CHUNG, SOONKYU, Ph. D. Mechanisms by Which Conjugated ...
CHUNG, SOONKYU, Ph. D. Mechanisms by Which Conjugated ...
CHUNG, SOONKYU, Ph. D. Mechanisms by Which Conjugated ...
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
Immunoblotting and 4MUrea-SDS-PAGE<br />
Immunoblotting was conducted as we previously described (Brown et al. 2004)<br />
using NuPage precasted gels (Invitrogen, Carlsbad, CA). To resolve PPARγ phospho-<br />
proteins, total cells extracts (75 ug protein) were subjected to 10% SDS-PAGE<br />
(acrylamide:bisacrylamide ratio was 100:1) containing 4 M urea and to electrophoresis at<br />
80 V for 20 h. Separated proteins were subsequently transferred to PVDF membranes and<br />
immunoblotted with a monoclonal PPARγ antibody (Santa Cruz Inc, Santa Cruz, CA).<br />
The abundance of PPARγ was quantified from exposed X-ray flim using the KODAK<br />
image station 440 (Eastman Kodak Co).<br />
[2- 3 H deoxyglucose] Uptake<br />
Basal and insulin-stimulated glucose uptakes were measured as we described<br />
previously (Chung et al. 2005).<br />
RNA Isolation and PCR<br />
Total RNA was isolated from the cultures using Tri Reagent according to<br />
manufacturer’s protocol for RT-PCR. 0.5 ug of total RNA from each RNA sample was<br />
used with the One-Step RT-PCR kit (Qiagen, Valencia, CA). Primer sets for aP2 were<br />
previously described (Brown et al. 2003). Primer sequences for Pref-1 (accession<br />
# NM_003836) were forward (5’TACGAGTGTCTGTGCAAGC), reverse (5’<br />
ACACAAGAGATAGCGAACACC) and running conditions were 37 cycles of 95 ◦ C for<br />
30 sec, 56 ◦ C for 30 sec, 72 ◦ C for 30 sec.<br />
98