des acides gras (Figure 5).16

Cette synthèse de novo a lieu dans les adipocytes et dans les hépatocytes, mais restecependant à un niveau très faible (Large et al., 2004; Sjostrom, 1972). La contribution desadipocytes à la néosynthèse des acides gras est moins bien définie chez lhomme que chez lasouris (Large et al., 2004). Cependant les enzymes clés dans la synthèse des acides gras, lafatty acid synthase et lacetyl coenzyme A carboxylase 1 sont exprimés dans le tissu adipeuxhumain (Angel and Bray, 1979; Letexier et al., 2003; Shrago et al., 1971; Shrago et al., 1969).La principale source dacides gras provient du plasma soit à partir des acides gras nonestérifiés liés à lalbumine plasmatique, soit à partir dacides gras estérifiés incorporés dansles lipoprotéines riches en triglycérides (principalement les chilomicrons et les VLDLs (VeryLow Density Lipoproteins)) durant la période qui suit la prise alimentaire (Large et al., 2004)(Figure 7). Ces lipoprotéines riches en triglycérides vont interagir avec des récepteurs de lafamille des LDLs, principalement le récepteur aux VLDLs qui est exprimé au niveau du tissuadipeux et qui lie les lipoprotéines riches en Apolipoprotéine E tels que les VLDL et leschylomicrons. Les acides gras sont relargués à partir des triglycérides présents dans ceslipoprotéines. Cest la lipoprotéine lipase qui hydrolyse ces triglycérides (Mead et al., 2002).Son expression ainsi que son activité sont augmentées après la prise alimentaire. Cetteenzyme travaille de concert avec le récepteur aux VLDLs. Des études chez des sourisdéficientes en récepteur aux VLDLs présentent une masse graisseuse réduite, ainsi quunerésistance à lobésité, soulignant son rôle au niveau de la lipogenèse (Goudriaan et al., 2001).Le glycérol-3P (Glycérol-3Phosphate) qui sestérifie avec les acides gras libres pour formerles triglycérides provient soit de la glycérogenèse (à partir de substrat tel le pyruvate), soit duglucose après la première étape de la glycolyse (Reshef et al., 2003). Le glucose rentre dansles adipocytes grâce aux transporteurs de glucose situés au niveau de la membrane plasmique,Glut1 et Glut4 (Figure 7).La principale hormone régulant la lipogenèse est linsuline. Elle permet daugmenter lentréede glucose dans ladipocyte par le recrutement de transporteur de glucose (Glut4) au niveaude la membrane plasmique (Bryant et al., 2002; Saltiel and Kahn, 2001). Elle inhibeégalement la lipolyse en stimulant la phosphodiesterase 3B (PDE3B) responsable delhydrolyse de lAMPc (Adenosine MonoPhosphate cyclique) (Fukao et al., 2004; Langin,2006b). Linsuline peut également inhiber la lipolyse en activant la protéine phosphatase-1(PP1), qui déphosphoryle la lipase hormono-sensible (HSL Hormone-Sensitive Lipase), uneprotéine qui joue un rôle clé dans la lipolyse, la rendant ainsi inactive (voir chapitre sur lalipolyse).18

c. La lipolyseLa lipolyse est le processus inverse de la lipogenèse. Elle a lieu principalement lorsdes périodes de jeûne. Elle est régulée par les hormones telles les catécholamines et leglucagon (Large and Arner, 1998) (Figure 7). En période de jeûne, ce sont principalement lescatécholamines qui sont responsables de la stimulation de la lipolyse (Langin, 2006a). Ceshormones atteignent les adipocytes via la circulation comme ladrenaline (epinephrine) ou vialinnervation sympathique comme la noradrénaline (norepinephrine). Leur effet lipolytiqueest médié par les récepteurs adrénergiques. Ces récepteurs sont couplés aux protéines G etleur activation par les catécholamines engendre une augmentation de lactivité adenylatecyclase. Cette stimulation de ladenylate cyclase entraine une augmentation de laconcentration dAMPc intracellulaire, conduisant à lactivation de la PKA (Protéine KinaseA) dépendant de lAMPc. La PKA phosphoryle alors la périlipine, une protéine associée à lagouttelette lipidique essentielle pour la régulation de la lipolyse, ainsi que la lipasehormonosensible (HSL) qui se retrouve également activée et hydrolyse les triglycérides. Lestriglycérides sont alors hydrolysés en acides gras et glycérol (Bjorntorp and Ostman, 1971)puis ces derniers sont relargués dans la circulation et transportés vers dautres tissus,principalement vers le foie pour le glycérol et vers les muscles et le cur pour les acides gras(Frayn et al., 2003) où ils seront dégradés dans les mitochondries via le processus de oxydation des acides gras afin de fournir de lénergie sous forme dATP (Figure 6).En conclusion, une fine régulation de la lipogenèse et de la lipolyse est déterminante pour lamaintenance de lhoméostasie énergétique.19

ABFigure 6 : Schéma de la oxydation des acides grasLes acides gras sont dégradés par oxydation au niveau du carbone ( oxydation).(A) La première étape est lactivation des acides gras par liaison avec le Coenzyme A.Lactivation est effectuée dans la membrane mitochondriale externe, la dégradation (oxydation) dansla matrice mitochondriale.(B)Un acyl-CoA saturé est dégradé par une séquence récurrente de 4 réactions:1) Oxydation par le FAD; 2) Hydratation; 3) Oxydation par le NAD+; 4) Thiolyse par le CoA.20

glycolysisPDE3BPP1Figure 7 : Lipogenèse et lipolyse (Adapté de Vazquez-Vela et al. 2008)Ce schéma représente les différentes voies conduisant à la lipogenèse et à la lipolyse dans lesadipocytes. Lexcès de glucose est oxydé par la glycolyse en acetyl-CoA dans ladipocyte, puisconverti en acide gras pour être estérifié dans le réticulum endoplasmique en triglycéride (TG). Cestriglycérides sont ensuite dirigés dans la gouttelette lipidique. Les acides gras captés à partir deslipoprotéines sont également estérifiés en TG et stockés dans la gouttelette lipidique. En condition dejeûne, la lipolyse est activée par des récepteurs couplés aux protéines G, ce qui entraîne uneaugmentation du taux dAMPc, conduisant à lactivation de la Protéine Kinase A (PKA). Cette PKAphosphoryle la périlipine située dans la membrane de la gouttelette lipidique, et également lHormoneSensitive Lipase (HSL), permettant son activation et son transfert à lintérieur de la gouttelettelipidique où elle hydrolysera les diglycérides (DG) (produits par ladipocyte triglyceride lipase(ATGL)) en monoglycérides (MG). Ces MG seront hydrolysés en acide gras et glycérol à lextérieurde la gouttelette lipidique avant dêtre relargués dans la circulation et acheminés vers les tissusconsommateurs en énergie comme le foie, les muscles, le cur.21

d. Ladipocyte : une cellule sécrétriceLes adipocytes ont longtemps été considérés comme des cellules de réserveénergétique relativement inertes. Cependant, les adipocytes sécrètent de multiples facteursappelés adipokines. Parmi ces adipokines, on retrouve des hormones, des cytokines, etdautres protéines ayant des fonctions biologiques spécifiques (Ahima, 2006; Vazquez-Vela etal., 2008) (voir tableau1).Tableau 1 : Facteurs produits par le tissu adipeux blanc(Daprès Ahima RS, 2006)Parmi les adipokines les mieux caractérisées, nous retrouvons la leptine, ladiponectine,langiotensinogène. Certaines de ces protéines ont des effets bénéfiques (leptine etadiponectine) ou délétères (angiotensinogène) pour lorganisme.La première adipokine à avoir été caractérisée est la leptine par léquipe de Friedman et al. en1994 (Zhang et al., 1994). Cette protéine principalement sécrétée par les adipocytes, agit auniveau de lhypothalamus et module le poids corporel, la prise alimentaire, ainsi que le22

stockage des graisses (Wozniak et al., 2009). La fonction de la leptine a été déterminée pardes études sur des souris obèses ayant des dommages au niveau de lhypothalamus. Cestravaux ont permis de montrer que la leptine contrôle la croissance du tissu adipeux via sonaction au niveau du système nerveux central (Maffei et al., 1995). De plus, ladministrationlocale de leptine au niveau des régions hypothalamiques réduit la prise alimentaire et le poidscorporel chez les animaux (Campfield et al., 1995; Vazquez-Vela et al., 2008). Cependant, leshauts niveaux de leptine retrouvés chez les patients obèses naffectent pas la suppression delappétit à cause de la résistance de lhormone dûe à une absence de signalisation du récepteurà la leptine ou un défaut de transport de la leptine au niveau de la barrière hématoencéphalique(Flier, 2004). En plus de son rôle majeur dans le métabolisme, elle joue un rôledans dautres processus physiologiques comme limmunité, ou la fertilité (Huang and Li,2000).Une autre adipokine bien caractérisée est ladiponectine. Cest une protéine de 30 kDasécrétée par le tissu adipeux qui a été identifiée en 1995 (Scherer et al., 1995). Son expressionet celle de ses récepteurs sont fortement diminuées chez la souris obèse, et son tauxplasmatique est inversement corrélé à la résistance à linsuline et au syndrôme métabolique(Yatagai et al., 2003). Ladiponectine augmente la sensibilité à linsuline, diminue linfluxdacides gras non estérifiés, et augmente loxydation des acides gras par le foie et les muscles.De nombreuses études ont également souligné son rôle protecteur dans lathérosclérose(Antoniades et al., 2009; Han et al., 2009b; Kim et al., 2008).Les adipocytes du tissu adipeux blanc représentent une source extra-hépatique majeuredangiotensinogène (AGT) (Ailhaud, 2006). Lhypertension est connue comme étant unecomplication fréquente liée à lobésité. Bien que les mécanismes par lesquels lexcès degraisse entraîne cette hypertension soient mal connus, laugmentation de la production dAGTpourrait contribuer à lélévation de la pression artérielle chez les patients obèses. De plus, desétudes menées chez des souris déficientes en AGT ont montré que sa ré-expression dans letissu adipeux induit la présence dAGT dans le sang et la restauration dune pression sanguinenormale (Massiera et al., 2001).23

3) Ladipogenèsea. Les différentes étapesLadipogenèse correspond à la formation dun adipocyte mature à partir dune celluleprécurseur, ladipoblaste (Vazquez-Vela et al., 2008) (Figure 8).Tout dabord, les adipoblastes, qui présentent un morphotype fibroblastique, prolifèrentjusquà atteindre un stade de confluence marqué par un arrêt de la multiplication cellulaire(Avram et al., 2007; Reichert and Eick, 1999). Cette interruption de croissance est nécessairepour lengagement vers la différenciation adipocytaire des cellules qui deviennent alors despréadipocytes. Les cellules sont alors engagées (commises) dans le processus dedifférenciation qui peut être divisé en évènements précoces et tardifs (Figure 8). Parmi lesévènements précoces, une phase dexpansion clonale, qui se caractérise par plusieurs mitosessuccessives fait suite à cette phase darrêt. Ce retour dans le cycle cellulaire est indispensablepuisque des inhibiteurs du cycle cellulaire (Tang et al., 2003) ou des inhibiteurs de la synthèsede lADN bloquent le processus adipogenique (Richon et al., 1997). On assiste égalementlors de cette phase précoce à des remodelages de la matrice extracellulaire (Gregoire et al.,1998; Kubo et al., 2000), ainsi que du cytosquelette ce qui se traduit par une diminutionimportante de lexpression dactine, tubuline, vimentine, entraînant le changementmorphologique de la cellule (Smas and Sul, 1995; Spiegelman and Farmer, 1982). Lors decette phase, on observe également lexpression de marqueurs précoces, tel que PPAR(peroxisome proliferator-activated receptor gamma). Durant la phase terminale de ladifférenciation, lexpression des enzymes impliquées dans le métabolisme du glucose et deslipides augmente très fortement (de 10 à 100 fois) (Avram et al., 2007; Gregoire et al., 1998).De plus, les cellules acquièrent la sensibilité à linsuline (avec une augmentation destransporteurs du glucose et du nombre des récepteurs à linsuline) et accumulent destriglycérides. Les cellules différenciées expriment aussi des marqueurs spécifiques du tissuadipeux tel que la protéine aP2 (qui est un transporteur des acides gras), ou la périlipine.Enfin, les adipocytes produisent et sécrètent de nombreuses protéines qui leur sont spécifiquescomme la leptine, langiotensinogène, ladipsine, conférant à ce tissus sa fonction endocrine(Avram et al., 2007) (Figure 8).24

Type cellulaireEtapeCellule souchemésenchymateuseDéterminationRemodelage de la MEC etdu cytosqueletteC/EBP, -PPARγC/EBPαPrécoceAdipoblasteArrêt de croissancePréadipocyteExpansion clonaleGènesadipocytairesDifférenciationTardifEnzymes lipogéniquesEnzymes lipolytiquesFacteurs sécrétésAdipocytematureFigure 8 : Schéma représentant les différentes étapes de ladipogenèseLes cellules souches mésenchymateuses, sous linfluence de certains facteurs sengagent dans leprocessus adipogénique et deveniennent des adipoblastes. Ces cellules vont proliférer jusquàatteindre un état de confluence, marqué par un arrêt de croissance cellulaire. Les cellules vont alorsdevenir des préadipocytes. Cette étape est suivie dune expansion clonale qui se traduit par plusieursmitoses successives. Au cours du processus adipogenique, les cellules vont également changer demorphologie grâce à une réorganisation des protéines du cytosquelette ainsi que de la matrice extracellulaire.Enfin les cellules entrent dans le processus de différenciation terminal et expriment lesenzymes nécessaires à la lipogenèse et à la lipolyse et acquièrent la capacité à synthétiser et sécréterles adipokines.25

. Les facteurs de transcriptionLa différenciation des préadipocytes en adipocytes est régulée par différents facteursde transcription qui vont engendrer lexpression coordonnée de centaines de protéines quipermettront lengagement et le maintien du phénotype terminal des adipocytes (Farmer, 2006)(Figure 8). Cette reprogrammation génétique complexe est contrôlée par des hormones, descytokines, des nutriments, des molécules de signalisation qui vont changer le niveaudexpression ou lactivité de facteurs de transcription qui en retour réguleront le processus dedifférenciation des adipocytes. Parmi les principaux facteurs de transcription régulantladipogenèse, on retrouve notamment PPAR (peroxisome proliferator-activated receptorgamma), et des membres de la famille des C/EBPs (CCAAT/enhancer-binding proteins)(Figure 9).PPAR appartient à la superfamille des récepteurs hormonaux nucléaires ; il est exprimé dansde nombreux tissus et joue un rôle majeur dans la différenciation adipocytaire. Il existe 2isoformes de PPAR (PPAR1, PPAR2,). PPAR1 est exprimé dans de nombreux typescellulaires à des niveaux assez faibles, alors que PPAR2 est principalement exprimé dans lesadipocytes à des taux élevés (Feve, 2005). PPAR shétérodimérise avec le récepteur RXR(Retinoid X Receptor) et lie lADN au niveau de séquences consensus composées dune seulerépétition de lhexamère AGGTCA séparée par un nucléotide. Cette séquence consensus estappelée élément de réponse à PPAR (PPAR reponsive element). Récemment, les basesmoléculaires de la liaison de lhétérodimère à cette séquence consensus ont été élucidéesgrâce à des études cristallographiques (Chandra et al., 2008). Bien que la nature précise desligands endogènes de PPAR ne soit pas encore bien établie, il a été décrit que certains acidesgras ainsi que leurs métabolites, telle la prostaglandine D2 qui dérive du métabolisme delacide arachidonique (Forman et al., 1995; Kliewer et al., 1995) sont capables dactiverPPAR (Tsai and Maeda, 2005). La plupart des gènes cibles de PPAR sont impliqués dans lemétabolisme des lipides et du glucose.De façon intéressante, des études ont démontré que lexpression de PPAR est nécessaire etsuffisante au déclenchement du processus adipogénique. En effet, lexpression ectopique dePPAR dans les fibroblastes (Tontonoz et al., 1994; Tontonoz et al., 1995) ou les myoblastes(Hu et al., 1995) induit ladipogenèse. Limportance de PPAR dans le développement dutissu adipeux a également été démontrée grâce aux modèles murins. Labsence de cetteprotéine chez la souris savère létal au stade embryonnaire. Cependant, une délétion dePPAR au niveau du tissu adipeux inhibe le développement du tissu adipeux ainsi quunstockage ectopique des graisses au niveau du foie (hépatostéatose) (Jones et al., 2005). Il a26

également été décrit dans des modèles de souris déficientes en PPAR2 que PPAR1 peutcompenser cette absence et permettre le développement du tissu adipeux bien queladipogenèse ex-vivo de MEFs ou de pré-adipocytes déficients en PPAR2 soit fortementdiminuée (Medina-Gomez et al., 2005; Zhang et al., 2004b). Enfin, PPAR est égalementnécessaire à la survie des adipocytes matures puisque son extinction conduit à la mortcellulaire (Imai et al., 2004). A lheure actuelle, aucun facteur pouvant permettreladipogenèse en absence de PPAR na été décrit soulignant son rôle capital dans ceprocessus (Lefterova et al., 2008).Lautre grande famille des facteurs de transcription impliqués dans ladipogenèse est lafamille des C/EBPs, avec notamment C/EBP, , . C/EBP et sont les premiers à êtreexprimés au cours de ladipogenèse et induisent en retour lexpression de PPAR et deC/EBP (Figure 9).PPARγResponseElementC/EBP-ResponseElementC/EBP-ResponseElementPPARγResponseElementFigure 9 : Modèle de laction transcriptionelle des facteurs de transcriptionPPARγ et C/EBP (Adapté de Lefterova et al., 2009)Durant les étapes précoces de ladipogenèse, C/EBP et activent lexpression de PPAR, C/EBP etdautres gènes adipogéniques en se fixant sur leur élément de réponse (C/EBP Response Element).Les gènes caractéristiques des adipocytes matures sont quant à eux régulés par PPAR (après sonhétérodimérisation avec RXR) et par C/EBP-α.La surexpression des facteurs C/EBP et dans les préadipocytes augmente la différenciationadipocytaire. Par contre, des MEFs déficientes en C/EBP, ou C/EBP présentent un niveaude différenciation diminué par rapport aux souris sauvages (Feve, 2005). Ils sont aussiresponsables de larrêt du cycle cellulaire via la surexpression de p21 (un inhibiteur des CDKs(Cyclin Dependant Kinase) générant une diminution de la phosphorylation de la protéine durétinoblastome (protéine Rb). Cette hypo-phosphorylation de la protéine Rb stimule larrêt ducycle cellulaire.27

Lexpression de C/EBP est quant à elle plus tardive et survient après lexpression de PPAR(Figure 9). C/EBP est fortement exprimé dans les adipocytes matures où il joue un rôlecrucial dans la prise de glucose dépendant de linsuline (Wu et al., 1999). Il a été décrit quedes MEFs déficientes en C/EBP sont incapables de se différencier en adipocyte, mais que cedéfaut est compensé en sur-exprimant PPAR2 (Wu et al., 1999). En revanche, lasurexpression de C/EBP dans des MEFs déficientes en PPAR ne permet pas de rétablir leprocessus adipogénique (Rosen et al., 2002). Lensemble de ces travaux montre que PPAR2est le régulateur clé de ladipogenèse et que C/EBP permet de maintenir le taux élevé dePPAR2.En conclusion, il est important de souligner que PPAR et les C/EBPs sont les facteurs detranscription essentiels à la différenciation adipocytaire et quils agissent de concert afin degénérer ladipocyte mature (Feve, 2005). Le mécanisme moléculaire précis par lequel ilscoopèrent reste encore à être élucidé (Lefterova and Lazar, 2009).c. Rôle des protéases dans ladipogenèseDes travaux réalisés au cours des 10 dernières années montrent limplication decertaines protéases dans le processus adipogénique. Leur action se ferait en grande partie viale remodelage de la matrice extra-cellulaire (MEC). En effet, au cours de la différenciationadipocytaire, on observe un profond changement des composés de la MEC, et ce remodelageest indispensable à la suite du processus adipogénique. Lexpression de certains composéscomme la fibronectine, lintégrine , le collagène de type I et III est régulée négativementalors que dautres sont surexprimés comme le collagène de type IV ou lentactine (nidogène)(Lilla et al., 2002; Smas and Sul, 1995). On sait aujourdhui que ces composants jouent unrôle crucial dans ce processus puisque lorsque des préadipocytes sont cultivés sur une matricede fibronectine, ils sont incapables de se différencier, suggérant que la fibronectine pourraitréguler lexpression de certains gènes ou de certaines enzymes lipogéniques (Spiegelman andGinty, 1983). Elle pourrait également interférer avec les protéines du cytosquelette empêchantles changements morphologiques nécessaires à lexpression de nouveaux gènes. Il a été décritque les MMPs et plus particulièrement les MMP2 et 9 sont impliquées dans le processus dedifférenciation adipocytaire. En effet, lorsque les préadipocytes sont traités à laidedinhibiteurs des MMPs ou danticorps neutralisants anti-MMP2 et 9, on observe une fortediminution de la différenciation adipocytaire (Bouloumie et al., 2001; Chavey et al., 2003;Croissandeau et al., 2002). Ceci se traduit par une absence dinduction de marqueurs de ladifférenciation adipocytaire (PPAR et adipsine), une baisse de laccumulation des28

triglycérides dans les cellules, ainsi quune absence de dégradation du réseau de fibronectine(Croissandeau et al., 2002). De plus, des cultures primaires de préadipocytes humains traitéespar un inhibiteur des MMP-2 et MMP-9 (Batimastat) présentent une très forte diminution dela différenciation adipocytaire (Bourlier et al., 2005).Il a également été décrit que des souris traitées par du galardin, un inhibiteur à large spectredes MMPs, et soumises à un régime hyper-lipidique, présentent des dépôts graisseuxgonadiques et sous-cutanés significativement diminués par rapport au groupe non traité(Lijnen et al., 2002). Il semblerait que la croissance et le développement du tissu adipeuxsoient limités par la formation dune matrice de collagène entourant les cellules, suggérant unrôle fonctionnel pour les MMPs dans le développement du tissu adipeux.Plus récemment, des travaux sur les cystéines cathepsines K (cath-K) (Funicello et al., 2007;Han et al., 2009a; Xiao et al., 2006; Yang et al., 2008), L (cath-L) (Yang et al., 2007) et S(cath-S) (Taleb et al., 2006) mettent en exergue leur implication dans ladipogenèse.Lutilisation dinhibiteurs spécifiques de ces protéases suggère également que leur action seferait via le remodelage de la matrice extracellulaire, plus précisément via la dégradation duréseau de fibronectine (Taleb et al., 2006; Yang et al., 2008; Yang et al., 2007). Les travauxplus récents de Han et al. suggèrent que la cath-K pourrait aussi réguler la différenciation desadipocytes en dégradant le collagène de type I (Han et al., 2009a).De plus, des études in vivo utilisant des souris déficientes en cath-L ou en cath-K ont montréque ces souris deviennent partiellement résistantes à lobésité induite par un régime hyperlipidiqueen comparaison avec le groupe de souris sauvages, soulignant le rôle potentiel de cesprotéases dans le contrôle de laccumulation du tissu adipeux (Funicello et al., 2007; Yang etal., 2007).Pour finir, la cath-S a récemment été identifiée comme étant un nouveau bio-marqueur sécrétépar le tissu adipeux (Taleb et al., 2006). Lexpression de son ARN messager dans le tissuadipeux sous-cutané ainsi que ses taux circulants sont positivement corrélés avec lindice demasse corporel (IMC), faisant de cette protéine un nouveau marqueur potentiel de lobésité.De façon paradoxale, il a été décrit que la MMP11 (stromélysine3) est puissant régulateurnégatif de ladipogenèse (Andarawewa et al., 2005). Ces travaux réalisés dans le cadre duneétude sur le cancer du sein, suggèrent que les cellules cancéreuses induisent la sécrétion destromélysine3 par les adipocytes situés au niveau du front invasif des tumeurs, ce qui enretour entraînerait une « dédifférenciation » de ces adipocytes, aboutissant à laccumulationdune population de fibroblastes péri-tumoraux particuliers. De façon intéressante, les sourisdéficientes en stromélysine3 présentent un poids corporel plus élevé ainsi quun excès de tissu29

adipeux. Les analyses histologiques ont révélé que le diamètre des adipocytes des sourisdéficientes en stromélysine3 est plus grand que celui des souris sauvages, indiquant unehypertrophie de ces adipocytes. On retrouve également une augmentation de lexpression delARN messager de marqueurs adipogéniques tel que PPAR ou la protéine aP2 au niveau dutissu adipeux des souris déficientes en stromélysine3.Lensemble de ces travaux souligne le rôle primordial des protéases dans le processusadipogenique, via le contrôle de la composition et/ou de lorganisation de la MEC.Cependant, cet effet pourrait également être induit par la libération et lactivation de facteursde croissance emprisonnés dans la MEC, ou par la dégradation dinhibiteurs de croissance.4) Obésité, micro-environnement et cancera. Le micro-environnementLes cellules épithéliales évoluent dans un contexte tissulaire dynamique, appelé microenvironnement,contenant des cellules stromales (fibroblastes, macrophages, lymphocytes,adipocytes et cellules endothéliales) entourées de matrice extra-cellulaire (Mueller andFusenig, 2004) (Figure 10).De nombreux travaux ont souligné limportance du stroma dans la progression tumorale. Lespremiers travaux ont permis détablir le rôle majeur de la néo-angiogenèse tumorale dans laprogression et la dissémination des tumeurs (Folkman and Kalluri, 2004). En effet,langiogénèse joue un rôle important dans la progression du cancer car les tumeurs solides, audelà dune certaine taille (1 à 2 mm de diamètre) ne peuvent plus grandir ni sétendre car ellesne sont pas vascularisées (Folkman, 2003). Les cellules au centre de la tumeur solide ontbesoin doxygène (O 2 ) et de nutriments mais également doivent pouvoir se débarrasser desdéchets métaboliques. Dautres composants du stroma ont été identifiés comme des acteursimportants de la progression tumorale comme les myo-fibroblastes ou les macrophages(Mueller and Fusenig, 2004). Leur implication dans la progression tumorale dépendprincipalement de leur capacité à sécréter des facteurs de croissance, des composants de lamatrice extra-cellulaire permettant laugmentation de la migration des cellules tumorales ainsique des sérines protéases et des métallo-protéases permettant la dégradation et le remodelagede la matrice extra-cellulaire (De Wever et al., 2004; Mueller and Fusenig, 2004; Sato et al.,2004; Sieuwerts et al., 1998).30

Cependant, le rôle de ce micro-environnement tumoral ne semble pas limité à un soutien à laprogression tumorale dans le cadre dune tumeur établie mais pourrait activement participeraux étapes précoces du processus de carcinogenèse (Bissell and Labarge, 2005; Elenbaas andWeinberg, 2001; Tlsty, 2001; Wiseman and Werb, 2002). Les premiers travaux montrent quedes myofibroblastes obtenus à partir de tumeurs prostatiques stimulent la transformationtumorale des cellules épithéliales (Olumi et al., 1999).Parmi les cellules qui constituent le stroma tumoral, les adipocytes sont probablement cellesdonc le rôle a été le moins bien caractérisé malgré le fait quils représentent un des typescellulaires prédominant du micro-environnement de certaines tumeurs comme le cancer dusein (Wiseman and Werb, 2002). Des études récentes suggèrent que les adipocytesfavoriseraient la progression tumorale mammaire (Iyengar et al., 2003) et pourraient jouer unrôle dans les étapes précoces de la carcinogenèse mammaire (Iyengar et al., 2005). Cesrésultats pourraient sexpliquer par la capacité des adipocytes à sécréter de nombreux facteursincluant des facteurs de croissance, de nombreuses cytokines ou adipokines, des protéasesainsi que certains composés de la matrice extra-cellulaire comme le collagène VI (Iyengar etal., 2005; Rajala and Scherer, 2003).31

adipocyteFigure 10 : Schéma représentant les différents types cellulaires qui composent lemicroenvironnement tumoral (Daprès (Mohamed and Sloane, 2006)).b. Obésité et cancerLe tissu adipeux nest pas seulement un organe de réserve. En effet, il intervient dansdivers processus physiologiques (métabolisme du glucose, appétit, réponse inflammatoire,angiogenèse, pression sanguine, fonction reproductive) via la sécrétion de nombreusesadipokines. La dérégulation de la sécrétion de ces molécules, constatée en cas dobésité,pourrait être responsable de certaines pathologies. En effet, lobésité, qui se caractérise parune hypertrophie et une hyperplasie des adipocytes, est fréquemment associée à certainespathologies comme le diabète de type 2, lhypertension, lathérosclérose (Bluher, 2009). Deplus, lobésité et les désordres métaboliques qui en découlent sont associés à un risque accrude développer certains types de cancer comme le cancer du colon, de la vésicule biliaire, durein, du pancréas, ainsi que le cancer du sein chez la femme ménopausée (Asseryanis et al.,2004; Reeves et al., 2007; Renehan et al., 2008; Rose et al., 2004; van Kruijsdijk et al., 2009).32

De récentes enquêtes épidémiologiques appuient le fait que lobésité est un facteur de risquepour ces cancers (Pan and DesMeules, 2009; Renehan et al., 2008).Ces dernières années, de nombreux travaux ont été réalisés afin de comprendre le rôle desadipocytes dans la progression tumorale. Il a été décrit que des milieux conditionnés issus deculture dadipocytes sont capables de stimuler la croissance des cellules cancéreusesmammaires MCF7 et également dinduire des programmes transcriptionnels anti-apoptotiques(Iyengar et al., 2003). Très récemment, il a été rapporté que le milieu conditionnédadipocytes stimule la migration et la capacité invasive des cellules de cancer du sein MDA-MB-231 via la production de la chimiokine CCL20 (Kim et al., 2009). Dautre part, desexpériences de coculture dans des matrices de collagène entre des adipocytes et des cellulesde cancer du sein (Manabe et al., 2003) ou de cancer de colon (Amemori et al., 2007) ontmontré que les adipocytes favorisent la prolifération de ces cellules cancéreuses.Les mécanismes par lesquels lobésité participe au processus carcinogénique sont encore malconnus. Cependant, de nombreuses études indiquent la participation de certaines adipokinesdans ce processus. Ainsi la leptine, dont le taux plasmatique est augmenté chez les patientsobèses (Munzberg and Myers, 2005), stimule (Vona-Davis and Rose, 2007) la croissance descellules de cancer du sein, de lsophage, de la prostate, mais inhibe la croissance des cellulesde cancer du pancréas (Housa et al., 2006; Somasundar et al., 2003). Son effet antiapoptotiquea également été décrit dans les cellules de cancer de colon et de prostate (vanKruijsdijk et al., 2009). A linverse, ladiponectine, dont le taux plasmatique est inversementcorrélé avec lindice de masse corporelle (IMC), a un effet anti-mitogène (Vona-Davis andRose, 2007) en diminuant la prolifération cellulaire et en augmentant lapoptose (Dieudonneet al., 2006). Dans le cadre du cancer du sein, il a été suggéré quune autre adipokine,laromatase, serait impliquée dans le processus carcinogénique. Cette enzyme catalyse labiosynthèse des strogènes à partir des androgènes. La biosynthèse des strogènes diffèreentre la femme pré-ménopausée et la femme ménopausée (Cleary and Grossmann, 2009).Avant la ménopause, la principale source dstrogènes provient des ovaires. Par contre, chezla femme ménopausée, cette biosynthèse se fait à partir de tissus périphériques tel le tissuadipeux. Les enquêtes épidémiologiques ont souligné quun taux élevé dstrogèneplasmatique augmente le risque de développer un cancer du sein chez la femme ménopausée(Kaaks et al., 2005; Kendall et al., 2007; Missmer et al., 2004). Chez la femme ménopausée etobèse, le tissu adipeux représente la principale source dstrogène, cest pourquoi laromataseserait un bon candidat pour comprendre la relation entre lobésité et le risque de développerun cancer du sein chez la femme ménopausée.33

II. La cathepsine-D1) Synthèse, maturation et adressage lysosomal de la cath-Da. Régulation de la transcription de la cath-DLa cathepsine-D (cath-D) est une aspartyl-endopeptidase lysosomale ubiquitaire activeà pH acide. Le gène de la cath-D contient 9 exons et est localisé sur le bras court du 11 èmechromosome, en 11p15 (Augereau et al., 1988; Redecker et al., 1991). La transcription de cegène conduit à la formation dun ARNm de 1988 bases (Minarowska et al., 2008). Il a étédécrit que le promoteur de la cath-D est un promoteur mixte (Cavailles et al., 1993; Zaidi etal., 2008). En effet comme de nombreux gènes eucaryotes régulés (appelés regulated genes),il comporte une boite TATA (TATA box) (séquence riche en adénine et thymine), qui permetla liaison au facteur de transcription IID (Transcription Factor II-D TFII-D) et linitiation dela transcription. Cette région promotrice contient également de multiples boites GC (GC box)(séquence riche en guanine et cytosine), comme de nombreux gènes de ménage (appeléshouse-keeping genes), tels les gènes codants pour les enzymes lysosomales. Ces GC box sontdes sites putatifs de liaison à certains facteurs de transcription comme Sp1. Il a été décrit quela transcription de la cath-D est initiée à partir de cinq sites principaux dinitiation de latranscription (transcription starting site TSS). Lexpression ubiquitaire de cath-D, chezlhomme, est indépendante de la TATA box (TATA-independent) et débute sur lun des TSS(TSS-II à -V) en amont de la TATA box et est probablement contrôlée par les GC box et lefacteur Sp1 comme pour de nombreux gènes de ménage (Cavailles et al., 1993; Zaidi et al.,2008). Par contre, dans les lignées cellulaires de cancer du sein MCF7 qui expriment lerécepteur aux strogènes (RE), il a été décrit un élément de réponse aux strogènes (ERE) auniveau du promoteur (fragment situé de -365 à -122) de la cath-D (Augereau et al., 1994;Cavailles et al., 1991). Linduction de la cath-D par les oestrogènes est réalisée parlinteraction du RE sur son ERE.Ceci demande également laction dautres éléments situés en amont et en aval de cet ERE(Augereau et al., 1994). Dans ce cas la transcription dépend de la TATA box (TATAdependent) et débute 28 paires de bases en aval de la TATA box (TSS-I) (Figure 11).34

Figure 11 : Schéma représentant la région promotrice de la cath-D (daprès Zaidi 2008)En condition basale, lexpression de la cath-D humaine est TATA-independent et débute sur lun desTSS (transcription stating site) (TSS-II à V) et est dirigée par les GC box et le facteur Sp1. Dans lescellules de cancer de sein stimulées par les oestrogènes, la transcription est TATA-dependent etdébute à partir du TSS-I. La partie inférieure de la figure représente une comparaison schématique dela longueur des différents ARN messagers de la cath-D.En résumé, le promoteur de la cath-D présente une structure mixte ayant les caractéristiques àla fois des gènes de ménages (GC box) et des gènes régulés (TATA box). Le gène de la cath-Dpeut ainsi à la fois être exprimé constitutivement à partir de sites dinitiation de latranscription indépendants de la TATA box, et aussi être surexprimé dans certaines conditionsphysiologiques tel le développement ou le remodelage de certains tissus via une transcriptiondépendante de la TATA box.b. Structure et maturation protéolytique de la cath-DLa cath-D est synthétisée dans le réticulum endoplasmique rugueux (RER) sous formedune pré-pro-enzyme de 412 acides aminés et va subir des glycosylations et de nombreuxclivages protéolytiques au cours de son routage lysosomal. Après synthèse et protéolyse dupeptide signal (20 acides aminés N-terminaux), la cath-D est sous la forme dune pro-enzymeprotéolytiquement inactive de 52 kDa. Sous laction des cystéines-protéases (autres que lescath-B et -L) et non par auto-activation, elle est maturée en plusieurs formes intermédiaires52-48 kDa, pour aboutir à une forme intermédiaire active simple chaîne de 48 kDa (Laurent-Matha et al., 2006). Cet intermédiaire est ensuite clivé, par des cystéines-protéases telles que35

les cath-B et L, en une forme mature à deux chaînes de 34 kDa, en position C-terminale, et14 kDa en position N-terminale (Laurent-Matha et al., 2006). Les deux chaînes sassocient defaçon non covalente via des liaisons de types hydrophobes. La maturation des deux chaînesest complétée par des amino-peptidases et des carboxy-peptidases (Faust et al., 1985) (Figure12).Figure 12 : Maturation intracellulaire de la cath-D (daprès Laurent-Matha et al.,2006)La cath-D est synthétisée dans le RER sous forme dune pré-pro-enzyme de 412 acides aminés qui vasubir plusieurs clivages protéolytiques lors de sa maturation. Ainsi, après la perte du peptide signal,la pro-cath-D est maturée en plusieurs formes intermédiaires 52-48 kDa, pour aboutir à une formesimple chaîne active de 48 kDa. Cet intermédiaire est ensuite clivé par des cystéines protéases, tellesque les cath-B et L, en une forme mature à deux chaînes de 14 kDa en position N-terminale, et de 34kDa en position C-terminale. La maturation des deux chaînes est complétée par des amino- etcarboxy-peptidases.De plus, il est décrit quà pH acide, in vitro, la procath-D sécrétée sautoactive en pseudocath-Dprésentant une activité protéolytique. Elle présente un poids moléculaire apparent de36

