CHUNG, SOONKYU, Ph. D. Mechanisms by Which Conjugated ...

were (accession #NM000600) sense (5’CCAGCTATGAACTCCTTCTC), antisense
(5’GCTTGTTCCTCACATCTCTC), and running conditions for IL-6 were 26 cycles at
94°C for 30 s, 57°C for 30 s, and 72°C for 30 s. The running conditions for gene-specific
primers for TNF-α (Ambion #5345) were 40 cycles at 94°C for 30 s, 57°C for 30 s, and
72°C for 1 min.
Immunofluorescence Microscopy and Phase Contrast Image
Cells were cultured on coverslips for immunofluorescence microscopy and stained
as described previously (Brown et al. 2004; Chung et al. 2005). For phospho-IKK
immunostaining, cells were permeablized with 0.1% saponin and then incubated with a
1:10 dilution of rabbit-anti-phospho-IKK overnight at 4°C. After three vigorous washes,
coverslips were incubated with 1:200 dilutions of FITC-conjugated anti-rabbit IgG for 1
h (Fig 3.4C). For NFκB p65 and aP2 double staining (Fig 3.5), cells were initially
incubated with a 1:10 dilution of NFκB p65 for 12 h at 4°C followed by incubation with a
1:500 dilution of Cy3-conjugated anti-mouse IgG. After adequate washing, coverslips
were incubated with a 1:200 dilution of aP2 for 2 h at room temperature followed by
incubation with a 1:400 dilution of FITC-conjugated anti-rabbit IgG for 1 h. Fluorescent
images were captured with a SPOT digital camera mounted on an Olympus BX160
fluorescence microscope. Cy3-labelled siGLO fluorescent and phase contrast images
were captured without fixation under the Olympus IX60 microscope equipped with a
SPOT digital camera (Fig 3.8B). For PPARγ immunostaining (Fig 3.8E), transfected cells
grown on coverslips were permeablized with 0.1% Triton X-100 on ice for 10 min
60