Maternal variation in Huichol and Mixtec populations from Mexico

TARTU UNIVERSITY
FACULTY OF SCIENCE AND TECHNOLOGY
INSTITUTE OF MOLECULAR AND CELL BIOLOGY
DEPARTMENT OF EVOLUTIONARY BIOLOGY
Tatjana Tsõpova
Maternal variation in Huichol and Mixtec populations from Mexico
Bachelor thesis
Supervisors
M.Sc Erika Tamm
Ph.D Ene Metspalu
TARTU 2012

TABLE OF CONTENTS
ABBREVIATIONS .................................................................................................................... 3
Definition of basic terms used in the thesis: ............................................................................... 3
INTRODUCTION ...................................................................................................................... 4
1. LITERATURE OVERVIEW ................................................................................................. 5
1.2 Mitochondrial molecular clock ......................................................................................... 6
1.3 Phylogenetic studies ......................................................................................................... 7
1.4 World mtDNA haplogroups ............................................................................................. 8
1.5 Native American mtDNA haplogroups ............................................................................ 8
1.4 Migration theories .......................................................................................................... 10
1.5 Minor founders ............................................................................................................... 11
1.6 Middle America .............................................................................................................. 12
2. EXPERIMENTAL STUDY ................................................................................................. 15
2.1 Aims of this study ........................................................................................................... 15
2.2 Materials and methods .................................................................................................... 16
2.2.1 Samples .................................................................................................................... 16
2.2.2 DNA amplification .................................................................................................. 16
2.2.3 Product purification ................................................................................................. 17
2.2.4. Sequencing reactions .............................................................................................. 18
2.2.5 Statistical analysis ................................................................................................... 19
2.3. RESULTS AND DISCUSSION ........................................................................................ 21
2.3.1. Phylogenetic network ................................................................................................. 21
2.3.2. C4c haplogroup .......................................................................................................... 29
CONCLUSIONS ...................................................................................................................... 33
KOKKUVÕTE ......................................................................................................................... 34
References ................................................................................................................................ 37
SUPPLEMENTARY MATERIALS ........................................................................................ 45
2

ABBREVIATIONS
bp - base pair
D-loop - displacement loop
HVS - Hypervariable Segment
LGM - Last Glacial Maximum
MRCA - Most Recent Common Ancestor
mtDNA - Mitochondrial DNA
SNP - Single Nucleotide Polymorphism
nps - nucleotide position
PCR - polymerase chain reaction
ybp - years before present
BIM - Beringian incubation model
aDNA - ancient DNA
Definition of basic terms used in the thesis:
Haplotype- a specific mitochondrial genotype defined by a characteristic collection of
mtDNA polymorphisms
Haplogroup- a group of similar haplotypes, that share a common ancestor
LGM- a period in the Earth's climate history when ice sheets were at their maximum
extension, between 26,500 and 19,000–20,000 years ago
3

INTRODUCTION
For decades mitochondrial DNA is being used in human phylogenetic studies, letting us to
reveal the evolutionary relationships between populations. Based on the mtDNA mutational
pattern, all living people can be divided into different maternal lineages, which are generally
geographically specific. The lineages` distribution pattern, frequency and diversity can tell us
a lot about human migrations.
The Americas were the last continents reached by modern humans. Although studies for
understanding the peopling process of the Western Hemisphere have lasted for decades, it still
is intriguing subject. Long time it was accepted that Clovis people were the first inhabitants of
the Americas. Now, with new archaeological findings and accumulating genetic variation data
with higher resolution, the Clovis-First model has been challenged. The questions have
remained open.
The less studied American region is Middle America. Being an important barrier for the gene
flow between North and South America, this region represents the most ethnic and language
diversity of the continent. Continuously, most studies of Native Americans mtDNA in this
region are based on the analysis of its control region; yet only high resolution analysis can
provide sufficient information into the early population history of Native Americans.
This study is part of a larger project, which aim is to understand the peopling process of
Americas through analysing valuable ancient DNA data and genetic variation in
contemporary population in high resolution. The purpose of present study is to characterize
maternal variability of two indigenous populations from Mexico – Huichols and Mixtecs.
4

1. LITERATURE OVERVIEW
1.1 Mitochondrial DNA
Mitochondria are organelles that play an essential role in the biological activity of every
eukaryotic cell. Mitochondrion has its own DNA different from nucleus genome. Human
mitochondrial DNA (mtDNA) is a small, 16,569 base pairs (bp) long, circular, doublestranded
molecule, which encodes for 37 genes (Anderson et al., 1981; Andrews et al., 1999)
(Figure 1). The genome is very compact thanks to the absence of introns and the lack of
Figure 1. Human mtDNA genetic map. Genes that are transcribed from H (heavy)-strand are
shown on the outer side of the circle, those that are transcribed from the L (light)-strand are
positioned inside the circle. Genome encodes 12S and 16S rRNA genes, 22 tRNA genes and
13 respiratory chain complexes genes (ND 1-6 and L4 of complex I, Cyt b of complex III,
COX 1-3 subunits of cytochrome oxidase of complex IV, and the ATP 6 and ATP 8 of
complex V). MtDNA replication origins and transcription promoters are shown by the arrows.
Origin: www.mitomap.org
5

noncoding sequences between the genes (Anderson et al., 1981). The only noncoding region
is the displacement loop (D-loop), or control region. It is a 1,121 bp sequence that is involved
in mtDNA replication and transcription. D-loop is the most polymorphic segment of mtDNA
(Aquadro and Greenberg, 1983; Stoneking et al., 1991). All polymorphisms in D-loop are
concentrated in 3 hypervariable regions (HVS) (Vigilant et al., 1989): HVS- I (nps 16024-
6365), HVS- II (nps 73-340) and HVS- III (nps 438-576). recent common ancestor (MRCA),
or “mitochondrial Eve”. Secondly, the high copy number of mtDNA per cell (Alberts et al.,
1989; Bogenhagen and Clayton, 1974) makes easy to use it in laboratory research, and also
recover it from ancient biological material in sufficient quantities. Finally, mtDNA is
characterized by rapid evolution rate due to the lack of protective proteins, ineffective DNA
reparation system, as well as the high concentration of oxidative radicals in the mitochondrion
(Clayton, 1982; Richter et al., 1988). In comparison with nuclear DNA, mtDNA nucleotide
substitution rate is 5 to 10 times higher and it is estimated 2-4% per site per million years
(Brown et al., 1979; Wilson et al., 1985). And it is even higher (to 10 times) in the control
region hence the presence of HVS sequences (Parsons et al., 1997). This entirely makes
mtDNA an effective marker for evolutionary studies at recent levels of divergence (Avise et
al., 1987).
1.2 Mitochondrial molecular clock
The molecular dating technique is an additional tool that can define the timeline of human
evolution if the archaeological or fossil records cannot provide thus. The basis for molecular
clock hypothesis is that mutations tend to accumulate in DNA sequence at relatively constant
rate. Estimates of the average rate at which human mtDNA mutates are very variable and
depend on the data and methods used for estimation. There are two main methods used: the
pedigree and the phylogenetic methods. The pedigree method is based on the comparing of
parent/offspring pairs or analyzing mtDNA sequences of individuals from a deep-rooted
genealogy (Heyer et al., 2001). The phylogenetic method is based on the reconstruction of the
haplotype of the MRCA from a sample with minimum two genetic lineages. For estimation of
human mutation rate usually the ancestral haplotype of the human-chimpanzee common
ancestor is reconstructed (Henn et al., 2009). The pedigree-based rates are much higher (to 10
times) than those obtained by using phylogenies (Forster et al., 1996; Howell et al., 2003).
6

One of the reasons may be, that pedigree method estimates mutation rate only on the depth of
few generations, while the phylogeny uses timescale of thousands or millions of years. That is
why the phylogenetic method is more widely used in studying population formation and
human migrations. The problem is that molecular clock is not linear- mutations appear with
different rates, because of the hyper-variability of control region, potential influence of
purifying selection for coding region and repeated occurrence of mutations in one site
(mutational saturation) (Howell et al., 2003). Lately the issue has been tried to be solved.
Loogväli et al. consider in calibration only synonymous mutations (Loogväli et al., 2009).
Soares et al., take into account both coding and control regions, but applying the correction
for purifying selection (Soares et al., 2009). In phylogenetic researches of the whole
mitochondrial genomes mutation rate of 1 transition per 3624 years is mostly used (Soares et
al., 2009).
1.3 Phylogenetic studies
In phylogenetic studies mtDNA is used for showing genetic relationships among human
ethnic groups. Phylogenetic analysis is based upon the comparison of mtDNA within and
between populations. First mtDNA diversity researches were based on analyzing single
nucleotide polymorphisms (SNP) determined by restriction fragment length polymorphism
(RFLP) analysis, and on the analysis of the control region. Nowadays the sequencing of
whole mitochondrial genome is becoming more and more popular, because the information
that we get with it is more precise and let us watch deeper into human maternal phylogeny
(Torroni et al., 2006).
MtDNA variety is due to accumulated mutations and their fixation with genetic drift. According
to them, the world-wide mtDNA variations form different lineages, or haplotypes. Haplotypes,
that share common ancestor, having particular SNPs, form haplogroup. The main haplogroups
are marked with capital letters (A-Z), first by Antonio Torroni and colleagues (Torroni et al.,
1993), and are further divided to subclades. Haplogroups are geographically specified: certain
haplogroups are found only in certain parts of the world.
7