51 kDa, et possède 18 résidus (27-44) du pro-fragment résultant du clivage de ce pro-peptideentre la Leucine 26 et lIsoleucine 27 (Capony et al., 1987; Richo and Conner, 1994).Cependant, cet intermédiaire de 51 kDa na pas encore été observé in vivo (Laurent-Matha etal., 2006; Richo and Conner, 1994).Le site catalytique de la cath-D contient deux acides aspartiques (33 et 231) situés dans uneséquence bien conservée de type Asp-Thr-Gly et localisés respectivement sur les chaînes 14 et34 kDa. Daprès létude de la structure tridimensionnelle de la cath-D de 48 kDa parcristallisation, ces deux acides aspartiques situés au niveau du site catalytique se font face(Metcalf and Fusek, 1993; Metcalf and Fusek, 1995).A lheure actuelle, aucun inhibiteur endogène de lactivité protéolytique de la cath-D na étéencore mis en évidence dans les cellules mammifères. Cependant, une étude récente à révéléque la maspine, une protéine sécrétée inhibe la dégradation de la matrice extra-cellulaire parde la cath-D (Khalkhali-Ellis and Hendrix, 2007). Toutefois, le mécanisme précis de cetteinhibition reste à être déterminé car aucun effet direct na été démontré. Le seul inhibiteurnaturel des aspartyl-protéases, la pepstatine A, a été isolé à partir dactinomycètes (Umezawaet al., 1970). Il est utilisé en routine pour étudier la fonction de la cath-D in vitro et pour sapurification par chromatographie daffinité (Metcalf and Fusek, 1993). La cristallisation de laforme mature active (Baldwin et al., 1993) et de la forme inhibée par la pepstatine A de lacath-D humaine (Metcalf and Fusek, 1993) montre lexistence de similitudes entre la structure3D de la cath-D et celle des autres aspartyl-protéases (la pepsine, la rénine et la protéase duvirus HIV, par exemple). Ces enzymes adoptent une structure bilobulaire. A lheure actuelle,il nexiste pas de structure 3D de la forme précurseur de la cath-D.c. Adressage lysosomalLa maturation intracellulaire de la pro-cath-D se déroule lors de son routage vers leslysosomes et comprend plusieurs étapes conduisant à la synthèse dune enzyme active(Erickson, 1989). Lors de son transit dans lappareil de golgi, la pro-enzyme est glycosyléesur certains résidus asparagine par addition doligosaccharides de type oligomannosique. Elleest ensuite reconnue de façon concertée par deux enzymes qui assurent la formation du signalMannose-6-Phosphate (M6P) (Baranski et al., 1992; Cantor et al., 1992) qui permettra laliaison ultérieure des hydrolases à des récepteurs du Mannose-6-Phosphate (RM6P)spécifiques dans le réseau trans-Golgien qui assurent son transport vers les lysosomes(Kornfeld, 1990) (Figure 13).37

Il existe deux RM6P : le RM6P/IGFII, ou grand récepteur ou récepteur cation indépendant, aun poids moléculaire de 275 kDa. Le second de 46 kDa se nomme le petit récepteur, ou lerécepteur cation dépendant. Ces récepteurs sont des glycoprotéines trans-membranairescomprenant une séquence signal, un domaine extra-cytoplasmique N-terminal, une régiontransmembranaire hydrophobe et un petit domaine cytoplasmique C-terminal. Cest leRM6P/IGFII qui réalise en majorité ladressage lysosomal de la cath-D car son affinité pourla protéase est supérieure à celle du petit récepteur (Ludwig et al., 1994; Ludwig et al., 1993).En effet, des fibroblastes nexprimant plus le récepteur RM6P/IGFII hypersécrètent la procath-D(Ludwig et al., 1994). Ce récepteur est aussi responsable de lendocytose de la procath-Dsécrétée (Stein et al., 1987) (Figure 13).Bien que les récepteurs du M6P soient les partenaires les mieux connus pour ladressagelysosomal, il existe dautres systèmes transportant les hydrolases aux lysosomes (Rijnboutt etal., 1991).En effet, plusieurs études ont décrit une association membranaire de la pro-cath-D et untransport lysosomal indépendant des RM6P (Diment et al., 1988; McIntyre and Erickson,1991; McIntyre and Erickson, 1993). Dans la lignée cellulaire HepG2, il existe uneassociation membranaire de la pro-cath-D indépendante des RM6P et une interaction avec lapro-saposine (Zhu and Conner, 1994).Dans le cancer du sein, la surexpression de la cath-D induit lhypersécrétion de la pro-enzymeet un ralentissement de son routage intra-cellulaire, avec une accumulation des formes activesintracellulaires de la cath-D dans les endosomes et les lysosomes (Capony et al., 1989).Lendocytose de la pro-cath-D sécrétée dans les cellules cancéreuses mammaires se fait par lavoie classique du RM6P/IGFII, mais également par un récepteur alternatif encore nonidentifié (Laurent-Matha et al., 1998; Vignon and Rochefort, 1992). Récemment, notrelaboratoire a montré que linternalisation de la pro-cath-D par les fibroblastes serait réaliséepar interaction avec la sous unité du LRP1 (LDL Receptor Related Protein 1) (manuscritsoumis pour publication).38

Activationat acidic pH ?52KSecretion51KTumor micro-environment52KEndocytosisM6P receptors andunknown receptorsRER Golgi EndosomesLysosomes52K48K34+14K34+14KNucleusCytoplasmFigure 13 : Schéma de la localisation de la cath-Ddans les cellules cancéreuses mammairesLa cath-D, synthétisée sur le réticulum endoplasmique rugueux (RER), transite par le réseautrans-Golgi avant dêtre adressée aux lysosomes via son interaction avec les récepteurs aumannose-6-phosphate (RM6P). Dans les cellules cancéreuses mammaires, la cath-D estsurexprimée et saccumule dans la cellule. Son routage lysosomal est ainsi perturbé,conduisant à lhypersécrétion de la cath-D. Durant la mort cellulaire programmée de type Iou apoptose, la cath-D est relarguée dans le cytoplasme suite à la perméabilisation deslysosomes.39

2) Fonctions de la cath-Da. Dans la physiologieLa cath-D est une aspartyl protéase majeure des lysosomes et endosomes (Braulke et al.,1995). Cest une endo-protéinase clivant préférentiellement les liaisons peptidiques entre deuxacides aminés hydrophobes (e.g. -Phe-Phe-, -Leu-Tyr-, -Tyr-Leu-, and Phe-Tyr-) à pH acide(pH optimum 3,5 (Barrett, 1970)). Elle joue un rôle crucial dans le catabolisme intracellulairedes protéines dans les lysosomes. De nombreuses fonctions physiologiques de la cath-D ontété suggérées, basées sur sa capacité à cliver des protéines et des peptides (voir tableau 2).Ainsi il a été montré que la cath-D active des précurseurs de protéines biologiquement activescomme lhormone parathyroide (Diment et al., 1989) ou la prolactine (Piwnica et al., 2006;Piwnica et al., 2004) dans les compartiments pré-lysosomaux dans des cellules spécialisées.Dans les cellules spécialisées, elle participe à la maturation des antigènes (Baechle et al.,2006; Barrera et al., 2001; Mohamadzadeh et al., 2004; Zaidi et al., 2007) et à la dégradationdhormone comme linsuline ou le glucagon (Authier et al., 2002; Authier et al., 1995).Dans la mort cellulaire programmée de type I, ou apoptose, le rôle de la cath-D est en coursdétude et semble être complexe. En effet, la cath-D peut soit prévenir lapoptose comme celaa été décrit en condition physiologique avec les expériences utilisant les souris déficientes encath-D (Koike et al., 2003; Saftig et al., 1995), soit favoriser lapoptose induite par des agentscytotoxiques (Deiss et al., 1996; Emert-Sedlak et al., 2005) ou chimiothérapeutiques(Beaujouin et al., 2006).Par ailleurs, la génération de souris déficientes en cath-D a permis de montrer que la cath-Dnest pas indispensable au développement embryonnaire, mais est nécessaire au maintien delhoméostasie de certains tissus. Elle participe au renouvellement et au remodelage de certainsépithéliums comme le thymus et lintestin grêle. En effet, les souris déficientes en cath-Dmeurent quatre semaines (26 jours ±1) après leur naissance. On retrouve chez ces souris unenécrose intestinale massive, ainsi quune destruction importante des organes lymphoïdesentraînant une chute importante des lymphocytes B et T (Saftig et al., 1995). On retrouveégalement chez ces souris une atrophie rétinienne, qui fait que ces souris deviennent aveuglesdans les derniers jours de leur vie (Steinfeld et al., 2006).40

Tableau 2 : Tableau référençant les possibles fonctions et substrats biologiques de la cath-D(daprès Benes et al 2008)Le système nerveux central est également affecté, on note une neurodégénération dans lecerveau de ces souris. Dans les neurones de ces souris, on retrouve une accumulation dans leslysosomes dun matériel autofluorescent, la lipofuscine céroide. Ce phénotype est retrouvénaturellement chez des animaux (mouton, bulldog américain) ayant une mutation du gène dela cath-D (Awano et al., 2006; Tyynela et al., 2000).Chez lhomme, la maladie de Batten (ou neuronal ceroid lipofuscinosis NCL) présente lesmêmes caractéristiques. Des études ont montré que des patients atteints de cette pathologieprésentent une mutation du gène de la cath-D (Kuronen et al., 2009; Siintola et al., 2006;Steinfeld et al., 2006).Des travaux récents suggèrent que la cath-D joue un rôle dans le transport intracellulaire ducholestérol et des sphingolipides ainsi que dans la régulation du flux lipidique contrôlé par laprotéine ABCA-1 (ATP-binding cassette protein A1) (Haidar et al., 2006; Mutka et al., 2009).41

. Dans les pathologiesEn plus de ses fonctions physiologiques, de nombreuses études ont suggérélimportance de la cath-D dans certains processus pathologiques.En effet, comme cela a été décrit dans le chapitre précédent, la cath-D participe à la maladiede Batten. Des mutations de la cath-D sont responsables des formes les plus sévères de NCLs(Kuronen et al., 2009; Siintola et al., 2006; Steinfeld et al., 2006).Dans la maladie dAlzheimer, où son expression est augmentée (Cataldo et al., 1995; Haqueet al., 2008), elle serait impliquée dans la maturation de APP (Amyloid Precursor Protein),apoE (apolipoprotein E) et de la protéine Tau, trois des facteurs importants de cette pathologie(Kenessey et al., 1997; Sadik et al., 1999; Zhou et al., 2006). De plus, une variation génétiquede la cath-D constituerait un facteur de risque majeur pour le développement de cette maladie(Papassotiropoulos et al., 2002).Des études récentes suggèrent que la cath-D serait impliquée dans la maladie de Parkinson viasa capacité à cliver la synucléine (une protéine retrouvée sous forme dagrégats dans lesneurones de patients atteints de maladie de Parkinson) (Cullen et al., 2009; Qiao et al., 2008;Sevlever et al., 2008).Dernièrement, une étude a montré que lexpression de la cath-D est augmentée dans lescerveaux de patients atteints dautisme. Les auteurs suggèrent que la cath-D jouerait un rôledans le développement de la maladie en régulant le processus apoptotique (Sheikh et al.,2009).Chez les patientes atteintes de cardiomyopathie du post-partum, le taux de cath-D activéedans le sérum est élevé et serait impliqué dans le clivage de la prolactine en multiplefragments de 16 kDA anti-angiogéniques et pro-apoptotiques qui seraient responsables de lamaladie (Hilfiker-Kleiner et al., 2007).Enfin, dans le cancer, la cath-D a été largement décrite comme étant une composante activedu processus métastatique (voir revue (Benes et al., 2008; Liaudet-Coopman et al., 2006)).3) Rôle de la cath-D dans le cancer du seina. Expression dans les lignées de cancer du seinLe cancer du sein est la première cause de mortalité par cancer chez la femme jeune ettouche une femme sur dix. Lexpression de la cath-D dans les lignées cancéreusesmammaires, est fortement augmentée en comparaison avec les cellules mammaires normales.42

En effet, les cellules cancéreuses mammaires humaines produisent un taux dARNm codantpour la cath-D de 8 à 50 fois supérieur à celui produit par les cellules épithéliales mammairesnormales et la concentration cytosolique totale de la cath-D (précurseur et enzyme mature) est8 fois plus élevée (Capony et al., 1989). De plus, son expression dépend de la présence ou nonde récepteurs aux strogènes (estrogen receptor RE). En effet, dans les lignées hormonosensiblesde cancer du sein (RE+) telles les cellules MCF7 ou T47D, lexpression de la cath-Dest stimulée par les strogènes et les facteurs de croissance (Cavailles et al., 1988). Parcontre, dans les lignées hormono-indépendantes de cancer du sein (RE-) telles les cellulesMDA-MB231 ou BT20, la cath-D est surexprimée de façon constitutive. De plus, lasurexpression de la cath-D induit lhypersécrétion de la forme pro-enzyme ainsi quunealtération de son adressage lysosomal avec une accumulation des formes intracellulaires(Capony et al., 1989).De façon intéressante, lexpression du récepteur aux strogènes permet de traiter lespatientes atteintes dun cancer du sein avec un traitement hormonal. Environ 80% despatientes dont les tumeurs expriment le RE répondent à une thérapie anti-oestrogénique(Tamoxifène), alors que seulement 10% des patientes ayant des tumeurs RE négativesrépondent favorablement au traitement.b. Facteur pronosticSur le plan clinique, l'augmentation de la concentration de cath-D dans les cytosols decancers du sein est associée à un mauvais pronostic avec un risque accru de disséminationmétastatique (Fitzgibbons et al., 2000) et aide à prédire le risque de rechute le plus souventindépendamment des autres paramètres cliniques et biologiques (pour revue : (Rochefort,1996)). Une étude regroupant 2810 patients indique de façon irrévocable la valeur de mauvaispronostic de la cath-D quantifiée dans les cytosols de tumeurs primaires du sein dans tous lesgroupes de patientes de cancer du sein (Foekens et al., 1999). De plus, une méta-analyseregroupant 11 études avec un total de 2690 patientes confirme la valeur de mauvais pronosticde la cath-D dans le cancer du sein chez les patientes sans métastases ganglionnaireslymphatique (N-) (Ferrandina et al., 1997). Une étude pilote indique la valeur de mauvaispronostic de la cath-D dans les lésions précoces pT1, suggérant un rôle potentiel de la cath-Ddans les étapes précoces de la progression tumorale (Nikolic-Vukosavljevic et al., 2005).43

c. Rôles et mécanismes daction dans le cancerDe nombreuses études sur le cancer du sein ont montré que la cath-D stimule laprolifération des cellules cancéreuses in vitro et la progression métastatique in vivo. La cath-Da été décrite comme étant mitogène pour les cellules de cancer du sein ou de prostate (Fusekand Vetvicka, 1994; Vetvicka et al., 1994; Vetvicka et al., 1998). La pro-cathD, purifiée àpartir des milieux de sécrétion de cellules cancéreuses mammaires MCF7 et MDA-MB-231,stimule leur prolifération (Vetvicka et al., 1999; Vignon et al., 1986). De plus, la cath-Dhumaine, surexprimée par transfection stable, augmente la prolifération cellulaire et lepotentiel métastatique de cellules tumorales de rat 3Y1-Ad12 chez la souris athymique(Garcia et al., 1990; Liaudet et al., 1995; Liaudet et al., 1994). Il a été montré que, dans lalignée cancéreuse mammaire humaine métastatique MDA-MB-231, linhibition delexpression endogène de la cath-D par des ARNs antisens (Glondu et al., 2002), desribozymes (Vashishta et al., 2007) et des shRNA (Ohri et al., 2007), inhibe la proliférationcellulaire in vitro, la croissance tumorale et le potentiel métastatique chez la souris athymiquein vivo. De façon intéressante, il a été rapporté que lexpression de NFkappaB2, qui joue unrôle important dans la tumorigenèse (Baldwin, 2001; Garg and Aggarwal, 2002; Takata et al.,2004), est diminuée dans ces cellules (Ohri et al., 2007).Plusieurs mécanismes ont été proposés pour expliquer leffet mitogène de la cath-D :1) la cath-D pourrait agir en tant que protéase. En effet, son activité catalytique intra-cellulairepourrait être impliquée dans linactivation de la sécrétion dinhibiteurs de croissance (Liaudetet al., 1995), telle la protéine heat shock cognate 70 (hsc70) (Nirde et al., 2009). Cetteprotéine appartient à la famille des hsp70, qui sont des protéines chaperone intracellulaires.De plus, son activité protéolytique extra-cellulaire pourrait intervenir dans lactivation defacteurs de croissance (Briozzo et al., 1991). On sait depuis longtemps que le pH extracellulairedes tumeurs est plus acide que celui des tissus normaux correspondants (Griffiths,1991). Toutefois, lactivation extra-cellulaire de la pro-cath-D na jamais pu être démontrée,suggérant quelle pourrait agir par un autre mécanisme.2) elle pourrait aussi agir par interaction avec dautres protéines. En effet, notre laboratoire amontré quun mutant catalytiquement inactif de la cath-D stimule toujours la prolifération descellules tumorales in vitro et in vivo, indiquant lexistence de mécanismes alternatifsindépendants de son activité protéolytique (Berchem et al., 2002; Glondu et al., 2001;Laurent-Matha et al., 2005). De plus, puisque la pro-cath-D sécrétée mime en partie lactionde la cath-D transfectée, il est envisageable que cette protéase agisse comme un ligand, en44

interagissant avec un récepteur couplé à une voie de signalisation. Des études du laboratoireont montré que laction mitogène de la cath-D est indépendante des récepteurs RM6P (Glonduet al., 2001), suggérant lexistence dun récepteur membranaire mitogène (Glondu et al.,2001; Vetvicka et al., 1999). Les travaux plus récents de léquipe ont découvert un nouveaurécepteur de la cath-D, LRP1 (LDL receptor-related protein1), responsable de son effetmitogène dans les fibroblastes (manuscrit soumis pour publication) (Figure 14). Des travauxsont en cours pour déterminer si le récepteur LRP1 est impliqué dans leffet mitogèneautocrine de la cath-D sur les cellules cancéreuses.Il est clair aujourdhui quil existe des inter-connexions, entre cellules cancéreuses etstromales, responsables de la croissance invasive des tumeurs, dans lesquelles les protéasessemblent être impliquées. La pro-cath-D sécrétée agit également au niveau du microenvironnementtumoral, en affectant les cellules stromales tels les fibroblastes, les cellulesendothéliales (Figure 14) (Laurent-Matha et al., 2005).On sait que les tumeurs solides, au delà dune certaine taille (1 à 2 mm 3 ) ne peuvent plusgrandir ni sétendre car elles ne sont pas vascularisées. Les cellules au centre de la tumeursolide ont besoin doxygène (O 2 ) et de nutriments mais également doivent pouvoir sedébarrasser des déchets métaboliques. Cest pourquoi langiogenèse (formation de nouveauxvaisseaux) joue un rôle important dans la progression du cancer. Une étude clinique portantsur 102 carcinomes invasifs du sein a révélé une association statistiquement significative entrelexpression de cath-D et la densité vasculaire (Gonzalez-Vela et al., 1999). Dautres travauxont montré que la cath-D stimule langiogenèse tumorale dans des xénogreffes de tumeursdans des souris athymiques et que cet effet est indépendant de lactivité catalytique de la cath-D (Berchem et al., 2002). Il est donc possible que son action passe par des voies designalisations activées par la liaison de la cath-D à un récepteur de surface qui na pas encoreété identifié (voir figure 15). Langiogenèse étant contrôlée par un équilibre entre les facteurspro- et anti angiogéniques, la cath-D pourrait libérer et activer des facteurs de croissance oubien dégrader des inhibiteurs de croissance présents dans la matrice extra-cellulaire. Dans cesens, les travaux de Briozzo et al. ont montré que la cath-D facilite le relargage de facteurspro-angiogéniques à partir de la matrice extra-cellulaire (Briozzo et al., 1991). Des travauxplus récents ont montré que la thrombine augmente lexpression et la sécrétion de la cath-Dqui en retour induit langiogenèse (Hu et al., 2008).Cependant, de façon paradoxale, des études in vitro indiquent que la cath-D clive la prolactineen multiples fragments de 16kDa anti-angiogéniques (Hu et al., 2008; Piwnica et al., 2006;Piwnica et al., 2004). Il a également été rapporté que la pro-cath-D sécrétée par les cellules de45

carcinome de prostate serait responsable de la génération dangiostatine, un puissantinhibiteur de langiogenèse (Morikawa et al., 2000). A lheure actuelle, le rôle de la cath-Ddans langiogenèse demeure complexe et doit encore être élucidé car cette protéase sembleprésenter à la fois des fonctions pro- ou anti-angiogéniques suivant les modèlesexpérimentaux.Des études du laboratoire ont également montré que la cath-D sécrétée stimule de façonparacrine la croissance invasive des fibroblastes du stroma mammaire (Laurent-Matha et al.,2005). De plus, lexpression ectopique de la cath-D humaine dans des fibroblastesembryonnaires de souris (MEF) déficients en cath-D stimule la croissance tridimensionnelledans le matrigel et est associée à une augmentation significative de la prolifération de cesfibroblastes, de la survie, de la motilité, et de la capacité invasive par activation de la voie desMAP kinases (Laurent-Matha et al., 2005). Tous ces effets sur les fibroblastes sontindépendants de lactivité protéolytique, puisque les MEFs exprimant la cath-Dprotéolytiquement inactive présentent les mêmes caractéristiques. De plus, les fibroblastes ontla capacité de capturer la pro-cath-D sécrétée par les cellules tumorales par un processusdépendant du RM6P (Heylen et al., 2002) ou indépendant du RM6P (Laurent-Matha et al.,2005). Les résultats du laboratoire ont montré que cet effet mitogène de la cath-D sur lesfibroblastes est médié par le récepteur LRP1 (Figure 14) (manuscrit soumis pour publication).cancer cellsecretedpro-cath-DLRP1fibroblast+ Invasive growthFigure 14 : Schéma représentant linteraction de la cath-D et de son récepteur LRP1La pro-cath-D hyper-sécrétée par les cellules épithéliales cancéreuses mammaires interagit avec lerécepteur fibroblastique LRP1. Linteraction de la pro-cath-D sur son récepteur est responsable deleffet mitogène observé sur les fibroblastes.46

Figure 15 : Schéma hypothétique des rôles de la cath-D dans la progression du cancer(daprès Benes P., 2008)La pro-cath-D hyper-sécrétée par les cellules épithéliales cancéreuses mammaires stimule laprolifération des cellules cancéreuses de façon autocrine, en ce fixant à un récepteur de surface quina pas encore été identifié. Cette interaction active la voie des MAPKinases qui va promouvoirlexpression de certains gènes dont certaines cytokines ou NFKB2 qui seront ensuite sécrétées. Enretour ces protéines vont stimuler la croissance de la tumeur et linvasion.Cette pro-cath-D va également agir de façon paracrine en stimulant la croissance invasive desfibroblastes. De plus, cette pro-cath-D sécrétée va favoriser langiogenèse en se liant sur un récepteurprésent sur la membrane de ces cellules, et/ou en libérant et activant des facteurs angiogéniques (unefois que la pro-cath-D est activée dans des zones acides du milieu extra-cellulaire).47

La cath-D joue donc un rôle important dans la progression du cancer, et affecte plusieurstypes cellulaires du stroma tumoral (cellules endothéliales, fibroblastes). De façonsurprenante, bien que les adipocytes représentent un des types cellulaires prédominant dumicroenvironnement tumoral dans le cancer du sein, et que de nombreuses études suggèrentlimplication de lobésité dans le cancer, aucun travail concernant le rôle de la cath-D dans lesadipocytes na encore été publié. Récemment, létude du sécrétome des adipocytes 3T3-L1montre une sécrétion augmentée de cath-D en réponse à linsuline (Zhou et al., 2009a).4) Substrats et partenairesa. Les substrats et partenaires de la cath-DLa cath-D est une aspartyl protéase qui dégrade les protéines à pH acide dans leslysosomes. De nombreux substrats de la cath-D ont été décrits in vitro (voir tableau 2)suggérant son implication dans divers processus physiologiques. Toutefois, ses substratsendogènes sont encore mal connus et restent à être identifiés. De plus, le rôle de la cath-D nese limite pas à la protéolyse des protéines dans les lysosomes et les endosomes. La cath-Dpeut se lier à dautres protéines. En effet de récentes études suggèrent que son effet mitogènedans le cancer pourrait être médié par une liaison à dautres protéines, certains récepteursmembranaires non identifiés à ce jour (Fusek and Vetvicka, 2005). Linteraction avec lesRM6P via les motifs M6P portée par la cath-D a été décrite lors de son adressage lysosomal(Ludwig et al., 1994) et de son endocytose (Stein et al., 1987).Différents travaux ont montré que la pro-cath-D interagit avec la pro-saposine dans lescellules HepG2 (Zhu and Conner, 1994), et dans les cellules de cancer du sein en extra- etintra-cellulaire (Laurent-Matha et al., 2002) et cette interaction stimulerait lauto-activation dela pro-cath-D (Gopalakrishnan et al., 2004). Des travaux récents réalisés au laboratoire ontmis en exergue que linteraction de la cath-D avec la sous unité du LRP1 est responsabledes effets engendrés par la cath-D sur les fibroblastes (manuscrit soumis pour publication).b. Identification de nouveaux substrats de la cath-DLidentification des substrats dune protéase est essentielle pour la compréhension desvoies protéolytiques qui vont permettre de réguler la fonction dune cellule. Durant ma thèse,nous avons collaboré avec le laboratoire du Professeur Christopher Overall afin didentifierles substrats naturels de la cath-D en utilisant une approche protéomique récemment48

développée dans ce laboratoire et dénommé TAILS (Terminal Amine Isotopic Labeling ofSubstrates).Cette technique repose sur la comparaison des protéines présentes dans le milieu de culture(sécrétome) provenant de cellules exprimant ou non la protéase dintérêt.En présence de la protéase, les protéines vont être coupées et générer une nouvelle extrêmitéNH 2 spécifique de ce clivage. La première étape consiste à récupérer les milieux de culturesoù se trouvent les protéines sécrétées (ainsi que les peptides générés par le clivage dessubstrats par la protéase dintérêt), puis à les marquer au niveau des extrêmités NH 2 libres(extrêmité N-terminale et Lysine) à laide de marqueurs isotopiques de type iTRAQ (isobaricTag for Relative and Absolute Quantitation) (un marqueur différent pour chaque condition)(voir Figure 16).PRGFigure 16 : Représentation schématique des réactifs iTRAQLes réactifs iTRAQ sont dits isobariques car ils possèdent tous une masse moléculaire de 145 Da.Chaque réactif iTRAQ est constitué de trois parties :- un groupement reporteur qui diffère entre les quatre formes du réactif utilisé par sa masse (m=114,115, 116 et 117 Da)- un groupement balance qui sert de contre poids afin que la masse globale du marqueur soit de 145Da. Sa masse varie de 28 à 31 Da.- un groupement fonctionnel qui lie de façon covalente le réactif iTRAQ aux amines primaires libresdu peptide (les lysines (K) qui portent un NH 2 libre au niveau de leur chaîne latérale seront égalementmarquées).49

Une fois le marquage des peptides et protéines effectué, les deux conditions (avec et sansprotéase) sont mélangées de façon équimolaire puis clivées par la trypsine. Cette digestionpermet dobtenir un mélange de peptides qui facilitera lanalyse en spectrométrie de masse etva générer de nouvelles extrêmités NH 2 libres (Figure 17). Afin de sélectionnerspécifiquement les sites de coupures générés par la protéase dintérêt, une sélection négativepar un polymère aldéhyde va être employée. Cette étape va permettre de simplifierléchantillon et de récupérer uniquement les peptides marqués et protégés à leur extrêmité N-terminale. Léchantillon contenant les peptides marqués est ensuite fractionné parchromatographie liquide haute performance (HPLC), puis les différentes fractions sontanalysées par spectrométrie de masse en tandem (MS/MS).Lors de lanalyse en spectrométrie de masse (MS), les peptides marqués seront donc détectésavec la masse intrinsèque du peptide plus 145 Da provenant du marqueur. Ce nest que lors delétape de fragmentation du peptide (MS/MS) que la contribution de chaque peptide pourraêtre appréciée, ce qui se traduira par la libération dions reporteurs ayant des masses de 114,115, 116, ou 117 Da, suivant le marquage utilisé. Enfin, lanalyse bioinformatique despeptides identifiés par spectrométrie de masse permettra de déterminer la proportion depeptides dun milieu de culture à lautre et didentifier les protéines qui leur sont associées.En résumé, lorsquune protéine est clivée dans léchantillon où la protéase est présente, cecigénère une nouvelle extrêmité NH 2 qui réagit avec le marqueur. Cest ce peptide marqué dansune seule condition qui sera identifiée par la spectrométrie de masse. Cette technique permetdonc didentifier des substrats naturels qui devront être validés par des études biochimiques.En effet, la présence dun peptide clivé dans le milieu de culture ou la protéase dintérêt y aété ajoutée ou exprimée, peut être le résultat dun effet indirect de cette protéase (vialactivation dautre protéase par exemple). Cette technique peut être également utilisée pourlidentification de substrats membranaires (Butler et al., 2009).50

Figure 17 : Schéma représentant la technique du TAILSLes milieux de culture sont collectés puis marqués avec les réactifs iTRAQ. Puis, les deux conditionssont mélangées et clivées par la trypsine, ce qui produit de nouvelles extrêmités Nter.Un polymère chimique est ajouté au mélange et va permettre de le simplifier en liant les extrêmitésNH 2 libres nouvellement générées. Les peptides marqués sont ensuite fractionnés parchromatographie liquide haute performance et analysés par spectrométrie de masse en tandem.Enfin, une analyse bioinformatique permet de traiter les résultats.51

Afin de réaliser ce projet, nous avons utilisé deux modèles cellulaires développés aulaboratoire (Figure 18) :1- des fibroblastes embryonnaires de souris (MEF) immortalisés exprimant ou pas la cath-Dhumaine ou la cath-D humaine mutée au niveau du site catalytique et donc protéolytiquementinactive. Ces trois lignées cellulaires ont déjà été publiées (Laurent-Matha et al., 2005).2- des cellules de cancer du sein (MDA-MB-231) transfectées de façon stable avec un shRNAciblant le gène de la luciférase ou celui de la cath-D. Ces cellules de cancer du sein exprimentou pas la cath-D.Lutilisation de cette technique peut sembler ne pas être appropriée à létude des substratsendogènes de la cath-D car cette dernière a besoin dun pH acide pour cliver ses substrats.Pourtant, il a été décrit lexistence de formes actives de la cath-D dans le milieu extracellulairecapables de cliver la prolactine du côté basal des acini de la glande mammaire(Castino et al., 2008). De plus, les travaux de Piwnica en 2006 suggèrent que la cath-Dsécrétée cliverait la prolactine à lextérieur de la cellule, mais que ce clivage nécessite uneacidification locale qui passerait par des pompes à protons et des échangeurs de cationsNa + /H + . Par ailleur, il est possible que le clivage de protéines par la cath-D se fasse àlintérieur de la cellule et que les produits de dégradations soient relargués par exocytose. Unedes hypothèses serait que la pro-cath-D sécrétée lie son substrat et que ce complexe soitinternalisé. La vésicule dendocytose devenant acide la cath-D cliverait son substrat et sesproduits de dégradation seraient relargués dans le milieu extra-cellulaire. Nous avons doncappliqué cette technique à nos deux modèles cellulaires, les travaux sont en cours.52

AB cathD-/- MEFcath-D cath-D-/- MEF D231N cath-D MDA-MB-231shLuc shcath-D1 shcath-D2P2 P3 P6 P2 P3 P6 P2 P3 P6cath-Dbactincath-D D231N cath-DFigure 18 : Expression de la cath-D dans différents modèles cellulairesA) Des fibroblastes embryonnaires de souris immortalisés (MEF) déficientes en cath-D ont ététransfectés avec de la cath-D humaine ou de la cath-D humaine mutée au niveau de son sitecatalytique. Il existe une différence dun 1 kDa au niveau de la masse moléculaire apparente de lacath-D mutée qui est due à une augmentation de la mobilité électrophorétique de la protéine mutée.B) Des cellules de cancer du sein, les MDA-MB-231, ont été transfectées à laide de shRNA ciblant legène de la luciférase (shLuc) ou le gène de la cath-D (shcath-D1 et shcath-D2). Dans les cellulestransfectées avec le shRNA ciblant le gène de la cath-D, lexpression de la cath-D est très fortementinhibée.53

III. Le récepteur LRP11) Organisation structuraleLRP1 (LDL receptor-related protein1) est un récepteur dendocytose qui appartient àla famille des LDL-récepteurs qui compte sept membres (Figure 19). Chaque membre de cettefamille est composé dun domaine extra-cellulaire (composé de régions de liaison du ligand etde répétitions EGF), dun domaine trans-membranaire, et dune queue cytoplasmiquecontenant au moins un motif NPxY. Ce récepteur est capable de lier et internaliser unequarantaine de ligands différents et est impliqué dans divers processus biologiques dont lemétabolisme des lipoprotéines, lélimination de protéases, le développement embryonnaire, lafonction neuronale, lentrée de toxines bactériennes et de virus à lintérieur des cellules. Il secompose dune chaîne α extra-cellulaire de 515 kDa, qui contient différents domaines deliaison aux ligands, et dune chaîne trans-membranaire de 85 kDa (pour revue (Boucher andGotthardt, 2004; Lillis et al., 2008; Strickland and Ranganathan, 2003)). LRP1 a été localisédans les râdeaux lipidiques en réponse au PDGF-BB et à l'insuline (Boucher et al., 2002; Wuand Gonias, 2005; Zhang et al., 2004a).On retrouve dans la partie extra-cellulaire de la chaîne , des répétitions de type complémentriches en cystéines (CR) (cysteine-rich complement-type repeats) qui sont généralementappelées répétitions de liaison au ligand (ligand-binding repeats) puisque la plupart desligands se lient au niveau de ces répétitions. Concernant la chaîne du récepteur LRP1, cesCRs sont localisées dans des régions précises appelées clusters (de I à IV), chacune contenantun nombre variable de CR. Les expériences de liaison de ligand indiquent que la plupart desligands interagissent avec la chaîne du récepteur au niveau des clusters II et IV (Neels et al.,1999; Willnow et al., 1994). On retrouve également dans cette partie extracellulaire desrépétitions EGF et des domaines -propeller.Tous les membres de cette famille contiennent une chaîne qui comporte une région transmembranaireainsi quun domaine cytoplasmique de longueur variable. Concernant la chaîne du LRP1, son domaine cytoplasmique est constitué de 100 résidus dacides aminés, etcomprend 2 motifs di-leucines (LL) et 2 motifs NPxY phosphorylables par v-Src (Barnes etal., 2001) et en réponse au PDGFR- (Boucher and Gotthardt, 2004; Boucher et al., 2002;Loukinova et al., 2002; Newton et al., 2005), et CTGF (connective tissue growth factor)(Yang et al., 2004). Cette région cytoplasmique peut également interagir avec des moléculesadaptatrices telles Shc (van der Geer, 2002), disabled (Zhang et al., 2008), Fe65 (Kinoshita et54

al., 2003) impliquées dans le trafic cellulaire et la signalisation cellulaire. Il a également étédécrit que chaîne du LRP1 pouvait subir une protéolyse intra-membranaire régulée(regulated intramembrane proteolysis) appelée RIP, qui aboutira à la libération dun domaineintra-cellulaire (LRP1-ICD) qui, in vitro, a été impliqué dans la régulation de la transcriptionde certains gènes (Zurhove et al., 2008).Figure 19 : Organisation structurale des membres de la famille des LDL-récepteurs(Daprès Lillis 2008)Chaque membre de la famille des LDL-récepteurs est composé dun domaine extracellulaire(présentant des régions de liaison au ligand, et des répétitions EGF), dun domaine transmembranaire,et dune queue cytoplasmique contenant au moins un motif NPxY.55

2) Trafic intra-cellulaireComme le récepteur LRP1 reconnaît de nombreux ligands différents, son trafic vers lamembrane plasmique est contrôlé afin de prévenir toute interaction précoce avec certains deses ligands dans le réticulum endoplasmique. La protéine RAP (receptor associated protein),une protéine chaperone, interagit fortement avec LRP1 et empêche toute autre liaisonprématurée du récepteur avec ses ligands. Cette protéine a été découverte comme étant copurifiéeavec LRP1 par chromatographie daffinité de ligand (Ashcom et al., 1990; Stricklandet al., 1990). La protéine RAP interagit avec de multiples sites de LRP1 et lescorte duréticulum endoplasmique jusquà lappareil de Golgi. Cette interaction est régulée par le pHdes différents compartiments cytoplasmiques. Dans le réticulum endoplasmique, linteractionse fait à pH neutre (pH 7.2) et la dissociation a lieu à pH plus acide (pH

transduction du signal par la phosphorylation des motifs NPxY cytoplasmiques sur résidustyrosine dans les fibroblastes transformés par vSrc (Barnes et al., 2001), en réponse au PDGF-BB (Boucher et al., 2002; Loukinova et al., 2002; Newton et al., 2005), au CTGF (Yang et al.,2004) et au tPA (Hu et al., 2006).b. Le RIPDe façon intéressante, LRP1 est aussi détecté sous forme soluble dans la circulation,dû au clivage in vivo de son domaine extracellulaire (ecto-domain shedding) (Quinn et al.,1997). Le fragment produit comporte la chaîne alpha (sous-unité de 515 kDa) et un fragmentde 55 kDa de la chaîne , indiquant une protéolyse proche de la membrane plasmique (Quinnet al., 1999). Le clivage de lecto-domaine de la chaîne du LRP1 est effectué par desprotéases associées à la membrane plasmique tel des métalloprotéases (Quinn et al., 1999;Rozanov et al., 2004; Liu et al., 2009), ou la sécrétase BACE 1 (von Arnim et al., 2005)(Figure 20).Le clivage de lecto-domaine des récepteurs est parfois suivi dun clivage intracellulaire, parun mécanisme appelé RIP (Regulated intra-membrane proteolysis). Le premier clivage libèrele domaine extracellulaire et produit une protéine membranaire comportant un domaineextracellulaire très court appelé CTF (Carboxy Terminal Fragment). Cette protéine devientalors substrat pour un clivage intra-membranaire généré par différentes enzymes incluant les-sécrétases. Ce clivage aboutit à la formation dun fragment intracellulaire appelé LRP1-ICD (LRP1- intracellular domain). La fonction de LRP1-ICD dans la signalisation estencore mal caractérisée mais implique certainement son association avec des protéinesadaptatrices. Ainsi, LRP1-ICD interagit avec la protéine adaptatrice Fe65 et lhistoneacétyltransférase Tip60 au noyau (Kinoshita et al., 2003). Des travaux ont suggéré quelinteraction entre LRP1 et BACE1 aurait lieu dans une zone intracellulaire du LRP1 etégalement que le domaine cytoplasmique libéré du LRP1 activerait la transcription de gènescibles (von Arnim et al., 2005). La fonction de LRP1-ICD comme répresseur transcriptioneldu promoteur de linterferon- ainsi que ses gènes cibles viennent dêtre caractérisés (Zurhoveet al., 2008).57

