CHUNG, SOONKYU, Ph. D. Mechanisms by Which Conjugated ...

More documents

Recommendations

Info

Conditioned medium from above the cell monolayer was collected at 0, 3, 6, 12, or 24 h, centrifuged at 12,000 g for 20 min to remove cell debris, and kept at -80°C before analysis. Cultures were washed twice with ice-chilled HBSS and cells harvested and dedicated for protein determination. IL-6 and IL-8 secretion to the medium was quantified using a commercial ELISA (R&D System) following the manufacturer’s protocol and normalized to the protein content of the monolayer. To measure IL-6 and IL-8 secretion from human subcutaneous adipose tissue explants, 500 mg pieces of adipose tissue obtained per subject were each minced into ~100 fragments as described by Fried et al. (Fried et al. 1993). Each minced explant was then preincubated in DMEM-Ham’s F12 (1:1) medium containing 100 U/ml penicillin, 100 U/ml streptomycin, 50 ug/ml gentamicin, and 0.25 mg/ml amphotercin-B at 37°C overnight. Then, explants were transferred to 10 ml of fresh medium containing either BSA vehicle or 30 µM trans-10, cis-12 CLA in culture tubes. Subsequently, conditioned medium was collected after 8, 24, or 72 h of incubation with treatments and stored at - 80°C until analysis. IL-6 and IL-8 secretion were quantified by ELISA. Relative RT-PCR Total RNA was isolated from the cultures using Tri Reagent (Molecular Research Center Inc., Cincinnati, OH) following the manufacturer’s protocol. Relative (semi- quantitative) RT-PCR was carried out using One-step RT-PCR kit (Qiagen Inc) as we described previously (Brown et al. 2003). Primer sets for adipose fatty acid binding protein (aP2) were previously described (Brown et al. 2003). Primer sequences for IL-6 59
were (accession #NM000600) sense (5’CCAGCTATGAACTCCTTCTC), antisense (5’GCTTGTTCCTCACATCTCTC), and running conditions for IL-6 were 26 cycles at 94°C for 30 s, 57°C for 30 s, and 72°C for 30 s. The running conditions for gene-specific primers for TNF-α (Ambion #5345) were 40 cycles at 94°C for 30 s, 57°C for 30 s, and 72°C for 1 min. Immunofluorescence Microscopy and Phase Contrast Image Cells were cultured on coverslips for immunofluorescence microscopy and stained as described previously (Brown et al. 2004; Chung et al. 2005). For phospho-IKK immunostaining, cells were permeablized with 0.1% saponin and then incubated with a 1:10 dilution of rabbit-anti-phospho-IKK overnight at 4°C. After three vigorous washes, coverslips were incubated with 1:200 dilutions of FITC-conjugated anti-rabbit IgG for 1 h (Fig 3.4C). For NFκB p65 and aP2 double staining (Fig 3.5), cells were initially incubated with a 1:10 dilution of NFκB p65 for 12 h at 4°C followed by incubation with a 1:500 dilution of Cy3-conjugated anti-mouse IgG. After adequate washing, coverslips were incubated with a 1:200 dilution of aP2 for 2 h at room temperature followed by incubation with a 1:400 dilution of FITC-conjugated anti-rabbit IgG for 1 h. Fluorescent images were captured with a SPOT digital camera mounted on an Olympus BX160 fluorescence microscope. Cy3-labelled siGLO fluorescent and phase contrast images were captured without fixation under the Olympus IX60 microscope equipped with a SPOT digital camera (Fig 3.8B). For PPARγ immunostaining (Fig 3.8E), transfected cells grown on coverslips were permeablized with 0.1% Triton X-100 on ice for 10 min 60
Page 1 and 2:
CHUNG, SOONKYU, Ph. D. Mechanisms b
Page 3 and 4:
MECHANISMS BY WHICH CONJUGATED LINO
Page 5 and 6:
APPROVAL PAGE This Dissertation has
Page 7 and 8:
I also would like to thank The Univ
Page 9 and 10:
IV. PREADIPOCYTES MEDIATE LPS-INDUC
Page 11 and 12:
LIST OF FIGURES ix Page Figure 1.1.
Page 13 and 14:
Figure 4.7. LPS-induced NFκB activ
Page 15 and 16:
in animals and some humans (reviewe
Page 17 and 18:
CLA is potentially effective in: 1)
Page 19 and 20:
Anti-adipogenic Mechanisms of CLA T
Page 21 and 22: 2005). Chapter II of this dissertat
Page 23 and 24: Figure 1. 2. Multiple mechanisms by
Page 25 and 26: In contrast, studies conducted in a
Page 27 and 28: activation. Similarly, Chen et al.
Page 29 and 30: Central Hypothesis and Specific Obj
Page 31 and 32: CHAPTER II TRANS-10, CIS-12 CLA INC
Page 33 and 34: of MEK/ERK signaling by trans-10, c
Page 35 and 36: Materials and Methods Materials All
Page 37 and 38: the cultures for additional 12 h. A
Page 39 and 40: precipitated with ethanol, dried, a
Page 41 and 42: or for 30 min with 10 µM isoproter
Page 43 and 44: either 30 µM cis-9, trans-11 CLA o
Page 45 and 46: dependent effects of CLA on the pho
Page 47 and 48: Rapamycin Blocks CLA’s Increase i
Page 49 and 50: Figure 2. 2. Trans-10, cis-12 CLA a
Page 53 and 54: Figure 2. 6. Trans-10, cis-12 CLA i
Page 55 and 56: Figure 2. 8. Trans-10, cis-12 CLA-i
Page 57 and 58: Discussion Feeding mixed CLA isomer
Page 59 and 60: in lipolysis may occur via an ERK-d
Page 61 and 62: espectively, by the MEK inhibitor U
Page 63 and 64: Furthermore, the CLA-mediated incre
Page 65 and 66: proteins. Inhibition of NFκB activ
Page 67 and 68: Sopasakis et al. 2004) and insulin
Page 69 and 70: antibodies for anti-glyceraldehydre
Page 71: pM of human insulin in the presence
Page 75 and 76: Transfection efficiency was examine
Page 77 and 78: treatment (Brown et al. 2004), we d
Page 79 and 80: myotubes (Sinha et al. 2004; Weiger
Page 81 and 82: controls was found in cytosol (Fig
Page 83 and 84: Depletion of NFκB p65 by RNAi Atte
Page 85 and 86: eports of cytokine-mediated insulin
Page 87 and 88: Figure 3. 2. Trans-10, cis-12 CLA i
Page 91 and 92: Figure 3. 6. Trans-10, cis-12 CLA-i
Page 93 and 94: Figure 3. 8. Specific depletion of
Page 95 and 96: Figure 3. 10. Working model: Trans-
Page 97 and 98: Based on our working model (Fig 3.1
Page 99 and 100: mRNA levels of TNF-α (Fig. 3). How
Page 101 and 102: humans (Riserus et al. 2004a), and
Page 103 and 104: most likely not impairing the diffe
Page 105 and 106: 1) decreased adipogenic gene expres
Page 107 and 108: adipocytes from WAT in inflammation
Page 109 and 110: differentiation, cultures of SV cel
Page 111 and 112: Immunoblotting and 4MUrea-SDS-PAGE
Page 113 and 114: activity was measured using the Dua
Page 115 and 116: macrophages and myocytes, respectiv
Page 117 and 118: cultures, insulin’s stimulation o
Page 119 and 120: AD90 cultures treated with LPS. Con
Page 121 and 122: Table 4.1. List of human-gene speci
Page 123 and 124:
Figure 4.2. Primary cultures of new
Page 125 and 126:
Figure 4.4 LPS induction of cytokin
Page 127 and 128:
Figure 4. 6. LPS suppresses PPARγ
Page 129 and 130:
Figure 4. 8. Inhibitors of NFκB at
Page 131 and 132:
Discussion Adipose tissue is a sour
Page 133 and 134:
To determine if non-adipocytes othe
Page 135 and 136:
attenuation of insulin sensitivity
Page 137 and 138:
epression of NFκB target gene expr
Page 139 and 140:
EPILOGUE The “Obesity epidemic’
Page 141 and 142:
Apart from our initial goal for thi
Page 143 and 144:
Concerning membrane specific recept
Page 145 and 146:
esearch topic I would like to exami
Page 147 and 148:
Berg, A.H., Lin, Y., Lisanti, M.P.,
Page 149 and 150:
Chen, C., Koh, A.J., Datta, N.S., Z
Page 151 and 152:
Diradourian, C., Girard, J., and Pe
Page 153 and 154:
Granlund, L., Juvet, L.K., Pedersen
Page 155 and 156:
Imamura, M., Inoguchi, T., Ikuyama,
Page 157 and 158:
Loscher, C.E., Draper, E., Leavy, O
Page 159 and 160:
Piper, R.C., Hess, L.J., and James,
Page 161 and 162:
Sinha, S., Perdomo, G., Brown, N.F.
Page 163 and 164:
Vanden Berghe, W., Vermeulen, L., D
show all

CHUNG, SOONKYU, Ph. D. Mechanisms by Which Conjugated ...

Create successful ePaper yourself

Delete template?

Save as template?