1.4 World mtDNA haplogroups
The most common way to represent phylogenetic relations is to reconstruct phylogenetic trees
of mtDNA lineages. In the root of the global mtDNA tree is the „mitochondrial Eve“, who
lived approximately 150,000-200,000 years before present (ybp) (Ingman et al., 2001; Soares
et al., 2009), which is very close to the age of the earliest modern humans estimated from
fossil data ~195,000 ybp (McDougall et al., 2005). This MRCA gave rise to exclusively
African major haplogroups L0-6. Only one of them, haplogroup L3, is shared by Africans
with the rest of the world (Vigilant et al., 1991; Chen YS et al., 1995; Brown, 1980). In
addition to other branches, In addition to others branches, L3 gave rise to macro-haplogroups
M, N, and N subgroup R, which are ancestors of all non-African mtDNA lineages. The
founding ages of the corresponding root types of M, N and R clades are very similar, about
60,000 years (Macaulay et al., 2005), raising the possibility that M and N haplogroups are
derived from a single African migration, which took place ~ 65,000-70,000 ybp from eastern
Africa (Forster, 2001; Soares et al., 2009;). The haplogroup N (including R) has spread all
over Eurasia, in contrast to haplogroup M, which is found in Eastern Eurasia but is virtually
absent in Europe (Metspalu et al., 2004). Macro-haplogroup M gave rise to different M
haplogroups (M1-M25) and to haplogroups D, C, E, G, Q and Z. Macro-haplogroup N gave
rise to haplogroups A, I, O, S, W, X and Y. From haplogroup R derive haplogroups B, F, J, H,
K, P, T, HV, V, and U.
As confirms the archaeological data, already by 40,000 ybp modern humans were in southern
Siberia and by 30,000 ybp have spread to the arctic Siberia (Goebel, 1999; Pitulko et al.,
2004). The data when humans moved from Asia to America is still debatable, but this could
happen between 30,000 and 13,000 ybp (Goebel et al., 2008).
1.5 Native American mtDNA haplogroups
America was the last continent reached by anatomically modern humans. In early studies,
based on RFLP analysis and through sequencing of the HVS-I region, 4 distinct haplogroup
clusters were recognized, initially named A, B, C and D (Schurr et al., 1990; Torroni et al.,
1993); the X haplogroup was identified a few years later (Brown et al., 1998). Today they are
termed as A2, B2, C1, D1 and X2a haplogroups (Achilli et al., 2008; Perego et al., 2009;
Tamm et al., 2007). The study of complete Amerindian mtDNA sequences has allowed
investigators to examine mtDNA variation in the Americas with much greater resolution.
8

Figure 2. Diagnostic markers of Native Americans mtDNA lineages. Characteristic
mutational positions are relative to rCRS and marked with red. Origin: modified Perego et al.,
2010.
9

Thus, the new American maternal lineages were recognized, leading the number of founding
lineages from 4 to 15: A2*, A2a, A2b, B2, C1b, C1c, C1d*, C1d1, C4c, D1, D2a, D3,
Dd4h3a, X2a and X2g (Achilli et al., 2008; Tamm et al., 2007; Fagundes et al., 2008; Perego
et al., 2009, 2010; Malhi et al., 2010; Hooshiar Kashani et al., 2012). The defining mutations
for all 15 haplogroups are present in Figure 2.
Haplogroups A2, B2, C1 (including it subgroups) and D1 are called major pan-American
founder haplogroups because of their frequency and the distribution pattern all over the
Americas. The rest are the minor founding haplogroups, which are present in a lower quantity
and are geographically restricted.
1.4 Migration theories
Although in the last decade the studies of Native American mtDNA have shed light to
population movements into the Western Hemisphere, the arrival time(s), the migration routes
and number of expansion events in the Americas remain controversial.
After the discovery of the Clovis culture in New Mexico in 1929, there has for many years
been a predominant hypothesis among archaeologists, that Clovis people were the first
inhabitants of the Americas, living 11,500-10,900 ybp (Haynes et al., 1992, 2005). Clovis was
the first well-established human culture in the Americas. The Clovis-first theory was
supported with the discovery of a number of other Clovis sites in wide area from Southern
Canada to Mexico, possibly to Southern America (Pearson and Ream, 2005). However, there
have been found other ancient sites which indicated human presence in the Americas much
earlier, for example: the Monte-Verde site in Chile with the estimated age of ~14,600 ybp
(Dillehay, 2008), the Meadowcroft Rockshelter in Pennsylvania dating to 22,000-18,000 ybp
(Adovasio and Pedler, 2004), the Buttermilk Creek Complex in Texas which shows that
people already lived in North America 15,500 ybp (Waters et al., 2011). Findings over the
past few years and a re-examination of old ones have convincingly shown that humans were
present in the Americas before Clovis culture arose. Pre-Clovis occupation model is in
agreement with genetic data.
The high diversity level and the distribution pattern of the major Pan-American haplogroups
together with their similar coalescence time estimates, has been used to support a singlemigration
model (Forster et al.,1996; Bonatto and Salzano, 1997; Merriwether et al., 1995).
10

According to it, only one small group of people came from Asia to Beringia - a landbridge
connecting Asian and American continents during the cold periods due to lowered see level -
where it probably settled before the eventual expansion into the Americas, (Tamm et al.,
2007; Fagundez et al., 2008). The „Beringian incubation model“ (BIM) (Tamm et al., 2007)
and its variants (Bonatto and Solzano, 1997; Kitchen et al., 2008; Mulligan eta al., 2008)
point out that American founding population could have reached Beringia by 30,000 ybp,
supporting this with the evidence of the earliest human habitation signs in Yana Rhinoceros
Horn Site in Northeastern Siberia (Pitulko et al., 2004). The founding populations remained in
Beringian refugium for ~5,000-15,000 ybp leading to the separation of the American founder
lineages from their Asian sister-clades. The autochthonous patterns of variation within the
continental founder haplogroups testifies that after the retreat of the ice-sheets the expanding
populations colonized the double continent around 14,000-16,000 ybp with a very rapid speed
(Tamm et al., 2007; Kitchen et al., 2008; Mulligan eta al., 2008).
The analysis of maternal variability in higher resolution (completely sequenced mitochondrial
genomes), have revealed greater number of American founder haplogroups. Their
distribution, frequency and age make us to reconsider the number and migrations routes into
the Americas.
1.5 Minor founders
Minor haplogroups A2a, A2b, D2a and D3 are restricted in arctic regions of the Siberia,
Alaska, the Canada and the Greenland (Torroni et al, 1993; Helgason et al., 2006; Derenko et
al., 2007; Tamm et al., 2007; Gilbert et al., 2008; Derbeneva et al., 2002; Volodko et al.,
2008; Saillard et al., 2000; Starikovskaja et al., 2005). The proposed reason for the presence
of partly different sub-haplogroups in arctic populations is that they diversified in Beringia
after the initial migration into the Americas had occurred (Tamm et al., 2007).
Recent years, a single-migration model of first humans coming to the North America through
the ice-free corridor, is being changed to the other one: first Americans (Paleo-Indians)
dispersal along the deglaciated Pacific coastline (Schurr and Sherry, 2004; Dillehay, 2008;
Goebel et al., 2008; Gilbert et al., 2008). The theory is strongly supported by genetic evidence
(founder haplogroups are autochthonous over continent) and archaeological discoveries (e.g.
Monte-Verde site in Chile). The Pacific coastline migration model was confirmed while
11

studying minor haplogroup D4h3a (Perego et al., 2009). Haplogroup D4h3a is spread only
along the Pacific coast of the continent, with a higher frequency in the South America. The
coalescence age of D4h3a is in agreement with the age when pan-American haplogroups
started their distribution all over both Americas. Thus D4h3a had rapidly with the others
founders migrated from Beringia along the Pacific coast (Perego et al., 2009). However, now
the genetic studies have revealed an existence of both simultaneous routes (Perego et al.,
2009; Haashiar Kashani et al., 2011).
The X2a and recently determined C4c haplogroups share a very similar phylogeography and
coalescence age estimates. X2a is restricted to northern North America, without any samples
found in south of USA. C4c is also distributed in North America, except two individuals from
Columbia. Both haplogroups have higher frequency in the Great Plains region. The estimated
age of C4c is 13,800 ± 3,800 ybp and the age of X2a is 18,600 ± 5,500 ybp, which is similar
when taking into account the standard errors. The contrasting distribution pattern of these two
rare haplogroups with D4h3a leads to a conclusion that there have been two migration paths -
X2a and C4c arrived to North America through an ice-free corridor between Laurentide and
Cordilleran ice sheets, while D4h3 was carried to southward along coastal migration (Perego
et al., 2009; Haashiar Kashani et al., 2011).
1.6 Middle America
Middle America, in a broad meaning, represents territories from the North to the South
America. It comprises the Southwestern USA, Mexico (including the Mesoamerica) and the
Central America, sometimes also Northeastern part of South America is included. The
Southwestern USA, Central America and Northeast of South America are geographic areas,
while the Mesoamerica is defined as a linguistic and cultural region, which extends from
middle southern Mexico to Costa Rica (because Mesoamerica is largely overlapping with
Central America, henceforth I will use term Mesoamerica also inferring to Central America)
(Figure 3). Although geographically close, northern and southern parts of Middle America
have had different roles in shaping population variation in this region.
Mesoamerica has been seen as geographical barrier between North and South Americas. It
played an important role during the colonization of the Americas, restricting the gene flow
between North and South America and thus shaping the diversity of founder haplogroups on
12

their way down to the South America (Sandoval et al., 2009). It has been suggested that the
migration of the first Paleo-Indians was rapid, probably moving along Pacific coast. The first
settlers inhabited the unoccupied land, diversified creating local variation, but had minimum
contacts later. This is exemplified in genetic pattern where diversity is very high, but most
mtDNA lineages are largely population specific. Mesoamerica has also one of the richest
linguistic and ethnic diversities of the (Nichols et al., 1990). In present day Mexico, which
covers most of the Mesoamerica, has eleven language families including 291 living languages
(Inali 2007). Such great language diversity on relatively small territory like Mesoamerica
supports the previous ideas for formation of population structure. The already occupied land
in narrow territory was the barrier for later migrations coming from northward. This explains
the pattern of distribution of some mtDNA haplogroups (e.g. X2a and C4c).
Figure 3. Map showing the Mesoamerica, Central America and Middle America regions.
.
Northern part of Middle America is genetically more closely connected to North America
than to Central and South America (Sandoval et al., 2009). This could be due to later
migrations, for example driven by the spread of agriculture. Archaeological findings confirm
that maize was domesticated in Mesoamerica ~7,000-6,000 ybp (Pohl et al., 2007) from
where it was introduced to US Southwest by 4,000 ybr (Merrill et al., 2009). However, the
search for identical sequences between Mexico and US shows that the connection cannot be
located with a certain regions. Haplogroup B is frequent and with clear star-like structure in
13