LRP1αLRP1Membrane associatedproteases1LRP1-CTF2γ-secretasesLRP1-ICDtranscriptionFigure 20 : Représentation schématique du RIP (Regulated intra-membrane proteolysis)Le mécanisme du RIP consiste en deux clivages successifs : le premier clivage est initié par uneprotéase et libère lecto-domaine du récepteur. La protéine membranaire restante, le LRP1-CTF,devient substrat dun 2 ème clivage intra-membranaire réalisé par des -sécrétases. Le fragment intracellulairelibéré, appelé ICD (Intra-cellular domain), diffuse alors au noyau afin de réguler latranscription de gènes cibles.4) FonctionsLe LRP1 reconnaît une quarantaine de ligands différents et est impliqué dans diversprocessus physiologiques (Tableau 3). La délétion du gène du LRP1 chez la souris savèrelétale au stade embryonnaire, soulignant un rôle déterminant mais encore mal caractérisé dece récepteur dans le développement (Herz et al., 1992). LRP1 est fortement exprimé danscertains types cellulaires tels que les hépatocytes, les neurones, des cellules musculaires lisses,et les adipocytes. Des mutants tissus-spécifiques ont permis une meilleure compréhension desdivers rôles de ce récepteur.Au niveau du foie, ce récepteur permet déliminer de la circulation sanguine de multiplesmolécules tels des cofacteurs impliqués dans la coagulation (Facteur VIII), des complexesenzyme-inhibiteur (complexe α2-Macroglobulin-protéase ou encore complexe Serpineprotéase),ainsi que des particules lipoprotéiques (chylomicron remnants) grâce à soninteraction avec la protéine ApoE (Lillis et al., 2008). Linteraction du récepteur LRP1 avecces molécules permet leur endocytose et leur dégradation intra-cellulaire. Au niveau du foie, iljoue un rôle dans lélimination des protéines plasmatiques.58

Il a été démontré, par des études de délétion du gène du LRP1 dans les cellules musculaireslisses, que ce récepteur joue un rôle protecteur de lathérosclérose en empêchant la voie designalisation du PDGF (Boucher et al., 2003). Il permet le maintient de lintégrité de la paroivasculaire en supprimant lactivation du récepteur au PDGF (PDGFR) (Zhou et al., 2009b).Au niveau des neurones, LRP1 est abondamment exprimé, cependant sa fonction est encoremal caractérisée. Les souris déficientes en LRP1 dans les neurones développent des troublesmoteurs et du comportement. Il semblerait que le LRP1 soit impliqué dans la transmissionsynaptique (May et al., 2004).Lexpression de ce récepteur est également élevée dans les adipocytes. La stimulation duLRP1 par linsuline, augmente lassimilation des triglycérides et des esters de cholestérol àpartir des lipoprotéines circulantes, en agissant de concert avec la lipoprotéine lipase(Beisiegel et al., 1996). Il a été récemment décrit que des souris déficientes en LRP1 auniveau du tissu adipeux, présentent de plus petites réserves lipidiques, un poids corporel plusfaible, un retard dans lélimination des lipides après la prise alimentaire (Hofmann et al.,2007) suggérant un rôle dans lhoméostasie des lipides. De plus LRP1 semble jouer un rôledans les voies de signalisation conduisant à la synthèse des acides gras, et pourrait égalementréguler lhoméostasie du cholestérol via la voie de signalisation Wnt5a (Terrand et al., 2009).Son rôle dans linvasion, la migration et la prolifération des cellules cancéreuses est enémergence. De façon intéressante, une étude décrit que le polymorphisme C766T dans le gènedu LRP1 est associé à un risque augmenté de développer un cancer du sein (Benes et al.,2003). De plus, il est exprimé dans les fibroblastes sur le front invasif dans les carcinomescolorectaux (Obermeyer et al., 2007). Des études décrivent que LRP1 stimule la proliférationdes cellules cancéreuses, la motilité et linvasion (Dedieu et al., 2008; Li et al., 2003; Song etal., 2009).59

Tableau 3 : Ligands connus du LRP1(daprès Lillis et al., 2008)60

C. PRESENTATION DUTRAVAIL DE THESE61

I. Etude du rôle de la cathepsine D dans les adipocytes1) Introduction :La cathepsine-D (cath-D) est une aspartyl protéase lysosomale qui est surexprimée etfortement sécrétée par les cellules épithéliales cancéreuses mammaires. Cest un facteur demauvais pronostic dans le cancer du sein associé à un risque plus élevé de récidives. De plus,cette protéase stimule la croissance des cellules cancéreuses, la croissance invasive desfibroblastes et la formation des métastases.Les cellules cancéreuses interagissent de façon dynamique avec les cellules normales desdifférents types cellulaires présents dans le tissu de support environnant appelé microenvironnementtumoral. Le micro-environnement tumoral est composé de cellules stromaleset de matrice extra-cellulaire. Les cellules stromales jouent un rôle important dans laprogression du cancer, notamment via la sécrétion de certains facteurs tels des facteurs decroissance ou des protéases. Parmi les cellules présentes dans le micro-environnementtumoral, ladipocyte est probablement celui qui a été le moins bien étudié alors quilreprésente un des types cellulaires prédominants du micro-environnement de certains cancerscomme le cancer du sein. On sait aujourdhui que ladipocyte nest pas uniquement unecellule de réserve énergétique, mais quil sécrète de nombreuses molécules, appeléesadipokines, dont certaines hormones, des cytokines, des facteurs de croissance qui pourraientinfluencer le comportement des cellules tumorales. Ces dernières années, des études cliniquesont mis en évidence que lobésité est un facteur de risque majeur ainsi quun facteur demauvais pronostic pour de nombreux cancers, dont le cancer du sein chez la femmeménopausée. De façon intéressante, des travaux récents indiquent que les cystéinescathepsines modulent la biologie de ladipocyte et jouent un rôle important dans lobésité. Ace jour, le rôle de la cath-D adipocytaire demeure inexploré. Dans cette étude, nous avonsquantifié le taux dexpression de la cath-D chez lhomme et la souris obèse. Nous avonségalement analysé lexpression de la cath-D au cours de la différenciation des adipocytes dansdes modèles humain et murin. Finalement, afin de déterminer le rôle de cette protéase aucours de ladipogenèse, nous avons inhibé de façon stable son expression dans les préadipocytespar lutilisation de shRNA anti-cath-D et nous avons étudié les conséquences surlexpression des marqueurs de la différenciation adipocytaire, PPARg, aP2 et HSL et surlaccumulation des lipides pendant linduction de ladipogenèse.62

2) Article 1:Cathepsin-D, a key protease in breast cancer,is up-regulated in obese tissue and controls adipogenesis63

Cathepsin-D, a key protease in breast cancer, is up-regulated in obese adiposetissue and controls adipogenesisOlivier Masson 1 , Christine Prébois 1 , Aline Meulle 2,3 , Cédric Dray 2,4 , DanielleDaviaud 2,4 , Didier Quilliot 5 , Philippe Valet 2,4 , Catherine Muller 3 , EmmanuelleLiaudet-Coopman 11 IRCM, Institut de Recherche en Cancérologie de Montpellier, Montpellier, F-34298,France; INSERM, U896, Montpellier, F-34298, France; Université Montpellier1,Montpellier, F-34298, France; CRLC Val dAurelle Paul Lamarque, Montpellier, F-34298, France. 2 Université de Toulouse, UPS, Institut de Médecine Moléculaire deRangueil, Equipe n°3, IFR31, Toulouse, France. 3 Institute of Pharmacology andStructural Biology CNRS UMR 5089, Toulouse, France; Université de Toulouse,Toulouse, France. 4 Institut National de la Santé et de la Recherche Médicale(INSERM), U858, Toulouse, France.5 Service de diabétologie, Maladiesmétaboliques et nutrition, CHU de Nancy, Hôpital J. dArc, 54201 Nancy Cedex,France.*Corresponding author: E Liaudet-Coopman, Inserm U896, IRCM Val d'Aurelle-Paul Lamarque, 34298 Montpellier Cedex 5, France ; Tel (33) 467 61 24 23 ; FAX(33) 467 31 37 87 ; E-mail: e.liaudet@valdorel.fnclcc.frRunning title: Role of cathepsin D in obesity and adipogenesisKeywords: cathepsin D, adipocyte, obesity, adipogenesis, differentiation, cancer1

ABSTRACTThe aspartic protease cathepsin-D (cath-D) is overexpressed by human epithelialbreast cancer cells and is closely correlated with poor prognosis in breast cancer.Adipocyte is one of the most prominent cell types in the tumor-microenvironment ofbreast cancers and clinical studies pointed out that obesity increases the incidence ofbreast cancer. Here, we provide the first evidence that cath-D expression is upregulatedin adipose tissue of obese human as well as in adipocytes of obeseC57BI6/J mouse model. Cath-D expression is also increased during human andmouse adipocyte differentiation. We demonstrate that cath-D silencing in NIH-3T3F442A murine preadipocytes significantly inhibits the expression of PPARg, HSLand aP2 adipocyte differentiation markers after adipogenesis induction, and leads tolipid-depleted cells. This study highlights the key role of cath-D in the control ofadipogenesis, and suggests that this protease may be a novel target in obesity.Since cath-D is implicated in breast cancer progression, we propose that cath-D mayrepresent a molecular link between cancer and obesity.2

IntroductionConsumption of meals rich in fat and carbohydrates is a major causative factor ofobesity, resulting in excessive white adipose tissue. An increase of adipose tissuemass results from combined hypertrophy of existing adipocytes (hypertrophicadipocytes) and adipogenic differentiation of precursor cells (adipocyte hyperplasia).A large amount of adipose tissues has been associated with poor prognosis forbreast cancer in obese postmenauposal women (Calle & Kaaks, 2004). Recently,clinical studies pointed out that obesity is a major risk factor for cancer (Renehan etal., 2008; van Kruijsdijk et al., 2009; Wright et al., 2007).Tumor progression has been recently recognized as the product of an evolvingcross talk between tumor cells and its surrounding supportive tissue, the tumorstroma (Mueller & Fusenig, 2004). Cancer cells interact dynamically with multiplenormal cell types such as fibroblast, infiltrating immune cells, endothelial cells andadipocytes within the context of extra-cellular matrix (Mueller & Fusenig, 2004). Of allthe cells present in themicroenvironment, adipocyte is probably the least wellstudied despite the fact that it corresponds to one of the most prominent cell type intissues such as breast and bone marrow (Wiseman & Werb, 2002). Until recently,adipocytes were mainly considered as an energy storage depot, but there is nowclear evidence pointing to the fat tissue as an endocrine organ that produceshormones,growth factors, cytokines, proteases and other molecules, anheterogeneous group of molecules included under the term of adipokines (Rajala &Scherer, 2003). Accordingly, the adipocyte is therefore an excellent candidate toinfluence tumor behaviour through heterotypic signalling processes and may prove tobe critical for tumor survival, growth, and metastasis.3

The aspartic protease cathepsin D (cath-D), a marker of poor prognosis in breastcancer (Ferrandina et al., 1997; Foekens et al., 1999; Rochefort, 1992; Rodriguez etal., 2005; Westley & May, 1999), is overexpressed and secreted at high levels byhuman epithelial breast cancer cells (Capony et al., 1987; Capony et al., 1989;Liaudet-Coopman et al., 2006; Rochefort & Liaudet-Coopman, 1999; Westley &Rochefort, 1980). Cath-D stimulates cancer cell proliferation, fibroblast outgrowth,angiogenesis and metastasis (Berchem et al., 2002; Fusek & Vetvicka, 1994; Garciaet al., 1990; Glondu et al., 2001; Glondu et al., 2002; Hu et al., 2008; Laurent-Mathaet al., 2005; Liaudet et al., 1995; Liaudet et al., 1994). Here, we investigated theexpression of cath-D in obese adipocytes and its role in the control of adipogenesis.We show that cath-D expression is up-regulated in human and mouse obese adiposetissues as well as during adipogenesis. Moreover, we demonstrate that cath-Dpositively controls the adipogenic process.ResultsCath-D transcription is up-regulated in human and mouse obese adiposetissuesBecause of the recently established relationship between obesity and cancerincidence (Renehan et al., 2008; van Kruijsdijk et al., 2009; Wright et al., 2007) andof the demonstrated role of cath-D in both cancer cells and stromal cells (Liaudet-Coopman et al., 2006), we investigated cath-D expression in human and mouseadipose tissues.Cath-D mRNA expression was examined in human intra-abdominal visceraladipose tissue (VAT) from lean and obese human (Fig. 1A, panel a). Interestingly,cath-D mRNA was significantly increased in human obese visceral adipose tissue4

(Fig. 1A, panel a). This differential expression of cath-D was also observed insubcutaneous adipose tissue (SAT) from lean and obese human (Fig. 1A, panel b).To assess whether this cath-D up-regulation was a general characteristic ofobese adipocytes, we next analysed cath-D mRNA levels in adipocytes isolated fromC57BI6/J mice either fed a HFD or ND (Fig. 1B). As attempted HFD-fed C57BI6/Jmice exhibited a significant increase in body mass (47.6 ± 1.4 g) when compared totheir control littermates (31.1 ± 1.2 g) (data not shown). Cath-D expression wassignificantly enhanced in adipocytes of HFD obese mice when compared to NDcontrol mice (Fig. 1B). Altogether, our results indicate that cath-D expression is upregulatedin human and mouse obese adipose tissues.Cath-D expression is increased during mouse and human adipocytedifferentiationSince no report described cath-D expression in adipocyte cells, we analysed cath-D expression in the well-established mouse adipocyte cell lines (NIH-3T3F442A andNIH-3T3L1), and compared it to that of mouse fibroblasts (NIH-3T3), human breastfibroblasts (HMF), and in epithelial breast cancer (MCF-7) cells. As shown in Figure2, mouse cells expressed preponderantly the single intermediate cath-D chain of 48kDa whereas human cells produced the mature cath-D double chain of 34 +14 kDa,as previously described (Felbor et al., 2002). As attempted, up-regulation of cath-Dwas observed in MCF7 breast cancer cells when compared to HMF fibroblasts.Interestingly, cath-D expression was increased in mature adipocytes in both NIH-3T3F442A and NIH-3T3L1 cell lines (Fig. 2).Given that cath-D transcription is up-regulated in obese tissues and as obesity ischaracterized by the increase of intracellular lipid accumulation, a characteristic of5

adipocyte differentiation which shows a significant correlation with adipocytedifferentiation, we next investigated whether cath-D may play a role in adipogenesis.We first examined the regulation of cath-D expression during the course ofdifferentiation of NIH-3T3F442A preadipocyte cell line, a valuable model ofadipogenesis (Maquoi Neese et al., 2002) (Fig. 3). Interestingly, cath-D mRNA (Fig.3A) and protein (Fig. 3B) expression was progressively up-regulated duringadipogenesis. Secreted cath-D was only detected in fully-differentiated adipocytesfrom day 10 of differentiation (Fig. 3B). To validate our experimental conditions, westudied in parallel the expression of PPARg (Fig. 3A), HSL (Fig. 3B) and aP2 (Fig.3A) adipocyte markers of differentiation. As expected, the level of these markers wasprogressively increased during acquisition of the adipocyte phenotype (Fig. 3A-B). Inaddition, the cytoskeletal actin protein amount was diminished during adipocytedifferentiation reflecting the change in cellular morphology (Fig. 3B), as describedbefore (Spiegelman & Farmer, 1982). To further assess that insulin treatment wasnot specifically involved in the observed effect, we used fully-differentiated NIH-3T3F442A adipocytes. As shown in Fig. 3C, the levels of cath-D protein remainedunaffected.Although NIH-3T3F442A cells are a valuable experimental model, thesepreadipocytes have distinct attributes compared with human cells in primary culturebeyond the obvious species differences. Therefore, we next examined the regulationof cath-D expression during adipogenesis in human preadipocytes purified fromabdominal subcutaneous adipose tissue (Bour et al., 2007) (Fig. 4). These primaryhuman cells were differentiated in an efficient manner since about 75 % ofpreadipocytes were converted to the adipocyte phenotype (Fig. 4A). As observed formouse adipocyte, expression of cath-D protein was also increased in human6

differentiated adipocyte (Fig. 4B). Taken together, these findings indicate that cath-Dexpression is up-regulated during mouse and human preadipocyte differentiation.Silencing of cath-D inhibits adipogenesisSince cath-D was up-regulated in obese tissue and as its expression was increasedduring the adipocytic process, we subsequently investigated whether preadipocyterequires cath-D expression in order to differentiate into mature adipocyte. Cath-Dexpression was stably silenced in NIH-F442A preadipocytes with cath-D shRNA1 andshRNA2 generating, respectively, the D10 and A4 clones (Fig. 5A). Control C34 andC37 clones were obtained using Luc shRNA stably transfected in NIH-F442Apreadipocytes (Fig. 5A).To evaluate the consequences of cath-D silencing in adipocyte differentiation, wequantified the expression of PPARg, HSL and aP2 adipocyte differentiation markersin Luc and cath-D shRNA transfected NIH-3T3F442A clones at day 7 ofdifferentiation (Fig. 5B). Cath-D silencing (Fig. 5B, panel a) significantly inhibitedPPARg (Fig. 5B, panel b), HSL (Fig. 5B panel c) and aP2 (Fig. 5B, panel d) mRNAlevels. These findings indicate that cath-D silencing inhibits adipogenic expressionmarkers.Then, we analysed the cellular lipid levels in adipocytes silenced or not for cath-D (Fig. 6). Indeed, the most obvious feature of adipocytes is the synthesis andstorage of triglycerides in lipid droplets and therefore the gradual appearance andgrowth of lipid droplets are characteristic for adipocyte precursor cells undergoingadipogenic differentiation. The presence of these neutral lipids was detected by oilred O staining (Fig. 6A-B). As illustrated in Fig. 6A, oil red O staining after 7 days ofdifferentiation revealed that extinction of cath-D expression in A4 and D10 clones7

strongly decreased neutral lipid droplet formation and/or accumulation as comparedto control C34 and C37 clones and to parental NIH-3T3F442A cells. Microscopicanalysis at day 7 of differentiation illustrated that, as attempted, C34 and C37 clonesaccumulated numerous large lipid droplets and adopted a non adherent roundmorphology characteristic of mature NIH-3T3F442A adipocytes (Fig. 6B). Bycontrast, in A4 and D10 clones silenced for cath-D, the lipid droplet size and numberwere strongly reduced (Fig. 6B). Moreover, cells kept the morphological feature ofadherent fibroblastic cells, suggesting that preadipocyte differentiation process didnot occur in the absence of cath-D. Quantification of lipids afterwards demonstratedthat silencing of cath-D in A4 and D10 clones significantly decreased lipid contentlevels at day 7 of differentiation as compared to C34 and C37 control clones (Fig.6C). Together, these findings reveal that cath-D silencing in preadipocytes inhibitsadipogenesis, leading to lipid-depleted cells.8

DiscussionOur results demonstrate that cath-D expression is up-regulated in human obesetissue. This up-regulation of cath-D expression in the VAT and SAT ofoverweight/obese patients is in consensus with our results in obese mice. Obesity ischaracterized by the increase of intracellular lipid accumulation which shows asignificant correlation with adipocyte differentiation. Terminally differentiatedadipocytes cannot divide. Hence, alterations in the number of fat cells within the bodymust be accomplished by the differentiation of preadipocytes, which act as arenewable source of adipocytes.Our data point out that cath-D expression increased gradually along with thedifferentiation of NIH-3T3F442A cells into mature adipocytes. The comparableincrease between mRNA and protein levels observed in NIH-3T3F442A cellssuggests that the overall increase in cath-D expression following differentiation maybe primarily due to an increase in transcription with little or no post-transcriptionalregulation. Interestingly, our findings further revealed that fully-differentiated NIH-3T3F442A adipocytes secrete pro-cath-D, suggesting its potential new function as anadipokine. A recent study analysing the secretome of adipocytes reported that cath-D is a secretory protein induced by insulin (Zhou et al., 2009). Similar up-regulation ofcath-D was observed during adipocyte conversion of primary culture of preadipocytesisolated from human sub-cutaneous adipose tissue. Most functional studies onadipocyte differentiation and function have been performed in the murine adipogenicNIH-3T3L1 and NIH-F442A cell lines and in genetically modified mice. However,there are fundamental differences in the lipoprotein metabolism of mouse and human(Prawitt et al., 2008). Therefore, it is important to investigate the regulation cath-Dexpression in human adipocytes as presented in this report. Our report highlights that9

cath-D silencing by shRNAs in NIH-3T3F442A preadipocytes leads to lipid-depletedcells and to a significant reduction of the expression of PPARg, HSL and aP2adipocyte markers of differentiation, indicating that cath-D acts as a key positiveregulator of adipogenesis. Given that cath-D protein is required for adipocytedifferentiation and as it is abundantly expressed in fully-differentiated adipocytes, wepropose that cath-D may participate in the onset of obesity. Interestingly, murinecath-D deficiency led to accumulation of cholesteryl esters in the brain, suggesting akey role of cath-D in lipid metabolism (Mutka et al., 2009).Experimental studies revealed that adipocytes support breast growth (Iyengar et al.,2005; Iyengar & Scherer, 2003; Manabe et al., 2003). A supportive role of adipocytesfor breast growth has been demonstrated both in vivo and ex vivo (Iyengar et al.,2005; Iyengar & Scherer, 2003; Manabe et al., 2003). Different proteases, describedto promote cancer and metastasis, have been shown to affect the biology of theadipocyte. The metalloproteinases (Bouloumie et al., 2001; Maquoi et al., 2002) andthe cysteine cathepsins -K, -S and L (Taleb et al., 2006; Xiao et al., 2006; Yang etal., 2007) stimulate adipogenesis and are up-regulated in obesity. By contrast,Stromelysin 3 inhibits adipogenesis and induces de-differentiation of adipocyte,generating a population of fibroblast-like cells supporting the desmoplastic reactionandprogression (Andarawewa et al., 2005). The role of cath-D up-regulated inmature adipocyte regarding cancer remains unknown. Preliminary experimentsindicate that breast cancer cells secrete soluble factors that decrease cath-Dexpression in adipocytes (data not shown), leading possibly to adipocyte dedifferentiationconversion, as described for Stromelysin 3 (Andarawewa et al., 2005).In the near future, it will be important to investigate cath-D expression in biopsies10

from normal and peri-al breast adipocytes to assess its possible role in theadipocyte/cancer cells interface.In conclusion, our findings highlight that cath-D plays a crucial role in the control ofadipogenesis. Moreover, our results indicate that cath-D is up-regulated in humanand mouse obese tissues. We propose that cath-D targeting in obesity may lead to adecrease of hypertrophic adipocytes and of adipocyte hyperplasia. Since cath-D isimplicated in breast cancer progression, it may represent a molecular link betweencancer and obesity. Indeed, cath-D secreted by fully-differentiated adipocytes in largeamounts in obesity, may stimulate proliferation of breast cancer epithelial cells andstromal fibroblasts, participating in the homeostasis of progression and metastasis.11

Materials and MethodsEthics StatementAll subjects gave their informed written consent to participate to the study, andinvestigations were performed in accordance with the declaration of Helsinki asrevised in 2000 (http://www.wma.net/e/policy/b3.htm).Cells and cell cultureCell lines were cultured in DMEM (Invitrogen) supplemented with 10% fetal calfserum (FCS). Differentiation was induced by incubating 3T3-F442A confluent cells indifferentiation medium (DMEM supplemented with 10% FCS and 50 nM insulin) asdescribed (Prawitt et al., 2008). Differentiation was induced by incubating 3T3-L1confluent cells in differentiation medium (DMEM supplemented with 10% FCS and10µg/ml insulin, 250 µM isobutylmethylxanthine, 1 µM rosiglitazone, 1 µMdexamethasone).RNA extraction and analysisTotal RNA was extracted using the Reasy minikit (QIAGEN Sciences, Maryland)according to the manufacturer's instructions. Reverse transcription of total RNA wasperformed at 37°C using Moloney murine leukemia virus reverse transcriptaseenzyme (Invitrogen, Carlsbad, CA) and random hexanucleotide primers (Promega,Madison, WI). Quantitative PCR was carried out by real-time PCR using aLightCycler and the DNA double-strand-specific SYBR green I dye for detection(Roche, Basel, Switzerland). Results were normalized to RS9 levels. Sequences ofprimers are:12

mouse RS9 (sens 5CGGCCCGGGAGCTGTTGACG3, reverse5CTGCTTGCGGACCCTAATGTGACG3),mouse aP2 (sens 5AACACCGAGATTTCCTTCAA3, reverse5AGTCACGCCTTTCATAACACA3),mouse cath-D (sens 5TTCGTCCTCCTTCGCGATT3; reverse5TCCGTCATAGTCCGACGGATA3)mouse HSL (sens 5CTGAAGGCTCTGAGTTGGTCAA3, reverse5GGCTTACTGGGCACAGATACCT3),mouse PPAR (sens 5 AGGCCGAGAAGGAGAAGCTGTTG3, reverse5TGGCCACCTCTTTGCTCTGCTC3),human cath-D (5TTGCTGTTTTGTTCTGTGGTTTTC, reverse5CAGACAGGCAGGCAGCATT3).Stable transfection of shRNAs in NIH-3T3F442A cellsNIH-3T3F442A cells were transfected with 1 µg of shLuc, anti-cath-D shRNA1 orshRNA2 expression vectors (Invivogen) using Nucleofector Technology (Amaxabiosystems) according to the manufacturers instructions and 40 clones resistant toBlasticidin (4 µg/ml) were isolated. Clone D10 transfected with anti-cath-D shRNA1and clone A4 transfected with anti-cath-D shRNA2 were the best clones selected forcath-D silencing.sh1 5GGTTCCATGTAAGTCTGACCATCAAGAGTGGTCAGACTTACATGGACCC3sh2 5GACCAGTCAAAGGCAAGAGGTTCAAGAGACCTCTTGCCTTTGACTGGTC3Oil Red O staining13

NIH-3T3F442A adipocytes were washed with phosphate-buffered saline (pH 7.4) andthen fixed with Antigenfix (Diapath, Italy). Cells were stained with Oil Red O dye(saturated Oil Red O dye in six parts of isopropanol and four parts of water), anindicator of cell lipid content, and then exhaustively rinsed with water.Spectrophotometric quantification of the stain was performed by dissolving thestained oil droplets in the cell in isopropanol and measuring absorbance at 540 nm.Human samplesHuman adipose tissue was collected according to the guidelines of the EthicalCommittee of Toulouse-Rangueil and Nancy J. dArc Hospitals and received fullethical approval from the Ethical Committee of Toulouse-Rangueil and Nancy J. d'ArcHospitals. All subjects gave their informed written consent to participate to the study.Human abdominal visceral (VAT) adipose tissue and human subcutaneous adiposetissue (SAT) samples were obtained from 9 patients healthy volunteers (42.7 +/- 4.5yr old, BMI: 23.1 +/- 3.3 kg/m 2 ) undergoing abdominal lipectomy for plastic surgery.No clinical data from these patients were available. Human VAT adipose tissuesamples were obtained from 27 morbidly (grade III) obese subjects (44.5+/-1.8 yr old,BMI: 47.6 +/- 1.3 kg/m 2 ) before a bariatric surgery.All subjects were drug-free and besides obesity they did not suffer of any disease.Tissue samples were immediately frozen in liquid nitrogen and stored at -80°C. TotalRNAs of isolated adipocytes were extracted and cath-D expression analysed by RT-PCR.For in vitro differentiation, human preadipocytes were isolated from humansubcutaneous adipose tissue obtained from patients undergoing abdominal lipectomyat the plastic surgery department of Rangueil Hospital (Toulouse, France) under the14

agreement of local ethic committee. All subjects gave their informed written consentto participate to the study. Adipose tissue pieces were immediately used forcollagenase digestion as previously described (Bour et al., 2007). The digestate wascentrifuged to separate adipocytes from the stroma-vascular fraction, containingpreadipocytes (pellet). Cells isolated from the SVF fraction were induced todifferentiate into adipocytes as previously described (Gesta et al., 2003). Briefly,confluent cells (day 0) were induced to differentiate in DMEM/Hams F12 (1:1)medium containing 0.01 mg/ml transferrin, 100 nM cortisol, 0.2 nM triiodothyronine,and 20 nM insulin. To trigger differentiation, 25 nM dexamethasone, 500 mM IBMXand 2 mM rosiglitazone were present from day 0 to day 4. Intracellular accumulationof lipid droplets became clearly evident at day 10 (Bour et al., 2007).MiceMice were handled in accordance with the principles and guidelines established bythe National Institute of Medical Research (INSERM). C57Bl6/J female mice wereobtained from Charles River laboratory (lArbresle, France). Mice were housedconventionally in a constant temperature (20-22°C) and humidity (5060%) animalroom and with a 12 h lightdark cycle. All mice had free access to food and waterthroughout the experiment. C57Bl6/J mice were assigned to normal-fat diet (ND) orhigh-fat diet (HFD) (SAFE, France). Energy contents of the specific diets were (%kcals): 20% protein, 70% carbohydrate, and 10% fat for ND; 20% protein, 35%carbohydrate, and 45% fat for HFD. The main source of fat in HFD was lard (20g/100g of food). C57Bl6/J (10 week old) mice were fed a ND or HFD for 20 weeks. Allmice were sacrificed at 30 weeks of age.15

Isolation of adipocytes from mouse adipose tissueMouse intra-abdominal adipose tissues were dissected immediately after sacrifice,minced in 5 ml of Dulbeccos modified Eagles medium (DMEM; Life Technologies,Inc., Invitrogen, Paisley, UK) supplemented with 1 mg/ml collagenase (SIGMA) and1% BSA for 30 min at 37°C under shaking. Digestion was followed by filtrationthrough a 150 µm screen, and the floating adipocytes were separated from themedium containing the stroma-vascular fraction (SVF). Adipocytes were washedtwice in DMEM and further processed for RNA extraction using the RNeasy mini kit(Qiagen, Germany).ImmunoblotsCells were lysed in lysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 10% glycerol,1 % Triton X100, 1.5 mM MgCl 2 , 1 mM EGTA, 100 mM NaF, 10 mM NaPPI, 500 µmNa-Vanadate, 1 mM PMSF, 10µM Aprotinine, and a protease inhibitor cocktail). Aftergentle shaking for 20 min at 4°C, cell extracts were obtained by centrifugation in amicrofuge at 13,000 rpm for 15 min at 4°C. Equal amounts of protein (100 g) fromcell extracts, quantitated by the Bradford assay, were separated on a 7% gel by SDS-PAGE. Proteins were electro-transferred to PVDF membrane and incubated with 1µg/ml anti-mouse cath-D (Santa Cruz Biotechnology), 1 g/ml anti- tubulin (LabVision Corporation), 1 µg/ml anti-b actin (Sigma), 1 µg/ml ERK2 (Santa CruzBiotechnology), or 0.4 µg/ml anti-HSL (Santa Cruz Biotechnology). Proteins werevisualized with horseradish peroxidase-conjugated sheep anti-mouseimmunoglobulin (ECL Amersham) or horseradish peroxidase-conjugated rabbit antigoatimmunoglobulin (ECL Amersham) followed by the Renaissancechemiluminescence system (Perkin Life Sciences).16

Statistical analysis. Results are expressed as means ± SEM. Statistical differencesbetween two groups were evaluated using Students t tests. The level of significancewas set at P < 0.05.ACKNOWLEDGEMENTSThis work was supported by the Institut National de la Santé et de la RechercheMédicale, the University of Montpellier I, the Canceropole Grand Sud-Ouest and theInstitut National du Cancer (INCA grants PL2006_035).The authors declare no conflict of interest.CONFLICT OF INTERESTREFERENCESAndarawewa KL, Motrescu ER, Chenard MP, Gansmuller A, Stoll I, Tomasetto C andRio MC. (2005). Cancer Res, 65, 10862-71.Berchem G, Glondu M, Gleizes M, Brouillet JP, Vignon F, Garcia M and Liaudet-Coopman E. (2002). Oncogene, 21, 5951-5.Bouloumie A, Sengenes C, Portolan G, Galitzky J and Lafontan M. (2001). Diabetes,50, 2080-6.Bour S, Daviaud D, Gres S, Lefort C, Prevot D, Zorzano A, Wabitsch M, Saulnier-Blache JS, Valet P and Carpene C. (2007). Biochimie, 89, 916-25.Calle EE and Kaaks R. (2004). Nat Rev Cancer, 4, 579-91.Capony F, Morisset M, Barrett AJ, Capony JP, Broquet P, Vignon F, Chambon M,Louisot P and Rochefort H. (1987). J Cell Biol, 104, 253-62.17

Capony F, Rougeot C, Montcourrier P, Cavailles V, Salazar G and Rochefort H.(1989). Cancer Res, 49, 3904-9.Felbor U, Kessler B, Mothes W, Goebel HH, Ploegh HL, Bronson RT and Olsen BR.(2002). Proc Natl Acad Sci U S A, 99, 7883-8.Ferrandina G, Scambia G, Bardelli F, Benedetti Panici P, Mancuso S and Messori A.(1997). Br J Cancer, 76, 661-6.Foekens JA, Look MP, Bolt-de Vries J, Meijer-van Gelder ME, van Putten WL andKlijn JG. (1999). Br J Cancer, 79, 300-7.Fusek M and Vetvicka V. (1994). Biochem J, 303 ( Pt 3), 775-80.Garcia M, Derocq D, Pujol P and Rochefort H. (1990). Oncogene, 5, 1809-14.Gesta S, Lolmede K, Daviaud D, Berlan M, Bouloumie A, Lafontan M, Valet P andSaulnier-Blache JS. (2003). Horm Metab Res, 35, 158-63.Glondu M, Coopman P, Laurent-Matha V, Garcia M, Rochefort H and Liaudet-Coopman E. (2001). Oncogene, 20, 6920-9.Glondu M, Liaudet-Coopman E, Derocq D, Platet N, Rochefort H and Garcia M.(2002). Oncogene, 21, 5127-34.Hu L, Roth JM, Brooks P, Luty J and Karpatkin S. (2008). Cancer Res, 68, 4666-73.Iyengar P, Espina V, Williams TW, Lin Y, Berry D, Jelicks LA, Lee H, Temple K,Graves R, Pollard J, Chopra N, Russell RG, Sasisekharan R, Trock BJ,Lippman M, Calvert VS, Petricoin EF, 3rd, Liotta L, Dadachova E, Pestell RG,Lisanti MP, Bonaldo P and Scherer PE. (2005). J Clin Invest, 115, 1163-76.Iyengar P and Scherer PE. (2003). Pediatr Diabetes, 4, 32-7.Laurent-Matha V, Maruani-Herrmann S, Prebois C, Beaujouin M, Glondu M, Noel A,Alvarez-Gonzalez ML, Blacher S, Coopman P, Baghdiguian S, Gilles C,18

Loncarek J, Freiss G, Vignon F and Liaudet-Coopman E. (2005). J Cell Biol,168, 489-99.Liaudet-Coopman E, Beaujouin M, Derocq D, Garcia M, Glondu-Lassis M, Laurent-Matha V, Prebois C, Rochefort H and Vignon F. (2006). Cancer Lett, 237, 167-79.Liaudet E, Derocq D, Rochefort H and Garcia M. (1995). Cell Growth Differ, 6, 1045-52.Liaudet E, Garcia M and Rochefort H. (1994). Oncogene, 9, 1145-54.Manabe Y, Toda S, Miyazaki K and Sugihara H. (2003). J Pathol, 201, 221-8.Maquoi E, Munaut C, Colige A, Collen D and Lijnen HR. (2002). Diabetes, 51, 1093-101.Maquoi Neese RA, Misell LM, Turner S, Chu A, Kim J, Cesar D, Hoh R, Antelo F,Strawford A, McCune JM, Christiansen M and Hellerstein MK. (2002). ProcNatl Acad Sci U S A, 99, 15345-50.Mueller MM and Fusenig NE. (2004). Nat Rev Cancer, 4, 839-49.Mutka AL, Haapanen A, Kakela R, Lindfors M, Wright AK, Inkinen T, Hermansson M,Rokka A, Corthals G, Jauhiainen M, Gillingwater TH, Ikonen E and Tyynela J.(2009). J Neurochem.Prawitt J, Niemeier A, Kassem M, Beisiegel U and Heeren J. (2008). Exp Cell Res,314, 814-24.Rajala MW and Scherer PE. (2003). Endocrinology, 144, 3765-73.Renehan AG, Tyson M, Egger M, Heller RF and Zwahlen M. (2008). Lancet, 371,569-78.Rochefort H. (1992). Eur J Cancer, 28A, 1780-3.Rochefort H and Liaudet-Coopman E. (1999). Apmis, 107, 86-95.19

Rodriguez J, Vazquez J, Corte MD, Lamelas M, Bongera M, Corte MG, Alvarez A,Allende M, Gonzalez L, Sanchez M, Vijande M, Garcia Muniz J and Vizoso F.(2005). Int J Biol Markers, 20, 103-11.Spiegelman BM and Farmer SR. (1982). Cell, 29, 53-60.Taleb S, Cancello R, Clement K and Lacasa D. (2006). Endocrinology, 147, 4950-9.van Kruijsdijk RC, van der Wall E and Visseren FL. (2009). Cancer EpidemiolBiomarkers Prev, 18, 2569-78.Westley B and Rochefort H. (1980). Cell, 20, 353-62.Westley BR and May FE. (1999). Br J Cancer, 79, 189-90.Wiseman BS and Werb Z. (2002). Science, 296, 1046-9.Wright ME, Chang SC, Schatzkin A, Albanes D, Kipnis V, Mouw T, Hurwitz P,Hollenbeck A and Leitzmann MF. (2007). Cancer, 109, 675-84.Xiao Y, Junfeng H, Tianhong L, Lu W, Shulin C, Yu Z, Xiaohua L, Weixia J, Sheng Z,Yanyun G, Guo L and Min L. (2006). J Clin Endocrinol Metab, 91, 4520-7.Yang M, Zhang Y, Pan J, Sun J, Liu J, Libby P, Sukhova GK, Doria A, Katunuma N,Peroni OD, Guerre-Millo M, Kahn BB, Clement K and Shi GP. (2007). Nat CellBiol, 9, 970-7.Zhou H, Xiao Y, Li R, Hong S, Li S, Wang L, Zeng R and Liao K. (2009). ActaBiochim Biophys Sin (Shanghai), 41, 910-21.20

Aa3000 *b4000*B8000**cath-D mRNA(arbitrary unit)20001000300020001000cath-D mRNA(arbitrary unit)6000400020000normalVATobeseVAT0normalSATobeseSAT0NDHFDFigure 1Figure 1. Cath-D expression is up-regulated in human and mouse obese adiposetissues(A) Cath-D expression in adipose tissue from lean and obese human. Cath-D mRNAlevel was quantified in human intra-abdominal visceral adipose tissue samples (VAT)(panel a) and in human subcutaneous adipose tissue samples (SAT) (panel b) obtainedfrom 27 morbide grade III obese patients (44.5+/-1.8 year old, BMI: 47.6 +/- 1.3 kg/m2)before a bariatric surgery and from 9 control patients undergoing abdominal lipectomy forplastic surgery (42.7 +/- 4.5 year old, BMI: 23.1 +/- 3.3 kg/m2). Results are means +/-SEM, *P

3T3-F442A3T3-L1Co D7 Co D7NIH-3T3HMFMCF-7cath-D52K -48K -34K -a-tubulinFigure 2Figure 2. Cath-D expression in pre-adipocytes, adipocytes, fibroblasts and breastepithelial cancer cellsCath-D expression was analysed by immunoblotting in confluent preadipocytes (Co) andadipocytes differentiated for 7 days (D7) in NIH-3T3F442A and NIH-3T3-L1 cell lines, inNIH-3T3 mouse fibroblasts, HMF human breast fibroblasts, and MCF-7 human epithelialbreast cancer cells . a-tubulin served as a loading control.

