CHUNG, SOONKYU, Ph. D. Mechanisms by Which Conjugated ...

More documents

Recommendations

Info

Immunofluorescence Microscopy and Phase Contrast Images Cells were cultured on coverslips for immunofluorescence microscopy and stained as described previously (Brown et al. 2004). For perilipin immunostaining, cells were fixed with 3.7% paraformaldehyde in phosphate buffered saline (PBS) for 20 min, then coverslips were blocked and quenched in PBS containing 0.1% saponin, 10 mM glycine and 1.25 mg/ml rabbit IgG for 1 h. Immunodetection was carried out by incubating cells with 1:400 dilution of goat-anti perilipin antiserum for 6 h followed by three washes with PBS. Coverslips were then incubated with 1:200 dilution of Rhodamine red conjugated rabbit anti-goat IgG for 1 h (Fig 2.1). For perilipin and ADRP double staining, coverslips were blocked again with PBS containing 1.25 mg/ml goat IgG and incubated with 1:50 dilution of a mouse-anti ADRP for 12 h followed by addition of a fluorescein isothiocyanate-conjugated secondary antibody (1:100 dilution of FITC-goat anti-mouse IgG). After adequate washing with PBS, fluorescent image were captured with a SPOT digital camera mounted on an Olympus BX60 fluorescence microscope. Phase contrast images were captured using a SPOT digital camera mounted on an Olympus IX60 microscope. RNA Isolation and Real Time qPCR Total RNA extraction. Total RNA was isolated from the cultures using Tri Reagent (Molecular Research Center, Inc, Cincinnati, OH) according to the manufacturer’s protocol. RNA was extracted with phenol / 1-bromo-3-chloropropane (BCP), and 25
precipitated with ethanol, dried, and resuspended in H2O. Contaminating genomic DNA was removed by treatment with DNase (DNA-free; Ambion). Real-time qPCR. First strand cDNA synthesis and real time quantitative PCR were carried out using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) as previously described (Brown et al. 2003). Primer sets for perilipin and TATA binding protein (TBP) have previously been described (Brown et al. 2004). Primer sets for HSL were (accession # NM_005357) sense (5’aagtgggcgcaagtccc), antisense (5’gcgcatcggctctgctat), and for ADRP were (accession # NM_001122) sense (5’gctgagcacattgagtcacgtac), antisense (5’ctgagtcaggttgcgggc). Statistical Analysis Lipolysis data are expressed as the mean ± S.E. representing 16 independent observations from four different human subjects. Data were analyzed using one-way analysis of variance (ANOVA), followed by each pair student’s t-tests for multiple comparisons. Differences were considered significant if p < 0.05. All analyses were performed using JMP IN v4.04 (SAS Institute; Cary, NC) software. Results Trans-10, cis-12 CLA Acutely Increases Lipolysis To determine the isomer-specific influence of CLA on lipolysis, [ 14 C]-oleic acid was preloaded into SV cultures containing newly differentiated human adipocytes, allowing esterification of radio-labeled oleic acid into TG. The release of [ 14 C]-oleic acid 26
Page 1 and 2: CHUNG, SOONKYU, Ph. D. Mechanisms b
Page 3 and 4: MECHANISMS BY WHICH CONJUGATED LINO
Page 5 and 6: APPROVAL PAGE This Dissertation has
Page 7 and 8: I also would like to thank The Univ
Page 9 and 10: IV. PREADIPOCYTES MEDIATE LPS-INDUC
Page 11 and 12: LIST OF FIGURES ix Page Figure 1.1.
Page 13 and 14: Figure 4.7. LPS-induced NFκB activ
Page 15 and 16: in animals and some humans (reviewe
Page 17 and 18: CLA is potentially effective in: 1)
Page 19 and 20: Anti-adipogenic Mechanisms of CLA T
Page 21 and 22: 2005). Chapter II of this dissertat
Page 23 and 24: Figure 1. 2. Multiple mechanisms by
Page 25 and 26: In contrast, studies conducted in a