American Southwest indicating recent expansion in this region. It is hypothesied that later
migrations and expansions have blurred the pre-existing mtDNA structure, at least in this
region, and provides us to see preexisting mtDNA structure (Kemp et al., 2010).
Today inhabitants of Mexico and Mesoamerica could be divided into mainly two distinct
groups: mestizos (individuals with recent admixed ancestry) and native indigenous groups.
Although mestizos represent nearly 95% of total population, the Native American component
is highly prevalent in their gene pool. It varies by region depending of recent postcolonisational
demographic history, but generally maternal component could be up to 100%
Native American while paternal is mostly European.
14

2. EXPERIMENTAL STUDY
2.1 Aims of this study
This study is a part of the TÜMRI Evolution Department co project together with Dr. Eske
Willerslev from the Copenhagen laboratory. The aim of the project to research human ancient
remains, found in New Mexico, which are representatives of Clovis culture. Our partners
make an ancient DNA (aDNA) analysis, using autosomal and mitochondrial DNA. The
mission of our laboratory is to create a base system for the research for future data
comparison. This includes the high-resolution analysis of mtDNA and autosomal
chromosomes of Mexico extant populations. aDNA researches are still in progress, and the
results are not yet available.
The aim of the present study is to describe the mtDNA variety of two indigenous populations
from Middle America, Huichols and Mixtecs:
1. To determine mitochondrial haplogroups and haplotypes.
2. To compare these populations with the published data and describe them in the context of
maternal genetic variation of Middle America.
3. To make a full sequence analysis for possibly interesting Native American haplotypes.
15

2.2 Materials and methods
2.2.1 Samples
The samples used in this study were collected from 2 indigenous populations (Mixtec, n=29
and Huichol, n=15) from Mexico and kindly provided to us through prof. Eske Willerslev.
Mixtecs are indigenous ethnic group that is localised in the middle South Mexico (Oaxaca,
Guerrero and Puebla states). Mixtec language belongs to Otomanguean language family and
there are about half a million speakers.
Huichol is indigenous population in the Northwest Mexico (Nayarit, Jalisco, Zacatecas, and
Durango states). The number of extant Huichol people is ~26,000. Huichol languge belongs
to Uto-Aztecan language family.
It is commonly accepted that all haplogroup-s A, B, C and D variants found in Americas can
be referred as American sub-lineages A2, B2, C1 and D1. However, the data from only HVS
regions cannot differentiate Native American specific haplogroups from their closest Asian
neighbours.
In this study, firstly, haplogroup of each sample was determined through sequencing control
region HVSI and II regions (nps 16024-684). Then, defining coding region markers specific
for Native American haplogroups and subhaplogroups were checked (Figure2).
One Huichol sample was completely sequenced with 24 overlaping fragments.
2.2.2 DNA amplification
Amplification reactions were performed using a thermocycler „Biometra UNO 11“.
PCR was carried out in 25 μl volume:
17-18 μl distillate water
5 μl 5x FIREPol ® Master Mix Ready to Load (with 12.5 mM MgCl 2 )
0.5 μl F primer (10 pmol/μl)
0.5 μl R primer (10 pmol/μl)
1-2 μl template DNA (10pmol/μl)
16

To determine possible contamination, negative control was added to every experiment.
Primers used for PCR for HVS1, 2, coding region and full sequence are listed in
Supplementary materials (Suppl. Table 1.1, 1.2 and 3 accordingly).
PCR programme for control-region and SNP checking:
* primary denaturation 94ºC 1min30s
* denaturation 94ºC 15s
* primer annealing 56(52) ºC 30s 36-38 cycles
* primer extension 72 ºC 1-2min
* final extension 72 ºC 2-4min
Annealing temperature and number of cycles depend on primer specificity and quality of
template DNA. Primer extension time depends on the sequence length (1000bp~1min).
PCR products were visualized in 1,5 % agarose gel electrophoresis with ethidium bromide
staining.
2.2.3 Product purification
Before sequencing, the amplified products were purified for to remove all the residual primers
and unincorporated nucleotides (dNTP). 1 μl of purifying mixture was added to every
product:
0,9 μl SAP (Shrimp alkaline phosphatase) (1U/μl)
0,1 μl ExoI (Exonuclease I) (1U/μl)
Purification programme:
* dNTP dephosphorylation and degradation of one-strand DNA 37ºC 20min
* inactivation of enzymes 80ºC 15min
17

2.2.4 Sequencing reactions
The amplicons were used as templates in cycle sequencing reactions using the BigDye R
Terminator v3.1 Cycle Sequencing Ready Reaction Kit.
Sequencing reactions were carried out in 10 μl volume:
4,65 μl distillate water
2 μl Sequencing buffer 5x
1,6 μl primer (1pmol/μl)
0,75 BigDye (BigDye R Terminator v3.1 Cycle Sequencing Ready Reaction Kit)
1 μl DNA product
Primers used for sequencing reactions for HVS1, 2, coding region and full mitochondrial
genome are listed in Supplementary materials (Suppl. Table 2.1, 2.2 and 3 accordingly).
BigDye programme:
* primary denaturation 94ºC 1min
* denaturation 94ºC 15s
* primer annealing 50-58ºC 10s 30-32 cycles
* extension 60ºC 1min
Annealing temperature and number of cycles depend on primer specificity and quality of
template DNA.
Ethanol Precipitation of Sequencing Reactions
* product+ 2 μl dextran + 30 μl 96% ethanol hold at -20ºC for 10min
* centrifuge 10min x 13000rmp remove supernatant
* add 200 μl 70% ethanol
* centrifuge 5-7min x 13000 rmp remove supernatant
(* add 200 μl 70% ethanol)
( * centrifuge 5-7min x 13000 rmp remove supernatant)
18

* let dry at 37ºC for 5 min
*add 10 μl formamide
hold at room tºC
* suspend load on the sequencing plat
The reaction products were sequenced with an Applied Biosystems ABI 3730xl 96-capillary
DNA analyzer.
2.2.5 Statistical analysis
Mutations were scored relative to the revised Cambridge Reference Sequence (rCRS)
covering the nucleotide positions 16024- 680 (Andrews et al., 1999). For DNA sequence
assembly and analysis software Sequencer 4.10.1 was used. Each deviation was confirmed by
manual checking on electropherogrammes. For reconstructing phylogenetic networks
Network (version 4.6.1.0) and Network Publisher (version 1.1.0.7) software were used
(Bandelt et al., 1999).
Haplogroup frequencies for Middle American populations are based on HVS I data and are
combined from current study and literature. They are shown in Figure 4. The detailed
information for frequencies and references are in Supplementary materials (Suppl. Table1).
For network analysis in addition to present study 658 published sequences from USA
Southwest and Mexico populations were used (Table 1). The data was provided by Dr. Brian
M. Kemp and has been previously published (Kemp et al., 2010). We restricted our haplotype
analysis with this data to include samples where both, HVS 1 and 2, are available to increase
the resolution of analysis. The location of populations and their language families from Kemp
et al., 2010 are shown in Table1.
Median-joining haplotype networks were constructed separately for haplogroups A2, B2, C1
and D1. The X haplogroup data was removed from the analysis, because it did not occur in
my analysed samples. The positions nps 16519, 16188.1, 16193.1, 16193.2, 309.1, 309.2,
309.3, 315.1, 573.1, 573.2, 573.3, 573.4 were removed from the analysis because of their
recurrent nature.
19

Table 1. The sample size, location and language families of populations used in network
analysis.
Populatsions
N
Language
Family Location Country References
Mixe 49 Mixe-Zoguean Mesoamerica Mexico Kemp et al., 2010
Mixtec 65 Otomanguean Mesoamerica Mexico Kemp et al., 2010
Mixtec 29 Otomanguean Mesoamerica Mexico present study
Zapotec 72 Otomanguean Mesoamerica Mexico Kemp et al., 2010
Cora 72 Uto-Aztecan Mesoamerica Mexico Kemp et al., 2010
Huichol 56 Uto-Aztecan Mesoamerica Mexico Kemp et al., 2010
Huichol 15 Uto-Aztecan Mesoamerica Mexico present study
Nahua-Atopcan 44 Uto-Aztecan Mesoamerica Mexico Kemp et al., 2010
Nahua-Cuetzalan 29 Uto-Aztecan Mesoamerica Mexico Kemp et al., 2010
Zuni 30 Isolate Southwest USA Kemp et al., 2010
Jemez 59 Kiowa-Tacoan Southwest USA Kemp et al., 2010
Akimel
O´odham 56 Uto-Aztecan Southwest USA Kemp et al., 2010
Tohono
O´odham 38 Uto-Aztecan Southwest USA/Mexico Kemp et al., 2010
Tarahumara 55 Uto-Aztecan Southwest Mexico Kemp et al., 2010
Hualapai 54 Yuman Southwest USA Kemp et al., 2010
Initial network construction for haplogroup A, B and C revealed a large amount of reticulation
(even with the removal of the poly-C and poly-A stretches). The reticulations on the networks
are probably caused by mutational hotspots. In order to minimize the reticulations the
differential weighting of mutational positions was perform. A weight of 1, 4 or 10 was chosen
according to mutational occurrence in larger dataset (Soares et al., 2009), giving the lowest
value (1) to highly mutable positions. In haplogroup B were deleted mutations at nps 310, 146
and 152, because repeated occurrence and backmutations causing a lot of reticulations.
20