ABcath-D mRNA(ratio RS9)PPARg mRNA(ratio RS9)aP2 mRNA(ratio RS9)864202520151050100806040200cath-DPPARgaP2Ex Co D1 D2 D3 D7 D10 D14 D17days relative to confluenceEx Co D1 D 2 D3 D7 D10 D14 D17** **cellular cath-Dsecreted cath-DHSLb actinERK2C8h 24h 48hInsulin - + - + - +cath-DERK2Figure 3

Figure 3. Cath-D expression increases during adipogenesis of NIH-3T3F442Apreadipocytes(A)Cath-D mRNA expression during adipogenesis. RNA expression of cath-D,PPARg and aP2 were analysed in exponentially growing NIH-3T3F442Apreadipocytes (Ex), in NIH-3T3F442A grown to confluence (Co) and after theindicated time of culture in adipogenic differentiation medium by real-timequantitative RT-PCR. Mean ± SD of 4 independent experiments is shown. P

A D3 D7 D14D0BaD0 D3 D7 D14D0 D3 D7 D14cath-DNScath-DNSHSLb400 Exp 1cath-D protein(% D0)300200100Exp20D0 D7 D14Figure 4

Figure 4. Expression of cath-D during adipogenesis in human(A) Micrographs of human adipocytes. Human preadipocytes isolated fromsubcutaneous adipose tissue digested with collagenase and separated from thestromal vascular fraction were grown for 0, 3, 7 and 14 days in the presence of theadipogenic medium as illustrated in the micrographs. A representative experiment isshown.(B) Cath-D protein expression during adipogenesis. Protein expression of cath-D andHSL was analysed by immunoblotting after the indicated time following induction ofthe differentiation process (panel a). Two independent experiments (panel a, left andright panels) are presented. NS, non specific band showing sample loading.Quantification of cath-D expression in non-differentiated adipocytes at day 0 (D0)and in differentiated adipocytes at days 7 and 14 (D7, D14) is shown in panel b.Exp; experiment.

AshLucshcath-DF442A C34 C37 A4 D10cath-D tubulinBBcath-D mRNA (% F442A cells)a140120100806040200ccath-D**F442A C34 C37 A4 D10PPARg mRNA (% F442A cells)b4003002001000dPPARg**F442A C34 C37 A4 D10HSL mRNA (% F442A cells)3002001000HSL**F442A C34 C37 A4 D10ap2 mRNA (% F442A cells)250200150100500aP2* *F442A C34 C37 A4 D10Figure 5

Figure 5. Silencing of cath-D inhibits expression of adipocyte differentiation markers.(A)Silencing of cath-D by shRNAs. NIH-3T3F442A preadipocytes were stably transfectedwith Luc shRNA (C34 and C37 clones), cath-D shRNA1 (D10 clone) and cath-D shRNA2(A4 clone). Cath-D protein expression was monitored by immunoblotting in C34, C37, A4,D10 clones and in parental F442A cells. a tubulin was used as a loading control. Arepresentative experiment out of 3 is shown.(B) mRNA expression of cath-D, PPARg, HSL and aP2 in cath-D-silenced preadipocytes.RNA expression of cath-D, PPARg, HSL and aP2 was analysed in Luc shRNA clones(C34 and C37) or cath-D shRNA clones (A4 and D10) after 7 day in the adipogenicdifferentiation medium. Mean ± SD of 3 independent experiments is shown. *P< 0.005when compared with C37 clone.

AF442-AC34C37A4D10BF442-AC34C37A4D10C200lipid content (% F442-A cells)15010050**0F442A C34 C37 A4 D10Figure 6

Figure 6. Cath-D expression is required for adipogenesis.(A)Staining of neutral lipids. Plates of parental NIH-3T3F442A cells, Luc shRNA(C34 and C37) and cath-D shRNA (A4 and D10) clones are presented at day 7 ofdifferentiation. The extent of cellular lipid accumulation was revealed by oil Red Ostaining. A representative experiment out of 3 is shown.(B) Micrographs. Micrographs of parental NIH-3T3F442A cells, Luc shRNA (C34 andC37) and cath-D shRNA (A4 and D10) clones were performed at 7 of differentiation.A representative experiment out of 3 is shown.(C) Quantification of neutral lipids. Lipid content was quantified at day 7 ofdifferentiation in parental NIH-3T3F442A cells, Luc shRNA (C34 and C37) and cath-D shRNA (A4 and D10) clones. Mean ± SD of triplicate of is shown. *P< 0.025 whencompared with C37 clone. A representative experiment out of 2 is shown.

II. Etude du rôle du LRP1 dans les adipocytes1) Introduction :Lobésité qui se caractérise par laugmentation de la taille (hypertrophie) et du nombre(hyperplasie) des adipocytes est fréquemment associée à certaines pathologies comme lediabète de type 2, des troubles cardio-vasculaires, lhypertension et certains cancers. Lenombre des adipocytes dun organisme est déterminé par un processus finement régulé dedifférenciation de cellules précurseur. Ce processus est régulé par différents facteurs detranscription, qui vont engendrer lexpression coordonnée de centaines de protéines quipermettront lengagement et le maintien du phénotype terminal des adipocytes. Parmi eux,PPAR (peroxisome proliferator-activated receptor gamma) joue un rôle capital, car lessouris déficientes en PPAR au niveau des adipocytes présentent un tissu adipeux très peudéveloppé. PPAR induit lexpression de gènes lipogéniques tel aP2 (fatty acid bindingprotein), ou de gènes lipolytiques tel la lipase hormono-sensibles. De façon très intéressante,ce récepteur nucléaire up-régule également la transcription du gène du LRP1 (LDL receptorrelatedprotein1), récemment identifié par léquipe comme étant un nouveau récepteur de lacath-D (publication soumise). LRP1 est un récepteur dendocytose composé dune sous-unité et dune sous-unité . Ce récepteur reconnaît une quarantaine de ligands différents, et estimpliqué dans divers processus physiologique. LRP1 est fortement exprimé dans leshépatocytes, les neurones, et les cellules musculaires lisses. Il participe à lélimination denombreux complexes protéiques dans le foie, est impliqué dans la transmission synaptique etjoue un rôle protecteur de lathérosclérose. Lexpression de LRP1 est particulièrement élevéedans les adipocytes où il participerait à lhoméostasie des lipides. Ce récepteur interagit avecla protéine ApoE présente dans les lipoprotéines circulantes et permet lassimilation destriglycérides et des esters de cholestérol en agissant de concert avec la lipoprotéine lipase.Une étude récente montre que les souris déficientes en LRP1 dans les adipocytes maturesprésentent un poids corporel plus faible, des réserves lipidiques réduites, ainsi que éliminationdes lipides après la prise alimentaire. De plus, il a été suggéré que ce récepteur serait impliquédans les voies de signalisation conduisant à la synthèse des acides gras et quil réguleraitégalement lhoméostasie du cholestérol. Cependant, la fonction de LRP1 dans la biologie dupré-adipocyte demeure encore inconnue. De plus, lexpression de LRP1 chez lindividu obèsena pas été rapportée. Dans cette étude, nous avons quantifié le taux dexpression du LRP1chez lhomme et la souris obèse. Nous avons également analysé lexpression du LRP1 aucours de la différenciation des adipocytes dans des modèles humain et murin. De plus, afin de64

déterminer le rôle de ce récepteur au cours de ladipogenèse, nous avons inhibé de façonstable son expression dans les pré-adipocytes par lutilisation de siRNA anti-LRP1 et nousavons étudié les conséquences sur lexpression des marqueurs de la différenciationadipocytaire, PPARg, aP2 et HSL et sur laccumulation des lipides pendant linduction deladipogenèse. Finalement, lexpression du LRP1 a été inhibée dans ladipocyte mature et lesconséquences sur laccumulation a été étudiée.65

2) Article 2:LRP1 receptor controls adipogenesis and is up-regulatedin human and mouse obese adipose tissue66

LRP1 Receptor Controls Adipogenesis and Is Up-Regulated In Human and Mouse Obese Adipose TissueOlivier Masson 1 , Carine Chavey 1 ,Cédric Dray 2,3 , Aline Meulle 3,4 , Danielle Daviaud 2,3 , Didier Quilliot 5 ,Catherine Muller 4 , Philippe Valet 2,3 , Emmanuelle Liaudet-Coopman 1 *1 IRCM, Institut de Recherche en Cancérologie de Montpellier, INSERM, U896, Université Montpellier1, CRLC Val d’Aurelle Paul Lamarque, Montpellier, France, 2 InstitutNational de la Santé et de la Recherche Médicale (INSERM), U858, Toulouse, France, 3 Université de Toulouse, UPS, Institut de Médecine Moléculaire de Rangueil, Equipenu3, IFR31, Toulouse, France, 4 Institute of Pharmacology and Structural Biology CNRS UMR 5089, Université de Toulouse, Toulouse, France, 5 Service de diabétologie,Maladies métaboliques et nutrition, CHU de Nancy, Hôpital J. d’Arc, Nancy FranceAbstractThe cell surface low-density lipoprotein receptor-related protein 1, LRP1, plays a major role in lipid metabolism. Thequestion that remains open concerns the function of LRP1 in adipogenesis. Here, we show that LRP1 is highly expressed inmurine preadipocytes as well as in primary culture of human adipocytes. Moreover, LRP1 remains abundantly synthesisedduring mouse and human adipocyte differentiation. We demonstrate that LRP1 silencing in 3T3F442A murine preadipocytessignificantly inhibits the expression of PPARc, HSL and aP2 adipocyte differentiation markers after adipogenesis induction,and leads to lipid-depleted cells. We further show that the absence of lipids in LRP1-silenced preadipocytes is not caused bylipolysis induction. In addition, we provide the first evidences that LRP1 is significantly up-regulated in obese C57BI6/Jmouse adipocytes and obese human adipose tissues. Interestingly, silencing of LRP1 in fully-differentiated adipocytes alsoreduces cellular lipid level and is associated with an increase of basal lipolysis. However, the ability of mature adipocytes toinduce lipolysis is independent of LRP1 expression. Altogether, our findings highlight the dual role of LRP1 in the control ofadipogenesis and lipid homeostasis, and suggest that LRP1 may be an important therapeutic target in obesity.Citation: Masson O, Chavey C, Dray C, Meulle A, Daviaud D, et al. (2009) LRP1 Receptor Controls Adipogenesis and Is Up-Regulated In Human and Mouse ObeseAdipose Tissue. PLoS ONE 4(10): e7422. doi:10.1371/journal.pone.0007422Editor: Yihai Cao, Karolinska Institutet, SwedenReceived March 9, 2009; Accepted September 22, 2009; Published October 12, 2009Copyright: ß 2009 Masson et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Funding: Institut National de la Santé et de la Recherche Médicale’, the University of Montpellier I, the Canceropole Grand Sud-Ouest and the Institut National duCancer (INCA grants PL2006_035). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.Competing Interests: The authors have declared that no competing interests exist.* E-mail: e.liaudet@valdorel.fnclcc.frIntroductionConsumption of meals rich in fat and carbohydrates is a majorcausative factor of obesity, resulting in excessive white adipose tissue.Adiposetissueservesasanenergyreservoirandasanendocrineorgan.An increase of adipose tissue mass results from combined hypertrophyof existing adipocytes (hypertrophic adipocytes) and adipogenicdifferentiation of precursor cells (hyperplasic adipocytes) [1]. Expressionof the nuclear peroxisome proliferator-activated receptor c(PPARc) is known to be crucial for the initiation of adipocytedifferentiation. Indeed, mice with a targeted adipocyte-specific deletionof the PPARc gene display a decreased adipose tissue mass [2].Activation of PPARc induces the expression of lipogenic genes, such asadipocyte fatty acid binding protein (aP2), and of lipolytic genes, suchas hormone-sensitive lipase (HSL) [3]. Interestingly, activated PPARcalso stimulates the transcription of the low-density lipoprotein receptorrelatedprotein 1 (LRP1) in adipocytes [4].LRP1 is a 600-kDa multifunctional endocytic receptor that bindsand internalizes a broad range of biologically diverse ligands includingproteins important in lipoprotein metabolism [5]. LRP1 mediates theendocytotic internalization of dietary lipids carried in postprandialchylomicron remnants into hepatocytes by binding to ApolipoproteinE (ApoE) [6,7], particle–bound lipoprotein lipase (LpL) [8] and hepaticlipase [9]. Interestingly, LRP1 is expressed in adipocytes [4,10,11] andinsulin stimulation of LRP1 increases the endocytic uptake oftriglycerides and cholesteryl esters from remnant lipoproteins inpostprandial adipocytes in a synergistic action with lipoprotein lipase[10]. Adipose-specific LRP1-knockout mice generated by crossingLRP1 flox/flox mice with aP2-Cre transgenic mice recently revealed itsprominent role in lipid assimilation affecting energy metabolism anddiet-induced obesity in mature adipocytes [12]. Even through thefundamental function of LRP1 in lipid homeostasis was recentlyrevealed in mouse model [12], its role in adipogenesis remains to beelucidated. Here, we report that LRP1 expression is necessary foradipocyte differentiation. Silencing of LRP1 in preadipocytes by theuse of siRNAs significantly inhibits the expression of PPARc,HSLandaP2 adipocyte differentiation markers, and leads to lipid-depleted cellsinept to induce lipolysis. Moreover, we corroborated the key functionof LRP1 in maintaining the lipid levels in mature adipocytes. Untilnow, the implication of LRP1 in obesity has not been reported yet inhuman. Our study highlights, for the first time, that LRP1 expression isup-regulated in obese human tissue, and suggests that this receptor maybe an interesting therapeutic target in obesity.ResultsLRP1 is highly expressed in adipocytes duringadipogenesis in mouse and humanIn order to explore the function of adipocytic LRP1, we firstinvestigated the level of LRP1 protein expression in preadipocytesPLoS ONE | www.plosone.org 1 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, Obesityrelative to fibroblasts and epithelial cancer cells. As illustrated inFigure 1A, LRP1 was abundantly expressed in preadipocytes (3T3-F442A, 3T3-L1) and in fibroblasts (NIH-3T3, LRP1+/2 MEFs, HMF),when compared to epithelial mammary immortalized (HMT3522-S1) or cancer (MCF7, MDA-MB231) cells. As expected, no LRP1expression was detected in LRP12/2 MEF cells (Fig. 1A).To assess the role of LRP1 in preadipocytes, we next examinedthe regulation of its expression during the course of adipogenesisin the well-established murine 3T3F442A preadipocyte cell line,which has been validated as a valuable model of adipogenesis [13](Fig. 1B–C). LRP1 mRNA (Fig. 1B) and LRP1b protein (Fig. 1C)were expressed at high levels along adipogenesis. Even through, atendency of LRP1 up-regulation was observed, no statisticalsignificance was reached (Fig. 1B–C). To validate our experimentalconditions, we studied in parallel the expression of PPARc (Fig. 1B),HSL (Fig. 1C) and aP2 (Fig. 1B) adipocyte markers of differentiation.As attempted, the level of these markers was progressivelyincreased during acquisition of the adipocyte phenotype (Fig. 1B–C). In addition, the cytoskeletal bactin protein amount wasdiminished during adipocyte differentiation reflecting the changein cellular morphology (Fig. 1C), as described before [14].Although 3T3F442A cells are a valuable experimental model,these preadipocytes have distinct attributes compared with humancells in primary culture beyond the obvious species differences.Therefore, we also analysed LRP1 expression during adipogenesisin human preadipocytes purified from abdominal subcutaneousadipose tissue using a recent approach [15] (Fig. 2). These primaryhuman cells were differentiated in an efficient manner since about75% of preadipocytes were converted to the adipocyte phenotype(Fig. 2A) and as reflected by HSL induction (Fig. 2B). As observedfor the mouse adipocyte, LRP1b protein remained abundantlyexpressed along human adipocyte differentiation (Fig. 2B). Takentogether, these findings report the presence of high LRP1 levelsduring adipocyte differentiation in both mouse and human.Silencing of LRP1 expression inhibits adipogenesisTo determine whether preadipocyte requires LRP1 to differentiateinto mature adipocyte, LRP1 expression was silenced in3T3F442A preadipocytes using 3 LRP1 siRNAs. As shown inFigure 3A, a robust LRP1b extinction was observed two days posttransfectionwith LRP1 siRNAs as compared to control Luc siRNA.Consequently, we induced adipogenesis in control (Luc siRNA) andLRP1-silenced 3T3F442A preadipocytes two days post-transfection(Fig. 3B). As shown in Fig. 3B, LRP1b protein expression wasinhibited by the 3 LRP1 siRNAs as compared to Luc siRNA duringdifferentiation. The most efficient siRNA, LRP1 siRNA1, inhibitedLRP1b protein still after 7 days of differentiation (Fig. 3B). Agradual lost of efficiency was observed with LRP1 siRNA2 andsiRNA3 at days 3, 5 and 7 days of differentiation (Fig. 3B). SimilarLRP1 silencing was observed at the mRNA level (Fig. 4A, panel a;Fig. 4B, panel a), with a significant reduction of 74% and 50% forLRP1 siRNA1 after 3 and 7 days of differentiation.In order to evaluate the consequences of LRP1 silencing inadipocyte differentiation, we first quantified the expression ofPPARc, HSL and aP2 adipocyte differentiation markers in Luc andLRP1 siRNA transfected 3T3F442A cells (Fig. 4). LRP1 siRNA1silencing (Fig. 4A, panel a) significantly inhibited PPARc (Fig. 4A,panel b), HSL (Fig. 4A, panel c) and aP2 (Fig. 4A, panel d) mRNAlevels at days 3 and 7 of differentiation. Extinction of LRP1expression by LRP1 siRNA2 and siRNA3 (Fig. 4B, panel a) alsoreduced PPARc (Fig. 4B, panel b), HSL (Fig. 4B, panel c) and aP2(Fig. 4B, panel d) mRNA levels at days 3 and 7 of differentiation butto a lesser extend as compared to LRP1 siRNA1. Hence, our resultsindicate that the gradual lost of LRP1 expression by LRP1 siRNAsFigure 1. Expression of LRP1 in mouse adipocytes duringadipogenesis. (A) LRP1b protein expression. Expression of LRP1b,and ERK2 were analysed by immunoblotting in preadipocytes (3T3-F442A, 3T3-L1), fibroblasts (NIH-3T3, LRP12/2 MEF, LRP1+/2 MEF, HMF), andepithelial (HMT3522-S1, MCF7, MDA-MB-231) cells. COS cells transfectedwith LRP1b serve as a positive control for LRP1b expression. ERK2 wasused as a loading control. (B) LRP1 mRNA expression duringadipogenesis. RNA expression of LRP1, PPARc and aP2 were analysedin exponentially growing 3T3F442A preadipocytes (Ex), in 3T3F442Agrown to confluence (Co) and after the indicated time of culture inadipogenic differentiation medium by real-time quantitative RT-PCR.Mean 6 SD of 5 independent experiments quantified in duplicate isshown. LRP1 mRNA expression was not statistically different duringadipogenesis. (C) LRP1b protein expression during adipogenesis.Protein expression of LRP1b, HSL, bactin and ERK2 were analysed byimmunoblotting in exponentially growing 3T3F442A preadipocytes (Ex)and after the indicated time following induction of the differentiationprocess. ERK2 was used as loading control. Similar results wereobserved in 3 independent experiments. LRP1b protein expressionwas not statistically different during adipogenesis.doi:10.1371/journal.pone.0007422.g001(Fig. 4B, panel a) led to a concomitant decrease of adipocytedifferentiation marker expression (Fig. 4B, panels b-d). Altogether,these findings highlight that LRP1 tightly controls adipogenicexpression markers in a dose-dependent manner.PLoS ONE | www.plosone.org 2 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, ObesityFigure 2. Expression of LRP1 during adipogenesis in human. (A) Micrographs of human adipocytes. Human preadipocytes isolated fromsubcutaneous adipose tissue digested with collagenase and separated from the stromal vascular fraction were grown for 0, 3, 7 and 14 days in thepresence of the adipogenic medium as illustrated in the micrographs. A representative experiment is shown. (B) LRP1b protein expressionduring adipogenesis. Protein expression of LRP1b and HSL was analysed by immunoblotting after the indicated time following induction of thedifferentiation process. NS, non specific band showing sample loading. Two independent experiments (left and right panels) are presented.doi:10.1371/journal.pone.0007422.g002Then, we analysed the cellular lipid levels in adipocytes silencedor not for LRP1 (Fig. 5). Indeed, the most obvious feature ofadipocytes is the synthesis and storage of triglycerides in lipiddroplets and therefore the gradual appearance and growth of lipiddroplets are characteristic for adipocyte precursor cells undergoingadipogenic differentiation. The presence of these neutral lipids wasdetected by oil red O staining (Fig. 5A–B). As illustrated in Fig. 5A,oil red O staining after 7 days of differentiation revealed thatextinction of LRP1 expression by siRNA1 strongly decreasedneutral lipid droplet formation and/or accumulation. Microscopicanalysis at day 3 and 7 of differentiation illustrated that, asattempted, Luc siRNA-transfected 3T3F442A cells accumulatednumerous large lipid droplets and adopted a non adherent roundmorphology characteristic of mature adipocytes (Fig. 5B, panels aand c). By contrast, in 3T3F442A cells silenced with LRP1siRNA1, the lipid droplet size and number were strongly reduced(Fig. 5B, panels b and d). Moreover, cells kept the morphologicalfeature of adherent fibroblastic cells, suggesting that preadipocytedifferentiation process did not occur in the absence of LRP1.Quantification of lipids afterwards demonstrated that silencing ofLRP1 with LRP1 siRNA1 significantly decreased lipid contentlevels by 7 fold at day 7 of differentiation (Fig. 5C, panel a). LRP1siRNA2 and siRNA3 also lowered the lipid content but to a lesserextend as compared to LRP1 siRNA1 (Fig. 5C, panel a). Similarresults were obtained by quantifying triglycerides (Fig. 5C, panelb). These results reveal that LRP1 silencing in preadipocytesinhibits adipogenesis, leading to lipid-depleted cells.We finally studied the effects of silencing LRP1 in preadipocyteon lipolysis. Indeed, only mature adipocytes possess the completeapparatus for lipolysis. Our results indicating a significant decreaseof HSL expression in LRP1 silenced cells (Fig. 4), we, therefore,advocate that lipolysis should be absent in LRP1-silencedpreadipocytes. An alternative could be that LRP1 silenced cellshave an increased lipolysis, leading to lipid depleted cells.However, our results revealed that glycerol release over 18 hwas significantly reduced in LRP1 silenced cells, indicatinginhibition of basal lipolysis (Fig. 6A). Moreover, glycerol andNEFA released in the media after isoproterenol treatment werealso significantly decreased in LRP1 silenced cells, evidencinginhibition of induced-lipolysis. Therefore, extinction of LRP1 inpreadipocytes abolishes expression of adipocyte differentiationmarkers and leads to lipid-depleted cells inept to induce lipolysis.LRP1 expression is up-regulated in human and mouseobese adipose tissuesObesity is characterized by the increase of intracellular lipidaccumulation which shows a significant correlation with adipocytedifferentiation. LRP1 mRNA expression was investigated in humanintra-abdominal visceral adipose tissue (VAT) from lean (42.764.5year old, BMI: 23.163.3 kg/m 2 ) and obese (44.561.8 year old,BMI: 47.661.3 kg/m 2 ) human (Fig. 7). Interestingly, LRP1 mRNAwas significantly increased in human obese adipose tissue (Fig. 7A).To assess whether this LRP1 up-regulation was a generalcharacteristic of obese adipocytes, we then analysed LRP1 mRNAPLoS ONE | www.plosone.org 3 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, ObesityFigure 3. Inhibition of LRP1 expression by silencing during adipocyte differentiation. (A) Silencing of LRP1 by siRNAs. 3T3F442Apreadipocytes were transiently transfected with Luc siRNA or LRP1 siRNAs. LRP1b protein expression was monitored by immunoblotting 2 days posttransfection.a tubulin was used as a loading control. A representative experiment out of 3 is shown. (B) Time-course of LRP1b proteinexpression after Luc siRNA or LRP1 siRNAs transfection during adipogenesis. 3T3F442A preadipocytes were transiently transfected withLuc siRNA or LRP1 siRNAs. Two-days post-transfection, LRP1b protein expression was monitored by immunoblotting 0, 3, 5 or 7 days afterdifferentiation induction. ERK2 was used as a loading control.doi:10.1371/journal.pone.0007422.g003expression in adipocytes isolated from C57BI6/J mice either fed aHFD or ND (Fig. 7B). As attempted HFD-fed C57BI6/J miceexhibited a significant increase in body mass (47.661.4 g) whencompared to their control littermates (31.161.2 g) (data not shown).LRP1 expression was significantly enhanced in adipocytes of HFDobese mice when compared to ND control mice (Fig. 7B).Altogether, our results indicate that LRP1 expression is upregulatedin human and mouse obese adipose tissues.Silencing of LRP1 expression inhibits the cellular lipidcontent of fully-differentiated adipocytesSince we observed that LRP1 expression was up-regulated inobese adipose tissues, we finally investigated whether extinction ofLRP1 expression in fully-differentiated adipocytes could diminishtheir lipid content (Fig. 8), as recently suggested in adipose-specificLRP12/2 mouse model [12]. 3T3F442A preadipocytes werecultured for 10 days in adipogenic differentiation medium (Fig. 8A,panel a) and fully-differentiated adipocytes were transientlytransfected with Luc siRNA or LRP1 siRNA1 (Fig. 8A, panel b).Oil red O staining revealed that, after 7 days of culture, the lipiddroplet size and number were decreased in LRP1 siRNA1transfected adipocytes (Fig. 8B–C). Quantification of lipids atdays 2 and 7 of culture revealed that, in Luc siRNA transfectedadipocytes, the level of cellular lipid remained unchanged whereas,in LRP1 siRNA1 transfected cells, the amount of lipid wassignificantly diminished by 27.8% (Fig. 8D). Interestingly, basallipolysis was significantly stimulated in LRP1 siRNA1 transfectedadipocytes (Fig. 9, panel a). We postulate that, since cells could notinternalized triglycerides in the absence of LRP1 as previouslyshown [12], they were metabolizing their intracellular lipid stock.However, induced lipolysis was not different in LRP1 and LucsiRNA transfected cells (Fig. 9, panel b). Altogether, these findingshighlight, for the first time, the crucial role of LRP1 in controllingadipogenesis and maintaining the lipid content in fully-differen-PLoS ONE | www.plosone.org 4 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, ObesityFigure 4. Silencing of LRP1 inhibits expression of adipocyte differentiation markers in a LRP1 dose-dependent manner. (A) mRNAexpression of LRP1, PPARc, HSL and aP2 in LRP1 siRNA1-silenced preadipocytes. RNA expression of LRP1, PPARc, HSL and aP2 was analysedin 3T3F442A preadipocytes transfected with Luc siRNA or LRP1 siRNA1. RNA was quantified by RT-PCR in 3T3F442A cells after 3 and 7 days in adipogenicdifferentiation medium. Mean 6 SD of 4 independent experiments is shown. *P,0.025 when compared with Luc siRNA transfected cells. (B) Inhibitionof PPARc, HSL and aP2 mRNA expression in LRP1-silenced preadipocytes in a LRP1 dose-dependent manner. RNA levels of LRP1, PPARc,HSL and aP2 in 3T3F442A preadipocytes transfected with Luc siRNA or the 3 LRP1 siRNA1-3 were performed as described in panel A.doi:10.1371/journal.pone.0007422.g004tiated adipocytes, and suggest that LRP1 may be an importanttherapeutic target in obesity.DiscussionHere, we show that LRP1 is highly expressed in 3T3F442Amurine preadipocyte cell line, as previously described for 3T3L1preadipocytes and embryonic fibroblasts [16,17]. Since LRP1 isexpressed at high levels in preadipocytes, it therefore can beinvolved in the early steps of adipocyte differentiation. Indeed, ourreport demonstrate that LRP1 silencing by siRNAs in 3T3F442Apreadipocytes significantly inhibits the expression of PPARc, HSLand aP2 adipocyte markers of differentiation and leads to lipiddepletedcells, indicating that LRP1 is a key regulator of thePLoS ONE | www.plosone.org 5 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, ObesityFigure 5. LRP1 expression is required for adipogenesis. (A)Staining of neutral lipids. Plates of 3T3F442A transfected with LucsiRNA (panel a) or LRP1 siRNA1 (panel b) at day 7 are presented. Twodayspost Luc or LRP1 siRNA transfection, confluent 3T3F442A cellswere grown in the presence of the adipogenic differentiation medium.After 7 days of differentiation, the extent of cellular lipid accumulationwas revealed by oil Red O staining. A representative experiment out of3 is shown. (B) Micrographs of 3T3F442A preadipocytes. Cellswere transfected with Luc siRNA (panels a and c) or LRP1 siRNA1 (panelsb and d) and micrographs were performed after 3 (panels a and b) and7 (panels c and d) days of differentiation. A representative experimentout of 3 is shown. (C) Quantification of neutral lipids andtriglycerides. In panel a, lipid content was quantified at 3, 5 and 7days of differentiation in 3T3F442A transfected with Luc or LRP1 siRNAs.Mean 6 SD of 3 independent experiments is shown. *P,0.0025 whencompared with Luc siRNA transfected cells. In panel b, triglycerideswere quantified at day 5 and 7 of differentiation in 3T3F442Atransfected with Luc or LRP1 siRNAs. Results were normalised per mgof DNA. Data are presented as mean 6 SD of an experiment performedin triplicate. *P,0.0025 when compared with Luc siRNA transfectedcells.doi:10.1371/journal.pone.0007422.g005Figure 6. Silencing of LRP1 in pre-adipocytes inhibits lipolysis.(A) Basal lipolysis. Glycerol release in the medium after 18 h wasquantified in 3T3F442A transfected with Luc or LRP1 siRNA1 after 7 daysof differentiation. Results were normalised with mg of DNA. Data arepresented as mean 6 SD of one experiment performed in quadruplicate.P,0.025 when compared with Luc siRNA transfected cells. (B)Induced lipolysis. Glycerol and non esterified fatty acid (NAFA)releases were quantified after 7 days of differentiation in 3T3F442A cellstransfected with Luc or LRP1 siRNA1 and treated with increasingconcentrations of isoproterenol. Results were normalised per mg ofDNA. Mean 6 SD of an experiment performed in quadruplicate ispresented. P,0.025 when compared with Luc siRNA transfected cells.doi:10.1371/journal.pone.0007422.g006adipogenic process. Our experiments using 3 LRP1 siRNAs showthat LRP1 extinction abrogates adipocyte differentiation in aLRP1 dose-dependent manner. Our results also pinpoint thatextinction of LRP1 expression in pre-adipocytes prevents theirlipolytic response both at a basal level and after isoproterenolinduction. Therefore the inhibition of lipid accumulation andtriglyceride levels observed in LRP1-silenced preadipocytes is notthe consequence of a stimulation of lipolysis, indicating a directeffect of LRP1 on the control of the adipogenic process. PPARc isknown to be crucial for the initiation of adipocyte differention [2].Interestingly, PPARc has been described to induce LRP1transcription [4] and our results indicate that LRP1 silencinginhibits PPARc expression. This suggests the existence of aregulatory loop between these two factors. Our findings reveal thatLRP1 silencing inhibits the expression of PPARc by 80% at day 3of differentiation, indicating an early effect of LRP1 at thecommencement of adipogenesis. It is therefore important todetermine how LRP1 lost down-regulates PPARc expression. Arecent study demonstrates that LRP1 controls gene transcriptionvia Regulated Intramembrane Proteolysis through the cytoplasmicPLoS ONE | www.plosone.org 6 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, ObesityFigure 7. LRP1 expression is up-regulated in human and mouseobese adipose tissues. (A) LRP1 expression in adipose tissuefrom lean and obese human. LRP1 mRNA level was quantified inhuman intra-abdominal visceral adipose tissue samples (VAT) obtainedfrom 27 morbide grade III obese patients (44.5+/21.8 year old, BMI: 47.6+/2 1.3 kg/m 2 ) before a bariatric surgery and from 10 control patientsundergoing abdominal lipectomy for plastic surgery (42.7 +/2 4.5 yearold, BMI: 23.1 +/2 3.3 kg/m 2 ). Results are mean values +/2 SEM,*P,0.01 when compared with controls (normal VAT). (B) LRP1expression in adipocytes from obese mouse. LRP1 mRNA levelwas quantified in adipocytes isolated from intra-abdominal adiposetissues from 30-week-old overweight C57Bl6/J mice fed in high-fat diet(HFD) and from C57Bl6/J control mice fed in normal diet (ND). Resultsare mean value +/2 SEM from 5 mice for ND group and 4 mice for HFDgroup. *P,0.05 when compared with ND controls.doi:10.1371/journal.pone.0007422.g007release of LRP1 intracellular domain, LRP1-ICD [18]. Studies inthe future will investigate whether LRP1-ICD regulates PPARcexpression in preadipocytes.Our results also indicate, for the first time, that LRP1 expressionis up-regulated in human obese tissue. This up-regulation of LRP1expression in the VAT of overweight/obese patients is inconsensus with our results in obese mice. Obesity is characterizedby the increase of intracellular lipid accumulation which shows asignificant correlation with adipocyte differentiation. Terminallydifferentiated adipocytes cannot divide. Hence, alterations in thenumber of fat cells within the body must be accomplished by thedifferentiation of preadipocytes, which act as a renewable source ofadipocytes. Interestingly, our in vitro study in 3T3F442A cellsindicates that LRP1 expression is required for adipocytedifferentiation and since LRP1 is abundantly expressed inadipocytes, we propose that LRP1 may participate in the onsetFigure 8. LRP1 silencing in fully-differentiated adipocytes leadsto lipid-depleted cells. (A) Silencing of LRP1 in fully-differentiatedadipocyte. 3T3F442A pre-adipocytes were maintained for 10 daysin adipogenic differentiation medium (panel a) and were transfected withLuc siRNA or LRP1 siRNA1. LRP1b protein expression was monitored byimmunoblotting 2 days post-transfection (panel b). ERK2 was used as aloading control. (B) Staining of neutral lipids. Plates of differentiated3T3F442A transfected with Luc siRNA (panel a) or LRP1 siRNA1 (panel b)are shown. After siRNA transfection, 3T3F442A mature adipocytes weregrown in DMEM + 10% FCS. The extent of cellular lipid accumulation wasdetermined at day 2 and 7 of culture by oil Red O staining. Arepresentative experiment out of 3 is shown. (C) Micrographs of3T3F442A adipocytes. Micrographs of differentiated adipocytestransfected with Luc siRNA (panel a) or LRP1 siRNA1 (panel b) wereperformed 7 days post-transfection. A representative experiment out of 3is shown. (D) Quantification of lipid content. Lipid content wasquantified at days 2 and 7 post-tranfection of differentiated adipocytestransfected with Luc or LRP1 siRNA1. Mean 6 SD of 3 independentexperiments is shown. *P,0.005 when compared with Luc siRNAtransfected cells.doi:10.1371/journal.pone.0007422.g008of obesity. The crucial role of LRP1 in obesity is also supported bya recent study showing that adipocyte LRP12/2 mice have anoverall decrease in fat mass and are protected from high-fat dietinducedobesity [12]. Our experiments further show that silencingPLoS ONE | www.plosone.org 7 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, ObesitySome insight into LRP1 function in mature adipocyte wasobtained by generating mice with adipocyte-specific inactivation ofthe LRP1 gene [12]. Adipocyte LRP1 knockout mice displayeddelayed postprandial lipid clearance, smaller fat stores, and lipiddepletedadipocytes which resulted in reduced body weight due tooverall decrease in fat mass. This work highlights the importanceof adipocyte LRP1 in postprandial triglyceride metabolism, whereLRP1 in collaboration with LpL mediates both the endocytic andlipolytic processes responsible for triglyceride catabolism[23,28,29]. Our results are in accordance with this study andindicate that extinction of LRP1 expression in mature adipocytesleads to increased basal lipolysis. In addition, we show that thecapacity of mature adipocytes to induce lipolysis in response toisoproterenol is not modified by LRP1 silencing. This suggests thatLRP1 does not directly control lipolysis. We propose thatinhibition of LRP1 expression stimulates basal lipolysis in orderto compensate the lack of lipid intake in the absence of LRP1.Recently, it was shown that LRP1 is also required for lipolysis andthe control of intracellular cholesterol storage and fatty acidsynthesis via the Wnt5a signaling pathway in LRP12/2 MEF cells[30].In conclusion, our findings highlight that LRP1 plays a crucialrole in the control of adipogenesis and lipid homeostasis in matureadipocytes. Moreover, our results indicate that LRP1 is upregulatedin human obese tissues and mouse adipocytes.Therefore, we propose that LRP1 targeting in obesity may leadto a reduction of hypertrophic and hyperplasic adipocytes.Materials and MethodsFigure 9. Analysis of lipolysis in fully-differentiated adipocytessilenced for LRP1. Adipocytes differentiated for 10 days weretransfected with Luc siRNA or LRP1 siRNA1. Two days post-transfection,glycerol release over 18 h (panel a) and glycerol and NEFA release afterisoproterenol stimulation (panel b) were quantified. Results werenormalised per mg of DNA. Mean 6 SD of an experiment inquadruplicate is shown. P,0.025.doi:10.1371/journal.pone.0007422.g009of LRP1 in fully-differentiated adipocytes significantly reducescellular lipid content, suggesting that LRP1 may be an importanttherapeutic target in obesity. Most functional studies on adipocytedifferentiation and function have been performed in the murineadipogenic 3T3L1 cell line and in genetically modified mice.However, there are fundamental differences in the lipoproteinmetabolism of mouse and human [19]. Therefore, it is importantto investigate the LRP1 expression in human adipocytes aspresented in this report.Results from the literature have suggested that LRP1 is a likelycontributor to adipogenesis, adipocyte homeostasis and obesitygiven its high expression in adipocytes [4,10,11], that it bindsApoE [7,8], LpL [20,21] and hepatic lipase [9], and that itcollaborates with heparin sulfate proteoglycans to mediate theinternalization of ApoE and LpL [22,23]. The dietary lipids arecarried in chylomicron remnants (CR) which are taken up into theliver mainly via LRP1. LRP1 interacts with CR via ApoE [6,7] andLpL in vitro and in vivo [8,24]. Interestingly, ApoE has beenreported to be crucial for the accumulation of triglycerides inmouse adipocytes [25] and also appears to have an importantfunction in adipocyte differentiation [26] and obesity [27].Altogether, these observations strongly suggest that a deregulationof LRP1 expression may have important consequences inadipocytes and obesity.Ethics StatementAll subjects gave their informed written consent to participate tothe study, and investigations were performed in accordance withthe declaration of Helsinki as revised in 2000 (http://www.wma.net/e/policy/b3.htm).Cells and cell cultureCell lines were cultured in DMEM (Invitrogen) supplementedwith 10% fetal calf serum (FCS). Differentiation was induced byincubating 3T3F442A confluent cells in differentiation medium(DMEM supplemented with 10% FCS and 50 nM insulin) asdescribed previously for up to 7 days [31]. After 7 days ofdifferentiation, cells were maintained in DMEM with 10% FCS.Human samplesHuman adipose tissue was collected according to the guidelinesof the Ethical Committee of Toulouse-Rangueil and Nancy J.d’Arc Hospitals and received full ethical approval from the EthicalCommittee of Toulouse-Rangueil and Nancy J. d’Arc Hospitals.All subjects gave their informed written consent to participate tothe study. Human abdominal visceral (VAT) adipose tissuesamples were obtained from 10 patients healthy volunteers (42.7+/2 4.5 yr old, BMI: 23.1 +/2 3.3 kg/m 2 ) undergoingabdominal lipectomy for plastic surgery. No clinical data fromthese patients were available. Human abdominal visceral adiposetissue samples were obtained from 27 morbidly (grade III) obesesubjects (44.5+/21.8 yr old, BMI: 47.6 +/2 1.3 kg/m 2 ) before abariatric surgery. All subjects were drug-free and besides obesitythey did not suffer of any disease. Tissue samples wereimmediately frozen in liquid nitrogen and stored at 280uC. TotalRNAs of isolated adipocytes were extracted and LRP1 expressionanalysed by RT-PCR. For in vitro differentiation, humanpreadipocytes were isolated from human subcutaneous adiposetissue obtained from patients undergoing abdominal lipectomy atPLoS ONE | www.plosone.org 8 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, Obesitythe plastic surgery department of Rangueil Hospital (Toulouse,France) under the agreement of local ethic committee. All subjectsgave their informed written consent to participate to the study.Adipose tissue pieces were immediately used for collagenasedigestion as previously described [15]. The digestate wascentrifuged to separate adipocytes from the stroma-vascularfraction, containing preadipocytes (pellet). Cells isolated from theSVF fraction were induced to differentiate into adipocytes aspreviously described [31]. Briefly, confluent cells (day 0) wereinduced to differentiate in DMEM/Ham’s F12 (1:1) mediumcontaining 0.01 mg/ml transferrin, 100 nM cortisol, 0.2 nMtriiodothyronine, and 20 nM insulin. To trigger differentiation,25 nM dexamethasone, 500 mM IBMX and 2 mM rosiglitazonewere present from day 0 to day 4. Intracellular accumulation oflipid droplets became clearly evident at day 10 [15].MiceMice were handled in accordance with the principles andguidelines established by the National Institute of MedicalResearch (INSERM). C57Bl6/J female mice were obtained fromCharles River laboratory (l’Arbresle, France). Mice were housedconventionally in a constant temperature (20–22uC) and humidity(50–60%) animal room and with a 12 h light–dark cycle. All micehad free access to food and water throughout the experiment.C57Bl6/J mice were assigned to normal-fat diet (ND) or high-fatdiet (HFD) (SAFE, France). Energy contents of the specific dietswere (% kcals): 20% protein, 70% carbohydrate, and 10% fat forND; 20% protein, 35% carbohydrate, and 45% fat for HFD. Themain source of fat in HFD was lard (20 g/100 g of food). C57Bl6/J (10 week old) mice were fed a ND or HFD for 20 weeks. All micewere sacrificed at 30 weeks of age.Isolation of adipocytes from mouse adipose tissueMouse intra-abdominal adipose tissues were dissected immediatelyafter sacrifice, minced in 5 ml of Dulbecco’s modified Eagle’smedium (DMEM; Life Technologies, Inc., Invitrogen, Paisley,UK) supplemented with 1 mg/ml collagenase (SIGMA) and 1%BSA for 30 min at 37uC under shaking. Digestion was followed byfiltration through a 150 mm screen, and the floating adipocyteswere separated from the medium containing the stroma-vascularfraction (SVF). Adipocytes were washed twice in DMEM andfurther processed for RNA extraction using the RNeasy mini kit(Qiagen, Germany).ImmunoblotsCells were lysed in lysis buffer (50 mM HEPES pH 7.5,150 mM NaCl, 10% glycerol, 1% Triton X100, 1.5 mM MgCl 2 ,1 mM EGTA, 100 mM NaF, 10 mM NaPPI, 500 mm Na-Vanadate, 1 mM PMSF, 10 mM Aprotinine, and a proteaseinhibitor cocktail). After gentle shaking for 20 min at 4uC, cellextracts were obtained by centrifugation in a microfuge at13,000 rpm for 15 min at 4uC. Equal amounts of protein(100 mg) from cell extracts, quantitated by the Bradford assay,were separated on a 7% gel by SDS-PAGE. Proteins were electrotransferredto PVDF membrane and incubated with 1 mg/ml antiatubulin (NeoMarkers), 1 mg/ml anti-b2actin (Sigma), 1 mg/mlERK2 (D-2, Santa Cruz Biotechnology), 11H4 anti-LRP1bhybridoma (1/10 dilution, ATCC) or 0.4 mg/ml anti-HSL (SantaCruz). Proteins were then visualized with horseradish peroxidaseconjugatedsheep anti-mouse immunoglobulin (ECL Amersham)or horseradish peroxidase-conjugated donkey anti-rabbit immunoglobulin(ECL Amersham) followed by the Renaissancechemiluminescence system (Perkin Life Sciences).RNA extraction and analysisTotal RNA was extracted using the RNeasy minikit (QIAGENSciences, Maryland) according to the manufacturer’s instructions.Reverse transcription of total RNA was performed at 37uC usingMoloney murine leukemia virus reverse transcriptase enzyme(Invitrogen, Carlsbad, CA) and random hexanucleotide primers(Promega, Madison, WI). Quantitative PCR was carried out byreal-time PCR using a LightCycler and the DNA double-strandspecificSYBR green I dye for detection (Roche, Basel,Switzerland). Results were normalized to RS9 levels. Sequencesof primers are:mouse RS9 (sens 59CGGCCCGGGAGCTGTTGACG39,reverse 59CTGCTTGCGGACCCTAATGTGACG39),mouse aP2 (sens 59AACACCGAGATTTCCTTCAA39, reverse59AGTCACGCCTTTCATAACACA39),mouse LRP1 (sens 59GACCAGGTGTTGGACACAGATG39,reverse 59AGTCGTTGTCTCCGTCACACTTC39),mouse HSL (sens 59CTGAAGGCTCTGAGTTGGTCAA39,reverse 59GGCTTACTGGGCACAGATACCT39),mouse PPARc (sens 59 AGGCCGAGAAGGAGAAGCTG-TTG39, reverse 59TGGCCACCTCTTTGCTCTGCTC39),human LRP1 (sens 59TAGACCGGCCCCCTGTGCTGTTG-A39, reverse 59GGTCTGCCGCGTGCTCGTAGGTGT39).siRNAs and 3T3F442A transfectionSilencing of LRP1 gene expression in adipocytes was achieved bythe use of siRNAs. Duplexes of 21-nucleotide mouse LRP1 siRNA1(target sequence AAGCATCTCAGTAGACTATCA) [32], mouseLRP1 siRNA2 (target sequence AACTTCTTAAACTCATAGCTT)(Dharmacon), mouse LRP1 siRNA3 (target sequence AAG-CAGTTTGCCTGCAGAGAC) or firefly luciferase (Luc) siRNA(target sequence AACGTACGCGGAATACTTCGA) were synthesizedby MWG Biotech S.A. (France). 2 10 6 3T3F442A matureadipocytes were transiently transfected with 2 mg of siRNA usingNucleofector Technology (Amaxa biosystems) according to themanufacturer’s instructions using kit L (# VCA-1005) and werereplated in 2 wells of 6-well plates. After 48 h of transfection, cells haverecovered and were maintained in DEM 10% FCS for further analysis.Analysis of LDH release monitored at 48 h revealed no toxicity oftransfecting mature adipocytes with LRP1 or Luc siRNAs (CytoTox96Non-Radioactive Cytotoxicity Assay, Promega). For preadipocytes,10 6 cells were transfected and were treated with insulin 48 h posttransfection.Oil Red O staining3T3F442A adipocytes were washed with phosphate-bufferedsaline (pH 7.4) and then fixed with Antigenfix (Diapath, Italy).Cells were stained with Oil Red O dye (saturated Oil Red O dyein six parts of isopropanol and four parts of water), an indicator ofcell lipid content, and then exhaustively rinsed with water.Spectrophotometric quantification of lipids was performed bydissolving the stained oil droplets with isopropanol and measuringabsorbance at 540 nm as previously described [33].Quantification of triglyceridesCells scraped in PBS were centrifugated for 5 min at 1200 rpmat 4uC. Cell pellet was dissolved in 40 ml isopropanol andcentrifugated at 13 000 rpm for 5 min at 4uC. The supernatantwas used to determine the triglyceride content using theTriglyceride FS kit (Diasys Diagnostic Systems, Germany)according to the manufacturer’s instructions. The pellet was usedto quantify DNA concentration by a diaminobenzoic acifluorescence assay [34].PLoS ONE | www.plosone.org 9 October 2009 | Volume 4 | Issue 10 | e7422

