Gene Cloning

Bioinformatics 243
A8.1. The triplet codon ATG represents methionine in DNA, however in RNA
thymine is replaced by uracil so that the RNA codon that encodes methionine
is AUG.
Q8.2. What do the codons UAA, UAG and UGA encode?
A8.2. These codons do not code for an amino acid, they signal the end of the
part of a gene that is translated into protein; they are referred to as stop
codons.
Q8.3. Why are three alternative translations given below the sequence in
Figure 8.2?
A.8.3. Because the genetic code uses three nucleotides to encode each amino
acid, there are three possible places where you can begin to translate a
sequence; these are called the three forward reading frames.
Q8.4. Are the three alternative translations given in Figure 8.2 the only possible
translations of this sequence?
A8.4. No, there are also three reverse reading frames. Remember that DNA
consists of two anti-parallel complementary strands, the translations shown
in Figure 8.2 are from one of these strands, and it is just as likely that genes
will be present on the other strand. In order to look at the reverse frames you
need to read the reverse complement of the DNA sequence and then translate
it.:
5′tcagacaagaaccattcgagagtcgggtctgtttgcggtttgcctagcaccatgcgcggt3′
-1 SerAspLysAsnHisSerArgValGlySerValCysGlyLeuProSerThrMetArgGly
-2 GlnThrArgThrIleArgGluSerGlyLeuPheAlaValCysLeuAlaProCysAla
-3 ArgGlnGluProPheGluSerArgValCysLeuArgPheAlaEndHisHisAlaArg
Q8.5. How many amino acids would you expect a protein to consist of if it
was encoded by a 100 nucleotide stretch of DNA?
A8.5. Because the genetic code uses triplet codons, 100 nucleotides could
potentially encode 33 amino acids.
Q8.6. Can you think of any circumstances in which a functioning gene
would not show a pattern of codon usage typical of that of the organism
from which the DNA was cloned?
A8.6. There are a number of such circumstances. Genes encoded on pathogenicity
islands (Section 2.9) and other regions acquired by horizontal transfer
of genetic material show patterns of codon usage typical of the organism
from which they originate rather than the current host organism. Also, while
there is strong evolutionary pressure on genes which are expressed at high
levels to use the codons for which there are plenty of tRNAs, the selective pressure
is not so strong on the sequence of genes which are expressed at low levels;
these are often seen to diverge from the norm in their codon usage.