2.3 RESULTS AND DISCUSSION
2.3.1 Phylogenetic network
All Mixtec and Huichol samples belong to American founder haplogroups A2, B2, C1 and
D1, with the exception of one Huichol belonging to minor haplogroup C4c.
The Southwest, Mesoamerica and Central America haplogroups frequencies in different
populations are shown in Figure 4. In the Mesoamerica dominates haplogroup A, while in the
Central America and in the Southwest the haplogroup A is less exposed, or even almost
absent like in the Southwestern USA (e.g. Zuni, Akimel O´odham, Jemez, Hualapai
populations). In several Mexican populations there has also not been found haplogroup A
(Cochimi, Delta Yuman, River Yuman populations), but they a considered closer to
Southwest. The haplogroup B is more frequent in the Southwest and Central America, than in
Mesoamerica. The haplogroup C frequency is relatively low in comparison with A and B
haplogroups, but is mostly exhibit in the Southwest and Cental America. The D haplogroup is
with the smallest frequency, but is found in small amount in some Mesoamerica, Southwest,
and in one Central America population. Haplogroup X is found only in Jemez and Navajo
populations from the Southwestern USA with really small frequency. The rare haplogroup
D4h3 is detected in one Tarahumara population from the North Mexico.
Present study of Mixtec and Huichol populations revealed results close to the published one.
The Mixtecs mostly exhibit haplogroup A (62%), which is a little different from the
previously published data (72%) (Kemp et al., 2010; Torroni et al., 1994; Sandoval et al.,
2009). Haplogroup B frequency is similar between published and present study (17%),
haplogroup C frequencies vary from 14% (present study) to 7% (published) (Kemp et al.,
2010; Torroni et al., 1994; Sandoval et al., 2009). The haplogroup D frequencies are low: 7%
and 3% accordingly. A little variety among both data is probably due to the small number of
samples studied. The haplogroup X was not found in Mixtec population.
The Huichol mostly exhibit haplogroup B (47%), which is close to previously studied Huichol
haplogroup B frequency (53%). The population exhibits less haplogroup A (33% and 31%
from both data). The haplogroup C frequency is only 16% and 20% accordingly. The
haplogroup D and haplogroup X are absent in Huichol population.
21

Figure 4. The location of the populations used in this study and deception of their
mitochondrial haplogroup frequencies. H The detailed Table 4 in Supplementary materials
shows, the sample saize from every population, the haplogroup frequencies, the population
location, and the languge family.
The networks are shown in Figures 5-8. 358 mitochondrial haplotypes were identified among
the 701 sequences. The majority of haplotypes are population specific or shared between
geographically close populations. The networks are star-like and there is no clear pattern with
nested structure there some populations would stem from others. This indicates that variation
arose in situ from founder haplogroups – very common pattern observed in Native American
mtDNA studies.
The haplogroup A network contains 118 haplotypes. The network is star-like, with several
reticulations. Reticulations propose possible different phylogenetic connections between
haplotypes. Because HVS regions are highly mutable we cannot say exactly how branches are
evolutionary connected in reticulations without coding region markers. Interestingly, only
four samples are positioned in the central node (1 Hualapai, 1 Zuni and 2 Zapotecs) showing
22

that populations have gone through diversification. Hg A is more frequent in Mesoamerican
populations. One bigger node is defined by nps 16111, which comprises geographically close
populations from different language families (Cora, Mixtec, Huichol, Zapotec, Nahua
Atopcans). The sub-clade defined by 153 comprises populations of more distant geographic
and linguistic origin (from Mexico Nahua-Atopcan, Nahua-Cuetzalan, Zapotec and
Tarahumara, from Southwestern USA Tohono O´odham and Zuni). However, such cluster
could be due to hypervariable mutation at nps 153. The Mixtec and Huichol populations from
present study and Kemp et al.2010, mostly share common haplotypes with each other, or with
geographically close Cora, Zapotec and Mixtec populations.
The haplogroup B network contains 151 haplotypes. The network is star-like, with a lot of
sole branches. Haplogroup B is presented mostly in the populations of the Southwestern USA.
The biggest node, defined by 16483 and 16111 has been previously connected with
population expansion in Southwest (Kemp et al., 2010, Malhi et al., 2003). The node is starlike
and comprises all populations from Southwest and Tarahumaras and Huichols.
Tarahumaras and Coras are shown to be intermediate between Southwest and Mesoamerica.
Interestingly, Coras are more distantly related to others than Huichols. The same is with
branch defined by 16186. Huichols claime themselves to come from North-Central Mexico
(Paez-Riberos et al., 2006 and references therein). Possible, they could be more related to the
centre of expansion of haplogroup B. The branch with 195 and 16261 mutations connects
Southwest populations with Coras, Mixtecs and Huichols. This could be another branch
destifieng expansion of haplogroup B, but due to backmutation in nps 195 its not evident if
these samples are phylogenetically related.
Interestingly, Huichol and Mixtec samples from this study and Kemp et al., 2010 represent
different haplotypes. This could be the effect of small sample size and collecting samples
from different locations.
The haplogroup C network contains 75 haplotypes. There is three sub-branches of haplogroup
C1. C1b is clearly divided from the rest sub-clades with defining nps 493. The characteristic
HVS mutations for C1d are 16051 and 194. Only three Huichols, one Nahua Cuetzalan and
Akimel O´odham share these mutations. All the rest samples are likely C1c. We checked the
C1c defining mutation 15930 of our Huichol and Mixtec samples. Except one Huichol with
493, all others harbour this mutation and cluster with Tarahumaras into branch with nps 215.
Generally, C1 sub-haplogroups have geographically specific branches and prevalently not
23

shared between Southwest and Mesoamerica. Iterestingly, Tarahumaras only have C1c and
Zapotecs C1b sub-clades.
The haplogroup D network contains 14 haplotypes. The branches are long enough to assume
that they separated long time ago. The network is specific to populations with the absent of
variability. This is most likely because of the small number of samples, or low D haplogroup
requency.
24

Figure 5. Haplogroup A haplotype network. The central node exhibits the following
mutations relative to rCRS (Andrews et al., 1999): 16111, 16223, 16290, 16319, 16362,
00064, 00073, 00146, 00153, 00235, and 00263. Mutational positions from this haplotype are
noted in small print. The colour scheme:Yellow stands for the Mecixo populations, blue
stands for the Southwestern USA. Dark green stands for Mixtec population from Kemp et al.,
2010, light green stands for Mixtec population studied in the present study. Pink colour stands
for Huichol population from Kemp et al., 2010. Darker pink stands for Huichol population
studied in the present study.
25

Figure 6. Haplogroup B haplotype network. The central node exhibits the following
mutations relative to rCRS (Andrews et al., 1999): 16111, 16223, 16290, 16319, 16362,
00064, 00073, 00146, 00153, 00235, and 00263. Mutational positions from this haplotype are
noted in small print. The color scheme is the same as for the haplogroup A network.
26

Figure 7. Haplogroup C haplotype network. The central node marked with blue, exhibits the
following mutations relative to rCRS (Andrews et al., 1999): 16223, 16298, 16325, 16327,
00073, 00249d, 00263, 00290d, and 00291d. Mutational positions from this haplotype are
noted in small print. The color scheme is the same as for the haplogroup A network.
27

Figure 8. Haplogroup D1 haplotype network. The green node in the middle, which indicates
the Mixtecs, is chosen to be the central node. It exhibits the following mutations relative to
rCRS (Andrews et al., 1999): 16223, 16325, 16362, 00073 and 00263. Mutational positions
from this haplotype are noted in small print. The color scheme is the same as for the
haplogroup A network.
28

2.3.2 C4c haplogroup
One Huichol individual was determined to belong to extremely rare C4c haplogroup. C4c has
been reported so far only in North America and two samples in Ijka population from
Colombia. To determine the phylogenetic relationship with previously published data the
mitochondrial genome of the Huichol sample was completely sequenced. Phylogenetic tree
construction was performed following a maximum parsimony approach. It was built using
newly determined full mtDNA genome and 16 previously published sequences. They
included: 1 by Tamm et al. (2007), 1 by Malhi et al. (2010) and 14 by Hooshiar Kashani et al.
(2011) (Figure 9).
Figure 9. The map of populations where is found C4c haplogroup. With the green colour are
shown the Canadian Native American populations. Red spots represent 12 populations from
the USA. The present study Huichol population`s location is marked with violet. With the
grey colour are marked populations determined by the HVS region analysis to carry C4c
haplogroup: the Kickapoo population from Cansas city, Oklahoma, USA; the Cherokee from
North Carolina, USA; the Chippewa from the Great Lakes, Canada; and the Oneota site,
Illinois, USA. Origin: modified from Hooshiar Kashani et al., 2011
The phylogenetic tree of C4c haplogroup is seen on Figure4. The haplogroup C4c is
characterized by the following mutations: 2232 insertion, 14433 and 15148. All haplotypes
(except one Canadian, one American and one Columbian) are clustered into C4c1 subclade by
29

the defining transition at nps 1243. The Huichol haplotype has a reversion at position 1243,
but according to the nps at 15629 and 16241, it is positioned to belong to C4c1a subclade of
C4a1 subhaplogroup. It also has unique SNP at 9938 position and a transversion at nps 11861.
The coalescent age estimates for C4c and C4c1 haplogroups were calculated by Rho (ρ)
statistics. The calculations were performed on all substitutions excluding the 16182C,
16183C, 16194C and 16519 mutations. Mutational distances were converted into years using
the corrected molecular clock proposed by Soares et al., (2009).
The average distance (ρ) of the haplotypes from the root of C4c haplogroup was 5,059 with
the standard error (σ) of 1,1. This corresponds to a divergence time of 13,500 ± 5,900 years
according to Soares et al., 2009. The estimated time for C4c1, with ρ=3,84 and σ=0,8,
corresponds to a divergence time of 10,200 ± 4,300 years.
The determination of a founder micro-haplogroup C4c in the Central American population
can lead to several conclusions. The distribution pattern of two minor-haplogroups X2a and
C4c is very similar (especially in comparison with D4h3), except the presence of two
Columbian C4c and one newly determined Mexican C4c samples south from United States.
The coalescence ages of both X2a and C4c founders are also similar, which supports the idea
that these two lineages arrived together from the Beringia through ice-free corridor after LGM
(Hooshiar Kashani et al., 2011; Perego et al., 2009). The frequencies of C4c and X2a
nowadays are very low. Because the C4c frequency in an ancient Oneota site in Western
Illinois could have reached ~8,3% (Stone and Stoneking, 1998), it is possible that the
frequencies of X2a and C4c might be higher, and their geographic distribution could have
been wider than today (Hooshiar Kashani et al., 2011). Because of the mtDNA sensibility to
genetic drift, it is possible that X2a lineages were more widely spread, but have gone through
extinction and X2a is not present and C4c is extremely rare in modern populations from south
of the USA. However, X2a and C4a could also have gone through, at least partly, separate
demographic events.
The newly sequenced Huichol belongs to C4c1a subclade (defining mutations 15629 and
16241) together with three Cherokee from North Carolina and Oklahoma (Figure 10). This
shows that Huichol is more closely connected with the North America than with the South
America, as it is previously described for Mexican Native Americans (Sandoval et al., 2009).
However, Huichol sample differs from them by its unique mutations: 1243 reversion, SNP at
30