LRP1, Adipogenesis, ObesityLipolysis AssayCells were incubated in DMEM without serum in the presenceof 2% fatty acid-free bovine serum albumin (A7030, Sigma)overnight. Fresh medium containing isoproterenol was added for90 min. Glycerol and NEFA contents in the medium weremeasured with free glycerol reagent (F6428 Sigma) and NEFA Ckit (Wako Chemicals, Germany).References1. Kahn SE, Hull RL, Utzschneider KM (2006) Mechanisms linking obesity toinsulin resistance and type 2 diabetes. Nature 444(7121): 840–846.2. He W, Barak Y, Hevener A, Olson P, Liao D, et al. (2003) Adipose-specificperoxisome proliferator-activated receptor gamma knockout causes insulinresistance in fat and liver but not in muscle. Proc Natl Acad Sci U S A 100(26):15712–15717.3. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM (1994) mPPARgamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8(10):1224–1234.4. Gauthier A, Vassiliou G, Benoist F, McPherson R (2003) Adipocyte low densitylipoprotein receptor-related protein gene expression and function is regulated byperoxisome proliferator-activated receptor gamma. J Biol Chem 278(14):11945–11953.5. Lillis AP, Van Duyn LB, Murphy-Ullrich JE, Strickland DK (2008) LDLreceptor-related protein 1: unique tissue-specific functions revealed by selectivegene knockout studies. Physiol Rev 88(3): 887–918.6. Beisiegel U, Weber W, Ihrke G, Herz J, Stanley KK (1989) The LDL-receptorrelatedprotein, LRP, is an apolipoprotein E-binding protein. Nature 341(6238):162–164.7. Kowal RC, Herz J, Goldstein JL, Esser V, Brown MS (1989) Low densitylipoprotein receptor-related protein mediates uptake of cholesteryl esters derivedfrom apoprotein E-enriched lipoproteins. Proc Natl Acad Sci U S A 86(15):5810–5814.8. Beisiegel U, Weber W, Bengtsson-Olivecrona G (1991) Lipoprotein lipaseenhances the binding of chylomicrons to low density lipoprotein receptor-relatedprotein. Proc Natl Acad Sci U S A 88(19): 8342–8346.9. Kounnas MZ, Chappell DA, Wong H, Argraves WS, Strickland DK (1995) Thecellular internalization and degradation of hepatic lipase is mediated by lowdensity lipoprotein receptor-related protein and requires cell surface proteoglycans.J Biol Chem 270(16): 9307–9312.10. Descamps O, Bilheimer D, Herz J (1993) Insulin stimulates receptor-mediateduptake of apoE-enriched lipoproteins and activated alpha 2-macroglobulin inadipocytes. J Biol Chem 268(2): 974–981.11. Vassiliou G, Benoist F, Lau P, Kavaslar GN, McPherson R (2001) The lowdensity lipoprotein receptor-related protein contributes to selective uptake ofhigh density lipoprotein cholesteryl esters by SW872 liposarcoma cells andprimary human adipocytes. J Biol Chem 276(52): 48823–48830.12. Hofmann SM, Zhou L, Perez-Tilve D, Greer T, Grant E, et al. (2007) AdipocyteLDL receptor-related protein-1 expression modulates postprandial lipidtransport and glucose homeostasis in mice. J Clin Invest 117(11): 3271–3282.13. Neese RA, Misell LM, Turner S, Chu A, Kim J, et al. (2002) Measurement invivo of proliferation rates of slow turnover cells by 2H2O labeling of thedeoxyribose moiety of DNA. Proc Natl Acad Sci U S A 99(24): 15345–15350.14. Spiegelman BM, Farmer SR (1982) Decreases in tubulin and actin geneexpression prior to morphological differentiation of 3T3 adipocytes. Cell 29(1):53–60.15. Bour S, Daviaud D, Gres S, Lefort C, Prevot D, et al. (2007) Adipogenesisrelatedincrease of semicarbazide-sensitive amine oxidase and monoamineoxidase in human adipocytes. Biochimie 89(8): 916–925.16. Zhang H, Links PH, Ngsee JK, Tran K, Cui Z, et al. (2004) Localization of lowdensity lipoprotein receptor-related protein 1 to caveolae in 3T3-L1 adipocytesin response to insulin treatment. J Biol Chem 279(3): 2221–2230.17. Willnow TE, Herz J (1994) Genetic deficiency in low density lipoproteinreceptor-related protein confers cellular resistance to Pseudomonas exotoxin A.Evidence that this protein is required for uptake and degradation of multipleligands. J Cell Sci 107 (Pt 3): 719–726.18. Zurhove K, Nakajima C, Herz J, Bock HH, May P (2008) Gamma-secretaselimits the inflammatory response through the processing of LRP1. Sci Signal1(47): ra15.Statistical analysisResults are expressed as means 6 SEM. Statistical differencesbetween two groups were evaluated using Student’s t tests. Thelevel of significance was set at P,0.05.Author ContributionsConceived and designed the experiments: OM ELC. Performed theexperiments: OM CD AM DD. Analyzed the data: OM CC CM PV ELC.Contributed reagents/materials/analysis tools: CC DQ CM PV. Wrote thepaper: OM ELC.19. Prawitt J, Niemeier A, Kassem M, Beisiegel U, Heeren J (2008) Characterizationof lipid metabolism in insulin-sensitive adipocytes differentiated from immortalizedhuman mesenchymal stem cells. Exp Cell Res 314(4): 814–824.20. Chappell DA, Fry GL, Waknitz MA, Iverius PH, Williams SE, et al. (1992) Thelow density lipoprotein receptor-related protein/alpha 2-macroglobulin receptorbinds and mediates catabolism of bovine milk lipoprotein lipase. J Biol Chem267(36): 25764–25767.21. Willnow TE, Goldstein JL, Orth K, Brown MS, Herz J (1992) Low densitylipoprotein receptor-related protein and gp330 bind similar ligands, includingplasminogen activator-inhibitor complexes and lactoferrin, an inhibitor ofchylomicron remnant clearance. J Biol Chem 267(36): 26172–26180.22. Ji ZS, Brecht WJ, Miranda RD, Hussain MM, Innerarity TL, et al. (1993) Roleof heparan sulfate proteoglycans in the binding and uptake of apolipoprotein E-enriched remnant lipoproteins by cultured cells. J Biol Chem 268(14):10160–10167.23. Chappell DA, Fry GL, Waknitz MA, Muhonen LE, Pladet MW, et al. (1993)Lipoprotein lipase induces catabolism of normal triglyceride-rich lipoproteins viathe low density lipoprotein receptor-related protein/alpha 2-macroglobulinreceptor in vitro. A process facilitated by cell-surface proteoglycans. J Biol Chem268(19): 14168–14175.24. Heeren J, Niemeier A, Merkel M, Beisiegel U (2002) Endothelial-derivedlipoprotein lipase is bound to postprandial triglyceride-rich lipoproteins andmediates their hepatic clearance in vivo. J Mol Med 80(9): 576–584.25. Huang ZH, Reardon CA, Mazzone T (2006) Endogenous ApoE expressionmodulates adipocyte triglyceride content and turnover. Diabetes 55(12):3394–3402.26. Yue L, Rasouli N, Ranganathan G, Kern PA, Mazzone T (2004) Divergenteffects of peroxisome proliferator-activated receptor gamma agonists and tumornecrosis factor alpha on adipocyte ApoE expression. J Biol Chem 279(46):47626–47632.27. Gao J, Katagiri H, Ishigaki Y, Yamada T, Ogihara T, et al. (2007) Involvementof apolipoprotein E in excess fat accumulation and insulin resistance. Diabetes56(1): 24–33.28. Chappell DA, Inoue I, Fry GL, Pladet MW, Bowen SL, et al. (1994) Cellularcatabolism of normal very low density lipoproteins via the low densitylipoprotein receptor-related protein/alpha 2-macroglobulin receptor is inducedby the C-terminal domain of lipoprotein lipase. J Biol Chem 269(27):18001–18006.29. Nykjaer A, Bengtsson-Olivecrona G, Lookene A, Moestrup SK, Petersen CM,et al. (1993) The alpha 2-macroglobulin receptor/low density lipoproteinreceptor-related protein binds lipoprotein lipase and beta-migrating very lowdensity lipoprotein associated with the lipase. J Biol Chem 268(20):15048–15055.30. Terrand J, Bruban V, Zhou L, Gong W, El Asmar Z, et al. (2009) LRP1Controls Intracellular Cholesterol Storage and Fatty Acid Synthesis throughModulation of Wnt Signaling. J Biol Chem 284(1): 381–388.31. Daviaud D, Boucher J, Gesta S, Dray C, Guigne C, et al. (2006) TNFalpha upregulatesapelin expression in human and mouse adipose tissue. Faseb J 20(9):1528–1530.32. Fears CY, Grammer JR, Stewart JE, Jr., Annis DS, Mosher DF, et al. (2005)Low-density lipoprotein receptor-related protein contributes to the antiangiogenicactivity of thrombospondin-2 in a murine glioma model. Cancer Res65(20): 9338–9346.33. Ramirez-Zacarias JL, Castro-Munozledo F, Kuri-Harcuch W (1992) Quantitationof adipose conversion and triglycerides by staining intracytoplasmic lipidswith Oil red O. Histochemistry 97(6): 493–497.34. Vignon F, Capony F, Chambon M, Freiss G, Garcia M, et al. (1986) Autocrinegrowth stimulation of the MCF 7 breast cancer cells by the estrogen-regulated 52K protein. Endocrinology 118: 1537–1545.PLoS ONE | www.plosone.org 10 October 2009 | Volume 4 | Issue 10 | e7422

D. CONCLUSION ETPERSPECTIVES67

CONCLUSIONLa cathepsine D (cath-D) est une aspartyl protéase lysosomale surexprimée ethypersécrétée par un grand nombre de carcinomes (sein, ovaire, foie, colon). Cest unmarqueur reconnu de mauvais pronostic dans le cancer du sein associé a un risque plus élevéde rechute (Ferrandina et al., 1997; Foekens et al., 1999; Liaudet-Coopman et al., 2006). Cetteprotéase stimule la prolifération des cellules cancéreuses (Fusek and Vetvicka, 1994; Glonduet al., 2001; Vignon et al., 1986) et la formation des métastases (Garcia et al., 1990; Glondu etal., 2002). Elle stimule aussi la croissance invasive des fibroblastes et l'angiogenèse tumorale,indiquant son rôle clef dans le micro-environnement tumoral (Berchem et al., 2002; Garcia etal., 1990; Glondu et al., 2002; Laurent-Matha et al., 2005). Les travaux récents du laboratoireont mis en évidence linteraction de la cath-D avec le domaine extracellulaire de la chaîne du récepteur LRP1 (LDL receptor-related protein1) et ont montré que cette liaison estresponsable de la stimulation de la croissance des fibroblastes (manuscrit soumis pourpublication). LRP1 est un récepteur dendocytose reconnu par une quarantaine de ligandsdifférents et impliqué dans divers processus physiologiques tels lélimination du cholestérolpar le foie, la transmission synaptique ou encore la protection contre lathérosclérose (Lillis etal., 2008). Des études récentes indiquent que le récepteur LRP1 joue aussi un rôle biologiqueimportant chez ladipocyte mature qui représente un des types cellulaire prédominant dumicro-environnement du cancer du sein (Hofmann et al., 2007; Terrand et al., 2009).Les études épidémiologiques récentes indiquent que lobésité est un facteur de risque decancer ainsi quun facteur de mauvais pronostic dans de nombreux cancers dont le cancer dusein chez la femme ménopausée (Pan and DesMeules, 2009; Renehan et al., 2008). Lesadipocytes sécrètent de nombreuses molécules appelées adipokines, ainsi que des constituantsde la matrice extra-cellulaire. Ils participent à la progression tumorale mammaire en sécrétantdifférentes adipokines telles la leptine, le TNFα, des métalloprotéases (MMP2, MMP9). Cesdernières années, plusieurs études décrivent également que certaines protéases, connues pourfavoriser la progression des cancers, affectent le comportement des adipocytes. Ainsi, lesmétalloprotéases MMP2 et MMP9 et les cystéines cathepsines K, S, L contrôlent le processusde différenciation adipocytaire (Bouloumie et al., 2001; Chavey et al., 2003; Croissandeau etal., 2002; Funicello et al., 2007; Pan and DesMeules, 2009; Renehan et al., 2008; Taleb et al.,2006; Xiao et al., 2006; Yang et al., 2007). A ce jour, la participation de la cath-D dans labiologie de ladipocyte na pas encore été étudiée.68

Principaux résultats de larticle 1La première partie de ce travail de thèse a mis en exergue limplication de la cath-Ddans la biologie de ladipocyte. Notre étude montre que lexpression de la cath-D estsignificativement augmentée au cours de ladipogenèse dans des modèles murin (lignée préadipocytairemurine 3T3-F442A) et humain (pré-adipocyte sous-cutané). De plus, nous avonsmis en évidence une sécrétion de pro-cath-D par les adipocytes murins matures, confirmantune étude protéomique indiquant que les adipocytes matures sécrètent la pro-cath-D enréponse à linsuline (Zhou et al., 2009a). Pour étudier le rôle de la cath-D dans ladipogenèse,nous avons généré des pré-adipocytes (3T3-F442A) déficients en cath-D en utilisant unestratégie shRNA anti-cath-D. Nos résultats indiquent que lextinction de lexpression de lacath-D inhibe significativement lexpression des marqueurs de la différenciation adipocytaire,PPAR (Peroxisome Proliferator-Activated Receptor gamma), HSL (Hormone SensitiveLipase) et aP2 (Adipocyte lipid binding Protein2). De plus, les préadipocytes déficients encath-D accumulent significativement moins de triglycérides indiquant que le processusdadipogenèse est inhibé en labsence de cath-D. Ces travaux sont les premiers à démontrer lerôle clef positif de la cath-D dans la différenciation du tissu adipeux et son implicationpossible dans lobésité.Principaux résultats de larticle 2Dans la deuxième partie de ce travail de thèse, nous avons étudié le rôle du LRP1,récepteur de la cath-D identifié récemment dans notre équipe, dans les pré-adipocytes et lesadipocytes. Des études sur des souris déficientes en LRP1 au niveau des adipocytes ontmontré que ce récepteur joue un rôle majeur dans lhoméostasie du tissu adipeux (Hofmann etal., 2007). En effet, ces souris présentent un poids corporel plus faible, des troubles delassimilation des lipides après la prise alimentaire ainsi quun tissu adipeux extrêmementréduit. De plus il a été décrit que ce récepteur interagit avec la protéine apoE présente auniveau des lipoprotéines et permet lassimilation des lipides après la prise alimentaire. Uneétude récente indique son implication dans le stockage du cholestérol, et également dans lasynthèse des acides gras via la modulation de la voie Wnt (Terrand et al., 2009). Nos travauxmontrent que les pré-adipocytes expriment des taux élevés de LRP1, comparativement auxcellules épithéliales mammaires. De plus lexpression de LRP1 demeure élevée au cours de ladifférenciation adipocytaire chez lhomme et la souris. De plus, nos résultats indiquent quelexpression du LRP1 est significativement augmentée dans le tissu adipeux chez lhomme et69

la souris obèses. Enfin, linhibition de lexpression du LRP1 par la technique de lARNinterférence, a mis en évidence le rôle majeur de ce récepteur dans ladipogenèse. En absencede LRP1, les cellules ne se différencient plus, naccumulent plus de triglycérides etnexpriment plus les marqueurs adipocytaires PPAR, aP2 et HSL. Nos études suggèrent quecette absence daccumulation de triglycérides nest pas due à une augmentation de la lipolysemais à linhibition de ladipogenèse. Pour compléter notre étude, nous avons inhibélexpression du LRP1 dans les adipocytes matures. En absence de LRP1, le contenu entriglycérides est significativement diminué et la lipolyse basale est augmentée. Sachant queLRP1 participe à lincorporation dacides gras précurseurs des triglycérides, il est possibleque lextinction de lexpression du LRP1 dans ladipocyte mature induise une stimulation dela lipolyse des triglycérides pour le maintien énergétique de ladipocyte. Ces derniers résultatsconfirment le rôle du LRP1 dans le maintien du contenu en triglycérides des adipocytes,comme suggéré par les études réalisées sur les souris avec invalidation de LRP1 dans lesadipocytes matures (Hofmann et al., 2007; Terrand et al., 2009).PERSPECTIVESLensemble de ces travaux apporte de nouvelles informations quant à limplication dela cath-D et de son récepteur LRP1 dans la différenciation adipocytaire et dans la biologie deladipocyte normal et obèse. Ces données suggèrent que ces deux protéines seraient des ciblespotentiellement intéressantes dans le traitement de lobésité. Cependant, des étudescomplémentaires devront être réalisées afin de mieux comprendre leur fonction dans labiologie de ladipocyte ainsi que dans le micro-environnement tumoral.I Rôle de la cath-D et du LRP1 dans la biologie de ladipocytePour compléter ce travail, il serait intéressant de déterminer si leffet de la cath-D surle processus adipogénique est contrôlé par son activité protéolytique. Les travaux impliquantdes protéases dans la différenciation des adipocytes indiquent une action extra-cellulaire via leremodelage et la dégradation de la matrice extra-cellulaire, mais également une action intracellulaire.Pour cela, des expériences de ré-expression de cath-D pourraient être réalisées dans les clonesshRNA cath-D que nous avons générés dans la lignée adipocytaire F442A. Nous avons ànotre disposition au laboratoire, des vecteurs codants pour la cath-D sauvage ou une forme70

mutée dépourvue dactivité catalytique. La ré-expression de ces deux formes de la protéasedans nos clones permettrait de déterminer si les cellules sont à nouveau capables de sedifférencier, et si lactivité de la cath-D est nécessaire à la différenciation des adipocytes.Lajout direct dans le milieu de culture de cath-D recombinante inactive (forme 52 kDa) ouactive (forme 51 kDa) pourrait apporter des informations supplémentaires sur leffet de lacath-D sécrétée dans la différenciation des adipocytes. Même si la cath-D nécessite unenvironnement acide pour cliver ses substrats, il est décrit que la cath-D sécrétée clive laprolactine à pH physiologique et ce clivage est dépendant des pompes à protons et deséchangeurs de cations présents sur la membrane plasmique (Piwnica et al., 2006). Dans cettemême étude, il a été rapporté que le proN peptide, qui correspond à la partie N-terminale dupropeptide de la cath-D, lie le site actif de la cath-D à pH neutre ou légèrement acide (Fuseket al., 1991; Lee et al., 1998; Piwnica et al., 2006; Wittlin et al., 1999). Il en résulte uneinhibition de lactivité catalytique de la cath-D. Lutilisation de pepstatine A et du proNpeptide dans le milieu de culture des pré-adipocytes permettrait de déterminer si lactivitécatalytique de la cath-D est nécessaire à ladipogenèse.Enfin, le développement de souris knock-out pour la cath-D dans les adipocytes permettraitdétudier le rôle de cette protéase dans le tissu adipeux in vivo. Une étude morphologique dutissu adipeux ainsi que des analyses portant sur lhoméostasie énergétique (assimilation deslipides, tolérance au glucose, ) de ces souris pourrait être réalisées.Concernant le LRP1, son mode daction est complexe et peut passer par :1- lendocytose de certaines molécules,2- lactivation des voies de signalisation par phosphorylation de résidus tyrosines présents sursa queue cytoplasmique,3- la protéolyse intra-membranaire régulée (RIP) qui génère un fragment intra-cellulaire quiira au noyau pour réguler la transcription génique.Il sera important de déterminer le mécanisme daction du LRP1 impliqué dans ladifférenciation des adipocytes en présence ou en absence de cath-D.II Rôle de la cath-D et du LRP1 adipocytaires dans le micro-environnement tumoralLes travaux accomplis durant cette thèse mettent en évidence le rôle de la cath-D et deson récepteur LRP1 dans les adipocytes et leur implication dans ladipogenèse. Toutefois, ilserait intéressant dapprofondir ces recherches en axant nos travaux futurs en cancérologie.Des études épidémiologiques indiquent que lobésité est un facteur de risque pour denombreux cancer. Cependant les mécanismes par lesquels lobésité participe au processus71

carcinogénique sont encore mal connus. Des études suggèrent la participation de certainesadipokines dans ce processus et les données de la littérature indiquent que la cath-D participeà la progression tumorale.Durant cette thèse, nous avons montré que lexpression de la cath-D est augmentée au coursde la différenciation des adipocytes et également que les adipocytes matures sécrètent la cath-D, suggérant que la cath-D est une nouvelle adipokine. De plus, les individus obèsesexpriment davantage de cath-D et lon sait aujourdhui que lobésité est un facteur de risquepour certains cancers. Il est possible que la cath-D sécrétée chez lindividu obèse participe à laprogression de tumeurs. En effet il est connu que la cath-D est mitogène sur les cellulescancéreuses (Vignon et al., 1986). La cath-D sécrétée par les adipocytes en surnombrepourrait favoriser les étapes précoces de prolifération de petites tumeurs initiées nécessitantdes facteurs de croissance pour leur survie.Tout dabord, lanalyse du niveau dexpression de la cath-D et du LRP1 dans des adipocytesmammaires purifiés à partir de patientes atteintes de cancer du sein ou de réductionmammoplastique, permettrait de déterminer si lexpression de ces deux protéines estperturbée dans les adipocytes au cours de la pathologie.Par la suite, une analyse immunohistochimique de lexpression adipocytaire de la cath-D et duLRP1 dans des biopsies de cancer du sein et de réduction mammoplastique apporteraitégalement des informations quant à la localisation de ces protéines en conditionphysiologique et pathologique.Par ailleurs, en plus dun rôle de charpente du tissu cancéreux, les cellules stromalesparticipent activement à la nutrition et à la progression tumorale. Les cellules cancéreuses etstromales interagissent et plusieurs protéases notamment sont impliquées dans cet échange.Dans ce sens, les travaux réalisés par léquipe du Dr Marie-Christine Rio, révèlent que lescellules cancéreuses induisent la sécrétion de stromélysine 3 par les adipocytes, et quenretour cette stromélysine 3 entraîne la dé-différenciation des adipocytes, générant unepopulation de fibroblastes péritumoraux particuliers (Andarawewa et al., 2005). Il serait doncintéressant de déterminer la régulation de lexpression de la cath-D et du LRP1 adipocytairespar les cellules épithéliales mammaires cancéreuses. Pour cela, il faudrait réaliser desexpériences de co-culture entre des adipocytes cultivés seuls ou co-cultivés avec des lignéescancéreuses mammaires ou normales immortalisées.Enfin, le croisement de souris déficientes en cath-D ou LRP1 dans les adipocytes avec dessouris transgéniques capables de développer « spontanément » des tumeurs de la glande72

mammaire, permettrait de déterminer in vivo, le rôle de ces deux protéines dans linitiation etla progression du cancer.73

Ce travail de thèse a étudié, pour la première fois, le rôle de la cathepsine D dansles adipocytes. Nous avons montré que lexpression de la cathepsine D est augmentée aucours de la différenciation adipocytaire dans des modèles humain et murin. De plus, nosrésultats indiquent que les adipocytes matures sécrètent la pro-cathepsine D. De façonintéressante, nos travaux révèlent que lexpression de la cathepsine D et du récepteurLRP1 sont nécessaires pour la différenciation adipocytaire. Par ailleurs, nos travauxindiquent que le LRP1 participe également au maintien du contenu en triglycérides desadipocytes différenciés. Enfin, nous avons montré que les taux dexpression de lacathepsine D et de son récepteur LRP1 sont augmentés chez lhomme et la souris obèse.Lensemble de ces résultats suggère que la cathepsine D et le LRP1 seraient des ciblesthérapeutiques potentielles dans le traitement de lobésité.74

E. REFERENCES75

REFERENCESAhima, R. S. (2006). Adipose tissue as an endocrine organ. Obesity (Silver Spring) 14 Suppl5, 242S-249S.Ailhaud, G. (2006). Adipose tissue as a secretory organ: from adipogenesis to the metabolicsyndrome. C R Biol 329, 570-577; discussion 653-575.Amemori, S., Ootani, A., Aoki, S., Fujise, T., Shimoda, R., Kakimoto, T., Shiraishi, R.,Sakata, Y., Tsunada, S., Iwakiri, R., and Fujimoto, K. (2007). Adipocytes and preadipocytespromote the proliferation of colon cancer cells in vitro. Am J Physiol Gastrointest LiverPhysiol 292, G923-929.Andarawewa, K. L., Motrescu, E. R., Chenard, M. P., Gansmuller, A., Stoll, I., Tomasetto, C.,and Rio, M. C. (2005). Stromelysin-3 is a potent negative regulator of adipogenesisparticipating to cancer cell-adipocyte interaction/crosstalk at the tumor invasive front. CancerRes 65, 10862-10871.Angel, A., and Bray, G. A. (1979). Synthesis of fatty acids and cholesterol by liver, adiposetissue and intestinal mucosa from obese and control patients. Eur J Clin Invest 9, 355-362.Antoniades, C., Antonopoulos, A. S., Tousoulis, D., and Stefanadis, C. (2009). Adiponectin:from obesity to cardiovascular disease. Obes Rev 10, 269-279.Arner, P. (2005). Human fat cell lipolysis: biochemistry, regulation and clinical role. BestPract Res Clin Endocrinol Metab 19, 471-482.Ashcom, J. D., Tiller, S. E., Dickerson, K., Cravens, J. L., Argraves, W. S., and Strickland, D.K. (1990). The human alpha 2-macroglobulin receptor: identification of a 420-kD cell surfaceglycoprotein specific for the activated conformation of alpha 2-macroglobulin. J Cell Biol110, 1041-1048.Asseryanis, E., Ruecklinger, E., Hellan, M., Kubista, E., and Singer, C. F. (2004). Breastcancer size in postmenopausal women is correlated with body mass index and androgenserum levels. Gynecol Endocrinol 18, 29-36.Augereau, P., Garcia, M., Mattei, M. G., Cavailles, V., Depadova, F., Derocq, D., Capony, F.,Ferrara, P., and Rochefort, H. (1988). Cloning and sequencing of the 52K cathepsin Dcomplementary deoxyribonucleic acid of MCF7 breast cancer cells and mapping onchromosome 11. Mol Endocrinol 2, 186-192.Augereau, P., Miralles, F., Cavailles, V., Gaudelet, C., Parker, M., and Rochefort, H. (1994).Characterization of the proximal estrogen-responsive element of human cathepsin D gene.Mol Endocrinol 8, 693-703.76