Page 27 and 28: activation. Similarly, Chen et al.
Page 29 and 30: Central Hypothesis and Specific Obj
Page 31 and 32: CHAPTER II TRANS-10, CIS-12 CLA INC
Page 33 and 34: of MEK/ERK signaling by trans-10, c
Page 35 and 36: Materials and Methods Materials All
Page 37: the cultures for additional 12 h. A
Page 41 and 42: or for 30 min with 10 µM isoproter
Page 43 and 44: either 30 µM cis-9, trans-11 CLA o
Page 45 and 46: dependent effects of CLA on the pho
Page 47 and 48: Rapamycin Blocks CLA’s Increase i
Page 49 and 50: Figure 2. 2. Trans-10, cis-12 CLA a
Page 51 and 52: Figure 2. 4. Trans-10, cis-12 CLA a
Page 53 and 54: Figure 2. 6. Trans-10, cis-12 CLA i
Page 55 and 56: Figure 2. 8. Trans-10, cis-12 CLA-i
Page 57 and 58: Discussion Feeding mixed CLA isomer
Page 59 and 60: in lipolysis may occur via an ERK-d
Page 61 and 62: espectively, by the MEK inhibitor U
Page 63 and 64: Furthermore, the CLA-mediated incre
Page 65 and 66: proteins. Inhibition of NFκB activ
Page 67 and 68: Sopasakis et al. 2004) and insulin
Page 69 and 70: antibodies for anti-glyceraldehydre
Page 71 and 72: pM of human insulin in the presence
Page 73 and 74: were (accession #NM000600) sense (5
Page 75 and 76: Transfection efficiency was examine
Page 77 and 78: treatment (Brown et al. 2004), we d
Page 79 and 80: myotubes (Sinha et al. 2004; Weiger
Page 81 and 82: controls was found in cytosol (Fig
Page 83 and 84: Depletion of NFκB p65 by RNAi Atte
Page 85 and 86: eports of cytokine-mediated insulin
Page 87 and 88: Figure 3. 2. Trans-10, cis-12 CLA i
Page 89 and 90:
Figure 3. 4. Trans-10, cis-12 CLA a
Page 91 and 92:
Figure 3. 6. Trans-10, cis-12 CLA-i
Page 93 and 94:
Figure 3. 8. Specific depletion of
Page 95 and 96:
Figure 3. 10. Working model: Trans-
Page 97 and 98:
Based on our working model (Fig 3.1
Page 99 and 100:
mRNA levels of TNF-α (Fig. 3). How
Page 101 and 102:
humans (Riserus et al. 2004a), and
Page 103 and 104:
most likely not impairing the diffe
Page 105 and 106:
1) decreased adipogenic gene expres
Page 107 and 108:
adipocytes from WAT in inflammation
Page 109 and 110:
differentiation, cultures of SV cel
Page 111 and 112:
Immunoblotting and 4MUrea-SDS-PAGE
Page 113 and 114:
activity was measured using the Dua
Page 115 and 116:
macrophages and myocytes, respectiv
Page 117 and 118:
cultures, insulin’s stimulation o
Page 119 and 120:
AD90 cultures treated with LPS. Con
Page 121 and 122:
Table 4.1. List of human-gene speci
Page 123 and 124:
Figure 4.2. Primary cultures of new
Page 125 and 126:
Figure 4.4 LPS induction of cytokin
Page 127 and 128:
Figure 4. 6. LPS suppresses PPARγ
Page 129 and 130:
Figure 4. 8. Inhibitors of NFκB at
Page 131 and 132:
Discussion Adipose tissue is a sour
Page 133 and 134:
To determine if non-adipocytes othe
Page 135 and 136:
attenuation of insulin sensitivity
Page 137 and 138:
epression of NFκB target gene expr
Page 139 and 140:
EPILOGUE The “Obesity epidemic’
Page 141 and 142:
Apart from our initial goal for thi
Page 143 and 144:
Concerning membrane specific recept
Page 145 and 146:
esearch topic I would like to exami
Page 147 and 148:
Berg, A.H., Lin, Y., Lisanti, M.P.,
Page 149 and 150:
Chen, C., Koh, A.J., Datta, N.S., Z
Page 151 and 152:
Diradourian, C., Girard, J., and Pe
Page 153 and 154:
Granlund, L., Juvet, L.K., Pedersen
Page 155 and 156:
Imamura, M., Inoguchi, T., Ikuyama,
Page 157 and 158:
Loscher, C.E., Draper, E., Leavy, O
Page 159 and 160:
Piper, R.C., Hess, L.J., and James,
Page 161 and 162:
Sinha, S., Perdomo, G., Brown, N.F.
Page 163 and 164:
Vanden Berghe, W., Vermeulen, L., D
show all

CHUNG, SOONKYU, Ph. D. Mechanisms by Which Conjugated ...

Create successful ePaper yourself

Delete template?

Save as template?