N
12705s 16223
R
73 11719s
R0
14766ns
HV
2706~r 7028s
H
1438~r
H2
4769s
H2a
263 315+C 750~r
8860ns 15326ns
rCRS
8701ns 9540s 10398ns
489 10400s
4715s 7196As 8584ns
10873s 15301s L3 14783s 15043s M
15487Ts 16298 M8
249d
CZ
3552As 9545s 11914s
13263s 14318ns 16327
C
6026s 11969ns 16325 522-523d
15204ns 16519 290-291d
C4 C1
2232+A~r 144433ns 15148s
13,535 (7,630-19,628)
C4c
10,189 (5,956-14,525) 1243~r
C4c1 !73
96
16189
105-110d
16193+C 114
15629s 189
16241
473
C4Cab
!1438~r
1719~r
15523s
195 C4c1a
16183C
7084ns 310d !315+C
980~r (16193.1)+C 13674s 5460ns
!10873s
1007~r !1243 14208ns 13781ns 6911s
C4c2 11440s
1413~r 11821s 9938 16203 14311s 207 7043s 8296s 13368s
14180ns 12397ns 11861T 16354 16362 16265C 8027ns 7064s 16362 13153ns 16111Y 16245
ShuswapCherokeeCherokee Huichol Ijka
Sioux Chippewa Ottawa/ Chippewa Sioux unknown Metis Metis unknown Canada USA Creek Mexico USA USA Chippewaunknown USA USA Canada Canada USA Colombia
USA USA
unknown
Cherokee USA
Creek
USA unknown
USA
Figure 10. Phylogeny of complete mtDNA sequences belonging to C4c (one novel and 16
previously published). The basal motif of Native American Haplogroup C1 is also included.
All mutations shown on the branches are transitions unless specified. The prefix “!” indicates
reversion, while the suffixes designate: transversions (A, C, G, T), deletions (d), insertions
(+), gene locus (~, r), synonymous or nonsynonymous changes (s or ns), T/C heteroplasmy
(Y). The A/C stretch length polymorphism in regions 16180–16193 and 303–315, 522–523
and mutation 16519, all known to be hypervariable, were disregarded for tree reconstruction.
The geographical locations of the samples (when known) are identified with colours: green-
Canada, red- USA, violet- Mexico, and yellow- Columbia. The coalescent ages of C4c and
4c1 are indicated with red color.
31

nps 9938 and 11861 transversion, proposing that Huichol has separated from Cherokee a time
ago and obtained its own variability.
The analysis by Malhi et al. (2001) provides the HVS regions data of two Southwest
populations: Cherokee and Kickapoo. Eight individuals out of 31 Cherokee as well as one
individual out of five Kickapoo have a mutation at position 16241 with possible C4c
background, thus potentially belonging to a C4c1a subclade (Malhi et al., 2001). The
Kickapoo population extends to North Mexico (Figure3). Curiously, Huichol traditions
maintain that they came from the North-Centre of Mexico in the state of San Luis Potosi to
their current location in Nayarit Mountains. Thus, the high resolution analysis is needed to
detect whether there are really more populations carrying C4c haplogroup and whether, in
particular, Kickapoo belong to C4c1a subclade, which would allow us to suppose the
migration of this founder haplogroup from the North to the South.
32

CONCLUSIONS
Mitochondrial DNA has been widely used in phylogenetic studies. Its unique qualities like
uniparental inheritance, relatively high mutation rate, lack of recombination and possibility to
use for age estimations allow us to follow maternal lineages back in time and make
conclusions for demographic histories of populations.
America was the last continent inhabited by anatomically modern humans. For decades
scientists have tried to find answers to questions for peopling process of Western Hemisphere
using anthropological, archaeological and genetic data. During the last years new
archaeological findings confirm that humans arrived to Americas earlier than previously
thought. Also, accumulating data of mtDNA genetic variation with higher resolution show
that the diversity of founder populations was higher and more complex. These discoveries
have raised new hypothesis and questions for the migration process.
Middle America is connecting land-bridge between North and South America with
exceptionally high ethnic and language diversity. This region has been considered a barrier
for migrations from north to south. The aim of the present study was to describe maternal
variability of two indigenous populations, Huichols and Mixtecs, from this region.
All analysed samples belonged to characteristic Native American haplogroups. The analyse of
HVS region haplotypes confirmed previously published results, that haplotypes from this
region are specific for populations or mostly shared with geographical neighbours.
Interestingly, for example in haplogroup B, Huichols and Mistexs from this and previous
study did not share common haplotypes, indicating that large enough sample sizes are
necessary to capture true genetic variation.
One Huichol was determined to belong to haplogroup C4c. This is exceptional finding as
frequency of C4c is extremely low and C4c has been detected only in North America and in
one Colombian population. The complete mitochondrial genome was sequenced to
characterise the position of Huichol C4c lineage in phylogenetic tree. Huichol C4c sample
belongs to the same branch with native populations of North America. This finding confirms
that nations from North Mexico are more closely related to North than South America and
shows a possible migration way.
33

KOKKUVÕTE (SUMMARY IN ESTONIAN)
MtDNA on leidnud laia kasutust inimese evolutsiooni uuringutes. Tänu oma unikaalsetele
omadustele nagu uniparentaalne pärandumine, kõrge mutatsioonide tekkimise kiirus ja
rekombineerumise puudumine, võime jälgida emaliinide ajalugu ning teha järeldusi
populatsioonide demograafilise arengu kohta.
Ameerika oli viimane kontinent, kuhu jõudis kaasaegne inimene. Juba aastakümneid on
teadlased antropoloogiliste, arheoloogiliste ja geneetiliste meetoditega püüdnud leida vastust
küsimustele kust, millal ja mitme lainena esimesed inimesed tulid Ameerikasse ning kuidas ja
mis suundades toimusid migratsioonid üle kontinendi. Kaua aega arvati, et Clovise kultuuri
esindajad olid esimesed kaasaegsed inimesed Ameerika mandril. Uued arheoloogilised leiud
aga kinnitavad, et inimene jõudis Ameerikasse varem. Seda toetavad ka viimaste aastate
geneetilise varieeruvuse analüüsid. Suurema resolutsiooniga läbi viidud uurimused on
näidanud, et põlis-ameeriklaste emaliinide varieeruvus on palju suurem ning kompleksem kui
algselt arvati. Sellised avastused on tekitanud uued küsimused asustamise protsessi kohta.
Käesolev töö on osa suuremast projektist, mille eesmärk on uurida arheoloogilistelt
uuringutelt leitud iidse inimese DNA-d ning suure resolutsiooniga kaasaegse inimese
populatsioone, et tuua selgust Ameerika asustamise protsessi. Kesk-Ameerika on ühendav
maakitsus Põhja- ja Lõuna-Ameerika vahel, mis on erakordselt rikkaliku etnilise ja keelelise
diversiteediga. Seda on peetud barjääriks migratsioonidele liikumisel põhjast lõunasse. Antud
töö eesmärgiks oli kirjeldada just selle piirkonna kahe põlisrahva, huitšolite ja misteekide,
emaliinide varieeruvust.
Analüüsis määrati huitšolite ja misteekide kuuluvus mtDNA haplogruppidesse ning
haplotüüpiline varieeruvus. Selleks sekveneerisin mtDNA kontroll-regiooni ning määrasin
põlis-ameeriklastele iseloomulikud haplogruppide markerid. Kõik analüüsitud proovid
kuulusid põlis-ameeriklaste haplogruppidesse. Haplotüüpide analüüs kinnitas varem
avaldatud andmeid, et haplotüübid on peamiselt populatsiooni-spetsiifilised või jagatud
geograafiliselt lähedaste populatsioonidega. Huvitav leid oli, et näiteks haplogrupis B ei
kattunud varem avaldatud ja antus töös analüüsitud haplotüübid huitšolite ja misteekide
populatsioonidel.
Huitšolide üks indiviid kuulub haplogruppi C4c. See on erakordne leid kuna C4c sagedus on
väga väike ning varem on C4c-d leitud ainult Põhja-Ameerikas ning ühel Kolumbia
populatsioonil. Et määrata selle proovi paiknemine fülogeneetilisel puul, sekveneeriti kogu
34

mitokondriaalne DNA. Huitšoli proovi C4c kuulub samasse harusse Põhja-Ameerika
rahvastega. See kinnitab varasemaid töödid näidates, et Kesk-Ameerika põhjaosa rahvad on
rohkem seotud Põhja- kui Lõuna-Ameerikaga, aga näitab ka võiamlikku migratsiooni teed.
Edaspidise töö eesmärk on analüüsida huitšoli ja misteeki populatsioonide mtDNA
mitmekesisust veel põhjalikumalt. Selleks on plaanis valida välja antud töös määratud ka
teistest põlis-ameeriklastele iseloomulikest haplogruppidest (A2, B2, C1 ja D1) huvitavamad
haplotüüpid ning teha neile täisjärjestuste analüüs.
35

ACKNOWLEDGEMENT
I would like express my sincere thanks to my supervisors Erika Tamm and Ene Metspalu for
their professional guidance and encouraging. Special thanks to Erika Tamm for her guidance
during this study and for her time. Also, thanks to all co-workers for a pleasant atmosphere at
our workplace.
36