Authier, F., Metioui, M., Fabrega, S., Kouach, M., and Briand, G. (2002). Endosomalproteolysis of internalized insulin at the C-terminal region of the B chain by cathepsin D. JBiol Chem 277, 9437-9446.Authier, F., Mort, J. S., Bell, A. W., Posner, B. I., and Bergeron, J. J. (1995). Proteolysis ofglucagon within hepatic endosomes by membrane-associated cathepsins B and D. J BiolChem 270, 15798-15807.Avram, M. M., Avram, A. S., and James, W. D. (2007). Subcutaneous fat in normal anddiseased states 3. Adipogenesis: from stem cell to fat cell. J Am Acad Dermatol 56, 472-492.Awano, T., Katz, M. L., O'Brien, D. P., Taylor, J. F., Evans, J., Khan, S., Sohar, I., Lobel, P.,and Johnson, G. S. (2006). A mutation in the cathepsin D gene (CTSD) in American Bulldogswith neuronal ceroid lipofuscinosis. Mol Genet Metab 87, 341-348.Baechle, D., Flad, T., Cansier, A., Steffen, H., Schittek, B., Tolson, J., Herrmann, T., Dihazi,H., Beck, A., Mueller, G. A., et al. (2006). Cathepsin D is present in human eccrine sweat andinvolved in the postsecretory processing of the antimicrobial peptide DCD-1L. J Biol Chem281, 5406-5415.Baldwin, A. S. (2001). Control of oncogenesis and cancer therapy resistance by thetranscription factor NF-kappaB. J Clin Invest 107, 241-246.Baldwin, E. T., Bhat, T. N., Gulnik, S., Hosur, M. V., Sowder, R. C., 2nd, Cachau, R. E.,Collins, J., Silva, A. M., and Erickson, J. W. (1993). Crystal structures of native and inhibitedforms of human cathepsin D: implications for lysosomal targeting and drug design. Proc NatlAcad Sci U S A 90, 6796-6800.Baranski, T. J., Cantor, A. B., and Kornfeld, S. (1992). Lysosomal enzyme phosphorylation. I.Protein recognition determinants in both lobes of procathepsin D mediate its interaction withUDP-GlcNAc:lysosomal enzyme N-acetylglucosamine-1-phosphotransferase. J Biol Chem267, 23342-23348.Barbaras, R., Grimaldi, P., Negrel, R., and Ailhaud, G. (1985). Binding of lipoproteins andregulation of cholesterol synthesis in cultured mouse adipose cells. Biochim Biophys Acta845, 492-501.Barnes, H., Larsen, B., Tyers, M., and van Der Geer, P. (2001). Tyrosine-phosphorylated lowdensity lipoprotein receptor-related protein 1 (Lrp1) associates with the adaptor protein SHCin SRC-transformed cells. J Biol Chem 276, 19119-19125.Barrera, C., Ye, G., Espejo, R., Gunasena, S., Almanza, R., Leary, J., Crowe, S., Ernst, P., andReyes, V. E. (2001). Expression of cathepsins B, L, S, and D by gastric epithelial cells77

implicates them as antigen presenting cells in local immune responses. Hum Immunol 62,1081-1091.Barrett, A. J. (1970). Cathepsin D. Purification of isoenzymes from human and chicken liver.Biochem J 117, 601-607.Beaujouin, M., Baghdiguian, S., Glondu-Lassis, M., Berchem, G., and Liaudet-Coopman, E.(2006). Overexpression of both catalytically active and -inactive cathepsin D by cancer cellsenhances apoptosis-dependent chemo-sensitivity. Oncogene 25, 1967-1973.Beisiegel, U., Krapp, A., Weber, W., Olivecrona, G., and Gliemann, J. (1996). The role oflipases and LRP in the catabolism of triglyceride-rich lipoproteins. Z Gastroenterol 34 Suppl3, 108-109.Benes, P., Jurajda, M., Zaloudik, J., Izakovicova-Holla, L., and Vacha, J. (2003). C766T lowdensitylipoprotein receptor-related protein 1 (LRP1) gene polymorphism and susceptibility tobreast cancer. Breast Cancer Res 5, R77-81.Benes, P., Vetvicka, V., and Fusek, M. (2008). Cathepsin D--many functions of one asparticprotease. Crit Rev Oncol Hematol 68, 12-28.Berchem, G., Glondu, M., Gleizes, M., Brouillet, J. P., Vignon, F., Garcia, M., and Liaudet-Coopman, E. (2002). Cathepsin-D affects multiple tumor progression steps in vivo:proliferation, angiogenesis and apoptosis. Oncogene 21, 5951-5955.Bissell, M. J., and Labarge, M. A. (2005). Context, tissue plasticity, and cancer: are tumorstem cells also regulated by the microenvironment? Cancer Cell 7, 17-23.Bjorntorp, P., and Ostman, J. (1971). Human adipose tissue dynamics and regulation. AdvMetab Disord 5, 277-327.Bluher, M. (2009). The distinction of metabolically 'healthy' from 'unhealthy' obeseindividuals. Curr Opin Lipidol.Boucher, P., and Gotthardt, M. (2004). LRP and PDGF signaling: a pathway toatherosclerosis. Trends Cardiovasc Med 14, 55-60.Boucher, P., Gotthardt, M., Li, W. P., Anderson, R. G., and Herz, J. (2003). LRP: role invascular wall integrity and protection from atherosclerosis. Science 300, 329-332.Boucher, P., Liu, P., Gotthardt, M., Hiesberger, T., Anderson, R. G., and Herz, J. (2002).Platelet-derived growth factor mediates tyrosine phosphorylation of the cytoplasmic domainof the low Density lipoprotein receptor-related protein in caveolae. J Biol Chem 277, 15507-15513.78

Bouloumie, A., Sengenes, C., Portolan, G., Galitzky, J., and Lafontan, M. (2001). Adipocyteproduces matrix metalloproteinases 2 and 9: involvement in adipose differentiation. Diabetes50, 2080-2086.Bourlier, V., Zakaroff-Girard, A., De Barros, S., Pizzacalla, C., de Saint Front, V. D.,Lafontan, M., Bouloumie, A., and Galitzky, J. (2005). Protease inhibitor treatments revealspecific involvement of matrix metalloproteinase-9 in human adipocyte differentiation. JPharmacol Exp Ther 312, 1272-1279.Braulke, T., Claussen, M., Saftig, P., Wendland, M., Neifer, K., Schmidt, B., Zapf, J., vonFigura, K., and Peters, C. (1995). Proteolysis of IGFBPs by cathepsin D in vitro and incathepsin D-deficient mice. Prog Growth Factor Res 6, 265-271.Briozzo, P., Badet, J., Capony, F., Pieri, I., Montcourrier, P., Barritault, D., and Rochefort, H.(1991). MCF7 mammary cancer cells respond to bFGF and internalize it following its releasefrom extracellular matrix: a permissive role of cathepsin D. Exp Cell Res 194, 252-259.Bryant, N. J., Govers, R., and James, D. E. (2002). Regulated transport of the glucosetransporter GLUT4. Nat Rev Mol Cell Biol 3, 267-277.Butler, G. S., Dean, R. A., Smith, D., and Overall, C. M. (2009). Membrane proteasedegradomics: proteomic identification and quantification of cell surface protease substrates.Methods Mol Biol 528, 159-176.Campfield, L. A., Smith, F. J., Guisez, Y., Devos, R., and Burn, P. (1995). Recombinantmouse OB protein: evidence for a peripheral signal linking adiposity and central neuralnetworks. Science 269, 546-549.Cantor, A. B., Baranski, T. J., and Kornfeld, S. (1992). Lysosomal enzyme phosphorylation.II. Protein recognition determinants in either lobe of procathepsin D are sufficient forphosphorylation of both the amino and carboxyl lobe oligosaccharides. J Biol Chem 267,23349-23356.Capony, F., Morisset, M., Barrett, A. J., Capony, J. P., Broquet, P., Vignon, F., Chambon, M.,Louisot, P., and Rochefort, H. (1987). Phosphorylation, glycosylation, and proteolytic activityof the 52-kD estrogen-induced protein secreted by MCF7 cells. J Cell Biol 104, 253-262.Capony, F., Rougeot, C., Montcourrier, P., Cavailles, V., Salazar, G., and Rochefort, H.(1989). Increased secretion, altered processing, and glycosylation of pro-cathepsin D inhuman mammary cancer cells. Cancer Res 49, 3904-3909.Castino, R., Delpal, S., Bouguyon, E., Demoz, M., Isidoro, C., and Ollivier-Bousquet, M.(2008). Prolactin promotes the secretion of active cathepsin D at the basal side of ratmammary acini. Endocrinology 149, 4095-4105.79

Cataldo, A. M., Barnett, J. L., Berman, S. A., Li, J., Quarless, S., Bursztajn, S., Lippa, C., andNixon, R. A. (1995). Gene expression and cellular content of cathepsin D in Alzheimer'sdisease brain: evidence for early up-regulation of the endosomal-lysosomal system. Neuron14, 671-680.Cavailles, V., Augereau, P., Garcia, M., and Rochefort, H. (1988). Estrogens and growthfactors induce the mRNA of the 52K-pro-cathepsin-D secreted by breast cancer cells. NucleicAcids Res 16, 1903-1919.Cavailles, V., Augereau, P., and Rochefort, H. (1991). Cathepsin D gene of human MCF7cells contains estrogen-responsive sequences in its 5' proximal flanking region. BiochemBiophys Res Commun 174, 816-824.Cavailles, V., Augereau, P., and Rochefort, H. (1993). Cathepsin D gene is controlled by amixed promoter, and estrogens stimulate only TATA-dependent transcription in breast cancercells. Proc Natl Acad Sci U S A 90, 203-207.Chandra, V., Huang, P., Hamuro, Y., Raghuram, S., Wang, Y., Burris, T. P., and Rastinejad,F. (2008). Structure of the intact PPAR-gamma-RXR- nuclear receptor complex on DNA.Nature 456, 350-356.Chavey, C., Mari, B., Monthouel, M. N., Bonnafous, S., Anglard, P., Van Obberghen, E., andTartare-Deckert, S. (2003). Matrix metalloproteinases are differentially expressed in adiposetissue during obesity and modulate adipocyte differentiation. J Biol Chem 278, 11888-11896.Cleary, M. P., and Grossmann, M. E. (2009). Minireview: Obesity and breast cancer: theestrogen connection. Endocrinology 150, 2537-2542.Croissandeau, G., Chretien, M., and Mbikay, M. (2002). Involvement of matrixmetalloproteinases in the adipose conversion of 3T3-L1 preadipocytes. Biochem J 364, 739-746.Cullen, V., Lindfors, M., Ng, J., Paetau, A., Swinton, E., Kolodziej, P., Boston, H., Saftig, P.,Woulfe, J., Feany, M. B., et al. (2009). Cathepsin D expression level affects alpha-synucleinprocessing, aggregation, and toxicity in vivo. Mol Brain 2, 5.De Wever, O., Nguyen, Q. D., Van Hoorde, L., Bracke, M., Bruyneel, E., Gespach, C., andMareel, M. (2004). Tenascin-C and SF/HGF produced by myofibroblasts in vitro provideconvergent pro-invasive signals to human colon cancer cells through RhoA and Rac. Faseb J18, 1016-1018.Dedieu, S., Langlois, B., Devy, J., Sid, B., Henriet, P., Sartelet, H., Bellon, G., Emonard, H.,and Martiny, L. (2008). LRP-1 silencing prevents malignant cell invasion despite increasedpericellular proteolytic activities. Mol Cell Biol 28, 2980-2995.80

Deiss, L. P., Galinka, H., Berissi, H., Cohen, O., and Kimchi, A. (1996). Cathepsin D proteasemediates programmed cell death induced by interferon-gamma, Fas/APO-1 and TNF-alpha.Embo J 15, 3861-3870.Dieudonne, M. N., Bussiere, M., Dos Santos, E., Leneveu, M. C., Giudicelli, Y., andPecquery, R. (2006). Adiponectin mediates antiproliferative and apoptotic responses in humanMCF7 breast cancer cells. Biochem Biophys Res Commun 345, 271-279.Diment, S., Leech, M. S., and Stahl, P. D. (1988). Cathepsin D is membrane-associated inmacrophage endosomes. J Biol Chem 263, 6901-6907.Diment, S., Martin, K. J., and Stahl, P. D. (1989). Cleavage of parathyroid hormone inmacrophage endosomes illustrates a novel pathway for intracellular processing of proteins. JBiol Chem 264, 13403-13406.Elenbaas, B., and Weinberg, R. A. (2001). Heterotypic signaling between epithelial tumorcells and fibroblasts in carcinoma formation. Exp Cell Res 264, 169-184.Emert-Sedlak, L., Shangary, S., Rabinovitz, A., Miranda, M. B., Delach, S. M., and Johnson,D. E. (2005). Involvement of cathepsin D in chemotherapy-induced cytochrome c release,caspase activation, and cell death. Mol Cancer Ther 4, 733-742.Erickson, A. H. (1989). Biosynthesis of lysosomal endopeptidases. J Cell Biochem 40, 31-41.Farmer, S. R. (2006). Transcriptional control of adipocyte formation. Cell Metab 4, 263-273.Faust, P. L., Kornfeld, S., and Chirgwin, J. M. (1985). Cloning and sequence analysis ofcDNA for human cathepsin D. Proc Natl Acad Sci U S A 82, 4910-4914.Ferrandina, G., Scambia, G., Bardelli, F., Benedetti Panici, P., Mancuso, S., and Messori, A.(1997). Relationship between cathepsin-D content and disease-free survival in node-negativebreast cancer patients: a meta-analysis. Br J Cancer 76, 661-666.Feve, B. (2005). Adipogenesis: cellular and molecular aspects. Best Pract Res ClinEndocrinol Metab 19, 483-499.Fitzgibbons, P. L., Page, D. L., Weaver, D., Thor, A. D., Allred, D. C., Clark, G. M., Ruby, S.G., O'Malley, F., Simpson, J. F., Connolly, J. L., et al. (2000). Prognostic factors in breastcancer. College of American Pathologists Consensus Statement 1999. Arch Pathol Lab Med124, 966-978.Flier, J. S. (2004). Obesity wars: molecular progress confronts an expanding epidemic. Cell116, 337-350.Foekens, J. A., Look, M. P., Bolt-de Vries, J., Meijer-van Gelder, M. E., van Putten, W. L.,and Klijn, J. G. (1999). Cathepsin-D in primary breast cancer: prognostic evaluation involving2810 patients. Br J Cancer 79, 300-307.81

Folkman, J. (2003). Fundamental concepts of the angiogenic process. Curr Mol Med 3, 643-651.Folkman, J., and Kalluri, R. (2004). Cancer without disease. Nature 427, 787.Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M.(1995). 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determinationfactor PPAR gamma. Cell 83, 803-812.Frayn, K. N., Karpe, F., Fielding, B. A., Macdonald, I. A., and Coppack, S. W. (2003).Integrative physiology of human adipose tissue. Int J Obes Relat Metab Disord 27, 875-888.Fukao, T., Lopaschuk, G. D., and Mitchell, G. A. (2004). Pathways and control of ketonebody metabolism: on the fringe of lipid biochemistry. Prostaglandins Leukot Essent FattyAcids 70, 243-251.Funicello, M., Novelli, M., Ragni, M., Vottari, T., Cocuzza, C., Soriano-Lopez, J., Chiellini,C., Boschi, F., Marzola, P., Masiello, P., et al. (2007). Cathepsin K null mice show reducedadiposity during the rapid accumulation of fat stores. PLoS One 2, e683.Fusek, M., Mares, M., Vagner, J., Voburka, Z., and Baudys, M. (1991). Inhibition of asparticproteinases by propart peptides of human procathepsin D and chicken pepsinogen. FEBS Lett287, 160-162.Fusek, M., and Vetvicka, V. (1994). Mitogenic function of human procathepsin D: the role ofthe propeptide. Biochem J 303 ( Pt 3), 775-780.Fusek, M., and Vetvicka, V. (2005). Dual role of cathepsin D: ligand and protease. BiomedPap Med Fac Univ Palacky Olomouc Czech Repub 149, 43-50.Garcia, M., Derocq, D., Pujol, P., and Rochefort, H. (1990). Overexpression of transfectedcathepsin D in transformed cells increases their malignant phenotype and metastatic potency.Oncogene 5, 1809-1814.Garg, A., and Aggarwal, B. B. (2002). Nuclear transcription factor-kappaB as a target forcancer drug development. Leukemia 16, 1053-1068.Glondu, M., Coopman, P., Laurent-Matha, V., Garcia, M., Rochefort, H., and Liaudet-Coopman, E. (2001). A mutated cathepsin-D devoid of its catalytic activity stimulates thegrowth of cancer cells. Oncogene 20, 6920-6929.Glondu, M., Liaudet-Coopman, E., Derocq, D., Platet, N., Rochefort, H., and Garcia, M.(2002). Down-regulation of cathepsin-D expression by antisense gene transfer inhibits tumorgrowth and experimental lung metastasis of human breast cancer cells. Oncogene 21, 5127-5134.82

Gonzalez-Vela, M. C., Garijo, M. F., Fernandez, F., Buelta, L., and Val-Bernal, J. F. (1999).Cathepsin D in host stromal cells is associated with more highly vascular and aggressiveinvasive breast carcinoma. Histopathology 34, 35-42.Gopalakrishnan, M. M., Grosch, H. W., Locatelli-Hoops, S., Werth, N., Smolenova, E.,Nettersheim, M., Sandhoff, K., and Hasilik, A. (2004). Purified recombinant humanprosaposin forms oligomers that bind procathepsin D and affect its autoactivation. Biochem J383, 507-515.Goudriaan, J. R., Tacken, P. J., Dahlmans, V. E., Gijbels, M. J., van Dijk, K. W., Havekes, L.M., and Jong, M. C. (2001). Protection from obesity in mice lacking the VLDL receptor.Arterioscler Thromb Vasc Biol 21, 1488-1493.Gregoire, F. M., Smas, C. M., and Sul, H. S. (1998). Understanding adipocyte differentiation.Physiol Rev 78, 783-809.Griffiths, J. R. (1991). Are cancer cells acidic? Br J Cancer 64, 425-427.Haidar, B., Kiss, R. S., Sarov-Blat, L., Brunet, R., Harder, C., McPherson, R., and Marcel, Y.L. (2006). Cathepsin D, a lysosomal protease, regulates ABCA1-mediated lipid efflux. J BiolChem 281, 39971-39981.Han, J., Luo, T., Gu, Y., Li, G., Jia, W., and Luo, M. (2009a). Cathepsin K regulatesadipocyte differentiation: possible involvement of type I collagen degradation. Endocr J 56,55-63.Han, S. H., Sakuma, I., Shin, E. K., and Koh, K. K. (2009b). Antiatherosclerotic and antiinsulinresistance effects of adiponectin: basic and clinical studies. Prog Cardiovasc Dis 52,126-140.Haque, A., Banik, N. L., and Ray, S. K. (2008). New insights into the roles of endolysosomalcathepsins in the pathogenesis of Alzheimer's disease: cathepsin inhibitors as potentialtherapeutics. CNS Neurol Disord Drug Targets 7, 270-277.Herz, J., Clouthier, D. E., and Hammer, R. E. (1992). LDL receptor-related proteininternalizes and degrades uPA-PAI-1 complexes and is essential for embryo implantation.Cell 71, 411-421.Heylen, N., Vincent, L. M., Devos, V., Dubois, V., Remacle, C., and Trouet, A. (2002).Fibroblasts capture cathepsin D secreted by breast cancer cells: possible role in the regulationof the invasive process. Int J Oncol 20, 761-767.Hilfiker-Kleiner, D., Kaminski, K., Podewski, E., Bonda, T., Schaefer, A., Sliwa, K., Forster,O., Quint, A., Landmesser, U., Doerries, C., et al. (2007). A cathepsin D-cleaved 16 kDa formof prolactin mediates postpartum cardiomyopathy. Cell 128, 589-600.83

Hofmann, S. M., Zhou, L., Perez-Tilve, D., Greer, T., Grant, E., Wancata, L., Thomas, A.,Pfluger, P. T., Basford, J. E., Gilham, D., et al. (2007). Adipocyte LDL receptor-relatedprotein-1 expression modulates postprandial lipid transport and glucose homeostasis in mice.J Clin Invest 117, 3271-3282.Housa, D., Housova, J., Vernerova, Z., and Haluzik, M. (2006). Adipocytokines and cancer.Physiol Res 55, 233-244.Hu, E., Tontonoz, P., and Spiegelman, B. M. (1995). Transdifferentiation of myoblasts by theadipogenic transcription factors PPAR gamma and C/EBP alpha. Proc Natl Acad Sci U S A92, 9856-9860.Hu, K., Yang, J., Tanaka, S., Gonias, S. L., Mars, W. M., and Liu, Y. (2006). Tissue-typeplasminogen activator acts as a cytokine that triggers intracellular signal transduction andinduces matrix metalloproteinase-9 gene expression. J Biol Chem 281, 2120-2127.Hu, L., Roth, J. M., Brooks, P., Luty, J., and Karpatkin, S. (2008). Thrombin up-regulatescathepsin D which enhances angiogenesis, growth, and metastasis. Cancer Res 68, 4666-4673.Huang, L., and Li, C. (2000). Leptin: a multifunctional hormone. Cell Res 10, 81-92.Imai, T., Takakuwa, R., Marchand, S., Dentz, E., Bornert, J. M., Messaddeq, N., Wendling,O., Mark, M., Desvergne, B., Wahli, W., et al. (2004). Peroxisome proliferator-activatedreceptor gamma is required in mature white and brown adipocytes for their survival in themouse. Proc Natl Acad Sci U S A 101, 4543-4547.Iyengar, P., Combs, T. P., Shah, S. J., Gouon-Evans, V., Pollard, J. W., Albanese, C.,Flanagan, L., Tenniswood, M. P., Guha, C., Lisanti, M. P., et al. (2003). Adipocyte-secretedfactors synergistically promote mammary tumorigenesis through induction of anti-apoptotictranscriptional programs and proto-oncogene stabilization. Oncogene 22, 6408-6423.Iyengar, P., Espina, V., Williams, T. W., Lin, Y., Berry, D., Jelicks, L. A., Lee, H., Temple,K., Graves, R., Pollard, J., et al. (2005). Adipocyte-derived collagen VI affects earlymammary tumor progression in vivo, demonstrating a critical interaction in the tumor/stromamicroenvironment. J Clin Invest 115, 1163-1176.Jones, J. R., Barrick, C., Kim, K. A., Lindner, J., Blondeau, B., Fujimoto, Y., Shiota, M.,Kesterson, R. A., Kahn, B. B., and Magnuson, M. A. (2005). Deletion of PPARgamma inadipose tissues of mice protects against high fat diet-induced obesity and insulin resistance.Proc Natl Acad Sci U S A 102, 6207-6212.Kaaks, R., Rinaldi, S., Key, T. J., Berrino, F., Peeters, P. H., Biessy, C., Dossus, L.,Lukanova, A., Bingham, S., Khaw, K. T., et al. (2005). Postmenopausal serum androgens,84

oestrogens and breast cancer risk: the European prospective investigation into cancer andnutrition. Endocr Relat Cancer 12, 1071-1082.Kendall, A., Folkerd, E. J., and Dowsett, M. (2007). Influences on circulating oestrogens inpostmenopausal women: relationship with breast cancer. J Steroid Biochem Mol Biol 103, 99-109.Kenessey, A., Nacharaju, P., Ko, L. W., and Yen, S. H. (1997). Degradation of tau bylysosomal enzyme cathepsin D: implication for Alzheimer neurofibrillary degeneration. JNeurochem 69, 2026-2038.Khalkhali-Ellis, Z., and Hendrix, M. J. (2007). Elucidating the function of secreted maspin:inhibiting cathepsin D-mediated matrix degradation. Cancer Res 67, 3535-3539.Kim, K. Y., Baek, A., Park, Y. S., Park, M. Y., Kim, J. H., Lim, J. S., Lee, M. S., Yoon, S. R.,Lee, H. G., Yoon, Y., et al. (2009). Adipocyte culture medium stimulates invasiveness ofMDA-MB-231 cell via CCL20 production. Oncol Rep 22, 1497-1504.Kim, S. H., Kang, E. S., Hur, K. Y., Lee, H. J., Han, S. J., Kwak, J. Y., Nam, C. M., Ahn, C.W., Cha, B. S., and Lee, H. C. (2008). Adiponectin gene polymorphism 45T>G is associatedwith carotid artery plaques in patients with type 2 diabetes mellitus. Metabolism 57, 274-279.Kinoshita, A., Shah, T., Tangredi, M. M., Strickland, D. K., and Hyman, B. T. (2003). Theintracellular domain of the low density lipoprotein receptor-related protein modulatestransactivation mediated by amyloid precursor protein and Fe65. J Biol Chem 278, 41182-41188.Kliewer, S. A., Lenhard, J. M., Willson, T. M., Patel, I., Morris, D. C., and Lehmann, J. M.(1995). A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptorgamma and promotes adipocyte differentiation. Cell 83, 813-819.Koike, M., Shibata, M., Ohsawa, Y., Nakanishi, H., Koga, T., Kametaka, S., Waguri, S.,Momoi, T., Kominami, E., Peters, C., et al. (2003). Involvement of two different cell deathpathways in retinal atrophy of cathepsin D-deficient mice. Mol Cell Neurosci 22, 146-161.Kornfeld, S. (1990). Lysosomal enzyme targeting. Biochem Soc Trans 18, 367-374.Kubo, Y., Kaidzu, S., Nakajima, I., Takenouchi, K., and Nakamura, F. (2000). Organizationof extracellular matrix components during differentiation of adipocytes in long-term culture.In Vitro Cell Dev Biol Anim 36, 38-44.Kuronen, M., Talvitie, M., Lehesjoki, A. E., and Myllykangas, L. (2009). Genetic modifiersof degeneration in the cathepsin D deficient Drosophila model for neuronal ceroidlipofuscinosis. Neurobiol Dis 36, 488-493.85

Langin, D. (2006a). Adipose tissue lipolysis as a metabolic pathway to definepharmacological strategies against obesity and the metabolic syndrome. Pharmacol Res 53,482-491.Langin, D. (2006b). Control of fatty acid and glycerol release in adipose tissue lipolysis. C RBiol 329, 598-607; discussion 653-595.Large, V., and Arner, P. (1998). Regulation of lipolysis in humans. Pathophysiologicalmodulation in obesity, diabetes, and hyperlipidaemia. Diabetes Metab 24, 409-418.Large, V., Peroni, O., Letexier, D., Ray, H., and Beylot, M. (2004). Metabolism of lipids inhuman white adipocyte. Diabetes Metab 30, 294-309.Laurent-Matha, V., Derocq, D., Prebois, C., Katunuma, N., and Liaudet-Coopman, E. (2006).Processing of human cathepsin D is independent of its catalytic function and auto-activation:involvement of cathepsins L and B. J Biochem 139, 363-371.Laurent-Matha, V., Farnoud, M. R., Lucas, A., Rougeot, C., Garcia, M., and Rochefort, H.(1998). Endocytosis of pro-cathepsin D into breast cancer cells is mostly independent ofmannose-6-phosphate receptors. J Cell Sci 111 ( Pt 17), 2539-2549.Laurent-Matha, V., Lucas, A., Huttler, S., Sandhoff, K., Garcia, M., and Rochefort, H. (2002).Procathepsin D interacts with prosaposin in cancer cells but its internalization is not mediatedby LDL receptor-related protein. Exp Cell Res 277, 210-219.Laurent-Matha, V., Maruani-Herrmann, S., Prebois, C., Beaujouin, M., Glondu, M., Noel, A.,Alvarez-Gonzalez, M. L., Blacher, S., Coopman, P., Baghdiguian, S., et al. (2005).Catalytically inactive human cathepsin D triggers fibroblast invasive growth. J Cell Biol 168,489-499.Lee, A. Y., Gulnik, S. V., and Erickson, J. W. (1998). Conformational switching in an asparticproteinase. Nat Struct Biol 5, 866-871.Lee, D., Walsh, J. D., Mikhailenko, I., Yu, P., Migliorini, M., Wu, Y., Krueger, S., Curtis, J.E., Harris, B., Lockett, S., et al. (2006). RAP uses a histidine switch to regulate its interactionwith LRP in the ER and Golgi. Mol Cell 22, 423-430.Lefterova, M. I., and Lazar, M. A. (2009). New developments in adipogenesis. TrendsEndocrinol Metab 20, 107-114.Lefterova, M. I., Zhang, Y., Steger, D. J., Schupp, M., Schug, J., Cristancho, A., Feng, D.,Zhuo, D., Stoeckert, C. J., Jr., Liu, X. S., and Lazar, M. A. (2008). PPARgamma and C/EBPfactors orchestrate adipocyte biology via adjacent binding on a genome-wide scale. GenesDev 22, 2941-2952.86

Letexier, D., Pinteur, C., Large, V., Frering, V., and Beylot, M. (2003). Comparison of theexpression and activity of the lipogenic pathway in human and rat adipose tissue. J Lipid Res44, 2127-2134.Li, Y., Lu, W., and Bu, G. (2003). Essential role of the low density lipoprotein receptorrelatedprotein in vascular smooth muscle cell migration. FEBS Lett 555, 346-350.Liaudet-Coopman, E., Beaujouin, M., Derocq, D., Garcia, M., Glondu-Lassis, M., Laurent-Matha, V., Prebois, C., Rochefort, H., and Vignon, F. (2006). Cathepsin D: newly discoveredfunctions of a long-standing aspartic protease in cancer and apoptosis. Cancer Lett 237, 167-179.Liaudet, E., Derocq, D., Rochefort, H., and Garcia, M. (1995). Transfected cathepsin Dstimulates high density cancer cell growth by inactivating secreted growth inhibitors. CellGrowth Differ 6, 1045-1052.Liaudet, E., Garcia, M., and Rochefort, H. (1994). Cathepsin D maturation and its stimulatoryeffect on metastasis are prevented by addition of KDEL retention signal. Oncogene 9, 1145-1154.Lijnen, H. R., Maquoi, E., Hansen, L. B., Van Hoef, B., Frederix, L., and Collen, D. (2002).Matrix metalloproteinase inhibition impairs adipose tissue development in mice. ArteriosclerThromb Vasc Biol 22, 374-379.Lilla, J., Stickens, D., and Werb, Z. (2002). Metalloproteases and adipogenesis: a weightysubject. Am J Pathol 160, 1551-1554.Lillis, A. P., Van Duyn, L. B., Murphy-Ullrich, J. E., and Strickland, D. K. (2008). LDLreceptor-related protein 1: unique tissue-specific functions revealed by selective geneknockout studies. Physiol Rev 88, 887-918.Liu, Q., Zhang, J., Tran, H., Verbeek, M. M., Reiss, K., Estus, S., and Bu, G. (2009). LRP1shedding in human brain: roles of ADAM10 and ADAM17. Mol Neurodegener 4, 17.Loukinova, E., Ranganathan, S., Kuznetsov, S., Gorlatova, N., Migliorini, M. M., Loukinov,D., Ulery, P. G., Mikhailenko, I., Lawrence, D. A., and Strickland, D. K. (2002). Plateletderivedgrowth factor (PDGF)-induced tyrosine phosphorylation of the low densitylipoprotein receptor-related protein (LRP). Evidence for integrated co-receptor functionbetwenn LRP and the PDGF. J Biol Chem 277, 15499-15506.Ludwig, T., Munier-Lehmann, H., Bauer, U., Hollinshead, M., Ovitt, C., Lobel, P., andHoflack, B. (1994). Differential sorting of lysosomal enzymes in mannose 6-phosphatereceptor-deficient fibroblasts. Embo J 13, 3430-3437.87

Ludwig, T., Ovitt, C. E., Bauer, U., Hollinshead, M., Remmler, J., Lobel, P., Ruther, U., andHoflack, B. (1993). Targeted disruption of the mouse cation-dependent mannose 6-phosphatereceptor results in partial missorting of multiple lysosomal enzymes. Embo J 12, 5225-5235.Maffei, M., Fei, H., Lee, G. H., Dani, C., Leroy, P., Zhang, Y., Proenca, R., Negrel, R.,Ailhaud, G., and Friedman, J. M. (1995). Increased expression in adipocytes of ob RNA inmice with lesions of the hypothalamus and with mutations at the db locus. Proc Natl Acad SciU S A 92, 6957-6960.Manabe, Y., Toda, S., Miyazaki, K., and Sugihara, H. (2003). Mature adipocytes, but notpreadipocytes, promote the growth of breast carcinoma cells in collagen gel matrix culturethrough cancer-stromal cell interactions. J Pathol 201, 221-228.Markert, C. D., Atala, A., Cann, J. K., Christ, G., Furth, M., Ambrosio, F., and Childers, M.K. (2009). Mesenchymal stem cells: emerging therapy for Duchenne muscular dystrophy. PmR 1, 547-559.Massiera, F., Bloch-Faure, M., Ceiler, D., Murakami, K., Fukamizu, A., Gasc, J. M.,Quignard-Boulange, A., Negrel, R., Ailhaud, G., Seydoux, J., et al. (2001). Adiposeangiotensinogen is involved in adipose tissue growth and blood pressure regulation. Faseb J15, 2727-2729.May, P., Rohlmann, A., Bock, H. H., Zurhove, K., Marth, J. D., Schomburg, E. D., Noebels,J. L., Beffert, U., Sweatt, J. D., Weeber, E. J., and Herz, J. (2004). Neuronal LRP1functionally associates with postsynaptic proteins and is required for normal motor function inmice. Mol Cell Biol 24, 8872-8883.McIntyre, G. F., and Erickson, A. H. (1991). Procathepsins L and D are membrane-bound inacidic microsomal vesicles. J Biol Chem 266, 15438-15445.McIntyre, G. F., and Erickson, A. H. (1993). The lysosomal proenzyme receptor that bindsprocathepsin L to microsomal membranes at pH 5 is a 43-kDa integral membrane protein.Proc Natl Acad Sci U S A 90, 10588-10592.Mead, J. R., Irvine, S. A., and Ramji, D. P. (2002). Lipoprotein lipase: structure, function,regulation, and role in disease. J Mol Med 80, 753-769.Medina-Gomez, G., Virtue, S., Lelliott, C., Boiani, R., Campbell, M., Christodoulides, C.,Perrin, C., Jimenez-Linan, M., Blount, M., Dixon, J., et al. (2005). The link betweennutritional status and insulin sensitivity is dependent on the adipocyte-specific peroxisomeproliferator-activated receptor-gamma2 isoform. Diabetes 54, 1706-1716.Metcalf, P., and Fusek, M. (1993). Two crystal structures for cathepsin D: the lysosomaltargeting signal and active site. Embo J 12, 1293-1302.88

Metcalf, P., and Fusek, M. (1995). Cathepsin D crystal structures and lysosomal sorting. AdvExp Med Biol 362, 193-200.Minarowska, A., Gacko, M., Karwowska, A., and Minarowski, L. (2008). Human cathepsinD. Folia Histochem Cytobiol 46, 23-38.Missmer, S. A., Eliassen, A. H., Barbieri, R. L., and Hankinson, S. E. (2004). Endogenousestrogen, androgen, and progesterone concentrations and breast cancer risk amongpostmenopausal women. J Natl Cancer Inst 96, 1856-1865.Mohamadzadeh, M., Mohamadzadeh, H., Brammer, M., Sestak, K., and Luftig, R. B. (2004).Identification of proteases employed by dendritic cells in the processing of protein purifiedderivative (PPD). J Immune Based Ther Vaccines 2, 8.Mohamed, M. M., and Sloane, B. F. (2006). Cysteine cathepsins: multifunctional enzymes incancer. Nat Rev Cancer 6, 764-775.Morikawa, W., Yamamoto, K., Ishikawa, S., Takemoto, S., Ono, M., Fukushi, J., Naito, S.,Nozaki, C., Iwanaga, S., and Kuwano, M. (2000). Angiostatin generation by cathepsin Dsecreted by human prostate carcinoma cells. J Biol Chem 275, 38912-38920.Mueller, M. M., and Fusenig, N. E. (2004). Friends or foes - bipolar effects of the tumourstroma in cancer. Nat Rev Cancer 4, 839-849.Munzberg, H., and Myers, M. G., Jr. (2005). Molecular and anatomical determinants ofcentral leptin resistance. Nat Neurosci 8, 566-570.Mutka, A. L., Haapanen, A., Kakela, R., Lindfors, M., Wright, A. K., Inkinen, T.,Hermansson, M., Rokka, A., Corthals, G., Jauhiainen, M., et al. (2009). Murine cathepsin Ddeficiency is associated with dysmyelination/myelin disruption and accumulation ofcholesteryl esters in the brain. J Neurochem.Neels, J. G., van Den Berg, B. M., Lookene, A., Olivecrona, G., Pannekoek, H., and vanZonneveld, A. J. (1999). The second and fourth cluster of class A cysteine-rich repeats of thelow density lipoprotein receptor-related protein share ligand-binding properties. J Biol Chem274, 31305-31311.Newton, C. S., Loukinova, E., Mikhailenko, I., Ranganathan, S., Gao, Y., Haudenschild, C.,and Strickland, D. K. (2005). Platelet-derived growth factor receptor-beta (PDGFR-beta)activation promotes its association with the low density lipoprotein receptor-related protein(LRP). Evidence for co-receptor function. J Biol Chem 280, 27872-27878.Nikolic-Vukosavljevic, D., Markicevic, M., Grujic-Adanja, G., Petrovic, A., Kanjer, K., andNeskovic-Konstantinovic, Z. (2005). Cathepsin D-related disease-free interval in pT1 primarybreast carcinomas: a pilot study. Clin Exp Metastasis 22, 363-368.89

Nirde, P., Derocq, D., Maynadier, M., Chambon, M., Basile, I., Gary-Bobo, M., and Garcia,M. (2009). Heat shock cognate 70 protein secretion as a new growth arrest signal for cancercells. Oncogene.Obermeyer, K., Krueger, S., Peters, B., Falkenberg, B., Roessner, A., and Rocken, C. (2007).The expression of low density lipoprotein receptor-related protein in colorectal carcinoma.Oncol Rep 17, 361-367.Ohri, S. S., Vashishta, A., Proctor, M., Fusek, M., and Vetvicka, V. (2007). Depletion ofprocathepsin D gene expression by RNA interference: a potential therapeutic target for breastcancer. Cancer Biol Ther 6, 1081-1087.Olumi, A. F., Grossfeld, G. D., Hayward, S. W., Carroll, P. R., Tlsty, T. D., and Cunha, G. R.(1999). Carcinoma-associated fibroblasts direct tumor progression of initiated humanprostatic epithelium. Cancer Res 59, 5002-5011.Pan, S. Y., and DesMeules, M. (2009). Energy intake, physical activity, energy balance, andcancer: epidemiologic evidence. Methods Mol Biol 472, 191-215.Papassotiropoulos, A., Lewis, H. D., Bagli, M., Jessen, F., Ptok, U., Schulte, A., Shearman,M. S., and Heun, R. (2002). Cerebrospinal fluid levels of beta-amyloid(42) in patients withAlzheimer's disease are related to the exon 2 polymorphism of the cathepsin D gene.Neuroreport 13, 1291-1294.Park, K. W., Halperin, D. S., and Tontonoz, P. (2008). Before they were fat: adipocyteprogenitors. Cell Metab 8, 454-457.Piwnica, D., Fernandez, I., Binart, N., Touraine, P., Kelly, P. A., and Goffin, V. (2006). Anew mechanism for prolactin processing into 16K PRL by secreted cathepsin D. MolEndocrinol 20, 3263-3278.Piwnica, D., Touraine, P., Struman, I., Tabruyn, S., Bolbach, G., Clapp, C., Martial, J. A.,Kelly, P. A., and Goffin, V. (2004). Cathepsin D processes human prolactin into multiple16K-like N-terminal fragments: study of their antiangiogenic properties and physiologicalrelevance. Mol Endocrinol 18, 2522-2542.Qiao, L., Hamamichi, S., Caldwell, K. A., Caldwell, G. A., Yacoubian, T. A., Wilson, S., Xie,Z. L., Speake, L. D., Parks, R., Crabtree, D., et al. (2008). Lysosomal enzyme cathepsin Dprotects against alpha-synuclein aggregation and toxicity. Mol Brain 1, 17.Quinn, K. A., Grimsley, P. G., Dai, Y. P., Tapner, M., Chesterman, C. N., and Owensby, D.A. (1997). Soluble low density lipoprotein receptor-related protein (LRP) circulates in humanplasma. J Biol Chem 272, 23946-23951.90

Quinn, K. A., Pye, V. J., Dai, Y. P., Chesterman, C. N., and Owensby, D. A. (1999).Characterization of the soluble form of the low density lipoprotein receptor-related protein(LRP). Exp Cell Res 251, 433-441.Rajala, M. W., and Scherer, P. E. (2003). Minireview: The adipocyte--at the crossroads ofenergy homeostasis, inflammation, and atherosclerosis. Endocrinology 144, 3765-3773.Redecker, B., Heckendorf, B., Grosch, H. W., Mersmann, G., and Hasilik, A. (1991).Molecular organization of the human cathepsin D gene. DNA Cell Biol 10, 423-431.Reeves, G. K., Pirie, K., Beral, V., Green, J., Spencer, E., and Bull, D. (2007). Cancerincidence and mortality in relation to body mass index in the Million Women Study: cohortstudy. Bmj 335, 1134.Reichert, M., and Eick, D. (1999). Analysis of cell cycle arrest in adipocyte differentiation.Oncogene 18, 459-466.Renehan, A. G., Tyson, M., Egger, M., Heller, R. F., and Zwahlen, M. (2008). Body-massindex and incidence of cancer: a systematic review and meta-analysis of prospectiveobservational studies. Lancet 371, 569-578.Reshef, L., Olswang, Y., Cassuto, H., Blum, B., Croniger, C. M., Kalhan, S. C., Tilghman, S.M., and Hanson, R. W. (2003). Glyceroneogenesis and the triglyceride/fatty acid cycle. J BiolChem 278, 30413-30416.Richo, G. R., and Conner, G. E. (1994). Structural requirements of procathepsin D activationand maturation. J Biol Chem 269, 14806-14812.Richon, V. M., Lyle, R. E., and McGehee, R. E., Jr. (1997). Regulation and expression ofretinoblastoma proteins p107 and p130 during 3T3-L1 adipocyte differentiation. J Biol Chem272, 10117-10124.Rijnboutt, S., Kal, A. J., Geuze, H. J., Aerts, H., and Strous, G. J. (1991). Mannose 6-phosphate-independent targeting of cathepsin D to lysosomes in HepG2 cells. J Biol Chem266, 23586-23592.Rochefort, H. (1996). The prognostic value of cathepsin D in breast cancer. A long road to theclinic. Eur J Cancer 32A, 7-8.Rose, D. P., Komninou, D., and Stephenson, G. D. (2004). Obesity, adipocytokines, andinsulin resistance in breast cancer. Obes Rev 5, 153-165.Rosen, E. D., Hsu, C. H., Wang, X., Sakai, S., Freeman, M. W., Gonzalez, F. J., andSpiegelman, B. M. (2002). C/EBPalpha induces adipogenesis through PPARgamma: a unifiedpathway. Genes Dev 16, 22-26.91

Rozanov, D. V., Hahn-Dantona, E., Strickland, D. K., and Strongin, A. Y. (2004). The lowdensity lipoprotein receptor-related protein LRP is regulated by membrane type-1 matrixmetalloproteinase (MT1-MMP) proteolysis in malignant cells. J Biol Chem 279, 4260-4268.Sadik, G., Kaji, H., Takeda, K., Yamagata, F., Kameoka, Y., Hashimoto, K., Miyanaga, K.,and Shinoda, T. (1999). In vitro processing of amyloid precursor protein by cathepsin D. Int JBiochem Cell Biol 31, 1327-1337.Saftig, P., Hetman, M., Schmahl, W., Weber, K., Heine, L., Mossmann, H., Koster, A., Hess,B., Evers, M., von Figura, K., and et al. (1995). Mice deficient for the lysosomal proteinasecathepsin D exhibit progressive atrophy of the intestinal mucosa and profound destruction oflymphoid cells. Embo J 14, 3599-3608.Saltiel, A. R., and Kahn, C. R. (2001). Insulin signalling and the regulation of glucose andlipid metabolism. Nature 414, 799-806.Sato, T., Sakai, T., Noguchi, Y., Takita, M., Hirakawa, S., and Ito, A. (2004). Tumor-stromalcell contact promotes invasion of human uterine cervical carcinoma cells by augmenting theexpression and activation of stromal matrix metalloproteinases. Gynecol Oncol 92, 47-56.Schaefer, E. J., Woo, R., Kibata, M., Bjornsen, L., and Schreibman, P. H. (1983).Mobilization of triglyceride but not cholesterol or tocopherol from human adipocytes duringweight reduction. Am J Clin Nutr 37, 749-754.Scherer, P. E., Williams, S., Fogliano, M., Baldini, G., and Lodish, H. F. (1995). A novelserum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 270, 26746-26749.Sevlever, D., Jiang, P., and Yen, S. H. (2008). Cathepsin D is the main lysosomal enzymeinvolved in the degradation of alpha-synuclein and generation of its carboxy-terminallytruncated species. Biochemistry 47, 9678-9687.Sheikh, A. M., Li, X., Wen, G., Tauqeer, Z., Brown, W. T., and Malik, M. (2009). CathepsinD and apoptosis related proteins are elevated in the brain of autistic subjects. Neuroscience.Shrago, E., Glennon, J. A., and Gordon, E. S. (1971). Comparative aspects of lipogenesis inmammalian tissues. Metabolism 20, 54-62.Shrago, E., Spennetta, T., and Gordon, E. (1969). Fatty acid synthesis in human adiposetissue. J Biol Chem 244, 2761-2766.Sieuwerts, A. M., Klijn, J. G., Henzen-Logmand, S. C., Bouwman, I., Van Roozendaal, K. E.,Peters, H. A., Setyono-Han, B., and Foekens, J. A. (1998). Urokinase-type-plasminogenactivator(uPA) production by human breast (myo) fibroblasts in vitro: influence of92

transforming growth factor-beta(1) (TGF beta(1)) compared with factor(s) released by humanepithelial-carcinoma cells. Int J Cancer 76, 829-835.Siintola, E., Partanen, S., Stromme, P., Haapanen, A., Haltia, M., Maehlen, J., Lehesjoki, A.E., and Tyynela, J. (2006). Cathepsin D deficiency underlies congenital human neuronalceroid-lipofuscinosis. Brain 129, 1438-1445.Sjostrom, L. (1972). Adult human adipose tissue cellularity and metabolism with specialreference to obesity and fatty acid synthesis de novo. Acta Med Scand Suppl 544, 1-52.Smas, C. M., and Sul, H. S. (1995). Control of adipocyte differentiation. Biochem J 309 ( Pt3), 697-710.Somasundar, P., Yu, A. K., Vona-Davis, L., and McFadden, D. W. (2003). Differential effectsof leptin on cancer in vitro. J Surg Res 113, 50-55.Song, H., Li, Y., Lee, J., Schwartz, A. L., and Bu, G. (2009). Low-density lipoproteinreceptor-related protein 1 promotes cancer cell migration and invasion by inducing theexpression of matrix metalloproteinases 2 and 9. Cancer Res 69, 879-886.Spiegelman, B. M., and Farmer, S. R. (1982). Decreases in tubulin and actin gene expressionprior to morphological differentiation of 3T3 adipocytes. Cell 29, 53-60.Spiegelman, B. M., and Ginty, C. A. (1983). Fibronectin modulation of cell shape andlipogenic gene expression in 3T3-adipocytes. Cell 35, 657-666.Stein, M., Zijderhand-Bleekemolen, J. E., Geuze, H., Hasilik, A., and von Figura, K. (1987).Mr 46,000 mannose 6-phosphate specific receptor: its role in targeting of lysosomal enzymes.Embo J 6, 2677-2681.Steinfeld, R., Reinhardt, K., Schreiber, K., Hillebrand, M., Kraetzner, R., Bruck, W., Saftig,P., and Gartner, J. (2006). Cathepsin D deficiency is associated with a humanneurodegenerative disorder. Am J Hum Genet 78, 988-998.Strickland, D. K., Ashcom, J. D., Williams, S., Burgess, W. H., Migliorini, M., and Argraves,W. S. (1990). Sequence identity between the alpha 2-macroglobulin receptor and low densitylipoprotein receptor-related protein suggests that this molecule is a multifunctional receptor. JBiol Chem 265, 17401-17404.Strickland, D. K., and Ranganathan, S. (2003). Diverse role of LDL receptor-related proteinin the clearance of proteases and in signaling. J Thromb Haemost 1, 1663-1670.Takata, H., Tomizawa, K., Matsushita, M., and Matsui, H. (2004). 2-methoxyestradiolenhances p53 protein transduction therapy-associated inhibition of the proliferation of oralcancer cells through the suppression of NFkappaB activity. Acta Med Okayama 58, 181-187.93

Taleb, S., Cancello, R., Clement, K., and Lacasa, D. (2006). Cathepsin s promotes humanpreadipocyte differentiation: possible involvement of fibronectin degradation. Endocrinology147, 4950-4959.Tang, Q. Q., Otto, T. C., and Lane, M. D. (2003). Mitotic clonal expansion: a synchronousprocess required for adipogenesis. Proc Natl Acad Sci U S A 100, 44-49.Terrand, J., Bruban, V., Zhou, L., Gong, W., El Asmar, Z., May, P., Zurhove, K., Haffner, P.,Philippe, C., Woldt, E., et al. (2009). LRP1 controls intracellular cholesterol storage and fattyacid synthesis through modulation of Wnt signaling. J Biol Chem 284, 381-388.Tlsty, T. D. (2001). Stromal cells can contribute oncogenic signals. Semin Cancer Biol 11,97-104.Tontonoz, P., Hu, E., and Spiegelman, B. M. (1994). Stimulation of adipogenesis infibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 79, 1147-1156.Tontonoz, P., Hu, E., and Spiegelman, B. M. (1995). Regulation of adipocyte gene expressionand differentiation by peroxisome proliferator activated receptor gamma. Curr Opin GenetDev 5, 571-576.Tsai, Y. S., and Maeda, N. (2005). PPARgamma: a critical determinant of body fatdistribution in humans and mice. Trends Cardiovasc Med 15, 81-85.Tyynela, J., Sohar, I., Sleat, D. E., Gin, R. M., Donnelly, R. J., Baumann, M., Haltia, M., andLobel, P. (2000). A mutation in the ovine cathepsin D gene causes a congenital lysosomalstorage disease with profound neurodegeneration. Embo J 19, 2786-2792.Umezawa, H., Aoyagi, T., Morishima, H., Matsuzaki, M., and Hamada, M. (1970). Pepstatin,a new pepsin inhibitor produced by Actinomycetes. J Antibiot (Tokyo) 23, 259-262.van der Geer, P. (2002). Phosphorylation of LRP1: regulation of transport and signaltransduction. Trends Cardiovasc Med 12, 160-165.van Kruijsdijk, R. C., van der Wall, E., and Visseren, F. L. (2009). Obesity and cancer: therole of dysfunctional adipose tissue. Cancer Epidemiol Biomarkers Prev 18, 2569-2578.Vashishta, A., Ohri, S. S., Proctor, M., Fusek, M., and Vetvicka, V. (2007). Ribozymetargetingprocathepsin D and its effect on invasion and growth of breast cancer cells: animplication in breast cancer therapy. Int J Oncol 30, 1223-1230.Vazquez-Vela, M. E., Torres, N., and Tovar, A. R. (2008). White adipose tissue as endocrineorgan and its role in obesity. Arch Med Res 39, 715-728.Vetvicka, V., Vektvickova, J., and Fusek, M. (1994). Effect of human procathepsin D onproliferation of human cell lines. Cancer Lett 79, 131-135.94

Vetvicka, V., Vetvickova, J., and Fusek, M. (1998). Effect of procathepsin D and itsactivation peptide on prostate cancer cells. Cancer Lett 129, 55-59.Vetvicka, V., Vetvickova, J., and Fusek, M. (1999). Anti-human procathepsin D activationpeptide antibodies inhibit breast cancer development. Breast Cancer Res Treat 57, 261-269.Vignon, F., Capony, F., Chambon, M., Freiss, G., Garcia, M., and Rochefort, H. (1986).Autocrine growth stimulation of the MCF 7 breast cancer cells by the estrogen-regulated 52 Kprotein. Endocrinology 118, 1537-1545.Vignon, F., and Rochefort, H. (1992). Interactions of pro-cathepsin D and IGF-II on themannose-6-phosphate/IGF-II receptor. Breast Cancer Res Treat 22, 47-57.von Arnim, C. A., Kinoshita, A., Peltan, I. D., Tangredi, M. M., Herl, L., Lee, B. M.,Spoelgen, R., Hshieh, T. T., Ranganathan, S., Battey, F. D., et al. (2005). The low densitylipoprotein receptor-related protein (LRP) is a novel beta-secretase (BACE1) substrate. J BiolChem 280, 17777-17785.Vona-Davis, L., and Rose, D. P. (2007). Adipokines as endocrine, paracrine, and autocrinefactors in breast cancer risk and progression. Endocr Relat Cancer 14, 189-206.Willnow, T. E., Armstrong, S. A., Hammer, R. E., and Herz, J. (1995). Functional expressionof low density lipoprotein receptor-related protein is controlled by receptor-associated proteinin vivo. Proc Natl Acad Sci U S A 92, 4537-4541.Willnow, T. E., Orth, K., and Herz, J. (1994). Molecular dissection of ligand binding sites onthe low density lipoprotein receptor-related protein. J Biol Chem 269, 15827-15832.Wiseman, B. S., and Werb, Z. (2002). Stromal effects on mammary gland development andbreast cancer. Science 296, 1046-1049.Wittlin, S., Rosel, J., Hofmann, F., and Stover, D. R. (1999). Mechanisms and kinetics ofprocathepsin D activation. Eur J Biochem 265, 384-393.Wozniak, S. E., Gee, L. L., Wachtel, M. S., and Frezza, E. E. (2009). Adipose tissue: the newendocrine organ? A review article. Dig Dis Sci 54, 1847-1856.Wu, L., and Gonias, S. L. (2005). The low-density lipoprotein receptor-related protein-1associates transiently with lipid rafts. J Cell Biochem 96, 1021-1033.Wu, Z., Rosen, E. D., Brun, R., Hauser, S., Adelmant, G., Troy, A. E., McKeon, C.,Darlington, G. J., and Spiegelman, B. M. (1999). Cross-regulation of C/EBP alpha and PPARgamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell3, 151-158.95

Xiao, Y., Junfeng, H., Tianhong, L., Lu, W., Shulin, C., Yu, Z., Xiaohua, L., Weixia, J.,Sheng, Z., Yanyun, G., et al. (2006). Cathepsin K in adipocyte differentiation and its potentialrole in the pathogenesis of obesity. J Clin Endocrinol Metab 91, 4520-4527.Yang, M., Huang, H., Li, J., Li, D., and Wang, H. (2004). Tyrosine phosphorylation of theLDL receptor-related protein (LRP) and activation of the ERK pathway are required forconnective tissue growth factor to potentiate myofibroblast differentiation. Faseb J 18, 1920-1921.Yang, M., Sun, J., Zhang, T., Liu, J., Zhang, J., Shi, M. A., Darakhshan, F., Guerre-Millo, M.,Clement, K., Gelb, B. D., et al. (2008). Deficiency and inhibition of cathepsin K reduce bodyweight gain and increase glucose metabolism in mice. Arterioscler Thromb Vasc Biol 28,2202-2208.Yang, M., Zhang, Y., Pan, J., Sun, J., Liu, J., Libby, P., Sukhova, G. K., Doria, A., Katunuma,N., Peroni, O. D., et al. (2007). Cathepsin L activity controls adipogenesis and glucosetolerance. Nat Cell Biol 9, 970-977.Yatagai, T., Nagasaka, S., Taniguchi, A., Fukushima, M., Nakamura, T., Kuroe, A., Nakai,Y., and Ishibashi, S. (2003). Hypoadiponectinemia is associated with visceral fataccumulation and insulin resistance in Japanese men with type 2 diabetes mellitus.Metabolism 52, 1274-1278.Zaidi, N., Burster, T., Sommandas, V., Herrmann, T., Boehm, B. O., Driessen, C., Voelter,W., and Kalbacher, H. (2007). A novel cell penetrating aspartic protease inhibitor blocksprocessing and presentation of tetanus toxoid more efficiently than pepstatin A. BiochemBiophys Res Commun 364, 243-249.Zaidi, N., Maurer, A., Nieke, S., and Kalbacher, H. (2008). Cathepsin D: a cellular roadmap.Biochem Biophys Res Commun 376, 5-9.Zhang, H., Lee, J. M., Wang, Y., Dong, L., Ko, K. W., Pelletier, L., and Yao, Z. (2008).Mutational analysis of the FXNPXY motif within LDL receptor-related protein 1 (LRP1)reveals the functional importance of the tyrosine residues in cell growth regulation and signaltransduction. Biochem J 409, 53-64.Zhang, H., Links, P. H., Ngsee, J. K., Tran, K., Cui, Z., Ko, K. W., and Yao, Z. (2004a).Localization of low density lipoprotein receptor-related protein 1 to caveolae in 3T3-L1adipocytes in response to insulin treatment. J Biol Chem 279, 2221-2230.Zhang, J., Fu, M., Cui, T., Xiong, C., Xu, K., Zhong, W., Xiao, Y., Floyd, D., Liang, J., Li,E., et al. (2004b). Selective disruption of PPARgamma 2 impairs the development of adiposetissue and insulin sensitivity. Proc Natl Acad Sci U S A 101, 10703-10708.96

Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994).Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425-432.Zhou, H., Xiao, Y., Li, R., Hong, S., Li, S., Wang, L., Zeng, R., and Liao, K. (2009a).Quantitative analysis of secretome from adipocytes regulated by insulin. Acta BiochimBiophys Sin (Shanghai) 41, 910-921.Zhou, L., Takayama, Y., Boucher, P., Tallquist, M. D., and Herz, J. (2009b). LRP1 regulatesarchitecture of the vascular wall by controlling PDGFRbeta-dependent phosphatidylinositol 3-kinase activation. PLoS One 4, e6922.Zhou, W., Scott, S. A., Shelton, S. B., and Crutcher, K. A. (2006). Cathepsin D-mediatedproteolysis of apolipoprotein E: possible role in Alzheimer's disease. Neuroscience 143, 689-701.Zhu, Y., and Conner, G. E. (1994). Intermolecular association of lysosomal protein precursorsduring biosynthesis. J Biol Chem 269, 3846-3851.Zilberberg, A., Yaniv, A., and Gazit, A. (2004). The low density lipoprotein receptor-1,LRP1, interacts with the human frizzled-1 (HFz1) and down-regulates the canonical Wntsignaling pathway. J Biol Chem 279, 17535-17542.Zurhove, K., Nakajima, C., Herz, J., Bock, H. H., and May, P. (2008). Gamma-secretaselimits the inflammatory response through the processing of LRP1. Sci Signal 1, ra15.97

F. ANNEXE98

Article 3:Cathepsin D is a new ligand for extracellular domain of LRP1 chain and promotesLRP1-dependent fibroblast outgrowth99

Cathepsin D is a new ligand for extracellular domain of LRP1 b chain andpromotes LRP1-dependent fibroblast outgrowthMélanie Beaujouin 1 , Christine Prébois 1 , Danielle Derocq 1 , Valérie Laurent-Matha 1 ,Olivier Masson 1 , Sophie Pattingre 1 , Peter Coopman 2 , Nadir Bettache 2 , JamiGrossfield 3 , Robert E. Hollingsworth 3 , Hongyu Zhang 4 , Zemin Yao 4 , Bradley THyman 5 , Peter van der Geer 6 , Gary K Smith 7 , and Emmanuelle Liaudet-Coopman 1* .1 IRCM, Institut de Recherche en Cancérologie de Montpellier, Montpellier, F-34298,France; INSERM, U896, Montpellier, F-34298, France; Université Montpellier1,Montpellier, F-34298, France; CRLC Val dAurelle Paul Lamarque, Montpellier, F-34298, France. 2 Centre de Recherche de Biochimie Macromoléculaire, CNRS UMR5237, Université Montpellier 2, 34293 Montpellier Cedex 5, France. 3 GeneticsResearch, GlaxoSmithKline, Inc. Five Moore Drive, Research Triangle Park, NorthCarolina, 27709, USA. 4 Department of Biochemistry, Microbiology and Immunology,University of Ottawa, Ottawa K1Y4W7, Canada. 5 Alzheimer Disease ResearchLaboratory, Massachusetts General Hospital, Harvard Medical School, Charlestown,Massachusetts 02129, USA. 6 Department of Chemistry and Biochemistry, San DiegoState University, 5500 Campanile Drive, MC 1030, San Diego, CA 92182-1030, USA.7 Screening and Compound Profiling, GlaxoSmithKline, Inc. Five Moore Drive,Research Triangle Park, North Carolina, 27709, USA.*Corresponding author: E Liaudet-Coopman, Inserm U896, IRCM Val d'Aurelle-Paul Lamarque, 34298 Montpellier Cedex 5, France ; Tel (33) 467 61 24 23 ; FAX(33) 467 31 37 87 ; E-mail: emmanuelle.liaudet-coopman@inserm.frRunning title: cath-D promotes LRP1-dependent fibroblast outgrowthKey words: cancer, fibroblast, cathepsin, LRP1, tumor micro-environment1

ABSTRACTThe aspartic protease cathepsin-D (cath-D) is highly secreted by breast cancer cellsand triggers fibroblast outgrowth via a paracrine loop. Here, we demonstrate that theLDL receptor-related protein-1, LRP1, is the cath-D fibroblastic receptor. Cath-Dbinds to residues 349-394 of LRP1b and is therefore the first identified ligand of theextra-cellular domain of the b chain of LRP1. Interaction occurs at the cell surfaceand in vesicle-like structures. Cath-D is partially endocytosed by LRP1 in fibroblasts.Our results revealed that the ability of secreted cath-D to promote fibroblastoutgrowth depends on LRP1 expression. These observations demonstrate that procath-Dsecreted by epithelial cancer cells promotes fibroblast outgrowth in aparacrine LRP1-dependent manner in the breast tumour micro-environment.2

INTRODUCTIONLysosomal aspartic protease cathepsin-D (cath-D) is overexpressed and highlysecreted by human epithelial breast cancer cells (1-4). Its overexpression in breastcancer is correlated with poor prognosis (5-7). Cath-D is synthesized as a 52-kDa,catalytically-inactive precursor. It is present in endosomes as an active 48-kDa,single-chain intermediate that is subsequently converted in the lysosomes into thefully active mature protease, composed of a 34-kDa heavy chain, and a 14-kDa lightchain. The 52-kDa pro-cath-D hypersecreted by breast cancer cells into theextracellular environment is endocytosed by both cancer cells and fibroblasts (1, 8,9). While cath-D endocytosis is mainly performed by the mannose-6-phosphatereceptors (M6PR), the existence of alternative cath-D receptors has been postulated(10, 11). Cath-D affects both cancer cells and stromal cells in the tumor microenvironmentby increasing cell proliferation, metastasis, angiogenesis and fibroblastoutgrowth (1, 12-16). We previously observed that a mutated catalytically-inactiveversion of cath-D (D231N) remains mitogenic for tumor cells and fibroblasts (12, 14,15), suggesting that cath-D acts as an extracellular messenger that interacts eitherdirectly or indirectly with an as-yet unidentified cell surface receptor.Here, we identify the fibroblast receptor that mediates the cath-D-inducedparacrine fibroblast outgrowth, LDL receptor-related protein-1 (LRP1). LRP1 iscomposed of a 515-kDa extracellular a chain, and an 85-kDa b chain (17, 18). Theb chain contains an extracellular domain, a trans-membrane region, and acytoplasmic tail. The extracellular a chain contains binding-sites for many structurallyunrelated ligands, including lipoprotein particles, proteases and protease-inhibitorcomplexes. At present, the ligands of the extracellular domain of the LRP1b chain are3

still unknown. In this study, we report for the first time the interaction between cath-Dand the extracellular domain of the b chain of LRP1.MATERIALS AND METHODSMaterials. Human mammary fibroblasts (HMFs), kindly provided by J. Piette (IGM,Montpellier, France), were obtained from reduction mammoplasty tissues from apatient without cancer.cath-D-/- MEF-cath-D,cath-D-/- MEF- D231N cath-D and cath-Dtransfected 3Y1-Ad12 cells were previously described (15). LRP1-/- MEF and LRP1+/-MEFs were purchased from ATCC. B-41 cells, LRP1-/- MEF cells stably transfected withthe full-length human LRP1, were kindly provided by D. Strickland (UniversityMaryland School of Medicine, Baltimore, USA). Cells were cultured in DMEMmedium with 10% fetal calf serum (FCS, GibcoBRL). The 11H4 hybridoma directedagainst the C-terminal part of LRP1b chain was purchased at ATCC. Polyclonal antihumanLRP1b-chain antiserum was previously described (19). The anti-human cath-D monoclonal antibody (BD Biosciences) used for immuno-blotting recognized 52-,48- and 34-kDa forms of cath-D. The anti-human cath-D M1G8 monoclonal antibodyused for immuno-precipitation and purification recognized 52-, 48- and 34-kDa formsof cath-D. The anti-human, cath-D monoclonal antibody M2E8, used for immunofluorescence,interacts only with 52-kDa pro-cath-D. Anti-b actin polyclonal antibodywas purchased from Sigma.Plasmids. pcDNA3.1(+)Myc-tagged LRP1b chain, pcDNA3.1(-)cath-D andpcDNA3.1(-) D231N cath-D expression plasmids have previously been described (12).The pcDNA3.1(+)LRP1b extracellular domain (1-476) expression plasmid wascreated by inserting the PCR-amplified cDNA encoding LRP1b (1-476) from4

pcDNA3.1(+)Myc-tagged LRP1b into pcDNA3.1(+) previously digested by NheI andXbaI. pGEX-4T-1 LRP1b (307-479) was generated by inserting PCR-amplified cDNAencoding LRP1b (307-479) from pYESTrp2-LRP1b (307-479) identified by a twoyeasthybrid assay into pGEX-4T-1 previously digested by EcoRI. pGEX-2TK -34, -14and -4 kDa cath-D domains were obtained by inserting PCR-amplified cDNAencoding cath-D fragments into pGEX-4T-1 previously digested by EcoRI. pSG5-APP695 plasmid was kindly provided by B. De Strooper (Laboratory of Neuronal CellBiology, University of Leuven, Belgium).Yeast two-hybrid assay. Human cath-D was fused with the LexA DNA-bindingdomain in the pMW101 vector. A cDNA library derived from normal breast tissue wascloned into the galactosidase-inducible pYESTrp2 vector (Invitrogen) containing aB42 activating domain. The yeast two-hybrid screen was performed as describedpreviously (20).siRNA transfections and outgrowth assays. 30,000 HMF cells were transientlytransfected with 10-µg human LRP1 or Luc siRNAs using Oligofectamine(Invitrogen). 50,000cath-D-/- MEF-cath-Dorcath-D-/- MEF- D231N cath-D cells weretransiently transfected with 2.5 µg mouse LRP1 or Luc siRNAs. For outgrowthassays, 50,000 cath-D-/- MEF-cath-D , cath-D-/- MEF- D231N cath-D and HMF cells cells werere-suspended at 4°C in Matrigel (BD Biosciences) 24 or 48 h post-transfection withLRP or Luc siRNAs, and added to a pre-set layer of Matrigel (12). In co-cultureoutgrowth assays, 100,000 cells from mock- or cath-D-transfected 3Y1-Ad12 celllines were plated and then covered with a layer of Matrigel, and then with a layer ofMatrigel containing 50,000 HMFs 48h post-transfection with LRP or Luc siRNAs (15).5

siRNAs. Duplexes of 21-nucleotide human LRP1 siRNA1 (target sequenceAAGCAGTTTGCCTGCAGAGAT, residues 666-684) (21), human LRP1 siRNA2(target sequence AAGCTATGAGTTTAAGAAGTT) (Dharmacon), mouse LRP1siRNA3 (target sequence AAGCAUCUCAGUAGACUAUCA) (22), mouse LRP1siRNA4 (target sequence AAGCAGTTTGCCTGCAGAGAC) or firefly luciferase (Luc)siRNA (target sequence AACGTACGCGGAATACTTCGA) were synthesized byMWG Biotech S.A. (France) or Dharmacon.GST pull-down assays[ 35 S]methionine-labeled pro-cath-D, LRP1 (1-476) or APP695 were obtained bytranscription and translation using the TNT T7 -coupled reticulocyte lysate system(Promega). GST, GST-LRP1b (307479), GST-LRP1b shorter fragments, GST-cath-D-52K, -34K, -14K and -4K fusion proteins were produced in Escherichia coli B strainBL21 using isopropyl-1-thio-b-D-galactopyranoside (1 mM) for 3 h at 37°C. GSTfusion proteins were purified on glutathione-Sepharose beads (AmershamBiosciences). For pull-down assays, 20-µl bed volume of glutathione-Sepharosebeads with immobilized GST fusion proteins were incubated overnight at 4°C witheither [ 35 S]methionine-labeled proteins in 500 µl PDB buffer (20 mM HEPES-KOH[pH 7.9], 10% glycerol, 100 mM KCl, 5 mM MgCl 2 , 0.2 mM EDTA, 1 mM DTT, 0.2 mMphenylmethylsulfonyl fluoride) containing 15 mg/ml BSA and 0.1% Tween 20. Thebeads were washed with 500 µl PDB buffer, and bound proteins were resolved by15% SDS-PAGE, stained with Coomassie blue, and exposed to autoradiographicfilm. The refolding of GST proteins was performed using a multi-step dialysis protocol6

(Protein refolding kit, Novagen) followed by disulfide bond formation using a redoxsystem (cystein/cystin).Co-transfection, co-immunoprecipitation and co-purification. COS cells weretransfected with 10 µg of pcDNA3-Myc-LRP1b and 10 µg of pcDNA3.1, pcDNA3.1-cath-D, or pcDNA3.1- D231N cath-D vectors. Transient transfections were carried outusing Lipofectamine and Opti-MEM (Gibco-BRL). Two days post-transfection, cellswere lysed in 50 mM Hepes [pH 7.5], 150 mM NaCl, 10% glycerol, 1% Triton X-100,1.5 mM MgCl 2 1 mM EGTA, 100 mM NaF, 10 mM sodium pyrophosphate, 500 µMsodium vanadate, 1 mM phenylmethylsulfonyl fluoride and a protease inhibitorcocktail (PLC lysis buffer). Lysates were incubated with 3 µg of anti-cath-D M1G8, oranti-IgG monoclonal antibodies, or 40 µlof the anti-LRP1b 11H4 hybridomaovernight at 4°C, and subsequently with 25 µl of 10% protein A- or G-Sepharose, for2 h at 4°C on a shaker. Sepharose beads were washed 4 times with PLC buffer,boiled for 3 min in SDS sample buffer, and resolvedby SDS-PAGE andimmunoblotting. For cath-D purification, cells lysed in PLC buffer were passed overan anti-cath-D M1G8-coupled agarose column. The column was washed with 20 mlof phosphate buffer (0.5 M NaPO 4 , 150 mM NaCl, 0.01% Tween 80, 5 mM b-glycerophosphate) containing protease inhibitors, and then eluted in differentfractions with 20 mM lysine, pH 11.Immunoblotting. Cell extracts (100 µg) or conditioned media (80 µl) were submittedto SDS-PAGE and anti-LRP1b, anti-cath-D or anti-b-actin immuno-blotting.7