References
Achilli, A, Perego, U. A., Bravi, C. M., Coble, M. D., Kong, Q. P., Woodward, S. R, Salas A,
Torroni, A. and Bandelt, H. J. (2008). The phylogeny of the four pan-American MtDNA
haplogroups: implications for evolutionary and disease studies. PLoS One 3(3):e1764.
Adovasio, J. M. and Pedler D. R. 2004. Pre Clovis Sites and Their Implications for Human
Occupation before the Last Glacial Maximum, p. 139–158. In Entering Northeast Asia and
Beringia before the Last Glacial Maximum edited by David B. Madsen. University of Utah
Press, Salt Lake City, Utah.
Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K. and Watson, J. D. 1989. Molecular
Biology of the Cell, 2nd ed., p. 341-404, Garland Publishing, New York, London.
Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H. L., Coulson, A. R., Drouin, J.,
Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J., Staden, R.
and Young, I. G. (1981). Sequence and organization of the human mitochondrial genome.
Nature 290: 457–465.
Andrews, R. M., Kubacka, I., Chinnery, P. F, Lightowlers, R. N., Turnbull, D. M. and
Howell, N. (1999). Reanalysis and revision of the Cambridge reference sequence for human
mitochondrial DNA. Nature Genet. 23: 147.
Aquadro, C. F. and Greenberg, B. D. (1983). Human mitochondrial DNA variation and
evolution: analysis of nucleotide sequences from seven individuals. Genetics 103: 287-312.
Avise, J. C, Arnold, J., Ball, R. M., Berminghatm, E., Lamb, E., Neigel, J. E., Reeb, C. A. and
Saunders, N. C. (1987). Intraspecific phylogeography: the mitochondrial DNA bridge
between population genetics and systematics. Annu. Rev. EcoI. Syst. 18: 489-522.
Bogenhagen, D. and Clayton, D. A. (1974). The number of mitochondrial deoxyribonucleic
acid genomes in mouse l and human HeLa cells. J. Biol. Chem. 249: 7991–7995.
Bonatto, S. L. and Salzano, F. M. (1997). Diversity and age of the four major mtDNA
haplogroups, and their implications for the peopling of the New World. Am J Hum Genet 61:
1413–1423
37

Brown, M. D., Hosseini, S. H., Torroni, A., Bandelt, H. J., Allen, J. C., Schurr, T. G.,
Scozzari, R., Cruciani, F. and Wallace, D. C. (1998). mtDNA haplogroup X: An ancient link
between Europe/Western Asia and North America? American Journal of Human Genetics 63:
1852-1861.
Brown, W. M. (1980). Polymorphism in mitochondrial DNA of humans as revealed by
restriction endonuclease analysis. Proc. Natl. Acad. Sci. U.S.A. 77 (6): 3605–609.
Brown, W. M., George, M. Jr. and Wilson, A. C. (1979). Rapid evolution of animal
mitochondrial DNA. Proc. Natl. Acad. Sci. 76: 1967-1971.
Chen, Y. S., Torroni, A., Excoffier, L., Santachiara-Benerecetti, A. S. and Wallace, D. C.
(1995). Analysis of mtDNA variation in African populations reveals the most ancient of all
human continent-specific haplogroups. Am. J. Hum. Genet. 57: 133–149. Chicago Press.
Clayton, D. A. (1982). Replication of animal mitochondrial DNA. Cell 28: 693–705.
Derbeneva, O. A., Sukernik, R. I., Volodko, N. V., Hosseini,S. H., Lott, M. T. and Wallace,
D. C. (2002). Analysis of mitochondrial DNA diversity in the Aleuts of the Commander
Islands and its implications for the genetic history of Beringia. Am. J. Hum. Genet, 71:. 415–
421
Derenko, M., Malyarchuk, B., Grzybowski, T., Denisova, G., Dambueva, I., Perkova, M.,
Dorzhu, C., Luzina, F., Lee, H. K., Vanecek, T., Villems, R. and Zakharov, I. (2007).
Phylogeographic analysis of mitochondrial DNA in northern Asian populations. Am J Hum
Genet 81(5):1025-1041.
Dillehay, T. D., Ramirex, C., Pino, M., Collins, M.B., Rossen, J. and Pino-Navarro, J.D.
(2008). Monte Verde: Seaweed, food, medicine, and the peopling of South America. Science,
320: 784-786.
Fagundes, N. J., Kanitz, R., Eckert, R., Valls, A. C., Bogo, M. R., Salzano, F. M., Smith, D.
G., Silva, W. A. Jr., Zago, M. A., Ribeiro-dos-Santos, A. K., Santos, S. E., Petzl-Erler, M.
L.and Bonatto, S. L. (2008). Mitochondrial population genomics supports a single pre-Clovis
origin with a coastal route for the peopling of the Americas. Am J Hum Genet 82(3):583-592.
Forster, P., Harding, R., Torroni, A. and Bandelt, H. J. (1996). Origin and evolution of native
American mDNA variation: a reappraisal. Am. J. Hum. Genet. 59: 935-945.
38

Forster, P., Torroni, A., Renfrew, C. and Rõhl, A. (2001). Phylogenetic Star Contraction
Applied to Asian and Papuan mtDNA Evolution. Mol. Biol. Evol. 18: 1864-1881.
Gilbert MT, Kivisild T, Grønnow B, Andersen PK, Metspalu E, Reidla M, Tamm E, Axelsson
E, Götherström A, Campos PF, Rasmussen M, Metspalu M, Higham TF, Schwenninger JL,
Nathan R, De Hoog CJ, Koch A, Møller LN, Andreasen C, Meldgaard M, Villems R,
Bendixen C, and Willerslev E. 2008. Paleo-Eskimo mtDNA genome reveals matrilineal
discontinuity in Greenland. Science 320(5884):1787-1789.
Giles, R. E., Blanc, H., Cann, H. M. and Wallace, D.C. (1980). Maternal inheritance of human
mitochondrial DNA. Proc. Natl. Acad. Sci. 77: 6715-6719.
Goebel, T. (1999). Pleistocene human colonization of Siberia and peopling of the Americas:
an ecological approach. Evolutionary Anthropology 8: 208-227.
Goebel, T., Waters, M. R. and ORourke, D. H. (2008). The late Pleistocene dispersal of
modern humans in the Americas. Science 319: 1497-1502.
Haynes, C. V. 2005. Clovis, Pre-Clovis, Climate Change, and Extinction, p. 113–132. In
Paleoamerican Origins: Beyond Clovis, edited by Robsen Bonnichsen, Bradley T. Lepper,
Dennis Stanford, and Michael R. Waters, Center for the Study of the First Americans, Texas
A&M University Press, College Station, Texas.
Haynes, C.V., Jr. 1992. Contributions of radiocarbon dating to the geochronology of the
peopling of the New World, p. 355–374. In R.E. Taylor, A. Long, & R.S. Kra (Eds.),
Radiocarbon after four decades: An interdisciplinary perspective. New York: Springer-
Verlag.
Helgason A, Palsson G, Pedersen HS, Angulalik E, Gunnarsdottir ED, et al. (2006) MtDNA
variation in Inuit populations of Greenland and Canada: migration history and population
structure. Am J Phys Anthropol 130: 123–134.
Henn, B. M., Gignoux, C. R., Feldman, M. W. and Mountain, J. L. (2009). "Characterizing
the Time Dependency of Human Mitochondrial DNA Mutation Rate Estimates", Molecular
Biology and Evolution 26 (1): 217–230
39

Heyer, E., Zietkiewicz, E., Rochowski A., Yotova, V., Puymirat, J. and Labuda D. (2001).
Phylogenetic and familial estimates of mitochondrial substitution rates: Study of control
region mutations in deep-rooting pedigrees. Am. J. Hum. Genet 69: 1113-1126.
Hooshiar Kashani, B., Perego, U. A., Olivieri, A., Angerhofer, N., Gandini, F., Carossa, V.,
Lancioni, H., Semino, O., Woodward, S. R., Achilli, A. and Torroni, A. ( 2011).
Mitochondrial haplogroup C4c: a rare lineage entering America through the ice-free corridor?
Am J Phys Anthropol 000:000-000
Howell, A., Dubrac, S., Andersen, K. K., Noone, D., Fert, J., Msadek, T. and Devine, K.
(2003). Genes controlled by the essential YycG/YycF two-component system of Bacillus
subtilis revealed through a novel hybrid regulator approach. Mol Microbiol 49, 1639–1655.
Inali. 2007. Catalogo de las lenguas indigenas nacionales: Variantes linguisticacs de mexico
con sus autodenominaciones y referencias geoestadisticas, Mexico
Ingman, M, Kaessmann, H, Pääbo, S. and Gyllensten, U. (2000). Mitochondrial genome
variation and the origin of modern humans. Nature 408:708-713
Jorde, L. B. and Bamshad, M. (2000). Questioning evidence for recombination in human
mitochondrial DNA. Science 288: 1931.
Kemp, B. M., Gonzalez-Oliver, A., Malhi, R., Monroe, C., Schroeder, K. B., McDonough, J.,
Rhett, G., Resendez, A., Penaloza-Espinosa, R. I., Buentello-Malo, L., Gorodesky, C. and
Smith, D. G. (2010) Evaluating the farming/language dispersal hypothesis with genetic
variation exhibited by populations in the Southwest and Mesoamerica. PNAS USA 107, 6759-
6764.
Kitchen, A., Miyamoto, M. M. and Mulligan, C. J. (2008). A three-stage colonization model
for the peopling of the Americas. PLoS ONE, 3: e1596.
Kivisild, T. and Villems, R. (2000). Questioning evidence for recombination in human
mitochondrial DNA. Science 288: 1931.
Kumar, S., Hedrick, P., Dowling, T. and Stoneking, M. (2000). Questioning evidence for
recombination in human mitochondrial DNA. Science 288: 1931.
40

Loogvali, E. L., Kivisild, T., Margus, T. and Villems, R. (2009). O'Rourke, D, ed.,
"Explaining the Imperfection of the Molecular Clock of Hominid Mitochondria", PLoS ONE
(PLoS ONE) 4 (12): e8260
Lorenz, J. G. and Smith, D. G. (1996). Distribution of four founding MtDNA haplogroups
among native North Americans. Am. J Phys. Anthrop. 101, 307-23.
Macaulay, V., Hill, C., Achilli, A., Rengo, C., Clarke, D., Meehan, W., Blackburn, J.,
Semino, O., Scozzari, R., Cruciani, F., Taha, A., Shaari, N. K., Raja, J. M., Ismail, P.,
Zainuddin, Z., Goodwin, W., Bulbeck, D., Bandelt, H.–J., Oppenheimer, S., Torroni, A. and
Richards, M. (2005). Single, rapid coastal settlement of Asia revealed by analysis of complete
mitochondrial genomes. Science 308: 1034–1036.
Malhi, R. S., Cybulski, J. S., Tito, R. Y., Johnson, J., Harry, H. and Dan, C. (2010). Brief
communication: Mitochondrial haplotype C4c confirmed as a founding genome in the
Americas. Am J Phys Anthropol 141(3):494-497.
Malhi, R. S., Mortensen, H. M., Eshleman, J. A., Kemp, B. M., Lorenz, J. G., Kaestle, F. A,
Johnson, J. R., Gorodezky, C. and Smith, D. G (2003). Native American mtDNA Prehistory
in the American Southwest. American Journal of Physical Anthropology 120:108–24.
McDougall , I., Brown, F. H. and Fleagle, J. G. (2005). Stratigraphic placement and age of
modern humans from Kibish, Ethiopia. Nature 433: 733-736.
Merrill W.L., Hard R.J., Mabry J.B., Fritz G.J., Adams K.R., Roney J.R. ans MacWilliams
A.C. (2009). The diffusion of maize to the southwestern United States and its impact.
Proceedings of the National Academy of Sciences of the United States of America, 106(50):
21019–21026.
Merriwether, D. A., Rothhammer, F. and Ferrell, R. E. (1995) Distribution of the four
founding lineage haplotypes in Native Americans suggests a single wave of migration for the
New World. Am J Phys Anthropol 98:411–430
Metspalu, M., Kivisild, T., Metspalu, E., Parik, J., Hudjashov, G., Kaldma, K., Serk, P.
Karmin, M., Behar, D. M., Gilbert, M. T. P., Endicott, P., Mastana, S., Papiha, S. S.,
Skorecki, K., Torroni, A. and Villems, R. (2004). Most of the extant mtDNA boundaries in
South and Southwest Asia were likely shaped during the initial settlement of Eurasia by
anatomically modern humans. BMC Genet. 5: 26.
41

Mulligan, C.J., Kitchen, A. and Miyamoto, M. M. (2008). Updated three stage model for the
peopling of the Americas. PLoS ONE 3: e3199.
Nichols, J. 1992. Linguistic Diversity in Space and Time. Chicago: University of
Parsons, T. J., Muniec, D. S., Sullivan, K., Woodyatt, N., Alliston-Greiner, R., Wilson, M. R.,
Berry, D. L., Holland, K. A., Weedn, V. W., Gill, P., Holland, M. M. (1997). A high observed
substitution rate in the human mitochondrial DNA control region. Nat. Genet. 15: 363-368.
Pearson, G. and Ream, J. (2005). Clovis on the Caribbean Coast of Venezuela. Current
Research in the Pleistocene 22: 28–31.
Perego, U. A., Achilli, A., Angerhofer, N., Accetturo, M., Pala, M., Olivieri, A., Hooshiar
Kashani, B., Ritchie, K. H., Scozzari R., Kong Q. P., Myres N. M., Salas, A., Semino, O.,
Bandelt, H. J., Woodward, S. R. and Torroni, A. (2009). Distinctive Paleo-Indian migration
routes from Beringia marked by two rare mtDNA haplogroups. Curr Biol 19(1):1-8.
Perego, U. A., Angerhofer, N., Pala, M., Olivieri, A., Lancioni, H., Hooshiar Kashani, B.,
Carossa, V., Ekins, J. E., Gómez-Carballa, A., Huber, G., Zimmermann, B., Corach, D.,
Babudri, N , Panara, F., Myres, N. M. Parson, W., Semino, O., Salas, A., Woodward, S, R.,
Achilli, A. and Torroni, A. (2010). The initial peopling of the Americas: a growing number of
founding mitochondrial genomes from Beringia. Genome Res 20(9):1174-1179.
Pitulko, V., Nikolsky, P. A., Girya, E. Y., Basilyan, A. E., Tumskoy, V. E., Koulakov, S. A.,
Astakhov, S. N., Pavlova, E. Y. and Anisimov, M. A. (2004). The Yana RHS Site: Humans in
the Arctic before the Last Glacial Maximum. Science 303: 52–56.
Pohl, M., von Nagy, C., Perrett, A. and Pope, K. (2004) "Olmec Civilization at San Andres,
Tabasco, Mexico", Foundation for the Advancement of Mesoamerican Studies, Inc. (FAMSI),
accessed October 2007.
Richter, C., Park, J. W. and Ames, B. N. (1988). Normal oxidative damage to mitochondrial
and nuclear DNA is extensive. Proc. Natl. Acad. Sci. 85: 6465–6467.
Saillard, J., Forster, P., Lynnerup, N., Bandelt, H.-J. and Nørby, S. (2000). mtDNA variation
among Greenland Eskimos: The edge of the Beringian expansion. Am. J. Hum. Genet. 67:
718-726.
42

Sandoval, K., Buentello-Malo, L., Peñaloza-Espinosa, R., Avelino, H., Salas, A., Calafell, F.
and Comas, D. (2009). Linguistic and maternal genetic diversity are not correlated in Native
Mexicans. Hum Genet 126: 521–531.
Schurr, T. G. and Sherry, S. T. (2004) Mitochondrial DNA and Y chromosome diversity and
the peopling of the Americas: evolutionary and demographic evidence. Am J Hum Biol 16:
420–439.
Schurr, T. G., Ballinger, S. W., Gan, Y. Y., Hodge, J. A., Merriwether, D. A., Lawrence, D.
N., Knowler, W. C., Weiss, K. M. and Wallace, D. C. (1990). Amerindian Mitochondrial
DNAs Have Rare Asian Mutations at High Frequencies, Suggesting They Derived from Four
Primary Maternal Lineages. American Journal of Human Genetics 46: 613-623.
Soares, P., Ermini, L., Thoson, N., Mormina, M., Rito, T., Röhl, A., Salas, A., Oppenheimer,
A., Macalay, V. and Richards, M. B. (2009). Correcting for purifying selection: An improved
human mitochondrial molecular clock. Am. J. Hum. Genet. 84: 740–759.
Starikovskaya EB, Sukernik RI, Derbeneva OA, Volodko NV, Ruiz-Pesini E, Torroni A,
Brown MD, Lott MT, Hosseini SH, Huoponen K and Wallace DC. (2005). Mitochondrial
DNA diversity in indigenous populations of the southern extent of Siberia, and the origins of
Native American haplogroups. Ann Hum Genet 69(Pt 1):67-89.
Stoneking, M., Hedgecock, D., Higuchi, R. G., Vigilant, L. and Erlich, H. A. (1991).
Population variation of human mtDNA control region sequences detected by enzymatic
amplification and sequence-specific oligonucleotide probes. Am. J. Hum. Genet. 48: 370–
382.
Tamm, E, Kivisild, T, Reidla, M, Metspalu, M, Smith DG, Mulligan, C. J., Bravi, C. M.,
Rickards, O., Martinez-Labarga, C., Knusbutdinova, E. K., Fedorova, S.A., Golubenko, M.
V., Stepanov, V. A., Gubina, M. A., Zhadanov, S. I., Ossipova, L. P., Damba, L., Voevoda,
M. I., Dipierri, J. E., Villems, R. and Malhi, R. S. (2007). Beringian standstill and spread of
Native American founders. PLoS ONE 2: e829.
Torroni A et al. (1994a) Mitochondrial DNA and Y chromosome polymorphisms in 4 Native
American populations from Southern Mexico. Am. J Hum. Gen. 54, 303-18.
Torroni, A., Achilli A., Macaulay V., Richards, M. and Bandelt, H-J. (2006). Harvesting the
fruit of the human mtDNA tree. Trends Genet 22:339–345.
43

Torroni, A., Schurr, T. G., Cabell, M. F., Brown, M. D., Neel, J. V., et al. (1993). Asian
affinities and continental radiation of the four founding Native American mtDNAs. Am. J.
Hum. Genet. 53: 563–590.
Torroni, A., Sukernik, R. I., Schurr, T. G., Starikorskaya, Y. B., Cabell, M. F., et al. (1993).
mtDNA variation of aboriginal Siberians reveals distinct genetic affinities with Native
Americans. Am. J. Hum. Genet. 53: 591–608.
Vigilant, L., Pennington, R., Harpending, H., Kocher, T. D. and Wilson, A. C. (1989).
Mitochondrial DNA sequences in single hairs from a southern African population. Proc. Natl.
Acad. Sci. 86: 9350-9354.
Vigilant, L., Stoneking, M., Harpending, H., Hawkes, K. and Wilson, A. C. (1991). African
populations and the evolution of human mitochondrial DNA. Science 253: 1503–1507.
Volodko, N. V., Starikovskaya, E. B., Mazunin, I. O., Eltsov, N. P., Naidenko, P. V., Wallace,
D. C. and Sukernik, R. I. 2008. Mitochondrial genome diversity in arctic Siberians, with
particular reference to the evolutionary history of Beringia and Pleistocenic peopling of the
Americas. Am J Hum Genet 82(5):1084-1100.
Waters, M. R. (2011). The Buttermilk Creek Complex and the Origins of Clovis at the Debra
L. Friedkin Site, Texas. Science 331:1599-1603.
Wilson, A. C., Cann, R. L., Carr, S. M., George, M., Gyllensten, U. B., Helm-Bychowski, K.
M., Higuchi, R. G., Palumbi, S. R., Prager, E. M., Sage, R. D. and Stoneking, M. (1985).
Mitochondrial DNA and two perspectives on evolutionary genetics. Biol. J. Linn. 2: 375-400.
44

SUPPLEMENTARY MATERIALS
Tabel 1.1. Primers for PCR (HVS regions)
23F (Rieder) 5´TCA TTG GAC AAG TAG CAT CC 3´
24R (Rieder) 5´AGG CTA AGC GTT TTG AGC TG 3´
F15909 5´ ACA CCA GTC TTG TAA ACC GGA 3´
R580 5´ TTG AGG AGG TAA GCT 3´
Tabel 1.2. Primers for PCR (coding region)
F7 (Rieder) 5´ ACTAATTAATCCCCTGGCCC 3´
R7 (Rieder) 5´ AATGGGGTGGGTTTTGTATG 3´
F1615 5´AAC ACA AAG CAC CCA ACT TAC AC 3´
R2216 5´TGT TGA GCT TGA ACG CTT TC 3´
Tabel 2.1. Primers for sequence reaction (HVS regions)
R727 5´ AGG GTG AAC TCA CTG 3´
F15909 5´ ACA CCA GTC TTG TAA ACC GGA 3´
F48 5´ CAT TTG GTA TTT TCGTCTGG 3´
R505 5´ GGT GTG TGT GTC TGG GTA GG 3´
F15975 5´ CTC CAC CAT TAG CAC CCA AA 3´
R5 5´ GAG TGG TTA ATA GGG 3´
F(L)16209 5´ CCA TGC TTA CAA GCA 3´
R370 5´ GGT TCT TTG TCT TTT TGG GGT 3´
F244 5´ ATTGAAT GTCTGCACAG CCACT 3´
R(H)15975 5´CTC CAC CAT TAG CAC CCA AA 3´
R477 5´ AGT AGT ATG GGA GTG GGA GGG 3´
R580 5´ TTG AGG AGG TAA GCT 3´
Tabel 2.2. Primers for sequence reaction (coding region)
F4711 5´ CCG GAC AAT GAA CCA TAA CCA 3´
R5171 5´ TCA GGT GCG AGA TAG TAG TAG TAG 3´
F1615 5´AAC ACA AAG CAC CCA ACT TAC AC 3´
R2216 5´TGT TGA GCT TGA ACG CTT TC 3´
45