Cath-D endocytosis. Human cath-D transfected 3Y1-Ad12 cells (12) were labeledwith 175 µCi/ml [ 35 S]Translabel (MP Biomedicals, Inc.) for 24 h in serum-,methionine- and cysteine-free DMEM medium, and the labeled conditioned culturemedium containing secreted labeled-pro-cath-D was used for internalization. Inparallel, 100,000 HMF cells were transiently transfected with 10 µg human LRP1 orLuc siRNAs using Oligofectamine (Invitrogen). Two days post-transfection, theexpression of human LRP1 (100 µg cellular protein) was monitored byimmunoblotting using the 11H4 hybridoma. For endocytosis experiments, siRNAtransfectedHMFs were incubated for 18h in DMEM medium supplemented with theconditioned medium prepared from 3Y1-Ad12-cath-D cells corresponding to 3 x10 6 cpm of total TCA-precipitable proteins, 10% FCS, 10 mM of methionine and5 mM of cysteine in the absence or presence of 10 mM mannose-6-phosphate(M6P). Cell extracts were prepared in PLC buffer. Similar amounts of total proteinwere obtained in LRP1- and Luc siRNA-transfected HMFs, indicating that cell viabilitywas not affected by LRP1 silencing. [ 35 S]cath-D endocytosed into cells wasimmunoprecipitated with M1G8 anti-cath-D antibody, and analyzed by 15% SDS-PAGE and autoradiography (23). LRP1-/- MEF-LRP1 cells (clone B-41) and LRP1-/- MEFcells were tested for cath-D endocytosis, as described above for HMF fibroblasts inthe presence of 10 mM M6P.Immunogold. Cells were fixed with 3% paraformaldehyde and 0.1% glutaraldehydein a phosphate buffer (pH 7.2) overnight at 4°C, and then cryoprotected. Ultra-thinsections (85 nm) were incubated in PBS with 0.1 % cold water fish gelatin, 1% BSA,and 0.05% Tween 20, and then with rabbit anti-LRP1b (1/20) and mouse anti-cath-DM2E8 (4 µg/ml), and subsequently with 15-nm goat anti-rabbit-gold and 6-nm goat8

anti-mouse-gold (Aurion). Sections were observed using a Hitachi 7100 transmissionelectron microscope.RESULTSIdentification of LRP1 as the cath-D receptor in fibroblastsSince cath-D hypersecreted by cancer cells is able to stimulate fibroblast outgrowthin a paracrine manner (15), we postulate that cath-D acts via a cell surface receptor.To identify potential cath-D receptors, we performed a yeast two-hybrid screen usingLexA DNA-binding domain fused to cath-D as bait (Fig. 1A, panel a), and a cDNAlibrary isolated from normal breast. The clone isolated in our screen was 100%identical to amino acids 307-479 of the extracellular domain of LRP1 b chain (Fig. 1A,panel b).To validate the cath-D/LRP1 interaction, we performed GST pull-down experimentsby using GST-fusion proteins containing the 52-, 34-, 14- or 4-kDa cath-D fragments(Fig. 1B, panels a and c). The full-length extracellular LRP1b domain, LRP1b (1-476),was shown to bind to 52-, 34- and 14-kDa cath-D fragments (Fig. 1B, panels b andd). However, LRP1b (1-476) was shown to bind poorly to GST-RAP, a ligand of theLRP1a chain (Fig. 1B, panel f). Subsequently, a polypeptide containing amino acids307-479 of the extracellular domain of the LRP1b chain, GST-LRP1b (307-479), wasexpressed as a GST fusion protein (Fig. 1C, panel a), and tested for its ability to bindpro-cath-D. Our results show that pro-cath-D bound to GST-LRP1b (307-479) (Fig.1C, panel b). In contrast, APP, a ligand of the LRP1a chain, did not bind to GST-LRP1b (307-479) (Fig. 1C, panel d). The LRP1b (307-479) domain contains fourjuxtaposed complete EGF-like repeats (19-22) (Fig. 2A, panel a). In order to identifythe LRP1 cath-D-binding domain, GST-fusion proteins containing various fragments9

of LRP1b (307-479) were tested for their ability to bind to pro-cath-D (Fig. 2A, panelb). We identified the fragment of LRP1b (349-394) that contains the EGF-like repeat20, as the shortest fragment able to bind cath-D (Fig. 2B, panels b and d). Becauseof the lack of disulfide linkage in E. coli, we verified that binding of pro-cath-D wascomparable after GST-LRP1b refolding (Fig. 2B, panel f). Our results provideindependent confirmation of the yeast two-hybrid screen, and reveal direct interactionbetween cath-D and residues 349-394 of the extracellular domain of the LRP1b chain.To find out whether cath-D interacts with LRP1b chain in cellulo, LRP1b wasexpressed in COS cells in presence of wild-type cath-D or of a cath-D mutant devoidof proteolytic activity ( D231N cath-D). Our results show that both wild-type and D231Npro-cath-D precursor co-immunoprecipitated with the b chain of LRP1 either byperforming the immunoprecipitation using anti-LRP1b antibody (Fig. 3A, panel a) oranti-cath-D antibody (Fig. 3A, panel b). D231N cath-D displayed greater electrophoreticmobility, corresponding to an apparent molecular mass shift of ~1 kDa (Fig. 3A, panela), as previously reported (24). We, therefore, conclude that co-transfected cath-Dand LRP1b interact in cells.To study endogenous interaction, we screened a variety of cell lines for LRP1expression (Fig. 3B). It is known that cath-D is overexpressed and hypersecreted bybreast cancer cells (2) but our survey revealed that breast cancer cells (MCF-7 andMDA-MB-231) express low levels of LRP1 (Fig. 3B). By contrast, LRP1 was highlyexpressed in all the fibroblastic cell lines tested ( LRP1-/+ MEF, cath-D-/- MEF-cath-D andCCL146 mouse fibroblasts, HMF human mammary fibroblasts and CCD45K skinfibroblasts) (Fig. 3B), as observed in cancer biopsies (25, 26) whereas fibroblasts do10

not secrete detectable levels of pro-cath-D (data not shown) as previously reported(15).Since the cells that express high LRP1 levels and those that secrete pro-cath-Dwere distinct, we studied the interaction of cath-D with endogenous LRP1 using cath-D-/- MEF cells stably transfected with human wild-type or mutated D231N cath-D thathad previously been shown to secrete pro-cath-D (15). Cath-D immuno-affinitypurification revealed that LRP1b was co-eluted with both wild-type (Fig. 3C panel a)and D231N cath-D (Fig. Sup1). Our results show that endogenous LRP1 interactswith transfected cath-D. We next studied the paracrine interaction of endogenousLRP1 with cath-D. Interestingly, LRP1 was co-purified with cath-D in humanmammary fibroblasts (HMFs) incubated with 15 nM cath-D (Fig. 3C, panel b). Weconclude that cath-D interacts with intact LRP1 in fibroblasts.To investigate LRP1/cath-D subcellular co-localization, HMF cells incubatedwith 15 nM of pro-cath-D were analyzed by immunogold electron microscopy afterdouble staining with a monoclonal antibody anti-pro-cath-D and a polyclonal antibodydirected against the cytoplasmic tail of LRP1b (Fig. 4A, panels a-c). It has beenreported that LRP1 is localized both at the cell surface and in early endosomes (27).Our data revealed that, in HMF fibroblasts, pro-cath-D and LRP1 b co-localized at thecell surface (Fig. 4A, panel a) and in vesicle-like structures proximal to the plasmamembrane (Fig. 4A, panels b and c). These findings indicate that, in intact cells, procath-Dand LRP1b co-localized at the cell surface and in vesicle-like structures.Given that we observed the co-localization of cath-D and LRP1 in vesicle-likestructures proximal to the plasma membrane (Fig. 4A), and as LRP1 is an endocyticreceptor, we hypothesized that pro-cath-D internalization may alternatively bemediated through its interaction with LRP1 (Fig. 4B). The endocytosis of secreted11

pro-cath-D was analyzed in HMF fibroblasts in which endogenous LRP1 expressionhad or had not been silenced. As previously observed (23), labeled 52-kDa proenzymewas transformed into a 48-kDa intermediate, and a 34-kDa mature enzymeafter binding and internalization into cells (Fig. 4B, panel a). Moreover, as expected,mannose-6-phosphate, that neutralizes the cath-D primary receptor (e.g. M6Preceptors) (23), strongly reduced pro-cath-D internalization (Fig. 4B, panel a,compare lanes 1 and 3). Interestingly, in the presence of M6P, siRNA-mediatedinhibition of LRP1 expression (Fig. 4B, panel b) led to a significant reduction in theuptake of pro-cath-D independent of the M6P receptors (Fig. 4B, panel a, comparelanes 3 and 4; panel c for quantification). These findings strongly suggest that LRP1is a cath-D alternative endocytosis receptor. To support these results, additionalexperiments were performed using LRP1-/- MEF fibroblasts transfected or not with fulllengthLRP1. LRP1-dependent cath-D endocytosis was also observed in LRP1-/-fibroblasts transfected with LRP1 (MEF-B41) (Fig. 4C, panels a-b). Altogether, thesefindings indicate that pro-cath-D is partially endocytosed by LRP1 in fibroblasts. We,therefore, propose that LRP1 is an internalization pathway of pro-cath-D alternativeto the M6P receptors.LRP1 is the receptor that mediates the cath-D-induced stimulation of fibroblastoutgrowthWe previously observed that pro-cath-D secreted by cancer cells mediates fibroblastoutgrowth in a paracrine manner (15). As we identified LRP1 as the novel receptorfor cath-D on fibroblasts, we further checked whether paracrine cath-D would inducefibroblast outgrowth via its interaction with LRP1. To find out whether cath-D requiresLRP1 expression to trigger fibroblast outgrowth, we performed 3D culture assays12

using cath-D-/- MEF transfected with human cath-D ( cath-D-/- MEF-cath-D), cath-D-/- MEFtransfected with proteolytically-inactive cath-D ( cath-D-/- MEF- D231N cath-D), and HMFcells, which express LRP1 (Fig. 5 and Fig. 6).Our findings demonstrate that LRP1 silencing in cath-D-/- MEF-cath-D cells usingsiRNA3 (Fig. 5A, panel e) and siRNA4 (Fig. Sup. 2, panel e) reduced their cath-Ddependentoutgrowth (Fig. 5A, panels a and c; Fig. Sup. 2, panels a and c),compared to cells transfected with Luc siRNA (Fig. 5A, panels b and d; Fig. Sup. 2,panels b and d). Similar results were observed when LRP1 expression was inhibitedin cath-D-/- MEF- D231N cath-D cells, indicating a mechanism independent of cath-Dproteolytic activity (Fig. 5B). These findings indicate that cath-D does indeed requireLRP1 expression to promote fibroblast invasive outgrowth.To gain further insight into whether LRP1 mediates the paracrine action ofsecreted pro-cath-D on fibroblast outgrowth, we performed 3D co-culture assays ofLuc- and LRP1-silenced HMF fibroblasts (Fig. 6, panel e) and control- or cath-Dsecreting3Y1-Ad12 cancer cell lines (Fig. 6, panel f). The co-culture assay revealedthat only pro-cath-D-secreting 3Y1-Ad12 cells stimulated the outgrowth of HMFfibroblasts (Fig. 6, panel b), in contrast to 3Y1-Ad12 control cells (Fig. 6, panel a).Our results further showed that silencing LRP1 expression in HMF fibroblasts usingsiRNA1 (Fig. 6, panel e) blocked their mitogenic response to secreted pro-cath-D(Fig. 6, panel d). Similar results were obtained with LRP1 siRNA2 (Fig. Sup. 3). Incontrol experiments, we verified that the viability of HMF cells remained unaffected byLRP1-silencing (data not shown). These experiments demonstrate that the paracrinestimulation of cath-D-induced fibroblast outgrowth requires LRP1 expression.DISCUSSION13

In this report, we identified LRP1 as the cath-D fibroblastic receptor. At present,no ligand of the extracellular domain of the LRP1b chain has been discovered. Ourresults demonstrate that in fibroblasts the pro-cath-D protease interacts with theextracellular domain of the b chain of LRP1 and establishe cath-D as the firstdiscovered ligand of the extracellular LRP1 b chain. We identified the LRP1b (349-394) fragment, that contains the EGF-like repeat 20, as the shortest fragment able tobind cath-D. A previous work excluded LRP1 as a cath-D receptor in cancer cells(28). These observations were, however, based on the use of the RAP chaperoneprotein (29) that competes with ligands that bind to the LRP1a chain. Consequently,our findings showing that cath-D binds to the LRP1b chain, explains why RAP did notcompete with cath-D for binding to LRP1.LRP1 was originally identified as an endocytosis receptor that shuttles betweenthe cell surface and early endosomes (27). Here, we showed that cath-D interactswith LRP1 at the cell surface, as well as in vesicle-like structures resemblingendosomes. Our results also indicate that pro-cath-D is partially endocytosed byLRP1 in fibroblasts and show that LRP1 is a novel cath-D endocytic receptoralternative to the M6P receptor. Since pro-cath-D is secreted by cancer cells in thenanomolar range, LRP1-dependent endocytosis should result in the internalization ofsignificant levels of pro-cath-D by fibroblasts.We previously observed that pro-cath-D secreted by cancer cells mediatesfibroblast outgrowth in a paracrine manner (15). In this study, we reported that LRP1is the fibroblast receptor responsive for the cath-D-induced outgrowth stimulation. Ascreen for cell types that express LRP1 and secrete cath-D revealed that fibroblastsexpress high LRP1 levels whereas breast cancer cells secrete pro-cath-D. Outgrowthassays using cath-D-transfected MEFs, silenced or not silenced for LRP1, and 3D14

co-culture outgrowth assays with cancer cells, secreting or not cath-D, and HMFs,silenced or not silenced for LRP1, demonstrated that cath-D requires LRP1expression to promote fibroblast invasive outgrowth. These findings support a modelin which pro-cath-D hypersecreted by cancer cells stimulates the outgrowth ofsurrounding fibroblasts in a paracrine and LRP1-dependent manner. Other studieshave reported the stimulatory role of LRP1 in cancer cell proliferation, motility andinvasion (21, 30, 31). LRP1 may also be involved in the onset and progression ofvarious human malignancies. Indeed, LRP1 is expressed by fibroblasts in breastcancer biopsies and at the invasive front in colon cancer biopsies (25, 26). Inaddition, the C766T LRP1 gene polymorphism is associated with an increased risk ofbreast cancer development (32). Although breast cancer cells express LRP1 at amuch lower level than fibroblasts, several studies reported that hypoxia upregulatesLRP1 expression in breast cancer cells (33-35). Therefore, it is possible that cathDenhancedbreast cancer cell proliferation and/or migration may be also dependent onLRP1 expression.The mechanism by which LRP1 controls the cath-D-dependent stimulation offibroblast outgrowth implies an action of cath-D independent of its catalytic activity.The serine protease tPA has also been shown to act as a cytokine via LRP1 (36).LRP1 is known to modulate signal transduction via cytoplasmic LRP1b tyrosinephosphorylation (36-40), and gene transcription by RIP (41-44). Future studies willinvestigate the mechanism by which cath-D promotes fibroblast outgrowthindependently of its proteolytic activity.In conclusion, we report, for the first time, that cath-D interacts with theextracellular domain of LRP1 b chain and that it promotes an LRP1-dependentfibroblast outgrowth.15

ACKNOWLEDGEMENTSWe would like to thank Nadia Kerdjadj for secretarial assistance, Jean-YvesCance for the photographs, and Chantal Cazevieille (Centre de Ressources enImagerie Cellulaire, Montpellier) for the immunogold microscopy. We would alsothank Stephan Jalaguier for helpful discussions regarding the GST pull-downexperiments. This work was supported by the Institut National de la Santé et de laRecherche Médicale, University of Montpellier I, ANR Jeunes Chercheuses, JeunesChercheurs and the Ligue Nationale contre le Cancer, and the Association pour laRecherche sur le Cancer, which provided a fellowship for Mélanie Beaujouin.16

REFERENCES1. Vignon, F., Capony, F., Chambon, M., Freiss, G., Garcia, M., and Rochefort,H. Autocrine growth stimulation of the MCF 7 breast cancer cells by theestrogen-regulated 52 K protein. Endocrinology, 118: 1537-1545, 1986.2. Capony, F., Rougeot, C., Montcourrier, P., Cavailles, V., Salazar, G., andRochefort, H. Increased secretion, altered processing, and glycosylation ofpro-cathepsin D in human mammary cancer cells. Cancer Res, 49: 3904-3909, 1989.3. Rochefort, H. and Liaudet-Coopman, E. Cathepsin D in cancer metastasis: aprotease and a ligand. Apmis, 107: 86-95, 1999.4. Liaudet-Coopman, E., Beaujouin, M., Derocq, D., Garcia, M., Glondu-Lassis,M., Laurent-Matha, V., Prebois, C., Rochefort, H., and Vignon, F. Cathepsin D:newly discovered functions of a long-standing aspartic protease in cancer andapoptosis. Cancer Lett, 237: 167-179, 2006.5. Ferrandina, G., Scambia, G., Bardelli, F., Benedetti Panici, P., Mancuso, S.,and Messori, A. Relationship between cathepsin-D content and disease-freesurvival in node-negative breast cancer patients: a meta-analysis. Br JCancer, 76: 661-666, 1997.6. Foekens, J. A., Dall, P., Klijn, J. G., Skroch-Angel, P., Claassen, C. J., Look,M. P., Ponta, H., Van Putten, W. L., Herrlich, P., and Henzen-Logmans, S. C.Prognostic value of CD44 variant expression in primary breast cancer. Int JCancer, 84: 209-215, 1999.7. Rodriguez, J., Vazquez, J., Corte, M. D., Lamelas, M., Bongera, M., Corte, M.G., Alvarez, A., Allende, M., Gonzalez, L., Sanchez, M., Vijande, M., Garcia17

Muniz, J., and Vizoso, F. Clinical significance of cathepsin D concentration intumor cytosol of primary breast cancer. Int J Biol Markers, 20: 103-111, 2005.8. Laurent-Matha, V., Farnoud, M. R., Lucas, A., Rougeot, C., Garcia, M., andRochefort, H. Endocytosis of pro-cathepsin D into breast cancer cells is mostlyindependent of mannose-6-phosphate receptors. J Cell Sci, 111 ( Pt 17):2539-2549, 1998.9. Heylen, N., Vincent, L. M., Devos, V., Dubois, V., Remacle, C., and Trouet, A.Fibroblasts capture cathepsin D secreted by breast cancer cells: possible rolein the regulation of the invasive process. Int J Oncol, 20: 761-767, 2002.10. Rijnboutt, S., Kal, A. J., Geuze, H. J., Aerts, H., and Strous, G. J. Mannose 6-phosphate-independent targeting of cathepsin D to lysosomes in HepG2 cells.J Biol Chem, 266: 23586-23592, 1991.11. Capony, F., Braulke, T., Rougeot, C., Roux, S., Montcourrier, P., andRochefort, H. Specific mannose-6-phosphate receptor-independent sorting ofpro-cathepsin D in breast cancer cells. Exp Cell Res, 215: 154-163, 1994.12. Glondu, M., Coopman, P., Laurent-Matha, V., Garcia, M., Rochefort, H., andLiaudet-Coopman, E. A mutated cathepsin-D devoid of its catalytic activitystimulates the growth of cancer cells. Oncogene, 20: 6920-6929, 2001.13. Glondu, M., Liaudet-Coopman, E., Derocq, D., Platet, N., Rochefort, H., andGarcia, M. Down-regulation of cathepsin-D expression by antisense genetransfer inhibits tumor growth and experimental lung metastasis of humanbreast cancer cells. Oncogene, 21: 5127-5134, 2002.14. Berchem, G., Glondu, M., Gleizes, M., Brouillet, J. P., Vignon, F., Garcia, M.,and Liaudet-Coopman, E. Cathepsin-D affects multiple tumor progression18

steps in vivo: proliferation, angiogenesis and apoptosis. Oncogene, 21: 5951-5955, 2002.15. Laurent-Matha, V., Maruani-Herrmann, S., Prebois, C., Beaujouin, M., Glondu,M., Noel, A., Alvarez-Gonzalez, M. L., Blacher, S., Coopman, P., Baghdiguian,S., Gilles, C., Loncarek, J., Freiss, G., Vignon, F., and Liaudet-Coopman, E.Catalytically inactive human cathepsin D triggers fibroblast invasive growth. JCell Biol, 168: 489-499, 2005.16. Hu, L., Roth, J. M., Brooks, P., Luty, J., and Karpatkin, S. Thrombin upregulatescathepsin D which enhances angiogenesis, growth, and metastasis.Cancer Res, 68: 4666-4673, 2008.17. Strickland, D. K. and Ranganathan, S. Diverse role of LDL receptor-relatedprotein in the clearance of proteases and in signaling. J Thromb Haemost, 1:1663-1670, 2003.18. Lillis, A. P., Mikhailenko, I., and Strickland, D. K. Beyond endocytosis: LRPfunction in cell migration, proliferation and vascular permeability. J ThrombHaemost, 3: 1884-1893, 2005.19. Zhang, H., Links, P. H., Ngsee, J. K., Tran, K., Cui, Z., Ko, K. W., and Yao, Z.Localization of low density lipoprotein receptor-related protein 1 to caveolae in3T3-L1 adipocytes in response to insulin treatment. J Biol Chem, 279: 2221-2230, 2004.20. Slentz-Kesler, K., Moore, J. T., Lombard, M., Zhang, J., Hollingsworth, R., andWeiner, M. P. Identification of the human Mnk2 gene (MKNK2) through proteininteraction with estrogen receptor beta. Genomics, 69: 63-71, 2000.19

21. Li, Y., Lu, W., and Bu, G. Essential role of the low density lipoprotein receptorrelatedprotein in vascular smooth muscle cell migration. FEBS Lett, 555: 346-350, 2003.22. Fears, C. Y., Grammer, J. R., Stewart, J. E., Jr., Annis, D. S., Mosher, D. F.,Bornstein, P., and Gladson, C. L. Low-density lipoprotein receptor-relatedprotein contributes to the antiangiogenic activity of thrombospondin-2 in amurine glioma model. Cancer Res, 65: 9338-9346, 2005.23. Capony, F., Morisset, M., Barrett, A. J., Capony, J. P., Broquet, P., Vignon, F.,Chambon, M., Louisot, P., and Rochefort, H. Phosphorylation, glycosylation,and proteolytic activity of the 52-kD estrogen-induced protein secreted byMCF7 cells. J Cell Biol, 104: 253-262, 1987.24. Laurent-Matha, V., Derocq, D., Prebois, C., Katunuma, N., and Liaudet-Coopman, E. Processing of human cathepsin D is independent of its catalyticfunction and auto-activation: involvement of cathepsins L and B. J Biochem,139: 363-371, 2006.25. Christensen, L., Wiborg Simonsen, A. C., Heegaard, C. W., Moestrup, S. K.,Andersen, J. A., and Andreasen, P. A. Immunohistochemical localization ofurokinase-type plasminogen activator, type-1 plasminogen-activator inhibitor,urokinase receptor and alpha(2)-macroglobulin receptor in human breastcarcinomas. Int J Cancer, 66: 441-452, 1996.26. Obermeyer, K., Krueger, S., Peters, B., Falkenberg, B., Roessner, A., andRocken, C. The expression of low density lipoprotein receptor-related proteinin colorectal carcinoma. Oncol Rep, 17: 361-367, 2007.27. Herz, J. and Strickland, D. K. LRP: a multifunctional scavenger and signalingreceptor. J Clin Invest, 108: 779-784, 2001.20

28. Laurent-Matha, V., Lucas, A., Huttler, S., Sandhoff, K., Garcia, M., andRochefort, H. Procathepsin D interacts with prosaposin in cancer cells but itsinternalization is not mediated by LDL receptor-related protein. Exp Cell Res,277: 210-219, 2002.29. Herz, J. The switch on the RAPper's necklace. Mol Cell, 23: 451-455, 2006.30. Dedieu, S., Langlois, B., Devy, J., Sid, B., Henriet, P., Sartelet, H., Bellon, G.,Emonard, H., and Martiny, L. LRP-1 silencing prevents malignant cell invasiondespite increased pericellular proteolytic activities. Mol Cell Biol, 28: 2980-2995, 2008.31. Song, H., Li, Y., Lee, J., Schwartz, A. L., and Bu, G. Low-density lipoproteinreceptor-related protein 1 promotes cancer cell migration and invasion byinducing the expression of matrix metalloproteinases 2 and 9. Cancer Res, 69:879-886, 2009.32. Benes, P., Jurajda, M., Zaloudik, J., Izakovicova-Holla, L., and Vacha, J.C766T low-density lipoprotein receptor-related protein 1 (LRP1) genepolymorphism and susceptibility to breast cancer. Breast Cancer Res, 5: R77-81, 2003.33. Montel, V., Gaultier, A., Lester, R. D., Campana, W. M., and Gonias, S. L. Thelow-density lipoprotein receptor-related protein regulates cancer cell survivaland metastasis development. Cancer Res, 67: 9817-9824, 2007.34. Koong, A. C., Denko, N. C., Hudson, K. M., Schindler, C., Swiersz, L., Koch,C., Evans, S., Ibrahim, H., Le, Q. T., Terris, D. J., and Giaccia, A. J. Candidategenes for the hypoxic tumor phenotype. Cancer Res, 60: 883-887, 2000.21

35. Bando, H., Toi, M., Kitada, K., and Koike, M. Genes commonly upregulated byhypoxia in human breast cancer cells MCF-7 and MDA-MB-231. BiomedPharmacother, 57: 333-340, 2003.36. Hu, K., Yang, J., Tanaka, S., Gonias, S. L., Mars, W. M., and Liu, Y. Tissuetypeplasminogen activator acts as a cytokine that triggers intracellular signaltransduction and induces matrix metalloproteinase-9 gene expression. J BiolChem, 281: 2120-2127, 2006.37. Boucher, P. and Gotthardt, M. LRP and PDGF signaling: a pathway toatherosclerosis. Trends Cardiovasc Med, 14: 55-60, 2004.38. Boucher, P., Liu, P., Gotthardt, M., Hiesberger, T., Anderson, R. G., and Herz,J. Platelet-derived growth factor mediates tyrosine phosphorylation of thecytoplasmic domain of the low Density lipoprotein receptor-related protein incaveolae. J Biol Chem, 277: 15507-15513, 2002.39. Yang, M., Huang, H., Li, J., Li, D., and Wang, H. Tyrosine phosphorylation ofthe LDL receptor-related protein (LRP) and activation of the ERK pathway arerequired for connective tissue growth factor to potentiate myofibroblastdifferentiation. Faseb J, 18: 1920-1921, 2004.40. Barnes, H., Ackermann, E. J., and van der Geer, P. v-Src induces Shc bindingto tyrosine 63 in the cytoplasmic domain of the LDL receptor-related protein 1.Oncogene, 22: 3589-3597, 2003.41. May, P., Reddy, Y. K., and Herz, J. Proteolytic processing of low densitylipoprotein receptor-related protein mediates regulated release of itsintracellular domain. J Biol Chem, 277: 18736-18743, 2002.22

42. Zurhove, K., Nakajima, C., Herz, J., Bock, H. H., and May, P. Gammasecretaselimits the inflammatory response through the processing of LRP1.Sci Signal, 1: ra15, 2008.43. von Arnim, C. A., Kinoshita, A., Peltan, I. D., Tangredi, M. M., Herl, L., Lee, B.M., Spoelgen, R., Hshieh, T. T., Ranganathan, S., Battey, F. D., Liu, C. X.,Bacskai, B. J., Sever, S., Irizarry, M. C., Strickland, D. K., and Hyman, B. T.The low density lipoprotein receptor-related protein (LRP) is a novel betasecretase(BACE1) substrate. J Biol Chem, 280: 17777-17785, 2005.44. Kinoshita, A., Shah, T., Tangredi, M. M., Strickland, D. K., and Hyman, B. T.The intracellular domain of the low density lipoprotein receptor-related proteinmodulates transactivation mediated by amyloid precursor protein and Fe65. JBiol Chem, 278: 41182-41188, 2003.23

A abNH2Beaujouin, Figure 14K 14K 34KAsp33Asp231-44 13481 QIDRGVTHLN ISGLKMPRGI AIDWVAGNVY WTDSGRDVIE VAQMKGENRK51 TLISGMIDEP HAIVVDPLRG TMYWSDWGNH PKIETAAMDG TLRETLVQDN101 IQWPTGLAVD YHNERLYWAD AKLSVIGSIR LNGTDPIVAA DSKRGLSHPF151 SIDVFEDYIY GVTYINNRVF KIHKFGHSPL VNLTGGLSHA SDVVLYHQHK201 QPEVTNPCDR KKCEWLCLLS PSGPVCTCPN GKRLDNGTCV PVPSPTPPPD251 APRPGTCNLQ CFNGGSCFLN ARRQPKCRCQ PRYTGDKCEL DQCWEHCRNG301 GTCAASPSGM PTCRCPTGFT GPKCTQQVCA GYCANNSTCT VNQGNQPQCR351 CLPGFLG DRC QYRQCSGYCE NFGTCQMAAD GSRQCRCTAY FEGSRCEVNK401 CSRCLEGACV VNKQSGDVTC NCTDGRVAPS CLTCVGHCSN GGSCTMNSKM451 MPECQCPPHM TGPRCEEHVF SQQQPGHIAS ILIPLLLLLL LVLVAGVVFW501 YKRRVQGAKG FQHQRMTNGA MNVEIGNPTY KMYEGGE PDD VGGLLDADFA551 LDPDKPTNFT NPVYATLYMG GHGSRHSLAS TDEKRELLGR GPEDEIGDPL601 ACOOHCoomassieAutoradiographyBab79K -27K -LRP1b [1-476]cd61K -27K -LRP1b [1-476]e66K -fLRP1b [1-476]27K -Cab43K -27K -52K pro-cath-Dcd43K -27K -APP

Figure 1. Cath-D interacts with the b chain of LRP1 in vitro(A) Sequence of the LRP1b chain interacting with cath-D. Panel a shows aschematic representation of human cath-D. The locations of 4-kDa cath-D profragment,14-kDa light and 34-kDa heavy mature chains are indicated. Theintermediate 48-kDa form (not shown) corresponds to non-cleaved 14 + 34-kDachains. Number 1 corresponds to the first amino acid of the mature cath-D. Theposition of the catalytic aspartic acid is shown.The sequence of the LRP1 b chain is shown in panel b. LRP1 is synthesized as a4544-amino acid precursor that is cleaved into a a chain and a b chain. Thesequence of the b chain is shown, and the amino acids are numbered starting atthe first residue of the b chain. Residues 307-479, which form the cath-D bindingsite, are shown in bold. The trans-membrane sequence is underlined, and thetwo NPXY motifs are in italics.(B) Binding of the full-length extracellular domain of LRP1b to cath-D. The radiolabeled,full-length extracellular domain of LRP1b (1-476) was incubated withglutathione-Sepharose beads containing GST-cath-D/52K, GST-cath-D/34K, GSTcath-D/14K,GST-cath-D/4K, GST-RAP and GST. GST proteins were stained byCoomassie (panels a, c and e). Bound LRP1b (1-476) was detected byautoradiography (panels b, d and f). The input corresponds to the lysate used forthe binding reaction.(C) Binding of pro-cath-D to LRP1b (307-479). Radio-labeled pro-cath-D wasincubated with beads containing GST-LRP1b (307-479) or GST. GST proteinsstained by Coomassie are shown in panels a and c. Bound pro-cath-D (panel b)was detected by autoradiography. APP was used a negative control (panel d).

Beaujouin, Figure 2ABaabF01Coomassie203 239 252 288 324 360 396 431 46516b1718307 348 349 394432 433479F7F419F5383 394F9 349382F10 349 363F11 356 372F12 364 382F13 357 36320F6Autoradiography2122membraneF843K -pro-cath-D27K -cd43K -27K -pro-cath-Derefoldingfrefoldingpro-cath-D

Figure 2. Cath-D binds to residues (349-394) of LRP1b in vitro(A)Schematic representation of LRP1b extracellular domain and GST-LRP1bfragments. In panel a, schematic representation and numbering of EGF-likerepeats 16 to 22 located in the extracellular domain of LRP1b is illustrated. Inpanel b, shorter GST-LRP1b fragments (F4, F6-F8) were derived from GST-LRP1b (307-479) (F0). The F4 (349-394) GST-LRP1b fragment was then subdividedinto shorter fragments (F5, F9-13).(B) Binding of pro-cath-D to GST-LRP1b fragments. Radio-labeled pro-cath-D wasincubated with beads containing GST-LRP1b fragments or GST. GST proteinsbound to beads were stained by Coomassie (panels a, c and e) and bound procath-Dwas detected by autoradiography (panels b, d and f).

Beaujouin, Figure 3Aa52K -48K -CE IP cath-D IP LRP1bIP IgG- Abpro-cath-D34K ---AbbWB cath-D85K -WB LRP1bfibroblastsbreast cancer cellsBaLRP1bbactinCacath-D-/-MEF-cath-D (N° fractions)3 4 5 6 7 8 9 10bHMF (N° fractions)2 3 4 5 6 7 8 9 10cath-D52K -48K -52K -48K -34K -34K -85K -LRP1b85K -

Figure 3. Cath-D interacts with LRP1b in cellulo(A)Co-transfected cath-D and LRP1b co-immunoprecipitate. COS cells weretransiently co-transfected with LRP1b in the presence or the absence of cath-D orD231Ncath-D. Cath-D, LRP1b, and non-immune IgG (control)immunoprecipitations (IP) and cell extracts (CE) were analyzed by anti-cath-D(panel a) and anti-LRP1b (panel b) immunoblotting. Arrows show coimmunoprecipitatedcath-D.(B) Expression of LRP1 in fibroblasts and breast cancer cells. Protein expressionof LRP1b chain is shown in panel a. Whole cell extracts were subjected to SDS-PAGE and immunoblotting with the anti-LRP1b hybridoma. LRP1b transfectedCOS lysate was used as a positive control, LRP1-deficient MEF cells as anegative control, and b actin as a loading control.(C) Co-purification of endogenous LRP1 with cath-D. Panel a shows the copurificationof endogenous LRP1 with cath-D in cath-D-transfected MEFs. Elutedfractions were subjected to SDS-PAGE and immunoblotting with the anti-cath-Dantibody (top panels) and anti-LRP1b hybridoma (bottom panels). Panel b showsthe co-purification of endogenous LRP1 with cath-D in HMF cells treated withcath-D. HMF fibroblasts were incubated for 48h with conditioned mediumcontaining 15 nM of pro-cath-D. HMF cell extracts were purified on an M1G8-coupled column and analyzed by immunoblotting as described in panel a.

Beaujouin, Figure 4Aa b cPMPMPMBa - M6P + M6P bsiRNA Luc LRP1 Luc LRP1C52K48K34K1 2 3 4a52K48KMEF+ M6PLRP1bbactinLRP1-/-LRP1-/-LRP1-/-MEF-B-41siRNALucbsiRNA1LRP1LRP1bMEFccath-D uptake+ M6P (% siLuc)LRP1-/-MEF-B41100806040200*****52K 48K 34Kcath-D forms34K

Figure 5. Silencing LRP1 in cath-D and D231Ncath-D expressing MEFs inhibitsinvasive growth capacities(A) Silencing LRP1 in cath-D expressing MEFs inhibits outgrowth. cath-D-/-MEFcath-Dcells transfected with LRP1 siRNA3 (panels a and c) or Luc siRNA (panelsb and d) were embedded in Matrigel 24 h post-transfection. Phase contrast opticalphotomicrographs (panels a and b), and p-nitrotetrazolium violet stained cells(panels c and d) are shown after 4 days of culture. Data from one representativeexperiment out of 2 are shown. LRP1b expression was monitored 24h posttransfectionof cath-D-/-MEF-cath-D cells with Luc siRNA or LRP1 siRNA3(panel e). Bars, 75 µm.(B) Silencing LRP1 in D231Ncath-D expressing MEFs inhibits outgrowth. cath-D-/-MEF-D231Ncath-D cells transfected with LRP1 siRNA3 (panels a and c) or LucsiRNA (panels b and d) were embedded in Matrigel 24 h post-transfection andanalyzed as described in A.

Beaujouin, Figure 5Aacath-D-/-MEF-cath-DLRP1 siRNA3Luc siRNAbesiRNALucsiRNA3LRP1LRP1bbactincdBacath-D-/-MEF- D231N cath-DLRP1 siRNA3Luc siRNAbesiRNALucsiRNA3LRP1LRP1bbactincd

Figure 1. Cath-D interacts with the b chain of LRP1 in vitro(A) Sequence of the LRP1b chain interacting with cath-D. Panel a shows aschematic representation of human cath-D. The locations of 4-kDa cath-D profragment,14-kDa light and 34-kDa heavy mature chains are indicated. Theintermediate 48-kDa form (not shown) corresponds to non-cleaved 14 + 34-kDachains. Number 1 corresponds to the first amino acid of the mature cath-D. Theposition of the catalytic aspartic acid is shown.The sequence of the LRP1 b chain is shown in panel b. LRP1 is synthesized as a4544-amino acid precursor that is cleaved into a a chain and a b chain. Thesequence of the b chain is shown, and the amino acids are numbered starting atthe first residue of the b chain. Residues 307-479, which form the cath-D bindingsite, are shown in bold. The trans-membrane sequence is underlined, and thetwo NPXY motifs are in italics.(B) Binding of the full-length extracellular domain of LRP1b to cath-D. The radiolabeled,full-length extracellular domain of LRP1b (1-476) was incubated withglutathione-Sepharose beads containing GST-cath-D/52K, GST-cath-D/34K, GSTcath-D/14K,GST-cath-D/4K, GST-RAP and GST. GST proteins were stained byCoomassie (panels a, c and e). Bound LRP1b (1-476) was detected byautoradiography (panels b, d and f). The input corresponds to the lysate used forthe binding reaction.(C) Binding of pro-cath-D to LRP1b (307-479). Radio-labeled pro-cath-D wasincubated with beads containing GST-LRP1b (307-479) or GST. GST proteinsstained by Coomassie are shown in panels a and c. Bound pro-cath-D (panel b)was detected by autoradiography. APP was used a negative control (panel d).

Beaujouin, Figure 6CaLuc siRNA HMF co-cultured on3Y1Ad12/control 3Y1Ad12/cath-DbesiRNALucHMFsiRNA1LRP1LRP1bbactincLRP1 siRNA1 HMF co-cultured on3Y1Ad12/control 3Y1Ad12/cath-DdfLuc siRNAHMFLRP1 siRNA1HMF- NS52Kpro-cath-D

Figure 6. LRP1 is the receptor mediating the cath-D-induced paracrinestimulation of fibroblast outgrowthHMFs transfected with Luc siRNA (panels a, b) or LRP1 siRNA1 (panels c, d) wereembedded 48 h post-transfection in the presence of a bottom layer of 3Y1-Ad12cancer cell lines that did not secrete cath-D (control, panels a and c) or didsecrete human cath-D (cath-D, panels b and d). Panels (a-d) correspond to phasecontrast optical photomicrographs of HMFs after 3 days of co-culture. Data fromone representative experiment out of 3 is shown. LRP1b expression wasmonitored 48h post-transfection and before the co-culture assays (panel e). Procath-Dsecretion was analyzed by immunoblotting after 3 days of co-culture of LucsiRNA (panel f, left panel) or LRP1 siRNA1 (panel f, right panel) transfected HMFswith 3Y1Ad12 control or cath-D-transfected cells. NS = non-specific contaminantprotein. Bars, 75 µm.

Beaujouin, Figure Sup.1cath-D-/-MEF- D231N cath-D (N° fractions)3 4 5 6 7 8 9 1052K -48K -cath-D34K -85K -LRP1bFigure Sup. 1. Co-purification of endogenous LRP1 with D231Ncath-DEluted fractions were subjected to SDS-PAGE and immunoblotting with theanti-cath-D antibody (top panels) and anti-LRP1b hybridoma (bottom panels).

Beaujouin, Figure Sup. 2cath-D-/-MEF-cath-DLRP1 siRNA4aLuc siRNAbesiRNALucsiRNA4LRP1LRP1bbactincdFigure Sup. 2. Silencing LRP1 in cath-D expressing MEFs inhibitsinvasive growthcath-D-/-MEF-cath-D cells transfected with LRP1 siRNA4 (panels a andc) or Luc siRNA (panels b and d) were embedded in Matrigel 24 h posttransfection,and analyzed as described in the legend to Figure 6A.

Beaujouin, Figure Sup. 3Luc siRNA HMF co-cultured ona3Y1Ad12/controlb3Y1Ad12/cath-DeHMFsiRNALucsiRNA2LRP1LRP1bbactincLRP1 siRNA2 HMF co-cultured on3Y1Ad12/control 3Y1Ad12/cath-DdfLuc siRNAHMFLRP1 siRNA2HMF- NS52Kpro-cath-DFigure Sup. 3. LRP1 silencing in HMF fibroblasts prevents cath-D-induced outgrowthHMF fibroblasts transfected with Luc siRNA (panels a, b) or LRP1 siRNA2 (panels c, d)were embedded 48h post-transfection in the presence of a bottom layer of 3Y1-Ad12cancer cell lines secreting either no cath-D (control, panels a and c) or human cath-D (cath-D, panels b and d). Phase contrast optical photomicrographs of HMF fibroblasts after 3days of co-culture are shown in panels a-d. HMF cells were transfected with Luc siRNA orLRP1 siRNA2 and LRP1b expression was monitored 48h post-transfection and before theco-culture assays (panel e). Pro-cath-D secretion was analyzed after 3 days of co-cultureof Luc (panel f, left panel) or LRP1 (panel f, right panel) siRNA HMF fibroblasts with3Y1Ad12/control or 3Y1Ad12/cath-D cells by immunoblotting. NS = non-specificcontaminant protein. Bars, 75 µm.

RésuméLaspartyl protéase cathepsine D, surexprimée et hyper-sécrétée par les cellulesépithéliales cancéreuses mammaires est un facteur de mauvais pronostic des cancers du sein etstimule la prolifération des cellules cancéreuses et la formation des métastases. Elle affecteégalement le micro-environnement tumoral en induisant la croissance invasive desfibroblastes. Les travaux de léquipe ont montré que le LDL-receptor related protein 1, LRP1,est le récepteur fibroblastique de la cathepsine D. LRP1 est fortement exprimé par lesadipocytes. Les études cliniques indiquent que lobésité est un facteur de risque dans denombreux cancers, dont le cancer du sein chez la femme ménopausée.Dans cette thèse, nous avons étudié le rôle de la cathepsine D et du LRP1 dans les adipocytes,type cellulaire prédominant du micro-environnement tumoral mammaire. Nos résultatsindiquent une surexpression de la cathepsine D et du LRP1 dans le tissu adipeux humain etmurin obèse. De plus, lexpression de la cathepsine D est augmentée pendant ladifférenciation adipocytaire. Finalement, lextinction de lexpression de la cathepsine D et duLRP1 inhibe ladipogenèse indiquant leurs rôles clefs dans ce processus.Lensemble de ces résultats suggère que la cathepsine D et son récepteur LRP1 pourraient êtredes cibles thérapeutiques potentielles dans le traitement de lobésité.Mots-clésAdipocytes, cancer du sein, cathepsine D, LRP1, micro-environnement tumoral, obésité.Laboratoire daccueilINSERM U896 cathepsines, autophagie et cancerInstitut de Recherche en Cancérologie de Montpellier208 rue des apothicaires34298 Montpellier France100