Tabel 3. Primers for PCR and sequence reaction for full sequence (Rieder et al.,1998)
1F 5´ CTCCTCAAAGCAATACACTG 3´ 1R 5´ TGCTAAATCCACCTTCGACC 3´
2F 5´ CGATCAACCTCACCACCTCT 3´ 2R 5´ TGGACAACCAGCTATCACCA 3´
3F 5´GGACTAACCCCTATACCTTCTGC 3´ 3R 5´ GGCAGGTCAATTTCACTGGT 3´
4F 5´ AAATCTTACCCCGCCTGTTT 3´ 4R 5´ AGGAATGCCATTGCGATTAG 3´
5F 5´ TACTTCACAAAGCGCCTTCC 3´ 5R 5´ ATGAAGAATAGGGCGAAGGG 3´
6F 5´ TGGCTCCTTTAACCTCTCCA 3´ 6R 5´ AAGGATTATGGATGCGGTTG 3´
7F 5´ ACTAATTAATCCCCTGGCCC 3´ 7R 5´ AATGGGGTGGGTTTTGTATG 3´
8F 5´ CTAACCGGCTTTTTGCCC 3´ 8R 5´ ACCTAGAAGGTTGCCTGGCT 3´
9F 5´ GAGGCCTAACCCCTGTCTTT 3´ 9R 5´ ATTCCGAAGCCTGGTAGGAT 3´
10F 5´ CTCTTCGTCTGATCCGTCCT 3´ 10R 5´ AGCGAAGGCTTCTCAAATCA 3´
11F 5´ ACGCCAAAATCCATTTCACT 3´ 11R 5´ CGGGAATTGCATCTGTTTTT 3´
12F 5´ ACGAGTACACCGACTACGGC 3´ 12R 5´ TGGGTGGTTGGTGTAAATGA 3´
13F 5´ TTTCCCCCTCTATTGATCCC 3´ 13R 5´ GTGGCCTTGGTATGTGCTTT 3´
14F 5´ CCCACCAATCACATGCCTAT 3´ 14R 5´ TGTAGCCGTTGAGTTGTGGT 3´
15F 5´ TCTCCATCTATTGATGAGGGTCT 3´ 15R 5´ AATTAGGCTGTGGGTGGTTG 3´
16F 5´ GCCATACTAGTCTTTGCCGC 3´ 16R 5´ TTGAGAATGAGTGTGAGGCG 3´
17F 5´ TCACTCTCACTGCCCAAGAA 3´ 17R 5´ GGAGAATGGGGGATAGGTGT 3´
18F 5´ TATCACTCTCCTACTTACAG 3´ 18R 5´ AGAAGGATATAATTCCTACG 3´
19F 5´ AAACAACCCAGCTCTCCCTAA 3´ 19R 5´ TCGATGATGTGGTCTTTGGA 3´
20F 5´ ACATCTGTACCCACGCCTTC 3´ 20R 5´ AGAGGGGTCAGGGTTGATTC 3´
21F 5´ GCATAATTAAACTTTACTTC 3´ 21R 5´ AGAATATTGAGGCGCCATTG 3´
22F 5´ TGAAACTTCGGCTCACTCCT 3´ 22R 5´ AGCTTTGGGTGCTAATGGTG 3´
23F 5´ TCATTGGACAAGTAGCATCC 3´ 23R 5´ GAGTGGTTAATAGGGTGATAG 3´
24F 5´ CACCATCCTCCGTGAAATCA 3´ 24R 5´ AGGCTAAGCGTTTTGAGCTG 3´
46

Table 4.Data used for haplogroups frequency table
Populatsions
Haplogroups
Language
Family Location Country References
n A B C D X D4h3
Kuna 113 82 31 0 0 0 0 Chibchan
Central
America Panama Tamm 2007, Batista 1995, Torroni 1993a
Central
Embera 83 19 44 20 0 0 0 Choco America Panama/Colombia Tamm 2007, Kolman 1997
Waunana 88 27 27 30 4 0 0 Choco
Central
America Panama/Colombia Tamm 2007, Kolman 1997
Guatuso (Male´ku
Jai´ka)
20 17 3 0 0 0 0 Chibchan Mesoamerica Costa Rica Torroni 94
Boruca 14 3 10 0 1 0 0 Chibchan Mesoamerica Costa Rica Torroni 93a
Bribri/Cabecar 24 13 11 0 0 0 0 Chibchan Mesoamerica Costa Rica Torroni 93a
Huetar 27 19 1 0 7 0 0 Chibchan Mesoamerica Costa Rica Santos 94
Guaymi 16 11 5 0 0 0 0 Chibchan Mesoamerica Panama/Costa Rica Torroni 93a
Ngöbe 123 80 43 0 0 0 0 Chibchan Mesoamerica Panama/Costa Rica Tamm 2007, Kolman 1997
Teribe 20 16 4 0 0 0 0 Chibchan Mesoamerica Panama/Costa Rica Torroni 94
Purépecha 34 20 3 8 3 0 0 isolate Mesoamerica Mexico Sandoval et al., 2009
Maya(contemporary) 78 46 15 12 5 0 0 Mayan Mesoamerica Mexico? Schurr 1990, Torroni 1993, Sandoval et al., 2009
Maya-Xcaret 24 21 1 2 0 0 0 Mayan Mesoamerica Mecico Gonzàlez-Oliver 2001
Mixe 68 26 20 16 6 0 0 Mixe-Zoguean Mesoamerica Mexico Kemp 2010, Torroni 1994
Mixtec 115 84 19 8 4 0 0 Otomanguean Mesoamerica Mexico Kemp 2010, Torroni 1994, Sandoval et al., 2009
Mixtec 29 18 5 4 2 0 0 Otomanguean Mesoamerica Mexico present study
Otomí 68 27 17 20 4 0 0 Otomanguean Mesoamerica Mexico Sandoval et al., 2009
Triqui 107 77 30 0 0 0 0 Otomanguean Mesoamerica Mexico Sandoval et al., 2009
Zapotec 103 41 24 30 5 0 0 Otomanguean Mesoamerica Mexico Kemp 2010, Torroni 1994
Aztecs 37 23 6 2 6 0 0 Uto-Aztecan Mesoamerica Mexico De la Cruz 2008, Kemp 2005
1

Cora 72 22 37 10 3 0 0 Uto-Aztecan Mesoamerica Mexico Kemp 2010
Huichol 62 19 33 10 0 0 0 Uto-Aztecan Mesoamerica Mexico Kemp 2010,
Huichol 15 5 7 3 0 0 0 Uto-Aztecan Mesoamerica Mexico present study
Nahua-Atopcan 50 19 20 9 2 0 0 Uto-Aztecan Mesoamerica Mexico Kemp 2010
Nahua-Cuetzalan 46 29 9 7 1 0 0 Uto-Aztecan Mesoamerica Mexico Kemp 2010, Malhi 2003
Xochimilco Nahua 35 27 5 3 0 0 0 Uto-Aztecan Mesoamerica Mexico Sandoval et al., 2009
Zitlala Nahua 14 14 0 0 0 0 0 Uto-Aztecan Mesoamerica Mexico Sandoval et al., 2009
Nahua-Veracruz 35 16 14 3 0 0 2 Uto-Aztecan Mesoamerica Mexico Sandoval et al., 2009
Pima 97 10 3 83 1 0 0 Uto-Aztecan Mesoamerica Mexico Sandoval et al., 2009
Anasazi 25 6 15 0 4 0 0 ? Southwest USA/Mexico Forster 1996
Apache 38 24 5 7 2 0 0 Athapaskan Southwest USA Torroni 1993, Lozerenz and Smith 1996, Malhi 2003(9)
Navajo 64 33 26 3 0 2 0 Athapaskan Southwest USA Torroni 1993, Lozerenz and Smith 1996, Malhi 2003(8)
Zuni 50 8 38 4 0 0 0 Isolate Southwest USA Kemp 2010, Malhi 2003
Jemez 71 0 61 3 0 7 0 Kiowa-Tacoan Southwest USA Kemp 2010, Malhi 2003,
Akimel O´odham 99 4 48 45 1 0 0 Uto-Aztecan Southwest USA Kemp 2010, Malhi 2003
N.Paiute/Shoshoni 94 0 40 9 45 0 0 Uto-Aztecan Southwest USA Kaestle and Smith 2001
Tohono O´odham 42 3 24 15 0 0 0 Uto-Aztecan Southwest USA/Mexico Kemp 2010, Malhi 2003
Tarahumara 88 27 22 34 4 0 1 Uto-Aztecan Southwest Mexico Kemp 2010, Malhi 2008, Sandoval et al., 2009
Hualapai 76 1 38 37 0 0 0 Yuman Southwest USA Kemp 2010
Cochimi 13 1 6 6 0 0 0 Yuman Southwest Mexico Lorenz and Smith 1996, Smith et al.2000, Malhi 2003(3)
Delta Yuman 23 0 13 10 0 0 0 Yuman Southwest Mexico Lorenz and Smith 1996, Smith et al.2000, Malhi 2003(20)
Pai Yuman 27 20 18 7 0 0 0 Yuman Southwest Mexico Lorenz and Smith 1996, Smith et al.2000, Malhi 2003(11)
River Yuman 22 0 14 8 0 0 0 Yuman Southwest Mexico Lorenz and Smith 1996, Smith et al.2000, Malhi 2003(1)
2